WorldWideScience

Sample records for streptococcus pneumoniae pneumococcal

  1. AdcAII of Streptococcus pneumoniae Affects Pneumococcal Invasiveness.

    Directory of Open Access Journals (Sweden)

    Lindsey R Brown

    Full Text Available Across bacterial species, metal binding proteins can serve functions in pathogenesis in addition to regulating metal homeostasis. We have compared and contrasted the activities of zinc (Zn2+-binding lipoproteins AdcA and AdcAII in the Streptococcus pneumoniae TIGR4 background. Exposure to Zn2+-limiting conditions resulted in delayed growth in a strain lacking AdcAII (ΔAdcAII when compared to wild type bacteria or a mutant lacking AdcA (ΔAdcA. AdcAII failed to interact with the extracellular matrix protein laminin despite homology to laminin-binding proteins of related streptococci. Deletion of AdcA or AdcAII led to significantly increased invasion of A549 human lung epithelial cells and a trend toward increased invasion in vivo. Loss of AdcAII, but not AdcA, was shown to negatively impact early colonization of the nasopharynx. Our findings suggest that expression of AdcAII affects invasiveness of S. pneumoniae in response to available Zn2+ concentrations.

  2. Streptococcus pneumoniae serotype-2 childhood meningitis in Bangladesh: a newly recognized pneumococcal infection threat.

    Directory of Open Access Journals (Sweden)

    Samir K Saha

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of meningitis in countries where pneumococcal conjugate vaccines (PCV targeting commonly occurring serotypes are not routinely used. However, effectiveness of PCV would be jeopardized by emergence of invasive pneumococcal diseases (IPD caused by serotypes which are not included in PCV. Systematic hospital based surveillance in Bangladesh was established and progressively improved to determine the pathogens causing childhood sepsis and meningitis. This also provided the foundation for determining the spectrum of serotypes causing IPD. This article reports an unprecedented upsurge of serotype 2, an uncommon pneumococcal serotype, without any known intervention. METHODS AND FINDINGS: Cases with suspected IPD had blood or cerebrospinal fluid (CSF collected from the beginning of 2001 till 2009. Pneumococcal serotypes were determined by capsular swelling of isolates or PCR of culture-negative CSF specimens. Multicenter national surveillance, expanded from 2004, identified 45,437 patients with suspected bacteremia who were blood cultured and 10,618 suspected meningitis cases who had a lumber puncture. Pneumococcus accounted for 230 culture positive cases of meningitis in children <5 years. Serotype-2 was the leading cause of pneumococcal meningitis, accounting for 20.4% (45/221; 95% CI 15%-26% of cases. Ninety eight percent (45/46 of these serotype-2 strains were isolated from meningitis cases, yielding the highest serotype-specific odds ratio for meningitis (29.6; 95% CI 3.4-256.3. The serotype-2 strains had three closely related pulsed field gel electrophoresis types. CONCLUSIONS: S. pneumoniae serotype-2 was found to possess an unusually high potential for causing meningitis and was the leading serotype-specific cause of childhood meningitis in Bangladesh over the past decade. Persisting disease occurrence or progressive spread would represent a major potential infection threat since serotype-2

  3. The effect of immunization with pneumococcal conjugated vaccines on Streptococcus pneumoniae resistance patterns in acute otitis media

    Directory of Open Access Journals (Sweden)

    Tal Marom

    2017-10-01

    Full Text Available Following the introduction of 7- and 13-pneumococcal conjugate vaccines (PCVs in Israel, we demonstrated that within Streptococcus pneumoniae (Sp positive middle ear cultures, obtained from young children with severe acute otitis media (AOM episodes, there were more penicillin-susceptible and less multi-drug resistant Sp isolates in PCV immunized children.

  4. [Bacteremic pneumococcal pneumonia].

    Science.gov (United States)

    Pineda Solas, V; Pérez Benito, A; Domingo Puiggros, M; Larramona Carrera, H; Segura Porta, F; Fontanals Aymerich, D

    2002-11-01

    Streptococcus pneumonia is the most common bacterial cause of community-acquired pneumonia in children. The reference standard for etiological diagnosis is isolation of S. pneumoniae from blood Since the advent of conjugate vaccines, disease caused by this organism can now be prevented. Many studies have been performed of the global incidence of invasive pneumococcal infections and of pneumococcal meningitis but few studies investigated bacteremic pneumococcal pneumonia and its complications in children. To determine the incidence, patient characteristics, clinical signs, laboratory data, percentage and days of hospitalization, response to antibiotic treatment, antibiotic resistance, complications and causal serogroups of bacteremic pneumococcal pneumonia in our environment in order to estimate requirements for systematic vaccination programs. From January 1990 to May 2001, data on all pediatric cases of invasive pneumococcal infections diagnosed in our hospital were collected. Several characteristics of patients with bacteremic pneumococcal pneumonia were analyzed. Bacteremic pneumococcal pneumonia was diagnosed in patients with positive blood or pleural fluid cultures for S. pneumoniae and radiographically evident pulmonary infiltrate. The incidence of both types of pneumonia were determined according to population census data. All S. pneumonia strains were sent to the Pneumococci Reference Laboratory of the Instituto Carlos III in Madrid for serotyping. We estimated the serotype coverage of the pneumococcal 7-valent conjugate vaccine according to the serotypes included in this vaccine and their distribution. Forty cases of bacteremic pneumococcal pneumonia were diagnosed, yielding an incidence of 17,10 and 5 cases per 10(5) children aged less than 2, 4 and 15 years old respectively. The mean age was 50 months and 43% were aged less than 4 years. Peaks occurred in January, March, April and May. A total of 77.5% of the patients were admitted to hospital and the

  5. Trivalent pneumococcal protein recombinant vaccine protects against lethal Streptococcus pneumoniae pneumonia and correlates with phagocytosis by neutrophils during early pathogenesis.

    Science.gov (United States)

    Xu, Qingfu; Surendran, Naveen; Verhoeven, David; Klapa, Jessica; Ochs, Martina; Pichichero, Michael E

    2015-02-18

    Due to the fact that current polysaccharide-based pneumococcal vaccines have limited serotype coverage, protein-based vaccine candidates have been sought for over a decade to replace or complement current vaccines. We previously reported that a trivalent Pneumococcal Protein recombinant Vaccine (PPrV), showed protection against pneumonia and sepsis in an infant murine model. Here we investigated immunological correlates of protection of PPrV in the same model. C57BL/6J infant mice were intramuscularly vaccinated at age 1-3 weeks with 3 doses of PPrV, containing pneumococcal histidine triad protein D (PhtD), pneumococcal choline binding protein A (PcpA), and detoxified pneumolysin mutant PlyD1. 3-4 weeks after last vaccination, serum and lung antibody levels to PPrV components were measured, and mice were intranasally challenged with a lethal dose of Streptococcus pneumoniae (Spn) serotype 6A. Lung Spn bacterial burden, number of neutrophils and alveolar macrophages, phagocytosed Spn by granulocytes, and levels of cytokines and chemokines were determined at 6, 12, 24, and 48h after challenge. PPrV vaccination conferred 83% protection against Spn challenge. Vaccinated mice had significantly elevated serum and lung antibody levels to three PPrV components. In the first stage of pathogenesis of Spn induced pneumonia (6-24h after challenge), vaccinated mice had lower Spn bacterial lung burdens and more phagocytosed Spn in the granulocytes. PPrV vaccination led to lower levels of pro-inflammatory cytokines IL-6, IL-1β, and TFN-α, and other cytokines and chemokines (IL-12, IL-17, IFN-γ, MIP-1b, MIP-2 and KC, and G-CSF), presumably due to a lower lung bacterial burden. Trivalent PPrV vaccination results in increased serum and lung antibody levels to the vaccine components, a reduction in Spn induced lethality, enhanced early clearance of Spn in lungs due to more rapid and thorough phagocytosis of Spn by neutrophils, and correspondingly a reduction in lung inflammation

  6. Redistribution of Streptococcus pneumoniae Serotypes After Nationwide 13-valent Pneumococcal Conjugate Vaccine Program in Children in Northern Taiwan.

    Science.gov (United States)

    Cho, Ying-Chun; Chiu, Nan-Chang; Lu, Chun-Yi; Huang, Daniel Tsung-Ning; Huang, Fu-Yuan; Chang, Luan-Yin; Huang, Li-Min; Chi, Hsin

    2017-12-01

    After the introduction of 13-valent pneumococcal conjugate vaccine (PCV13) against Streptococcus pneumoniae, public health officials in Taiwan monitored a decline in circulating vaccine serotypes and the emergence of nonvaccine serotypes in children with invasive pneumococcal disease. A gradually expanded PCV13 national immunization program was launched in 2013 in Taiwan. Here, we evaluate the changes in the distribution of pneumococcal serotypes and antimicrobial nonsusceptibility in children during the evolution of vaccination policy. S. pneumoniae isolates from children with pneumococcal disease were collected and serotyped from 2010 to 2015 in northern Taiwan. PCVs were administered at the recipients' expense between 2010 and 2012, and then PCV13 was partially reimbursed by the government beginning in 2013. The distribution and diversity of serotypes were analyzed along with their antimicrobial susceptibilities. Among a total of 498 isolates, the proportion of invasive pneumococcal disease isolates declined (47.1%-10.6%) during the study period, and serotype diversity increased after 2011. Between 2010 and 2012, the dominant serotypes were 19A, 19F, 3, 6B and 14, and serotype 19A rose from 44.1% to 57.5%. Serotypes 19A, 15A, 19F and 15B were more prevalent from 2013 to 2015, and serotype 19A decreased from 42.1% to 4.5%. Serotypes 19F and 15A became the most commonly detected serotypes in 2015. Overall, PCV13 additional serotypes were reduced by 80% (P program is effective against pneumococcal disease in Taiwanese children, mainly by reducing PCV13 additional serotypes.

  7. Streptococcus pneumoniae-Induced Oxidative Stress in Lung Epithelial Cells Depends on Pneumococcal Autolysis and Is Reversible by Resveratrol.

    Science.gov (United States)

    Zahlten, Janine; Kim, Ye-Ji; Doehn, Jan-Moritz; Pribyl, Thomas; Hocke, Andreas C; García, Pedro; Hammerschmidt, Sven; Suttorp, Norbert; Hippenstiel, Stefan; Hübner, Ralf-Harto

    2015-06-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia worldwide. During pneumococcal pneumonia, the human airway epithelium is exposed to large amounts of H2O2 as a product of host and pathogen oxidative metabolism. Airway cells are known to be highly vulnerable to oxidant damage, but the pathophysiology of oxidative stress induced by S. pneumoniae and the role of nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated antioxidant systems of the host are not well characterized. For gluthation/gluthathion disulfide analysis BEAS-2B cells, primary broncho-epithelial cells (pBEC), explanted human lung tissue and mouse lungs were infected with different S. pneumoniae strains (D39, A66, R6x, H2O2/pneumolysin/LytA- deficient mutants of R6x). Cell death was proven by LDH assay and cell viability by IL-8 ELISA. The translocation of Nrf2 and the expression of catalase were shown via Western blot. The binding of Nrf2 at the catalase promoter was analyzed by ChIP. We observed a significant induction of oxidative stress induced by S. pneumoniae in vivo, ex vivo, and in vitro. Upon stimulation, the oxidant-responsive transcription factor Nrf2 was activated, and catalase was upregulated via Nrf2. The pneumococci-induced oxidative stress was independent of S. pneumoniae-derived H2O2 and pneumolysin but depended on the pneumococcal autolysin LytA. The Nrf2 inducer resveratrol, as opposed to catalase, reversed oxidative stress in lung epithelial cells. These observations indicate a H2O2-independent induction of oxidative stress in lung epithelial cells via the release of bacterial factors of S. pneumoniae. Resveratrol might be an option for prevention of acute lung injury and inflammatory responses observed in pneumococcal pneumonia. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Nasopharyngeal carriage of Streptococcus pneumoniae and other bacteria in the 7th year after implementation of the pneumococcal conjugate vaccine in the Netherlands

    NARCIS (Netherlands)

    Bosch, Astrid A T M; van Houten, Marlies A.; Bruin, Jacob P.; Wijmenga-Monsuur, Alienke J.; Trzciński, Krzysztof; Bogaert, Debby; Rots, Nynke Y.; Sanders, Elisabeth A M

    2016-01-01

    After introduction of the 7-valent pneumococcal conjugate vaccine (PCV7) in the infant national immunization program (NIP) in the Netherlands in 2006, Streptococcus pneumoniae strains of the non-vaccine serotype 19A emerged and became the dominant serotype in carriage in children and their parents.

  9. The post-vaccine microevolution of invasive Streptococcus pneumoniae

    NARCIS (Netherlands)

    Cremers, Amelieke J H; Mobegi, Fredrick M; de Jonge, Marien I; van Hijum, Sacha A F T; Meis, Jacques F; Hermans, Peter W M; Ferwerda, Gerben; Bentley, Stephen D; Zomer, Aldert L

    2015-01-01

    The 7-valent pneumococcal conjugated vaccine (PCV7) has affected the genetic population of Streptococcus pneumoniae in pediatric carriage. Little is known however about pneumococcal population genomics in adult invasive pneumococcal disease (IPD) under vaccine pressure. We sequenced and serotyped

  10. Serotype distribution of Streptococcus pneumoniae isolated from patients with invasive pneumococcal disease in Brazil before and after ten-pneumococcal conjugate vaccine implementation.

    Science.gov (United States)

    dos Santos, Silvia R; Passadore, Lilian F; Takagi, Elizabeth H; Fujii, Cristiane M; Yoshioka, Cristina R M; Gilio, Alfredo E; Martinez, Marina B

    2013-12-09

    The ten-pneumococcal conjugate vaccine (PCV10) was introduced into the national immunization program for childhood vaccination schedules by the Brazilian Health Public Service in March 2010. The aim of this study was to compare Streptococcus pneumoniae serotype distribution, antibiotic resistance patterns, and potential coverage before (January 2006-June 2010) and after (July 2010-September 2012) PCV10 introduction. The incidence of invasive pneumococcal disease (IPD), patient demographics, and disease characteristics were recorded. This study was conducted at the University Hospital of Sao Paulo University in Brazil from January 2006 to September 2012. Serotyping was performed using multiplex PCR typing, and antimicrobial sensitivity by Clinical and Laboratory Standards Institute (CLSI). A total of 259 S. pneumoniae strains were isolated from patients with IPD. The ages of the patients ranged from 3 months to 95 years old. The strains were isolated from cerebrospinal fluid, pleural fluid, and blood. The incidence of IPD among patients at HU-USP changed after the introduction of PCV10. The overall incidence of IPD was 3.42 cases per 1000 admissions in the vaccine pre- implementation period and of 2.99 cases per 1000 admissions in the vaccine post-implementation period. The incidence of IPD among children<2 y.o. attended at HU-USP changed significantly after the introduction of PCV10, from 20.30 to 3.97 of incidence. The incidence of PCV10- serotypes decrease from 16.47 to 0.44 in the same age, before and after PC10 implementation, respectively. Moreover, it was possible to realize the sensitivity to penicillin among isolates increased significantly in the post-vaccine period. Data from this study suggest that PCV10 contributed to decrease with PID rate among children less than 2 y.o. The resistance rate among pneumococcal isolates also could be observed since serotypes with greater resistance to beta lactam antibiotics were not easily isolated after vaccination

  11. Meningitis - pneumococcal

    Science.gov (United States)

    Pneumococcal meningitis; Pneumococcus - meningitis ... Pneumococcal meningitis is caused by Streptococcus pneumoniae bacteria (also called pneumococcus, or S pneumoniae ). This type of bacteria is the ...

  12. Phylogenetic analysis of emergent Streptococcus pneumoniae serotype 22F causing invasive pneumococcal disease using whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Walter H B Demczuk

    Full Text Available Since implementation of the 13-valent polyvalent conjugate vaccine (PCV13 in Canada during 2010, the proportion of PCV13 serotypes causing invasive pneumococcal disease (IPD has declined from 55% (n = 1492 in 2010 to 31% (n = 764 in 2014. A concurrent increase of non-PCV13 serotypes has occurred and 22F has become the most prevalent serotype in Canada increasing from 7% (n = 183 to 11% (n = 283. Core single nucleotide variant phylogenetic analysis was performed on 137 Streptococcus pneumoniae serotype 22F isolates collected across Canada from 2005-2015. Six phylogenetic lineages (n = 117 were identified among a serotype 22F/ST433 clonal complex (CC, including a recently expanding erythromycin-resistant clone. Erythromycin-resistance was observed in 25 isolates possessing ermB, mef or a 23S rRNA A2061G point mutation; 2 penicillin-resistant isolates had recombinant pbp1a, pbp2a and/or pbp2x; 3 tetracycline-resistant isolates contained tetM; and 1 isolate was multidrug-resistant. Virulence factor analysis indicated a high level of homogeneity among the 22F/ST433 clonal complex strains. A group of 6 phylogenetic outlier strains had differing MLST, antimicrobial resistance and molecular profiles suggestive of capsule switching events. While capsule switch events among S. pneumoniae serotype 22F has been observed, increasing prevalence of S. pneumoniae serotype 22F can be attributed to an evolving homogenous clone expanding nationally through local transmission events.

  13. Cord blood Streptococcus pneumoniae-specific cellular immune responses predict early pneumococcal carriage in high-risk infants in Papua New Guinea.

    Science.gov (United States)

    Francis, J P; Richmond, P C; Strickland, D; Prescott, S L; Pomat, W S; Michael, A; Nadal-Sims, M A; Edwards-Devitt, C J; Holt, P G; Lehmann, D; van den Biggelaar, A H J

    2017-03-01

    In areas where Streptococcus pneumoniae is highly endemic, infants experience very early pneumococcal colonization of the upper respiratory tract, with carriage often persisting into adulthood. We aimed to explore whether newborns in high-risk areas have pre-existing pneumococcal-specific cellular immune responses that may affect early pneumococcal acquisition. Cord blood mononuclear cells (CBMC) of 84 Papua New Guinean (PNG; high endemic) and 33 Australian (AUS; low endemic) newborns were stimulated in vitro with detoxified pneumolysin (dPly) or pneumococcal surface protein A (PspA; families 1 and 2) and compared for cytokine responses. Within the PNG cohort, associations between CBMC dPly and PspA-induced responses and pneumococcal colonization within the first month of life were studied. Significantly higher PspA-specific interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-5, IL-6, IL-10 and IL-13 responses, and lower dPly-IL-6 responses were produced in CBMC cultures of PNG compared to AUS newborns. Higher CBMC PspA-IL-5 and PspA-IL-13 responses correlated with a higher proportion of cord CD4 T cells, and higher dPly-IL-6 responses with a higher frequency of cord antigen-presenting cells. In the PNG cohort, higher PspA-specific IL-5 and IL-6 CBMC responses were associated independently and significantly with increased risk of earlier pneumococcal colonization, while a significant protective effect was found for higher PspA-IL-10 CBMC responses. Pneumococcus-specific cellular immune responses differ between children born in pneumococcal high versus low endemic settings, which may contribute to the higher risk of infants in high endemic settings for early pneumococcal colonization, and hence disease. © 2016 British Society for Immunology.

  14. Nasal immunization of mice with Lactobacillus casei expressing the Pneumococcal Surface Protein A: induction of antibodies, complement deposition and partial protection against Streptococcus pneumoniae challenge.

    Science.gov (United States)

    Campos, Ivana B; Darrieux, Michelle; Ferreira, Daniela M; Miyaji, Eliane N; Silva, Débora A; Arêas, Ana Paula M; Aires, Karina A; Leite, Luciana C C; Ho, Paulo L; Oliveira, Maria Leonor S

    2008-04-01

    Strategies for the development of new vaccines against Streptococcus pneumoniae infections try to overcome problems such as serotype coverage and high costs, present in currently available vaccines. Formulations based on protein candidates that can induce protection in animal models have been pointed as good alternatives. Among them, the Pneumococcal Surface Protein A (PspA) plays an important role during systemic infection at least in part through the inhibition of complement deposition on the pneumococcal surface, a mechanism of evasion from the immune system. Antigen delivery systems based on live recombinant lactic acid bacteria (LAB) represents a promising strategy for mucosal vaccination, since they are generally regarded as safe bacteria able to elicit both systemic and mucosal immune responses. In this work, the N-terminal region of clade 1 PspA was constitutively expressed in Lactobacillus casei and the recombinant bacteria was tested as a mucosal vaccine in mice. Nasal immunization with L. casei-PspA 1 induced anti-PspA antibodies that were able to bind to pneumococcal strains carrying both clade 1 and clade 2 PspAs and to induce complement deposition on the surface of the bacteria. In addition, an increase in survival of immunized mice after a systemic challenge with a virulent pneumococcal strain was observed.

  15. Streptococcus pneumoniae carriage among healthy and sick pediatric patients before the generalized implementation of the 13-valent pneumococcal vaccine in Morocco from 2010 to 2011.

    Science.gov (United States)

    Jroundi, Imane; Mahraoui, Chafik; Benmessaoud, Rachid; Moraleda, Cinta; Munoz Almagro, Carmen; Seffar, Meryem; Tligui, Houssain; Kettani, Selma C; Benjelloun, Badr S; Alonso, Pedro L; Bassat, Quique

    Nasopharyngeal carriage studies provide insights into the local prevalence of circulating pneumococcal serotypes. These data are critical to vaccination monitoring, as they allow for the prediction and assessment of impact. Very little data are available on the carriage of pneumococcal serotypes in Morocco. Here, we describe the prevalence of Streptococcus pneumoniae carriage and serotype distribution among 697 pediatric patients with ages ranging from 2 to 59 months who were admitted to a Moroccan hospital with severe pneumonia, as well as 195 healthy infants and young children who were recruited at a vaccination clinic. Carriage rates were 40.5% (79/195) for healthy children and 22.8% (159/697) for sick children. The most commonly observed circulating serotypes included 6A, 6B and 19F, all of which are included in the current 13-valent anti-pneumococcal conjugate vaccine that was recently introduced in Morocco. Monitoring of circulating serotypes remains necessary after vaccine introduction to assess whether serotype replacement is occurring. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  16. The enhanced pneumococcal LAMP assay: a clinical tool for the diagnosis of meningitis due to Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Dong Wook Kim

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of invasive bacterial disease in developed and developing countries. We studied the loop-mediated isothermal amplification (LAMP technique to assess its suitability for detecting S. pneumoniae nucleic acid in cerebrospinal fluid (CSF. METHODOLOGY/PRINCIPAL FINDINGS: We established an improved LAMP assay targeting the lytA gene (Streptococcus pneumoniae [Sp] LAMP. The analytical specificity of the primers was validated by using 32 reference strains (10 Streptococcus and seven non-Streptococcus species plus 25 clinical alpha-hemolytic streptococcal strains, including four S. pneumoniae strains and 21 other strains (3 S. oralis, 17 S. mitis, and one Streptococcus species harboring virulence factor-encoding genes (lytA or ply. Within 30 minutes, the assay could detect as few as 10 copies of both purified DNA and spiked CSF specimens with greater sensitivity than conventional polymerase chain reaction (PCR. The linear determination range for this assay is 10 to 1,000,000 microorganisms per reaction mixture using real-time turbidimetry. We evaluated the clinical sensitivity and specificity of the Sp LAMP assay using 106 randomly selected CSF specimens from children with suspected meningitis in Korea, China and Vietnam. For comparison, CSF specimens were also tested against conventional PCR and culture tests. The detection rate of the LAMP method was substantially higher than the rates of PCR and culture tests. In this small sample, relative to the LAMP assay, the clinical sensitivity of PCR and culture tests was 54.5% and 33.3%, respectively, while clinical specificity of the two tests was 100%. CONCLUSIONS/SIGNIFICANCE: Compared to PCR, Sp LAMP detected S. pneumoniae with higher analytical and clinical sensitivity. This specific and sensitive LAMP method offers significant advantages for screening patients on a population basis and for diagnosis in clinical settings.

  17. NEW VIRULENCE FACTORS OF STREPTOCOCCUS PNEUMONIAE

    NARCIS (Netherlands)

    Hermans, Peter Wilhelmus Maria; Bootsma, Jeanette Hester; Burghout, Pieter Jan; Kuipers, Oscar; Bijlsma, Johanna Jacoba Elisabeth; Kloosterman, Tomas Gerrit; Andersen, Christian O.

    2011-01-01

    The present invention provides proteins/genes, which are essential for survival, and consequently, for virulence of Streptococcus pneumoniae in vivo, and thus are ideal vaccine candidates for a vaccine preparation against pneumococcal infection. Further, also antibodies against said protein(s) are

  18. Time and dose-dependent risk of pneumococcal pneumonia following influenza: a model for within-host interaction between influenza and Streptococcus pneumoniae

    OpenAIRE

    Shrestha, Sourya; Foxman, Betsy; Dawid, Suzanne; Aiello, Allison E.; Davis, Brian M.; Berus, Joshua; Rohani, Pejman

    2013-01-01

    A significant fraction of seasonal and in particular pandemic influenza deaths are attributed to secondary bacterial infections. In animal models, influenza virus predisposes hosts to severe infection with both Streptococcus pneumoniae and Staphylococcus aureus. Despite its importance, the mechanistic nature of the interaction between influenza and pneumococci, its dependence on the timing and sequence of infections as well as the clinical and epidemiological consequences remain unclear. We e...

  19. Dominance of multidrug-resistant Denmark(14)-32 (ST230) clone among Streptococcus pneumoniae serotype 19A isolates causing pneumococcal disease in Bulgaria from 1992 to 2013.

    Science.gov (United States)

    Setchanova, Lena Petrova; Alexandrova, Alexandra; Dacheva, Daniela; Mitov, Ivan; Kaneva, Radka; Mitev, Vanio

    2015-02-01

    A pneumococcal conjugate vaccine (PCV10) was introduced in Bulgarian national immunization program since April 2010. Clonal composition based on pulsed-field gel electrophoresis and multilocus sequence typing genotyping of 52 serotype 19A Streptococcus pneumoniae isolates was analyzed. These were invasive and respiratory isolates collected between 1992 and 2013 from both children (78.8% clone. The most frequent sequence type (ST) was ST230 (48.1%) and together with four other closely related STs (15.4%), belonging to ST1611, ST276, ST7466, and ST2013, which were single- and double-locus variants; they were included in the main CC230. The disappearance of highly drug-resistant ST663 clone and emergence of new clones as CC320 and CC199 was also observed among the rest 19A isolates. A comparison of clonal composition between invasive and noninvasive isolates did not show a great genetic diversity among both kinds of isolates. Continuous surveillance of serotype 19A population following the introduction of PCV10 is essential to evaluate the impact of the vaccine on the epidemiology of this serotype.

  20. The impact of serotype-specific vaccination on phylodynamic parameters of Streptococcus pneumoniae and the pneumococcal pan-genome.

    Science.gov (United States)

    Azarian, Taj; Grant, Lindsay R; Arnold, Brian J; Hammitt, Laura L; Reid, Raymond; Santosham, Mathuram; Weatherholtz, Robert; Goklish, Novalene; Thompson, Claudette M; Bentley, Stephen D; O'Brien, Katherine L; Hanage, William P; Lipsitch, Marc

    2018-04-01

    In the United States, the introduction of the heptavalent pneumococcal conjugate vaccine (PCV) largely eliminated vaccine serotypes (VT); non-vaccine serotypes (NVT) subsequently increased in carriage and disease. Vaccination also disrupts the composition of the pneumococcal pangenome, which includes mobile genetic elements and polymorphic non-capsular antigens important for virulence, transmission, and pneumococcal ecology. Antigenic proteins are of interest for future vaccines; yet, little is known about how the they are affected by PCV use. To investigate the evolutionary impact of vaccination, we assessed recombination, evolution, and pathogen demographic history of 937 pneumococci collected from 1998-2012 among Navajo and White Mountain Apache Native American communities. We analyzed changes in the pneumococcal pangenome, focusing on metabolic loci and 19 polymorphic protein antigens. We found the impact of PCV on the pneumococcal population could be observed in reduced diversity, a smaller pangenome, and changing frequencies of accessory clusters of orthologous groups (COGs). Post-PCV7, diversity rebounded through clonal expansion of NVT lineages and inferred in-migration of two previously unobserved lineages. Accessory COGs frequencies trended toward pre-PCV7 values with increasing time since vaccine introduction. Contemporary frequencies of protein antigen variants are better predicted by pre-PCV7 values (1998-2000) than the preceding period (2006-2008), suggesting balancing selection may have acted in maintaining variant frequencies in this population. Overall, we present the largest genomic analysis of pneumococcal carriage in the United States to date, which includes a snapshot of a true vaccine-naïve community prior to the introduction of PCV7. These data improve our understanding of pneumococcal evolution and emphasize the need to consider pangenome composition when inferring the impact of vaccination and developing future protein-based pneumococcal

  1. The impact of serotype-specific vaccination on phylodynamic parameters of Streptococcus pneumoniae and the pneumococcal pan-genome

    Science.gov (United States)

    Hammitt, Laura L.; Santosham, Mathuram; Goklish, Novalene; Thompson, Claudette M.; Bentley, Stephen D.; O’Brien, Katherine L.

    2018-01-01

    In the United States, the introduction of the heptavalent pneumococcal conjugate vaccine (PCV) largely eliminated vaccine serotypes (VT); non-vaccine serotypes (NVT) subsequently increased in carriage and disease. Vaccination also disrupts the composition of the pneumococcal pangenome, which includes mobile genetic elements and polymorphic non-capsular antigens important for virulence, transmission, and pneumococcal ecology. Antigenic proteins are of interest for future vaccines; yet, little is known about how the they are affected by PCV use. To investigate the evolutionary impact of vaccination, we assessed recombination, evolution, and pathogen demographic history of 937 pneumococci collected from 1998–2012 among Navajo and White Mountain Apache Native American communities. We analyzed changes in the pneumococcal pangenome, focusing on metabolic loci and 19 polymorphic protein antigens. We found the impact of PCV on the pneumococcal population could be observed in reduced diversity, a smaller pangenome, and changing frequencies of accessory clusters of orthologous groups (COGs). Post-PCV7, diversity rebounded through clonal expansion of NVT lineages and inferred in-migration of two previously unobserved lineages. Accessory COGs frequencies trended toward pre-PCV7 values with increasing time since vaccine introduction. Contemporary frequencies of protein antigen variants are better predicted by pre-PCV7 values (1998–2000) than the preceding period (2006–2008), suggesting balancing selection may have acted in maintaining variant frequencies in this population. Overall, we present the largest genomic analysis of pneumococcal carriage in the United States to date, which includes a snapshot of a true vaccine-naïve community prior to the introduction of PCV7. These data improve our understanding of pneumococcal evolution and emphasize the need to consider pangenome composition when inferring the impact of vaccination and developing future protein

  2. Síndrome hemolítico-urêmica relacionada à infecção invasiva pelo Streptococcus pneumoniae Hemolytic-uremic syndrome complicating invasive pneumococcal disease

    Directory of Open Access Journals (Sweden)

    Anna Leticia de O. Cestari

    2008-03-01

    Full Text Available OBJETIVO: A doença pneumocócica é importante problema de saúde pública e raramente há associação desta infecção com a síndrome hemolítico-urêmica (SHU grave. O objetivo deste artigo é relatar o caso de um paciente com esta associação. DESCRIÇÃO DO CASO: Criança do sexo masculino, com 17 meses de idade, admitida no hospital com insuficiência respiratória aguda e necessitando de suporte ventilatório. O exame radiológico mostrava extensa opacidade homogênea em hemitórax direito. A hemocultura foi positiva para Streptococcus pneumoniae. Nos exames de admissão, notaram-se: hemoglobina de 6,5g/dL, 38.000 plaquetas/mm³, uréia de 79mg/dL e creatinina de 1,64mg/dL. No primeiro dia, apresentou oligoanúria e hipervolemia, necessitando de hemodiafiltração. Evoluiu com disfunção de múltiplos órgãos e óbito no sétimo dia. A necrópsia mostrou áreas extensas de necrose cortical e tubular renal, com depósito de fibrina nas arteríolas. COMENTÁRIOS: A SHU associada ao pneumococo apresenta morbidade e mortalidade elevadas. Em crianças com doença pneumocócica invasiva e acometimento hematológico ou renal grave, deve-se estar atento a esta rara complicação. Merecem investigação os seguintes aspectos relacionados à doença: a função da detecção precoce de antígenos T ativados no diagnóstico e terapêutica, o papel do fator H na patogênese, o método ideal de substituição renal e a definição do prognóstico em longo prazo.OBJECTIVE: Pneumococcal diseases are a major public health problem. Severe hemolytic-uremic syndrome is an uncommon complication. The aim of this study is to report a child with this complication. CASE DESCRIPTION: A male child with 17 months old was admitted to the hospital, due to acute respiratory failure, needing ventilatory support. Roentgenogram demonstrated massive condensation of right lung and Streptococcus pneumonia was isolated from blood cultures. Laboratory tests showed

  3. Health related quality of life in patients with community-acquired pneumococcal pneumonia in France

    OpenAIRE

    Andrade, Luiz Flavio; Saba, Grèce; Ricard, Jean-Damien; Messika, Jonathan; Gaillat, Jacques; Bonnin, Pierre; Chidiac, Christian; Illes, Hajnal-Gabriela; Laurichesse, Henri; Detournay, Bruno; Petitpretz, Patrick; de Pouvourville, Gérard

    2018-01-01

    Background Community Acquired Pneumococcal Pneumonia is a lung infection that causes serious health problems and can lead to complications and death. The aim of this study was to observe and analyze health related quality of life after a hospital episode for patients with community acquired pneumococcal pneumonia in France. Methods A total of 524 individuals were enrolled prospectively in the study and were followed for 12 months after hospital discharge. Presence of streptococcus pneumoniae ...

  4. Incidence of Hospitalized Pneumococcal Pneumonia among Adults in Guatemala, 2008-2012

    Science.gov (United States)

    Contreras, Carmen Lucía; Verani, Jennifer R.; Lopez, María Renee; Paredes, Antonio; Bernart, Chris; Moscoso, Fabiola; Roldan, Aleida; Arvelo, Wences; Lindblade, Kim A.; McCracken, John P.

    2015-01-01

    Background Streptococcus pneumoniae is a leading cause of pneumonia worldwide. However, the burden of pneumococcal pneumonia among adults in low- and middle-income countries is not well described. Methods Data from 2008–2012 was analyzed from two surveillance sites in Guatemala to describe the incidence of pneumococcal pneumonia in adults. A case of hospitalized pneumococcal pneumonia was defined as a positive pneumococcal urinary antigen test or blood culture in persons aged ≥ 18 years hospitalized with an acute respiratory infection (ARI). Results Among 1595 adults admitted with ARI, 1363 (82%) had either urine testing (n = 1286) or blood culture (n = 338) performed. Of these, 188 (14%) had pneumococcal pneumonia, including 173 detected by urine only, 8 by blood culture only, and 7 by both methods. Incidence rates increased with age, with the lowest rate among 18–24 year-olds (2.75/100,000) and the highest among ≥65 year-olds (31.3/100,000). The adjusted incidence of hospitalized pneumococcal pneumonia was 18.6/100,000 overall, with in-hospital mortality of 5%. Conclusions An important burden of hospitalized pneumococcal pneumonia in adults was described, particularly for the elderly. However, even adjusted rates likely underestimate the true burden of pneumococcal pneumonia in the community. These data provide a baseline against which to measure the indirect effects of the 2013 introduction of the pneumococcal conjugate vaccine in children in Guatemala. PMID:26488871

  5. Incidence of Hospitalized Pneumococcal Pneumonia among Adults in Guatemala, 2008-2012.

    Science.gov (United States)

    Contreras, Carmen Lucía; Verani, Jennifer R; Lopez, María Renee; Paredes, Antonio; Bernart, Chris; Moscoso, Fabiola; Roldan, Aleida; Arvelo, Wences; Lindblade, Kim A; McCracken, John P

    2015-01-01

    Streptococcus pneumoniae is a leading cause of pneumonia worldwide. However, the burden of pneumococcal pneumonia among adults in low- and middle-income countries is not well described. Data from 2008-2012 was analyzed from two surveillance sites in Guatemala to describe the incidence of pneumococcal pneumonia in adults. A case of hospitalized pneumococcal pneumonia was defined as a positive pneumococcal urinary antigen test or blood culture in persons aged ≥ 18 years hospitalized with an acute respiratory infection (ARI). Among 1595 adults admitted with ARI, 1363 (82%) had either urine testing (n = 1286) or blood culture (n = 338) performed. Of these, 188 (14%) had pneumococcal pneumonia, including 173 detected by urine only, 8 by blood culture only, and 7 by both methods. Incidence rates increased with age, with the lowest rate among 18-24 year-olds (2.75/100,000) and the highest among ≥65 year-olds (31.3/100,000). The adjusted incidence of hospitalized pneumococcal pneumonia was 18.6/100,000 overall, with in-hospital mortality of 5%. An important burden of hospitalized pneumococcal pneumonia in adults was described, particularly for the elderly. However, even adjusted rates likely underestimate the true burden of pneumococcal pneumonia in the community. These data provide a baseline against which to measure the indirect effects of the 2013 introduction of the pneumococcal conjugate vaccine in children in Guatemala.

  6. Bacteremia with Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Christensen, J S; Jensen, T G; Kolmos, H J

    2012-01-01

    We conducted a hospital-based cohort study among adult patients with first-time Streptococcus pneumoniae bacteremia (SPB) from 2000 through 2008. Patients were identified in a population-based bacteremia database and followed up for mortality through the Danish Civil Registration System (CRS...

  7. A Visual Review of the Human Pathogen Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David

    2017-01-01

    Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life...

  8. Population snapshot of Streptococcus pneumoniae causing invasive disease in South Africa prior to introduction of pneumococcal conjugate vaccines.

    Directory of Open Access Journals (Sweden)

    Kedibone M Ndlangisa

    Full Text Available We determined the sequence types of isolates that caused invasive pneumococcal disease (IPD prior to routine use of pneumococcal conjugate vaccines (PCV in South Africa. PCV-13 serotypes and 6C isolates collected in 2007 (1 461/2 437, 60% from patients of all ages as part of on-going, national, laboratory-based surveillance for IPD, were selected for genetic characterization. In addition, all 134 non-PCV isolates from children <2 years were selected for characterization. Sequence type diversity by serotype and age category (children <5 years vs. individuals ≥5 years was assessed for PCV serotypes using Simpson's index of diversity. Similar genotypes circulated among isolates from children and adults and the majority of serotypes were heterogeneous. While globally disseminated clones were common among some serotypes (e.g., serotype 1 [clonal complex (CC 217, 98% of all serotype 1] and 14 [CC230, 43%], some were represented mainly by clonal complexes rarely reported elsewhere (e.g., serotype 3 [CC458, 60%] and 19A [CC2062, 83%]. In children <2 years, serotype 15B and 8 were the most common serotypes among non-PCV isolates (16% [22/134] and 15% [20/134] isolates, respectively. Sequence type 7052 and 53 were most common among serotypes 15B and 8 isolates and accounted for 58% (7/12 and 64% (9/14 of the isolates, respectively. Serotype 19F, 14, 19A and 15B had the highest proportions of penicillin non-susceptible isolates. Genotypes rarely reported in other parts of the world but common among some of our serotypes highlight the importance of our data as these genotypes may emerge post PCV introduction.

  9. Serotype distribution in non-bacteremic pneumococcal pneumonia

    DEFF Research Database (Denmark)

    Benfield, Thomas Lars Vibe; Skovgaard, Marlene; Schønheyder, Henrik Carl

    2013-01-01

    There is limited knowledge of serotypes that cause non-bacteremic pneumococcal pneumonia (NBP). Here we report serotypes, their associated disease potential and coverage of pneumococcal conjugate vaccines (PCV) in adults with NBP and compare these to bacteremic pneumonia (BP).......There is limited knowledge of serotypes that cause non-bacteremic pneumococcal pneumonia (NBP). Here we report serotypes, their associated disease potential and coverage of pneumococcal conjugate vaccines (PCV) in adults with NBP and compare these to bacteremic pneumonia (BP)....

  10. Pneumococcal pneumonia: clinical features, diagnosis and management in HIV-infected and HIV noninfected patients.

    Science.gov (United States)

    Madeddu, Giordano; Fois, Alessandro Giuseppe; Pirina, Pietro; Mura, Maria Stella

    2009-05-01

    In this review, we focus on the clinical features, diagnosis and management of pneumococcal pneumonia in HIV-infected and noninfected patients, with particular attention to the most recent advances in this area. Classical clinical features are found in young adults, whereas atypical forms occur in immunocompromised patients including HIV-infected individuals. Bacteremic pneumococcal pneumonia is more frequently observed in HIV-infected and also in low-risk patients, according to the Pneumonia Severity Index (PSI). Pneumococcal pneumonia diagnostic process includes physical examination, radiologic findings and microbiologic diagnosis. However, etiologic diagnosis using traditional culture methods is difficult to obtain. In this setting, urinary antigen test, which recognizes Streptococcus pneumoniae cell wall C-polysaccharide, increases the probability of etiologic diagnosis. A correct management approach is crucial in reducing pneumococcal pneumonia mortality. The use of the PSI helps clinicians in deciding between inpatient and outpatient management in immunocompetent individuals, according to Infectious Diseases Society of America (IDSA)-American Thoracic Society (ATS) guidelines. Recent findings support PSI utility also in HIV-infected patients. Recently, efficacy of pneumococcal vaccine in reducing pneumococcal disease incidence has been evidenced in both HIV-infected and noninfected individuals. Rapid diagnosis and correct management together with implementation of preventive measures are crucial in order to reduce pneumococcal pneumonia related incidence and mortality in HIV-infected and noninfected patients.

  11. streptococcus pneumoniae , klebsiella pneumoniae proteus vulgaris

    African Journals Online (AJOL)

    DR. AMINU

    2-20mm) on Streptococcus pneumoniae and Proteus vulgaris when compared to the ... The result from this preliminary study suggests that the plant contains active compounds that .... Veterinary and Medical Laboratory Technology, Vom,. Jos.

  12. Lung abscess caused by Streptococcus pneumoniae serotype 6B

    Directory of Open Access Journals (Sweden)

    Yuhei Ito

    Full Text Available Lung abscess has been considered to be a rare complication of pneumococcal infection, and most cases are reported to be Streptococcus pneumoniae serotype 3. A 67-year-old man presented with fever and was diagnosed to have lung abscess caused by S. pneumoniae serotype 6B. The minimal inhibitory concentration (MIC of penicillin for the isolate was 1 μg/mL. He was treated with high-dose intravenous sulbactam/ampicillin as definitive therapy based on susceptibility testing for S. pneumoniae and recovered successfully without surgical intervention. S. pneumoniae serotype 6B can cause lung abscess. Keywords: Streptococcus pneumoniae, Lung abscess, Serotype 6B, Penicillin-resistant Streptococcus pneumoniae

  13. Lung abscess caused by Streptococcus pneumoniae serotype 6B.

    Science.gov (United States)

    Ito, Yuhei; Toyoshima, Hirokazu; Suzuki, Takehiro; Iwamoto, Keisuke; Sasano, Hajime; Itani, Hidetoshi; Kondo, Shigeto; Tanigawa, Motoaki

    2018-01-01

    Lung abscess has been considered to be a rare complication of pneumococcal infection, and most cases are reported to be Streptococcus pneumoniae serotype 3. A 67-year-old man presented with fever and was diagnosed to have lung abscess caused by S. pneumoniae serotype 6B. The minimal inhibitory concentration (MIC) of penicillin for the isolate was 1 μg/mL. He was treated with high-dose intravenous sulbactam/ampicillin as definitive therapy based on susceptibility testing for S. pneumoniae and recovered successfully without surgical intervention. S. pneumoniae serotype 6B can cause lung abscess.

  14. Carriage of Streptococcus pneumoniae 3 Years after Start of Vaccination Program, the Netherlands

    NARCIS (Netherlands)

    Spijkerman, J.; van Gils, E.J.M.; Veenhoven, R.H.; Hak, E.; Yzerman, E.P.F.; van den Ende, A.; Wijmenga-Monsuur, A.J.; van den Dobbelsteen, G.P.J.M.; Sanders, E.A.M.

    2011-01-01

    To evaluate the effectiveness of the 7-valent pneumococcal conjugate vaccine (PCV7) program, we conducted a cross-sectional observational study on nasopharyngeal carriage of Streptococcus pneumoniae 3 years after implementation of the program in the Netherlands. We compared pneumococcal serotypes in

  15. ADULT RESPIRATORY-DISTRESS SYNDROME (ARDS) DUE TO BACTEREMIC PNEUMOCOCCAL PNEUMONIA

    NARCIS (Netherlands)

    MANNES, GPM; BOERSMA, WG; BAUR, CHJM; POSTMUS, PE

    We describe a patient, who had no pre-existing disease, with bacteraemic pneumococcal pneumonia and adult respiratory distress syndrome (ARDS), a rare complication. In spite of the use of antibiotics and intensive treatment the mortality rate of this kind of infection remains high. Streptococcus

  16. An evaluation of emerging vaccines for childhood pneumococcal pneumonia

    Directory of Open Access Journals (Sweden)

    Zhang Jian Shayne F

    2011-04-01

    Full Text Available Abstract Background Pneumonia is the leading cause of child mortality worldwide. Streptococcus pneumoniae (SP or pneumococcus is estimated to cause 821,000 child deaths each year. It has over 90 serotypes, of which 7 to 13 serotypes are included in current formulations of pneumococcal conjugate vaccines that are efficacious in young children. To further reduce the burden from SP pneumonia, a vaccine is required that could protect children from a greater diversity of serotypes. Two different types of vaccines against pneumococcal pneumonia are currently at varying stages of development: a multivalent pneumococcal conjugate vaccine covering additional SP serotypes; and a conserved common pneumococcal protein antigen (PPA vaccine offering protection for all serotypes. Methods We used a modified CHNRI methodology for setting priorities in health research investments. This was done in two stages. In Stage I, we systematically reviewed the literature related to emerging SP vaccines relevant to several criteria of interest: answerability; efficacy and effectiveness; cost of development, production and implementation; deliverability, affordability and sustainability; maximum potential for disease burden reduction; acceptability to the end users and health workers; and effect on equity. In Stage II, we conducted an expert opinion exercise by inviting 20 experts (leading basic scientists, international public health researchers, international policy makers and representatives of pharmaceutical companies. The policy makers and industry representatives accepted our invitation on the condition of anonymity, due to sensitive nature of their involvement in such exercises. They answered questions from CHNRI framework and their “collective optimism” towards each criterion was documented on a scale from 0 to 100%. Results The experts expressed very high level of optimism (over 80% that low-cost polysaccharide conjugate SP vaccines would satisfy each of the 9

  17. Pneumococcal conjugate vaccine herd effects on non-invasive pneumococcal pneumonia in elderly

    NARCIS (Netherlands)

    van Werkhoven, Cornelis H; Hollingsworth, Rosalind C; Huijts, Susanne M; Bolkenbaas, Marieke; Webber, Chris; Patterson, Scott; Sanders, Elisabeth A M; Bonten, Marc J M

    2016-01-01

    BACKGROUND: Herd protection from infant pneumococcal conjugate vaccination is well established for invasive pneumococcal disease (IPD) but not for non-IPD pneumococcal community-acquired pneumonia (PCAP). We assessed the contribution of vaccine-serotypes in non-IPD PCAP in adults 65 years and older

  18. Prevotella intermedia induces severe bacteremic pneumococcal pneumonia in mice with upregulated platelet-activating factor receptor expression.

    Science.gov (United States)

    Nagaoka, Kentaro; Yanagihara, Katsunori; Morinaga, Yoshitomo; Nakamura, Shigeki; Harada, Tatsuhiko; Hasegawa, Hiroo; Izumikawa, Koichi; Ishimatsu, Yuji; Kakeya, Hiroshi; Nishimura, Masaharu; Kohno, Shigeru

    2014-02-01

    Streptococcus pneumoniae is the leading cause of respiratory infection worldwide. Although oral hygiene has been considered a risk factor for developing pneumonia, the relationship between oral bacteria and pneumococcal infection is unknown. In this study, we examined the synergic effects of Prevotella intermedia, a major periodontopathic bacterium, on pneumococcal pneumonia. The synergic effects of the supernatant of P. intermedia (PiSup) on pneumococcal pneumonia were investigated in mice, and the stimulation of pneumococcal adhesion to human alveolar (A549) cells by PiSup was assessed. The effects of PiSup on platelet-activating factor receptor (PAFR) transcript levels in vitro and in vivo were analyzed by quantitative real-time PCR, and the differences between the effects of pneumococcal infection induced by various periodontopathic bacterial species were verified in mice. Mice inoculated with S. pneumoniae plus PiSup exhibited a significantly lower survival rate, higher bacterial loads in the lungs, spleen, and blood, and higher inflammatory cytokine levels in the bronchoalveolar lavage fluid (macrophage inflammatory protein 2 and tumor necrosis factor alpha) than those infected without PiSup. In A549 cells, PiSup increased pneumococcal adhesion and PAFR transcript levels. PiSup also increased lung PAFR transcript levels in mice. Similar effects were not observed in the supernatants of Porphyromonas gingivalis or Fusobacterium nucleatum. Thus, P. intermedia has the potential to induce severe bacteremic pneumococcal pneumonia with enhanced pneumococcal adhesion to lower airway cells.

  19. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

    OpenAIRE

    Quintero, B.; Araque, M.; van der Gaast-de Jongh, C.; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P. W. M.

    2010-01-01

    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5?years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae?S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6...

  20. Nasopharyngeal carriage of Streptococcus pneumonia in pneumonia-prone age groups in Semarang, Java Island, Indonesia.

    Science.gov (United States)

    Farida, Helmia; Severin, Juliëtte A; Gasem, M Hussein; Keuter, Monique; Wahyono, Hendro; van den Broek, Peterhans; Hermans, Peter W M; Verbrugh, Henri A

    2014-01-01

    Streptococcus pneumoniae is a worldwide occurring pathogen Nasopharyngeal carriage of Streptococcus pneumoniae precedes pneumonia and other pneumococcal diseases in the community. Little is known about S. pneumoniae carriage in Indonesia, complicating strategies to control pneumococcal diseases. We investigated nasopharyngeal carriage of S. pneumoniae in Semarang, Indonesia. A population-based survey was performed in Semarang, Indonesia. Nasopharyngeal swabs and questionnaires were taken from 496 healthy young (6-60 month-old) children and 45-70 year-old adults. Forty-three percent of children aged 6-60 months and 11% of adults aged 45-75 years carried S. pneumoniae. Determinants of carriage were being a child (OR 7.7; 95% CI = 4.5-13.0), passive smoking (OR 2.1; 95% CI = 1.3-3.4), and contact with toddler(s) at home (OR 3.0; 95% CI = 1.9-4.7). The most frequent serotypes found were 6A/B and 15B/C. The current commercially available vaccines cover <50% serotypes found in children. Twenty-four percent of S. pneumoniae strains were penicillin non-susceptible, and 45% were resistant to cotrimoxazol. The limited coverage of commercially available vaccines against the serotypes found in this population, and the high proportion of non-susceptibility to penicillin and cotrimoxazol suggest the need for region-specific information and strategies to control S. pneumoniae.

  1. Vaccination for the control of childhood bacterial pneumonia - Haemophilus influenzae type b and pneumococcal vaccines

    Directory of Open Access Journals (Sweden)

    Diana C Otczyk

    2013-01-01

    Full Text Available Pneumonia in childhood is endemic in large parts of the world and in particular, in developing countries, as well as in many indigenous communities within developed nations. Haemophilus influenzae type b and Streptococcus pneumoniae conjugate vaccines are currently available against the leading bacterial causes of pneumonia.  The use of the vaccines in both industrialised and developing countries have shown a dramatic reduction in the burden of pneumonia and invasive disease in children.  However, the greatest threat facing pneumococcal conjugate vaccine effectiveness is serotype replacement.  The current vaccines provide serotype-specific, antibody–mediated protection against only a few of the 90+ capsule serotypes.  Therefore, there has been a focus in recent years to rapidly advance technologies that will result in broader disease coverage and more affordable vaccines that can be used in developing countries.  The next generation of pneumococcal vaccines have advanced to clinical trials.

  2. Streptococcus pneumoniae Drugs Resistance in Acute Rhinosinusitis

    Directory of Open Access Journals (Sweden)

    Chong Jie Hao

    2016-03-01

    Full Text Available Background: Acute rhinosinusitis that usually caused by Streptococcus pneumoniae becomes the reason why patients seek for medical care. Drugs resistance in Streptococcus pneumoniae is increasing worldwide. This study was conducted to determine drugs resistance of Streptococcus pneumonia from acute rhinosinusitis in Dr. Hasan Sadikin General Hospital. Methods: A descriptive laboratory study was conducted in June–October 2014 at the Laboratory of Microbiology Faculty of Medicine Universitas Padjadjaran. The sample was taken using nasopharyngeal swabbing from 100 acute rhinosinusitis patients in Dr. Hasan Sadikin General Hospital and planted on tryptic soy agar containing 5% sheep blood and 5 μg/ml of gentamicin sulphate and then incubated in 5% CO2 incubator at 37°C for 24 hours. The identification of Streptococcus pneumonia was performed by optochin test. The susceptibility test against Streptococcus pneumoniae was done using disk diffusion method.The antibiotic disks were trimethoprim-sulfamethoxazole, oxacillin, levofloxacin, azithromycin, and doxycycline. Results: Out of 100 samples, 8 of them were tested positive for Streptococcus pneumoniae. Three of Streptococcus pneumoniae isolates died with unknown reason after it were stored at -80 .The drugs resistance test showed the resistance of Streptococcus pneumonia to oxacillin, azithromycin and trimethoprim were 6, whereas levofloxacin and doxycycline are 4. Conclusions: Streptococcus pneumonia drugs resistance in acute rhinosinusitis shows the resistance of Streptococcus pneumoniae to oxacillin, azithromycin and trimethoprim are 6, whereas the resistance to levofloxacin and doxycycline are 4.

  3. Gene Regulation in Streptococcus pneumoniae: interplay between nutrition and virulence

    NARCIS (Netherlands)

    W.T. Hendriksen (Wouter)

    2010-01-01

    textabstractStreptococcus pneumoniae (the pneumococcus) is a Gram-positive bacterium, which belongs to the species of streptococci. Other pathogenic bacteria belonging to this class include Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus suis, Streptococcus uberis, Streptococcus

  4. Burden of Severe Pneumonia, Pneumococcal Pneumonia and Pneumonia Deaths in Indian States: Modelling Based Estimates.

    Science.gov (United States)

    Farooqui, Habib; Jit, Mark; Heymann, David L; Zodpey, Sanjay

    2015-01-01

    The burden of severe pneumonia in terms of morbidity and mortality is unknown in India especially at sub-national level. In this context, we aimed to estimate the number of severe pneumonia episodes, pneumococcal pneumonia episodes and pneumonia deaths in children younger than 5 years in 2010. We adapted and parameterized a mathematical model based on the epidemiological concept of potential impact fraction developed CHERG for this analysis. The key parameters that determine the distribution of severe pneumonia episode across Indian states were state-specific under-5 population, state-specific prevalence of selected definite pneumonia risk factors and meta-estimates of relative risks for each of these risk factors. We applied the incidence estimates and attributable fraction of risk factors to population estimates for 2010 of each Indian state. We then estimated the number of pneumococcal pneumonia cases by applying the vaccine probe methodology to an existing trial. We estimated mortality due to severe pneumonia and pneumococcal pneumonia by combining incidence estimates with case fatality ratios from multi-centric hospital-based studies. Our results suggest that in 2010, 3.6 million (3.3-3.9 million) episodes of severe pneumonia and 0.35 million (0.31-0.40 million) all cause pneumonia deaths occurred in children younger than 5 years in India. The states that merit special mention include Uttar Pradesh where 18.1% children reside but contribute 24% of pneumonia cases and 26% pneumonia deaths, Bihar (11.3% children, 16% cases, 22% deaths) Madhya Pradesh (6.6% children, 9% cases, 12% deaths), and Rajasthan (6.6% children, 8% cases, 11% deaths). Further, we estimated that 0.56 million (0.49-0.64 million) severe episodes of pneumococcal pneumonia and 105 thousand (92-119 thousand) pneumococcal deaths occurred in India. The top contributors to India's pneumococcal pneumonia burden were Uttar Pradesh, Bihar, Madhya Pradesh and Rajasthan in that order. Our results

  5. Burden of Severe Pneumonia, Pneumococcal Pneumonia and Pneumonia Deaths in Indian States: Modelling Based Estimates.

    Directory of Open Access Journals (Sweden)

    Habib Farooqui

    Full Text Available The burden of severe pneumonia in terms of morbidity and mortality is unknown in India especially at sub-national level. In this context, we aimed to estimate the number of severe pneumonia episodes, pneumococcal pneumonia episodes and pneumonia deaths in children younger than 5 years in 2010. We adapted and parameterized a mathematical model based on the epidemiological concept of potential impact fraction developed CHERG for this analysis. The key parameters that determine the distribution of severe pneumonia episode across Indian states were state-specific under-5 population, state-specific prevalence of selected definite pneumonia risk factors and meta-estimates of relative risks for each of these risk factors. We applied the incidence estimates and attributable fraction of risk factors to population estimates for 2010 of each Indian state. We then estimated the number of pneumococcal pneumonia cases by applying the vaccine probe methodology to an existing trial. We estimated mortality due to severe pneumonia and pneumococcal pneumonia by combining incidence estimates with case fatality ratios from multi-centric hospital-based studies. Our results suggest that in 2010, 3.6 million (3.3-3.9 million episodes of severe pneumonia and 0.35 million (0.31-0.40 million all cause pneumonia deaths occurred in children younger than 5 years in India. The states that merit special mention include Uttar Pradesh where 18.1% children reside but contribute 24% of pneumonia cases and 26% pneumonia deaths, Bihar (11.3% children, 16% cases, 22% deaths Madhya Pradesh (6.6% children, 9% cases, 12% deaths, and Rajasthan (6.6% children, 8% cases, 11% deaths. Further, we estimated that 0.56 million (0.49-0.64 million severe episodes of pneumococcal pneumonia and 105 thousand (92-119 thousand pneumococcal deaths occurred in India. The top contributors to India's pneumococcal pneumonia burden were Uttar Pradesh, Bihar, Madhya Pradesh and Rajasthan in that order. Our

  6. Burden of Severe Pneumonia, Pneumococcal Pneumonia and Pneumonia Deaths in Indian States: Modelling Based Estimates

    Science.gov (United States)

    Farooqui, Habib; Jit, Mark; Heymann, David L.; Zodpey, Sanjay

    2015-01-01

    The burden of severe pneumonia in terms of morbidity and mortality is unknown in India especially at sub-national level. In this context, we aimed to estimate the number of severe pneumonia episodes, pneumococcal pneumonia episodes and pneumonia deaths in children younger than 5 years in 2010. We adapted and parameterized a mathematical model based on the epidemiological concept of potential impact fraction developed CHERG for this analysis. The key parameters that determine the distribution of severe pneumonia episode across Indian states were state-specific under-5 population, state-specific prevalence of selected definite pneumonia risk factors and meta-estimates of relative risks for each of these risk factors. We applied the incidence estimates and attributable fraction of risk factors to population estimates for 2010 of each Indian state. We then estimated the number of pneumococcal pneumonia cases by applying the vaccine probe methodology to an existing trial. We estimated mortality due to severe pneumonia and pneumococcal pneumonia by combining incidence estimates with case fatality ratios from multi-centric hospital-based studies. Our results suggest that in 2010, 3.6 million (3.3–3.9 million) episodes of severe pneumonia and 0.35 million (0.31–0.40 million) all cause pneumonia deaths occurred in children younger than 5 years in India. The states that merit special mention include Uttar Pradesh where 18.1% children reside but contribute 24% of pneumonia cases and 26% pneumonia deaths, Bihar (11.3% children, 16% cases, 22% deaths) Madhya Pradesh (6.6% children, 9% cases, 12% deaths), and Rajasthan (6.6% children, 8% cases, 11% deaths). Further, we estimated that 0.56 million (0.49–0.64 million) severe episodes of pneumococcal pneumonia and 105 thousand (92–119 thousand) pneumococcal deaths occurred in India. The top contributors to India’s pneumococcal pneumonia burden were Uttar Pradesh, Bihar, Madhya Pradesh and Rajasthan in that order. Our

  7. Predicting pneumococcal community-acquired pneumonia in the emergency department: evaluation of clinical parameters.

    Science.gov (United States)

    Huijts, S M; Boersma, W G; Grobbee, D E; Gruber, W C; Jansen, K U; Kluytmans, J A J W; Kuipers, B A F; Palmen, F; Pride, M W; Webber, C; Bonten, M J M

    2014-12-01

    The aim of this study was to quantify the value of clinical predictors available in the emergency department (ED) in predicting Streptococcus pneumoniae as the cause of community-acquired pneumonia (CAP). A prospective, observational, cohort study of patients with CAP presenting in the ED was performed. Pneumococcal aetiology of CAP was based on either bacteraemia, or S. pneumoniae being cultured from sputum, or urinary immunochromatographic assay positivity, or positivity of a novel serotype-specific urinary antigen detection test. Multivariate logistic regression was used to identify independent predictors and various cut-off values of probability scores were used to evaluate the usefulness of the model. Three hundred and twenty-eight (31.0%) of 1057 patients with CAP had pneumococcal CAP. Nine independent predictors for pneumococcal pneumonia were identified, but the clinical utility of this prediction model was disappointing, because of low positive predictive values or a small yield. Clinical criteria have insufficient diagnostic capacity to predict pneumococcal CAP. Rapid antigen detection tests are needed to diagnose S. pneumoniae at the time of hospital admission. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  8. Lung abscess due to Streptococcus pneumoniae: a case series and brief review of the literature.

    Science.gov (United States)

    Nicolini, Antonello; Cilloniz, Catia; Senarega, Renata; Ferraioli, Gianluca; Barlascini, Cornelius

    2014-01-01

    Anaerobes used to be the most common cause of community-acquired lung abscess, and Streptococcus species used to be the second most common cause. In recent years, this has been changing. Klebsiella pneumoniae is now an increasing cause of community- acquired lung abscess, but Streptococcus species continue to be major pathogens. Necrotizing pneumonia has generally been regarded as a rare complication of pneumococcal infection in adults. Type 3 Streptococcus pneumoniae was the single most common type implicated in necrosis; however, many other serotypes were implicated. This entity predominately infects children, but is present also in adults. Lung abscess in adults due to Streptococcus pneumoniae is not common. In this regard we present a case series of pulmonary cavitation due to Streptococcus pneumoniae and discuss the possible pathogenic mechanism of the disease.

  9. Nasopharyngeal carriage of Streptococcus pneumoniae among HIV-infected and -uninfected children <5 years of age before introduction of pneumococcal conjugate vaccine in Mozambique.

    Directory of Open Access Journals (Sweden)

    Jennifer R Verani

    Full Text Available Nasopharyngeal carriage is a precursor for pneumococcal disease and can be useful for evaluating pneumococcal conjugate vaccine (PCV impact. We studied pre-PCV pneumococcal carriage among HIV-infected and -uninfected children in Mozambique. Between October 2012 and March 2013, we enrolled HIV-infected children age <5 years presenting for routine care at seven HIV clinics in 3 sites, including Maputo (urban-south, Nampula (urban-north, and Manhiça (rural-south. We also enrolled a random sample of HIV-uninfected children <5 years old from a demographic surveillance site in Manhiça. A single nasopharyngeal swab was obtained and cultured following enrichment in Todd Hewitt broth with yeast extract and rabbit serum. Pneumococcal isolates were serotyped by Quellung reaction and multiplex polymerase chain reaction. Factors associated with pneumococcal carriage were examined using logistic regression. Overall pneumococcal carriage prevalence was 80.5% (585/727, with similar prevalences among HIV-infected (81.5%, 339/416 and HIV-uninfected (79.1%, 246/311 children, and across age strata. Among HIV-infected, after adjusting for recent antibiotic use and hospitalization, there was no significant association between study site and colonization: Maputo (74.8%, 92/123, Nampula (83.7%, 82/98, Manhiça (84.6%, 165/195. Among HIV-uninfected, report of having been born to an HIV-infected mother was not associated with colonization. Among 601 pneumococcal isolates from 585 children, serotypes 19F (13.5%, 23F (13.1%, 6A (9.2%, 6B (6.2% and 19A (5.2% were most common. The proportion of serotypes included in the 10- and 13-valent vaccines was 44.9% and 61.7%, respectively, with no significant differences by HIV status or age group. Overall 36.9% (n = 268 of children were colonized with a PCV10 serotype and 49.7% (n = 361 with a PCV13 serotype. Pneumococcal carriage was common, with little variation by geographic region, age, or HIV status. PCV10 was introduced in

  10. Severe pneumococcal pneumonia: impact of new quinolones on prognosis

    Directory of Open Access Journals (Sweden)

    Meybeck Agnes

    2011-03-01

    Full Text Available Abstract Background Most guidelines have been proposing, for more than 15 years, a β-lactam combined with either a quinolone or a macrolide as empirical, first-line therapy of severe community acquired pneumonia (CAP requiring ICU admission. Our goal was to evaluate the outcome of patients with severe CAP, focusing on the impact of new rather than old fluoroquinolones combined with β-lactam in the empirical antimicrobial treatments. Methods Retrospective study of consecutive patients admitted in a 16-bed general intensive care unit (ICU, between January 1996 and January 2009, for severe (Pneumonia Severity Index > or = 4 community-acquired pneumonia due to non penicillin-resistant Streptococcus pneumoniae and treated with a β-lactam combined with a fluoroquinolone. Results We included 70 patients of whom 38 received a β-lactam combined with ofloxacin or ciprofloxacin and 32 combined with levofloxacin. Twenty six patients (37.1% died in the ICU. Three independent factors associated with decreased survival in ICU were identified: septic shock on ICU admission (AOR = 10.6; 95% CI 2.87-39.3; p = 0.0004, age > 70 yrs. (AOR = 4.88; 95% CI 1.41-16.9; p = 0.01 and initial treatment with a β-lactam combined with ofloxacin or ciprofloxacin (AOR = 4.1; 95% CI 1.13-15.13; p = 0.03. Conclusion Our results suggest that, when combined to a β-lactam, levofloxacin is associated with lower mortality than ofloxacin or ciprofloxacin in severe pneumococcal community-acquired pneumonia.

  11. Pneumococcal vaccines: the impact of conjugate vaccine

    National Research Council Canada - National Science Library

    Mäkelä, P. Helena; Siber, George R; Klugman, Keith P

    2008-01-01

    ... of Streptococcus pneumoniae with Complement Proteins 83 Margaret K. Hostetter III. Clinical Disease and Epidemiology 8 Epidemiology, Diagnosis, and Treatment of Serious Pneumococcal Infections in Chi...

  12. Drug treatment of pneumococcal pneumonia in the elderly.

    Science.gov (United States)

    Neralla, Sridhar; Meyer, Keith C

    2004-01-01

    Streptococcus pneumoniae has been recognised as a major cause of pneumonia since the time of Sir William Osler. Drug-resistant S. pneumoniae (DRSP), which have gradually become resistant to penicillins as well as more recently developed macrolides and fluoroquinolones, have emerged as a consequence of indiscriminate use of antibacterials coupled with the ability of the pneumococcus to adapt to a changing antibacterial milieu. Pneumococci use cell wall choline components to bind platelet-activating factor receptors, colonise mucosal surfaces and evade innate immune defenses. Numerous virulence factors that include hyaluronidase, neuraminidase, iron-binding proteins, pneumolysin and autolysin then facilitate cytolysis of host cells and allow tissue invasion and bloodstream dissemination. Changes in pneumococcal cell wall penicillin-binding proteins account for resistance to penicillins, mutations in the ermB gene cause high-level macrolide resistance and mutations in topoisomerase IV genes coupled with GyrA gene mutations alter DNA gyrase and lead to high-level fluoroquinolone resistance. Risk factors for lower respiratory tract infections in the elderly include age-associated changes in oral clearance, mucociliary clearance and immune function. Other risks for developing pneumonia include poor nutrition, hypoalbuminaemia, bedridden status, aspiration, recent viral infection, the presence of chronic organ dysfunction syndromes including parenchymal lung disease and recent antibacterial therapy. Although the incidence of infections caused by DRSP is rising, the effect of an increase in the prevalence of resistant pneumococci on mortality is not clear. When respiratory infections occur, rapid diagnosis and prompt, empirical administration of appropriate antibacterial therapy that ensures adequate coverage of DRSP is likely to increase the probability of a successful outcome when treating community-acquired pneumonia in elderly patients, particularly those with multiple

  13. Role of Nucleotide-Binding Oligomerization Domain-Containing (NOD 2 in Host Defense during Pneumococcal Pneumonia.

    Directory of Open Access Journals (Sweden)

    Tijmen J Hommes

    Full Text Available Streptococcus (S. pneumoniae is the most common causative pathogen in community-acquired pneumonia. Nucleotide-binding oligomerization domain-containing (NOD 2 is a pattern recognition receptor located in the cytosol of myeloid cells that is able to detect peptidoglycan fragments of S. pneumoniae. We here aimed to investigate the role of NOD2 in the host response during pneumococcal pneumonia. Phagocytosis of S. pneumoniae was studied in NOD2 deficient (Nod2-/- and wild-type (Wt alveolar macrophages and neutrophils in vitro. In subsequent in vivo experiments Nod2-/- and Wt mice were inoculated with serotype 2 S. pneumoniae (D39, an isogenic capsule locus deletion mutant (D39Δcps or serotype 3 S. pneumoniae (6303 via the airways, and bacterial growth and dissemination and the lung inflammatory response were evaluated. Nod2-/- alveolar macrophages and blood neutrophils displayed a reduced capacity to internalize pneumococci in vitro. During pneumonia caused by S. pneumoniae D39 Nod2-/- mice were indistinguishable from Wt mice with regard to bacterial loads in lungs and distant organs, lung pathology and neutrophil recruitment. While Nod2-/- and Wt mice also had similar bacterial loads after infection with the more virulent S. pneumoniae 6303 strain, Nod2-/- mice displayed a reduced bacterial clearance of the normally avirulent unencapsulated D39Δcps strain. These results suggest that NOD2 does not contribute to host defense during pneumococcal pneumonia and that the pneumococcal capsule impairs recognition of S. pneumoniae by NOD2.

  14. Analysis of invasive pneumonia-causing strains of Streptococcus pneumoniae: serotypes and antimicrobial susceptibility.

    Science.gov (United States)

    Yoshioka, Cristina R M; Martinez, Marina B; Brandileone, Maria C C; Ragazzi, Selma B; Guerra, Maria L L S; Santos, Silvia R; Shieh, Huei H; Gilio, Alfredo E

    2011-01-01

    To identify the most common pneumococcal serotypes in children hospitalized with invasive pneumonia, correlate isolated serotypes with those included in conjugate vaccines, and ascertain the sensitivity of the isolated pneumococcal strains to penicillin and other antibiotics. From January 2003 to October 2008, a retrospective study of hospitalized children with a diagnosis of Streptococcus pneumoniae pneumonia was conducted at the university hospital of Universidade de São Paulo. Criteria for inclusion were: age greater than 29 days and less than 15 years, radiological and clinical diagnosis of pneumonia, and isolation of Streptococcus pneumoniae in blood cultures and/or pleural effusion. The study included 107 children. The most common serotypes were 14 (36.5%), 1 (16%), 5 (14.6%), 6B (6.3%) and 3 (4.2%). The proportion of identified serotypes contained in the heptavalent, 10-valent and 13-valent conjugate vaccines was 53.1, 86.5, and 96.9%, respectively. Pneumococcal strains were sensitive to penicillin (minimum inhibitory concentration, MIC ≤ 2 µg/mL) in 100 cases (93.5%) and displayed intermediate resistance (MIC = 4 µg/mL) in 7 cases (6.5%). No strains were penicillin-resistant (MIC ≥ 8 µg/mL) according to the Clinical and Laboratory Standards Institute 2008 standards. Tested isolates were highly sensitive to vancomycin, rifampicin, ceftriaxone, clindamycin, erythromycin, and chloramphenicol. Our results confirm a significant potential impact of conjugate vaccines, mainly 10-valent and 13-valent, on invasive pneumonia. Furthermore, susceptibility testing results show that penicillin is still the treatment of choice for invasive pneumonia in our setting.

  15. Expression of Streptococcus pneumoniae Bacteriocins Is Induced by Antibiotics via Regulatory Interplay with the Competence System

    NARCIS (Netherlands)

    Kjos, Morten; Miller, Eric; Slager, Jelle; Lake, Frank B; Gericke, Oliver; Roberts, Ian S; Rozen, Daniel E; Veening, Jan-Willem

    2016-01-01

    Pneumococcal bacteriocins (pneumocins) are antibacterial toxins that mediate intra-species competition within the human host. However, the triggers of pneumocin expression are poorly understood. Using RNA-sequencing, we mapped the regulon of the pneumocin cluster (blp) of Streptococcus pneumoniae

  16. Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae

    NARCIS (Netherlands)

    Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven

    2014-01-01

    Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires

  17. Streptococcus pneumoniae: A Cause of Primary Lung Abscess in a Child

    OpenAIRE

    MacDonald, Kelly S; de Carvalho, Volia M; Liebert, Lawrence; Embree, Joanne E

    1993-01-01

    A case of primary pneumococcal lung abscess in a five-year-old child is described. Secondary anaerobic infection as a cause of cavitation was excluded by bronchoscopic culture of the cavity. Streptococcus pneumoniae is a rare but recognized cause of lung abscess in healthy children.

  18. Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

    Energy Technology Data Exchange (ETDEWEB)

    Cilloniz, Catia; Torres, Antoni [Servicio de Neumologia, Hospital Clinic de Barcelona, Ciber de Enfermedades Respiratorias (CIBERES), Instituto de Investigacion Biomedica Agusti Pi i Sunyer, Universidad de Barcelona (Spain); Rangel, Ernesto [Facultad de Medicina, Universidad Autonoma de Nayarit, Tepic (Mexico); Barlascini, Cornelius [Servizio di Igiene e Sanita Pubblica, Ospedale Generale di Sestri Levante, Sestri Levante (Italy); Piroddi, Ines Maria Grazia; Nicolini, Antonello, E-mail: antonellonicolini@gmail.com [Servizio di Pneumologia, Ospedale Generale di Sestri Levante, Sestri Levante (Italy)

    2015-07-15

    Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

  19. Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

    International Nuclear Information System (INIS)

    Cilloniz, Catia; Torres, Antoni; Rangel, Ernesto; Barlascini, Cornelius; Piroddi, Ines Maria Grazia; Nicolini, Antonello

    2015-01-01

    Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

  20. Increased incidence of adult pneumococcal pneumonia during school holiday periods

    Science.gov (United States)

    Rodrigo, Chamira; Bewick, Thomas; Sheppard, Carmen; Greenwood, Sonia; McKeever, Tricia M.; Slack, Mary; Lim, Wei Shen

    2017-01-01

    Child contact is a recognised risk factor for adult pneumococcal disease. Peaks in invasive pneumococcal disease incidence observed during winter holidays may be related to changes in social dynamics. This analysis was conducted to examine adult pneumococcal community-acquired pneumonia (CAP) incidence during school holiday periods. Between September 2008 and 2013, consecutive adults admitted to hospitals covering the Greater Nottingham area with a diagnosis of CAP were studied. Pneumococcal pneumonia was detected using culture and antigen detection methods. Of 2221 adults studied, 575 (25.9%) were admitted during school holidays and 643 (29.0%) had pneumococcal CAP. CAP of pneumococcal aetiology was significantly more likely in adults admitted during school holidays compared to term time (35.3% versus 26.7%; adjusted OR 1.38, 95% CI 1.11–1.72, p=0.004). Over the 5-year period, the age-adjusted incidence of hospitalised pneumococcal CAP was higher during school holidays compared to term time (incident rate ratio 1.35, 95% CI 1.14–1.60, pholidays compared to term time (42.0% versus 33.7%, OR 1.43, 95% CI 1.00–2.03, p=0.046). Further study of transmission dynamics in relation to these findings and to identify appropriate intervention strategies is warranted. PMID:28326311

  1. The Streptococcus pneumoniae Competence Regulatory System Influences Respiratory Tract Colonization ▿

    OpenAIRE

    Kowalko, J. E.; Sebert, M. E.

    2008-01-01

    The Streptococcus pneumoniae ComDE two-component signaling system controls the development of genetic competence in the bacterium and affects virulence in models of pneumonia and bacteremia. We have investigated the impact of the competence pathway during colonization of the nasopharynx, the principal ecological niche of the pneumococcus. Previous work showed that deletion of the pneumococcal CiaRH signaling system inhibited colonization and increased expression of genes required for competen...

  2. Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease

    Science.gov (United States)

    Chao, Yashuan; Marks, Laura R.; Pettigrew, Melinda M.; Hakansson, Anders P.

    2015-01-01

    Streptococcus pneumoniae (the pneumococcus) is a common colonizer of the human nasopharynx. Despite a low rate of invasive disease, the high prevalence of colonization results in millions of infections and over one million deaths per year, mostly in individuals under the age of 5 and the elderly. Colonizing pneumococci form well-organized biofilm communities in the nasopharyngeal environment, but the specific role of biofilms and their interaction with the host during colonization and disease is not yet clear. Pneumococci in biofilms are highly resistant to antimicrobial agents and this phenotype can be recapitulated when pneumococci are grown on respiratory epithelial cells under conditions found in the nasopharyngeal environment. Pneumococcal biofilms display lower levels of virulence in vivo and provide an optimal environment for increased genetic exchange both in vitro and in vivo, with increased natural transformation seen during co-colonization with multiple strains. Biofilms have also been detected on mucosal surfaces during pneumonia and middle ear infection, although the role of these biofilms in the disease process is debated. Recent studies have shown that changes in the nasopharyngeal environment caused by concomitant virus infection, changes in the microflora, inflammation, or other host assaults trigger active release of pneumococci from biofilms. These dispersed bacteria have distinct phenotypic properties and transcriptional profiles different from both biofilm and broth-grown, planktonic bacteria, resulting in a significantly increased virulence in vivo. In this review we discuss the properties of pneumococcal biofilms, the role of biofilm formation during pneumococcal colonization, including their propensity for increased ability to exchange genetic material, as well as mechanisms involved in transition from asymptomatic biofilm colonization to dissemination and disease of otherwise sterile sites. Greater understanding of pneumococcal biofilm

  3. Pathophysiology of pneumococcal meningitis

    NARCIS (Netherlands)

    Geldhoff, M.

    2016-01-01

    Bacterial meningitis is a serious infectious disease, involving the membranes surrounding the brain and spinal cord, and the subarachnoid space. In the Netherlands most common causative agents are Streptococcus pneumoniae (72%) and Neisseria meningitidis (11%). The incidence of pneumococcal

  4. A visual review of the human pathogen Streptococcus pneumoniae.

    Science.gov (United States)

    Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David S; Andersen, Ebbe Sloth; Kjærgaard, Rikke Schmidt

    2017-11-01

    Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life cycle in eight watercolor paintings. The paintings are done to a consistent nanometer scale based on currently available data from structural biology and proteomics. In this review article, the paintings are used to provide a visual review of protein synthesis, carbohydrate metabolism, cell wall synthesis, cell division, teichoic acid synthesis, virulence, transformation and pilus synthesis based on the available scientific literature within the field of pneumococcal biology. Visualization of the molecular details of these processes reveals several scientific questions about how molecular components of the pneumococcal cell are organized to allow biological function to take place. By the presentation of this visual review, we intend to stimulate scientific discussion, aid in the generation of scientific hypotheses and increase public awareness. A narrated video describing the biological processes in the context of a whole-cell illustration accompany this article. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Streptococcus pneumoniae urinary tract infection in pedeatrics.

    Science.gov (United States)

    Pougnet, Richard; Sapin, Jeanne; De Parscau, Loïc; Pougnet, Laurence

    2017-06-01

    Streptococcus pneumoniae infections in children are most often lung infections or meningitis. Urinary tract infections are much rarer. We present the case of a urinary tract infection with Streptococcus pneumoniae. The clinical picture was classical. The urine culture showed the presence of Streptococcus pneumoniae in urine (10 4 UFC/mL; with 2 × 10 4 leucocytes/mL). The literature mentions a few cases of such infections. In some studies, the prevalence of Streptococcus pneumoniae in urine of children is less than 1%. Those children mostly present abnormalities of urinary tract. In our case, urinary ultrasound scan have shown the presence of an ectopic kidney in this child. The discussion between the clinician and the biologist has contributed to the discovery of this renal anomaly.

  6. The gut microbiota plays a protective role in the host defence against pneumococcal pneumonia.

    Science.gov (United States)

    Schuijt, Tim J; Lankelma, Jacqueline M; Scicluna, Brendon P; de Sousa e Melo, Felipe; Roelofs, Joris J T H; de Boer, J Daan; Hoogendijk, Arjan J; de Beer, Regina; de Vos, Alex; Belzer, Clara; de Vos, Willem M; van der Poll, Tom; Wiersinga, W Joost

    2016-04-01

    Pneumonia accounts for more deaths than any other infectious disease worldwide. The intestinal microbiota supports local mucosal immunity and is increasingly recognised as an important modulator of the systemic immune system. The precise role of the gut microbiota in bacterial pneumonia, however, is unknown. Here, we investigate the function of the gut microbiota in the host defence against Streptococcus pneumoniae infections. We depleted the gut microbiota in C57BL/6 mice and subsequently infected them intranasally with S. pneumoniae. We then performed survival and faecal microbiota transplantation (FMT) experiments and measured parameters of inflammation and alveolar macrophage whole-genome responses. We found that the gut microbiota protects the host during pneumococcal pneumonia, as reflected by increased bacterial dissemination, inflammation, organ damage and mortality in microbiota-depleted mice compared with controls. FMT in gut microbiota-depleted mice led to a normalisation of pulmonary bacterial counts and tumour necrosis factor-α and interleukin-10 levels 6 h after pneumococcal infection. Whole-genome mapping of alveolar macrophages showed upregulation of metabolic pathways in the absence of a healthy gut microbiota. This upregulation correlated with an altered cellular responsiveness, reflected by a reduced responsiveness to lipopolysaccharide and lipoteichoic acid. Compared with controls, alveolar macrophages derived from gut microbiota-depleted mice showed a diminished capacity to phagocytose S. pneumoniae. This study identifies the intestinal microbiota as a protective mediator during pneumococcal pneumonia. The gut microbiota enhances primary alveolar macrophage function. Novel therapeutic strategies could exploit the gut-lung axis in bacterial infections. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  7. Sensitivity, Specificity, and Positivity Predictors of the Pneumococcal Urinary Antigen Test in Community-Acquired Pneumonia.

    Science.gov (United States)

    Molinos, Luis; Zalacain, Rafael; Menéndez, Rosario; Reyes, Soledad; Capelastegui, Alberto; Cillóniz, Catia; Rajas, Olga; Borderías, Luis; Martín-Villasclaras, Juan J; Bello, Salvador; Alfageme, Inmaculada; Rodríguez de Castro, Felipe; Rello, Jordi; Ruiz-Manzano, Juan; Gabarrús, Albert; Musher, Daniel M; Torres, Antoni

    2015-10-01

    Detection of the C-polysaccharide of Streptococcus pneumoniae in urine by an immune-chromatographic test is increasingly used to evaluate patients with community-acquired pneumonia. We assessed the sensitivity and specificity of this test in the largest series of cases to date and used logistic regression models to determine predictors of positivity in patients hospitalized with community-acquired pneumonia. We performed a multicenter, prospective, observational study of 4,374 patients hospitalized with community-acquired pneumonia. The urinary antigen test was done in 3,874 cases. Pneumococcal infection was diagnosed in 916 cases (21%); 653 (71%) of these cases were diagnosed exclusively by the urinary antigen test. Sensitivity and specificity were 60 and 99.7%, respectively. Predictors of urinary antigen positivity were female sex; heart rate≥125 bpm, systolic blood pressureantibiotic treatment; pleuritic chest pain; chills; pleural effusion; and blood urea nitrogen≥30 mg/dl. With at least six of all these predictors present, the probability of positivity was 52%. With only one factor present, the probability was only 12%. The urinary antigen test is a method with good sensitivity and excellent specificity in diagnosing pneumococcal pneumonia, and its use greatly increased the recognition of community-acquired pneumonia due to S. pneumoniae. With a specificity of 99.7%, this test could be used to direct simplified antibiotic therapy, thereby avoiding excess costs and risk for bacterial resistance that result from broad-spectrum antibiotics. We also identified predictors of positivity that could increase suspicion for pneumococcal infection or avoid the unnecessary use of this test.

  8. Factors associated with colonization of Streptococcus pneumoniae ...

    African Journals Online (AJOL)

    with schooling and presence chronic diseases. ... Streptococcus pneumoniae is a leading cause of serious community-acquired infections such as ... large number of individuals are still suffering from infections caused by these bacteria, especially ... samples of children with severe pneumonia (Nantanda et al., 2008).

  9. Detection and quantification of Streptococcus pneumoniae from ...

    African Journals Online (AJOL)

    The aim of this study was to develop a real time polymerase chain reaction (PCR) for quantitative detection of Streptococcus pneumoniae from clinical respiratory specimens. Initially, 184 respiratory specimens from patients with community acquired pneumonia (CAP) (n = 129) and 55 cases with hospital associated ...

  10. Pneumococcal Pneumonia and Pandemic H1N1

    Centers for Disease Control (CDC) Podcasts

    2012-06-06

    Dr. George Nelson, a CDC medical officer, discusses the relationship between pneumococcal pneumonia and Pandemic H1N1.  Created: 6/6/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 6/6/2012.

  11. RAPID DETECTION OF PNEUMOCOCCAL ANTIGEN IN PLEURAL FLUID OF PATIENTS WITH COMMUNITY ACQUIRED PNEUMONIA

    NARCIS (Netherlands)

    BOERSMA, WG; LOWENBERG, A; HOLLOWAY, Y; KUTTSCHRUTTER, H; SNIJDER, JAM; KOETER, GH

    Background Detection of pneumococcal antigen may help to increase the rate of diagnosis of pneumococcal pneumonia. This study was designed to determine the value of rapid detection of pneumococcal antigen in pleural fluid from patients with community acquired pneumonia. Methods Thoracentesis was

  12. Long-term mortality after IPD and bacteremic versus non-bacteremic pneumococcal pneumonia

    NARCIS (Netherlands)

    Wagenvoort, Gertjan H. J.; Sanders, Elisabeth A. M.; de Melker, Hester E.; van der Ende, Arie; Vlaminckx, Bart J.; Knol, Mirjam J.

    2017-01-01

    Short-term mortality after invasive pneumococcal disease (IPD) and pneumococcal pneumonia is high but data on long-term mortality (including the comparison between bacteremic and non-invasive/non-bacteremic pneumococcal pneumonia) within the first years after diagnosis are scarce. Adult patients

  13. Exposure to welding fumes and lower airway infection with Streptococcus pneumoniae.

    Science.gov (United States)

    Suri, Reetika; Periselneris, Jimstan; Lanone, Sophie; Zeidler-Erdely, Patti C; Melton, Geoffrey; Palmer, Keith T; Andujar, Pascal; Antonini, James M; Cohignac, Vanessa; Erdely, Aaron; Jose, Ricardo J; Mudway, Ian; Brown, Jeremy; Grigg, Jonathan

    2016-02-01

    Welders are at increased risk of pneumococcal pneumonia. The mechanism for this association is not known. The capacity of pneumococci to adhere to and infect lower airway cells is mediated by host-expressed platelet-activating factor receptor (PAFR). We sought to assess the effect of mild steel welding fumes (MS-WF) on PAFR-dependent pneumococcal adhesion and infection to human airway cells in vitro and on pneumococcal airway infection in a mouse model. The oxidative potential of MS-WF was assessed by their capacity to reduce antioxidants in vitro. Pneumococcal adhesion and infection of A549, BEAS-2B, and primary human bronchial airway cells were assessed by means of quantitative bacterial culture and expressed as colony-forming units (CFU). After intranasal instillation of MS-WF, mice were infected with Streptococcus pneumoniae, and bronchoalveolar lavage fluid (BALF) and lung CFU values were determined. PAFR protein levels were assessed by using immunofluorescence and immunohistochemistry, and PAFR mRNA expression was assessed by using quantitative PCR. PAFR was blocked by CV-3988, and oxidative stress was attenuated by N-acetylcysteine. MS-WF exhibited high oxidative potential. In A549 and BEAS-2B cells MS-WF increased pneumococcal adhesion and infection and PAFR protein expression. Both CV-3988 and N-acetylcysteine reduced MS-WF-stimulated pneumococcal adhesion and infection of airway cells. MS-WF increased mouse lung PAFR mRNA expression and increased BALF and lung pneumococcal CFU values. In MS-WF-exposed mice CV-3988 reduced BALF CFU values. Hypersusceptibility of welders to pneumococcal pneumonia is in part mediated by the capacity of welding fumes to increase PAFR-dependent pneumococcal adhesion and infection of lower airway cells. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

  14. Association between nasopharyngeal load of Streptococcus pneumoniae, viral coinfection, and radiologically confirmed pneumonia in Vietnamese children.

    Science.gov (United States)

    Vu, Huong Thi Thu; Yoshida, Lay Myint; Suzuki, Motoi; Nguyen, Hien Anh Thi; Nguyen, Cat Dinh Lien; Nguyen, Ai Thi Thuy; Oishi, Kengo; Yamamoto, Takeshi; Watanabe, Kiwao; Vu, Thiem Dinh

    2011-01-01

    The interplay between nasopharyngeal bacterial carriage, viral coinfection, and lower respiratory tract infections (LRTIs) is poorly understood. We explored this association in Vietnamese children aged less than 5 years. A hospital-based case-control study of pediatric LRTIs was conducted in Nha Trang, Vietnam. A total of 550 hospitalized children (274 radiologically confirmed pneumonia [RCP] and 276 other LRTIs) were enrolled and 350 healthy controls were randomly selected from the community. Polymerase chain reaction-based methods were used to measure bacterial loads of Streptococcus pneumoniae (SP), Haemophilus influenzae, and Moraxella catarrhalis and to detect 13 respiratory viruses and bacterial serotypes in nasopharyngeal samples of study participants. The median nasopharyngeal bacterial load of SP was substantially higher in children with RCP compared with healthy controls or children with other LRTIs (P RCP or other LRTIs groups. An increased load of SP in the nasopharynx was associated with RCP, viral coinfection, and presence of pneumococcal capsule.

  15. Monoclonal Idiotope Vaccine against Streptococcus pneumoniae Infection

    Science.gov (United States)

    McNamara, Mary K.; Ward, Ronald E.; Kohler, Heinz

    1984-12-01

    A monoclonal anti-idiotope antibody coupled to a carrier protein was used to immunize BALB/c mice against a lethal Streptococcus pneumoniae infection. Vaccinated mice developed a high titer of antibody to phosphorylcholine, which is known to protect against infection with Streptococcus pneumoniae. Measurement of the median lethal dose of the bacteria indicated that anti-idiotope immunization significantly increased the resistance of BALB/c mice to the bacterial challenge. Antibody to an idiotope can thus be used as an antigen substitute for the induction of protective immunity.

  16. Carrier state of Haemophilus influenzae type b (Hib, Streptococcus pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children in Pokhara, Nepal

    Directory of Open Access Journals (Sweden)

    Dharm Raj Bhatta

    2014-02-01

    Full Text Available Objective: To determine the incidence of carrier state of Haemophilus influenzae type b, Streptococcus pneumoniae (S. pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children. Methods: Specimen from posterior pharyngeal wall and tonsils were collected on calcium alginate coated swabs from 1 02 participants. Processing of specimen and antimicrobial susceptibility testing was done by standard procedures. Results: Potential pathogens isolated in our study were S. pneumoniae (14.7%, Staphylococcus aureus (12.7%, Corynebacterium diphtheriae (3.9%, Streptococcus pyogenes (3.9% and Haemophilus influenzae (1.9%. Important findings in antibiogram include high resistance of S. pneumoniae to penicillin (73% and resistance of Staphylococcus aureus to oxacillin (23%. Conclusions: Pharyngeal colonization by S. pneumoniae among school children was found high and there is need of introduction of pneumococcal vaccines among children. Despite expected universal vaccination, pharyngeal colonization by Corynebacterium diphtheriae is possible and there is possibility of transmission.

  17. Estado de portador nasofaríngeo de Streptococcus pneumoniae en madres e hijos de la población indígena Panare del estado Bolívar, Venezuela Pneumococcal carriage in mothers and children of the Panare Amerindians from the State of Bolivar, Venezuela

    Directory of Open Access Journals (Sweden)

    T Bello González

    2010-02-01

    Full Text Available En América del Norte, los grupos indígenas se han identificado como una población con un riesgo elevado de ser portadora de Streptococcus pneumoniae, así como de desarrollar enfermedad neumocócica invasora. Sin embargo, hay poca información con respecto a los indígenas de Latinoamérica. En el presente estudio se evaluó el estado de portador nasofaríngeo y la distribución de los serotipos de S. pneumoniae en madres e hijos de la población panare de Venezuela. Durante el mes de mayo de 2008 se obtuvieron 148 muestras nasofaríngeas de 64 madres y 84 niños menores de 5 años pertenecientes a 8 comunidades panare. Mediante procedimientos estándares se identificaron 65 cepas de S. pneumoniae. Dichas cepas fueron tipificadas por PCR múltiple, y sus patrones de sensibilidad a los antimicrobianos se determinaron por el método de difusión con discos. El 11% de las madres y el 69% de los niños eran portadores de S. pneumoniae. Los serotipos 6B (49%, 33F (21,5%, 6A (6%, 19A (3,1% y 23F (1,5% fueron los más frecuentes. El mismo serotipo se identificó en 3 de los 6 grupos madre-hijo/s colonizados. Todas las cepas fueron sensibles a la penicilina y el 13,7% fue resistente a los macrólidos. La elevada tasa de colonización en la población panare sugiere que los niños presentan un alto riesgo de desarrollar enfermedad invasora por S. pneumoniae; por lo tanto podrían beneficiarse de la vacunación. Cuatro serotipos de la vacuna conjugada (6B, 6A, 19A y 23F, que representaron el 58% de las cepas aisladas, estaban presentes en la población al momento del estudio. La resistencia a los antibióticos no se presenta como un problema dentro de esta población.In North America, the indigenous groups have been identified as a population with increased risk of pneumococcal colonization and pneumococcal invasive disease. However, little information is available from South American natives. In the present study we evaluated the nasopharyngeal

  18. Association of infant pneumococcal vaccination with pneumococcal pneumonia among mothers : A nested case-control study using the GPRD

    NARCIS (Netherlands)

    Hak, Eelko; Shea, Kimberly M.; Jick, Susan S.

    2013-01-01

    Since implementation of infant immunization with 7-valent pneumococcal conjugate vaccine (PCV7), increased rates of pneumococcal pneumonia have been reported among adults. Using a cohort of mother-infant pairs identified from the General Practice Research Database in the UK we found that from 2006

  19. Dyrkningsnegativ Streptococcus pneumoniae endokarditis diagnosticeret med polymerasekaedereaktion

    DEFF Research Database (Denmark)

    Rasmussen, Rasmus Vedby; Kemp, Michael; Bangsborg, Jette Marie

    2008-01-01

    A 60-year old man was admitted with sepsis and meningitis of unknown aetiology. Underlying aortic valve endocarditis was diagnosed by echocardiography and severe insufficiency led to aortic valve replacement. Application of broad-range PCR to cusp tissue revealed a DNA product, and a diagnosis of...... of Streptococcus pneumoniae endocarditis was obtained by DNA sequencing....

  20. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children.

    Science.gov (United States)

    Quintero, B; Araque, M; van der Gaast-de Jongh, C; Escalona, F; Correa, M; Morillo-Puente, S; Vielma, S; Hermans, P W M

    2011-01-01

    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae-S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6A (8%), 11 (8%), 23A (6%), and 34 (6%) were the most prevalent. Non-respiratory atopy was a risk factor for S. aureus colonization (p = 0.017). Vaccine serotypes were negatively associated with preceding respiratory infection (p = 0.02) and with S. aureus colonization (p = 0.03). We observed a high prevalence of pneumococcal resistance against trimethoprim-sulfamethoxazole (40%), erythromycin (38%), and penicillin (14%). Semi-quantitative measurement of pneumococcal colonization density showed that children with young siblings and low socioeconomic status were more densely colonized (p = 0.02 and p = 0.02, respectively). In contrast, trimethoprim-sulfamethoxazole- and multidrug-resistant-pneumococci colonized children sparsely (p = 0.03 and p = 0.01, respectively). Our data form an important basis to monitor the future impact of pneumococcal vaccination on bacterial colonization, as well as to recommend a rationalized and restrictive antimicrobial use in our community.

  1. Economic aspects of pneumococcal pneumonia: a review of the literature.

    Science.gov (United States)

    De Graeve, Diana; Beutels, Philippe

    2004-01-01

    In this review, the economic aspects of pneumococcal pneumonia are analysed, including the costs, cost effectiveness and cost benefit of treatment and prevention. We identified eight cost-of-illness studies, 15 analyses comparing the costs of different treatment options and 15 economic evaluations of prevention that met our search criteria. The studies were conducted largely in Europe and the US. Most pertained to community-acquired pneumonia (CAP) in general, without specific analysis of pneumococcus-related illness. Many of the studies were considered to be of poor quality for the following reasons: comparison without randomisation or control variables, disregard of health outcomes, small sample size, restriction of costs to drug costs and vague or disputable sources of cost information. In the US, hospitalisation costs resulting from CAP can be estimated to be between US 7,000 dollars and US 8,000 dollars per admission or US 4 million dollars per 100,000 population. Hospitalisation costs are significant (representing about 90% of total costs), but are much lower in Europe than in the US (one-third to one-ninth of the US estimates in the UK and Spain, respectively). In general, economic studies of treatment for pneumococcal pneumonia are in line with clinical evidence. A drug with proven clinical effectiveness would also appear to be supported from an economic stand point. Furthermore, economic data support an early switch from an intravenous to an oral antibacterial, the use of quinolones for inpatients with CAP, and also the use of guidelines built on clinical evidence. Of all the possible preventive strategies for pneumococcal pneumonia, only vaccination has been subjected to economic evaluation. Pneumococcal polysaccharide vaccine seems relatively cost effective (and potentially cost saving) for those between 65 and 75 years of age, for military recruits and for HIV positive patients with a sufficiently high CD4 cell count. Evaluations of the pneumococcal

  2. Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae.

    Science.gov (United States)

    Maricic, Natalie; Anderson, Erica S; Opipari, AnneMarie E; Yu, Emily A; Dawid, Suzanne

    2016-01-26

    Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus) in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials. Successful colonization of a polymicrobial host surface is a prerequisite for the subsequent development of disease for many bacterial pathogens. Bacterial factors that directly inhibit the growth of neighbors

  3. Drug-resistance in Streptococcus pneumoniae isolates among Spanish middle aged and older adults with community-acquired pneumonia

    Directory of Open Access Journals (Sweden)

    Raga-Luria Xavier

    2009-03-01

    Full Text Available Abstract Background Pneumococcal diseases remain a major cause of morbidity and mortality worldwide. Updated data on drug-resistance from different populations may be important to recognize changes in disease patterns. This study assessed current levels of penicilin resistance among Streptococcus Pneumoniae causing pneumonia in Spanish middle age and older adults. Methods Antimicrobial susceptibility was tested for 104 consecutive isolates of Streptococcus pneumoniae recovered from patients 50 years or older with radiographically confirmed pneumonia in the region of Tarragona (Spain between 2002 and 2007. According to the minimum inhibitory concentration of tested antimicrobials (penicillin, erythromycin, cefotaxime and levofloxacin strains were classified as susceptible or resistant. Antimicrobial resistance was determined for early cases (2002–2004 and contemporary cases (2005–2007. Results Twenty-seven (25.9% were penicillin-resistant strains (19 strains with intermediate resistance and 8 strains with high resistance. Penicillin-resistance was higher in 2002–2004 than in 2005–2007 (39.5% vs 18.2%, p = 0.017. Of 27 penicillin-resistant strains, 10 (37% were resistant to erythromycin, 8 (29.6% to cefotaxime, 2 (7.4% to levofloxacin, and 4 (14.8% were identified as multidrug resistant. Case-fatality rate was higher among those patients who had an infection caused by any penicillin susceptible strain (16.9% than in those with infections due to penicillin-resistant strains. Conclusion Resistance to penicillin among Streptococcus pneumoniae remains high, but such resistance does not result in increased mortality in patients with pneumococcal pneumonia.

  4. Seeing Streptococcus pneumoniae, a Common Killer Bacteria

    DEFF Research Database (Denmark)

    Kjærgaard, Rikke Schmidt; Andersen, Ebbe Sloth

    2014-01-01

    Look around you. The diversity and complexity of life on earth is overwhelming and data continues to grow. In our desire to understand and explain everything scientifically from molecular evolution to supernovas we depend on visual representations. This paper investigates visual representations...... of the bacteria Streptococcus pneumoniae by use of ink, watercolours and computer graphics. We propose a novel artistic visual rendering of Streptococcus pneumoniae and ask what the value of these kind of representations are compared to traditional scientific data. We ask if drawings and computer......-assisted representations can add to our scientific knowledge about this dangerous bacteria. Is there still a role for the scientific illustrator in the scientific process and synthesis of scientific knowledge?...

  5. Detection of Streptococcus pneumoniae in whole blood by PCR.

    Science.gov (United States)

    Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D

    1995-03-01

    Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple

  6. The comparative development of elevated resistance to macrolides in community-acquired pneumonia caused by Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Yayan J

    2014-10-01

    Full Text Available Josef Yayan Department of Internal Medicine, Division of Pulmonary, Allergy and Sleep Medicine, Saarland University Medical Center, Homburg/Saar, Germany Background: Community-acquired pneumonia (CAP is an acute inflammation of the lungs, which is often caused by Streptococcus pneumoniae. CAP is the leading cause of death by infectious disease in industrialized countries. Therefore, an immediate and effective antibiotic therapy is of great importance for the nonfatal outcome of the disease. The literature contains increasing data about the development of resistance to antibiotics that are used for the treatment of CAP caused by S. pneumoniae; this article also examines the possible development of resistance to antibiotics in S. pneumoniae in recent years.Methods: Within the study period of 2004–2014, all hospital charts from patients with CAP caused by S. pneumoniae were collected from the Department of Internal Medicine, Saarland University Medical Center, Homburg/Saar, Germany. The tracheal secretions of S. pneumoniae in CAP patients were obtained by bronchoalveolar lavage; bronchial aspirates were obtained through flexible bronchoscopy and directly from sputum, and blood cultures were examined microbiologically for microorganisms.Results: From a total of 100 patients with CAP caused by S. pneumoniae, 23 (53.49% [34.78% female], 95% confidence interval, 38.58–68.4 patients with a mean age of 59.78±15.77 years met the inclusion criteria of this investigation. These patients were compared to a total of 20 (46.51% [35% female], 95% confidence interval, 31.6–61.42 patients with a mean age of 58.9±13.36 years with CAP who were infested with S. pneumoniae. In the latter group, the streptococcal antigen was detected in pulmonary aspirations by bronchoscopy or in urine using polymerase chain reaction and a rapid pneumococcal test. Penicillin G and vancomycin had a high rate of sensitivity on the antibiogram for S. pneumoniae, which was

  7. Comparative genomic analysis of multidrug-resistant Streptococcus pneumoniae isolates

    Directory of Open Access Journals (Sweden)

    Pan F

    2018-05-01

    Full Text Available Fen Pan,1 Hong Zhang,1 Xiaoyan Dong,2 Weixing Ye,3 Ping He,4 Shulin Zhang,4 Jeff Xianchao Zhu,5 Nanbert Zhong1,2,6 1Department of Clinical Laboratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 2Department of Respiratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 3Shanghai Personal Biotechnology Co., Ltd, Shanghai, China; 4Department of Medical Microbiology and Immunology, Shanghai Jiao Tong University School of Medicine, Shanghai, China; 5Zhejiang Bioruida Biotechnology co. Ltd, Zhejiang, China; 6New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY, USA Introduction: Multidrug resistance in Streptococcus pneumoniae has emerged as a serious problem to public health. A further understanding of the genetic diversity in antibiotic-resistant S. pneumoniae isolates is needed. Methods: We conducted whole-genome resequencing for 25 pneumococcal strains isolated from children with different antimicrobial resistance profiles. Comparative analysis focus on detection of single-nucleotide polymorphisms (SNPs and insertions and deletions (indels was conducted. Moreover, phylogenetic analysis was applied to investigate the genetic relationship among these strains. Results: The genome size of the isolates was ~2.1 Mbp, covering >90% of the total estimated size of the reference genome. The overall G+C% content was ~39.5%, and there were 2,200–2,400 open reading frames. All isolates with different drug resistance profiles harbored many indels (range 131–171 and SNPs (range 16,103–28,128. Genetic diversity analysis showed that the variation of different genes were associated with specific antibiotic resistance. Known antibiotic resistance genes (pbps, murMN, ciaH, rplD, sulA, and dpr were identified, and new genes (regR, argH, trkH, and PTS-EII closely related with antibiotic resistance were found, although these genes were primarily annotated

  8. Streptococcus pneumoniae, mecanismos de resistencia antimicrobiana

    Directory of Open Access Journals (Sweden)

    Amauri Noda Albelo

    2011-09-01

    Full Text Available El Streptococcus pneumoniae, principal agente causal de la neumonía comunitaria, líder en la etiología de la otitis media y la meningitis, en las últimas 3 décadas ha incrementado, de manera importante, su resistencia a los agentes terapéuticos más utilizados, como los betalactámicos, macrólidos, azálidos y fluroquinolonas. La versatilidad adaptativa del microorganismo le ha permitido crear mecanismos capaces de sobreponerse a cualquiera de estas agresiones terapéuticas con un grado variable de eficacia. Se realiza una revisión de los mecanismos más importantes implicados en la adquisición de resistencia antimicrobiana por S. pneumoniae, y se precisan algunos de los factores de riesgo implicados en infección por S. pneumoniae resistente.

  9. Gut Microbiota Contributes to Resistance Against Pneumococcal Pneumonia in Immunodeficient Rag-/- Mice.

    Science.gov (United States)

    Felix, Krysta M; Jaimez, Ivan A; Nguyen, Thuy-Vi V; Ma, Heqing; Raslan, Walid A; Klinger, Christina N; Doyle, Kristian P; Wu, Hsin-Jung J

    2018-01-01

    Streptococcus pneumoniae causes infection-related mortality worldwide. Immunocompromised individuals, including young children, the elderly, and those with immunodeficiency, are especially vulnerable, yet little is known regarding S. pneumoniae- related pathogenesis and protection in immunocompromised hosts. Recently, strong interest has emerged in the gut microbiota's impact on lung diseases, or the "gut-lung axis." However, the mechanisms of gut microbiota protection against gut-distal lung diseases like pneumonia remain unclear. We investigated the role of the gut commensal, segmented filamentous bacteria (SFB), against pneumococcal pneumonia in immunocompetent and immunocompromised mouse models. For the latter, we chose the Rag -/- model, with adaptive immune deficiency. Immunocompetent adaptive protection against S. pneumoniae infection is based on antibodies against pneumococcal capsular polysaccharides, prototypical T cell independent-II (TI-II) antigens. Although SFB colonization enhanced TI-II antibodies in C57BL/6 mice, our data suggest that SFB did not further protect these immunocompetent animals. Indeed, basal B cell activity in hosts without SFB is sufficient for essential protection against S. pneumoniae . However, in immunocompromised Rag -/- mice, we demonstrate a gut-lung axis of communication, as SFB influenced lung protection by regulating innate immunity. Neutrophil resolution is crucial to recovery, since an unchecked neutrophil response causes severe tissue damage. We found no early neutrophil recruitment differences between hosts with or without SFB; however, we observed a significant drop in lung neutrophils in the resolution phase of S. pneumoniae infection, which corresponded with lower CD47 expression, a molecule that inhibits phagocytosis of apoptotic cells, in SFB-colonized Rag -/- mice. SFB promoted a shift in lung neutrophil phenotype from inflammatory neutrophils expressing high levels of CD18 and low levels of CD62L, to pro

  10. Streptococcus pneumoniae and Pseudomonas aeruginosa pneumonia induce distinct host responses.

    Science.gov (United States)

    McConnell, Kevin W; McDunn, Jonathan E; Clark, Andrew T; Dunne, W Michael; Dixon, David J; Turnbull, Isaiah R; Dipasco, Peter J; Osberghaus, William F; Sherman, Benjamin; Martin, James R; Walter, Michael J; Cobb, J Perren; Buchman, Timothy G; Hotchkiss, Richard S; Coopersmith, Craig M

    2010-01-01

    Pathogens that cause pneumonia may be treated in a targeted fashion by antibiotics, but if this therapy fails, then treatment involves only nonspecific supportive measures, independent of the inciting infection. The purpose of this study was to determine whether host response is similar after disparate infections with similar mortalities. Prospective, randomized controlled study. Animal laboratory in a university medical center. Pneumonia was induced in FVB/N mice by either Streptococcus pneumoniae or two different concentrations of Pseudomonas aeruginosa. Plasma and bronchoalveolar lavage fluid from septic animals was assayed by a microarray immunoassay measuring 18 inflammatory mediators at multiple time points. The host response was dependent on the causative organism as well as kinetics of mortality, but the pro-inflammatory and anti-inflammatory responses were independent of inoculum concentration or degree of bacteremia. Pneumonia caused by different concentrations of the same bacteria, Pseudomonas aeruginosa, also yielded distinct inflammatory responses; however, inflammatory mediator expression did not directly track the severity of infection. For all infections, the host response was compartmentalized, with markedly different concentrations of inflammatory mediators in the systemic circulation and the lungs. Hierarchical clustering analysis resulted in the identification of five distinct clusters of the host response to bacterial infection. Principal components analysis correlated pulmonary macrophage inflammatory peptide-2 and interleukin-10 with progression of infection, whereas elevated plasma tumor necrosis factor sr2 and macrophage chemotactic peptide-1 were indicative of fulminant disease with >90% mortality within 48 hrs. Septic mice have distinct local and systemic responses to Streptococcus pneumoniae and Pseudomonas aeruginosa pneumonia. Targeting specific host inflammatory responses induced by distinct bacterial infections could represent a

  11. Concurrent Infection with Hepatitis C Virus and Streptococcus pneumoniae.

    Science.gov (United States)

    Marrie, Thomas J; Tyrrell, Gregory J; Majumdar, Sumit R; Eurich, Dean T

    2017-07-01

    Little is known about concurrent infection with hepatitis C virus (HCV) and Streptococcus pneumoniae, which causes invasive pneumococcal disease (IPD). We hypothesized that co-infection with HCV and S. pneumoniae would increase risk for death and complications. We captured sociodemographic and serologic data for adults with IPD in a population-based cohort study in northern Alberta, Canada, during 2000-2014. IPD patients infected with HCV were compared with IPD patients not infected with HCV for risk of in-hospital deaths and complications by using multivariable logistic regression. A total of 355 of 3,251 patients with IPD were co-infected with HCV. The in-hospital mortality rate was higher for IPD patients infected with HCV. Prevalence of most IPD-related complications (e.g., cellulitis, acute kidney injury, mechanical ventilation) was also higher in HCV-infected patients. Infection with HCV is common in patients with IPD, and HCV is independently associated with an increased risk for serious illness and death.

  12. Economic aspects of hospital treated pneumococcal pneumonia and the results of Pneumo 23 vaccine use in Serbia

    Directory of Open Access Journals (Sweden)

    Adžić Tatjana

    2008-01-01

    Full Text Available INTRODUCTION In Serbia, there is a significant number of persons suffering of pneumococcal pneumonia. Persons aged 65 years or older, immunocompromised patients, patients with co-morbidities, such as chronic obstructive lung disease and congestive heart failure, are at the highest risk for developing pneumococcal pneumonia. Most of the patients are treated empirically, although it is often overlooked that Streptococcus pneumoniae can be resistant to the used antibiotics. The treatment costs of such inpatients and outpatients are very high. In Serbia, immunization of persons at risk to develop the diseases caused by Streptococcus pneumoniae is carried out using pneumococcus polysaccharide vaccine according to clinical indications. The exact number of immunized persons and the total number of registered patients are still unknown, but it is certain of being unjustifiably low. OBJECTIVE The goal of the study was to investigate, during a one-year period, the number and basic characteristics of persons hospitably treated for pneumonia, the type of cause of the infection, applied antibiotic medications, duration and costs of hospital treatment at the Institute for Lung Diseases and Tuberculosis of the Clinical Centre of Serbia in Belgrade. METHOD We retrospectively analyzed the medical records of patients with pneumonia treated at the Institute for Lung Diseases and Tuberculosis of the Clinical Centre of Serbia in Belgrade during 2006. RESULTS During the observed one-year period, 290 patients underwent hospital treatment, of whom the cause of the infection was confirmed in 116 (40%. The average duration of hospitalization was 12 days, with treatment cost of 32,031.74 RSD (402.42 EUR per patient. The treatment cost per patient including general and intensive care was 18,290.01 RSD (229.78 EUR. The distribution cost of Pneumo 23 vaccine in Serbia, without purchase tax, was 746.90 RSD (9.38 EUR. CONCLUSION Pneumococcal pneumonia is a significant medical

  13. Streptococcus pneumoniae aislados de infecciones invasivas: serotipos y resistencia antimicrobiana Streptococcus pneumoniae isolated from invasive infections: serotypes and antimicrobial resistance

    Directory of Open Access Journals (Sweden)

    Gladys Antonia Cueto Montoya

    2007-03-01

    Full Text Available Las meningoencefalitis bacterianas constituyen una enfermedad invasiva importante, quizás no tanto por su frecuencia, como por la gravedad de su cuadro. Los cambios en la epidemiología de los síndromes neurológicos infecciosos en Cuba a partir de la vacunación contra meningococo BC y Haemophilus influenzae b han hecho que el Streptococcus pneumoniae constituya el agente causal más frecuente. Debido al incremento de la resistencia de este microorganismo a los antibióticos habituales, se realizaron modificaciones al régimen terapéutico convencional, fundamentalmente en las meningitis pediátricas. Es necesario lograr el aislamiento en cultivo de este agente para conocer los serotipos más frecuentes en el país, y lograr una vacuna neumocócica conjugada, así como para la vigilancia de las cepas frente a los antimicrobianos.The bacterial meningoencephalitis is an important invasive disease, not only because of its frequency, but also because of the severity of its picture. The changes in the epidemiology of the neurological infectious syndromes in Cuba starting from the vaccination against meningococcus BC and Haemophilus infuenzae b have made that Streptococcus pneumoniae be the most frequent causal agent. Due to the increase of the resistance of this microorganism to habitual antibiotics, modifications were made in the conventional therapeutic regimen, mainly in the pediatric meningitis. It is necessary to achieve the isolation in culture of this agent to know the most common serotypes in the country, to attain a conjugated pneumococcal vaccine, and to keep the surveillance of the strains against the antimicrobials.

  14. Genome-wide identification of Streptococcus pneumoniae genes essential for bacterial replication during experimental meningitis

    DEFF Research Database (Denmark)

    Molzen, T E; Burghout, P; Bootsma, H J

    2010-01-01

    Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... as targets for future therapy and prevention of pneumococcal meningitis, since their mutants were attenuated in both models of infection as well as in competitive growth in human cerebrospinal fluid in vitro.......Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... genes mutants of which had become attenuated or enriched, respectively, during infection. The results point to essential roles for capsular polysaccharides, nutrient uptake, and amino acid biosynthesis in bacterial replication during experimental meningitis. The GAF phenotype of a subset of identified...

  15. Polyamine transporter potABCD is required for virulence of encapsulated but not nonencapsulated Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Haley R Pipkins

    Full Text Available Streptococcus pneumoniae is commonly found in the human nasopharynx and is the causative agent of multiple diseases. Since invasive pneumococcal infections are associated with encapsulated pneumococci, the capsular polysaccharide is the target of licensed pneumococcal vaccines. However, there is an increasing distribution of non-vaccine serotypes, as well as nonencapsulated S. pneumoniae (NESp. Both encapsulated and nonencapsulated pneumococci possess the polyamine oligo-transport operon (potABCD. Previous research has shown inactivation of the pot operon in encapsulated pneumococci alters protein expression and leads to a significant reduction in pneumococcal murine colonization, but the role of the pot operon in NESp is unknown. Here, we demonstrate deletion of potD from the NESp NCC1 strain MNZ67 does impact expression of the key proteins pneumolysin and PspK, but it does not inhibit murine colonization. Additionally, we show the absence of potD significantly increases biofilm production, both in vitro and in vivo. In a chinchilla model of otitis media (OM, the absence of potD does not significantly affect MNZ67 virulence, but it does significantly reduce the pathogenesis of the virulent encapsulated strain TIGR4 (serotype 4. Deletion of potD also significantly reduced persistence of TIGR4 in the lungs but increased persistence of PIP01 in the lungs. We conclude the pot operon is important for the regulation of protein expression and biofilm formation in both encapsulated and NCC1 nonencapsulated Streptococcus pneumoniae. However, in contrast to encapsulated pneumococcal strains, polyamine acquisition via the pot operon is not required for MNZ67 murine colonization, persistence in the lungs, or full virulence in a model of OM. Therefore, NESp virulence regulation needs to be further established to identify potential NESp therapeutic targets.

  16. Streptococcus pneumoniae from Palestinian nasopharyngeal carriers: serotype distribution and antimicrobial resistance.

    Directory of Open Access Journals (Sweden)

    Abedelmajeed Nasereddin

    Full Text Available Infections of Streptococcus pneumoniae in children can be prevented by vaccination; left untreated, they cause high morbidity and fatalities. This study aimed at determining the nasopharyngeal carrier rates, serotype distribution and antimicrobial resistance patterns of S. pneumoniae in healthy Palestinian children under age two prior to the full introduction of the pneumococcal 7-valent conjugate vaccine (PCV7, which was originally introduced into Palestine in a pilot trial in September, 2010. In a cross sectional study, nasopharyngeal specimens were collected from 397 healthy children from different Palestinian districts between the beginning of November 2012 to the end of January 2013. Samples were inoculated into blood agar and suspected colonies were examined by amplifying the pneumococcal-specific autolysin gene using a real-time PCR. Serotypes were identified by a PCR that incorporated different sets of specific primers. Antimicrobial susceptibility was measured by disk diffusion and MIC methods. The resulting carrier rate of Streptococcus pneumoniae was 55.7% (221/397. The main serotypes were PCV7 serotypes 19F (12.2%, 23F (9.0%, 6B (8.6% and 14 (4% and PCV13 serotypes 6A (13.6% and 19A (4.1%. Notably, serotype 6A, not included in the pilot trial (PCV7 vaccine, was the most prevalent. Resistance to more than two drugs was observed for bacteria from 34.1% of the children (72/211 while 22.3% (47/211 carried bacteria were susceptible to all tested antibiotics. All the isolates were sensitive to cefotaxime and vancomycin. Any or all of these might impinge on the type and efficacy of the pneumococcal conjugate vaccines and antibiotics to be used for prevention and treatment of pneumococcal disease in the country.

  17. Familias de la proteína de superficie PspA de Streptococcus pneumoniae: Relación con serotipos y localización Pneumococcal surface protein A (PspA families: Relation with serotypes and clinical site of infection

    Directory of Open Access Journals (Sweden)

    Clara Mayoral

    2010-10-01

    Full Text Available PspA, proteína de superficie de Streptococcus pneumoniae es un factor de virulencia, fuertemente inmunogénica y común a todos los serotipos. Aunque el gen que codifica para esta proteína presenta una marcada heterogeneidad en la región correspondiente al N-terminal, la PspA contiene epitopes conservados de manera tal que la inmunización genera protección contra neumococos pertenecientes a diversos tipos capsulares y con distintas PspA. A pesar del marcado polimorfismo del gen pspA es posible agrupar las distintas variantes en 3 familias mayoritarias. Estas propiedades las convierten en candidatas ideales para elaborar vacunas. Debido a que la mayoría de los trabajos sobre identificación de familias fueron realizados sobre serotipos frecuentes en otros países, el objetivo fue identificar las familias de PspA de aislamientos de pacientes de nuestra región y relacionarlas con los serotipos prevalentes y patologías. Se estudiaron 70 aislamientos, provenientes de niños con infecciones invasoras. Se aplicó una PCR utilizando cebadores específicos de cada familia. El 60% fueron familia 1 y 34% familia 2. En un 6% no se identificó ninguna de las familias de PspA. Los serotipos 1 y 5 presentaron familia 1 únicamente; los serotipos 14, 6B, 19F y 18C mostraron genes de ambas familias. La familia 1 se observó en 60% de las neumonías y 50% de las meningitis. La familia 2 en 33% de neumonías y 50% de meningitis. Esta información podría ser un valioso aporte para la formulación de una vacuna regional efectiva utilizando PspA recombinante como inmunógeno.PspA, a pneumococcal surface protein, is highly immunogenic and common to all serotypes. Although pspA gene shows a great heterogeneity at the N-terminal region, PspA protein has conserved epytopes which are able to elicit protective cross-reaction against various serotypes presenting different PspA. In spite of the high polimorfism of the PspA, three majority families can be identified

  18. Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

    Science.gov (United States)

    Moore, Catrin E; Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P J; Parry, Christopher M

    2016-01-01

    The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9-6.2). The case fatality was 15.6% (95% CI 8-23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

  19. Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

    Directory of Open Access Journals (Sweden)

    Catrin E Moore

    Full Text Available The 13-valent pneumococcal vaccine (PCV13 was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD. Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation.All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing.There were 90 Cambodian children hospitalized with IPD with a median (IQR age of 2.3 years (0.9-6.2. The case fatality was 15.6% (95% CI 8-23. Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%, 23F (8/50; 16%, 14 (6/50; 12%, 5 (5/50; 10% and 19A (3/50; 6%. Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing.This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

  20. Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 – 2012

    Science.gov (United States)

    Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P. J.; Parry, Christopher M.

    2016-01-01

    Background The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. Methods All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. Results There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9–6.2). The case fatality was 15.6% (95% CI 8–23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. Conclusions This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel

  1. Antimicrobial Susceptibility/Resistance of Streptococcus Pneumoniae

    Science.gov (United States)

    Karcic, Emina; Aljicevic, Mufida; Bektas, Sabaheta; Karcic, Bekir

    2015-01-01

    Introduction: Pneumococcal infections are a major cause of morbidity and mortality worldwide, whose treatment is threatened with an increase in the number of strains resistant to antibiotic therapy. Goal: The main goal of this research was to investigate the presence of antimicrobial susceptibility/resistance of S. pneumoniae. Material and methods: Taken are swabs of the nose and nasopharynx, eye and ear. In vitro tests that were made in order to study the antimicrobial resistance of pneumococci are: disk diffusion method and E-test. Results: The resistance to inhibitors of cell wall synthesis was recorded at 39.17%, protein synthesis inhibitors 19.67%, folate antagonists 47.78% and quinolone in 1.11%. S. pneumoniae has shown drug resistance to erythromycin in 45%, clindamycin in 45%, chloramphenicol–0.56%, rifampicin–6.11%, tetracycline–4.67%, penicillin-G in 4.44%, oxacillin in 73.89%, ciprofloxacin in 1.11% and trimethoprim-sulfamethoxazole in 5.34% of cases. Conclusion: The highest resistance pneumococcus showed to erythromycin, clindamycin and trimethoprim-sulfamethoxazole and these should be avoided in the treatment. The least resistance pneumococcus showed to tetracycline, rifampicin, chloramphenicol, penicillin-G and ciprofloxacin. PMID:26236165

  2. S-carboxymethylcysteine inhibits adherence of Streptococcus pneumoniae to human alveolar epithelial cells.

    Science.gov (United States)

    Sumitomo, Tomoko; Nakata, Masanobu; Yamaguchi, Masaya; Terao, Yutaka; Kawabata, Shigetada

    2012-01-01

    Streptococcus pneumoniae is a major pathogen of respiratory infections that utilizes platelet-activating factor receptor (PAFR) for firm adherence to host cells. The mucolytic agent S-carboxymethylcysteine (S-CMC) has been shown to exert inhibitory effects against infection by several respiratory pathogens including S. pneumoniae in vitro and in vivo. Moreover, clinical studies have implicated the benefits of S-CMC in preventing exacerbation of chronic obstructive pulmonary disease, which is considered to be related to respiratory infections. In this study, to assess whether the potency of S-CMC is attributable to inhibition of pneumococcal adherence to host cells, an alveolar epithelial cell line stimulated with interleukin-1α was used as a model of inflamed epithelial cells. Despite upregulation of PAFR by inflammatory activation, treatment with S-CMC efficiently inhibited pneumococcal adherence to host epithelial cells. In order to gain insight into the inhibitory mechanism, the effects of S-CMC on PAFR expression were also investigated. Following treatment with S-CMC, PAFR expression was reduced at both mRNA and post-transcriptional levels. Interestingly, S-CMC was also effective in inhibiting pneumococcal adherence to cells transfected with PAFR small interfering RNAs. These results indicate S-CMC as a probable inhibitor targeting numerous epithelial receptors that interact with S. pneumoniae.

  3. Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction

    OpenAIRE

    Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E.; Lau, Gee W.

    2015-01-01

    The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 “late” competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically...

  4. Penicillin resistance and serotype distribution of Streptococcus pneumoniae in Ghanaian children less than six years of age

    DEFF Research Database (Denmark)

    Dayie, Nicholas T. K. D.; Arhin, Reuben E.; Newman, Mercy J.

    2013-01-01

    Background: The objective of this study was to determine the prevalence of nasopharyngeal carriage, serotype distribution, and penicillin resistance of Streptococcus pneumoniae in children 2 mu g/ml and were classified as fully penicillin resistant with 45% of the isolates having intermediate...... serotypes detected. The two penicillin resistant isolates (MIC 32 mu g/ml) were serotypes included in both PCV-13 and PPV-23. A nationwide monitoring system of penicillin susceptibility patterns and pneumococcal serotypes is recommended....

  5. Changed Expression of Cytoskeleton Proteins During Lung Injury in a Mouse Model of Streptococcus pneumoniae Infection

    Directory of Open Access Journals (Sweden)

    Mario Ferrer-Navarro

    2018-05-01

    Full Text Available Infections by Streptococcus pneumoniae are a major cause of morbidity and mortality worldwide, often causing community-acquired pneumonia, otitis media and also bacteremia and meningitis. Studies on S. pneumoniae are mainly focused on its virulence or capacity to evade the host immune system, but little is known about the injury caused in lungs during a pneumococcal infection. Herein we investigated this issue comparing the proteome profile of lungs from S. pneumoniae-infected mice with control mice by means of difference gel electrophoresis (DIGE technology. In order to obtain reliable results three biological replicas were used, and four technical replicas were carried out in each biological replica. Proteomic comparison was performed at two time points: 24 and 48 h post infection. A total of 91 proteins were identified with different abundance. We found important changes in the protein profiles during pneumococcal infection mainly associated with regulation of vesicle-mediated transport, wound healing, and cytoskeleton organization. In conclusion, the results obtained show that the cytoskeleton of the host cell is modified in S. pneumoniae infection.

  6. Multiple colonization with S. pneumoniae before and after introduction of the seven-valent conjugated pneumococcal polysaccharide vaccine.

    Directory of Open Access Journals (Sweden)

    Silvio D Brugger

    2010-07-01

    Full Text Available Simultaneous carriage of more than one strain of Streptococcus pneumoniae promotes horizontal gene transfer events and may lead to capsule switch and acquisition of antibiotic resistance. We studied the epidemiology of cocolonization with S. pneumoniae before and after introduction of the seven-valent conjugated pneumococcal vaccine (PCV7.Nasopharyngeal swabs (n 1120 were collected from outpatients between 2004 and 2009 within an ongoing nationwide surveillance program. Cocolonization was detected directly from swabs by restriction fragment length polymorphism (RFLP analysis. Serotypes were identified by agglutination, multiplex PCR and microarray.Rate of multiple colonization remained stable up to three years after PCV7 introduction. Cocolonization was associated with serotypes of low carriage prevalence in the prevaccine era. Pneumococcal colonization density was higher in cocolonized samples and cocolonizing strains were present in a balanced ratio (median 1.38. Other characteristics of cocolonization were a higher frequency at young age, but no association with recurrent acute otitis media, recent antibiotic exposure, day care usage and PCV7 vaccination status.Pneumococcal cocolonization is dominated by serotypes of low carriage prevalence in the prevaccine era, which coexist in the nasopharynx. Emergence of such previously rare serotypes under vaccine selection pressure may promote cocolonization in the future.

  7. Is 13-Valent Pneumococcal Conjugate Vaccine (PCV13 Combined With 23-Valent Pneumococcal Polysaccharide Vaccine (PPSV23 Superior to PPSV23 Alone for Reducing Incidence or Severity of Pneumonia in Older Adults? A Clin-IQ

    Directory of Open Access Journals (Sweden)

    Starla Hayward

    2016-04-01

    Full Text Available Pneumonia infection is a significant cause of morbidity and mortality worldwide. In addition to the public health concerns, pneumonia also accounts for a significant cost to the health care system. Currently there are two leading vaccines targeted against Streptococcus pneumoniae: 23-valent pneumococcal polysaccharide vaccine (PPSV23 and 13-valent pneumococcal conjugate vaccine (PCV13. Until recently, the recommendation for adult pneumonia vaccination has been a single dose of PPSV23 for all adults aged 65 years or older. However, concerns were raised regarding the vaccine’s efficacy due to the persistent burden of pneumococcal disease in the elderly population. This paper focuses on two trials that evaluated the safety and efficacy of PCV13 in the adult population. The first study reveals improved immune response with the addition of PCV13 to PPSV23, while the second shows PCV13 was effective in the prevention of vaccine-type community-acquired pneumonia. Both studies observed adequate safety profiles for PCV13 in series with PPSV23 and with PCV13 compared to placebo.

  8. Prevalence and serotype distribution of nasopharyngeal carriage of Streptococcus pneumoniae in China: a meta-analysis.

    Science.gov (United States)

    Wang, Lin; Fu, Jinjian; Liang, Zhuoxin; Chen, Jichang

    2017-12-13

    To explore the overall prevalence and serotype distribution of nasopharyngeal carriage of Streptococcus pneumoniae(S. pneumoniae) among healthy children. A search for pneumococcal nasopharyngeal carriage studies including children published up to July 31th, 2016 was conducted to describe carriage in China. The review also describes antibiotic resistance in and serotypes of S. pneumoniae and assesses the impact of vaccination on carriage in this region. Summary measures for overall prevalence, antibiotic resistance, and serotype distributions extracted from the analyzed data were determined with 95% confidence intervals (CIs) using random-effects models. Heterogeneity was assessed using I 2 test statistics. Thirty-seven studies were included in this review, and the majority of studies (64.9%) were located in the pre-introduction period of 7-valent pneumococcal conjugate vaccine (PCV7) in China. The pooled prevalence of S. pneumoniae nasopharyngeal carriage was 21.4% (95% CI: 18.3-24.4%). Carriage was highest in children attending kindergartens [24.5%, (19.7-29.3%)] and decreased with increasing age. Before the introduction of PCV7 into China, the prevalence of S. pneumoniae nasopharyngeal carriage was 25.8% (20.7-30.9%), the pooled carriage of S. pneumoniae sharply dropped into the 14.1% (11.3-16.9%) by PCV7 vaccination period (P China, the penicillin resistance rate in S. pneumoniae isolated from healthy children was 31.9% (21.2-42.6%); however, this rate sharply decreased after the introduction of PCV7 in China [21.6%, (7.4-35.9%)], and the difference between the rates during these two time periods was statistically significant (P value China. PCV7 immunization was found to be associated with reduction of nasopharyngeal colonization of S. pneumoniae. Conjugate vaccination coverage was slightly affected by the introduction of PCV7 into China because of low vaccination rate. The government should implement timely adjusted conjugate vaccination strategies based on

  9. Three Decades of Follow-up of Adults After Recovery From Invasive Pneumococcal Pneumonia.

    Science.gov (United States)

    Ajayi, Oluwadamilare O; Norton, Nancy B; Gress, Todd W; Stanek, Ronald J; Mufson, Maurice A

    2017-05-01

    Streptococcus pneumoniae infection is the most common cause of community-acquired pneumonia in adults. Invasive pneumococcal disease (IPD) carries a high case fatality rate. We investigated the lifespan of adults who recovered from IPD during a 32-year follow-up. We determined whether adults discharged after an episode of IPD from hospitals affiliated with the Marshall University Joan C. Edwards School of Medicine in Huntington, West Virginia from 1983-2003 were alive on June 30, 2014. Lifespan was assessed by Kaplan-Meier methodology, Cox proportional hazards multivariate analysis, life expectancy using life tables for West Virginia, years of potential life lost and serotype occurrence. The study group comprised 155 adults who survived IPD. They had a mean age at discharge of 64.6 years, mean lifespan after IPD of 7.1 years, mean expected lifespan after IPD of 17.0 years, mean age at death of 71.6 years and a mean life expectancy of 81.6 years. Only 14 (9.0%) patients lived longer than their life expectancy. Of the 13 comorbid diseases analyzed, cancer and neurologic diseases and the number of comorbid diseases suffered by each patient were the significant variables associated with survival. The mean years of potential life lost was 9.936 years. Only serotype 12 of 31 serotypes recovered occurred more often in patients who survived for 11 or more years after discharge (relative risk = 3.44, 95% CI: 1.19-9.95). The fact that most adult patients who recovered from IPD died before their documented life expectancy argues for the pernicious severity of IPD and the importance of immunization of adults with pneumococcal vaccines. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

  10. Acute suppurative parotitis caused by Streptococcus pneumoniae in an HIV-infected man.

    Science.gov (United States)

    Guzman Vinasco, Luis; Bares, Sara; Sandkovsky, Uriel

    2015-03-02

    We report a case of a 32-year-old man who presented with progressive unilateral parotid gland enlargement and subsequently tested positive for HIV. A CT scan of the neck performed with contrast showed a phlegmon in the region of the right parotid tail measuring approximately 2.5×2.4 cm. Cultures of the aspirated fluid grew Streptococcus pneumoniae and the S. pneumoniae urinary antigen test was also positive. The patient underwent surgical debridement and received antimicrobial therapy with complete resolution of the parotitis. Parotitis caused by S. pneumoniae is rare, and HIV infection should be suspected in any case of invasive pneumococcal disease. 2015 BMJ Publishing Group Ltd.

  11. Estimating the burden of pneumococcal pneumonia among adults: a systematic review and meta-analysis of diagnostic techniques.

    Directory of Open Access Journals (Sweden)

    Maria A Said

    Full Text Available Pneumococcal pneumonia causes significant morbidity and mortality among adults. Given limitations of diagnostic tests for non-bacteremic pneumococcal pneumonia, most studies report the incidence of bacteremic or invasive pneumococcal disease (IPD, and thus, grossly underestimate the pneumococcal pneumonia burden. We aimed to develop a conceptual and quantitative strategy to estimate the non-bacteremic disease burden among adults with community-acquired pneumonia (CAP using systematic study methods and the availability of a urine antigen assay.We performed a systematic literature review of studies providing information on the relative yield of various diagnostic assays (BinaxNOW® S. pneumoniae urine antigen test (UAT with blood and/or sputum culture in diagnosing pneumococcal pneumonia. We estimated the proportion of pneumococcal pneumonia that is bacteremic, the proportion of CAP attributable to pneumococcus, and the additional contribution of the Binax UAT beyond conventional diagnostic techniques, using random effects meta-analytic methods and bootstrapping. We included 35 studies in the analysis, predominantly from developed countries. The estimated proportion of pneumococcal pneumonia that is bacteremic was 24.8% (95% CI: 21.3%, 28.9%. The estimated proportion of CAP attributable to pneumococcus was 27.3% (95% CI: 23.9%, 31.1%. The Binax UAT diagnosed an additional 11.4% (95% CI: 9.6, 13.6% of CAP beyond conventional techniques. We were limited by the fact that not all patients underwent all diagnostic tests and by the sensitivity and specificity of the diagnostic tests themselves. We address these resulting biases and provide a range of plausible values in order to estimate the burden of pneumococcal pneumonia among adults.Estimating the adult burden of pneumococcal disease from bacteremic pneumococcal pneumonia data alone significantly underestimates the true burden of disease in adults. For every case of bacteremic pneumococcal pneumonia

  12. Novel role for the Streptococcus pneumoniae toxin pneumolysin in the assembly of biofilms.

    Science.gov (United States)

    Shak, Joshua R; Ludewick, Herbert P; Howery, Kristen E; Sakai, Fuminori; Yi, Hong; Harvey, Richard M; Paton, James C; Klugman, Keith P; Vidal, Jorge E

    2013-09-10

    Streptococcus pneumoniae is an important commensal and pathogen responsible for almost a million deaths annually in children under five. The formation of biofilms by S. pneumoniae is important in nasopharyngeal colonization, pneumonia, and otitis media. Pneumolysin (Ply) is a toxin that contributes significantly to the virulence of S. pneumoniae and is an important candidate as a serotype-independent vaccine target. Having previously demonstrated that a luxS knockout mutant was unable to form early biofilms and expressed less ply mRNA than the wild type, we conducted a study to investigate the role of Ply in biofilm formation. We found that Ply was expressed in early phases of biofilm development and localized to cellular aggregates as early as 4 h postinoculation. S. pneumoniae ply knockout mutants in D39 and TIGR4 backgrounds produced significantly less biofilm biomass than wild-type strains at early time points, both on polystyrene and on human respiratory epithelial cells, cultured under static or continuous-flow conditions. Ply's role in biofilm formation appears to be independent of its hemolytic activity, as S. pneumoniae serotype 1 strains, which produce a nonhemolytic variant of Ply, were still able to form biofilms. Transmission electron microscopy of biofilms grown on A549 lung cells using immunogold demonstrated that Ply was located both on the surfaces of pneumococcal cells and in the extracellular biofilm matrix. Altogether, our studies demonstrate a novel role for pneumolysin in the assembly of S. pneumoniae biofilms that is likely important during both carriage and disease and therefore significant for pneumolysin-targeting vaccines under development. The bacterium Streptococcus pneumoniae (commonly known as the pneumococcus) is commonly carried in the human nasopharynx and can spread to other body sites to cause disease. In the nasopharynx, middle ear, and lungs, the pneumococcus forms multicellular surface-associated structures called biofilms

  13. Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Natalie Maricic

    2016-01-01

    Full Text Available Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials.

  14. Validation of an immunodiagnostic assay for detection of 13 Streptococcus pneumoniae serotype-specific polysaccharides in human urine.

    Science.gov (United States)

    Pride, Michael W; Huijts, Susanne M; Wu, Kangjian; Souza, Victor; Passador, Sherry; Tinder, Chunyan; Song, Esther; Elfassy, Arik; McNeil, Lisa; Menton, Ronald; French, Roger; Callahan, Janice; Webber, Chris; Gruber, William C; Bonten, Marc J M; Jansen, Kathrin U

    2012-08-01

    To improve the clinical diagnosis of pneumococcal infection in bacteremic and nonbacteremic community-acquired pneumonia (CAP), a Luminex technology-based multiplex urinary antigen detection (UAD) diagnostic assay was developed and validated. The UAD assay can simultaneously detect 13 different serotypes of Streptococcus pneumoniae by capturing serotype-specific S. pneumoniae polysaccharides (PnPSs) secreted in human urine. Assay specificity is achieved by capturing the polysaccharides with serotype-specific monoclonal antibodies (MAbs) on spectrally unique microspheres. Positivity for each serotype was based on positivity cutoff values calculated from a standard curve run on each assay plate together with positive- and negative-control urine samples. The assay is highly specific, since significant signals are detected only when each PnPS was paired with its homologous MAb-coated microspheres. Validation experiments demonstrated excellent accuracy and precision. The UAD assay and corresponding positivity cutoff values were clinically validated by assessing 776 urine specimens obtained from patients with X-ray-confirmed CAP. The UAD assay demonstrated 97% sensitivity and 100% specificity using samples obtained from patients with bacteremic, blood culture-positive CAP. Importantly, the UAD assay identified Streptococcus pneumoniae (13 serotypes) in a proportion of individuals with nonbacteremic CAP, a patient population for which the pneumococcal etiology of CAP was previously difficult to assess. Therefore, the UAD assay provides a specific, noninvasive, sensitive, and reproducible tool to support vaccine efficacy as well as epidemiological evaluation of pneumococcal disease, including CAP, in adults.

  15. Aspirin-triggered resolvin D1 reduces pneumococcal lung infection and inflammation in a viral and bacterial coinfection pneumonia model.

    Science.gov (United States)

    Wang, Hao; Anthony, Desiree; Yatmaz, Selcuk; Wijburg, Odilia; Satzke, Catherine; Levy, Bruce; Vlahos, Ross; Bozinovski, Steven

    2017-09-15

    Formyl peptide receptor 2/lipoxin A 4 (LXA 4 ) receptor (Fpr2/ALX) co-ordinates the transition from inflammation to resolution during acute infection by binding to distinct ligands including serum amyloid A (SAA) and Resolvin D1 (RvD1). Here, we evaluated the proresolving actions of aspirin-triggered RvD1 (AT-RvD1) in an acute coinfection pneumonia model. Coinfection with Streptococcus pneumoniae and influenza A virus (IAV) markedly increased pneumococcal lung load and neutrophilic inflammation during the resolution phase. Fpr2/ALX transcript levels were increased in the lungs of coinfected mice, and immunohistochemistry identified prominent Fpr2/ALX immunoreactivity in bronchial epithelial cells and macrophages. Levels of circulating and lung SAA were also highly increased in coinfected mice. Therapeutic treatment with exogenous AT-RvD1 during the acute phase of infection (day 4-6 post-pneumococcal inoculation) significantly reduced the pneumococcal load. AT-RvD1 also significantly reduced neutrophil elastase (NE) activity and restored total antimicrobial activity in bronchoalveolar lavage (BAL) fluid (BALF) of coinfected mice. Pneumonia severity, as measured by quantitating parenchymal inflammation or alveolitis was significantly reduced with AT-RvD1 treatment, which also reduced the number of infiltrating lung neutrophils and monocytes/macrophages as assessed by flow cytometry. The reduction in distal lung inflammation in AT-RvD1-treated mice was not associated with a significant reduction in inflammatory and chemokine mediators. In summary, we demonstrate that in the coinfection setting, SAA levels were persistently increased and exogenous AT-RvD1 facilitated more rapid clearance of pneumococci in the lungs, while concurrently reducing the severity of pneumonia by limiting excessive leukocyte chemotaxis from the infected bronchioles to distal areas of the lungs. © 2017 The Author(s).

  16. The cGAS/STING Pathway Detects Streptococcus pneumoniae but Appears Dispensable for Antipneumococcal Defense in Mice and Humans.

    Science.gov (United States)

    Ruiz-Moreno, Juan Sebastian; Hamann, Lutz; Jin, Lei; Sander, Leif E; Puzianowska-Kuznicka, Monika; Cambier, John; Witzenrath, Martin; Schumann, Ralf R; Suttorp, Norbert; Opitz, Bastian

    2018-03-01

    Streptococcus pneumoniae is a frequent colonizer of the upper respiratory tract and a leading cause of bacterial pneumonia. The innate immune system senses pneumococcal cell wall components, toxin, and nucleic acids, which leads to production of inflammatory mediators to initiate and control antibacterial defense. Here, we show that the cGAS (cyclic GMP-AMP [cGAMP] synthase)-STING pathway mediates detection of pneumococcal DNA in mouse macrophages to primarily stimulate type I interferon (IFN) responses. Cells of human individuals carrying HAQ TMEM173 , which encodes a common hypomorphic variant of STING, were largely or partly defective in inducing type I IFNs and proinflammatory cytokines upon infection. Subsequent analyses, however, revealed that STING was dispensable for restricting S. pneumoniae during acute pneumonia in mice. Moreover, explorative analyses did not find differences in the allele frequency of HAQ TMEM173 in nonvaccinated pneumococcal pneumonia patients and healthy controls or an association of HAQ TMEM173 carriage with disease severity. Together, our results indicate that the cGAS/STING pathway senses S. pneumoniae but plays no major role in antipneumococcal immunity in mice and humans. Copyright © 2018 American Society for Microbiology.

  17. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Margarida Carrolo

    Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.

  18. Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae.

    Science.gov (United States)

    Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven

    2014-02-07

    Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires powerful tools. In this study, two different methods, an optimized biotinylation approach and shaving with trypsin beads, were applied to study the pneumococcal surface proteome and to identify surface-exposed protein domains, respectively. The identification of nearly 95% of the predicted lipoproteins and 75% of the predicted sortase substrates reflects the high coverage of the two classical surface protein classes accomplished in this study. Furthermore, the biotinylation approach was applied to study the impact of an impaired lipoprotein maturation pathway on the cell envelope proteome and exoproteome. Loss of the lipoprotein diacylglyceryl transferase Lgt leads to striking changes in the lipoprotein distribution. Many lipoproteins disappear from the surface proteome and accumulate in the exoproteome. Further insights into lipoprotein processing in pneumococci are provided by immunoblot analyses of bacterial lysates and corresponding supernatant fractions. Taken together, the first comprehensive overview of the pneumococcal surface and exoproteome is presented, and a model for lipoprotein processing in S. pneumoniae is proposed.

  19. Case Report of Necrotizing Fasciitis Associated with Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Lei Jiao

    2016-01-01

    Full Text Available Necrotizing fasciitis, caused by Streptococcus pneumoniae, is an extremely rare and life-threatening bacterial soft tissue infection. We report a case of early necrotizing fasciitis associated with Streptococcus pneumoniae infection in a 26-year-old man who was immunocompromised with mixed connective tissue disease. The patient presented with acute, painful, erythematous, and edematous skin lesions of his right lower back, which rapidly progressed to the right knee. The patient underwent surgical exploration, and a diagnosis of necrotizing fasciitis was confirmed by pathological evidence of necrosis of the fascia and neutrophil infiltration in tissue biopsies. Cultures of fascial tissue biopsies and blood samples were positive for Streptococcus pneumoniae. To our knowledge, this is the first report of necrotizing fasciitis resulting from Streptococcus pneumoniae diagnosed at early phase; the patient recovered well without surgical debridement.

  20. Streptococcus pneumoniae-induced ototoxicity in organ of Corti explant cultures.

    Science.gov (United States)

    Perny, Michael; Solyga, Magdalena; Grandgirard, Denis; Roccio, Marta; Leib, Stephen L; Senn, Pascal

    2017-07-01

    Hearing loss remains the most common long-term complication of pneumococcal meningitis (PM) reported in up to 30% of survivors. Streptococcus pneumoniae have been shown to possess different ototoxic properties. Here we present a novel ex vivo experimental setup to examine in detail the pattern of hair cell loss upon exposure to different S. pneumoniae strains, therefore recapitulating pathogen derived aspects of PM-induced hearing loss. Our results show a higher susceptibility towards S. pneumoniae-induced cochlear damage for outer hair cells (OHC) compared to inner hair cells (IHC), which is consistent with in vivo data. S. pneumoniae-induced hair cell loss was both time and dose-dependent. Moreover, we have found significant differences in the level of cell damage between tissue from the basal and the apical turns. This shows that the higher vulnerability of hair cells located at high frequency regions observed in vivo cannot be explained solely by the spatial organisation and bacterial infiltration from the basal portion of the cochlea. Using a wild type D39 strain and a mutant defective for the pneumolysin (PLY) gene, we also have shown that the toxin PLY is an important factor involved in ototoxic damages. The obtained results indicate that PLY can cause both IHC and OHC loss. Finally, we are reporting here for the first time a higher vulnerability of HC located at the basal and middle cochlear region to pneumolysin-induced damage. The detailed description of the susceptibility of hair cells to Streptococcus pneumoniae provided in this report can in the future determine the choice and the development of novel otoprotective therapies during pneumococcal meningitis. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited

    DEFF Research Database (Denmark)

    Martens, Pernille; Worm, Signe Westring; Lundgren, Bettina

    2004-01-01

    Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited.Martens P, Worm SW, Lundgren B, Konradsen HB, Benfield T. Department of Infectious Diseases 144, Hvidovre University Hospital, DK-2650 Hvidovre, Denmark. pernillemartens@yahoo.com BACKGROUND: Invasive infection...... with Streptococcus pneumoniae (pneumococci) causes significant morbidity and mortality. Case series and experimental data have shown that the capsular serotype is involved in the pathogenesis and a determinant of disease outcome. METHODS: Retrospective review of 464 cases of invasive disease among adults diagnosed...

  2. Time-resolved dual RNA-seq reveals extensive rewiring of lung epithelial and pneumococcal transcriptomes during early infection

    NARCIS (Netherlands)

    Aprianto, Rieza; Slager, Jelle; Holsappel, Siger; Veening, Jan-Willem

    2016-01-01

    BACKGROUND: Streptococcus pneumoniae, the pneumococcus, is the main etiological agent of pneumonia. Pneumococcal infection is initiated by bacterial adherence to lung epithelial cells. The exact transcriptional changes occurring in both host and microbe during infection are unknown. Here, we

  3. Quorum Sensing Regulation of Competence and Bacteriocins in Streptococcus pneumoniae and mutans

    Science.gov (United States)

    Shanker, Erin; Federle, Michael J.

    2017-01-01

    The human pathogens Streptococcus pneumoniae and Streptococcus mutans have both evolved complex quorum sensing (QS) systems that regulate the production of bacteriocins and the entry into the competent state, a requirement for natural transformation. Natural transformation provides bacteria with a mechanism to repair damaged genes or as a source of new advantageous traits. In S. pneumoniae, the competence pathway is controlled by the two-component signal transduction pathway ComCDE, which directly regulates SigX, the alternative sigma factor required for the initiation into competence. Over the past two decades, effectors of cellular killing (i.e., fratricides) have been recognized as important targets of the pneumococcal competence QS pathway. Recently, direct interactions between the ComCDE and the paralogous BlpRH pathway, regulating bacteriocin production, were identified, further strengthening the interconnections between these two QS systems. Interestingly, a similar theme is being revealed in S. mutans, the primary etiological agent of dental caries. This review compares the relationship between the bacteriocin and the competence QS pathways in both S. pneumoniae and S. mutans, and hopes to provide clues to regulatory pathways across the genus Streptococcus as a potential tool to efficiently investigate putative competence pathways in nontransformable streptococci. PMID:28067778

  4. Outcome of meningitis caused by Streptococcus pneumoniae and Haemophilus influenzae type b in children in The Gambia.

    Science.gov (United States)

    Goetghebuer, T; West, T E; Wermenbol, V; Cadbury, A L; Milligan, P; Lloyd-Evans, N; Adegbola, R A; Mulholland, E K; Greenwood, B M; Weber, M W

    2000-03-01

    In developing countries, endemic childhood meningitis is a severe disease caused most commonly by Streptococcus pneumoniae or Haemophilus influenzae type b (Hib). Although many studies have shown that fatality rates associated with meningitis caused by these organisms are high in developing countries, little is known about the long-term outcome of survivors. The purpose of this study was to assess the importance of disabilities following pneumococcal and Hib meningitis in The Gambia. 257 children aged 0-12 years hospitalized between 1990 and 1995 with culture-proven S. pneumoniae (n = 134) or Hib (n = 123) meningitis were included retrospectively in the study. 48% of children with pneumococcal meningitis and 27% of children with Hib meningitis died whilst in hospital. Of the 160 survivors, 89 (55%) were followed up between September 1996 and October 1997. Of the children with pneumococcal meningitis that were traced, 58% had clinical sequelae; half of them had major disabilities preventing normal adaptation to social life. 38% of survivors of Hib meningitis had clinical sequelae, a quarter of whom had major disabilities. Major handicaps found were hearing loss, mental retardation, motor abnormalities and seizures. These data show that despite treatment with effective antibiotics, pneumococcal and Hib meningitis kill many Gambian children and leave many survivors with severe sequelae. Hib vaccination is now given routinely in The Gambia; an effective pneumococcal vaccine is needed.

  5. Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Feroze Ahmed Ganaie

    2015-01-01

    Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

  6. Host-pathogen interaction during Streptococcus pneumoniae colonization and infection

    NARCIS (Netherlands)

    D. Bogaert (Debby)

    2004-01-01

    markdownabstract__Abstract__ Streptococcus pneumoniae was discovered by Sternberg and Pasteur in 1880. It took another six years to discover that this microorganism, called the pneumococcus, was the actual cause of bacterial pneumonia . Subsequently, this bacterium has been shown to provoke an

  7. Evolution of Streptococcus pneumoniae and its close commensal relatives

    DEFF Research Database (Denmark)

    Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise

    2008-01-01

    Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...

  8. Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

    Science.gov (United States)

    Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

    2003-01-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom had no other laboratory evidence of S. pneumoniae infection). Buffy coat samples from two control patients (neither having evidence of S. pneumoniae infection), but no control plasma samples, were PCR positive. Although pneumococcal antigen was detected in the urine from 120 of 420 (29%) patients, only 4 of 227 (2%) urine samples tested were PCR positive. Overall, 256 of 318 (81%) patients had PCR-positive sputum samples, including 58 of 59 samples from which S. pneumoniae was cultured. Throat swab samples from 229 of 417 (55%) patients were PCR positive and, in those who produced sputum, 96% also had positive PCR results from sputum. Throat swabs from 73 of 126 (58%) control patients were also PCR positive. We conclude that the pneumolysin PCR assay adds little to existing diagnostic tests for S. pneumoniae and is unable to distinguish colonization from infection when respiratory samples are tested. PMID:12517826

  9. Identification of PblB mediating galactose-specific adhesion in a successful Streptococcus pneumoniae clone.

    Science.gov (United States)

    Hsieh, Yu-Chia; Lin, Tzu-Lung; Lin, Che-Ming; Wang, Jin-Town

    2015-07-21

    The pneumococcal genome is variable and there are minimal data on the influence of the accessory genome on phenotype. Pneumococcal serotype 14 sequence type (ST) 46 had been the most prevalent clone causing pneumonia in children in Taiwan. A microarray was constructed using the genomic DNA of a clinical strain (NTUH-P15) of serotype 14 ST46. Using DNA hybridization, genomic variations in NTUH-P15 were compared to those of 3 control strains. Microarray analysis identified 7 genomic regions that had significant increases in hybridization signals in the NTUH-P15 strain compared to control strains. One of these regions encoded PblB, a phage-encoded virulence factor implicated (in Streptococcus mitis) in infective endocarditis. The isogenic pblB mutant decreased adherence to A549 human lung epithelial cell compared to wild-type NTUH-P15 strain (P = 0.01). Complementation with pblB restored the adherence. PblB is predicted to contain a galactose-binding domain-like region. Preincubation of NTUH-P15 with D-galactose resulted in decreases of adherence to A549 cell in a dose-dependent manner. Challenge of mice with NTUH-P15, isogenic pblB mutant and pblB complementation strains determined that PblB was required for bacterial persistence in the nasopharynx and lung. PblB, as an adhesin mediating the galactose-specific adhesion activity of pneumococci, promote pneumococcal clonal success.

  10. Streptococcus pneumoniae sepsis as the initial presentation of systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Erdem I

    2016-09-01

    Full Text Available Ilknur Erdem,1 Senay Elbasan Omar,1 Ridvan Kara Ali,1 Hayati Gunes,2 Aynur Eren Topkaya2 1Department of Infectious Diseases, 2Department of Medical Microbiology, Faculty of Medicine, Namik Kemal University, Tekirdag, Turkey Objective: Infections are among the most important causes of morbidity and mortality in patients with systemic lupus erythematosus (SLE but are rare initial presentation of the disease. Therefore, in this study, we describe a case of Streptococcus pneumoniae sepsis in a young woman with previously undiagnosed SLE. Case report: A 23-year-old female patient was admitted to our outpatient clinic complaining of high fever (40°C, chills, fatigue, generalized myalgia, and cough with brown sputum for 5 days. Blood cultures grew gram-positive coccus defined as S. pneumoniae using standard procedures. Antinuclear antibody was positive at a titer of 1/1,000, and anti-double-stranded DNA was positive at 984 IU/mL. She was diagnosed with SLE. Her respiratory symptoms and pleural effusion were considered to be due to pulmonary manifestation of SLE. Conclusion: The underlying immunosuppression caused by SLE could have predisposed the patient to invasive pneumococcal disease. It may also occur as a primary presenting feature, although a rare condition. Keywords: Streptococcus pneumoniae, sepsis, systemic lupus erythematosus

  11. Streptococcus pneumoniae necrotizing fasciitis in systemic lupus erythematosus.

    Science.gov (United States)

    Sánchez, A; Robaina, R; Pérez, G; Cairoli, E

    2016-04-01

    Necrotizing fasciitis is a rapidly progressive destructive soft tissue infection with high mortality. Streptococcus pneumoniae as etiologic agent of necrotizing fasciitis is extremely unusual. The increased susceptibility to Streptococcus pneumoniae infection in patients with systemic lupus erythematosus is probably a multifactorial phenomenon. We report a case of a patient, a 36-year-old Caucasian female with 8-year history of systemic lupus erythematosus who presented a fatal Streptococcus pneumoniae necrotizing fasciitis. The role of computed tomography and the high performance of blood cultures for isolation of the causative microorganism are emphasized. Once diagnosis is suspected, empiric antibiotic treatment must be prescribed and prompt surgical exploration is mandatory. © The Author(s) 2015.

  12. Streptococcus pneumoniae PspC Subgroup Prevalence in Invasive Disease and Differences in Contribution to Complement Evasion.

    Science.gov (United States)

    van der Maten, Erika; van den Broek, Bryan; de Jonge, Marien I; Rensen, Kim J W; Eleveld, Marc J; Zomer, Aldert L; Cremers, Amelieke J H; Ferwerda, Gerben; de Groot, Ronald; Langereis, Jeroen D; van der Flier, Michiel

    2018-04-01

    The pneumococcal capsular serotype is an important determinant of complement resistance and invasive disease potential, but other virulence factors have also been found to contribute. Pneumococcal surface protein C (PspC), a highly variable virulence protein that binds complement factor H to evade C3 opsonization, is divided into two subgroups: choline-bound subgroup I and LPxTG-anchored subgroup II. The prevalence of different PspC subgroups in invasive pneumococcal disease (IPD) and functional differences in complement evasion are unknown. The prevalence of PspC subgroups in IPD isolates was determined in a collection of 349 sequenced strains of Streptococcus pneumoniae isolated from adult patients. pspC deletion mutants and isogenic pspC switch mutants were constructed to study differences in factor H binding and complement evasion in relation to capsule thickness. Subgroup I pspC was far more prevalent in IPD isolates than subgroup II pspC The presence of capsule was associated with a greater ability of bound factor H to reduce complement opsonization. Pneumococcal subgroup I PspC bound significantly more factor H and showed more effective complement evasion than subgroup II PspC in isogenic encapsulated pneumococci. We conclude that variation in the PspC subgroups, independent of capsule serotypes, affects pneumococcal factor H binding and its ability to evade complement deposition. Copyright © 2018 American Society for Microbiology.

  13. Impacto de Streptococcus pneumoniae en las neumonías del niño latinoamericano Impact of Streptococcus pneumoniae in pneumonias of Latin American children

    Directory of Open Access Journals (Sweden)

    María Hortal

    2000-09-01

    xico (47,0% y los menores a Colombia (12,1%. La resistencia a la penicilina se asoció con un reducido número de serotipos capsulares, fundamentalmente el 14 y el 23F, el primero resistente a la penicilina y a la trimetoprima-sulfametoxazol, y el segundo multirresistente. La frecuencia de la resistencia a la trimetoprima-sulfametoxazol fue elevada en todos los países y el valor máximo correspondió a Argentina (58,0%. La disminución de la susceptibilidad al cloranfenicol tuvo baja frecuencia, salvo en Colombia (23,4%. La resistencia a la eritromicina fue baja en todos los países y todos los aislados fueron sensibles a la vancomicina.Community-acquired pneumonia is one of the leading causes of infant morbidity and mortality. Studies conducted in developing countries indicate that the most serious symptoms of pneumonia are associated with bacterial causes, mainly Streptococcus pneumoniae, followed by Haemophilus influenzae type b. Managing those infections in children under two years of age is hindered by the lack of appropriate vaccines and by the decreased susceptibility of S. pneumoniae to penicillin and other antibiotics. In 1993, at the initiative of the Regional System for Vaccines of the Pan American Health Organization, and with funding from the Canadian International Development Agency, a study was designed to identify the S. pneumoniae capsular types that cause invasive disease in Latin American children under 5 years of age. The objective of the study was to determine the ideal composition of a conjugate vaccine that could be used in Latin America, and the penicillin susceptibility of the S. pneumoniae isolates. The initiative was undertaken in Argentina, Brazil, Chile, Colombia, Mexico, and Uruguay. This report analyzes the information that the participating countries generated on pneumococcal pneumonia. A total of 3 393 children were found with systemic S. pneumoniae infections, of which 1 578 corresponded to pneumonias. The analysis focused on 1 409 cases

  14. Mechanical ventilation drives pneumococcal pneumonia into lung injury and sepsis in mice: protection by adrenomedullin.

    Science.gov (United States)

    Müller-Redetzky, Holger C; Will, Daniel; Hellwig, Katharina; Kummer, Wolfgang; Tschernig, Thomas; Pfeil, Uwe; Paddenberg, Renate; Menger, Michael D; Kershaw, Olivia; Gruber, Achim D; Weissmann, Norbert; Hippenstiel, Stefan; Suttorp, Norbert; Witzenrath, Martin

    2014-04-14

    Ventilator-induced lung injury (VILI) contributes to morbidity and mortality in acute respiratory distress syndrome (ARDS). Particularly pre-injured lungs are susceptible to VILI despite protective ventilation. In a previous study, the endogenous peptide adrenomedullin (AM) protected murine lungs from VILI. We hypothesized that mechanical ventilation (MV) contributes to lung injury and sepsis in pneumonia, and that AM may reduce lung injury and multiple organ failure in ventilated mice with pneumococcal pneumonia. We analyzed in mice the impact of MV in established pneumonia on lung injury, inflammation, bacterial burden, hemodynamics and extrapulmonary organ injury, and assessed the therapeutic potential of AM by starting treatment at intubation. In pneumococcal pneumonia, MV increased lung permeability, and worsened lung mechanics and oxygenation failure. MV dramatically increased lung and blood cytokines but not lung leukocyte counts in pneumonia. MV induced systemic leukocytopenia and liver, gut and kidney injury in mice with pneumonia. Lung and blood bacterial burden was not affected by MV pneumonia and MV increased lung AM expression, whereas receptor activity modifying protein (RAMP) 1-3 expression was increased in pneumonia and reduced by MV. Infusion of AM protected against MV-induced lung injury (66% reduction of pulmonary permeability p protect against development of lung injury, sepsis and extrapulmonary organ injury in mechanically ventilated individuals with severe pneumonia.

  15. Characterization of Streptococcus pneumoniae isolates from Austrian companion animals and horses.

    Science.gov (United States)

    Ginders, Maximilian; Leschnik, Michael; Künzel, Frank; Kampner, Doris; Mikula, Claudia; Steindl, Georg; Eichhorn, Inga; Feßler, Andrea T; Schwarz, Stefan; Spergser, Joachim; Loncaric, Igor

    2017-11-14

    The aim of the present study was to investigate the genetic relatedness and the antimicrobial resistance profiles of a collection of Austrian Streptococcus pneumoniae isolates from companion animals and horses. A total of 12 non-repetitive isolates presumptively identified as S. pneumoniae were obtained during routinely diagnostic activities between March 2009 and January 2017. Isolates were confirmed as S. pneumoniae by bile solubility and optochin susceptibility testing, matrix-assisted laser desorption-ionization-time of flight (MALDI-TOF) mass spectrometry and sequence analysis of a part recA and the 16S rRNA genes. Isolates were further characterized by pneumolysin polymerase chain reaction (PCR) and genotyped by multilocus sequence typing (MLST). Antimicrobial susceptibility testing was performed and resistance genes were detected by specific PCR assays. All isolates were serotyped. Four sequence types (ST) (ST36, ST3546, ST6934 and ST6937) and four serotypes (3, 19A, 19F and 23F) were detected. Two isolates from twelve displayed a multidrug-resistance pheno- and genotype. This study represents the first comprehensive investigation on characteristics of S. pneumoniae isolates recovered from Austrian companion animals and horses. The obtained results indicate that common human sero- (23F) and sequence type (ST36) implicated in causing invasive pneumococcal disease (IPD) may circulate in dogs. Isolates obtained from other examined animals seem to be host-adapted.

  16. TLR-mediated inflammatory responses to Streptococcus pneumoniae are highly dependent on surface expression of bacterial lipoproteins.

    Science.gov (United States)

    Tomlinson, Gillian; Chimalapati, Suneeta; Pollard, Tracey; Lapp, Thabo; Cohen, Jonathan; Camberlein, Emilie; Stafford, Sian; Periselneris, Jimstan; Aldridge, Christine; Vollmer, Waldemar; Picard, Capucine; Casanova, Jean-Laurent; Noursadeghi, Mahdad; Brown, Jeremy

    2014-10-01

    Streptococcus pneumoniae infections induce inflammatory responses that contribute toward both disease pathogenesis and immunity, but the host-pathogen interactions that mediate these effects are poorly defined. We used the surface lipoprotein-deficient ∆lgt pneumococcal mutant strain to test the hypothesis that lipoproteins are key determinants of TLR-mediated immune responses to S. pneumoniae. We show using reporter assays that TLR2 signaling is dependent on pneumococcal lipoproteins, and that macrophage NF-κB activation and TNF-α release were reduced in response to the ∆lgt strain. Differences in TNF-α responses between Δlgt and wild-type bacteria were abrogated for macrophages from TLR2- but not TLR4-deficient mice. Transcriptional profiling of human macrophages revealed attenuated TLR2-associated responses to ∆lgt S. pneumoniae, comprising many NF-κB-regulated proinflammatory cytokine and chemokine genes. Importantly, non-TLR2-associated responses were preserved. Experiments using leukocytes from IL-1R-associated kinase-4-deficient patients and a mouse pneumonia model confirmed that proinflammatory responses were lipoprotein dependent. Our data suggest that leukocyte responses to bacterial lipoproteins are required for TLR2- and IL-1R-associated kinase-4-mediated inflammatory responses to S. pneumoniae. Copyright © 2014 The Authors.

  17. Protease-activated receptor-1 impairs host defense in murine pneumococcal pneumonia: a controlled laboratory study

    NARCIS (Netherlands)

    Schouten, Marcel; van't Veer, Cornelis; Roelofs, Joris J. T. H.; Levi, Marcel; van der Poll, Tom

    2012-01-01

    Streptococcus pneumoniae is the most common causative pathogen in community-acquired pneumonia. Protease-activated receptor-1 (PAR-1) is expressed by multiple cell types present in the lungs and can be activated by various proteases generated during acute inflammation. The cellular effect of PAR-1

  18. The Receptor for Advanced Glycation End Products Impairs Host Defense in Pneumococcal Pneumonia

    NARCIS (Netherlands)

    van Zoelen, Marieke A. D.; Schouten, Marcel; de Vos, Alex F.; Florquin, Sandrine; Meijers, Joost C. M.; Nawroth, Peter P.; Bierhaus, Angelika; van der Poll, Tom

    2009-01-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia. The receptor for advanced glycation end products (RAGE) is a multiligand receptor that is expressed ubiquitously in the lungs. Engagement of RAGE leads to activation of multiple intracellular signaling pathways,

  19. Recent epidemiology of Streptococcus pneumoniae in nasopharynxes of Korean children with acute otitis media.

    Science.gov (United States)

    Han, Seung Beom; Kim, Jong-Hyun; Kang, Jin Han; Ma, Sang Hyuk; Kim, Chun Soo; Kim, Kyung-Hyo; Kim, Hwang Min; Choi, Young Youn

    2017-03-01

    This prospective study was performed to evaluate serotype distribution, multilocus sequence typing, and antibiotic susceptibility of Streptococcus pneumoniae identified in Korean children with acute otitis media (AOM) after the introduction of a 7-valent pneumococcal conjugate vaccine (PCV7). Nasopharyngeal aspirates were collected from children diagnosed with AOM in seven hospitals in Korea. The bacteria identified in these samples and the serotypes, sequence types (STs), and antibiotic susceptibilities of S. pneumoniae isolates were evaluated. A total of 390 children were enrolled, and bacteria were identified in 376 (96.4%) children. S. pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were identified in 155 (39.7%), 127 (32.6%) and 86 (22.1%) children, respectively. Serotype 19A (22.4%) was the most common S. pneumoniae serotype, with serogroups 11 (14.7%) and 15 (13.5%) following. ST320 (23.5%) was the most common ST; ST166 (17.0%) and ST83 (8.5%) followed. The overall susceptibility rates of S. pneumoniae to oral penicillin V and amoxicillin/clavulanate were 2.6% and 53.2%, respectively. The susceptibility rate to cefditoren was 91.0%; however, the rates for other cephalosporins were less than 10.0%. Compared with other serogroups, S. pneumoniae serogroups 19, 11, and 15 showed significantly lower susceptibility rates to all the antibiotics tested. S. pneumoniae serotype 19A, serogroups 11 and 15 were the major nasopharyngeal-colonizing bacteria in Korean children with AOM after the introduction of PCV7. These relatively prevalent serotype/serogroups showed lower antibiotic susceptibility rates. Copyright © 2016. Published by Elsevier Ltd.

  20. Construction of improved tools for protein localization studies in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Mafalda X Henriques

    Full Text Available We have constructed a set of plasmids that allow efficient expression of both N- and C-terminal fusions of proteins of interest to fluorescent proteins mCherry, Citrine, CFP and GFP in the Gram-positive pathogen Streptococcus pneumoniae. In order to improve expression of the fluorescent fusions to levels that allow their detection by fluorescence microscopy, we have introduced a 10 amino acid tag, named i-tag, at the N-terminal end of the fluorescent proteins. This caused increased expression due to improved translation efficiency and did not interfere with the protein localization in pneumococcal bacteria. Localizing fluorescent derivatives of FtsZ, Wzd and Wze in dividing bacteria validated the developed tools. The availability of the new plasmids described in this work should greatly facilitate studies of protein localization in an important clinical pathogen.

  1. Mechanisms and impact of genetic recombination in the evolution of Streptococcus pneumoniae.

    Science.gov (United States)

    Chaguza, Chrispin; Cornick, Jennifer E; Everett, Dean B

    2015-01-01

    Streptococcus pneumoniae (the pneumococcus) is a highly recombinogenic bacterium responsible for a high burden of human disease globally. Genetic recombination, a process in which exogenous DNA is acquired and incorporated into its genome, is a key evolutionary mechanism employed by the pneumococcus to rapidly adapt to selective pressures. The rate at which the pneumococcus acquires genetic variation through recombination is much higher than the rate at which the organism acquires variation through spontaneous mutations. This higher rate of variation allows the pneumococcus to circumvent the host innate and adaptive immune responses, escape clinical interventions, including antibiotic therapy and vaccine introduction. The rapid influx of whole genome sequence (WGS) data and the advent of novel analysis methods and powerful computational tools for population genetics and evolution studies has transformed our understanding of how genetic recombination drives pneumococcal adaptation and evolution. Here we discuss how genetic recombination has impacted upon the evolution of the pneumococcus.

  2. Antibiotic treatment and the diagnosis of Streptococcus pneumoniae in lower respiratory tract infections in adults

    DEFF Research Database (Denmark)

    Korsgaard, Jens; Møller, Jens Kjølseth; Kilian, Mogens

    2005-01-01

    OBJECTIVE: To analyze the possible influence of antibiotic treatment on the results of different diagnostic tests for the diagnosis of lower respiratory tract infections with Streptococcus pneumoniae. MATERIAL AND METHODS: A prospective cohort of 159 unselected adult immunocompetent patients...... admitted to Silkeborg County Hospital in Denmark with community-acquired lower respiratory tract infections underwent microbiological investigations with fiber-optic bronchoscopy with bronchoalveolar lavage, blood and sputum culture and urine antigen test for type-specific polysaccharide capsular antigens...... was positive in both systems, making a total of 22 patients with documented pneumococcal infection. As a positive culture test was dependent on the absence of antibiotic treatment, whereas a positive urine antigen test depended on antibiotic treatment within 48 hours, the two tests were complementary...

  3. Identification of proteins in Streptococcus pneumoniae by reverse vaccinology and genetic diversity of these proteins in clinical isolates.

    Science.gov (United States)

    Argondizzo, Ana Paula Corrêa; da Mota, Fabio Faria; Pestana, Cristiane Pinheiro; Reis, Joice Neves; de Miranda, Antonio Basílio; Galler, Ricardo; Medeiros, Marco Alberto

    2015-02-01

    Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Virulence-associated proteins common and conserved among all capsular types now represent the best strategy to combat pneumococcal infections. Our aim was to identify conserved targets in pneumococci that showed positive prediction for lipoprotein and extracellular subcellular location using bioinformatics programs and verify the distribution and the degree of conservation of these targets in pneumococci. These targets can be considered potential vaccine candidate to be evaluated in the future. A set of 13 targets were analyzed and confirmed the presence in all pneumococci tested. These 13 genes were highly conserved showing around >96 % of amino acid and nucleotide identity, but they were also present and show high identity in the closely related species Streptococcus mitis, Streptococcus oralis, and Streptococcus pseudopneumoniae. S. oralis clusters away from S. pneumoniae, while S. pseudopneumoniae and S. mitis cluster closer. The divergence between the selected targets was too small to be observed consistently in phylogenetic groups between the analyzed genomes of S. pneumoniae. The proteins analyzed fulfill two of the initial criteria of a vaccine candidate: targets are present in a variety of different pneumococci strains including different serotypes and are conserved among the samples evaluated.

  4. Impact of infant pneumococcal conjugate vaccination on community acquired pneumonia hospitalization in all ages in the Netherlands

    NARCIS (Netherlands)

    van Deursen, A. M.M.; Schurink-van't Klooster, Tessa M; Man, W. H.; van de Kassteele, J.; van Gageldonk-Lafeber, Arianne B; Bruijning-Verhagen, P. C.J.L.; de Melker, Hester E.; Sanders, E. A.M.; Knol, Mirjam J.

    2017-01-01

    Background The long-term impact of pneumococcal conjugate vaccines on pneumonia hospitalizations in all age-groups varies between countries. In the Netherlands, the 7-valent pneumococcal conjugate vaccine (PCV7) was implemented for newborns in 2006 and replaced by PCV10 in 2011. We assessed the

  5. Evolution of Streptococcus pneumoniae and its close commensal relatives

    DEFF Research Database (Denmark)

    Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise

    2008-01-01

    Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...... of unique genes and their origin support the model that the entire cluster of S. pneumoniae, S. pseudopneumoniae, and S. mitis lineages evolved from pneumococcus-like bacteria presumably pathogenic to the common immediate ancestor of hominoids. During their adaptation to a commensal life style, most...

  6. Streptococcus pneumoniae bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome.

    Science.gov (United States)

    Yii, Irene Yuen Lin; Tan, Jamie Bee Xian; Fong, Warren Weng Seng

    2016-10-01

    Invasive pneumococcal disease is an uncommon and notifiable disease in Singapore. It is often associated with significant morbidity and mortality. We report a rare case of invasive pneumococcal bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome. We also present a retrospective review of Streptococcus pneumoniae bacteraemia cases in Singapore General Hospital from January 2011 to April 2016. A 59-year-old Malay lady with a history of systemic sclerosis with secondary Sjögren's syndrome presented with fever and left parotid gland swelling. Clinical examination revealed poor salivary pooling and left parotid swelling without fluctuance. Ultrasound of the left parotid gland confirmed acute parotitis without evidence of abscess or sialolithiasis. Blood cultures were positive for S. pneumoniae . She was diagnosed to have invasive pneumococcal bacteraemia secondary to acute parotitis, and treated with intravenous benzylpenicillin with clearance of bacteraemia after 3 days. Upon discharge, her antibiotics were changed to intravenous ceftriaxone to facilitate outpatient parenteral antibiotic therapy for another 2 weeks. She responded favourably to antibiotics at follow-up, with no complications from the bacteraemia. A review of the microbiological records of the Singapore General Hospital revealed 116 cases of pneumococcal bacteraemia, most (80.3 %) of which were due to pneumonia. None were due to parotitis. S. pneumoniae parotitis and subsequent bacteraemia is rare. Prompt recognition of the disease and appropriate use of antibiotics are important. This case highlights that close communication between healthcare workers (microbiologist, rheumatologist and infectious disease specialist) is essential in ensuring good clinical outcomes in patients with a potentially fatal disease.

  7. Outbreak of Streptococcus pneumoniae in a Psychiatric Unit

    Centers for Disease Control (CDC) Podcasts

    2012-11-02

    Dr. Katherine Fleming-Dutra, an epidemiologist at CDC, discusses her investigation of a Streptococcus pneumoniae outbreak in a pediatric psychiatric unit.  Created: 11/2/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 11/5/2012.

  8. SUSCEPTIBILITY OF RESPIRATORY ISOLATES OF STREPTOCOCCUS PNEUMONIAE ISOLATED FROM CHILDREN HOSPITALIZED IN THE CLINICAL CENTER NIS.

    Science.gov (United States)

    Dinić, Marina M; Mladenović Antić, Snezana; Kocić, Branislava; Stanković Dordević, Dobrila; Vrbić, Miodrag; Bogdanović, Milena

    2016-01-01

    Streptococcus pneumoniae is one of the most common causes of respiratory infections. The aim was to study the susceptibility to antimicrobial agents of respiratory isolates ofStreptococcus pneumoniae obtained from hospitalized children. A total of 190 respiratory pneumococcal isolates obtained from children aged from 0 to 14 years were isolated and identified by using standard microbiological methods. Susceptibility to oxacillin, erythromycin, clindamycin, tetracycline, cotrimoxazole, ofloxacin and rifampicin was tested by disc diffusion method. Minimal inhibitory concentrations for amoxicillin and ceftriaxone were determined by means of E test. The macrolide-resistant phenotype was detected by double disc diffusion test. All tested isolates were susceptible to amoxicillin and ceftriaxone. The minimal amoxicillin concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.50 microg/ml and 1.0 microg/ml, respectively and the minimal ceftriaxone concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.25 microg/ml and 0.50 microg/ml, respectively. Susceptibility to erythromycin and clindamycin was observed in 21.6% and 29.47% of isolates, respectively. The resistence to macrolides-M phenotype was detected in 10.07% of isolates and constitutive macrolide-lincosamide-streptogramin phenotype (constitutive MLS phenotype) was found in 89.93% of isolates. All tested isolates were susceptible to ofloxacin and rifampicin. Amoxicillin could be the therapy of choice in pediatric practice. The macrolides should not be recommended for the empirical therapy of pneumococcal respiratory tract infection in our local area.

  9. Impact of experimental human pneumococcal carriage on nasopharyngeal bacterial densities in healthy adults

    NARCIS (Netherlands)

    Shak, J.R.; Cremers, A.J.H.; Gritzfeld, J.F.; Jonge, M.I. de; Hermans, P.W.M.; Vidal, J.E.; Klugman, K.P.; Gordon, S.B.

    2014-01-01

    Colonization of the nasopharynx by Streptococcus pneumoniae is a necessary precursor to pneumococcal diseases that result in morbidity and mortality worldwide. The nasopharynx is also host to other bacterial species, including the common pathogens Staphylococcus aureus, Haemophilus influenzae, and

  10. Detection of Pneumococcal DNA in Blood by Polymerase Chain Reaction for Diagnosing Pneumococcal Pneumonia in Young Children From Low- and Middle-Income Countries.

    Science.gov (United States)

    Morpeth, Susan C; Deloria Knoll, Maria; Scott, J Anthony G; Park, Daniel E; Watson, Nora L; Baggett, Henry C; Brooks, W Abdullah; Feikin, Daniel R; Hammitt, Laura L; Howie, Stephen R C; Kotloff, Karen L; Levine, Orin S; Madhi, Shabir A; O'Brien, Katherine L; Thea, Donald M; Adrian, Peter V; Ahmed, Dilruba; Antonio, Martin; Bunthi, Charatdao; DeLuca, Andrea N; Driscoll, Amanda J; Githua, Louis Peter; Higdon, Melissa M; Kahn, Geoff; Karani, Angela; Karron, Ruth A; Kwenda, Geoffrey; Makprasert, Sirirat; Mazumder, Razib; Moore, David P; Mwansa, James; Nyongesa, Sammy; Prosperi, Christine; Sow, Samba O; Tamboura, Boubou; Whistler, Toni; Zeger, Scott L; Murdoch, David R

    2017-06-15

    We investigated the performance of polymerase chain reaction (PCR) on blood in the diagnosis of pneumococcal pneumonia among children from 7 low- and middle-income countries. We tested blood by PCR for the pneumococcal autolysin gene in children aged 1-59 months in the Pneumonia Etiology Research for Child Health (PERCH) study. Children had World Health Organization-defined severe or very severe pneumonia or were age-frequency-matched community controls. Additionally, we tested blood from general pediatric admissions in Kilifi, Kenya, a PERCH site. The proportion PCR-positive was compared among cases with microbiologically confirmed pneumococcal pneumonia (MCPP), cases without a confirmed bacterial infection (nonconfirmed), cases confirmed for nonpneumococcal bacteria, and controls. In PERCH, 7.3% (n = 291/3995) of cases and 5.5% (n = 273/4987) of controls were blood pneumococcal PCR-positive (P < .001), compared with 64.3% (n = 36/56) of MCPP cases and 6.3% (n = 243/3832) of nonconfirmed cases (P < .001). Blood pneumococcal PCR positivity was higher in children from the 5 African countries (5.5%-11.5% among cases and 5.3%-10.2% among controls) than from the 2 Asian countries (1.3% and 1.0% among cases and 0.8% and 0.8% among controls). Among Kilifi general pediatric admissions, 3.9% (n = 274/6968) were PCR-positive, including 61.7% (n = 37/60) of those with positive blood cultures for pneumococcus. The utility of pneumococcal PCR on blood for diagnosing childhood pneumococcal pneumonia in the 7 low- and middle-income countries studied is limited by poor specificity and by poor sensitivity among MCPP cases. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  11. Outbreaks of Streptococcus pneumoniae carriage in day care cohorts in Finland – implications for elimination of transmission

    Directory of Open Access Journals (Sweden)

    Auranen Kari

    2009-06-01

    Full Text Available Abstract Background Day care centre (DCC attendees play a central role in maintaining the circulation of Streptococcus pneumoniae (pneumococcus in the population. Exposure within families and within DCCs are the main risk factors for colonisation with pneumococcal serotypes in DCC attendees. Methods Transmission of serotype specific carriage was analysed with a continuous time event history model, based on longitudinal data from day care attendees and their family members. Rates of acquisition, conditional on exposure, were estimated in a Bayesian framework utilising latent processes of carriage. To ensure a correct level of exposure, non-participating day care attendees and their family members were included in the analysis. Posterior predictive simulations were used to quantify transmission patterns within day care cohorts, to estimate the basic reproduction number for pneumococcal carriage in a population of day care cohorts, and to assess the critical vaccine efficacy against carriage to eliminate pneumococcal transmission. Results The model, validated by posterior predictive sampling, was successful in capturing the strong temporal clustering of pneumococcal serotypes in the day care cohorts. In average 2.7 new outbreaks of pneumococcal carriage initiate in a day care cohort each month. While 39% of outbreaks were of size one, the mean outbreak size was 7.6 individuals and the mean length of an outbreak was 2.8 months. The role of families in creating and maintaining transmission was minimal, as only 10% of acquisitions in day care attendees were from family members. Considering a population of day care cohorts, a child-to-child basic reproduction number was estimated as 1.4 and the critical vaccine efficacy against acquisition of carriage as 0.3. Conclusion Pneumococcal transmission occurs in serotype specific outbreaks of carriage, driven by within-day-care transmission and between-serotype competition. An amplifying effect of the day

  12. Multiplex PCR to determine Streptococcus pneumoniae serotypes causing otitis media in the Republic of Ireland with further characterisation of antimicrobial susceptibilities and genotypes.

    LENUS (Irish Health Repository)

    Vickers, I

    2011-03-01

    The purpose of this study was to determine the serotypes, genotypes and antimicrobial susceptibilities of Streptococcus pneumoniae causing otitis media (OM) in children in Dublin, Ireland. S. pneumoniae isolates (n = 28) from spontaneously discharging OM were studied. Serotyping was performed using a previously undescribed multiplex polymerase chain reaction (PCR) scheme in combination with serological methods. Multilocus sequence typing (MLST) was performed using standard procedures. Antimicrobial susceptibility testing was performed using the Etest method. Fourteen different S. pneumoniae serotypes were identified. The five most common serotypes were 3, 19F, 19A, 14 and 6A, which accounted for 68% of all infections. The 7-valent pneumococcal conjugate vaccine (PCV7), 10-valent pneumococcal conjugate vaccine (PHiD-CV) and 13-valent pneumococcal conjugate vaccine (PCV13) provided potential coverages of 43%, 46% and 86%, respectively. Reduced susceptibility to penicillin was evident for 25% of isolates and was associated with serotypes 14, 19A, 19F and 9V. A total of 21 different sequence types (STs) were identified. Pneumococcal Molecular Epidemiology Network (PMEN) clones or their variants represented 54% (15\\/28) of all isolates. Continued monitoring and characterisation of S. pneumoniae causing OM in Ireland is warranted in order to guide future vaccine and treatment policies.

  13. Clinical behavior of Streptococcus pneumoniae meningoencephalitis Comportamiento clinico y terapéutico de la meningoencefalitis por Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Raisa Bu-Coifiu Fanego

    2009-12-01

    Full Text Available OBJECTIVE: There was an increased number of cases of meningoencephalitis caused by Streptococcus pneumoniae, after the successful vaccination campaigns against Neisseria meningitidis and Haemophilus influenzae. This paper aims at describing the clinical characteristics, the laboratory findings, the complications, and the therapeutic management of these patients, who have been suffering from this disease since 1993 to 2006. METHOD: Twelve children with Streptococcus pneumoniae meningoencephalitis admitted to the pediatric hospital of San Miguel del Padron, City of Havana in this period were assessed. RESULTS: Children under one year are the most frequently affected. Septic shock and brain edema were the most severe complications. Three patients died, implying that this disease has a serious course. Early treatment of brain edema is very important to reduce mortality. The elective drugs for treatment of these cases of Streptococcus pneumoniae meningoencephalitis were vancomycin combined with cephalosporin, cefotaxime or ceftriaxone type. CONCLUSION: Patients with Streptococcus pneumoniae meningoencephalitis show clinical characteristics, complications, and sequels that are different to other bacterial meningoencephalitis, meaning that they could be helpful for physicians considering the differential diagnosis of meningoencephalitis.OBJETIVO: Existe un incremento de la meningoencefalitis producida por Streptococcus pneumoniae, después de las campañas exitosas de vacunación contra Neisseria meningitidis y Haemophilus influenzae. El objetivo de este trabajo es describir las caracteristicas clinicas, los hallazgos de laboratorio, las complicaciones y el manejo terapéutico de los pacientes que sufrieron esta enfermedad desde 1993 a 2006. MÉTODO: Se estudiaron doce niños con meningoencefalitis por Streptococcus pneumoniae ingresados en el Hospital Pediátrico de San Miguel del Padrón, Ciudad de La Habana en este periodo. RESULTADOS: Los ni

  14. Fluorescence Imaging of Streptococcus pneumoniae with the Helix pomatia agglutinin (HPA As a Potential, Rapid Diagnostic Tool

    Directory of Open Access Journals (Sweden)

    Mirian Domenech

    2017-07-01

    Full Text Available Streptococcus pneumoniae is a common human pathogen and a major causal agent of life-threatening infections that can either be respiratory or non-respiratory. It is well known that the Helix pomatia (edible snail agglutinin (HPA lectin shows specificity for terminal αGalNAc residues present, among other locations, in the Forssman pentasaccharide (αGalNAc1→3βGalNAc1→3αGal1→4βGal1→4βGlc. Based on experiments involving choline-independent mutants and different growth conditions, we propose here that HPA recognizes the αGalNAc terminal residues of the cell wall teichoic and lipoteichoic acids of S. pneumoniae. In addition, experimental evidence showing that pneumococci can be specifically labeled with HPA when growing as planktonic cultures as well as in mixed biofilms of S. pneumoniae and Haemophilus influenzae has been obtained. It should be underlined that pneumococci were HPA-labeled despite of the presence of a capsule. Although some non-pneumococcal species also bind the agglutinin, HPA-binding combined with fluorescence microscopy constitutes a suitable tool for identifying S. pneumoniae and, if used in conjunction with Gram staining and/or other suitable technique like antigen detection, it may potentially facilitate a fast and accurate diagnosis of pneumococcal infections.

  15. Differential recognition and hydrolysis of host carbohydrate antigens by Streptococcus pneumoniae family 98 glycoside hydrolases.

    Science.gov (United States)

    Higgins, Melanie A; Whitworth, Garrett E; El Warry, Nahida; Randriantsoa, Mialy; Samain, Eric; Burke, Robert D; Vocadlo, David J; Boraston, Alisdair B

    2009-09-18

    The presence of a fucose utilization operon in the Streptococcus pneumoniae genome and its established importance in virulence indicates a reliance of this bacterium on the harvesting of host fucose-containing glycans. The identities of these glycans, however, and how they are harvested is presently unknown. The biochemical and high resolution x-ray crystallographic analysis of two family 98 glycoside hydrolases (GH98s) from distinctive forms of the fucose utilization operon that originate from different S. pneumoniae strains reveal that one enzyme, the predominant type among pneumococcal isolates, has a unique endo-beta-galactosidase activity on the LewisY antigen. Altered active site topography in the other species of GH98 enzyme tune its endo-beta-galactosidase activity to the blood group A and B antigens. Despite their different specificities, these enzymes, and by extension all family 98 glycoside hydrolases, use an inverting catalytic mechanism. Many bacterial and viral pathogens exploit host carbohydrate antigens for adherence as a precursor to colonization or infection. However, this is the first evidence of bacterial endoglycosidase enzymes that are known to play a role in virulence and are specific for distinct host carbohydrate antigens. The strain-specific distribution of two distinct types of GH98 enzymes further suggests that S. pneumoniae strains may specialize to exploit host-specific antigens that vary from host to host, a factor that may feature in whether a strain is capable of colonizing a host or establishing an invasive infection.

  16. Dominance of multidrug resistant CC271 clones in macrolide-resistant streptococcus pneumoniae in Arizona

    Directory of Open Access Journals (Sweden)

    Bowers Jolene R

    2012-01-01

    Full Text Available Abstract Background Rates of resistance to macrolide antibiotics in Streptococcus pneumoniae are rising around the world due to the spread of mobile genetic elements harboring mef(E and erm(B genes and post-vaccine clonal expansion of strains that carry them. Results Characterization of 592 clinical isolates collected in Arizona over a 10 year period shows 23.6% are macrolide resistant. The largest portion of the macrolide-resistant population, 52%, is dual mef(E/erm(B-positive. All dual-positive isolates are multidrug-resistant clonal lineages of Taiwan19F-14, mostly multilocus sequence type 320, carrying the recently described transposon Tn2010. The remainder of the macrolide resistant S. pneumoniae collection includes 31% mef(E-positive, and 9% erm(B-positive strains. Conclusions The dual-positive, multidrug-resistant S. pneumoniae clones have likely expanded by switching to non-vaccine serotypes after the heptavalent pneumococcal conjugate vaccine release, and their success limits therapy options. This upsurge could have a considerable clinical impact in Arizona.

  17. Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction.

    Science.gov (United States)

    Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E; Lau, Gee W

    2015-07-01

    The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 'late' competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically deleted, and the resulting mutants were examined for their fitness during mouse models of bacteremia and acute pneumonia. Among these, 14 late genes were important for fitness in mice. Significantly, deletion of some late genes attenuated pneumococcal fitness to the same level in both wild-type and ComX-null genetic backgrounds, suggesting that the constitutive baseline expression of these genes was important for bacterial fitness. In contrast, some mutants were attenuated only in the wild-type genetic background but not in the ComX-null background, suggesting that specific expression of these genes during competence state contributed to pneumococcal fitness. Increased virulence during competence state was partially caused by the induction of allolytic enzymes that enhanced pneumolysin release. These results distinguish the role of basal expression versus competence induction in virulence functions encoded by ComX-regulated late competence genes. © 2015 John Wiley & Sons Ltd.

  18. Recombination in Streptococcus pneumoniae Lineages Increase with Carriage Duration and Size of the Polysaccharide Capsule

    Science.gov (United States)

    Andam, Cheryl P.; Harris, Simon R.; Cornick, Jennifer E.; Yang, Marie; Bricio-Moreno, Laura; Kamng’ona, Arox W.; French, Neil; Heyderman, Robert S.; Kadioglu, Aras; Everett, Dean B.; Bentley, Stephen D.

    2016-01-01

    ABSTRACT Streptococcus pneumoniae causes a high burden of invasive pneumococcal disease (IPD) globally, especially in children from resource-poor settings. Like many bacteria, the pneumococcus can import DNA from other strains or even species by transformation and homologous recombination, which has allowed the pneumococcus to evade clinical interventions such as antibiotics and pneumococcal conjugate vaccines (PCVs). Pneumococci are enclosed in a complex polysaccharide capsule that determines the serotype; the capsule varies in size and is associated with properties including carriage prevalence and virulence. We determined and quantified the association between capsule and recombination events using genomic data from a diverse collection of serotypes sampled in Malawi. We determined both the amount of variation introduced by recombination relative to mutation (the relative rate) and how many individual recombination events occur per isolate (the frequency). Using univariate analyses, we found an association between both recombination measures and multiple factors associated with the capsule, including duration and prevalence of carriage. Because many capsular factors are correlated, we used multivariate analysis to correct for collinearity. Capsule size and carriage duration remained positively associated with recombination, although with a reduced P value, and this effect may be mediated through some unassayed additional property associated with larger capsules. This work describes an important impact of serotype on recombination that has been previously overlooked. While the details of how this effect is achieved remain to be determined, it may have important consequences for the serotype-specific response to vaccines and other interventions. PMID:27677790

  19. Recombination in Streptococcus pneumoniae Lineages Increase with Carriage Duration and Size of the Polysaccharide Capsule

    Directory of Open Access Journals (Sweden)

    Chrispin Chaguza

    2016-09-01

    Full Text Available Streptococcus pneumoniae causes a high burden of invasive pneumococcal disease (IPD globally, especially in children from resource-poor settings. Like many bacteria, the pneumococcus can import DNA from other strains or even species by transformation and homologous recombination, which has allowed the pneumococcus to evade clinical interventions such as antibiotics and pneumococcal conjugate vaccines (PCVs. Pneumococci are enclosed in a complex polysaccharide capsule that determines the serotype; the capsule varies in size and is associated with properties including carriage prevalence and virulence. We determined and quantified the association between capsule and recombination events using genomic data from a diverse collection of serotypes sampled in Malawi. We determined both the amount of variation introduced by recombination relative to mutation (the relative rate and how many individual recombination events occur per isolate (the frequency. Using univariate analyses, we found an association between both recombination measures and multiple factors associated with the capsule, including duration and prevalence of carriage. Because many capsular factors are correlated, we used multivariate analysis to correct for collinearity. Capsule size and carriage duration remained positively associated with recombination, although with a reduced P value, and this effect may be mediated through some unassayed additional property associated with larger capsules. This work describes an important impact of serotype on recombination that has been previously overlooked. While the details of how this effect is achieved remain to be determined, it may have important consequences for the serotype-specific response to vaccines and other interventions.

  20. Lung abscess complicating pneumococcal pneumonia: a causal role of non-steroidal anti-inflammatory drugs?

    OpenAIRE

    Gibelin, Aude; de Prost, Nicolas; Brun-Buisson, Christian

    2013-01-01

    Pulmonary abscess is a distinctly uncommon complication of pneumococcal pneumonia in immunocompetent adults that has recently been reported to occur following administration of non-steroidal anti-inflammatory drugs (NSAIDs). We report herein the case of a 24-year-old patient with no predisposing risk factor who developed a lung abscess after NSAIDs exposure, further illustrating this potentially severe complication of NSAIDs use, especially in the absence of associated antibiotic therapy.

  1. Lung abscess complicating pneumococcal pneumonia: a causal role of non-steroidal anti-inflammatory drugs?

    Science.gov (United States)

    Gibelin, Aude; de Prost, Nicolas; Brun-Buisson, Christian

    2013-08-20

    Pulmonary abscess is a distinctly uncommon complication of pneumococcal pneumonia in immunocompetent adults that has recently been reported to occur following administration of non-steroidal anti-inflammatory drugs (NSAIDs). We report herein the case of a 24-year-old patient with no predisposing risk factor who developed a lung abscess after NSAIDs exposure, further illustrating this potentially severe complication of NSAIDs use, especially in the absence of associated antibiotic therapy.

  2. The Small Molecule DAM Inhibitor, Pyrimidinedione, Disrupts Streptococcus pneumoniae Biofilm Growth In Vitro.

    Directory of Open Access Journals (Sweden)

    Mukesh Kumar Yadav

    Full Text Available Streptococcus pneumoniae persist in the human nasopharynx within organized biofilms. However, expansion to other tissues may cause severe infections such as pneumonia, otitis media, bacteremia, and meningitis, especially in children and the elderly. Bacteria within biofilms possess increased tolerance to antibiotics and are able to resist host defense systems. Bacteria within biofilms exhibit different physiology, metabolism, and gene expression profiles than planktonic cells. These differences underscore the need to identify alternative therapeutic targets and novel antimicrobial compounds that are effective against pneumococcal biofilms. In bacteria, DNA adenine methyltransferase (Dam alters pathogenic gene expression and catalyzes the methylation of adenine in the DNA duplex and of macromolecules during the activated methyl cycle (AMC. In pneumococci, AMC is involved in the biosynthesis of quorum sensing molecules that regulate competence and biofilm formation. In this study, we examine the effect of a small molecule Dam inhibitor, pyrimidinedione, on Streptococcus pneumoniae biofilm formation and evaluate the changes in global gene expression within biofilms via microarray analysis. The effects of pyrimidinedione on in vitro biofilms were studied using a static microtiter plate assay, and the architecture of the biofilms was viewed using confocal and scanning electron microscopy. The cytotoxicity of pyrimidinedione was tested on a human middle ear epithelium cell line by CCK-8. In situ oligonucleotide microarray was used to compare the global gene expression of Streptococcus pneumoniae D39 within biofilms grown in the presence and absence of pyrimidinedione. Real-time RT-PCR was used to study gene expression. Pyrimidinedione inhibits pneumococcal biofilm growth in vitro in a concentration-dependent manner, but it does not inhibit planktonic cell growth. Confocal microscopy analysis revealed the absence of organized biofilms, where cell

  3. Changes in the incidence of pneumonia, bacterial meningitis, and infant mortality 5 years following introduction of the 13-valent pneumococcal conjugate vaccine in a "3+0" schedule.

    Science.gov (United States)

    Becker-Dreps, Sylvia; Blette, Bryan; Briceño, Rafaela; Alemán, Jorge; Hudgens, Michael G; Moreno, Gilberto; Ordoñez, Ana; Rocha, Julio; Weber, David J; Amaya, Erick

    2017-01-01

    Streptococcus pneumoniae causes about 826,000 deaths of children in the world each year and many health facility visits. To reduce the burden of pneumococcal disease, many nations have added pneumococcal conjugate vaccines to their national immunization schedules. Nicaragua was the first country eligible for GAVI Alliance funding to introduce the 13-valent pneumococcal conjugate vaccine (PCV13) in 2010, provided to infants at 2, 4, and 6 months of age. The goal of this study was to evaluate the population impact of the first five years of the program. Numbers of visits for pneumonia, pneumonia-related deaths, and bacterial meningitis in both children and adults, and infant deaths between 2008 and 2015 were collected from all 107 public health facilities in León Department. Vital statistics data provided additional counts of pneumonia-related deaths that occurred outside health facilities. Adjusted incidence rates and incidence rate ratios (IRRa) in the vaccine (2011-2015) and pre-vaccine periods (2008-2010) were estimated retrospectively using official population estimates as exposure time. The IRRa for pneumonia hospitalizations was 0.70 (95% confidence interval [CI]: 0.66, 0.75) for infants, and 0.92 (95% CI: 0.85, 0.99) for one year-olds. The IRRa for post-neonatal infant mortality was 0.56 (95% CI: 0.41, 0.77). In the population as a whole, ambulatory visits and hospitalizations for pneumonia, as well as pneumonia-related mortality and rates of bacterial meningitis were lower in the vaccine period. During the first five years of program implementation, reductions were observed in health facility visits for pneumonia in immunized age groups and infant mortality, which would be hard to achieve with any other single public health intervention. Future study is warranted to understand whether the lack of a booster dose (e.g., at 12 months) may be responsible for the small reductions in pneumonia hospitalizations observed in one year-olds as compared to infants.

  4. MALDI-TOF mass spectrometry for differentiation between Streptococcus pneumoniae and Streptococcus pseudopneumoniae.

    Science.gov (United States)

    van Prehn, Joffrey; van Veen, Suzanne Q; Schelfaut, Jacqueline J G; Wessels, Els

    2016-05-01

    We compared the Vitek MS and Microflex MALDI-TOF mass spectrometry platform for species differentiation within the Streptococcus mitis group with PCR assays targeted at lytA, Spn9802, and recA as reference standard. The Vitek MS correctly identified 10/11 Streptococcus pneumoniae, 13/13 Streptococcus pseudopneumoniae, and 12/13 S. mitis/oralis. The Microflex correctly identified 9/11 S. pneumoniae, 0/13 S. pseudopneumoniae, and 13/13 S. mitis/oralis. MALDI-TOF is a powerful tool for species determination within the mitis group. Diagnostic accuracy varies depending on platform and database used. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Distinct effects on diversifying selection by two mechanisms of immunity against Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Yuan Li

    Full Text Available Antigenic variation to evade host immunity has long been assumed to be a driving force of diversifying selection in pathogens. Colonization by Streptococcus pneumoniae, which is central to the organism's transmission and therefore evolution, is limited by two arms of the immune system: antibody- and T cell- mediated immunity. In particular, the effector activity of CD4(+ T(H17 cell mediated immunity has been shown to act in trans, clearing co-colonizing pneumococci that do not bear the relevant antigen. It is thus unclear whether T(H17 cell immunity allows benefit of antigenic variation and contributes to diversifying selection. Here we show that antigen-specific CD4(+ T(H17 cell immunity almost equally reduces colonization by both an antigen-positive strain and a co-colonized, antigen-negative strain in a mouse model of pneumococcal carriage, thus potentially minimizing the advantage of escape from this type of immunity. Using a proteomic screening approach, we identified a list of candidate human CD4(+ T(H17 cell antigens. Using this list and a previously published list of pneumococcal Antibody antigens, we bioinformatically assessed the signals of diversifying selection among the identified antigens compared to non-antigens. We found that Antibody antigen genes were significantly more likely to be under diversifying selection than the T(H17 cell antigen genes, which were indistinguishable from non-antigens. Within the Antibody antigens, epitopes recognized by human antibodies showed stronger evidence of diversifying selection. Taken together, the data suggest that T(H17 cell-mediated immunity, one form of T cell immunity that is important to limit carriage of antigen-positive pneumococcus, favors little diversifying selection in the targeted antigen. The results could provide new insight into pneumococcal vaccine design.

  6. Neutrophil evasion strategies by Streptococcus pneumoniae and Staphylococcus aureus.

    Science.gov (United States)

    Lewis, Megan L; Surewaard, Bas G J

    2018-03-01

    Humans are well equipped to defend themselves against bacteria. The innate immune system employs diverse mechanisms to recognize, control and initiate a response that can destroy millions of different microbes. Microbes that evade the sophisticated innate immune system are able to escape detection and could become pathogens. The pathogens Streptococcus pneumoniae and Staphylococcus aureus are particularly successful due to the development of a wide variety of virulence strategies for bacterial pathogenesis and they invest significant efforts towards mechanisms that allow for neutrophil evasion. Neutrophils are a primary cellular defense and can rapidly kill invading microbes, which is an indispensable function for maintaining host health. This review compares the key features of Streptococcus pneumoniae and Staphylococcus aureus in epidemiology, with a specific focus on virulence mechanisms utilized to evade neutrophils in bacterial pathogenesis. It is important to understand the complex interactions between pathogenic bacteria and neutrophils so that we can disrupt the ability of pathogens to cause disease.

  7. Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

    Directory of Open Access Journals (Sweden)

    Pui-Ying Iroh Tam

    Full Text Available Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture.Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples.A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%. One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1% and 62.5% (95% CI 24.5-91.5%, respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%. Among these, six were positive for a non-S. pneumoniae pathogen on culture.Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite

  8. Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

    Science.gov (United States)

    Iroh Tam, Pui-Ying; Hernandez-Alvarado, Nelmary; Schleiss, Mark R; Hassan-Hanga, Fatimah; Onuchukwu, Chuma; Umoru, Dominic; Obaro, Stephen K

    2016-01-01

    Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS) is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR) assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture. Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples. A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%). One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1%) and 62.5% (95% CI 24.5-91.5%), respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%). Among these, six were positive for a non-S. pneumoniae pathogen on culture. Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite growth of

  9. Correlations between computed tomography findings and clinical manifestations of Streptococcus pneumoniae pneumonia

    International Nuclear Information System (INIS)

    Yagihashi, Kunihiro; Kurihara, Yasuyuki; Fujikawa, Atsuko; Matsuoka, Shin; Nakajima, Yasuo

    2011-01-01

    The aim of this study was to characterize the imaging features and compare computed tomography (CT) findings with clinical features of patients with Streptococcus pneumoniae pneumonia. We retrospectively reviewed 75 patients (44 men, 31 women; mean age 67 years) diagnosed with S. pneumoniae pneumonia who underwent chest CT scanning at our institution between January 2007 and August 2008. Diagnoses were based on detection of the S. pneumoniae antigen in urine. Chest CT scans revealed abnormalities in all patients. The predominant opacity patterns were an airspace pneumonia pattern (48%) and a bronchopneumonia pattern (48%), followed by an interstitial pneumonia pattern (4%). Consolidation was observed most frequently (84%) followed by ground glass opacity (82.7%), bronchial wall thickening (61.3%), and centrilobular nodules (49.3%). Airway dilatation (21.6%), pleural effusion (33.3%), lymphadenopathy (34.8%), and pulmonary emphysema (21.3%) were also observed. Pulmonary emphysema was significantly less frequent in patients with the bronchopneumonia pattern than in those without (p=0.007). The clinical features and CT findings did not differ significantly. CT image analysis showed that patients with S. pneumoniae pneumonia exhibited the bronchopneumonia and airspace pneumonia patterns with equal frequency. Bronchopneumonia pattern was less common in patients with preexisting emphysema. (author)

  10. Structure of a conjugative element in Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Vijayakumar, M.N.; Priebe, S.D.; Guild, W.R.

    1986-06-01

    The authors have cloned and mapped a 69-kilobase (kb) region of the chromosome of Streptococcus pneumoniae DP1322, which carries the conjugative Omega(cat-tet) insertion from S. pneumoniae BM6001. This element proved to be 65.5 kb in size. Location of the junctions was facilitated by cloning a preferred target region from the wild-type strain Rx1 recipient genome. This target site was preferred by both the BM6001 element and the cat-erm-tet element from Streptococcus agalactiae B109. Within the BM6001 element cat and tet were separated by 30 kb, and cat was flanked by two copies of a sequence that was also present in the recipient strain Rx1 DNA. Another sequence at least 2.4 kb in size was found inside the BM6001 element and at two places in the Rx1 genome. Its role is unknown. The ends of the BM6001 element appear to be the same as those of the B109 element, both as seen after transfer to S. pneumoniae and as mapped by others in pDP5 after transposition in Streptococcus faecalis. No homology is seen between the ends of the BM6001 element and no evidence found suggesting that it ever circularizes.

  11. Clinical presentation and prognostic factors of Streptococcus pneumoniae meningitis according to the focus of infection

    Directory of Open Access Journals (Sweden)

    Samuelsson Susanne

    2005-10-01

    Full Text Available Abstract Background We conducted a nationwide study in Denmark to identify clinical features and prognostic factors in patients with Streptococcus pneumoniae according to the focus of infection. Methods Based on a nationwide registration, clinical information's was prospectively collected from all reported cases of pneumococcal meningitis during a 2-year period (1999–2000. Clinical and laboratory findings at admission, clinical course and outcome of the disease including follow-up audiological examinations were collected retrospectively. The focus of infection was determined according to the clinical diagnosis made by the physicians and after review of the medical records. Results 187 consecutive cases with S. pneumoniae meningitis were included in the study. The most common focus was ear (30%, followed by lung (18%, sinus (8%, and other (2%. In 42% of cases a primary infection focus could not be determined. On admission, fever and an altered mental status were the most frequent findings (in 93% and 94% of cases, respectively, whereas back rigidity, headache and convulsion were found in 57%, 41% and 11% of cases, respectively. 21% of patients died during hospitalisation (adults: 27% vs. children: 2%, Fisher Exact Test, P P = 0.0005. Prognostic factors associated with fatal outcome in univariate logistic regression analysis were advanced age, presence of an underlying disease, history of headache, presence of a lung focus, absence of an otogenic focus, having a CT-scan prior to lumbar puncture, convulsions, requirement of assisted ventilation, and alterations in various CSF parameters (WBC P P = 0.005. Conclusion These results emphasize the prognostic importance of an early recognition of a predisposing focus to pneumococcal meningitis.

  12. Effect of Xylitol on Growth of Streptococcus pneumoniae in the Presence of Fructose and Sorbitol

    Science.gov (United States)

    Tapiainen, Terhi; Kontiokari, Tero; Sammalkivi, Laura; Ikäheimo, Irma; Koskela, Markku; Uhari, Matti

    2001-01-01

    Xylitol is effective in preventing acute otitis media by inhibiting the growth of Streptococcus pneumoniae. To clarify this inhibition we used fructose, which is known to block similar growth inhibition observed in Streptococcus mutans. In addition, we evaluated the efficacy of sorbitol in inhibiting the growth of pneumococci, as sorbitol is widely used for indications similar to those for which xylitol is used. The addition of 5% xylitol to the growth medium resulted in marked growth inhibition, an effect which was totally eliminated in the presence of 1, 2.5, or 5% fructose but not in the presence of 1 or 5% glucose, 1% galactose, or 1% sucrose. This finding implies that xylitol-induced inhibition of pneumococcal growth is mediated via the fructose phosphotransferase system in a way similar to that in which mutans group streptococcal growth is inhibited. The addition of sorbitol at concentrations of 1, 2.5, or 5% to the growth medium did not affect the growth of pneumococci and neither inhibited nor enhanced the xylitol-induced growth impairment. Thus, it seems that xylitol is the only commercially used sugar substitute proven to have an antimicrobial effect on pneumococci. PMID:11120960

  13. Frequent beneficial mutations during single-colony serial transfer of Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Kathleen E Stevens

    2011-08-01

    Full Text Available The appearance of new mutations within a population provides the raw material for evolution. The consistent decline in fitness observed in classical mutation accumulation studies has provided support for the long-held view that deleterious mutations are more common than beneficial mutations. Here we present results of a study using a mutation accumulation design with the bacterium Streptococcus pneumoniae in which the fitness of the derived populations increased. This rise in fitness was associated specifically with adaptation to survival during brief stationary phase periods between single-colony population bottlenecks. To understand better the population dynamics behind this unanticipated adaptation, we developed a maximum likelihood model describing the processes of mutation and stationary-phase selection in the context of frequent population bottlenecks. Using this model, we estimate that the rate of beneficial mutations may be as high as 4.8×10(-4 events per genome for each time interval corresponding to the pneumococcal generation time. This rate is several orders of magnitude higher than earlier estimates of beneficial mutation rates in bacteria but supports recent results obtained through the propagation of small populations of Escherichia coli. Our findings indicate that beneficial mutations may be relatively frequent in bacteria and suggest that in S. pneumoniae, which develops natural competence for transformation, a steady supply of such mutations may be available for sampling by recombination.

  14. Epithelial Cell–Derived Secreted and Transmembrane 1a Signals to Activated Neutrophils during Pneumococcal Pneumonia

    Science.gov (United States)

    Kamata, Hirofumi; Yamamoto, Kazuko; Wasserman, Gregory A.; Zabinski, Mary C.; Yuen, Constance K.; Lung, Wing Yi; Gower, Adam C.; Belkina, Anna C.; Ramirez, Maria I.; Deng, Jane C.; Quinton, Lee J.; Jones, Matthew R.

    2016-01-01

    Airway epithelial cell responses are critical to the outcome of lung infection. In this study, we aimed to identify unique contributions of epithelial cells during lung infection. To differentiate genes induced selectively in epithelial cells during pneumonia, we compared genome-wide expression profiles from three sorted cell populations: epithelial cells from uninfected mouse lungs, epithelial cells from mouse lungs with pneumococcal pneumonia, and nonepithelial cells from those same infected lungs. Of 1,166 transcripts that were more abundant in epithelial cells from infected lungs compared with nonepithelial cells from the same lungs or from epithelial cells of uninfected lungs, 32 genes were identified as highly expressed secreted products. Especially strong signals included two related secreted and transmembrane (Sectm) 1 genes, Sectm1a and Sectm1b. Refinement of sorting strategies suggested that both Sectm1 products were induced predominantly in conducting airway epithelial cells. Sectm1 was induced during the early stages of pneumococcal pneumonia, and mutation of NF-κB RelA in epithelial cells did not diminish its expression. Instead, type I IFN signaling was necessary and sufficient for Sectm1 induction in lung epithelial cells, mediated by signal transducer and activator of transcription 1. For target cells, Sectm1a bound to myeloid cells preferentially, in particular Ly6GbrightCD11bbright neutrophils in the infected lung. In contrast, Sectm1a did not bind to neutrophils from uninfected lungs. Sectm1a increased expression of the neutrophil-attracting chemokine CXCL2 by neutrophils from the infected lung. We propose that Sectm1a is an epithelial product that sustains a positive feedback loop amplifying neutrophilic inflammation during pneumococcal pneumonia. PMID:27064756

  15. Epithelial Cell-Derived Secreted and Transmembrane 1a Signals to Activated Neutrophils during Pneumococcal Pneumonia.

    Science.gov (United States)

    Kamata, Hirofumi; Yamamoto, Kazuko; Wasserman, Gregory A; Zabinski, Mary C; Yuen, Constance K; Lung, Wing Yi; Gower, Adam C; Belkina, Anna C; Ramirez, Maria I; Deng, Jane C; Quinton, Lee J; Jones, Matthew R; Mizgerd, Joseph P

    2016-09-01

    Airway epithelial cell responses are critical to the outcome of lung infection. In this study, we aimed to identify unique contributions of epithelial cells during lung infection. To differentiate genes induced selectively in epithelial cells during pneumonia, we compared genome-wide expression profiles from three sorted cell populations: epithelial cells from uninfected mouse lungs, epithelial cells from mouse lungs with pneumococcal pneumonia, and nonepithelial cells from those same infected lungs. Of 1,166 transcripts that were more abundant in epithelial cells from infected lungs compared with nonepithelial cells from the same lungs or from epithelial cells of uninfected lungs, 32 genes were identified as highly expressed secreted products. Especially strong signals included two related secreted and transmembrane (Sectm) 1 genes, Sectm1a and Sectm1b. Refinement of sorting strategies suggested that both Sectm1 products were induced predominantly in conducting airway epithelial cells. Sectm1 was induced during the early stages of pneumococcal pneumonia, and mutation of NF-κB RelA in epithelial cells did not diminish its expression. Instead, type I IFN signaling was necessary and sufficient for Sectm1 induction in lung epithelial cells, mediated by signal transducer and activator of transcription 1. For target cells, Sectm1a bound to myeloid cells preferentially, in particular Ly6G(bright)CD11b(bright) neutrophils in the infected lung. In contrast, Sectm1a did not bind to neutrophils from uninfected lungs. Sectm1a increased expression of the neutrophil-attracting chemokine CXCL2 by neutrophils from the infected lung. We propose that Sectm1a is an epithelial product that sustains a positive feedback loop amplifying neutrophilic inflammation during pneumococcal pneumonia.

  16. Empyema and bacteremic pneumococcal pneumonia in children under five years of age

    Directory of Open Access Journals (Sweden)

    Maria Regina Alves Cardoso

    2014-01-01

    Full Text Available We compared bacteremic pneumococcal pneumonia (BPP and pneumococcal empyema (PE, in terms of clinical, radiological, and laboratory findings, in under-fives. A cross-sectional nested cohort study, involving under-fives (102 with PE and 128 with BPP, was conducted at 12 centers in Argentina, Brazil, and the Dominican Republic. Among those with PE, mean age was higher; disease duration was longer; and tachypnea, dyspnea, and high leukocyte counts were more common. Among those with BPP, fever and lethargy were more common. It seems that children with PE can be distinguished from those with BPP on the basis of clinical and laboratory findings. Because both conditions are associated with high rates of morbidity and mortality, prompt diagnosis is crucial.

  17. Nasopharyngeal carriage, antibiogram & serotype distribution of Streptococcus pneumoniae among healthy under five children

    Directory of Open Access Journals (Sweden)

    K.L. Ravi Kumar

    2014-01-01

    Full Text Available Background & objectives: Information related to nasopharyngeal carriage of Streptococcus pneumoniae among healthy children is scanty in India. This prospective study was undertaken to determine the presence of asymptomatic nasopharyngeal colonization, assess serogroups/types (SGT and drug resistance of S. pneumoniae in children below five years of age. Methods: A total of 109 male and 81 female children in the age group of three months to five years belonging to different socio-economic classes were enrolled. They were recruited across all age groups from those attending paediatric OPD of a tertiary care and research centre for immunization program. Fifty three isolates identified as pneumococci were tested for their antimicrobial susceptibility pattern by Kirby-Bauer′s disc diffusion and E-Test methods. Serotyping was performed by detection of the quelling reaction with specific antiserum. Result: The pneumococcal carriage rate in the study population was 27.9 per cent. The isolation rate was associated with age being higher (49.2% in smaller children (3-12 months and among male (62.2%. The most prevalent SGTs were 19 followed by 10, 14 and 7; 21 per cent of isolates belonging to serotype 10 (n=7 were 11 (n=4 were not covered in any of the conjugate vaccines currently available in Indian market. Resistance to co-trimoxazole, tetracycline, penicillin and erythromycin was observed in 91 per cent (n=48, 36 per cent (n=19, 17 per cent (n=9 and 9 per cent (n=5 isolates, respectively. All the penicillin resistant isolates were found to be intermediately resistant by E-Test. Multidrug resistance was observed in 19 per cent (n=10 isolates. Interpretation & conclusions: High level of antibiotic resistance was present in S. pneumoniae isolated from healthy children below age five. A pneumococcal conjugate vaccine with the prevailing SGTs would help to reduce the pool of antibiotic resistant pneumococci. Continued surveillance of serotypes and tracking

  18. Unusual Manifestation of Severe Conjugated Hyperbilirubinemia in an Infant with Streptococcus pneumoniae-associated Hemolytic Uremic Syndrome

    Directory of Open Access Journals (Sweden)

    Jung-Pin Chen

    2007-01-01

    Full Text Available Streptococcus pneumoniae is an uncommon etiologic organism in children with hemolytic uremic syndrome (HUS. Historically, severe S. pneumoniae-associated HUS usually has a poor clinical outcome. The clinical manifestations of marked jaundice and hepatic dysfunction in this form of HUS are extremely rare. We report a 10-month-old female infant with S. pneumoniae-associated HUS who had the unusual manifestation of severely elevated conjugated bilirubin and hepatic transaminases. Screening for viral hepatitis was negative, and evidence of biliary obstruction and hepatotoxic drug exposure was also absent. The patient was treated with antihypertensive agents for 2.5 months and required peritoneal dialysis for a period of 26 days. Hepatic function returned to normal on the 8th day of hospitalization. Renal function was mildly impaired at 1-year follow-up. Our report suggests that severe conjugated hyperbilirubinemia is a rare manifestation of S. pneumoniae-associated HUS in children. It is important for pediatricians that pneumococcal infection with severe hematologic and renal disorders should be investigated for evidence of S. pneumoniae-associated HUS. [J Formos Med Assoc 2007;106(2 Suppl:S17-S22

  19. [Incidence of admissions due to pneumonia in children under 24 months old before and after the introduction of the 10-valent pneumococcal conjugate vaccine into the National Immunization Program of Chile].

    Science.gov (United States)

    Fernández V, José Pablo; Goecke H, Carola; von Borries, Cecilia; Tapia R, Natalia; Santolaya de P, María Elena

    2015-01-01

    Streptococcus pneumoniae is the leading cause of bacterial pneumonia in children, especially in the hospitalized population. The 10-valent pneumococcal vaccine was included in the National Immunization Program of Chile in 2011. This study aims to evaluate the incidence of pneumonia in hospitalized children<24 months of age in the Luis Calvo Mackenna Hospital before and after the introduction of the pneumococcal vaccine into the National Immunization Program. Passive surveillance study. Patients<24 months with discharge diagnosis of bacterial pneumonia from Luis Calvo Mackenna Hospital were studied between 2009 and 2013. Data were obtained from the Luis Calvo Mackenna Hospital's Statistical Service. The incidence of pneumonia was evaluated in the pre-vaccination period (2009-2010) and in the post-vaccination period (2012-2013). During the study period, an average of 4,321 discharges/year was observed in children<24 months (range: 3,587-4,702), with a significant decrease from pre- to post-vaccination vaccine period (4,644 vs 4,013, P<.001). The average incidence of pneumonia ranged from 3.4/100,000 to 1.5/100,000 in the pre- and post-vaccine period, respectively (P=.009), with an annual mean of 157 cases of pneumonia in the pre- vaccine period, and 62 cases in the postvaccine period (P<.001) and a decrease in incidence between the two periods of 56%. This study confirms information previously obtained in other countries, which show a decrease in the incidence of pneumonia associated with the implementation of a pneumococcal vaccine at the population level. Ongoing surveillance is required to evaluate if this effect is maintained over time and expands to older populations. Copyright © 2015 Sociedad Chilena de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.

  20. Emerging, Non-PCV13 Serotypes 11A and 35B of Streptococcus pneumoniae Show High Potential for Biofilm Formation In Vitro.

    Directory of Open Access Journals (Sweden)

    Mirian Domenech

    Full Text Available Since the use of pneumococcal conjugate vaccines PCV7 and PCV13 in children became widespread, invasive pneumococcal disease (IPD has dramatically decreased. Nevertheless, there has been a rise in incidence of Streptococcus pneumoniae non-vaccine serotypes (NVT colonising the human nasopharynx. Nasopharyngeal colonisation, an essential step in the development of S. pneumoniae-induced IPD, is associated with biofilm formation. Although the capsule is the main pneumococcal virulence factor, the formation of pneumococcal biofilms might, in fact, be limited by the presence of capsular polysaccharide (CPS.We used clinical isolates of 16 emerging, non-PCV13 serotypes as well as isogenic transformants of the same serotypes. The biofilm formation capacity of isogenic transformants expressing CPSs from NVT was evaluated in vitro to ascertain whether this trait can be used to predict the emergence of NVT. Fourteen out of 16 NVT analysed were not good biofilm formers, presumably because of the presence of CPS. In contrast, serotypes 11A and 35B formed ≥45% of the biofilm produced by the non-encapsulated M11 strain.This study suggest that emerging, NVT serotypes 11A and 35B deserve a close surveillance.

  1. Epidemiological Studies of Potent Environmental Pathogen: Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Nazir A. Brohi

    2016-12-01

    Full Text Available A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton’s agar after 24 hours incubation

  2. Epidemiological studies of potent environment pathogen streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Brohi, N.A.; Tunio, S.A.

    2016-01-01

    A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years) including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton's agar after 24 hours incubation. (author)

  3. CRH Affects the Phenotypic Expression of Sepsis-Associated Virulence Factors by Streptococcus pneumoniae Serotype 1 In vitro

    Directory of Open Access Journals (Sweden)

    Colette G. Ngo Ndjom

    2017-06-01

    Full Text Available Sepsis is a life-threatening health condition caused by infectious pathogens of the respiratory tract, and accounts for 28–50% of annual deaths in the US alone. Current treatment regimen advocates the use of corticosteroids as adjunct treatment with antibiotics, for their broad inhibitory effect on the activity and production of pro-inflammatory mediators. However, despite their use, corticosteroids have not proven to be able to reverse the death incidence among septic patients. We have previously demonstrated the potential for neuroendocrine factors to directly influence Streptococcus pneumoniae virulence, which may in turn mediate disease outcome leading to sepsis and septic shock. The current study investigated the role of Corticotropin-releasing hormone (CRH in mediating key markers of pneumococcal virulence as important phenotypic determinants of sepsis and septic shock risks. In vitro cultures of serotype 1 pneumococcal strain with CRH promoted growth rate, increased capsule thickness and penicillin resistance, as well as induced pneumolysin gene expression. These results thus provide significant insights of CRH–pathogen interactions useful in understanding the underlying mechanisms of neuroendocrine factor's role in the onset of community acquired pneumonias (CAP, sepsis and septic shock.

  4. Replication of type 5 adenovirus promotes middle ear infection by Streptococcus pneumoniae in the chinchilla model of otitis media

    Science.gov (United States)

    Murrah, Kyle A.; Turner, Roberta L.; Pang, Bing; Perez, Antonia C.; Reimche, Jennifer L.; King, Lauren B.; Wren, John; Gandhi, Uma; Swords, W. Edward; Ornelles, David A.

    2015-01-01

    Adenoviral infection is a major risk factor for otitis media. We hypothesized that adenovirus promotes bacterial ascension into the middle ear through the disruption of normal function in the Eustachian tubes due to inflammation-induced changes. An intranasal infection model of the chinchilla was used to test the ability of type 5 adenovirus to promote middle ear infection by Streptococcus pneumoniae. The hyperinflammatory adenovirus mutant dl327 and the nonreplicating adenovirus mutant H5wt300ΔpTP were used to test the role of inflammation and viral replication, respectively, in promotion of pneumococcal middle ear infection. Precedent infection with adenovirus resulted in a significantly greater incidence of middle ear disease by S. pneumoniae as compared to nonadenovirus infected animals. Infection with the adenovirus mutant dl327 induced a comparable degree of bacterial ascension into the middle ear as did infection with the wild-type virus. By contrast, infection with the nonreplicating adenovirus mutant H5wt300ΔpTP resulted in less extensive middle ear infection compared to the wild-type adenovirus. We conclude that viral replication is necessary for adenoviral-induced pneumococcal middle ear disease. PMID:25251686

  5. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

    Directory of Open Access Journals (Sweden)

    Laura ePaixão

    2015-10-01

    Full Text Available Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonised by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonisation to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc on this response at the transcriptional, physiological and metabolic levels. Galactose (Gal, N-acetylglucosamine (GlcNAc and mannose (Man affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo 13C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s was readily consumed and elicited a metabolic shift towards a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome. In central carbon metabolism (most represented category, Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

  6. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism.

    Science.gov (United States)

    Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R

    2015-01-01

    Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonization to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc) on this response at the transcriptional, physiological, and metabolic levels. Galactose (Gal), N-acetylglucosamine (GlcNAc), and mannose (Man) affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo (13)C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed) and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s) was readily consumed and elicited a metabolic shift toward a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome). In central carbon metabolism (most represented category), Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

  7. NK and NKT Cell Depletion Alters the Outcome of Experimental Pneumococcal Pneumonia: Relationship with Regulation of Interferon-γ Production

    Directory of Open Access Journals (Sweden)

    Eirini Christaki

    2015-01-01

    Full Text Available Background. Natural killer (NK and natural killer T (NKT cells contribute to the innate host defense but their role in bacterial sepsis remains controversial. Methods. C57BL/6 mice were infected intratracheally with 5 × 105 cfu of Streptococcus pneumoniae. Animals were divided into sham group (Sham; pretreated with isotype control antibody (CON group; pretreated with anti-asialo GM1 antibody (NKd group; and pretreated with anti-CD1d monoclonal antibody (NKTd group before bacterial challenge. Serum and tissue samples were analyzed for bacterial load, cytokine levels, splenocyte apoptosis rates, and cell characteristics by flow cytometry. Splenocyte miRNA expression was also analyzed and survival was assessed. Results. NK cell depletion prolonged survival. Upon inhibition of NKT cell activation, spleen NK (CD3−/NK1.1+ cells increased compared to all other groups. Inhibition of NKT cell activation led to higher bacterial loads and increased levels of serum and splenocyte IFN-γ. Splenocyte miRNA analysis showed that miR-200c and miR-29a were downregulated, while miR-125a-5p was upregulated, in anti-CD1d treated animals. These changes were moderate after NK cell depletion. Conclusions. NK cells appear to contribute to mortality in pneumococcal pneumonia. Inhibition of NKT cell activation resulted in an increase in spleen NK (CD3−/NK1.1+ cells and a higher IFN-γ production, while altering splenocyte miRNA expression.

  8. High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae

    Science.gov (United States)

    Marks, Laura R.; Reddinger, Ryan M.; Hakansson, Anders P.

    2012-01-01

    ABSTRACT Transformation of genetic material between bacteria was first observed in the 1920s using Streptococcus pneumoniae as a model organism. Since then, the mechanism of competence induction and transformation has been well characterized, mainly using planktonic bacteria or septic infection models. However, epidemiological evidence suggests that genetic exchange occurs primarily during pneumococcal nasopharyngeal carriage, which we have recently shown is associated with biofilm growth, and is associated with cocolonization with multiple strains. However, no studies to date have comprehensively investigated genetic exchange during cocolonization in vitro and in vivo or the role of the nasopharyngeal environment in these processes. In this study, we show that genetic exchange during dual-strain carriage in vivo is extremely efficient (10−2) and approximately 10,000,000-fold higher than that measured during septic infection (10−9). This high transformation efficiency was associated with environmental conditions exclusive to the nasopharynx, including the lower temperature of the nasopharynx (32 to 34°C), limited nutrient availability, and interactions with epithelial cells, which were modeled in a novel biofilm model in vitro that showed similarly high transformation efficiencies. The nasopharyngeal environmental factors, combined, were critical for biofilm formation and induced constitutive upregulation of competence genes and downregulation of capsule that promoted transformation. In addition, we show that dual-strain carriage in vivo and biofilms formed in vitro can be transformed during colonization to increase their pneumococcal fitness and also, importantly, that bacteria with lower colonization ability can be protected by strains with higher colonization efficiency, a process unrelated to genetic exchange. PMID:23015736

  9. Individual risk factors associated with nasopharyngeal colonization with Streptococcus pneumoniae and Haemophilus influenzae: a Japanese birth cohort study.

    Science.gov (United States)

    Otsuka, Taketo; Chang, Bin; Shirai, Takatoshi; Iwaya, Atsushi; Wada, Akihito; Yamanaka, Noboru; Okazaki, Minoru

    2013-07-01

    The first step in a bacterial disease is the establishment of nasopharyngeal carriage. We conducted a birth cohort study to identify factors associated with colonization in healthy children and evaluate the serotype distributions and resistances of Streptococcus pneumoniae/Haemophilus influenzae. Nasopharyngeal cultures were obtained from 349 subjects at 5 time points coinciding with health checkups (4, 7, 10, 18 and 36 months). A total of 551 S. pneumoniae (penicillin resistance rate: 46.3%) and 301 H. influenzae (ampicillin resistance rate: 44.5%) isolates were obtained from 1654 samples. In this study, 47.5% and 60.9% of S. pneumoniae isolates were included in the serotypes of 7- and 13-valent pneumococcal conjugate vaccines, respectively. Analyzing by Cox proportional hazards models, cohabiting older sibling(s) attending day-care (hazard ratios: 2.064-3.518, P rates. This data indicated that introduction of appropriate antimicrobial usage in areas of overuse of antimicrobials could contribute to lower colonization of S. pneumoniae/H. influenzae, resulting in a decrease in the absolute number of resistant isolates. Strategies to control transmission at day-care centers or from older sibling(s) as well as appropriate use of antimicrobials are essential for reducing colonization and the absolute number of resistant isolates.

  10. The Proteasome-Ubiquitin System Is Required for Efficient Killing of Intracellular Streptococcus pneumoniae by Brain Endothelial Cells

    NARCIS (Netherlands)

    Iovino, Federico; Gradstedt, Henrik; Bijlsma, Jetta J.

    2014-01-01

    Streptococcus pneumoniae (pneumococcus) is a Gram-positive bacterium that causes serious invasive diseases, such as pneumonia, bacteremia, and meningitis, with high morbidity and mortality throughout the world. Before causing invasive disease, S. pneumoniae encounters cellular barriers, which are

  11. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

    Science.gov (United States)

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

    2018-01-01

    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  12. Testing Pneumonia Vaccines in the Elderly: Determining a Case Definition for Pneumococcal Pneumonia in the Absence of a Gold Standard.

    Science.gov (United States)

    Jokinen, Jukka; Snellman, Marja; Palmu, Arto A; Saukkoriipi, Annika; Verlant, Vincent; Pascal, Thierry; Devaster, Jeanne-Marie; Hausdorff, William P; Kilpi, Terhi M

    2017-12-15

    Clinical assessments of vaccines to prevent pneumococcal (Pnc) community-acquired pneumonia (CAP) require sensitive and specific case definitions, but there is no gold standard diagnostic test. To develop a new case definition suitable for vaccine efficacy studies, we applied latent class analysis (LCA) to the results from seven diagnostic tests for Pnc etiology on clinical specimens from 323 elderly radiologically-confirmed pneumonia cases enrolled in The Finnish Community-Acquired Pneumonia Epidemiology study during 2005-2007. Compared to the conventional use of LCA, which is mainly to determine sensitivities and specificities of different tests, we instead used LCA as an appropriate instrument to predict the probability of Pnc etiology for each CAP case based on their test profiles, and utilized the predictions to minimize the sample size that would be needed for a vaccine efficacy trial. When compared to the conventional laboratory criteria of encapsulated Pnc in blood culture or in high-quality sputum culture or urine antigen positivity, our optimized case definition for PncCAP resulted in a trial sample size which was almost 20,000 subjects smaller. We believe that our novel application of LCA detailed here to determine a case definition for PncCAP could also be similarly applied to other diseases without a gold standard. © The Author(s) 2017. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health.

  13. Translation quality control is maintained by the penicillin resistance factor MurM in Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Shepherd, Jennifer; Ibba, Michael

    2013-01-01

    Streptococcus pneumoniae is a causative agent of nosocomial infections such as pneumonia, meningitis and septicaemia. Penicillin resistance in S. pneumoniae depends in part upon MurM, an aminoacyl-tRNA-ligase that attaches L-serine or L-alanine to the stem peptide lysine of Lipid II in cell wall...

  14. Impact of Pneumococcal Conjugate Vaccines on Pneumonia Hospitalizations in High- and Low-Income Subpopulations in Brazil

    DEFF Research Database (Denmark)

    Warren, Joshua L.; Shioda, Kayoko; Kürüm, Esra

    2017-01-01

    Background: Pneumococcal conjugate vaccines (PCVs) are being used worldwide. A key question is whether the impact of PCVs on pneumonia is similar in low- and high-income populations. However, most low-income countries, where the burden of disease is greatest, lack reliable data that can be used t...

  15. Autolytic Activity and Plasma Binding Study of Aap, a Novel Minor Autolysin of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Ramina Mahboobi

    2016-04-01

    Full Text Available Pneumococcal autolysins are enzymes involved in cell wall turnover and cellular division physiologically. They have been found to be involved in the pneumococcus pathogenesis. The aim of this study was to identify the autolytic activity of Spr1754 as a novel protein of Streptococcus pneumoniae. Moreover, the binding of the recombinant protein to plasma proteins was also determined. The spr1754 gene was amplified by PCR and cloned into the pET21a(+ prokaryotic expression vector. The constructed pET21a(+/spr1754 recombinant plasmid was transformed into E. coli Origami (DE3 and induced using IPTG. The recombinant protein of Spr1754 was purified by Ni-NTA affinity chromatography and confirmed by SDS-PAGE and Western blot analysis using anti-His tag monoclonal antibody. Autolytic activity and the ability of the recombinant protein in binding to plasma proteins were performed using zymogram analysis and western blot, respectively. The spr1754 with expected size was cloned and overexpressed in Escherichia coli Origami (DE3, successfully. After purification of the Spr1754 recombinant protein, the autolytic activity was observed by zymography. Of the four plasma proteins used in this study, binding of lactoferrin to Spr1754 recombinant protein was shown. The Spr1754 recombinant protein has a bifunctional activity, i.e., as being autolysin and lactoferrin binding and designated as Aap (autolytic/ adhesion/ pneumococcus. Nevertheless, characterization of the Aap needs to be followed using gene inactivation and cell wall localization.

  16. Nasopharyngeal colonization and invasive disease are enhanced by the cell wall hydrolases LytB and LytC of Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Elisa Ramos-Sevillano

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a common colonizer of the human nasopharynx and one of the major pathogens causing invasive disease worldwide. Dissection of the molecular pathways responsible for colonization, invasion, and evasion of the immune system will provide new targets for antimicrobial or vaccine therapies for this common pathogen. METHODOLOGY/PRINCIPAL FINDINGS: We have constructed mutants lacking the pneumococcal cell wall hydrolases (CWHs LytB and LytC to investigate the role of these proteins in different phases of the pneumococcal pathogenesis. Our results show that LytB and LytC are involved in the attachment of S. pneumoniae to human nasopharyngeal cells both in vitro and in vivo. The interaction of both proteins with phagocytic cells demonstrated that LytB and LytC act in concert avoiding pneumococcal phagocytosis mediated by neutrophils and alveolar macrophages. Furthermore, C3b deposition was increased on the lytC mutant confirming that LytC is involved in complement evasion. As a result, the lytC mutant showed a reduced ability to successfully cause pneumococcal pneumonia and sepsis. Bacterial mutants lacking both LytB and LytC showed a dramatically impaired attachment to nasopharyngeal cells as well as a marked degree of attenuation in a mouse model of colonization. In addition, C3b deposition and phagocytosis was more efficient for the double lytB lytC mutant and its virulence was greatly impaired in both systemic and pulmonary models of infection. CONCLUSIONS/SIGNIFICANCE: This study confirms that the CWHs LytB and LytC of S. pneumoniae are essential virulence factors involved in the colonization of the nasopharynx and in the progress of invasive disease by avoiding host immunity.

  17. The impact of pneumolysin on the macrophage response to Streptococcus pneumoniae is strain-dependent.

    Directory of Open Access Journals (Sweden)

    Richard M Harvey

    Full Text Available Streptococcus pneumoniae is the world's leading cause of pneumonia, bacteremia, meningitis and otitis media. A major pneumococcal virulence factor is the cholesterol-dependent cytolysin, which has the defining property of forming pores in cholesterol-containing membranes. In recent times a clinically significant and internationally successful serotype 1 ST306 clone has been found to express a non-cytolytic variant of Ply (Ply306. However, while the pneumococcus is a naturally transformable organism, strains of the ST306 clonal group have to date been virtually impossible to transform, severely restricting efforts to understand the role of non-cytolytic Ply in the success of this clone. In this study isogenic Ply mutants were constructed in the D39 background and for the first time in the ST306 background (A0229467 to enable direct comparisons between Ply variants for their impact on the immune response in a macrophage-like cell line. Strains that expressed cytolytic Ply were found to induce a significant increase in IL-1β release from macrophage-like cells compared to the non-cytolytic and Ply-deficient strains in a background-independent manner, confirming the requirement for pore formation in the Ply-dependent activation of the NLRP3 inflammasome. However, cytolytic activity in the D39 background was found to induce increased expression of the genes encoding GM-CSF (CSF2, p19 subunit of IL-23 (IL23A and IFNβ (IFNB1 compared to non-cytolytic and Ply-deficient D39 mutants, but had no effect in the A0229467 background. The impact of Ply on the immune response to the pneumococcus is highly dependent on the strain background, thus emphasising the importance of the interaction between specific virulence factors and other components of the genetic background of this organism.

  18. Stress-triggered signaling affecting survival or suicide of Streptococcus pneumoniae.

    Science.gov (United States)

    Cortes, Paulo R; Piñas, Germán E; Cian, Melina B; Yandar, Nubia; Echenique, Jose

    2015-01-01

    Streptococcus pneumoniae is a major human pathogen that can survive to stress conditions, such as the acidic environment of inflammatory foci, and tolerates lethal pH through a mechanism known as the acid tolerance response. We previously described that S. pneumoniae activates acidic-stress induced lysis in response to acidified environments, favoring the release of cell wall compounds, DNA and virulence factors. Here, we demonstrate that F(0)F(1)-ATPase is involved in the response to acidic stress. Chemical inhibitors (DCCD, optochin) of this proton pump repressed the ATR induction, but caused an increased ASIL. Confirming these findings, mutants of the subunit c of this enzyme showed the same phenotypes as inhibitors. Importantly, we demonstrated that F(0)F(1)-ATPase and ATR are necessary for the intracellular survival of the pneumococcus in macrophages. Alternatively, a screening of two-component system (TCS) mutants showed that ATR and survival in pneumocytes were controlled in contrasting ways by ComDE and CiaRH, which had been involved in the ASIL mechanism. Briefly, CiaRH was essential for ATR (ComE represses activation) whereas ComE was necessary for ASIL (CiaRH protects against induction). They did not regulate F0F1-ATPase expression, but control LytA expression on the pneumococcal surface. These results suggest that both TCSs and F(0)F(1)-ATPase control a stress response and decide between a survival or a suicide mechanism by independent pathways, either in vitro or in pneumocyte cultures. This biological model contributes to the current knowledge about bacterial response under stress conditions in host tissues, where pathogens need to survive in order to establish infections. Copyright © 2014 Elsevier GmbH. All rights reserved.

  19. Brain-derived neurotrophic factor reduces inflammation and hippocampal apoptosis in experimental Streptococcus pneumoniae meningitis.

    Science.gov (United States)

    Xu, Danfeng; Lian, Di; Wu, Jing; Liu, Ying; Zhu, Mingjie; Sun, Jiaming; He, Dake; Li, Ling

    2017-08-04

    Streptococcus pneumoniae meningitis is a serious inflammatory disease of the central nervous system (CNS) and is associated with high morbidity and mortality rates. The inflammatory processes initiated by recognition of bacterial components contribute to apoptosis in the hippocampal dentate gyrus. Brain-derived neurotrophic factor (BDNF) has long been recommended for the treatment of CNS diseases due to its powerful neuro-survival properties, as well as its recently reported anti-inflammatory and anti-apoptotic effects in vitro and in vivo. In this study, we investigated the effects of BDNF-related signaling on the inflammatory response and hippocampal apoptosis in experimental models of pneumococcal meningitis. Pretreatment with exogenous BDNF or the tropomyosin-receptor kinase B (TrkB) inhibitor k252a was performed to assess the activation or inhibition of the BDNF/TrkB-signaling axis prior to intracisternal infection with live S. pneumoniae. At 24 h post-infection, rats were assessed for clinical severity and sacrificed to harvest the brains. Paraffin-embedded brain sections underwent hematoxylin and eosin staining to evaluate pathological severity, and cytokine and chemokine levels in the hippocampus and cortex were evaluated by enzyme-linked immunosorbent assay. Additionally, apoptotic neurons were detected in the hippocampal dentate gyrus by terminal deoxynucleotidyl transferase dUTP-nick-end labeling, key molecules associated with the related signaling pathway were analyzed by real-time polymerase chain reaction and western blot, and the DNA-binding activity of nuclear factor kappa B (NF-κB) was measured by electrophoretic mobility shift assay. Rats administered BDNF exhibited reduced clinical impairment, pathological severity, and hippocampal apoptosis. Furthermore, BDNF pretreatment suppressed the expression of inflammatory factors, including tumor necrosis factor α, interleukin (IL)-1β, and IL-6, and increased the expression of the anti

  20. The Saudi Thoracic Society pneumococcal vaccination guidelines-2016

    Science.gov (United States)

    Alharbi, N. S.; Al-Barrak, A. M.; Al-Moamary, M. S.; Zeitouni, M. O.; Idrees, M. M.; Al-Ghobain, M. O.; Al-Shimemeri, A. A.; Al-Hajjaj, Mohamed S.

    2016-01-01

    Streptococcus pneumoniae (pneumococcus) is the leading cause of morbidity and mortality worldwide. Saudi Arabia is a host to millions of pilgrims who travel annually from all over the world for Umrah and the Hajj pilgrimages and are at risk of developing pneumococcal pneumonia or invasive pneumococcal disease (IPD). There is also the risk of transmission of S. pneumoniae including antibiotic resistant strains between pilgrims and their potential global spread upon their return. The country also has unique challenges posed by susceptible population to IPD due to people with hemoglobinopathies, younger age groups with chronic conditions, and growing problem of antibiotic resistance. Since the epidemiology of pneumococcal disease is constantly changing, with an increase in nonvaccine pneumococcal serotypes, vaccination policies on the effectiveness and usefulness of vaccines require regular revision. As part of the Saudi Thoracic Society (STS) commitment to promote the best practices in the field of respiratory diseases, we conducted a review of S. pneumoniae infections and the best evidence base available in the literature. The aim of the present study is to develop the STS pneumococcal vaccination guidelines for healthcare workers in Saudi Arabia. We recommend vaccination against pneumococcal infections for all children Saudi Arabia population <50 years of age, many of whom have risk factors for contracting pneumococcal infections. A section for pneumococcal vaccination before the Umrah and Hajj pilgrimages is included as well. PMID:27168856

  1. Impact of the factor V Leiden mutation on the outcome of pneumococcal pneumonia: a controlled laboratory study

    NARCIS (Netherlands)

    Schouten, Marcel; van 't Veer, Cornelis; Roelofs, Joris Jth; Levi, Marcel; van der Poll, Tom

    2010-01-01

    Introduction: Streptococcus (S.) pneumoniae is the most common cause of community-acquired pneumonia. The factor V Leiden (FVL) mutation results in resistance of activated FV to inactivation by activated protein C and thereby in a prothrombotic phenotype. Human heterozygous FVL carriers have been

  2. Recombinant human tissue factor pathway inhibitor exerts anticoagulant, anti-inflammatory and antimicrobial effects in murine pneumococcal pneumonia

    NARCIS (Netherlands)

    van den Boogaard, F. E.; Brands, X.; Schultz, M. J.; Levi, M. [=Marcel M.; Roelofs, J. J. T. H.; van 't Veer, C.; van der Poll, T.

    2011-01-01

    Background: Streptococcus (S.) pneumoniae is the most common causative pathogen in community-acquired pneumonia and a major cause of sepsis. Recombinant human tissue factor pathway inhibitor (rh-TFPI) attenuates sepsis-induced coagulation and has been evaluated in clinical trials involving patients

  3. Pneumococcal and influenza vaccination status of hospitalized adults with community acquired pneumonia and the effects of vaccination on clinical presentation.

    Science.gov (United States)

    Demirdogen Cetinoglu, Ezgi; Uzaslan, Esra; Sayıner, Abdullah; Cilli, Aykut; Kılınc, Oguz; Sakar Coskun, Aysın; Hazar, Armağan; Kokturk, Nurdan; Filiz, Ayten; Polatli, Mehmet

    2017-09-02

    Previous reports have shown that vaccination rates of adult at-risk populations are low in Turkey. There are differing reports with regards to the effectiveness of the influenza and the pneumococcal polysaccharide vaccine (PPSV23) on the clinical outcomes of community acquired pneumonia (CAP). The purpose of this study was to analyze the influenza (FV) and pneumococcal vaccination (PV) status, the factors that influence the receipt of influenza/pneumococcal vaccine and the effects of prior vaccination on the clinical outcomes in adults hospitalized with CAP. Patients hospitalized with CAP between March 2009 and October 2013 and registered at the web-based Turkish Thoracic Society Pneumonia Database (TURCAP) were included in this multicentric, observational study. Of a total of 787 cases, data were analyzed for 466 patients for whom self-reported information on PV and FV was available. In this adult population with CAP, the vaccination rate with both the pneumococcal and influenza vaccines was found to be 6%. Prior FV was found to be the sole variable that was associated with the receipt of PV [OR 17.8, 95% CI (25-75:8.56-37.01), p pneumonia severity index (PSI) score ≥ 90, CURB-65 score ≥3 and multilobar involvement, but not the vaccination status, were identified as independent determinants of ICU admission. This study showed that, among patients hospitalized with CAP, the FV and/or PV rates are low. Prior vaccination does not appear to significantly affect the clinical outcomes.

  4. [Contribution of urinary pneumococcal antigen detection combined with the research of legionella antigen for diagnosis of pneumonia in hospitalized patients].

    Science.gov (United States)

    Honoré, S; Trillard, M; Ould-Hocine, Z; Lesprit, P; Deforges, L; Legrand, P

    2004-10-01

    Bacteriological confirmation of pneumonia (PNM) in hospitalized patients is often erratic or belated. Because of importance of prognosis, early adaptation of treatment requires an empirical antimicrobial therapy (generally aminopenicillin and macrolide combination). The starting therapeutic strategy should profit by a fast and reliable test asserting a pneumococcal etiology. The Binax Now S. pneumoniae (BNP) test allows an urinary pneumococcal antigen (UPA) detection using an immunochromatographic membrane assay within 15 minutes. We first evaluated the BNP test for 28 patients with pneumococcal PNM proved by culture, and 118 negative control patients without PNM. The BNP test was then evaluated by testing urine from 158 hospitalized patients with a clinical picture of PNM (community-acquired: 90, nosocomial: 68) for whom a research of urinary Legionella antigen (Binax Now) was prescribed and was positive for only two cases. 57 patients (36.1%) were hospitalized in ICU. The sensitivity was 71.4% (85.7% for the 21 bacteriemic PNM), and the specificity was 98.3%; that is consistent with previous published data. Among the 158 patients with PNM, UPA was detected in 17 cases (10.8%): 15 within the community-acquired PNM (16.7%) and 2 (2.9%) within the nosocomial cases. The pneumococcal etiology was confirmed by bacteriological samples in 7/17 patients (6 by blood cultures). The 10 others showed clinical and radiological features in agreement with a pneumococcal PNM. Among the 141 patients with negative AUP, S. pneumoniae was isolated from 6 of them (2 in blood cultures). The Binax Now S. pneumoniae test allowed a fast and reliable etiological diagnosis in 10.8% of hospitalized PNM (16.7% of the community-acquired cases) having a research of urinary Legionella antigen (conceiving with severity factors). So it could conduce to an improved adjustment of the starting antimicrobial therapy of hospitalized adult patients with PNM.

  5. A Cross-sectional Survey Assessing Carriage of Streptococcus pneumoniae in a Healthy Population in Xinjiang Uygur Autonomous Region of China.

    Science.gov (United States)

    Xie, Na; Chen, Zhao Yun; Chen, Tao; Zhu, Bing Qing; Xu, Li; Gao, Yuan; Zhang, Ai Yu; Zhao, Pan; Liu, Ji Wen; Shao, Zhu Jun

    2018-03-01

    The carriage rate and serotype distribution of Streptococcus pneumoniae (S. pneumoniae) in a healthy population in China remains unclear. In this study, we collected the oropharyngeal swabs from 513 individuals in Xinjiang, China. Real-time PCR targeting the lytA gene and 12 serotypes were assessed to identify S. pneumoniae carriage. The total carriage rate of S. pneumoniae was 70.4% (361/513). The most prevalent serotypes were 19B/F, 18B/C, 5, and 6A/B. The highest carriage rate of S. pneumoniae was noted in children aged 6-10 years (88.6%), which merits further attention. The co-colonization rate of two or more S. pneumoniae serotypes was 79.8% (264/331). This study aimed to investigate the baseline pneumococcal carriage rate among healthy individuals in China to improve our understanding of the epidemiology of S. pneumoniae. Copyright © 2018 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  6. Influence of bacterial interactions on pneumococcal colonization of the nasopharynx.

    Science.gov (United States)

    Shak, Joshua R; Vidal, Jorge E; Klugman, Keith P

    2013-03-01

    Streptococcus pneumoniae (the pneumococcus) is a common commensal inhabitant of the nasopharynx and a frequent etiologic agent in serious diseases such as pneumonia, otitis media, bacteremia, and meningitis. Multiple pneumococcal strains can colonize the nasopharynx, which is also home to many other bacterial species. Intraspecies and interspecies interactions influence pneumococcal carriage in important ways. Co-colonization by two or more pneumococcal strains has implications for vaccine serotype replacement, carriage detection, and pneumonia diagnostics. Interactions between the pneumococcus and other bacterial species alter carriage prevalence, modulate virulence, and affect biofilm formation. By examining these interactions, this review highlights how the bacterial ecosystem of the nasopharynx changes the nature and course of pneumococcal carriage. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Pneumococcal Pneumonia

    Science.gov (United States)

    ... Cause Disease , May 30, 2018 NIH Begins Testing Ebola Treatment in Early-Stage Trial , May 23, 2018 ... visit the MedlinePlus flu site . Credit: NIAID Colorized structure of a prototype for a universal flu vaccine. ...

  8. Streptococcus pneumoniae enhances human respiratory syncytial virus infection in vitro and in vivo

    NARCIS (Netherlands)

    D.T. Nguyen (Tien); R.P.L. Louwen (Rogier); Elberse, K. (Karin); G. van Amerongen (Geert); S. Yüksel (Selma); A. Luijendijk (Ad); A.D.M.E. Osterhaus (Albert); W.P. Duprex (William Paul); R.L. de Swart (Rik)

    2015-01-01

    textabstractHuman respiratory syncytial virus (HRSV) and Streptococcus pneumoniae are important causative agents of respiratory tract infections. Both pathogens are associated with seasonal disease outbreaks in the pediatric population, and can often be detected simultaneously in infants

  9. Molecular epidemiology of penicillin-nonsusceptible Streptococcus pneumoniae among children in Greece

    NARCIS (Netherlands)

    D. Bogaert (Debby); G.A. Syrogiannopoulos; I.N. Grivea; R. de Groot (Ronald); N.G. Beratis; P.W.M. Hermans (Peter)

    2000-01-01

    textabstractA total of 145 penicillin-nonsusceptible Streptococcus pneumoniae strains were isolated from young carriers in Greece and analyzed by antibiotic susceptibility testing, serotyping, restriction fragment end labeling (RFEL), and penicillin-binding protein

  10. Meropenem susceptibility of Neisseria meningitidis and Streptococcus pneumoniae from meningitis patients in The Netherlands

    NARCIS (Netherlands)

    van de Beek, D.; Hensen, E. F.; Spanjaard, L.; de Gans, J.; Enting, R. H.; Dankert, J.

    1997-01-01

    In-vitro susceptibility of 299 Neisseria meningitidis and 157 Streptococcus pneumoniae strains from meningitis patients in The Netherlands in 1993 and 1994 to meropenem was determined using the Etest. Susceptibility to penicillin, ceftriaxone, and chloramphenicol was also determined. Rifampicin

  11. Competence in Streptococcus pneumoniae is regulated by the rate of ribosomal decoding errors.

    Science.gov (United States)

    Stevens, Kathleen E; Chang, Diana; Zwack, Erin E; Sebert, Michael E

    2011-01-01

    Competence for genetic transformation in Streptococcus pneumoniae develops in response to accumulation of a secreted peptide pheromone and was one of the initial examples of bacterial quorum sensing. Activation of this signaling system induces not only expression of the proteins required for transformation but also the production of cellular chaperones and proteases. We have shown here that activity of this pathway is sensitively responsive to changes in the accuracy of protein synthesis that are triggered by either mutations in ribosomal proteins or exposure to antibiotics. Increasing the error rate during ribosomal decoding promoted competence, while reducing the error rate below the baseline level repressed the development of both spontaneous and antibiotic-induced competence. This pattern of regulation was promoted by the bacterial HtrA serine protease. Analysis of strains with the htrA (S234A) catalytic site mutation showed that the proteolytic activity of HtrA selectively repressed competence when translational fidelity was high but not when accuracy was low. These findings redefine the pneumococcal competence pathway as a response to errors during protein synthesis. This response has the capacity to address the immediate challenge of misfolded proteins through production of chaperones and proteases and may also be able to address, through genetic exchange, upstream coding errors that cause intrinsic protein folding defects. The competence pathway may thereby represent a strategy for dealing with lesions that impair proper protein coding and for maintaining the coding integrity of the genome. The signaling pathway that governs competence in the human respiratory tract pathogen Streptococcus pneumoniae regulates both genetic transformation and the production of cellular chaperones and proteases. The current study shows that this pathway is sensitively controlled in response to changes in the accuracy of protein synthesis. Increasing the error rate during

  12. Community-acquired lobar pneumonia in children in the era of universal 7-valent pneumococcal vaccination: a review of clinical presentations and antimicrobial treatment from a Canadian pediatric hospital

    Directory of Open Access Journals (Sweden)

    Rowan-Legg Anne

    2012-08-01

    Full Text Available Abstract Background Community-acquired pneumonia (CAP is a common cause of pediatric admission to hospital. The objectives of this study were twofold: 1 to describe the clinical characteristics of CAP in children admitted to a tertiary care pediatric hospital in the pneumococcal vaccination era and, 2 to examine the antimicrobial selection in hospital and on discharge. Methods A retrospective review of healthy immunocompetent children admitted to a tertiary pediatric hospital from January 2007 to December 2008 with clinical features consistent with pneumonia and a radiographically-confirmed consolidation was performed. Clinical, microbiological and antimicrobial data were collected. Results One hundred and thirty-five hospitalized children with pneumonia were evaluated. Mean age at admission was 4.8 years (range 0–17 years. Two thirds of patients had been seen by a physician in the 24 hours prior to presentation; 56 (41.5% were on antimicrobials at admission. 52 (38.5% of patients developed an effusion, and 22/52 (42.3% had pleural fluid sampled. Of 117 children who had specimens (blood/pleural fluid cultured, 9 (7.7% had pathogens identified (7 Streptococcus pneumoniae, 1 Group A Streptococcus, and 1 Rhodococcus. 55% of patients received 2 or more antimicrobials in hospital. Cephalosporins were given to 130 patients (96.1% in hospital. Only 21/126 patients (16.7% were discharged on amoxicillin. The median length of stay was 3 days (IQR 2–4 for those without effusion and 9 (IQR 5–13 for those with effusion. No deaths were related to pneumonia. Conclusions This study provides comprehensive data on the clinical characteristics of hospitalized children with CAP in the pneumococcal 7-valent vaccine era. Empiric antimicrobial choice at our institution is variable, highlighting a need for heightened antimicrobial stewardship.

  13. Serotype Distribution and Antimicrobial Sensitivity Profile of Streptococcus pneumoniae Carried in Healthy Toddlers before PCV13 Introduction in Niamey, Niger.

    Directory of Open Access Journals (Sweden)

    Sani Ousmane

    Full Text Available To mitigate the burden of pneumococcal infections in Niger, a 13-valent pneumococcal vaccine, PCV13, was introduced for routine child vaccination in July 2014. In order to provide pre-vaccine baseline data and allow appreciation of changes on carriage due to vaccination, we analyzed retrospectively pneumococcal isolates obtained from healthy, 0 to 2 year old children prior to the vaccine introduction.From June 5, 2007, to May 26, 2008, 1200 nasopharyngeal swabs were collected from healthy 0 to 2 year old children and analyzed by standard microbiological methods. Serotyping was done by SM-PCR and the data were analyzed with R version 2.15.0 (2012-03-30.Streptococcus pneumoniae was detected in 654/1200 children (54.5% among whom 339 (51.8% were males. The ages of the study subjects varied from few days to 26 months (mean = 7.1, median = 6, 95% CI [6.8-7.4]. Out of 654 frozen isolates, 377 (54.8% were able to be re-grown and analyzed. In total, 32 different serogroups/serotypes were detected of which, the most prevalent were 6/(6A/6B/6C/6D (15.6%, 23F (10.6%, 19F (9.3%, 14 (9%, 19A (5.6%, 23B (4.0%, 25F/38 (3.7%, 18/(18A/18B/18C/18F (2.9% and PCR non-typeable (16.4%. Eleven serogroups/serotypes accounting for 57.3% (216/377 were of PCV13 types. Of the 211/377 (56% isolates tested for drug sensitivity, 23/211 (10.9%, 24/211 (11.4%, 9/211(4.3% and 148/210 (70.5% were respectively resistance to oxacillin, chloramphenicol, erythromycin and tetracycline. Thirteen of the oxacillin resistant isolates were additionally multidrug-resistant. No resistance was however detected to gentamycin500μg and to fluoroquinolones (ø Norfloxacin5μg 3 months and presence in family of more than one sibling aged 3 months and presence in family of children aged < 6 years were significant factors for pneumococcal carriage. The present data should help understanding post vaccine introduction changes in pneumococcal carriage and infections for better action.

  14. Validation of the Infectious Diseases Society of America/American Thoracic Society criteria to predict severe community-acquired pneumonia caused by Streptococcus pneumoniae.

    Science.gov (United States)

    Kontou, Paschalina; Kuti, Joseph L; Nicolau, David P

    2009-10-01

    Severe community-acquired pneumonia (CAP) is usually defined as pneumonia that requires intensive care unit (ICU) admission; the primary pathogen responsible for ICU admission is Streptococcus pneumoniae. In this study, the 2007 Infectious Diseases Society of America/American Thoracic Society (IDSA/ATS) consensus criteria for ICU admission were compared with other severity scores in predicting ICU admission and mortality. We retrospectively studied 158 patients with pneumococcal CAP (1999-2003). Clinical and laboratory features at the emergency department were recorded and used to calculate the 2007 IDSA/ATS rule, the 2001 ATS rule, 2 modified 2007 IDSA/ATS rules, the Pneumonia Severity Index (PSI), and the CURB (confusion, urea, respiratory rate, blood pressure) score. The sensitivity, specificity, positive predictive value, and negative predictive value (NPV) were assessed for the various indices. We also determined the criteria that were independently predictive of ICU admission and of mortality in our population. The 2007 IDSA/ATS criteria performed as well as the 2001 ATS rule in predicting ICU admission both demonstrated high sensitivity (90%) and NPV (97%). For the prediction of mortality, the best tool proved to be the PSI score (sensitivity, 95%; NPV, 99%). The variables associated with ICU admission in this patient population included tachypnea, confusion, Pao(2)/Fio(2) ratio of 250 or lower, and hypotension requiring fluid resuscitation. Mechanical ventilation and PSI class V were independently associated with mortality. This study confirms the usefulness of the new criteria in predicting severe CAP. The 2001 ATS criteria seem an attractive alternative because they are simple and as effective as the 2007 IDSA/ATS criteria.

  15. Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

    International Nuclear Information System (INIS)

    Jorens, Philippe G.; Demey, Hendrik E.; Parizel, Paul M.; Smets, Katrien; Jadoul, Kris; Verbeek, M.M.; Wevers, R.A.; Cras, Patrick

    2005-01-01

    Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

  16. Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

    Energy Technology Data Exchange (ETDEWEB)

    Jorens, Philippe G.; Demey, Hendrik E. [University Hospital of Antwerp, UZA, Department of Intensive Care Medicine, Edegem (Belgium); Parizel, Paul M. [University of Antwerp, Department of Radiology, Edegem (Belgium); Smets, Katrien [University of Antwerp, Department of Neurology, Edegem (Belgium); General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Jadoul, Kris [General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Verbeek, M.M.; Wevers, R.A. [University Hospital of Nijmegen, Laboratory of Paediatrics and Neurology, Nijmegen (Netherlands); Cras, Patrick [University of Antwerp, Department of Neurology, Edegem (Belgium)

    2005-10-01

    Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

  17. Carriage of Streptococcus pneumoniae and other respiratory bacterial pathogens in low and lower-middle income countries: a systematic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Richard A Adegbola

    Full Text Available Infection with Streptococcus pneumoniae is a major cause of childhood morbidity and mortality worldwide, especially in low income countries where pneumococcal conjugate vaccines (PCVs are still underused. In countries where PCVs have been introduced, much of their efficacy has resulted from their impact on nasopharyngeal carriage in vaccinated children. Understanding the epidemiology of carriage for S. pneumoniae and other common respiratory bacteria in developing countries is crucial for implementing appropriate vaccination strategies and evaluating their impact.We have systematically reviewed published studies reporting nasopharyngeal or oropharyngeal carriage of S. pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Staphylococcus aureus, and Neisseria meningitidis in children and adults in low and lower-middle income countries. Studies reporting pneumococcal carriage for healthy children <5 years of age were selected for a meta-analysis. The prevalences of carriage for S. pneumoniae, H. influenzae, and M. catarrhalis were generally higher in low income than in lower-middle income countries and were higher in young children than in adults. The prevalence of S. aureus was high in neonates. Meta-analysis of data from young children before the introduction of PCVs showed a pooled prevalence estimate of 64.8% (95% confidence interval, 49.8%-76.1% in low income countries and 47.8% (95% confidence interval, 44.7%-50.8% in lower-middle income countries. The most frequent serotypes were 6A, 6B, 19A, 19F, and 23F.In low and lower-middle income countries, pneumococcal carriage is frequent, especially in children, and the spectrum of serotypes is wide. However, because data are limited, additional studies are needed to adequately assess the impact of PCV introduction on carriage of respiratory bacteria in these countries.

  18. Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

    NARCIS (Netherlands)

    Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.

    2015-01-01

    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

  19. Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

    NARCIS (Netherlands)

    Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.; Nijland, Reindert; Veening, Jan-Willem

    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

  20. Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

    NARCIS (Netherlands)

    W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell

    2007-01-01

    textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we

  1. Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

    NARCIS (Netherlands)

    Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.

    Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that

  2. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

    2016-01-01

    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  3. N-acetylglucosamine-Mediated Expression of nagA and nagB in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Henriques-Normark, Birgitta; Kuipers, Oscar P

    2016-01-01

    In this study, we have explored the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylglucosamine (NAG). Transcriptome comparison of S. pneumoniae D39 wild-type grown in chemically defined medium (CDM) in the presence of 0.5% NAG to that grown in the presence of 0.5% glucose

  4. Characterization and transfer studies of macrolide resistance genes in Streptococcus pneumoniae from Denmark

    DEFF Research Database (Denmark)

    Nielsen, Karen L; Hammerum, Anette M; Lambertsen, Lotte M

    2010-01-01

    Over the last decade, erythromycin resistance has been increasing in frequency in Streptococcus pneumoniae in Denmark. In the present study, 49 non-related erythromycin-resistant S. pneumoniae isolates from invasive sites and 20 isolates from non-invasive sites were collected; antimicrobial...

  5. Clonal distribution of pneumococcal serotype 19F isolates from Ghana

    DEFF Research Database (Denmark)

    Sparding, Nadja; Dayie, Nicholas Tete Kwaku Dzifa; Mills, Richael O.

    2015-01-01

    Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Pneumococcal strains are classified according to their capsular polysaccharide and more than 90 different serotypes are currently known. In this project, three distinct groups of pneumococcal carriage isolates from Gh...... in Ghana in that many new clones were identified. This supports the importance of continued monitoring of pneumococcal carriage in Ghana and elsewhere when vaccines, e.g., PCV-13, have been introduced to monitor the possible future spread of antimicrobial resistant clones....

  6. Pneumococcal Carriage in Children under Five Years in Uganda-Will Present Pneumococcal Conjugate Vaccines Be Appropriate?

    Directory of Open Access Journals (Sweden)

    Ann Lindstrand

    Full Text Available Pneumonia is the major cause of death in children globally, with more than 900,000 deaths annually in children under five years of age. Streptococcus pneumoniae causes most deaths, most often in the form of community acquired pneumonia. Pneumococcal conjugate vaccines (PCVs are currently being implemented in many low-income countries. PCVs decrease vaccine-type pneumococcal carriage, a prerequisite for invasive pneumococcal disease, and thereby affects pneumococcal disease and transmission. In Uganda, PCV was launched in 2014, but baseline data is lacking for pneumococcal serotypes in carriage.To study pneumococcal nasopharyngeal carriage and serotype distribution in children under 5 years of age prior to PCV introduction in Uganda.Three cross-sectional pneumococcal carriage surveys were conducted in 2008, 2009 and 2011, comprising respectively 150, 587 and 1024 randomly selected children aged less than five years from the Iganga/Mayuge Health and Demographic Surveillance Site. The caretakers were interviewed about illness history of the child and 1723 nasopharyngeal specimens were collected. From these, 927 isolates of S. pneumoniae were serotyped.Overall, the carriage rate of S. pneumoniae was 56% (957/1723. Pneumococcal carriage was associated with illness on the day of the interview (OR = 1.50, p = 0.04. The most common pneumococcal serotypes were in descending order 19F (16%, 23F (9%, 6A (8%, 29 (7% and 6B (7%. One percent of the strains were non-typeable. The potential serotype coverage rate for PCV10 was 42% and 54% for PCV13.About half of circulating pneumococcal serotypes in carriage in the Ugandan under-five population studied was covered by available PCVs.

  7. Effectiveness of and obstacles to antibiotic streamlining to amoxicillin monotherapy in bacteremic pneumococcal pneumonia.

    Science.gov (United States)

    Blot, Mathieu; Pivot, Diane; Bourredjem, Abderrahmane; Salmon-Rousseau, Arnaud; de Curraize, Claire; Croisier, Delphine; Chavanet, Pascal; Binquet, Christine; Piroth, Lionel

    2017-09-01

    Antibiotic streamlining is pivotal to reduce the emergence of resistant bacteria. However, whether streamlining is frequently performed and safe in difficult situations, such as bacteremic pneumococcal pneumonia (BPP), has still to be assessed. All adult patients admitted to Dijon Hospital (France) from 2005 to 2013 who had BPP without complications, and were alive on the third day were enrolled. Clinical, biological, radiological, microbiological and therapeutic data were recorded. A first analysis was conducted to assess factors associated with being on amoxicillin on the third day. A second analysis, adjusting for a propensity score, was performed to determine whether 30-day mortality was associated with streamlining to amoxicillin monotherapy. Of the 196 patients hospitalized for BPP, 161 were still alive on the third day and were included in the study. Treatment was streamlined to amoxicillin in 60 patients (37%). Factors associated with not streamlining were severe pneumonia (OR 3.11, 95%CI [1.23-7.87]) and a first-line antibiotic combination (OR 3.08, 95%CI [1.34-7.09]). By contrast, starting with amoxicillin monotherapy correlated inversely with the risk of subsequent treatment with antibiotics other than amoxicillin (OR 0.06, 95%CI [0.01-0.30]). The Cox model adjusted for the propensity-score analysis showed that streamlining to amoxicillin during BPP was not significantly associated with a higher risk of 30-day mortality (HR 0.38, 95%CI [0.08-1.87]). Streamlining to amoxicillin is insufficiently implemented during BPP. This strategy is safe and potentially associated with ecological and economic benefits; therefore, it should be further encouraged, particularly when antibiotic combinations are started for severe pneumonia. Copyright © 2017. Published by Elsevier B.V.

  8. Crystallization and preliminary X-ray diffraction analysis of phosphoglycerate kinase from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Bernardo-García, Noelia; Bartual, Sergio G.; Fulde, Marcus; Bergmann, Simone; Hermoso, Juan A.

    2011-01-01

    Phosphoglycerate kinase, a two-domain enzyme involved in the glycolytic pathway, has been crystallized. Both the N-terminal domain and a ternary complex of the full-length enzyme with substrates were crystallized by the sitting-drop vapour-diffusion method. Inclusion of the substrates was critical in order to obtain crystals of the full-length protein. Phosphoglycerate kinase (PGK) is a widespread two-domain enzyme that plays a critical role in the glycolytic pathway. Several glycolytic enzymes from streptococci have been identified as surface-exposed proteins that are involved in streptococcal virulence by their ability to bind host proteins. This binding allows pneumococcal cells to disseminate through the epithelial and endothelial layers. Crystallization of PGK from Streptococcus pneumoniae yielded orthorhombic crystals (space group I222, unit-cell parameters a = 62.73, b = 75.38, c = 83.63 Å). However, the unit cell of these crystals was not compatible with the presence of full-length PGK. Various analytical methods showed that only the N-terminal domain of PGK was present in the I222 crystals. The ternary complex of PGK with adenylyl imidodiphosphate (AMP-PNP) and 3-phospho-d-glycerate (3PGA) produced monoclinic crystals (space group P2 1 , unit-cell parameters a = 40.35, b = 78.23, c = 59.03 Å, β = 96.34°). Molecular replacement showed that this new crystal form contained full-length PGK, thereby indicating the relevance of including substrates in order to avoid proteolysis during the crystallization process

  9. ABC transporter content diversity in Streptococcus pneumoniae impacts competence regulation and bacteriocin production.

    Science.gov (United States)

    Wang, Charles Y; Patel, Nisha; Wholey, Wei-Yun; Dawid, Suzanne

    2018-06-19

    The opportunistic pathogen Streptococcus pneumoniae (pneumococcus) uses natural genetic competence to increase its adaptability through horizontal gene transfer. One method of acquiring DNA is through predation of neighboring strains with antimicrobial peptides called "bacteriocins." Competence and production of the major family of pneumococcal bacteriocins, pneumocins, are regulated by the quorum-sensing systems com and blp , respectively. In the classical paradigm, the ABC transporters ComAB and BlpAB each secretes its own system's signaling pheromone and in the case of BlpAB also secretes the pneumocins. While ComAB is found in all pneumococci, only 25% of strains encode an intact version of BlpAB [BlpAB(+)] while the rest do not [BlpAB(-)]. Contrary to the classical paradigm, it was previously shown that BlpAB(-) strains can activate blp through ComAB-mediated secretion of the blp pheromone during brief periods of competence. To better understand the full extent of com - blp crosstalk, we examined the contribution of each transporter to competence development and pneumocin secretion. We found that BlpAB(+) strains have a greater capacity for competence activation through BlpAB-mediated secretion of the com pheromone. Similarly, we show that ComAB and BlpAB are promiscuous and both can secrete pneumocins. Consequently, differences in pneumocin secretion between BlpAB(+) and BlpAB(-) strains derive from the regulation and kinetics of transporter expression rather than substrate specificity. We speculate that BlpAB(-) strains (opportunists) use pneumocins mainly in a narrowly tailored role for DNA acquisition and defense during competence while BlpAB(+) strains (aggressors) expand their use for the general inhibition of rival strains. Copyright © 2018 the Author(s). Published by PNAS.

  10. ROLE OF STREPTOCOCCUS PNEUMONIAE IN THE STRUCTURE OF BACTERIAL INFECTIONS IN THE CHILDREN HOSPITALIZED TO INPATIENT HOSPITALS IN MOSCOW IN 2011–2012

    Directory of Open Access Journals (Sweden)

    A. A. Baranov

    2013-01-01

    Full Text Available Data on the spread of Streptococcus pneumoniae serotypes in the RF are extremely limited. 3 pneumococcal conjugated vaccines are approved inRussia; however, neither has yet been employed in the framework of the national population immunization program. At the same time, it is the dataon the serotype range of pneumococcal infections that may be considered the prognostic efficacy criterion for the national vaccination programs.The objective of this research is identification of the circulating S. pneumoniae serotypes and spread of pneumococcal etiology infections in the structure of bacterial infections in the infants hospitalized to 5 inpatient hospital of Moscow in 2011–2012. The trial involved 864 patients in tote. Vast majority of patients (86% had acute purulent otitis media and sinusitis. Community-acquired pneumonia was diagnosed in 9% of patients, sepsis and bacteremia — in 3.6%; purulent meningitis — 1.2% of patients. It has been revealed that S. pneumoniae is the primary pathogen in the structure of nasopharyngeal carriage in the children under 5 years of age hospitalized with acute bacterial infections, and the primary bacterial causative agent of acute otitis media at this age. Nasopharyngeal pneumococcal carriage analysis revealed the prevalent serotypes — 19F, 14, 23F, 3, 6A and B; they were present in 3/4 of all cases; 19F was the most frequent (> 20%. Diversity of the S. pneumoniae serotypes detected in middle ear liquid was less significant — 17 serotypes (in comparison with 24 serotypes in nasopharynx. The 5 prevalent serotypes were 19F, 3, 14, 23F, 6B and 19A (> 75% in tote. Detection rate of serotypes 3 and 19A in middle ear liquid significantly exceeded the detection rate of these serotypes in case of nasopharyngeal carriage. The study of invasive infections revealed serotypes 14, 23F, 3 and 15C. These data may be used as a benchmark for future monitoring and evaluation of effect of PCV vaccines on epidemiology of

  11. Conservative sex and the benefits of transformation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Daniel J P Engelmoer

    Full Text Available Natural transformation has significant effects on bacterial genome evolution, but the evolutionary factors maintaining this mode of bacterial sex remain uncertain. Transformation is hypothesized to have both positive and negative evolutionary effects on bacteria. It can facilitate adaptation by combining beneficial mutations into a single individual, or reduce the mutational load by exposing deleterious alleles to natural selection. Alternatively, it may expose transformed cells to damaged or otherwise mutated environmental DNA and is energetically expensive. Here, we examine the long-term effects of transformation in the naturally competent species Streptococcus pneumoniae by evolving populations of wild-type and competence-deficient strains in chemostats for 1000 generations. Half of these populations were exposed to periodic mild stress to examine context-dependent benefits of transformation. We find that competence reduces fitness gain under benign conditions; however, these costs are reduced in the presence of periodic stress. Using whole genome re-sequencing, we show that competent populations fix fewer new mutations and that competence prevents the emergence of mutators. Our results show that during evolution in benign conditions competence helps maintain genome stability but is evolutionary costly; however, during periods of stress this same conservativism enables cells to retain fitness in the face of new mutations, showing for the first time that the benefits of transformation are context dependent.

  12. Polarity of recombination in transformation of Streptococcus pneumoniae.

    Science.gov (United States)

    Pasta, F; Sicard, M A

    1999-03-16

    In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5'- and 3'-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami- transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5' to the deletion, showing that, in vivo, the 5' side is strongly favored by recombination. Further results suggest that exchanges occurring from 5' to 3' relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5' preference.

  13. A Novel Function for the Streptococcus pneumoniae Aminopeptidase N: Inhibition of T Cell Effector Function through Regulation of TCR Signaling

    Directory of Open Access Journals (Sweden)

    Lance K. Blevins

    2017-11-01

    Full Text Available Streptococcus pneumoniae (Spn causes a variety of disease states including fatal bacterial pneumonia. Our previous finding that introduction of Spn into an animal with ongoing influenza virus infection resulted in a CD8+ T cell population with reduced effector function gave rise to the possibility of direct regulation by pneumococcal components. Here, we show that treatment of effector T cells with lysate derived from Spn resulted in inhibition of IFNγ and tumor necrosis factor α production as well as of cytolytic granule release. Spn aminopeptidase N (PepN was identified as the inhibitory bacterial component and surprisingly, this property was independent of the peptidase activity found in this family of proteins. Inhibitory activity was associated with reduced activation of ZAP-70, ERK1/2, c-Jun N-terminal kinase, and p38, demonstrating the ability of PepN to negatively regulate TCR signaling at multiple points in the cascade. These results reveal a novel immune regulatory function for a bacterial aminopeptidase.

  14. Dalbavancin Activity When Tested against Streptococcus pneumoniae Isolated in Medical Centers on Six Continents (2011 to 2014).

    Science.gov (United States)

    Jones, Ronald N; Schuchert, Jason E; Mendes, Rodrigo E

    2016-06-01

    Dalbavancin, a novel lipoglycopeptide, was approved for use in 2014 by regulatory agencies in the United States and Europe for the treatment of skin and skin structure infections. The activity of dalbavancin was also widely assessed by determination of its activity against Streptococcus pneumoniae clinical isolates collected from patients on six continents monitored during two time intervals (2011 to 2013 and 2014). A total of 18,186 pneumococcal isolates were obtained from 49 nations and submitted to a monitoring laboratory as part of the SENTRY Antimicrobial Surveillance Program for reference susceptibility testing. The potency of dalbavancin against S. pneumoniae was consistent across the years that it was monitored, with the MIC50 and MIC90 being 0.015 and 0.03 μg/ml, respectively, and all isolates were inhibited by ≤0.12 μg/ml. The activity of dalbavancin was not adversely influenced by nonsusceptibility to β-lactams (ceftriaxone or penicillin), macrolides, clindamycin, fluoroquinolones, or tetracyclines or multidrug resistance (MDR). Regional variations in dalbavancin activity were not detected, but S. pneumoniae strains isolated in the Asia-Pacific region were more likely to be nonsusceptible to penicillin and ceftriaxone as well as to be MDR than strains isolated in North or South America and Europe. Direct comparisons of potency illustrated that dalbavancin (MIC50 and MIC90, 0.015 and 0.03 μg/ml, respectively) was 16-fold or more active than vancomycin (MIC50, 0.25 μg/ml), linezolid (MIC50, 1 μg/ml), levofloxacin (MIC50, 1 μg/ml), ceftriaxone (MIC90, 1 μg/ml), and penicillin (MIC90, 2 μg/ml). In conclusion, dalbavancin had potent and consistent activity against this contemporary (2011 to 2014) collection of S. pneumoniae isolates. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. Endocarditis in Greenland with special reference to endocarditis caused by Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Madsen, Rasmus Gaarde; Ladefoged, Karin; Kjaergaard, Jens Jørgen

    2009-01-01

    OBJECTIVES: The aim of this retrospective study was to determine the incidence and outcome of infectious endocarditis in Greenland with an emphasis on pneumococcal endocarditis. STUDY DESIGN: Retrospective, non-interventional study. METHODS: Review of files and medical history of all patients...... with infectious endocarditis from the Patient Registry in Greenland in the 11-year period 1995-2005. RESULTS: There were 25 cases of endocarditis, giving an incidence rate of 4.0/100,000 per year. Twenty-four percent of these cases were caused by Streptoccous pneumonia, which is significantly more frequent than...... in studies on Caucasian populations, where pneumococcal infection was seen in 1-3% of endocarditis cases. The overall mortality rate was 12%. Pneumococcal endocarditis (PE) had the clinical characteristics of fulminant disease with frequent heart failure, complications and need for surgery. Among cases...

  16. Effect of early measles vaccine on pneumococcal colonization

    DEFF Research Database (Denmark)

    Hansen, Nadja Skadkær; Byberg, Stine; Hervig Jacobsen, Lars

    2017-01-01

    BACKGROUND: Measles vaccine (MV) may have non-specific beneficial effects for child health and particularly seems to prevent respiratory infections. Streptococcus pneumoniae is the leading cause of bacterial pneumonia among children worldwide, and nasopharyngeal colonization precedes infection....... OBJECTIVE: We investigated whether providing early MV at 18 weeks of age reduced pneumococcal colonization and/or density up to 9 months of age. METHOD: The study was conducted in 2013-2014 in Guinea-Bissau. Pneumococcal vaccine was not part of the vaccination program. Infants aged 18 weeks were block...

  17. The Transcriptome of Streptococcus pneumoniae Induced by Local and Global Changes in Supercoiling

    Directory of Open Access Journals (Sweden)

    Adela G. de la Campa

    2017-07-01

    Full Text Available The bacterial chromosome is compacted in a manner optimal for DNA transactions to occur. The degree of compaction results from the level of DNA-supercoiling and the presence of nucleoid-binding proteins. DNA-supercoiling is homeostatically maintained by the opposing activities of relaxing DNA topoisomerases and negative supercoil-inducing DNA gyrase. DNA-supercoiling acts as a general cis regulator of transcription, which can be superimposed upon other types of more specific trans regulatory mechanism. Transcriptomic studies on the human pathogen Streptococcus pneumoniae, which has a relatively small genome (∼2 Mb and few nucleoid-binding proteins, have been performed under conditions of local and global changes in supercoiling. The response to local changes induced by fluoroquinolone antibiotics, which target DNA gyrase subunit A and/or topoisomerase IV, involves an increase in oxygen radicals which reduces cell viability, while the induction of global supercoiling changes by novobiocin (a DNA gyrase subunit B inhibitor, or by seconeolitsine (a topoisomerase I inhibitor, has revealed the existence of topological domains that specifically respond to such changes. The control of DNA-supercoiling in S. pneumoniae occurs mainly via the regulation of topoisomerase gene transcription: relaxation triggers the up-regulation of gyrase and the down-regulation of topoisomerases I and IV, while hypernegative supercoiling down-regulates the expression of topoisomerase I. Relaxation affects 13% of the genome, with the majority of the genes affected located in 15 domains. Hypernegative supercoiling affects 10% of the genome, with one quarter of the genes affected located in 12 domains. However, all the above domains overlap, suggesting that the chromosome is organized into topological domains with fixed locations. Based on its response to relaxation, the pneumococcal chromosome can be said to be organized into five types of domain: up-regulated, down

  18. Exploring hotspots of pneumococcal pneumonia and potential impacts of ejecta dust exposure following the Christchurch earthquakes.

    Science.gov (United States)

    Pearson, Amber L; Kingham, Simon; Mitchell, Peter; Apparicio, Philippe

    2013-12-01

    The etiology of pneumococcal pneumonia (PP) is well-known. Yet, some events may increase its incidence. Natural disasters may worsen air quality, a risk factor for PP. We investigated spatial/spatio-temporal clustering of PP pre- and post-earthquakes in Christchurch, New Zealand. The earthquakes resulted in deaths, widespread damage and liquefaction ejecta (a source of air-borne dust). We tested for clusters and associations with ejecta, using 97 cases (diagnosed 10/2008-12/2011), adjusted for age and area-level deprivation. The strongest evidence to support the potential role of ejecta in clusters of PP cases was the: (1) geographic shift in the spatio-temporal cluster after deprivation adjustment to match the post-earthquake clusters and; (2) increased relative risk in the fully-adjusted post-earthquake compared to the pre-earthquake cluster. The application of spatial statistics to study PP and ejecta are novel. Further studies to assess the long-term impacts of ejecta inhalation are recommended particularly in Christchurch, where seismic activity continues. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Severe febrile systemic reaction to pneumococcal vaccine.

    Science.gov (United States)

    Hasan, Syed; Yousef, Mahmoud; Shridharani, Sachin

    2005-02-01

    Polyvalent pneumococcal polysaccharide vaccine (Pneumovax, PPV) has been shown to substantially reduce the risk of Streptococcus pneumoniae infections in susceptible individuals. Side effects, such as mild local erythema, induration, pain and fever, have been reported with various frequencies. Rarely, systemic symptoms, including high fever, headache, nausea and photophobia, have been reported in the literature. This case report describes a 38-year-old male who developed severe and prolonged local and systemic symptoms necessitating hospitalization following a dose of pneumovax.

  20. Thrombotic Thrombocytopenic Purpura Associated with Pneumococcal Sepsis

    Directory of Open Access Journals (Sweden)

    Jeffrey R Schriber

    1993-01-01

    Full Text Available The first documented case of thrombotic thrombocytopenic purpura (TTP associated with pneumococcal septicemia is reported. This association has been previously demonstrated with hemolytic uremic syndrome. The patient presented with recurrent seizures, oliguric renal failure, fever, thrombocytopenia and microangiopathic hemolytic anemia; coagulation studies were normal. Blood and sputum cultures were positive for Streptococcus pneumoniae. The patient responded to therapy with plasmapheresis and antiplatelet agents as well as antibiotics. Coincident infection should be searched for in all cases of TTP.

  1. Determination of Serotypes and Antibiotic Resistance in Streptococcus Pneumoniae

    Directory of Open Access Journals (Sweden)

    Deniz Akgun Karapinar

    2016-01-01

    Full Text Available Aim: In this study, the distribution of serogroup/serotype and antibiotic susceptibility testing of Streptococcus pneumoniae strains, recovered from pediatric and adult patients were evaluated. Material and Method: A total of 80 clinical isolates recovered from 19 pediatric and 61 adult patients were performed by latex aglutination method and antibiotic susceptibility tests in Istanbul University, Istanbul Faculty of Medicine, Medical Microbiology Laboratories. Results: Sixty-two strains (76 %, were serogroup/serotyped and 18 (23 % strains couldn%u2019t serogroup/serotyped. The most frequent identified serogroups were 19, 14, 23, 6, 4 in pediatrics, and 3, 19, 23 and 9 in adults. In adults, serogroups 3, 9, 5, 8, 18, 1, 15 were determined, but these serogroups weren%u2019t found in pediatrics. Vaccine serotypes rates were found as 53 % in pediatric and as 85 % in adults. The serogroups 2, 7, 10, 11, 12, 17, 20, 22, 33 were not detected, which are available in vaccine serotypes. Only 1 (1 % strain was found to exhibit low level resistance to penicillin and high level resistance wasn%u2019t found in any strain. Resistant results for trimethoprim-sulfamethoxazole, erythromycin, chloramphenicol and ofloxacin were found as 45 (56 %, 22 (27.5 %, 7 (9 %, 2 (2.5 %, respectively. All strains were found susceptible to vancomycin, linezolid and levofloxacin. The most resistant serogroups were 19, 23, 9 and 14 in the tested antibiotics. Multidrug resistance was found in 9 (11 % strains and these strains were found as serogroups 19, 23, 9, 6 and 14. Discussion: The epidemiological studies are important that the distribution of serotype and antibiotic resistance vary depending on many factors like age, and geographic region.

  2. JST Thesaurus Headwords and Synonyms: Streptococcus pneumoniae [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Streptococcus pneumoniae 名詞 一般 * ...* * * 肺炎球菌 ハイエンキュウキン ハイエンキューキン Thesaurus2015 200906003627228649 C LS07 UNKNOWN_2 Streptococcus pneumoniae

  3. Septic arthritis of shoeulder caused by Streptococcus pneumoniae serotype 23F in a female infant. Report of a case

    Directory of Open Access Journals (Sweden)

    Flores Nava Gerardo

    2014-07-01

    Full Text Available We present the case of a female infant previously vaccinated against Streptococcus pneumoniae who developed a septic arthritis in the right shoulder. An artrothomy was performed. The culture of the sy- novial fluid was positive for serotype 23F Streptococcus pneumonia.

  4. Impact of Pneumococcal Conjugate Vaccines on Pneumonia Hospitalizations in High- and Low-Income Subpopulations in Brazil

    DEFF Research Database (Denmark)

    Warren, Joshua L.; Shioda, Kayoko; Kürüm, Esra

    2017-01-01

    Background Pneumococcal conjugate vaccines (PCVs) are being used worldwide. A key question is whether the impact of PCVs on pneumonia is similar in low- and high-income populations. However, most low-income countries, where the burden of disease is greatest, lack reliable data that can be used...... to evaluate the impact. Data from middle-income countries that have both low- and high-income subpopulations can provide a proxy measure for the impact of the vaccine in low-income countries. Methods We evaluated the impact of PCV10 on hospitalizations for all-cause pneumonia in Brazil, a middle......-income country with localities that span a broad range of human development index (HDI) levels. We used complementary time series and spatiotemporal methods (synthetic controls and hierarchical Bayesian spatial regression) to test whether the decline in pneumonia hospitalizations associated with vaccine...

  5. Lung abscess due to Streptococcus pneumoniae simulating pulmonary tuberculosis: presentation of two cases

    Directory of Open Access Journals (Sweden)

    Alessandro Perazzo

    2014-03-01

    Full Text Available In the past, anaerobes were the most common cause of community-acquired lung abscess; Streptococcus species were the second most common cause. In recent years, this has changed. Klebsiella pneumoniae is now most common cause of community- acquired lung abscess, although Streptococcus species remain pathogen of major importance. We present two cases of pulmonary cavitation due to Streptococcus pneumoniae which resembled pulmonary tuberculosis with regards to their history and radiological findings. These are examples of a common diagnosis presenting in an uncommon way. Our cases had some peculiarities: they had a clinical picture strongly suggestive of pulmonary tuberculosis or lung cancer rather than necrotizing infectious pneumonia in patients with no comorbidities or underlying diseases (including oral or dental pathologies. Radiological findings did not help the clinicians: pulmonary tuberculosis was the first diagnostic hypothesis in both cases. An underlying lung cancer was excluded in the first case only after invasive pulmonary procedures.

  6. Polymeric immunoglobulin receptor-mediated invasion of Streptococcus pneumoniae into host cells requires a coordinate signaling of SRC family of protein-tyrosine kinases, ERK, and c-Jun N-terminal kinase.

    Science.gov (United States)

    Agarwal, Vaibhav; Asmat, Tauseef M; Dierdorf, Nina I; Hauck, Christof R; Hammerschmidt, Sven

    2010-11-12

    Streptococcus pneumoniae are commensals of the human nasopharynx with the capacity to invade mucosal respiratory cells. PspC, a pneumococcal surface protein, interacts with the human polymeric immunoglobulin receptor (pIgR) to promote bacterial adherence to and invasion into epithelial cells. Internalization of pneumococci requires the coordinated action of actin cytoskeleton rearrangements and the retrograde machinery of pIgR. Here, we demonstrate the involvement of Src protein-tyrosine kinases (PTKs), focal adhesion kinase (FAK), extracellular signal-regulated kinase (ERK), and c-Jun N-terminal kinase (JNK) but not p38 mitogen-activated protein kinases (MAPK) in pneumococcal invasion via pIgR. Pharmacological inhibitors of PTKs and MAPKs and genetic interference with Src PTK and FAK functions caused a significant reduction of pIgR-mediated pneumococcal invasion but did not influence bacterial adhesion to host cells. Furthermore, pneumococcal ingestion by host cells induces activation of ERK1/2 and JNK. In agreement with activated JNK, its target molecule and DNA-binding protein c-Jun was phosphorylated. We also show that functionally active Src PTK is essential for activation of ERK1/2 upon pneumococcal infections. In conclusion, these data illustrate the importance of a coordinated signaling between Src PTKs, ERK1/2, and JNK during PspC-pIgR-mediated uptake of pneumococci by host epithelial cells.

  7. Serotype distribution and antibiotic susceptibility of Streptococcus pneumoniae strains in the south of Tunisia: A five-year study (2012–2016 of pediatric and adult populations

    Directory of Open Access Journals (Sweden)

    Sonia Ktari

    2017-12-01

    Full Text Available Objectives: To analyze the serotype distribution of Streptococcus pneumoniae clinical isolates collected in the south of Tunisia over a 5-year period in different age groups and to assess their antimicrobial susceptibility patterns. Methods: A total of 305 non-duplicate S. pneumoniae isolates were collected between January 2012 and December 2016 at the university hospital in Sfax, Tunisia. All isolates were serotyped by multiplex PCR. The antibiotic susceptibility of all isolates was determined using the disk diffusion test or Etest assay. Results: Among the 305 pneumococcal isolates, 76 (24.9% were invasive and 229 (75.1% were non-invasive. The most common serotypes were 19F (20%, 14 (16.7%, 3 (9.2%, 23F (7.5%, 19A (5.9%, and 6B (5.9%. Potential immunization coverage rates for pneumococcal conjugate vaccines PCV7, PCV10, and PCV13 were 58%, 59.3%, and 78.7%, respectively. Three-quarters (75.3% of pneumococcal isolates were non-susceptible to penicillin. The resistance rate to erythromycin was 71.4%. Only two isolates were resistant to levofloxacin. Conclusions: 19F and 14 were the most prevalent serotypes in the south of Tunisia. The inclusion of a PCV in the immunization program could be useful for reducing the burden of pneumococcal diseases. The high resistance rate to penicillin and macrolides is alarming. Prudent use of antibiotics is crucial to prevent the selection of multidrug-resistant pneumococci. Keywords: Streptococcus pneumoniae, Antibiotic, Serotype, PCV, Tunisia

  8. The Importance of TLR2 and Macrophages in Modulating a Humoral Response after Encountering Streptococcus pneumoniae

    Science.gov (United States)

    2008-03-26

    Chapter 3 Submited as: Sam Vasilevsky, Jesus Colino, Roman Puliaev, David H. Canaday, and Clifford M...general microbiology 138:249- 259. 7. Musher , D. M. 1992. Infections caused by Streptococcus pneumoniae: clinical spectrum, pathogenesis, immunity, and...Pneumonia and Its Implications for Antimicrobial Resistance Chest 115:1-2. 230. Musher , D. M., I. Alexandraki, E. A. Graviss, N. Yanbeiy, A. Eid, L

  9. Streptococcus pneumoniae as a cause of lactational mastitis

    DEFF Research Database (Denmark)

    Hald, Sara Vester; Schønheyder, Henrik Carl

    2018-01-01

    Pneumococci are predominant in respiratory tract infections but may have unusual presentations such as lactational mastitis. We report a 29-year-old breastfeeding woman with pneumococcal mastitis confirmed by positive blood culture and culture of milk. Previously, a few similar cases have been...

  10. Streptococcus pneumoniae as a cause of lactational mastitis

    DEFF Research Database (Denmark)

    Hald, Sara Vester; Schønheyder, Henrik Carl

    2018-01-01

    Pneumococci are predominant in respiratory tract infections but may have unusual presentations such as lactational mastitis. We report a 29-year-old breastfeeding woman with pneumococcal mastitis confirmed by positive blood culture and culture of milk. Previously, a few similar cases have been re...

  11. Radiolabeling of gemifloxacin with technetium-99m and biological evaluation in artificially Streptococcus pneumoniae infected rats

    International Nuclear Information System (INIS)

    Syed Qaiser Shah; Muhammad Rafiullah Khan

    2011-01-01

    In the current investigation complexation of the gemifloxacin (GIN) with technetium-99 m ( 99m Tc) and its biological evaluation in artificially Streptococcus pneumoniae (S. pneumoniae) infected rats was assessed as potential S. pneumoniae infection radiotracer. Radiochemically the 99m Tc-GIN complex was further analyzed in terms of stability in saline, in vitro stability in serum at 37 deg C, in vitro binding with S. pneumoniae and biodistribution in artificially S. pneumoniae (living and heat killed) infected rats. The complex was found 97.25 ± 0.25% radiochemically stable in saline at 30 min after reconstitution. The stability of the 99m Tc-GIN complex was decreased to 90.50 ± 0.20% within 240 min after reconstitution. In serum the 99m Tc-GIN complex showed stable profile with the appearance of 18.85% free tracer within 16 h of incubation. The 99m Tc-GIN complex showed saturated in vitro binding with S. pneumoniae after different intervals. Almost five fold uptake was observed in living S. pneumoniae infected muscle of the rats as compared to the inflamed and normal muscle. No significant difference in the uptake of heat killed S. pneumoniae infected, inflamed and normal muscles of the rats. The high RCP yield in saline, in vitro permanence in serum, in vitro binding with living S. pneumoniae and biodistribution in artificially S. pneumoniae infected rats we recommend the 99m Tc-GIN as potential S. pneumoniae infection radiotracer. (author)

  12. Efficacy of some synthetic antibiotics on Streptococcus pneumoniae ...

    African Journals Online (AJOL)

    Effects of some synthetic antibiotics on Streptococcus pnemoniae and Proteus mirabilis isolated from cultured Clarias gariepinus, an important food fish raised in a concrete tank was carried out to ascertain their remedies on mortalities of the Clarias gariepinus adult fish. Streptococcus pnemoniae and Proteus mirabilis were ...

  13. Population biology of Streptococcus pneumoniae in West Africa: multilocus sequence typing of serotypes that exhibit different predisposition to invasive disease and carriage.

    Directory of Open Access Journals (Sweden)

    Eric S Donkor

    Full Text Available Little is known about the population biology of Streptococcus pneumoniae in developing countries, although the majority of pneumococcal infections occur in this setting. The aim of the study was to apply MLST to investigate the population biology of S. pneumoniae in West Africa.Seventy three invasive and carriage S. pneumoniae isolates from three West African countries including The Gambia, Nigeria and Ghana were investigated. The isolates covered seven serotypes (1, 3, 5, 6A, 11, 14, 23F and were subjected to multilocus sequence typing and antibiotic susceptibility testing.Overall, 50 different sequence types (STs were identified, of which 38% (29 were novel. The most common ST was a novel clone-ST 4012 (6.5%, and some clones including STs 913, 925, 1737, 2160 and 3310 appeared to be specific to the study region. Two STs including ST 63 and ST 4012 were associated with multiple serotypes indicating a history of serotype switching. ST 63 was associated with serotypes 3 and 23F, while ST 4012 was associated with serotypes 6A and 23. eBURST analyses using the stringent 6/7 identical loci definition grouped the 50 STs into 5 clonal complexes and 65 singletons, expressing a high level of genetic diversity among the isolates. Compared to the other serotypes, serotypes 1 and 5 isolates appeared to be more clonal. Internationally recognized antibiotic resistant clones of S. pneumoniae were generally absent in the population investigated and the only multidrug resistant isolate identified (1/66 belong to the Pneumocococcal Epidemiology Network clone ST 63.The pneumococcal population in West Africa is quite divergent, and serotypes that are common in invasive disease (such as serotypes 1 and 5 are more likely to be clonal than serotypes that are common in carriage.

  14. Streptococcus pneumoniae Cell-Wall-Localized Phosphoenolpyruvate Protein Phosphotransferase Can Function as an Adhesin: Identification of Its Host Target Molecules and Evaluation of Its Potential as a Vaccine.

    Directory of Open Access Journals (Sweden)

    Yaffa Mizrachi Nebenzahl

    Full Text Available In Streptococcus pneumonia, phosphoenolpyruvate protein phosphotransferase (PtsA is an intracellular protein of the monosaccharide phosphotransferase systems. Biochemical and immunostaining methods were applied to show that PtsA also localizes to the bacterial cell-wall. Thus, it was suspected that PtsA has functions other than its main cytoplasmic enzymatic role. Indeed, recombinant PtsA and anti-rPtsA antiserum were shown to inhibit adhesion of S. pneumoniae to cultured human lung adenocarcinoma A549 cells. Screening of a combinatorial peptide library expressed in a filamentous phage with rPtsA identified epitopes that were capable of inhibiting S. pneumoniae adhesion to A549 cells. The insert peptides in the phages were sequenced, and homologous sequences were found in human BMPER, multimerin1, protocadherin19, integrinβ4, epsin1 and collagen type VIIα1 proteins, all of which can be found in A549 cells except the latter. Six peptides, synthesized according to the homologous sequences in the human proteins, specifically bound rPtsA in the micromolar range and significantly inhibited pneumococcal adhesion in vitro to lung- and tracheal-derived cell lines. In addition, the tested peptides inhibited lung colonization after intranasal inoculation of mice with S. pneumoniae. Immunization with rPtsA protected the mice against a sublethal intranasal and a lethal intravenous pneumococcal challenge. In addition, mouse anti rPtsA antiserum reduced bacterial virulence in the intravenous inoculation mouse model. These findings showed that the surface-localized PtsA functions as an adhesin, PtsA binding peptides derived from its putative target molecules can be considered for future development of therapeutics, and rPtsA should be regarded as a candidate for vaccine development.

  15. Epidemiology of Streptococcus pneumoniae causing acute otitis media among children in Southern Catalonia throughout 2007-2013: Incidence, serotype distribution and vaccine's effectiveness.

    Science.gov (United States)

    Ochoa-Gondar, O; Figuerola-Massana, E; Vila-Corcoles, A; Aguirre, C A; de Diego, C; Satue, E; Gomez, F; Raga, X

    2015-12-01

    This study investigated incidence and serotype distribution of Streptococcus pneumoniae causing acute otitis media (AOM) in Catalonian children, evaluating vaccination effectiveness in the current era of extended valency pneumococcal conjugate vaccines (PCVs). Population-based surveillance study that included all AOM cases with isolation of pneumococcus (from otic fluids/otorrea) identified among children ≤14 years in the region of Tarragona (Southern Catalonia, Spain) from 01/01/2007 to 31/12/2013. Prevalence of infections caused by serotypes covered by the different PCVs formulations were calculated for the periods before and after 30/06/2010 (date of PCV7/PCV13 replacement). The indirect cohort method was used to estimate PCV7/13 effectiveness against vaccine-type infections. A total of 78 children with a pneumococcal AOM were identified across study period, which meant an incidence rate of 23 cases per 100,000 population-year. Thirty-six cases (46.2%) occurred within the late PCV7 era and 42 cases (53.8%) during the early PCV13 era. Overall, the most common serotypes were type 19A (21.7%), type 3 (13.3%) and type 15B (6.7%). Prevalence of cases caused by serotypes included in PCV7 did not substantially change between the first and the second study period (from 10.3% to 12.9%), whereas prevalence of cases caused by PCV13 serotypes showed a decreasing trend between both periods (from 65.5% to 48.4%). The aggregate PCV7/13 effectiveness against vaccine-type infections was 72% (95% confidence interval: -26 to 94). Pneumococcal conjugate vaccination appears an acceptable preventive option to prevent pneumococcal AOM in infants. However, its serotype coverage and clinical effectiveness are not optimal. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  16. Infection by Streptococcus pneumoniae in children with or without radiologically confirmed pneumonia

    Directory of Open Access Journals (Sweden)

    Dafne C. Andrade

    2018-01-01

    Conclusions: Among children with clinical diagnosis of community‐acquired pneumonia submitted to chest radiograph, those with radiologically confirmed pneumonia present a higher rate of infection by S. pneumoniae when compared with those with a normal chest radiograph.

  17. In vivo capsular switch in Streptococcus pneumoniae--analysis by whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Fen Z Hu

    Full Text Available Two multidrug resistant strains of Streptococcus pneumoniae - SV35-T23 (capsular type 23F and SV36-T3 (capsular type 3 were recovered from the nasopharynx of two adult patients during an outbreak of pneumococcal disease in a New York hospital in 1996. Both strains belonged to the pandemic lineage PMEN1 but they differed strikingly in virulence when tested in the mouse model of IP infection: as few as 1000 CFU of SV36 killed all mice within 24 hours after inoculation while SV35-T23 was avirulent.Whole genome sequencing (WGS of the two isolates was performed (i to test if these two isolates belonging to the same clonal type and recovered from an identical epidemiological scenario only differed in their capsular genes? and (ii to test if the vast difference in virulence between the strains was mostly - or exclusively - due to the type III capsule. WGS demonstrated extensive differences between the two isolates including over 2500 single nucleotide polymorphisms in core genes and also differences in 36 genetic determinants: 25 of which were unique to SV35-T23 and 11 unique to strain SV36-T3. Nineteen of these differences were capsular genes and 9 bacteriocin genes.Using genetic transformation in the laboratory, the capsular region of SV35-T23 was replaced by the type 3 capsular genes from SV36-T3 to generate the recombinant SV35-T3* which was as virulent as the parental strain SV36-T3* in the murine model and the type 3 capsule was the major virulence factor in the chinchilla model as well. On the other hand, a careful comparison of strains SV36-T3 and the laboratory constructed SV35-T3* in the chinchilla model suggested that some additional determinants present in SV36 but not in the laboratory recombinant may also contribute to the progression of middle ear disease. The nature of this determinants remains to be identified.

  18. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

    NARCIS (Netherlands)

    Quintero, B.; Araque, M.; Gaast-de Jongh, C.E. van der; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P.W.M.

    2011-01-01

    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of

  19. Identification of the smallest structure capable of evoking opsonophagocytic antibodies against Streptococcus pneumoniae type 14

    NARCIS (Netherlands)

    Safari, D.; Dekker, H.A.T.; Joosten, J.A.; Michalik, D.; de Souza, A.C.; Adamo, R.; Lahmann, M.; Oscarson, S.; Kamerling, J.P.|info:eu-repo/dai/nl/070433941; Snippe, H.

    2008-01-01

    Synthetic overlapping oligosaccharide fragments of Streptococcus pneumoniae serotype 14 capsular polysaccharide (Pn14PS), {6)-[β-D-Galp-(14)-]β-D-GlcpNAc-(13)-β-D-Galp-(14)-β-D-Glcp-(1}n, were conjugated to CRM197 protein and injected into mice to determine the smallest immunogenic structure. The

  20. Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

    NARCIS (Netherlands)

    P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

    1995-01-01

    textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

  1. Pyruvate Oxidase Influences the Sugar Utilization Pattern and Capsule Production in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Carvalho, Sandra M.; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P.; Neves, Ana R.; Bijlsma, Jetta J. E.

    2013-01-01

    Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence,

  2. Bilateral Acromioclavicular Septic Arthritis as an Initial Presentation of Streptococcus pneumoniae Endocarditis

    Directory of Open Access Journals (Sweden)

    Neda Hashemi-Sadraei

    2014-01-01

    Full Text Available Infective endocarditis (IE is infrequently associated with septic arthritis. Moreover, septic arthritis of the acromioclavicular (AC joint is rarely reported in the literature. We report a case of Streptococcus pneumoniae IE in a patient who presented with bilateral AC joint septic arthritis and we review the literature on the topic.

  3. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

    NARCIS (Netherlands)

    Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R

    2015-01-01

    Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose

  4. Nonencapsulated Streptococcus pneumoniae as a cause of chronic adenoiditis

    Directory of Open Access Journals (Sweden)

    Cheshil Dixit

    2016-01-01

    We present the case of a child with chronic adenoiditis caused by a PspK+ NESp. We tested the pneumococcal isolate, designated C144.66, for antimicrobial resistance, the presence of the pspK gene and the expression of PspK. Sequence typing and genome sequencing were performed. C144.66 was found to be resistant to erythromycin and displayed intermediate resistance to penicillin and trimethoprim/sulfamethoxazole. C144.66 has the pspK gene in place of the capsule locus. Additionally, PspK expression was confirmed by flow cytometry. NESp are a growing concern as an emerging human pathogen, as current pneumococcal vaccines do not confer immunity against them. An inability to vaccinate against NESp may result in increased carriage and associated pathology.

  5. Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

    OpenAIRE

    Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

    2003-01-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom h...

  6. Interleukin-18 gene-deficient mice show enhanced defense and reduced inflammation during pneumococcal meningitis

    NARCIS (Netherlands)

    Zwijnenburg, Petra J. G.; van der Poll, Tom; Florquin, Sandrine; Akira, Shizuo; Takeda, Kiyoshi; Roord, John J.; van Furth, A. Marceline

    2003-01-01

    To determine the role of endogenous interleukin-18 (IL-18) in pneumococcal meningitis, meningitis was induced in IL-18 gene-deficient (IL-18(-/-)) and wild-type (WT) mice by intranasal inoculation of Streptococcus pneumoniae with hyaluronidase. Induction of meningitis resulted in an upregulation of

  7. Did the dutch pneumococcal vaccination campaign decrease the need for antibiotics in children?

    NARCIS (Netherlands)

    Gefenaite, Giedre; Bijlsma, Maarten J.; Bos, Jens; Hak, Eelko

    2013-01-01

    Background: Streptococcus pneumoniae is responsible for a significant amount of respiratory infections and acute otitis media (AOM) and use of antibiotics in children. In June 2006 a four-dose 7-valent pneumococcal vaccination campaign (PVC) was introduced in the Netherlands; 94% of children born

  8. Interleukin-18 gene-deficient mice show enhanced defense and reduced inflammation during pneumococcal meningitis.

    NARCIS (Netherlands)

    Zwijnenburg, P.J.G.; Poll, van der T.; Florquin, S; Akira, S; Takeda, K; Roord, J.J.; Furth, van A.M.

    2003-01-01

    To determine the role of endogenous interleukin-18 (IL-18) in pneumococcal meningitis, meningitis was induced in IL-18 gene-deficient (IL-18(-/-)) and wild-type (WT) mice by intranasal inoculation of Streptococcus pneumoniae with hyaluronidase. Induction of meningitis resulted in an upregulation of

  9. Uji Daya Hambat Ekstrak Buah Belimbing Manis (Averrhoa carambola terhadap Pertumbuhan Bakteri Streptococcus pneumoniae secara In Vitro

    Directory of Open Access Journals (Sweden)

    Rita Risandi

    2016-09-01

    Full Text Available AbstrakBuah belimbing manis (Averrhoa carambola merupakan salah satu tanaman Indonesia yang diyakini memiliki khasiat obat. Salah satu manfaat yang dapat diambil dari sari buah belimbing manis (Averrhoa carambola adalah dapat mengobati radang tenggorokan. Radang tenggorokan merupakan salah satu infeksi yang disebabkan oleh bakteri Streptococcus pneumoniae. Tujuan penelitian ini adalah menentukan daya hambat ekstrak buah belimbing manis (Averrhoa carambola terhadap pertumbuhan bakteri Streptococcus pneumoniae  secara in vitro. Metode studi ini ialah eksperimental dengan desain postest only control group design yang dilakukan di Laboratorium Biota Sumatera Universitas Andalas dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Andalas dari Agustus sampai Oktober 2014. Hasil penelitian menunjukkan bahwa ekstrak buah belimbing manis (Averrhoa carambola dengan konsentrasi yaitu 5%, 10%, 15% dan 20% tidak memiliki daya hambat terhadap pertumbuhan bakteri Streptococcus pneumoniae.  Hal ini terbukti karena tidak terbentuk zona hambat pada agar darah dan tidak terdapat pengaruh lama kontak ekstrak buah belimbing manis (Averrhoa carambola  terhadap pertumbuhan bakteri Streptococcus pneumoniae secara in vitro. Ekstrak buah belimbing manis tidak memiliki efek antibakteri terhadap pertumbuhan bakteri Streptococcus pneumoniae.Kata kunci: ekstrak buah belimbing manis, Streptococcus pneumoniae, daya hambat Abstract             Star fruit (Averrhoa carambola is a Indonesian plant that is believed to have medicinal properties. One of the benefits that can be drawn from the juice of star fruit (Averrhoa carambola is the ability to treat strep throat. Strep throat is a bacterial infection caused by Streptococcus pneumoniae. The objective of this study was to determine the inhibitory extract of star fruit (Averrhoa carambola on the growth of the bacterium Streptococcus pneumoniae in vitro. This was an experimental  research  with design

  10. Retrospective economic evaluation of childhood 7-valent pneumococcal conjugate vaccination in Australia: Uncertain herd impact on pneumonia critical.

    Science.gov (United States)

    Newall, A T; Reyes, J F; McIntyre, P; Menzies, R; Beutels, P; Wood, J G

    2016-01-12

    Retrospective cost-effectiveness analyses of vaccination programs using routinely collected post-implementation data are sparse by comparison with pre-program analyses. We performed a retrospective economic evaluation of the childhood 7-valent pneumococcal conjugate vaccine (PCV7) program in Australia. We developed a deterministic multi-compartment model that describes health states related to invasive and non-invasive pneumococcal disease. Costs (Australian dollars, A$) and health effects (quality-adjusted life years, QALYs) were attached to model states. The perspective for costs was that of the healthcare system and government. Where possible, we used observed changes in the disease rates from national surveillance and healthcare databases to estimate the impact of the PCV7 program (2005-2010). We stratified our cost-effectiveness results into alternative scenarios which differed by the outcome states included. Parameter uncertainty was explored using probabilistic sensitivity analysis. The PCV7 program was estimated to have prevented ∼5900 hospitalisations and ∼160 deaths from invasive pneumococcal disease (IPD). Approximately half of these were prevented in adults via herd protection. The incremental cost-effectiveness ratio was ∼A$161,000 per QALY gained when including only IPD-related outcomes. The cost-effectiveness of PCV7 remained in the range A$88,000-$122,000 when changes in various non-invasive disease states were included. The inclusion of observed changes in adult non-invasive pneumonia deaths substantially improved cost-effectiveness (∼A$9000 per QALY gained). Using the initial vaccine price negotiated for Australia, the PCV7 program was unlikely to have been cost-effective (at conventional thresholds) unless observed reductions in non-invasive pneumonia deaths in the elderly are attributed to it. Further analyses are required to explore this finding, which has significant implications for the incremental benefit achievable by adult PCV

  11. Pneumonia Prevention during a Humanitarian Emergency: Cost-effectiveness of Haemophilus Influenzae Type B Conjugate Vaccine and Pneumococcal Conjugate Vaccine in Somalia.

    Science.gov (United States)

    Gargano, Lisa M; Hajjeh, Rana; Cookson, Susan T

    2015-08-01

    Pneumonia is a leading cause of death among children less than five years old during humanitarian emergencies. Haemophilus influenzae type b (Hib) and Streptococcus pneumoniae are the leading causes of bacterial pneumonia. Vaccines for both of these pathogens are available to prevent pneumonia. Problem This study describes an economic analysis from a publicly funded health care system perspective performed on a birth cohort in Somalia, a country that has experienced a protracted humanitarian emergency. An impact and cost-effectiveness analysis was performed comparing: no vaccine, Hib vaccine only, pneumococcal conjugate vaccine 10 (PCV10) only, and both together administered through supplemental immunization activities (SIAs). The main summary measure was the incremental cost per disability-adjusted life-years (DALYs) averted. One-way sensitivity analysis was conducted for uncertainty in parameter values. Each SIA would avert a substantial number of cases and deaths. Compared with no vaccine, the DALYs averted by two SIAs for two doses of Hib vaccine was US $202.93 (lower and upper limits: $121.80-$623.52), two doses of PCV10 was US $161.51 ($107.24-$227.21), and two doses of both vaccines was US $152.42 ($101.20-$214.42). Variables that influenced the cost-effectiveness for each strategy most substantially were vaccine effectiveness, case fatality rates (CFRs), and disease burden. The World Health Organization (WHO) defines a cost-effective intervention as costing one to three times the per capita gross domestic product (GDP; in 2011, for Somalia=US $112). Based on the presented model, Hib vaccine alone, PCV10 alone, or Hib vaccine and PCV10 given together in SIAs are cost-effective interventions in Somalia. The WHO/Strategic Advisory Group of Experts decision-making factors for vaccine deployment appear to have all been met: the disease burden is large, the vaccine-related risk is low, prevention in this setting is more feasible than treatment, the vaccine

  12. [Examination about utility of a Streptococcus pneumoniae capsular antigen swiftness search kit urine in a pneumonia patient].

    Science.gov (United States)

    Hashikita, Giichi; Yamaguti, Toshiyuki; Tachi, Yoshimi; Kishi, Etsuko; Kawamura, Toru; Takahashi, Shun; Arai, Yukie; Koyama, Sachie; Huruhata, Toshihumi; Itabashi, Akira; Oka, Yoko; Yamazaki, Tsutomu; Maesaki, Sigefumi

    2005-01-01

    We investigated the usefullness of Binax NOW urine antigen test, an immunochromatographic assay that binds any soluble Streptococcus pneumoniae antigen (C polysaccharide) for the diagnosis of penumoniae form September 2003 to March 2005. We used 372 samples form the patinets with pneumoniae diagnosed for blood or sputum cultuter or gram-stained sputum smear. Out of 24 culture positive specimens, Binax NOW urine antigen test, showed positive in 18 (75%) specimens. The sensitivity of sputum and blood culture was 71.7% and 83.3%, respectively. Binax NOW urine antigen test was seemed false positives in 55 samples, false negatives in 6 samples. The specificity of Binax NOW urine antigen test was evaluated 84.1%. Overall agreement among tests was 83.6%. When compared to culture, false negative urine antigen may be the result of colonizing S. pneumoniae in sputum or pneumonia caused by an agent other than S. pneumoniae. CRP values for cases were both urine antigen and culture were positive ranged from 40 mg/dl to 10 mg/dl while urine antigen and culture negative cases were predominantly less than 10 mg/dl. Positive blood and pleural fluid culture cases were consistently associated with strongly positive urine antigen tests. Non-agreement between urine antigen, culture, and microscopy may be the result of specimen quality, labile nature of S. pneumoniae and antimicrobial therapy.

  13. Epidemiology of culture-confirmed infections of Streptococcus pneumoniae (2012-2015) and nasopharyngeal carriage in children and households in Taiwan (2014-2015).

    Science.gov (United States)

    Janapatla, Rajendra Prasad; Su, Lin-Hui; Chen, Hsin-Hang; Chang, Hsin-Ju; Tsai, Tian-Chi; Chen, Po-Yen; Chen, Chyi-Liang; Chiu, Cheng-Hsun

    2017-06-01

    An observational study was performed to investigate the carriage rate and serotypes of Streptococcus pneumoniae in the 13-valent pneumococcal conjugate vaccine (PCV13) era in Taiwan. From March 2014 to March 2015 a total of 500 healthy children and their households (631 adults) were enrolled from two large medical centres for nasopharyngeal carriage survey. Clinical isolates were prospectively collected from June 2012 to May 2015 at Chang Gung Memorial Hospital. We applied a multiplex polymerase chain reaction in addition to culture to detect S. pneumoniae. S. pneumoniae was isolated from 12.0 % of the children and 3.6 % of the households. In the children's cohort only 23.3 % of the isolates could be assigned to PCV13 serotypes; non-vaccine serotypes were predominant (76.6 %) and the most frequently detected non-vaccine serotypes were 15A/F and 15B/C (both 13.3 %), followed by 23A (6.7 %). In the household cohort, 21.7 % belonged to PCV13 serotypes, and 78.3 % to non-vaccine serotypes. Clinical analysis of culture-confirmed pneumococcal infection showed that infection caused by PCV13 serotypes decreased by 47 % from 83 % in 2012-2013 to 44 % in 2014-2015, while infection caused by non-PCV13 serotypes increased from 17 to 56 %. Among the carriage isolates a significantly higher percentage belonged to serogroup 15 compared to serogroup 19 (26.6 vs 6.66 %, 2014-2015; P=0.003). Therefore, clinical isolates belonging to serogroup 15 were more prevalent than those belonging to serogroup 19 (44.1 vs 32.3 %, 2014-2015; P=0.318). The isolation of non-vaccine serotypes and unknown serotypes after the introduction of PCV13 in children highlights the importance of continued surveillance for emerging serotypes.

  14. Effectiveness of 23-valent pneumococcal polysaccharide vaccine and seasonal influenza vaccine for pneumonia among the elderly - Selection of controls in a case-control study.

    Science.gov (United States)

    Kondo, Kyoko; Suzuki, Kanzo; Washio, Masakazu; Ohfuji, Satoko; Fukushima, Wakaba; Maeda, Akiko; Hirota, Yoshio

    2017-08-24

    We conducted a case-control study to elucidate associations between pneumonia in elderly individuals and 23-valent pneumococcal polysaccharide vaccine (PPSV23) and seasonal influenza vaccine (influenza vaccine). Here, we examined selection of controls in our study using an analytic epidemiology approach. The study period was from October 1, 2009 through September 30, 2014. Cases comprised ≥65-year-old patients newly diagnosed with pneumonia. For every case with pneumonia, two patients with other diseases (one respiratory medicine, one non-respiratory medicine) who were sex-, age-, visit date- and visit hospital-matched were selected as controls. Odds ratios (ORs) and 95% confidence intervals (CIs) of vaccination for pneumonia were calculated using conditional logistic regression model. Similar analyses were also conducted based on the clinical department of controls. Analysis was conducted in 234 cases and 438 controls. Effectiveness of pneumococcal vaccination or influenza vaccination against pneumonia was not detected. Proportions of either vaccination in controls were greater among respiratory medicine (pneumococcal vaccine, 38%; influenza vaccine, 55%) than among non-respiratory medicine (23%; 48%). Analysis using controls restricted to respiratory medicine showed marginally significant effectiveness of pneumococcal vaccination (OR, 0.59; 95%CI, 0.34-1.03; P=0.064) and influenza vaccination (0.64; 0.40-1.04; 0.072). However, this effectiveness might have been overestimated by selection bias of controls, as pneumonia cases are not necessarily respiratory medicine patients. In the analysis using controls restricted to non-respiratory medicine, OR of pneumococcal vaccination for pneumonia was close to 1, presumably because the proportion of pneumococcal vaccination was higher in cases than in controls. Because pneumococcal vaccine was not routinely administered during the study period, differences in recommendations of vaccination by physician in different

  15. Internamento devido a PAC por Streptococcus pneumoniae - Avaliação de factores de mortalidade Streptococcus pneumoniae - caused CAP in hospitalised patients: mortality predictors

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo

    2008-10-01

    Full Text Available A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0. Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade. Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society

  16. Multidrug-resistant Streptococcus pneumoniae isolates from healthy Ghanaian preschool children

    DEFF Research Database (Denmark)

    Dayie, Nicholas Tete Kwaku Dzifa; Arhin, Reuben E.; Newman, Mercy J.

    2015-01-01

    in a previous study, to six antimicrobials was determined by disk diffusion test. Overall, 90.4% of isolates were intermediate penicillin resistant, 99.1% were trimethoprim resistant, 73.0% were tetracycline resistant, and 33.9% were sulfamethoxazole resistant. Low resistance was recorded for erythromycin (2...... of this study was to determine the antibiogram of S. pneumoniae recovered from Ghanaian children younger than six years of age and to what extent resistances were due to the spread of certain sero- and multilocus sequence typing (MLST) types. The susceptibility of 115 pneumococcal isolates, recovered...

  17. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

    OpenAIRE

    Aura Lucía Leal; Castañeda Elizabeth

    1999-01-01

    Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medell...

  18. Evaluation of anti-pneumococcal capsular antibodies as adjunctive therapy in experimental pneumococcal meningitis

    DEFF Research Database (Denmark)

    Brandt, Christian; Frimodt-Moller, N; Lundgren, Jens Dilling

    2006-01-01

    OBJECTIVE: Bacteraemia concomitant with meningitis has been shown to greatly affect outcome. Consequently, the efficacy of serotype-specific anti-pneumococcal antiserum (APAS) was investigated in a rat model of pneumococcal meningitis. METHODS: Rats were infected with Streptococcus pneumoniae...... serotype 3. All rats received ceftriaxone starting 26 h post-infection. APAS was administered either at the time of infection or 26 h post-infection and effects were compared with rats treated with antibiotics only. RESULTS AND CONCLUSION: A significant clinical benefit was found when APAS was given...... at the time of infection whereas no effect was found when administered 26 h after infection. This work indicates that the clinical value of using APAS in pneumococcal meningitis may be limited...

  19. Functional validation of putative toxin-antitoxin genes from the Gram-positive pathogen Streptococcus pneumoniae: phd-doc is the fourth bona-fide operon.

    Science.gov (United States)

    Chan, Wai Ting; Yeo, Chew Chieng; Sadowy, Ewa; Espinosa, Manuel

    2014-01-01

    Bacterial toxin-antitoxin (TAs) loci usually consist of two genes organized as an operon, where their products are bound together and inert under normal conditions. However, under stressful circumstances the antitoxin, which is more labile, will be degraded more rapidly, thereby unleashing its cognate toxin to act on the cell. This, in turn, causes cell stasis or cell death, depending on the type of TAs and/or time of toxin exposure. Previously based on in silico analyses, we proposed that Streptococcus pneumoniae, a pathogenic Gram-positive bacterium, may harbor between 4 and 10 putative TA loci depending on the strains. Here we have chosen the pneumococcal strain Hungary(19A)-6 which contains all possible 10 TA loci. In addition to the three well-characterized operons, namely relBE2, yefM-yoeB, and pezAT, we show here the functionality of a fourth operon that encodes the pneumococcal equivalent of the phd-doc TA. Transcriptional fusions with gene encoding Green Fluorescent Protein showed that the promoter was slightly repressed by the Phd antitoxin, and exhibited almost background values when both Phd-Doc were expressed together. These findings demonstrate that phd-doc shows the negative self-regulatory features typical for an authentic TA. Further, we also show that the previously proposed TAs XreA-Ant and Bro-XreB, although they exhibit a genetic organization resembling those of typical TAs, did not appear to confer a functional behavior corresponding to bona fide TAs. In addition, we have also discovered new interesting bioinformatics results for the known pneumococcal TAs RelBE2 and PezAT. A global analysis of the four identified toxins-antitoxins in the pneumococcal genomes (PezAT, RelBE2, YefM-YoeB, and Phd-Doc) showed that RelBE2 and Phd-Doc are the most conserved ones. Further, there was good correlation among TA types, clonal complexes and sequence types in the 48 pneumococcal strains analyzed.

  20. Role of pneumococcal vaccination in prevention of pneumococcal disease among adults in Singapore.

    Science.gov (United States)

    Eng, Philip; Lim, Lean Huat; Loo, Chian Min; Low, James Alvin; Tan, Carol; Tan, Eng Kiat; Wong, Sin Yew; Setia, Sajita

    2014-01-01

    The burden of disease associated with Streptococcus pneumoniae infection in adults can be considerable but is largely preventable through routine vaccination. Although substantial progress has been made with the recent licensure of the new vaccines for prevention of pneumonia in adults, vaccine uptake rates need to be improved significantly to tackle adult pneumococcal disease effectively. Increased education regarding pneumococcal disease and improved vaccine availability may contribute to a reduction in pneumococcal disease through increased vaccination rates. The increase in the elderly population in Singapore as well as globally makes intervention in reducing pneumococcal disease an important priority. Globally, all adult vaccines remain underused and family physicians give little priority to pneumococcal vaccination for adults in daily practice. Family physicians are specialists in preventive care and can be leaders in ensuring that adult patients get the full benefit of protection against vaccine-preventable diseases. They can play a key role in the immunization delivery of new and routine vaccines by educating the public on the risks and benefits associated with vaccines. Local recommendations by advisory groups on vaccination in adults will also help to tackle vaccine preventable diseases in adults.

  1. An Increase in Streptococcus pneumoniae Serotype 12F

    Centers for Disease Control (CDC) Podcasts

    2018-02-08

    Dr. Cynthia Whitney, a CDC medical doctor and Epidemiologist, discusses serotype 12F pneumoniae.  Created: 2/8/2018 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 2/8/2018.

  2. Escherichia coli, Streptococcus pneumoniae, 4(1.2%) Haemophilus ...

    African Journals Online (AJOL)

    pneumoniae, P.aeruginosa, and. S.aureus may also cause acute conjunctivitis in neonates or children3 In sexually active teenagers and adults,. C.trachomatis and N.gonorrhoea have been implicated. In young children, H.influenzae can cause ...

  3. Antibiotic resistant profile of Streptococcus pneumoniae from the ...

    African Journals Online (AJOL)

    The isolates were subjected to antimicrobial susceptibility testing using the disc diffusion method. Results: S. pneumoniae was isolated from 37(42.04%) of the 88 samples. Isolates showed the highest resistance of 12 (32.43%) to erythromycin and lowest resistance of 4(10.81%) to ciprofloxacin. The resistance profiles for ...

  4. Demographic profile of healthy children with nasopharyngeal colonisation of Streptococcus pneumoniae: A research paper

    Directory of Open Access Journals (Sweden)

    Radhika Raman

    2017-01-01

    Full Text Available Background: Pneumonia is a preventable cause of mortality in children. Streptococcus pneumoniae colonising the nasopharynx of healthy children can cause invasive diseases and the serotype distribution of colonisation isolates should be an indicator of invasive disease, antibiotic resistance profiles, and potential vaccine coverage. Identifying factors influencing nasopharyngeal colonisation, the serotypes and antimicrobial resistance pattern can improve rational preventive strategies. Objectives: Identify risk factors associated with nasopharyngeal colonisation of S.pneumoniae in healthy children between 6 months to 5 years of age. Determine the serotype and antibiotic sensitivity of S. pneumoniae isolated from nasopharynx of healthy children. Methods: This prospective observational included 500 healthy children, 6months to 5 years of age. Demographic features of the study population, the serotypes and antimicrobial sensitivity pattern of S.Pneumoniae isolated from cultures of nasopharyngeal swabs were subjected to statistical analysis. Results: S. pneumoniae was isolated in 9% of 450 children. Increased nasopharyngeal carriage rate was associated with overcrowding 48.8% and poor ventilation 35.5%. 6B (n=16 was the most common serotype isolated. 69% were serogroups known to cause invasive disease All S. pneumoniae isolates were susceptible to vancomycin and linezolid. Antimicrobial susceptibility of PCV 7 serotypes were greater than non PCV 7 serotypes for almost all antimicrobials tested. Penicillin resistance was 11 % and MDR 51%

  5. Roles of the Essential Protein FtsA in Cell Growth and Division in Streptococcus pneumoniae

    Czech Academy of Sciences Publication Activity Database

    Mura, Andrea; Fadda, D.; Perez, A.J.; Danforth, M.L.; Musu, D.; Rico, A.I.; Krupka, M.; Denapaite, D.; Tsui, H-Ch.T.; Winkler, M.E.; Branny, Pavel; Vicente, M.; Margolin, W.; Massidda, O.

    2017-01-01

    Roč. 199, č. 3 (2017), č. článku UNSP e00608. ISSN 0021-9193 R&D Projects: GA ČR GAP302/12/0256; GA MŠk LH12055 Institutional support: RVO:61388971 Keywords : FtsA * Gram-positive cocci * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.143, year: 2016

  6. A Multi-Scale Computational Study on the Mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic)

    OpenAIRE

    Ion, Bogdan; Kazim, Erum; Gauld, James

    2014-01-01

    Nicotinamidase (Nic) is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic). In particular, density functional theory (DFT), molecular dynamics (MD) and ONIOM quantum mechanics/molecular mechanics (QM/MM) methods have been employed. The o...

  7. Impact of the 13-Valent Pneumococcal Conjugate Vaccine on Clinical and Hypoxemic Childhood Pneumonia over Three Years in Central Malawi: An Observational Study

    Science.gov (United States)

    McCollum, Eric D.; Nambiar, Bejoy; Deula, Rashid; Zadutsa, Beatiwel; Bondo, Austin; King, Carina; Beard, James; Liyaya, Harry; Mankhambo, Limangeni; Lazzerini, Marzia; Makwenda, Charles; Masache, Gibson; Bar-Zeev, Naor; Kazembe, Peter N.; Mwansambo, Charles; Lufesi, Norman; Costello, Anthony; Armstrong, Ben

    2017-01-01

    Background The pneumococcal conjugate vaccine’s (PCV) impact on childhood pneumonia during programmatic conditions in Africa is poorly understood. Following PCV13 introduction in Malawi in November 2011, we evaluated the case burden and rates of childhood pneumonia. Methods and Findings Between January 1, 2012-June 30, 2014 we conducted active pneumonia surveillance in children pneumonia per Malawi guidelines, defined as fast breathing only, chest indrawing +/- fast breathing, or, ≥1 clinical danger sign. Since pulse oximetry was not in the Malawi guidelines, oxygenation pneumonia, a distinct category from clinical pneumonia. We quantified the pneumonia case burden and rates in two ways. We compared the period immediately following vaccine introduction (early) to the period with >75% three-dose PCV13 coverage (post). We also used multivariable time-series regression, adjusting for autocorrelation and exploring seasonal variation and alternative model specifications in sensitivity analyses. The early versus post analysis showed an increase in cases and rates of total, fast breathing, and indrawing pneumonia and a decrease in danger sign and hypoxemic pneumonia, and pneumonia mortality. At 76% three-dose PCV13 coverage, versus 0%, the time-series model showed a non-significant increase in total cases (+47%, 95% CI: -13%, +149%, p = 0.154); fast breathing cases increased 135% (+39%, +297%, p = 0.001), however, hypoxemia fell 47% (-5%, -70%, p = 0.031) and hospital deaths decreased 36% (-1%, -58%, p = 0.047) in children pneumonia, including hypoxemia and death, have markedly decreased. PMID:28052071

  8. CodY Regulates Thiol Peroxidase Expression as Part of the Pneumococcal Defense Mechanism against H2O2 Stress

    NARCIS (Netherlands)

    Hajaj, Barak; Yesilkaya, Hasan; Shafeeq, Sulman; Zhi, Xiangyun; Benisty, Rachel; Tchalah, Shiran; Kuipers, Oscar P; Porat, Nurith

    2017-01-01

    Streptococcus pneumoniae is a facultative anaerobic pathogen. Although it maintains fermentative metabolism, during aerobic growth pneumococci produce high levels of H2O2, which can have adverse effects on cell viability and DNA, and influence pneumococcal interaction with its host. The pneumococcus

  9. Mannose-binding lectin gene, MBL2, polymorphisms are not associated with susceptibility to invasive pneumococcal disease in children

    DEFF Research Database (Denmark)

    Lundbo, Lene Fogt; Harboe, Zitta Barrella; Clausen, Louise Nygaard

    2014-01-01

    BACKGROUND: Most children are transiently colonized with Streptococcus pneumoniae, but very few develop invasive pneumococcal disease (IPD). Host genetic variation of innate immunity may predispose to IPD. We investigated the effect of genetic variation in the mannose-binding lectin gene, MBL2......, on susceptibility and disease severity of IPD in previously healthy children aged

  10. Antibiotic resistance of Streptococcus pneumoniae in children with acute otitis media treatment failure.

    Science.gov (United States)

    Zielnik-Jurkiewicz, Beata; Bielicka, Anna

    2015-12-01

    The emergence of antibiotic-resistant bacteria is a major cause of treatment failure in children with acute otitis media (AOM). This study aimed to analyze the types of bacterial strains in fluid isolated from the middle ear of children with AOM who did not respond to oral antibiotic treatment. We also determined the antibiotic resistance of the most frequently isolated bacterial strain (Streptococcus pneumoniae) found in these children. This was a prospective study of 157 children with AOM aged from 6 months to 7 years admitted due to unsuccessful oral antibiotic treatment. All children underwent a myringotomy, and samples of the middle ear fluid were collected for bacteriological examination. Positive bacterial cultures were obtained in 104 patients (66.2%), with Streptococcus pneumoniae (39.69%), Haemophilus influenzae (16.03%) Staphylococcus aureus (16.03%), Staphylococcus haemolyticus (6.9%) and Streptococcus pyogenes (5.34%) found most frequently. The majority (65.4%) of S. pneumoniae strains were penicillin-intermediate-resistant or penicillin-resistant, and 67.2% strains of S. pneumoniae were multidrug-resistant. We identified S. pneumoniae as the most frequently isolated pathogen from the middle ear in children with AOM treatment failure and determined that the majority of strains were antibiotic-resistant. We propose that the microbiological identification of bacterial strains and their degree of antibiotic resistance should be performed prior to therapy in order to choose the most appropriate antibiotic therapy for children with AOM treatment failure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  11. Streptococcus pneumoniae – caused CAP in hospitalised patients: mortality predictors

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo

    2008-09-01

    Full Text Available Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society (BTS CURB-65 scoring tools were evaluated. The statistical treatment was performed using the SPSS 14.0 program. We included 104 patients, 67.3% male, median age 63 years old, mortality 13.4%. There was a significant association between the PSI and CURB-65 score and mortality. Despite advances, CAP is still an important health problem with a high atten - dant morbi-mortality. This study confirms the value of PSI and CURB-65 in the prediction of severe pneumonia. Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67

  12. Meeting the challenge: prevention of pneumococcal disease with conjugate vaccines

    Directory of Open Access Journals (Sweden)

    Echániz-Avilés Irma Gabriela

    2001-01-01

    Full Text Available Streptococcus pneumoniae is one of the leading causes of both invasive and noninvasive diseases in the pediatric population and continues to represent a significant public health burden worldwide. The increasing incidence of antibioticresistant strains of the pathogen has complicated treatment and management of the various pneumococcal disease manifestations. Thus, the best management strategy may be the prevention of pneumococcal diseases through vaccination. Although several pneumococcal conjugate vaccines have been clinically studied in infants and children, only a 7-valent conjugate vaccine (PNCRM7; Prevnar®/Prevenar® is currently approved for the prevention of invasive disease. Vaccination with PNCRM7 is safe and effective in infants and young children. Routine vaccination with the conjugate vaccine could improve outcomes by safeguarding against the development of antibiotic-resistant strains of S. pneumoniae, thus simplifying the management of pneumococcal disease. Additionally, the overall costs associated with the treatment of pneumococcal diseases could be substantially reduced, particularly in developing countries. The time has come for fully applying this new advancement against S. pneumoniae, to benefit the children of the world. The Spanish version of this paper is available at: http://www.insp.mx/salud/index.html

  13. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

    OpenAIRE

    Amauri Lázaro Noda Albelo; Lázaro Arturo Vidal Tallet; Joan Iavier Vidal Casal; Leanet Hernández Álvarez

    2011-01-01

    La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos beta...

  14. A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae Polymerase chain reaction used to detect Streptococcus pneumoniae resistance to penicillin

    Directory of Open Access Journals (Sweden)

    Eduardo Walker Zettler

    2004-12-01

    Full Text Available INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM. A reação em cadeia da polimerase (PCR detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca de 8 horas. OBJETIVO: Comparar a PCR com o método da CIM no diagnóstico da resistência da Streptococcus pneumoniae a penicilina. MÉTODO: Foram estudadas 153 amostras de Streptococcus pneumoniae, isoladas de diferentes sítios anatômicos, usando-se para detecção de mutações nos genes que codificam as proteínas ligadoras de penicilina 1a, 2b e 2x, responsáveis pela resistência à penicilina. A ocorrência das mutações foi correlacionada com a CIM de penicilina, determinada pelo teste de difusão em ágar. RESULTADOS: A resistência global à penicilina do Streptococcus pneumoniae foi de 22,8% (16,3% de resistência intermediária e 6,5% de resistência alta. Em proporções estatisticamente significativas, as amostras sensíveis à penicilina não tinham mutações, as intermediárias apenas uma, geralmente na proteína ligadora de penicilina 2x, e as altamente resistentes tinham mutações nas três proteínas investigadas. CONCLUSÃO: A PCR é um método rápido para a detecção da resistência à penicilina do Streptococcus pneumoniae, que poderá vir a ser utilizado na prática clínica.BACKGROUND: Streptococcus pneumoniae is the most common etiologic agent of community-acquired respiratory infections. In recent years, S. pneumoniae resistance to antimicrobial agents has increased. Minimum inhibitory concentration (MIC is routinely used to determine resistance. Polymerase chain reaction (PCR detects the genes

  15. A necrotic lung ball caused by co-infection with Candida and Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Yokoyama T

    2011-12-01

    Full Text Available Toshinobu Yokoyama, Jun Sasaki, Keita Matsumoto, Chie Koga, Yusuke Ito, Yoichiro Kaku, Morihiro Tajiri, Hiroki Natori, Masashi HirokawaDivision of Respirology, Neurology and Rheumatology, Department of Internal Medicine, Kurume University School of Medicine, Kurume, JapanIntroduction: A necrotic lung ball is a rare radiological feature that is sometimes seen in cases of pulmonary aspergillosis. This paper reports a rare occurrence of a necrotic lung ball in a young male caused by Candida and Streptococcus pneumoniae.Case report: A 28-year-old male with pulmonary candidiasis was found to have a lung ball on computed tomography (CT of the chest. The patient was treated with ß-lactams and itraconazole and then fluconazole, which improved his condition (as found on a following chest CT scan and serum ß-D-glucan level. The necrotic lung ball was suspected to have been caused by co-infection with Candida and S. pneumoniae.Conclusion: A necrotic lung ball can result from infection by Candida and/or S. pneumoniae, indicating that physicians should be aware that patients may still have a fungal infection of the lungs that could result in a lung ball, even when they do not have either Aspergillus antibodies or antigens.Keywords: lung ball, necrotic lung ball, Candida, Streptococcus pneumoniae

  16. Induction of prophages by fluoroquinolones in Streptococcus pneumoniae: implications for emergence of resistance in genetically-related clones.

    Directory of Open Access Journals (Sweden)

    Elena López

    Full Text Available Antibiotic resistance in Streptococcus pneumoniae has increased worldwide by the spread of a few clones. Fluoroquinolone resistance occurs mainly by alteration of their intracellular targets, the type II DNA topoisomerases, which is acquired either by point mutation or by recombination. Increase in fluoroquinolone-resistance may depend on the balance between antibiotic consumption and the cost that resistance imposes to bacterial fitness. In addition, pneumococcal prophages could play an important role. Prophage induction by fluoroquinolones was confirmed in 4 clinical isolates by using Southern blot hybridization. Clinical isolates (105 fluoroquinolone-resistant and 160 fluoroquinolone-susceptible were tested for lysogeny by using a PCR assay and functional prophage carriage was studied by mitomycin C induction. Fluoroquinolone-resistant strains harbored fewer inducible prophages (17/43 than fluoroquinolone-susceptible strains (49/70 (P = 0.0018. In addition, isolates of clones associated with fluoroquinolone resistance [CC156 (3/25; CC63 (2/20, and CC81 (1/19], had lower frequency of functional prophages than isolates of clones with low incidence of fluoroquinolone resistance [CC30 (4/21, CC230 (5/20, CC62 (9/21, and CC180 (21/30]. Likewise, persistent strains from patients with chronic respiratory diseases subjected to fluoroquinolone treatment had a low frequency of inducible prophages (1/11. Development of ciprofloxacin resistance was tested with two isogenic strains, one lysogenic and the other non-lysogenic: emergence of resistance was only observed in the non-lysogenic strain. These results are compatible with the lysis of lysogenic isolates receiving fluoroquinolones before the development of resistance and explain the inverse relation between presence of inducible prophages and fluoroquinolone-resistance.

  17. [Antibiotic susceptibility of Staphylococcus aureus and Streptococcus pneumoniae in healthy carrier individuals in primary care in Barcelona area].

    Science.gov (United States)

    Llor, Carles; Boada, Albert; Pons-Vigués, Mariona; Grenzner, Elisabet; Juvé, Rosa; Almeda, Jesús

    2018-01-01

    The information available on antibiotic resistance patterns are generally based on specimens from hospitalised individuals. This study was aimed at evaluating the antibiotic resistance rate of nasal carriage strains of Staphylococcus aureus and Streptococcus pneumoniae in healthy individuals, in accordance with age and gender, attended in Primary Care Centres (PCC). Cross-sectional study. Seven PCC in the Barcelona area. Healthy nasal carriers aged 4years or more who did not present with any sign of infectious disease, and had not taken any antibiotic or had been hospitalised in the previous 3months. A total of 3,969 nasal swabs valid for identification were collected between 2010 and 2011 and were sent to one central microbiological laboratory for isolation of both pathogens. Resistance to common antibiotics was determined on the basis of the current European Committee on Antimicrobial Susceptibility Testing guidelines on cut-off points. The prevalence of methicillin-resistant S.aureus was 1.3% (95%CI: 0.5-2.1%), with resistance rates of 87.1% to phenoxymethylpenicillin and 11.6% to azithromycin, with no significant differences with age and gender. A total of 2.4% (95CI%: 0.1-4.7%) of the pneumococcal strains were highly resistant to both phenoxymethylpenicillin and macrolides, whereas the highest resistance rates were to cefaclor (53.3%), followed by tetracycline (20%) and cefuroxime (12.1%). These pathogens have lower resistance rates in the community than in the hospital setting. Primary Care physicians must be more aware of the current antimicrobial resistance, in order to ensure prudent use of antibiotics. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  18. Bactericidal effect of bovine lactoferrin and synthetic peptide lactoferrin chimera in Streptococcus pneumoniae and the decrease in luxS gene expression by lactoferrin

    NARCIS (Netherlands)

    León-Sicairos, N.; Angulo-Zamudio, U.A.; Vidal, J.E.; López-Torres, C.A.; Bolscher, J.G.M.; Nazmi, K.; Reyes-Cortes, R.; Reyes-López, M.; de la Garza, M.; Canizalez-Román, A.

    2014-01-01

    Streptococcus pneumoniae (pneumococcus) is responsible for nearly one million child deaths annually. Pneumococcus causes infections such as pneumonia, otitis media, meningitis, and sepsis. The human immune system includes antibacterial peptides and proteins such as lactoferrin (LF), but its activity

  19. Total synthesis of a Streptococcus pneumoniae serotype 12F CPS repeating unit hexasaccharide

    Directory of Open Access Journals (Sweden)

    Peter H. Seeberger

    2017-01-01

    Full Text Available The Gram-positive bacterium Streptococcus pneumoniae causes severe disease globally. Vaccines that prevent S. pneumoniae infections induce antibodies against epitopes within the bacterial capsular polysaccharide (CPS. A better immunological understanding of the epitopes that protect from bacterial infection requires defined oligosaccharides obtained by total synthesis. The key to the synthesis of the S. pneumoniae serotype 12F CPS hexasaccharide repeating unit that is not contained in currently used glycoconjugate vaccines is the assembly of the trisaccharide β-D-GalpNAc-(1→4-[α-D-Glcp-(1→3]-β-D-ManpNAcA, in which the branching points are equipped with orthogonal protecting groups. A linear approach relying on the sequential assembly of monosaccharide building blocks proved superior to a convergent [3 + 3] strategy that was not successful due to steric constraints. The synthetic hexasaccharide is the starting point for further immunological investigations.

  20. A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Raphaël Laurenceau

    Full Text Available Natural genetic transformation is widely distributed in bacteria and generally occurs during a genetically programmed differentiated state called competence. This process promotes genome plasticity and adaptability in Gram-negative and Gram-positive bacteria. Transformation requires the binding and internalization of exogenous DNA, the mechanisms of which are unclear. Here, we report the discovery of a transformation pilus at the surface of competent Streptococcus pneumoniae cells. This Type IV-like pilus, which is primarily composed of the ComGC pilin, is required for transformation. We provide evidence that it directly binds DNA and propose that the transformation pilus is the primary DNA receptor on the bacterial cell during transformation in S. pneumoniae. Being a central component of the transformation apparatus, the transformation pilus enables S. pneumoniae, a major Gram-positive human pathogen, to acquire resistance to antibiotics and to escape vaccines through the binding and incorporation of new genetic material.

  1. Distribución de serotipos de Streptococcus pneumoniae aislados de infecciones invasoras en el Hospital de Niños de Santa Fe Serotype distribution of Streptococcus pneumoniae isolated from invasive infections at the Hospital de Niños of Santa Fe.

    Directory of Open Access Journals (Sweden)

    C. Mayoral

    2008-03-01

    Full Text Available Con la introducción de vacunas conjugadas antineumocócicas se observó, en muchos países, disminución de aislamientos de Streptococcus pneumoniae del serotipo 14 y aumento de aislamientos correspondientes a serotipos no incluidos en esas vacunas. En 1993, el Hospital de Niños de Santa Fe comenzó la vigilancia de la distribución de serotipos de Streptococcus pneumoniae invasores. En este trabajo se estudió la correlación entre serotipo y a patología (neumonía/meningitis, b edad (menor o mayor de dos años, y c CIM de penicilina, para los serotipos aislados en el período 2003-2005. El serotipo predominante fue el 14, seguido del 1, 6B, 18C, 7F, 19F y 5. El serotipo 14 mostró asociación estadísticamente significativa con valores de CIM de penicilina entre 0,5 y 2 mg/l, no así con alguna patología, aunque se lo halló con mayor frecuencia en neumonías que en meningitis. Los serotipos 14 y 1 prevalecieron en niños menores y mayores de 2 años, respectivamente. La CIM de penicilina = 2 mg/l se observó más en neumonías que en meningitis. La frecuencia relativa de los diferentes serotipos hallados fue semejante a la observada en el período 1993-99; no obstante, los serotipos 18C, 4, 12F y 22F no se habían encontrado antes. La aparición de nuevos serotipos convierte en importante la vigilancia, dada la necesidad de formular vacunas que los incluyan y que efectivamente prevengan las infecciones neumocócicas más comunes.The serotype distribution of Streptococcus pneumoniae varies through time. The introduction of pneumococcal conjugate vaccines showed a decreased prevalence of pneumococcal invasive isolates belonging to serotype 14 and an increase of serotypes not therein included. In 1993, the Hospital de Niños of Santa Fe began surveillance of the serotype distribution of invasive S. pneumoniae disease. In the period 2003 - 2005, 76 isolates were analysed by studying the correlation between serotype and pathology, age and MIC

  2. Pneumococcal Sepsis Complicated by Splenic Abscesses and Purpura Fulminans in a 15-Month-Old Child

    Directory of Open Access Journals (Sweden)

    Scott Pangonis MD

    2016-02-01

    Full Text Available Streptococcus pneumoniae is an invasive organism that causes a wide range of common diseases, including sinusitis, acute otitis media, and pneumonia. Splenic abscesses and purpura fulminans (PF are rare complications of pneumococcal disease. Splenic abscesses caused by S pneumoniae have only been reported in the adult literature. PF has been described in the pediatric population as a rare complication in patients with invasive pneumococcal disease (IPD with and without underlying immunological disorders such as asplenia. Here, we report a patient with IPD complicated by splenic abscesses and PF. Our patient initially presented with bacteremia, septic shock, and disseminated intravascular coagulation. She subsequently developed PF and splenic abscesses. She survived her illness after receiving a total of 8 weeks of antibiotic therapy. This case highlights 2 rare complications of IPD and demonstrates the need to keep pneumococcal disease in the differential diagnosis even in children whose vaccination status is up to date.

  3. Pathogenesis and Pathophysiology of Pneumococcal Meningitis

    Science.gov (United States)

    Mook-Kanamori, Barry B.; Geldhoff, Madelijn; van der Poll, Tom; van de Beek, Diederik

    2011-01-01

    Summary: Pneumococcal meningitis continues to be associated with high rates of mortality and long-term neurological sequelae. The most common route of infection starts by nasopharyngeal colonization by Streptococcus pneumoniae, which must avoid mucosal entrapment and evade the host immune system after local activation. During invasive disease, pneumococcal epithelial adhesion is followed by bloodstream invasion and activation of the complement and coagulation systems. The release of inflammatory mediators facilitates pneumococcal crossing of the blood-brain barrier into the brain, where the bacteria multiply freely and trigger activation of circulating antigen-presenting cells and resident microglial cells. The resulting massive inflammation leads to further neutrophil recruitment and inflammation, resulting in the well-known features of bacterial meningitis, including cerebrospinal fluid pleocytosis, cochlear damage, cerebral edema, hydrocephalus, and cerebrovascular complications. Experimental animal models continue to further our understanding of the pathophysiology of pneumococcal meningitis and provide the platform for the development of new adjuvant treatments and antimicrobial therapy. This review discusses the most recent views on the pathophysiology of pneumococcal meningitis, as well as potential targets for (adjunctive) therapy. PMID:21734248

  4. Alta prevalência de crianças portadoras de Streptococcus pneumoniae resistentes à penicilina em creches públicas High prevalence of children colonized with penicillin-resistant Streptococcus pneumoniae in public day-care centers

    Directory of Open Access Journals (Sweden)

    Patrícia A. G. Velasquez

    2009-12-01

    Full Text Available OBJETIVOS: Investigar a prevalência de Streptococcus pneumoniae (pneumococos na nasofaringe de crianças sadias atendidas em creches municipais da cidade de Umuarama (PR. Avaliar a susceptibilidade aos antimicrobianos dos pneumococos isolados. MÉTODOS: Secreção da nasofaringe de 212 crianças foi coletada no período de abril a outubro de 2008. Após semeadura dos espécimes em ágar sangue e incubação a 37 °C por 24-48 horas, as colônias suspeitas de pertencerem a S. pneumoniae foram identificadas pela α-hemólise, sensibilidade à optoquina e bile solubilidade. A susceptibilidade à penicilina foi investigada pelos testes de disco-difusão e de diluição. A susceptibilidade aos demais antimicrobianos indicados no tratamento das infecções pneumocócicas foi realizada por disco-difusão RESULTADOS: A prevalência de pneumococos na nasofaringe foi de 43,4% (92/212, sendo maior em crianças com idade entre 2 e 5 anos (p = 0,0005. Não houve diferença significativa entre os sexos. Resistência intermediária e resistência plena à penicilina foram encontradas respectivamente em 34,8 (32/92 e 22,8% (21/92 dos isolados. Sessenta e sete amostras (72,8% foram resistentes ao sulfametoxazol-trimetoprim, oito (8,7% à eritromicina e seis (6,5% à tetraciclina. Uma amostra apresentou resistência à clindamicina (1,1%, e outra ao cloranfenicol (1,1%. Todas as amostras foram sensíveis a levofloxacina, ofloxacina, rifampicina, telitromicina, linezolide e vancomicina. Nove amostras foram consideradas multirresistentes, por apresentarem resistência a três ou mais classes de antimicrobianos. CONCLUSÕES: O presente estudo registrou uma alta prevalência de crianças portadoras sadias de amostras de S. pneumoniae resistentes à penicilina que podem constituir importantes reservatórios desse patógeno na comunidade.OBJECTIVES: To investigate the prevalence of Streptococcus pneumoniae (pneumococci in the nasopharynx of healthy children enrolled

  5. SpxB is a suicide gene of Streptococcus pneumoniae and confers a selective advantage in an in vivo competitive colonization model.

    Science.gov (United States)

    Regev-Yochay, Gili; Trzcinski, Krzysztof; Thompson, Claudette M; Lipsitch, Marc; Malley, Richard

    2007-09-01

    The human bacterial pathogen Streptococcus pneumoniae dies spontaneously upon reaching stationary phase. The extent of S. pneumoniae death at stationary phase is unusual in bacteria and has been conventionally attributed to autolysis by the LytA amidase. In this study, we show that spontaneous pneumococcal death is due to hydrogen peroxide (H(2)O(2)), not LytA, and that the gene responsible for H(2)O(2) production (spxB) also confers a survival advantage in colonization. Survival of S. pneumoniae in stationary phase was significantly prolonged by eliminating H(2)O(2) in any of three ways: chemically by supplementing the media with catalase, metabolically by growing the bacteria under anaerobic conditions, or genetically by constructing DeltaspxB mutants that do not produce H(2)O(2). Likewise, addition of H(2)O(2) to exponentially growing S. pneumoniae resulted in a death rate similar to that of cells in stationary phase. While DeltalytA mutants did not lyse at stationary phase, they died at a rate similar to that of the wild-type strain. Furthermore, we show that the death process induced by H(2)O(2) has features of apoptosis, as evidenced by increased annexin V staining, decreased DNA content, and appearance as assessed by transmission electron microscopy. Finally, in an in vivo rat model of competitive colonization, the presence of spxB conferred a selective advantage over the DeltaspxB mutant, suggesting an explanation for the persistence of this gene. We conclude that a suicide gene of pneumococcus is spxB, which induces an apoptosis-like death in pneumococci and confers a selective advantage in nasopharyngeal cocolonization.

  6. Recommendations for pneumococcal immunization outside routine childhood immunization programs in Western Europe.

    Science.gov (United States)

    Castiglia, Paolo

    2014-10-01

    The global burden of pneumococcal diseases is high, with young children and adults≥50 years of age at highest risk of infection. Two types of vaccine are available for the prevention of pneumococcal diseases caused by specific Streptococcus pneumoniae serotypes: the pneumococcal polysaccharide vaccine (PPV23) and the pneumococcal conjugate vaccine (PCV7, PCV10, and PCV13). Despite pneumococcal immunization programs in adults and children, the burden in adults has remained high. Most European countries have national or local/regional vaccination recommendations. The objective of this review was to provide an overview of the government recommendations for pneumococcal vaccination outside routine childhood vaccination programs for 16 Western European countries as of August 2014. We found that recommendations for pneumococcal immunization across Europe are complex and vary greatly among countries in terms of age groups and risk groups recommended for vaccination, as well as which vaccine should be administered. Clarifying or simplifying these recommendations and improving their dissemination could help to increase pneumococcal vaccine uptake and decrease the high burden of pneumococcal diseases in adults, both through a direct effect of the vaccine and via a herd effect in unvaccinated individuals.

  7. The gut microbiota plays a protective role in the host defence against pneumococcal pneumonia

    NARCIS (Netherlands)

    Schuijt, Tim J.; Lankelma, Jacqueline M.; Scicluna, Brendon P.; de Sousa E Melo, Felipe; Roelofs, Joris J. T. H.; de Boer, J. Daan; Hoogendijk, Arjan J.; de Beer, Regina; de Vos, Alex; Belzer, Clara; de Vos, Willem M.; van der Poll, Tom; Wiersinga, W. Joost

    2016-01-01

    Pneumonia accounts for more deaths than any other infectious disease worldwide. The intestinal microbiota supports local mucosal immunity and is increasingly recognised as an important modulator of the systemic immune system. The precise role of the gut microbiota in bacterial pneumonia, however, is

  8. The gut microbiota plays a protective role in the host defence against pneumococcal pneumonia

    NARCIS (Netherlands)

    Schuijt, T.J.; Lankelma, J.M.; Scicluna, B.P.; Melo, e F.S.; Roelofs, J.J.; Boer, de J.D.; Hoogendijk, A.J.; Beer, de R.; Vos, de A.; Belzer, C.; Vos, de W.M.; Poll, van der T.; Wiersinga, W.J.

    2016-01-01

    OBJECTIVE: Pneumonia accounts for more deaths than any other infectious disease worldwide. The intestinal microbiota supports local mucosal immunity and is increasingly recognised as an important modulator of the systemic immune system. The precise role of the gut microbiota in bacterial pneumonia,

  9. Rationale and design of the CAPAMIS study: Effectiveness of pneumococcal vaccination against community-acquired pneumonia, acute myocardial infarction and stroke

    Directory of Open Access Journals (Sweden)

    Salsench Elisabet

    2010-01-01

    Full Text Available Abstract Background The 23-valent polysaccharide pneumococcal vaccine (PPV-23 is recommended for elderly and high-risk people, although its effectiveness is controversial. Some studies have reported an increasing risk of acute vascular events among patients with pneumonia, and a recent case-control study has reported a reduction in the risk of myocardial infarction among patients vaccinated with PPV-23. Given that animal experiments have shown that pneumococcal vaccination reduces the extent of atherosclerotic lesions, it has been hypothesized that PPV-23 could protect against acute vascular events by an indirect effect preventing pneumonia or by a direct effect on oxidized low-density lipoproteins. The main objective of this study is to evaluate the clinical effectiveness of PPV-23 in reducing the risk of pneumonia and acute vascular events (related or nonrelated with prior pneumonia in the general population over 60 years. Methods/Design Cohort study including 27,000 individuals 60 years or older assigned to nine Primary Care Centers in the region of Tarragona, Spain. According to the reception of PPV-23 before the start of the study, the study population will be divided into vaccinated and nonvaccinated groups, which will be followed during a consecutive 30-month period. Primary Care and Hospitals discharge databases will initially be used to identify study events (community-acquired pneumonia, hospitalisation for acute myocardial infarction and stroke, but all cases will be further validated by checking clinical records. Multivariable Cox regression analyses estimating hazard ratios (adjusted for age, sex and comorbidities will be used to estimate vaccine effectiveness. Discussion The results of the study will contribute to clarify the controversial effect of the PPV-23 in preventing community-acquired pneumonia and they will be critical in determining the posible role of pneumococcal vaccination in cardiovascular prevention.

  10. Difference between Japanese Secondary and Tertiary Medical Facilities Regarding Changes in the Hospitalization of Children for Pneumonia after the Introduction of the Pneumococcal Conjugate Vaccine.

    Science.gov (United States)

    Haro, Kaoru; Ogawa, Masato; Hoshina, Takayuki; Kojiro, Masumi; Kusuhara, Koichi

    2017-05-24

    This study aimed to compare hospitalization of children for pneumonia between secondary and tertiary medical facilities, which hospitalize many children without and with underlying diseases, respectively, after the introduction of the pneumococcal conjugate vaccine (PCV). Our retrospective study included children admitted to the Department of Pediatrics at Kitakyushu General Hospital, a secondary medical facility, and the Hospital of the University of Occupational and Environment Health, Japan, a tertiary medical facility, from 2009 to 2013 for pneumonia. We compared the change in the rate of hospitalization for pneumonia after the introduction of the 7-valent PCV between the secondary and tertiary medical facilities. Hospitalization of patients with pneumonia declined by 28.8% in our secondary medical facility. In particular, hospitalization for pneumonia other than confirmed mycoplasmal or viral pneumonia was significantly reduced by 49.2%. In contrast, hospitalization of patients with pneumonia did not decline in our tertiary medical facility. After the introduction of PCV, hospitalization of children for pneumonia was not reduced at the tertiary medical facility. Various other pathogens besides pneumococcus may be associated with the development of pneumonia in children with underlying diseases.

  11. A novel typing method for Streptococcus pneumoniae using selected surface proteins

    Directory of Open Access Journals (Sweden)

    Arnau eDomenech

    2016-03-01

    Full Text Available The diverse pneumococcal diseases are associated with different pneumococcal lineages, or clonal complexes. Nevertheless, intra-clonal genomic variability, which influences pathogenicity, has been reported for surface virulence factors. These factors constitute the communication interface between the pathogen and its host and their corresponding genes are subjected to strong selective pressures affecting functionality and immunogenicity. First, the presence and allelic dispersion of 97 outer protein families were screened in 19 complete pneumococcal genomes. Seventeen families were deemed variable and were then examined in 216 draft genomes. This procedure allowed the generation of binary vectors with 17 positions and the classification of strains into surfotypes. They represent the outer protein subsets with the highest inter-strain discriminative power. A total of 116 non-redundant surfotypes were identified. Those sharing a critical number of common protein features were hierarchically clustered into 18 surfogroups. Most clonal complexes with comparable epidemiological characteristics belonged to the same or similar surfogroups. However, the very large CC156 clonal complex was dispersed over several surfogroups. In order to establish a relationship between surfogroup and pathogenicity, the surfotypes of 95 clinical isolates with different serogroup/serotype combinations were analysed. We found a significant correlation between surfogroup and type of pathogenic behaviour (primary invasive, opportunistic invasive and non-invasive. We conclude that the virulent behaviour of S. pneumoniae is related to the activity of collections of, rather than individual, surface virulence factors. Since surfotypes evolve faster than MLSTs and directly reflect virulence potential, this novel typing protocol is appropriate for the identification of emerging clones.

  12. Silica desiccant packets for storage and transport of Streptococcus pneumoniae and other clinically relevant species.

    Directory of Open Access Journals (Sweden)

    Casey L Pell

    Full Text Available Bacterial isolates are often transported between laboratories for research and diagnostic purposes. Silica desiccant packets (SDPs, which are inexpensive and do not require freezing, were evaluated for storage and recovery of bacterial isolates. Conditions such as inoculum size, swab type and temperature of storage were investigated using ten Streptococcus pneumoniae isolates. The optimized protocol was then tested using 49 additional S. pneumoniae isolates representing 40 serogroups. Overall, S. pneumoniae growth was considered satisfactory (>100 colony forming units for 98/109 (89.9% and 20/20 (100% swabs after 14 days at room temperature or 28 days at 4° C, respectively. Storage in SDPs did not impact on the ability of S. pneumoniae isolates to be subsequently serotyped. When the survival of nine other clinically relevant bacterial species was tested, seven were viable after 28 days at room temperature, the exceptions being Neisseria gonorrhoeae and Haemophilus influenzae. SDPs are suitable for transport and short-term storage of bacterial species including S. pneumoniae.

  13. Serotype distribution of Streptococcus pneumoniae causing invasive disease in the Republic of Ireland.

    LENUS (Irish Health Repository)

    Vickers, I

    2011-05-01

    The 7-valent pneumococcal conjugate vaccine (PCV7) was included in the routine infant immunization schedule in Ireland in September 2008. We determined the serotype of 977 S. pneumoniae isolates causing invasive disease between 2000-2002 and 2007-2008, assessed for the presence of the recently described serotype 6C and determined the susceptibility of isolates during 2007-2008 to penicillin and cefotaxime. Serotype 14 was the most common serotype during both periods and 7·7% of isolates previously typed as serotype 6A were serotype 6C. During 2000-2002 and 2007-2008, PCV7 could potentially have prevented 85% and 74% of invasive pneumococcal disease in the target population (i.e. children aged <2 years), respectively. The level of penicillin non-susceptibility was 17% in 2007-2008. Ongoing surveillance of serotypes is required to determine the impact of PCV7 in the Irish population and to assess the potential of new vaccines with expanded valency.

  14. Fallos vacunales a vacunas conjugadas de Streptococcus pneumoniae y Haemophilus influenzae tipo b

    Directory of Open Access Journals (Sweden)

    Gonzalo Angulo

    2016-11-01

    Full Text Available Haemophilus influenzae type b and Streptococcus pneumoniae are the main cause agents of otitis, pneumonia, sepsis and meningitis, affecting mainly children under 5 years. Conjugate vaccines for encapsulated germs have dramatically decreased, the various diseases caused by these germs. Despite the decrease in morbidity and mortality, vaccine failures were observed. Children who experienced vaccine failures to Haemophilus influenzae type b had associated comorbidities more frequently than the general population (prematurity, HIV, Down syndrome, tumors, etc.. Nevertheless, most of these children have no medical history or immunological disorders. There is no consensus on whether all patients with vaccine failures should be assessed immunologically and how. There are recommendations to indicate a booster dose to patients with certain comorbidities and patients experiencing vaccine failure even in the absence of theses. Of the vaccine preparations available for Haemophilus influenzae type b association with acellular Bordetella pertussis proved to be less immunogenic and is currently being discouraged. Streptococcus pneumoniae serotypes 6B and 19F are less immunogenics and explain most of the vaccine failures in some series.

  15. Streptococcus pneumoniae Supragenome Hybridization Arrays for Profiling of Genetic Content and Gene Expression.

    Science.gov (United States)

    Kadam, Anagha; Janto, Benjamin; Eutsey, Rory; Earl, Joshua P; Powell, Evan; Dahlgren, Margaret E; Hu, Fen Z; Ehrlich, Garth D; Hiller, N Luisa

    2015-02-02

    There is extensive genomic diversity among Streptococcus pneumoniae isolates. Approximately half of the comprehensive set of genes in the species (the supragenome or pangenome) is present in all the isolates (core set), and the remaining is unevenly distributed among strains (distributed set). The Streptococcus pneumoniae Supragenome Hybridization (SpSGH) array provides coverage for an extensive set of genes and polymorphisms encountered within this species, capturing this genomic diversity. Further, the capture is quantitative. In this manner, the SpSGH array allows for both genomic and transcriptomic analyses of diverse S. pneumoniae isolates on a single platform. In this unit, we present the SpSGH array, and describe in detail its design and implementation for both genomic and transcriptomic analyses. The methodology can be applied to construction and modification of SpSGH array platforms, as well to other bacterial species as long as multiple whole-genome sequences are available that collectively capture the vast majority of the species supragenome. Copyright © 2015 John Wiley & Sons, Inc.

  16. The LuxS/AI-2 Quorum-Sensing System of Streptococcus pneumoniae Is Required to Cause Disease, and to Regulate Virulence- and Metabolism-Related Genes in a Rat Model of Middle Ear Infection

    Directory of Open Access Journals (Sweden)

    Mukesh K. Yadav

    2018-05-01

    Full Text Available Objective:Streptococcus pneumoniae colonizes the nasopharynx of children, and from nasopharynx it could migrate to the middle ear and causes acute otitis media (AOM. During colonization and AOM, the pneumococcus forms biofilms. In vitro biofilm formation requires a functional LuxS/AI-2 quorum-sensing system. We investigated the role of LuxS/AI-2 signaling in pneumococcal middle ear infection, and identified the genes that are regulated by LuxS/AI-2 during pneumococcal biofilm formation.Methods:Streptococcus pneumoniae D39 wild-type and an isogenic D39ΔluxS strain were utilized to evaluate in vitro biofilm formation, and in vivo colonization and epithelial damage using a microtiter plate assay and a rat model of pneumococcal middle ear infection, respectively. Biofilm structures and colonization and epithelial damage were evaluated at the ultrastructural level by scanning electron microscopy and confocal microscopy. Microarrays were used to investigate the global genes that were regulated by LuxS/AI-2 during biofilm formation.Results: The biofilm biomass and density of D39ΔluxS were significantly (p < 0.05 lower than those of D39 wild-type. SEM and confocal microscopy revealed that D39ΔluxS formed thin biofilms in vitro compared with D39 wild-type. The in vivo model of middle ear infection showed that D39ΔluxS resulted in ~60% less (p < 0.05 bacterial colonization than the wild-type. SEM analysis of the rat middle ears revealed dense biofilm-like cell debris deposited on the cilia in wild-type D39-infected rats. However, little cell debris was deposited in the middle ears of the D39ΔluxS-inoculated rats, and the cilia were visible. cDNA-microarray analysis revealed 117 differentially expressed genes in D39ΔluxS compared with D39 wild-type. Among the 66 genes encoding putative proteins and previously characterized proteins, 60 were significantly downregulated, whereas 6 were upregulated. Functional annotation revealed that genes involved in

  17. C3b/iC3b deposition on Streptococcus pneumoniae is not affected by HIV infection.

    Directory of Open Access Journals (Sweden)

    Catherine Hyams

    2010-01-01

    Full Text Available Streptococcus pneumoniae is a common cause of infection in both HIV positive patients and those with complement deficiencies. We hypothesised that HIV positive individuals might exhibit reduced opsonisation of pneumococcus with complement due to reduced levels of S. pneumoniae specific IgG. We discovered no difference in C3 deposition on S. pneumoniae between HIV positive or negative individuals, and furthermore C3 deposition remained unchanged as HIV progressed towards AIDS. We found no correlation between C3 deposition on S. pneumoniae and CD4 cell count in HIV infected individuals. Hence we have demonstrated no failure of complement immunity in HIV positive patients.

  18. NADH oxidase functions as an adhesin in Streptococcus pneumoniae and elicits a protective immune response in mice.

    Directory of Open Access Journals (Sweden)

    Lena Muchnik

    Full Text Available The initial event in disease caused by S. pneumoniae is adhesion of the bacterium to respiratory epithelial cells, mediated by surface expressed molecules including cell-wall proteins. NADH oxidase (NOX, which reduces free oxygen to water in the cytoplasm, was identified in a non-lectin enriched pneumococcal cell-wall fraction. Recombinant NOX (rNOX was screened with sera obtained longitudinally from children and demonstrated age-dependent immunogenicity. NOX ablation in S. pneumoniae significantly reduced bacterial adhesion to A549 epithelial cells in vitro and their virulence in the intranasal or intraperitoneal challenge models in mice, compared to the parental strain. Supplementation of Δnox WU2 with the nox gene restored its virulence. Saturation of A549 target cells with rNOX or neutralization of cell-wall residing NOX using anti-rNOX antiserum decreased adhesion to A549 cells. rNOX-binding phages inhibited bacterial adhesion. Moreover, peptides derived from the human proteins contactin 4, chondroitin 4 sulfotraferase and laminin5, homologous to the insert peptides in the neutralizing phages, inhibited bacterial adhesion to the A549 cells. Furthermore, rNOX immunization of mice elicited a protective immune response to intranasal or intraperitoneal S. pneumoniae challenge, whereas pneumococcal virulence was neutralized by anti-rNOX antiserum prior to intraperitoneal challenge. Our results suggest that in addition to its enzymatic activity, NOX contributes to S. pneumoniae virulence as a putative adhesin and thus peptides derived from its target molecules may be considered for the treatment of pneumococcal infections. Finally, rNOX elicited a protective immune response in both aerobic and anaerobic environments, which renders NOX a candidate for future pneumococcal vaccine.

  19. Análise das cepas de Streptococcus pneumoniae causadores de pneumonia invasiva: sorotipos e sensibilidade aos antimicrobianos

    Directory of Open Access Journals (Sweden)

    Cristina R. M. Yoshioka

    2011-02-01

    Full Text Available OBJETIVOS: Identificar os sorotipos de pneumococo mais frequentemente isolados de crianças internadas com pneumonia invasiva, comparar os sorotipos com os incluídos em vacinas conjugadas e analisar sua sensibilidade aos antimicrobianos mais utilizados na faixa etária pediátrica. MÉTODOS: Estudo descritivo, retrospectivo das pneumonias pneumocócicas identificadas em crianças internadas no hospital universitário da Universidade de São Paulo, no período de janeiro de 2003 a outubro de 2008. Os critérios de inclusão foram: faixa etária de 29 dias até 15 anos incompletos com diagnóstico clínico e radiológico de pneumonia e com cultura de sangue e/ou líquido pleural com crescimento de Streptococcus pneumoniae. RESULTADOS: Foram incluídas no estudo 107 crianças. Os sorotipos mais frequentes foram: 14 (36,5%, 1 (16,7%, 5 (14,6%, 6B (6,3% e 3 (4,2%. A proporção de sorotipos contidos na vacina conjugada heptavalente seria de 53,1%, na vacina 10-valente de 86,5% e na 13-valente seria de 96,9%. De acordo com os padrões do Clinical and Laboratory Standards Institute 2008, 100 cepas (93,5% de pneumococos foram sensíveis à penicilina (concentração inibitória mínima, CIM 8 µg/mL. Verificamos alta taxa de sensibilidade para as cepas testadas para vancomicina, rifampicina, ceftriaxone, clindamicina, cloranfenicol e eritromicina. CONCLUSÕES: Nossos resultados confirmam um expressivo impacto potencial das vacinas conjugadas, principalmente pela 10-valente e 13-valente, sobre os casos de pneumonias invasivas. Os resultados de sensibilidade à penicilina evidenciam que a opção terapêutica de escolha para o tratamento das pneumonias invasivas continua sendo a penicilina.

  20. Streptococcus pneumonia YlxR at 1.35 Å shows a putative new fold

    OpenAIRE

    Osipiuk, Jerzy; Górnicki, Piotr; Maj, Luke; Dementieva, Irina; Laskowski, Roman; Joachimiak, Andrzej

    2001-01-01

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Å. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Å from orthorhombic crystals using synchrotron radiation and the structure was determined ...

  1. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

    Science.gov (United States)

    2006-07-06

    P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

  2. Structure of the Streptococcus pneumoniae Surface Protein and Adhesin PfbA

    OpenAIRE

    Suits, Michael D.; Boraston, Alisdair B.

    2013-01-01

    PfbA (plasmin- and fibronectin-binding protein A) is an extracellular Streptococcus pneumoniae cell-wall attached surface protein that binds to fibronectin, plasmin, and plasminogen. Here we present a structural analysis of the surface exposed domains of PfbA using a combined approach of X-ray crystallography and small-angle X-ray scattering (SAXS). The crystal structure of the PfbA core domain, here called PfbAβ, determined to 2.28 Å resolution revealed an elongated 12-stranded parallel β-he...

  3. Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

    Science.gov (United States)

    Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

    1995-06-01

    A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

  4. Differential B-cell memory around the 11-month booster in children vaccinated with a 10- or 13-valent pneumococcal conjugate vaccine

    NARCIS (Netherlands)

    van Westen, Els; Wijmenga-Monsuur, Alienke J; van Dijken, Harry H; van Gaans-van den Brink, Jacqueline A M; Kuipers, Betsy; Knol, Mirjam J; Berbers, Guy A M; Sanders, Elisabeth A M; Rots, Nynke Y; van Els, Cécile A C M

    2015-01-01

    BACKGROUND: Both the 10- and 13-valent pneumococcal conjugate vaccines (PCV10 and PCV13) induce immunological memory against Streptococcus pneumoniae infections caused by vaccine serotypes. In addition to comparing serum antibody levels, we investigated frequencies of serotype-specific plasma cells

  5. Impact of bacteremia on the pathogenesis of experimental pneumococcal meningitis

    DEFF Research Database (Denmark)

    Brandt, Christian T; Holm, David; Liptrot, Matthew

    2008-01-01

    BACKGROUND: Bacteremia plays a major role in the outcome of pneumococcal meningitis. This experimental study investigated how bacteremia influences the pathophysiologic profile of the brain. METHODS: Rats with Streptococcus pneumoniae meningitis were randomized to 1 of 3 groups of infected study...... rats: (1) rats with attenuated bacteremia resulting from intravenous injection of serotype-specific pneumococcal antibody, (2) rats with early-onset bacteremia resulting from concomitant intravenous infection, or (3) a meningitis control group. The blood-brain barrier (BBB) breakdown, ventricle size......, brain water distribution, and brain pathologic findings were analyzed using magnetic resonance morphological and functional imaging. Laboratory data and clinical disease scores were obtained. RESULTS: Attenuation of the bacteremic component of pneumococcal meningitis improved clinical disease symptoms...

  6. Recurrent pneumococcal meningitis in a splenectomised HIV-infected patient

    Directory of Open Access Journals (Sweden)

    Quesne Gilles

    2003-11-01

    Full Text Available Abstract Background Streptococcus pneumoniae is a major cause of human disease, especially in pre-school children and elderly people, as well as in special risk groups such as asplenic, antibody deficient patients, or presenting disruption of natural barriers. The occurrence of pneumococcal disease has increased with the onset of the HIV epidemic and the emergence of drug-resistance. Case presentation We report the case of an HIV-1-infected patient who experienced three episodes of recurrent pneumococcal meningitis over a 4-year period, despite chemoprophylaxis and capsular vaccination. Conclusions Efficacy of anti-pneumococcal chemoprophylaxis and vaccination in HIV-infected patients are discussed in the light of this particular case.

  7. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Amauri Lázaro Noda Albelo

    2011-12-01

    Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.

  8. The relBE2Spn toxin-antitoxin system of Streptococcus pneumoniae: role in antibiotic tolerance and functional conservation in clinical isolates.

    Directory of Open Access Journals (Sweden)

    Concha Nieto

    2010-06-01

    Full Text Available Type II (proteic chromosomal toxin-antitoxin systems (TAS are widespread in Bacteria and Archaea but their precise function is known only for a limited number of them. Out of the many TAS described, the relBE family is one of the most abundant, being present in the three first sequenced strains of Streptococcus pneumoniae (D39, TIGR4 and R6. To address the function of the pneumococcal relBE2Spn TAS in the bacterial physiology, we have compared the response of the R6-relBE2Spn wild type strain with that of an isogenic derivative, Delta relB2Spn under different stress conditions such as carbon and amino acid starvation and antibiotic exposure. Differences on viability between the wild type and mutant strains were found only when treatment directly impaired protein synthesis. As a criterion for the permanence of this locus in a variety of clinical strains, we checked whether the relBE2Spn locus was conserved in around 100 pneumococcal strains, including clinical isolates and strains with known genomes. All strains, although having various types of polymorphisms at the vicinity of the TA region, contained a functional relBE2Spn locus and the type of its structure correlated with the multilocus sequence type. Functionality of this TAS was maintained even in cases where severe rearrangements around the relBE2Spn region were found. We conclude that even though the relBE2Spn TAS is not essential for pneumococcus, it may provide additional advantages to the bacteria for colonization and/or infection.

  9. Physical structure and genetic expression of the sulfonamide-resistance plasmid pLS80 and its derivatives in Streptococcus pneumoniae and Bacillus subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, P.; Espinosa, M.; Lacks, S.A.

    1984-01-01

    The 10-kb chromosomal fragment of Streptococcus pneumoniae cloned in pLS80 contains the sul-d allele of the pneumococcal gene for dihydropteroate synthase. As a single copy in the chromosome this allele confers resistance to sulfanilamide at 0.2 mg/ml; in the multicopy plasmid it confers resistance to 2.0 mg/ml. The sul-d mutation was mapped by restriction analysis to a 0.4-kb region. A spontaneous deletion beginning approx. 1.5 kb to the right of the sul-d mutation prevented gene function, possibly by removing a promoter. This region could be restored by chromosomal facilitation and be demonstrated in the plasmid by selection for sulfonamide resistance. Under selection for a vector marker, tetracycline resistance, only the deleted plasmid was detectable, apparently as a result of plasmid segregation and the advantageous growth rates of cells with smaller plasmids. When such cells were selected for sulfonamide resistance, the deleted region returned to the plasmid, presumably by equilibration between the chromosome and the plasmid pool, to give a low frequency (approx. 10/sup -3/) of cells resistant to sulfanilamide at 2.0 mg/ml. Models for the mechanisms of chromosomal facilitation and equilibration are proposed. Several derivatives of pLS80 could be transferred to Bacillus subtilis, where they conferred resistance to sulfanilamide at 2 mg/ml, thereby demonstrating cross-species expression of the pneumococcal gene. Transfer of the plasmids to B. subtilis gave rise to large deletions to the left of the sul-d marker, but these deletions did not interfere with the sul-d gene function. Restriction maps of pLS80 and its variously deleted derivatives are presented.

  10. A Novel Initiation Mechanism of Death in Streptococcus pneumoniae Induced by the Human Milk Protein-Lipid Complex HAMLET and Activated during Physiological Death*

    Science.gov (United States)

    Clementi, Emily A.; Marks, Laura R.; Duffey, Michael E.; Hakansson, Anders P.

    2012-01-01

    To cause colonization or infection, most bacteria grow in biofilms where differentiation and death of subpopulations is critical for optimal survival of the whole population. However, little is known about initiation of bacterial death under physiological conditions. Membrane depolarization has been suggested, but never shown to be involved, due to the difficulty of performing such studies in bacteria and the paucity of information that exists regarding ion transport mechanisms in prokaryotes. In this study, we performed the first extensive investigation of ion transport and membrane depolarization in a bacterial system. We found that HAMLET, a human milk protein-lipid complex, kills Streptococcus pneumoniae (the pneumococcus) in a manner that shares features with activation of physiological death from starvation. Addition of HAMLET to pneumococci dissipated membrane polarity, but depolarization per se was not enough to trigger death. Rather, both HAMLET- and starvation-induced death of pneumococci specifically required a sodium-dependent calcium influx, as shown using calcium and sodium transport inhibitors. This mechanism was verified under low sodium conditions, and in the presence of ionomycin or monensin, which enhanced pneumococcal sensitivity to HAMLET- and starvation-induced death. Pneumococcal death was also inhibited by kinase inhibitors, and indicated the involvement of Ser/Thr kinases in these processes. The importance of this activation mechanism was made evident, as dysregulation and manipulation of physiological death was detrimental to biofilm formation, a hallmark of bacterial colonization. Overall, our findings provide novel information on the role of ion transport during bacterial death, with the potential to uncover future antimicrobial targets. PMID:22700972

  11. A novel initiation mechanism of death in Streptococcus pneumoniae induced by the human milk protein-lipid complex HAMLET and activated during physiological death.

    Science.gov (United States)

    Clementi, Emily A; Marks, Laura R; Duffey, Michael E; Hakansson, Anders P

    2012-08-03

    To cause colonization or infection, most bacteria grow in biofilms where differentiation and death of subpopulations is critical for optimal survival of the whole population. However, little is known about initiation of bacterial death under physiological conditions. Membrane depolarization has been suggested, but never shown to be involved, due to the difficulty of performing such studies in bacteria and the paucity of information that exists regarding ion transport mechanisms in prokaryotes. In this study, we performed the first extensive investigation of ion transport and membrane depolarization in a bacterial system. We found that HAMLET, a human milk protein-lipid complex, kills Streptococcus pneumoniae (the pneumococcus) in a manner that shares features with activation of physiological death from starvation. Addition of HAMLET to pneumococci dissipated membrane polarity, but depolarization per se was not enough to trigger death. Rather, both HAMLET- and starvation-induced death of pneumococci specifically required a sodium-dependent calcium influx, as shown using calcium and sodium transport inhibitors. This mechanism was verified under low sodium conditions, and in the presence of ionomycin or monensin, which enhanced pneumococcal sensitivity to HAMLET- and starvation-induced death. Pneumococcal death was also inhibited by kinase inhibitors, and indicated the involvement of Ser/Thr kinases in these processes. The importance of this activation mechanism was made evident, as dysregulation and manipulation of physiological death was detrimental to biofilm formation, a hallmark of bacterial colonization. Overall, our findings provide novel information on the role of ion transport during bacterial death, with the potential to uncover future antimicrobial targets.

  12. Pneumococcal Infections: MedlinePlus Health Topic

    Science.gov (United States)

    ... Prevention, Immunization Action Coalition) - PDF Also in Spanish Topic Image MedlinePlus Email Updates Get Pneumococcal Infections updates ... ray Meningitis - pneumococcal Sputum gram stain Related Health Topics Meningitis Pneumonia Sepsis Sinusitis Streptococcal Infections National Institutes ...

  13. Impacto de la bacteriemia en una cohorte de pacientes con neumonía neumocócica Impact of bacteremia in a cohort of patients with pneumococcal pneumonia

    Directory of Open Access Journals (Sweden)

    Ileana Palma

    2012-08-01

    Full Text Available OBJETIVO: Bacteriemia es la forma invasiva más común de neumonía adquirida en la comunidad (NAC por Streptococcus pneumoniae. Investigamos si la bacteriemia en NAC neumocócica empeora los resultados y si ella guarda relación con la vacunación antineumocócica (VAN. MÉTODOS: Análisis secundario de una cohorte de pacientes con NAC neumocócica confirmada por cultivo de sangre o esputo o antígeno urinario. Se registraron datos demográficos, clínicos, radiográficos y de laboratorio, escores Acute Physiology and Chronic Health Evaluation II (APACHE II y pneumonia severity index (PSI, comorbilidades y antecedente de VAN. Se compararon pacientes con NAC neumocócica bacteriémica (NNB vs. no bacteriémica (NNNB. RESULTADOS: Cuarenta y siete pacientes tenían NNB y 71 NNNB (45 por cultivo de esputo y 26 por antígeno urinario; 107 tenían alguna indicación de VAN. Ningún paciente con NNB, pero 9 con NNNB, habían recibido VAN (p = 0,043. Los pacientes con NNB eran mayores (76,4 ± 11,5 vs. 67,5 ± 20,9 años, tenían mayor APACHE II (16,4 ± 4,6 vs. 14,1 ± 6,5 y PSI (129,5 ± 36 vs. 105,2 ± 45, más frecuentemente cardiopatía e insuficiencia renal crónica e internación en UTI (42,5% vs. 22,5% y menor hematocrito (35,7 ± 5,8 vs. 38,6 ± 6,7% y sodio plasmático (133,9 ± 6,0 vs. 137,1 ± 5,5 mEq/L. La mortalidad fue similar (29,8% vs. 28,2%. CONCLUSIONES: Los niveles de VAN (8,4% en esta población con alto riesgo de NAC por S. pneumoniae fueron extremadamente bajos. Los pacientes con NNB estaban más graves, pero la mortalidad fue similar entre los dos grupos. La VAN reduce la incidencia de NNB y es razonable incrementar el nivel de vacunación de la población en riesgo.OBJECTIVE: Bacteremia is the most common presentation of invasive disease in community-acquired pneumonia (CAP due to Streptococcus pneumoniae. We investigated whether bacteremia in pneumococcal CAP worsens outcomes and whether it is related to pneumococcal

  14. Impact of experimental human pneumococcal carriage on nasopharyngeal bacterial densities in healthy adults.

    Science.gov (United States)

    Shak, Joshua R; Cremers, Amelieke J H; Gritzfeld, Jenna F; de Jonge, Marien I; Hermans, Peter W M; Vidal, Jorge E; Klugman, Keith P; Gordon, Stephen B

    2014-01-01

    Colonization of the nasopharynx by Streptococcus pneumoniae is a necessary precursor to pneumococcal diseases that result in morbidity and mortality worldwide. The nasopharynx is also host to other bacterial species, including the common pathogens Staphylococcus aureus, Haemophilus influenzae, and Moraxella catarrhalis. To better understand how these bacteria change in relation to pneumococcal colonization, we used species-specific quantitative PCR to examine bacterial densities in 52 subjects 7 days before, and 2, 7, and 14 days after controlled inoculation of healthy human adults with S. pneumoniae serotype 6B. Overall, 33 (63%) of subjects carried S. pneumoniae post-inoculation. The baseline presence and density of S. aureus, H. influenzae, and M. catarrhalis were not statistically associated with likelihood of successful pneumococcal colonization at this study's sample size, although a lower rate of pneumococcal colonization in the presence of S. aureus (7/14) was seen compared to that in the presence of H. influenzae (12/16). Among subjects colonized with pneumococci, the number also carrying either H. influenzae or S. aureus fell during the study and at 14 days post-inoculation, the proportion carrying S. aureus was significantly lower among those who were colonized with S. pneumoniae (p = 0.008) compared to non-colonized subjects. These data on bacterial associations are the first to be reported surrounding experimental human pneumococcal colonization and show that co-colonizing effects are likely subtle rather than absolute.

  15. Impact of experimental human pneumococcal carriage on nasopharyngeal bacterial densities in healthy adults.

    Directory of Open Access Journals (Sweden)

    Joshua R Shak

    Full Text Available Colonization of the nasopharynx by Streptococcus pneumoniae is a necessary precursor to pneumococcal diseases that result in morbidity and mortality worldwide. The nasopharynx is also host to other bacterial species, including the common pathogens Staphylococcus aureus, Haemophilus influenzae, and Moraxella catarrhalis. To better understand how these bacteria change in relation to pneumococcal colonization, we used species-specific quantitative PCR to examine bacterial densities in 52 subjects 7 days before, and 2, 7, and 14 days after controlled inoculation of healthy human adults with S. pneumoniae serotype 6B. Overall, 33 (63% of subjects carried S. pneumoniae post-inoculation. The baseline presence and density of S. aureus, H. influenzae, and M. catarrhalis were not statistically associated with likelihood of successful pneumococcal colonization at this study's sample size, although a lower rate of pneumococcal colonization in the presence of S. aureus (7/14 was seen compared to that in the presence of H. influenzae (12/16. Among subjects colonized with pneumococci, the number also carrying either H. influenzae or S. aureus fell during the study and at 14 days post-inoculation, the proportion carrying S. aureus was significantly lower among those who were colonized with S. pneumoniae (p = 0.008 compared to non-colonized subjects. These data on bacterial associations are the first to be reported surrounding experimental human pneumococcal colonization and show that co-colonizing effects are likely subtle rather than absolute.

  16. Crystallization and preliminary X-ray crystallographic studies of DnaJ from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Zhao, Shasha; Jin, Li; Niu, Siqiang; Yang, Wei; Zhang, Shaocheng; Guo, Zhen; Zhang, Hongpeng; Huang, Ailong; Yin, Yibing; Wang, Deqiang

    2013-01-01

    DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. DnaJ, cooperating with DnaK and GrpE, promotes the folding of unfolded hydrophobic polypeptides, dissociates protein complexes and translocates protein across membranes. Additionally, DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. The crystals belong to space groups I222 or I2 1 2 1 2 1 and the diffraction resolution is 3.0 Å with unit-cell parameters a = 47.68, b = 104.45, c = 234.57 Å. The crystal most likely contains one molecule in the asymmetric unit, with a V M value of 3.24 Å 3 Da −1 and a solvent content of 62.1%

  17. Feasibility and Safety of Local Treatment with Recombinant Human Tissue Factor Pathway Inhibitor in a Rat Model of Streptococcus pneumoniae Pneumonia.

    Directory of Open Access Journals (Sweden)

    Florry E van den Boogaard

    Full Text Available Pulmonary coagulopathy is intrinsic to pulmonary injury including pneumonia. Anticoagulant strategies could benefit patients with pneumonia, but systemic administration of anticoagulant agents may lead to suboptimal local levels and may cause systemic hemorrhage. We hypothesized nebulization to provide a safer and more effective route for local administration of anticoagulants. Therefore, we aimed to examine feasibility and safety of nebulization of recombinant human tissue factor pathway inhibitor (rh-TFPI in a well-established rat model of Streptococcus (S. pneumoniae pneumonia. Thirty minutes before and every 6 hours after intratracheal instillation of S. pneumonia causing pneumonia, rats were subjected to local treatment with rh-TFPI or placebo, and sacrificed after 42 hours. Pneumonia was associated with local as well as systemic activation of coagulation. Nebulization of rh-TFPI resulted in high levels of rh-TFPI in bronchoalveolar lavage fluid, which was accompanied by an attenuation of pulmonary coagulation. Systemic rh-TFPI levels remained undetectable, and systemic TFPI activity and systemic coagulation were not affected. Histopathology revealed no bleeding in the lungs. We conclude that nebulization of rh-TFPI seems feasible and safe; local anticoagulant treatment with rh-TFPI attenuates pulmonary coagulation, while not affecting systemic coagulation in a rat model of S. pneumoniae pneumonia.

  18. Innovative Strategies Designed to Improve Adult Pneumococcal Immunizations in Safety Net Patient-Centered Medical Homes.

    Science.gov (United States)

    Park, Nina J; Sklaroff, Laura Myerchin; Gross-Schulman, Sandra; Hoang, Khathy; Tran, Helen; Campa, David; Scheib, Geoffrey; Guterman, Jeffrey J

    2016-08-01

    Streptococcus pneumoniae is a principal cause of serious illness, including bacteremia, meningitis, and pneumonia, worldwide. Pneumococcal immunization is proven to reduce morbidity and mortality in high-risk adult and elderly populations. Current pneumococcal vaccination practices are suboptimal in part because of recommendation complexity, the high cost of provider-driven immunization interventions, and outreach methods that are not patient-centric. These barriers are amplified within the safety net. This paper identifies efforts by the Los Angeles County Department of Health Services to increase pneumococcal immunization rates for adult indigent patient populations. A 4-part approach will be used to increase vaccination rates: (1) protocol driven care, (2) staff education, (3) electronic identification of eligible patients, and (4) automated patient outreach and scheduling. The proposed analytics plan and potential for scalability are described. (Population Health Management 2016;19:240-247).

  19. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae Use of penicillin in the extrameningeal infection from Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Amauri Lázaro Noda Albelo

    2011-12-01

    Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.The beta-lactamase resistance of Strepcoccus pneumoniae is relative and may to be overcome if the dose of this type of drugs is increased. The definition of oversensitivity and of resistance of above mentioned bacteria was originally created to predict the infection response of central nervous system (CNS to treatment. The infection outside of the CNS by most of strains of S. pneumoniae responds to habitual dose of betalactamic antibiotics. A review of the new cut points of Laboratory Standards Institute for the sensitivity to pathogen penicillin and its implication in current therapy of extrameningeal disease by S. pneumoniae is analyzed.

  20. MLVA Typing of Streptococcus pneumoniae Isolates with Emphasis on Serotypes 14, 9N and 9V: Comparison of Previously Described Panels and Proposal of a Novel 7 VNTR Loci-Based Simplified Scheme.

    Science.gov (United States)

    Costa, Natália S; Pinto, Tatiana C A; Merquior, Vânia L C; Castro, Luciana F S; da Rocha, Filomena S P; Morais, Jaqueline M; Peralta, José M; Teixeira, Lúcia M

    2016-01-01

    Streptococcus pneumoniae remains as an important cause of community-acquired bacterial infections, and the nasopharynx of asymptomatic carriers is the major reservoir of this microorganism. Pneumococcal strains of serotype 14 and serogroup 9 are among the most frequently isolated from both asymptomatic carriers and patients with invasive disease living in Brazil. Internationally disseminated clones belonging to such serotypes have been associated with the emergence and spread of antimicrobial resistance in our setting, highlighting the need for epidemiological tracking of these isolates. In this scenario, Multiple Loci VNTR Analysis (MLVA) has emerged as an alternative tool for the molecular characterization of pneumococci, in addition to more traditional techniques such as Multi-Locus Sequence Typing (MLST) and Pulsed-Field Gel Electrophoresis (PFGE). In the present study, 18 VNTR loci, as well as other previously described reduced MLVA panels (7 VNTR loci), were evaluated as tools to characterize pneumococcal strains of serotypes 14, 9N and 9V belonging to international and regional clones isolated in Brazil. The 18 VNTR loci panel was highly congruent with MLST and PFGE, being also useful for indicating the genetic relationship with international clones and for discriminating among strains with indistinguishable STs and PFGE profiles. Analysis of the results also allowed deducing a novel shorter 7 VNTR loci panel, keeping a high discriminatory power for isolates of the serotypes investigated and a high congruence level with MLST and PFGE. The newly proposed simplified panel was then evaluated for typing pneumococcal strains of other commonly isolated serotypes. The results indicate that MLVA is a faster and easier to perform, reliable approach for the molecular characterization of S. pneumoniae isolates, with potential for cost-effective application, especially in resource-limited countries.

  1. Genotyping and serotyping of macrolide and multidrug resistant Streptococcus pneumoniae isolated from carrier children

    Directory of Open Access Journals (Sweden)

    S F Swedan

    2016-01-01

    Full Text Available Aims: Streptococcus pneumoniae, an opportunistic pathogen commonly carried asymptomatically in the nasopharynx of children, is associated with increasing rates of treatment failures due to a worldwide increase in drug resistance. We investigated the carriage of S. pneumoniae in children 5 years or younger, the identity of prevalent serotypes, the rates of resistance to macrolides and other antimicrobial agents and the genotypes responsible for macrolide resistance. Materials and Methods: Nasopharyngeal swabs were collected from 157 children under 5 years for cultural isolation of S. pneumoniae. Antibiogram of isolates  was determined using the disk diffusion test, and the minimal inhibitory concentration to macrolides was determined using the E-test. Isolate serotypes and macrolide resistance genes, erm(B and mef(E, were identified using multiplex polymerase chain reactions. Results: S. pneumoniae was recovered from 33.8% of children; 41.9% among males and 21.9% among females (P = 0.009. The highest carriage rate occurred among age groups 7-12 months and 49-60 months. Most frequent serotypes were 19F, 6A/B, 11A, 19A, 14 and 15B/C.  Resistance to macrolides was 60.4%. Resistance to oxacillin, trimethoprim/sulfamethoxazole and clindamycin was present among 90.6%, 54.7% and 32.1% of isolates, respectively. All isolates were susceptible to chloramphenicol, levofloxacin and vancomycin. Isolates resistant to one or more macrolide drugs were more likely to be multidrug resistant. Resistance to clindamycin or oxacillin coexisted with macrolide resistance. Among the erythromycin-resistant isolates, erm(B, mef(E and erm(B and mef(E genes were present at rates of 43.8%, 37.5% and 6.3%, respectively. Erm(B and mef(E were associated with very high level and moderate-to-high level resistance to macrolides, respectively. Conclusion: A significant proportion of children harboured macrolide and multidrug-resistant S. pneumoniae.

  2. The Three Major Spanish Clones of Penicillin-Resistant Streptococcus pneumoniae Are the Most Common Clones Recovered in Recent Cases of Meningitis in Spain

    Science.gov (United States)

    Enright, Mark C.; Fenoll, Asunción; Griffiths, David; Spratt, Brian G.

    1999-01-01

    One hundred six isolates of Streptococcus pneumoniae recovered in Spain from patients with meningitis in 1997 and 1998 were characterized by multilocus sequence typing. A heterogeneous collection of genotypes was associated with meningitis in Spain: 65 different sequence types were resolved and, even at a genetic distance of 0.43, there were 37 distinct lineages. Thirty-eight percent of the isolates, including all isolates of serotypes 6B, 9V, 14, and 23F, were resistant to penicillin, and 24% of the isolates were members of the three major Spanish penicillin-resistant or multidrug-resistant clones of serotypes 6B, 9V, and 23F or serotype variants of these clones. These three clones (MICs, 1 to 2 μg of penicillin/ml) were the most common clones associated with pneumococcal meningitis in Spain during 1997 and 1998. Only two of the other clones associated with meningitis were penicillin resistant (MICs, 0.12 to 0.5 μg/ml). One of the two most prevalent penicillin-susceptible clones causing meningitis (serotype 3) has not been detected outside of Spain, whereas the other (serotype 18C) has been recovered from patients with meningitis in the United Kingdom, The Netherlands, and Denmark. The prevalence of meningitis caused by isolates of the three major Spanish penicillin-resistant or multiply antibiotic-resistant clones, which are now globally distributed, is disturbing and clearly establishes their ability to cause life-threatening disease. PMID:10488179

  3. Prevalence of mef and ermB genes in invasive pediatric erythromycin-resistant Streptococcus pneumoniae isolates from Argentina Prevalencia de los genes mef y ermB en aislamientos invasivos de Streptococcus pneumoniae resistentes a eritromicina recuperados de pacientes pediátricos en Argentina

    Directory of Open Access Journals (Sweden)

    A. Corso

    2009-03-01

    Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.

  4. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  5. Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence.

    NARCIS (Netherlands)

    Hendriksen, W.T.; Bootsma, H.J.; Diepen, A. van; Estevao, S.; Kuipers, O.P.; Groot, R. de; Hermans, P.W.M.

    2009-01-01

    Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray

  6. LocZ is a new cell division protein involved in proper septum placement in Streptococcus pneumoniae

    Czech Academy of Sciences Publication Activity Database

    Holečková, Nela; Doubravová, Linda; Massidda, Orietta; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel

    2015-01-01

    Roč. 6, č. 1 (2015), s. 1-13 ISSN 2150-7511 R&D Projects: GA ČR GAP207/12/1568; GA ČR GAP302/12/0256 Institutional support: RVO:61388971 Keywords : cell division * septum placement * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology Impact factor: 6.975, year: 2015

  7. LuxS impacts on LytA-dependent autolysis and on competence in Streptococcus pneumoniae.

    Science.gov (United States)

    Romao, Susana; Memmi, Guido; Oggioni, Marco R; Trombe, Marie-Claude

    2006-02-01

    The ubiquitous protein LuxS with S-ribosylhomocysteinase activity is involved in S-adenosyl methionine detoxification, C-1 unit recycling and the production of autoinducers that allow the cell to sense and respond to cell density. Independent reports describe the impact of LuxS deficiency on Streptococcus pneumoniae virulence in the mouse. In vitro, LuxS deficiency confers discrete phenotypes. A combined approach using genetic dissection and mixed-culture experiments allowed the involvement of LuxS in the developmental physiology of S. pneumoniae to be investigated. Functional LuxS was found to be related on the one hand to down-regulation of competence, and on the other hand to attenuation of autolysis in cultures entering stationary phase. The competence phenotype of luxS mutant bacteria was complemented by media conditioned by competence-defective ComAB0 bacteria, but not by BSA. The autolytic phenotype was complemented by BSA, but not by conditioned supernatants. It is suggested that the impact of LuxS on competence, but not on autolysis, involves cell-cell communication. The phenotype of luxS mutant strains reveals a hierarchy in the competence regulatory networks of S. pneumoniae.

  8. Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Sandra M Carvalho

    Full Text Available Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

  9. IL-22 Defect During Streptococcus pneumoniae Infection Triggers Exacerbation of Chronic Obstructive Pulmonary Disease

    Directory of Open Access Journals (Sweden)

    Muriel Pichavant

    2015-11-01

    Full Text Available Progression of chronic obstructive pulmonary disease (COPD is linked to episodes of exacerbations caused by bacterial infections due to Streptococcus pneumoniae. Our objective was to identify during COPD, factors of susceptibility to bacterial infections among cytokine network and their role in COPD exacerbations. S. pneumoniae was used to sub-lethally challenge mice chronically exposed to air or cigarette smoke (CS and to stimulate peripheral blood mononuclear cells (PBMC from non-smokers, smokers and COPD patients. The immune response and the cytokine production were evaluated. Delayed clearance of the bacteria and stronger lung inflammation observed in infected CS-exposed mice were associated with an altered production of IL-17 and IL-22 by innate immune cells. This defect was related to a reduced production of IL-1β and IL-23 by antigen presenting cells. Importantly, supplementation with recombinant IL-22 restored bacterial clearance in CS-exposed mice and limited lung alteration. In contrast with non-smokers, blood NK and NKT cells from COPD patients failed to increase IL-17 and IL-22 levels in response to S. pneumoniae, in association with a defect in IL-1β and IL-23 secretion. This study identified IL-17 and IL-22 as susceptibility factors in COPD exacerbation. Therefore targeting such cytokines could represent a potent strategy to control COPD exacerbation.

  10. Septicaemia models using Streptococcus pneumoniae and Listeria monocytogenes: understanding the role of complement properdin.

    Science.gov (United States)

    Dupont, Aline; Mohamed, Fatima; Salehen, Nur'Ain; Glenn, Sarah; Francescut, Lorenza; Adib, Rozita; Byrne, Simon; Brewin, Hannah; Elliott, Irina; Richards, Luke; Dimitrova, Petya; Schwaeble, Wilhelm; Ivanovska, Nina; Kadioglu, Aras; Machado, Lee R; Andrew, Peter W; Stover, Cordula

    2014-08-01

    Streptococcus pneumoniae and Listeria monocytogenes, pathogens which can cause severe infectious disease in human, were used to infect properdin-deficient and wildtype mice. The aim was to deduce a role for properdin, positive regulator of the alternative pathway of complement activation, by comparing and contrasting the immune response of the two genotypes in vivo. We show that properdin-deficient and wildtype mice mounted antipneumococcal serotype-specific IgM antibodies, which were protective. Properdin-deficient mice, however, had increased survival in the model of streptococcal pneumonia and sepsis. Low activity of the classical pathway of complement and modulation of FcγR2b expression appear to be pathogenically involved. In listeriosis, however, properdin-deficient mice had reduced survival and a dendritic cell population that was impaired in maturation and activity. In vitro analyses of splenocytes and bone marrow-derived myeloid cells support the view that the opposing outcomes of properdin-deficient and wildtype mice in these two infection models is likely to be due to a skewing of macrophage activity to an M2 phenotype in the properdin-deficient mice. The phenotypes observed thus appear to reflect the extent to which M2- or M1-polarised macrophages are involved in the immune responses to S. pneumoniae and L. monocytogenes. We conclude that properdin controls the strength of immune responses by affecting humoral as well as cellular phenotypes during acute bacterial infection and ensuing inflammation.

  11. Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

    Science.gov (United States)

    Carvalho, Sandra M; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P; Neves, Ana R; Bijlsma, Jetta J E

    2013-01-01

    Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps) transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

  12. Antibiotic susceptibility of Streptococcus pneumoniae colonizing the nasopharynx of Colombian children with pneumonia Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1997-10-01

    Full Text Available Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolates (17%, with 12 (11% having an intermediate level of sensitivity and 7 (6% showing outright resistance. Only 1 of the 19 isolates resistant to penicillin also showed resistance to ceftriaxone. There was diminished sensitivity to erythromycin in 3 isolates (3%, to chloramphenicol in 6 (5%, and to co-trimoxazole (trimethoprim + sulfamethoxazole in 46 (40%. Resistance to multiple drugs was found in 7 isolates (6%. The most commonly encountered penicillin-resistant serotype was 23F (68.4%. An association was observed between age, prior use of antibiotics, and colonization by S. pneumoniae with reduced penicillin sensitivity or multiple-drug resistance. This study confirmed the presence of antibiotic-resistant S. pneumoniae in Colombia and highlights the importance of the rational use of antibiotics and of the implementation of epidemiologic surveillance for this agent.Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia

  13. Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía Antibiotic susceptibility of Streptococcus pneumoniae colonizing the nasopharynx of Colombian children with pneumonia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1997-04-01

    Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolations (17%, with 12 (11

  14. Adult bacteremic pneumococcal pneumonia acquired in the community: A prospective study on 101 patients Neumonía neumocóccica bacteriémica de la comunidad: Un estudio prospectivo en 101 pacientes

    Directory of Open Access Journals (Sweden)

    J. H. Gentile

    2003-01-01

    Full Text Available Our objective was to describe incidence, clinical, radiographic and microbiological features of bacteremic pneumococcal pneumonia (BPP in our environment. A total of 101 patients (7 were treated as outpatients, older than 18 years of age suffering BPP were prospectively evaluated. The incidence was 2.8 cases per 1000 admissions, 50 were males, mean age was 59.9 years (19-97, mortality was 11.8%. Eighty three percent of fatalities occurred within 3 days of admission. Mortality rate increased with advancing age. Fever, cough and chest pain were the commonest presenting symptoms and 44% of patients had extrapulmonary manifestations. Cigarette smoking, chronic obstructive lung disease, alcoholism and congestive heart failure (CHF were the commonest underlying conditions. CHF was more frequent in non-survivors (p = 0.002. A lobar pattern at chest radiograph predominated in survivors and a diffuse pattern in non-survivors (p = 0.007. Pleural effusion (20.7%, empyema (7.9% and respiratory failure (7.9% were the main complications. Underlying diseases were present in 100% of non-survivors (p = 0.03. Ninety four percent of patients were treated with beta-lactam antibiotics. Streptococcus pneumoniae was isolated from sputum in 6 cases. Three out of 101 S. pneumoniae isolates recovered from blood samples (one from each patient presented organisms resistant to penicillin. We observed an incidence of BPP that is similar to the observed in other countries. There are clinical and radiographic differences between survivors and non-survivors. Penicillin-resistant S. pneumoniae is still an unusual problem in our area.Se evaluaron en forma prospectiva 101 pacientes > 18 años admitidos al hospital con diagnóstico de NNB. El objetivo fue conocer la incidencia y describir las características de la enfermedad, así como la susceptibilidad antibiótica de cepas invasivas de Streptococcus pneumoniae. Se halló una incidencia de 2.8 casos/1000 admisiones; 50 fueron

  15. Recurrent invasive pneumococcal disease in children

    DEFF Research Database (Denmark)

    Ingels, Helene; Lambertsen, Lotte; Harboe, Zitta B

    2014-01-01

    %, and 78% of the cases would have been covered by the 7-, 10-, and 13-valent pneumococcal conjugate vaccines, respectively. Conclusions: Of children with an IPD episode, 2.4% experienced rIPD, and an underlying disease was documented in 66% of these children. Investigation of underlying conditions...... laboratory-confirmed cases of IPD in children aged 0-15 y were identified from the Neisseria and Streptococcus Reference Laboratory, Statens Serum Institut, Denmark for the period 1980-2013. rIPD was defined as isolation of Streptococcus pneumoniae from any normally sterile site ≥ 30 days after an initial...... positive culture. Clinical data were obtained for all children with rIPD. Results: Of all children with IPD, 2.4% (59/2418) experienced at least 1 episode of rIPD, and an underlying condition was documented in 39 (66%). Immune deficiency due to transplantation (n = 9) was the most common disease; however...

  16. Transcriptional attenuation controls macrolide inducible efflux and resistance in Streptococcus pneumoniae and in other Gram-positive bacteria containing mef/mel(msr(D)) elements.

    Science.gov (United States)

    Chancey, Scott T; Bai, Xianhe; Kumar, Nikhil; Drabek, Elliott F; Daugherty, Sean C; Colon, Thomas; Ott, Sandra; Sengamalay, Naomi; Sadzewicz, Lisa; Tallon, Luke J; Fraser, Claire M; Tettelin, Hervé; Stephens, David S

    2015-01-01

    Macrolide resistance, emerging in Streptococcus pneumoniae and other Gram-positive bacteria, is increasingly due to efflux pumps encoded by mef/mel(msr) operons found on discrete mobile genetic elements. The regulation of mef/mel(msr) in these elements is not well understood. We identified the mef(E)/mel transcriptional start, localized the mef(E)/mel promoter, and demonstrated attenuation of transcription as a mechanism of regulation of macrolide-inducible mef-mediated macrolide resistance in S. pneumoniae. The mef(E)/mel transcriptional start site was a guanine 327 bp upstream of mef(E). Consensus pneumococcal promoter -10 (5'-TATACT-3') and -35 (5'-TTGAAC-3') boxes separated by 17 bp were identified 7 bp upstream of the start site. Analysis of the predicted secondary structure of the 327 5' region identified four pairs of inverted repeats R1-R8 predicted to fold into stem-loops, a small leader peptide [MTASMRLR, (Mef(E)L)] required for macrolide induction and a Rho-independent transcription terminator. RNA-seq analyses provided confirmation of transcriptional attenuation. In addition, expression of mef(E)L was also influenced by mef(E)L-dependent mRNA stability. The regulatory region 5' of mef(E) was highly conserved in other mef/mel(msr)-containing elements including Tn1207.1 and the 5612IQ complex in pneumococci and Tn1207.3 in Group A streptococci, indicating a regulatory mechanism common to a wide variety of Gram-positive bacteria containing mef/mel(msr) elements.

  17. Components of Streptococcus pneumoniae suppress allergic airways disease and NKT cells by inducing regulatory T cells.

    Science.gov (United States)

    Thorburn, Alison N; Foster, Paul S; Gibson, Peter G; Hansbro, Philip M

    2012-05-01

    Asthma is an allergic airways disease (AAD) caused by dysregulated immune responses and characterized by eosinophilic inflammation, mucus hypersecretion, and airway hyperresponsiveness (AHR). NKT cells have been shown to contribute to AHR in some mouse models. Conversely, regulatory T cells (Tregs) control aberrant immune responses and maintain homeostasis. Recent evidence suggests that Streptococcus pneumoniae induces Tregs that have potential to be harnessed therapeutically for asthma. In this study, mouse models of AAD were used to identify the S. pneumoniae components that have suppressive properties, and the mechanisms underlying suppression were investigated. We tested the suppressive capacity of type-3-polysaccharide (T3P), isolated cell walls, pneumolysoid (Ply) and CpG. When coadministered, T3P + Ply suppressed the development of: eosinophilic inflammation, Th2 cytokine release, mucus hypersecretion, and AHR. Importantly, T3P + Ply also attenuated features of AAD when administered during established disease. We show that NKT cells contributed to the development of AAD and also were suppressed by T3P + Ply treatment. Furthermore, adoptive transfer of NKT cells induced AHR, which also could be reversed by T3P + Ply. T3P + Ply-induced Tregs were essential for the suppression of NKT cells and AAD, which was demonstrated by Treg depletion. Collectively, our results show that the S. pneumoniae components T3P + Ply suppress AAD through the induction of Tregs that blocked the activity of NKT cells. These data suggest that S. pneumoniae components may have potential as a therapeutic strategy for the suppression of allergic asthma through the induction of Tregs and suppression of NKT cells.

  18. Antimicrobial resistance patterns of colonizing Streptococcus pneumoniae among young child-mother pairs in the rural highlands of the Peruvian Andes

    Science.gov (United States)

    Howard, Leigh; Edwards, Kathryn; Griffin, Marie; Gil, Ana; Minaya, Gina; Mercado, Erik; Ochoa, Theresa; Lanata, Claudio; Grijalva, Carlos G

    2017-01-01

    Abstract Background Despite widespread use of pneumococcal conjugate vaccines (PCVs), Streptococcus pneumoniae (pneumococcus) remains an important cause of pneumonia. Prior to widespread PCV use, we found a high prevalence of nasopharyngeal (NP) colonization with pneumococcus resistant to multiple antibiotic classes among young children in the rural highlands of Peru. We sought to confirm contemporary resistance profiles among young children, their mothers, and animal contacts in the post-PCV era. Methods We enrolled eligible members of Peruvian households whose children had participated in our previous study. Mothers were questioned about antibiotic use for themselves and their children age <3 years. NP samples were collected from children, mothers, and their animal contacts including cows, guinea pigs, and dogs, when available. Samples were cultured for pneumococcus using standard methods and routine disk antibiotic susceptibility testing was performed. Drinking water and milk samples were tested, when available, for the presence of β-lactam and tetracycline residues (IDEXX Β-Tetra testing kit; Westbrook, ME). Results Members of 47 households were enrolled, including 50 children and 47 mothers (3 sibling pairs). The median (IQR) age of children was 1.2 years (0.6-2.2) and number of household members was 5 (4-6). Sixteen of 50 (32%) children and 7/47 (15%) mothers had received antibiotics in the prior 6 months (Fig 1). Pneumococcus was detected in 31/50 (62%) children, 9/47 (19%) mothers, and 1/31 (3%) guinea pigs. Pneumococci were not detected in dogs (n = 29) or cows (n = 7). Resistance to multiple classes of antibiotics, including TMP-SMX, tetracyclines, and β-lactams, was common among children and adults (Fig 2). No antibiotic residues were detected in water (n = 41) or milk (n = 7) samples. Conclusion Pneumococcal colonization was common among young children, less prevalent among adults, and rare among animals. Resistance to macrolides and

  19. Sampling methods for the study of pneumococcal carriage: a systematic review.

    Science.gov (United States)

    Gladstone, R A; Jefferies, J M; Faust, S N; Clarke, S C

    2012-11-06

    Streptococcus pneumoniae is an important pathogen worldwide. Accurate sampling of S. pneumoniae carriage is central to surveillance studies before and following conjugate vaccination programmes to combat pneumococcal disease. Any bias introduced during sampling will affect downstream recovery and typing. Many variables exist for the method of collection and initial processing, which can make inter-laboratory or international comparisons of data complex. In February 2003, a World Health Organisation working group published a standard method for the detection of pneumococcal carriage for vaccine trials to reduce or eliminate variability. We sought to describe the variables associated with the sampling of S. pneumoniae from collection to storage in the context of the methods recommended by the WHO and those used in pneumococcal carriage studies since its publication. A search of published literature in the online PubMed database was performed on the 1st June 2012, to identify published studies that collected pneumococcal carriage isolates, conducted after the publication of the WHO standard method. After undertaking a systematic analysis of the literature, we show that a number of differences in pneumococcal sampling protocol continue to exist between studies since the WHO publication. The majority of studies sample from the nasopharynx, but the choice of swab and swab transport media is more variable between studies. At present there is insufficient experimental data that supports the optimal sensitivity of any standard method. This may have contributed to incomplete adoption of the primary stages of the WHO detection protocol, alongside pragmatic or logistical issues associated with study design. Consequently studies may not provide a true estimate of pneumococcal carriage. Optimal sampling of carriage could lead to improvements in downstream analysis and the evaluation of pneumococcal vaccine impact and extrapolation to pneumococcal disease control therefore

  20. Meningitis caused by streptococci other than Streptococcus pneumoniae: a retrospective clinical study

    DEFF Research Database (Denmark)

    Møller, Kirsten; Harder, Eva; Wandall, Johan

    1999-01-01

    We reviewed the medical records of 26 patients (median age 62 years, range 5-76 years) admitted to our institution during 1978-98 with acute bacterial meningitis (ABM) caused by streptococci other than Streptococcus pneumoniae (comprising 1.9% of all patients with ABM). 19 cases were community......-acquired and 7 were nosocomial. 73% had comorbid or predisposing conditions and 73% had an identifiable extracerebral focus; only in 2 patients no comorbid disease, primary focus or predisposing condition was present. Five patients had cerebral abscesses, and 5 had endocarditis. Beta-haemolytic streptococci were...... grown in 14 cases (serotype A: 4, B: 5, C: 1, G: 4) and were predominant among patients with endocarditis, whereas alpha- or non-haemolytic strains grew in 12 cases (S. mitis: 4, S. constellatus: 2, E. faecalis: 2, S. bovis: 1, unspecified: 3) and were predominant in patients with a brain abscess...

  1. Spermidine Biosynthesis and Transport Modulate Pneumococcal Autolysis

    Science.gov (United States)

    Potter, Adam J.

    2014-01-01

    Polyamines are small cationic molecules that have far-reaching roles in biology. In the case of pathogenic bacteria, these functions include those central to their pathogenesis. Streptococcus pneumoniae is a major bacterial pathogen, causing a diverse range of diseases that account for significant morbidity and mortality worldwide. In this work, we characterize the polyamine biosynthetic pathway of S. pneumoniae, demonstrating that this organism produces spermidine from arginine. The synthesis of spermidine was found to be nonessential for growth in a polyamine-free chemically defined medium. However, mutant strains lacking the ability to synthesize or transport spermidine displayed a significant delay in the onset of autolysis. We provide evidence for a model in which spermidine modulates the activity of the major autolysin LytA in the pneumococcal cell wall compartment via interactions with negatively charged molecules, such as teichoic acids. PMID:25092031

  2. Meningitis and pneumonia in Guatemalan children: the importance of Haemophilus influenzae type b and Streptococcus pneumoniae Meningitis y neumonía en niños guatemaltecos: importancia de Haemophilus influenzae tipo b y de Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Edwin J. Asturias

    2003-12-01

    Full Text Available OBJECTIVE: To determine the epidemiology of Haemophilus influenzae type b (Hib and Streptococcus pneumoniae invasive infections in hospitalized Guatemalan children. This is an important issue since Hib vaccine has not been incorporated into the routine immunization program in Guatemala and information from hospital records in 1995 indicated a low incidence of Hib and S. pneumoniae as causes of meningitis and invasive infections. METHODS: Children who were hospitalized in Guatemala City with clinical signs compatible with bacterial infections were evaluated for evidence of Hib or S. pneumoniae infection. Normally sterile body fluids were cultured, and antigen detection was performed on cerebrospinal fluid (CSF and pleural fluid. RESULTS: Of 1 203 children 1-59 months of age hospitalized over a 28-month period, 725 of them (60.3% had a primary diagnosis of pneumonia, 357 (29.7% of meningitis, 60 (5.0% of cellulitis, and 61 (5.1% of sepsis and other conditions. Hib was identified in 20.0% of children with meningitis and S. pneumoniae in 12.9%. The average annual incidence of Hib meningitis was 13.8 cases per 100 000 children under 5 years of age, and 32.4% of meningitides caused by Hib and 58.7% of S. pneumoniae meningitides occurred prior to 6 months of age. Case fatality rates were 14.1%, 37.0%, and 18.0%, respectively, for children with Hib, S. pneumoniae, and culture-negative and antigen-negative meningitis. Prior antibiotic therapy was common and was associated with significant reductions in CSF-culture-positive results for children with other evidence of Hib or S. pneumoniae meningitis. CONCLUSIONS: Improvements in case detection, culture methods, and latex agglutination for antigen detection in CSF resulted in identification of Hib and S. pneumoniae as important causes of severe disease in Guatemalan children. Using a cutoff of > 10 white blood cells per cubic millimeter in CSF would improve the sensitivity for detection of bacterial

  3. Ablation of the Leptin receptor in Myeloid Cells Impairs Pulmonary Clearance of Streptococcus Pneumoniae and Alveolar Macrophage Bactericidal Function.

    Science.gov (United States)

    Mancuso, Peter; Curtis, Jeffrey L; Freeman, Christine M; Peters-Golden, Marc; Weinberg, Jason B; Myers, Martin G

    2018-03-22

    Leptin is a pleiotropic hormone produced by white adipose tissue that regulates appetite and many physiologic functions including the immune response to infection. Genetic leptin deficiency in humans and mice impairs host defenses against respiratory tract infections. Since leptin deficiency is associated with obesity and other metabolic abnormalities, we generated mice that lack the leptin receptor (LepRb) in cells of the myeloid linage (LysM-LepRb-KO) to evaluate its impact in lean metabolically normal mice in a murine model of pneumococcal pneumonia. We observed higher lung and spleen bacterial burdens in LysM-LepRb-KO mice following an intratracheal challenge with S. pneumoniae. Although numbers of leukocytes recovered from bronchoalveolar lavage fluid did not differ between groups, we did observe higher levels of pulmonary IL-13 and TNFα in LysM-LepRb-KO mice 48 h post-infection. Phagocytosis and killing of ingested S. pneumoniae were also impaired in alveolar macrophages (AM)s from LysM-LepRb-KO mice in vitro, and was associated with reduced LTB4 and enhanced PGE2 synthesis in vitro. Pretreatment of AMs with LTB4 and the cyclooxygenase inhibitor, indomethacin, restored phagocytosis but not bacterial killing in vitro. These results, confirm our previous observations in leptin-deficient (ob/ob) and fasted mice, and demonstrate that decreased leptin action, as opposed to metabolic irregularities associated with obesity or starvation, are responsible for the defective host defense against pneumococcal pneumonia. They also provide novel targets for therapeutic intervention in humans with bacterial pneumonia.

  4. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia Susceptibility to antimicrobial agents in isolates of invasive Streptococcus pneumoniae in Colombia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1999-03-01

    Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P A study was done to determine the patterns of susceptibility to antimicrobial agents in isolates of Streptococcus

  5. PSGL-1 on Leukocytes is a Critical Component of the Host Immune Response against Invasive Pneumococcal Disease.

    Directory of Open Access Journals (Sweden)

    Elisa Ramos-Sevillano

    2016-03-01

    Full Text Available Bacterial uptake by phagocytic cells is a vital event in the clearance of invading pathogens such as Streptococcus pneumoniae. A major role of the P-selectin glycoprotein ligand-1 (PSGL-1 on leukocytes against invasive pneumococcal disease is described in this study. Phagocytosis experiments using different serotypes demonstrated that PSGL-1 is involved in the recognition, uptake and killing of S. pneumoniae. Co-localization of several clinical isolates of S. pneumoniae with PSGL-1 was demonstrated, observing a rapid and active phagocytosis in the presence of PSGL-1. Furthermore, the pneumococcal capsular polysaccharide and the main autolysin of the bacterium--the amidase LytA--were identified as bacterial ligands for PSGL-1. Experimental models of pneumococcal disease including invasive pneumonia and systemic infection showed that bacterial levels were markedly increased in the blood of PSGL-1-/- mice. During pneumonia, PSGL-1 controls the severity of pneumococcal dissemination from the lung to the bloodstream. In systemic infection, a major role of PSGL-1 in host defense is to clear the bacteria in the systemic circulation controlling bacterial replication. These results confirmed the importance of this receptor in the recognition and clearance of S. pneumoniae during invasive pneumococcal disease. Histological and cellular analysis demonstrated that PSGL-1-/- mice have increased levels of T cells migrating to the lung than the corresponding wild-type mice. In contrast, during systemic infection, PSGL-1-/- mice had increased numbers of neutrophils and macrophages in blood, but were less effective controlling the infection process due to the lack of this functional receptor. Overall, this study demonstrates that PSGL-1 is a novel receptor for S. pneumoniae that contributes to protection against invasive pneumococcal disease.

  6. Streptococcus pneumoniae Coinfection Is Correlated with the Severity of H1N1 Pandemic Influenza

    Science.gov (United States)

    Cisterna, Daniel; Savji, Nazir; Bussetti, Ana Valeria; Kapoor, Vishal; Hui, Jeffrey; Tokarz, Rafal; Briese, Thomas; Baumeister, Elsa; Lipkin, W. Ian

    2009-01-01

    Background Initial reports in May 2009 of the novel influenza strain H1N1pdm estimated a case fatality rate (CFR) of 0.6%, similar to that of seasonal influenza. In July 2009, however, Argentina reported 3056 cases with 137 deaths, representing a CFR of 4.5%. Potential explanations for increased CFR included virus reassortment or genetic drift, or infection of a more vulnerable population. Virus genomic sequencing of 26 Argentinian samples representing both severe and mild disease indicated no evidence of reassortment, mutations associated with resistance to antiviral drugs, or genetic drift that might contribute to virulence. Furthermore, no evidence was found for increased frequency of risk factors for H1N1pdm disease. Methods/Principal Findings We examined nasopharyngeal swab samples (NPS) from 199 cases of H1N1pdm infection from Argentina with MassTag PCR, testing for 33 additional microbial agents. The study population consisted of 199 H1N1pdm-infected subjects sampled between 23 June and 4 July 2009. Thirty-nine had severe disease defined as death (n = 20) or hospitalization (n = 19); 160 had mild disease. At least one additional agent of potential pathogenic importance was identified in 152 samples (76%), including Streptococcus pneumoniae (n = 62); Haemophilus influenzae (n = 104); human respiratory syncytial virus A (n = 11) and B (n = 1); human rhinovirus A (n = 1) and B (n = 4); human coronaviruses 229E (n = 1) and OC43 (n = 2); Klebsiella pneumoniae (n = 2); Acinetobacter baumannii (n = 2); Serratia marcescens (n = 1); and Staphylococcus aureus (n = 35) and methicillin-resistant S. aureus (MRSA, n = 6). The presence of S. pneumoniae was strongly correlated with severe disease. S. pneumoniae was present in 56.4% of severe cases versus 25% of mild cases; more than one-third of H1N1pdm NPS with S. pneumoniae were from subjects with severe disease (22 of 62 S. pneumoniae-positive NPS, p = 0

  7. Multicentre in-vitro evaluation of the susceptibility of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin

    NARCIS (Netherlands)

    HoogkampKorstanje, JAA; DirksGo, SIS; Kabel, P; Manson, WL; Stobberingh, EE; Vreede, RW; Davies, BI

    Seven laboratories, including a reference laboratory, tested the susceptibility of Moraxella catarrhalis, Streptococcus pneumoniae and Haemophilus influenzae strains to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin with the Etest. A total of 976 strains were collected. The results

  8. The putative proteinase maturation protein A of Streptococcus pneumoniae is a conserved surface protein with potential to elicit protective immune responses

    NARCIS (Netherlands)

    K. Overweg (Karin); A. Kerr; M. Sluijter (Marcel); M.H. Jackson; T.J. Mitchell; A.P. de Jong; R. de Groot (Ronald); P.W.M. Hermans (Peter)

    2000-01-01

    textabstractSurface-exposed proteins often play an important role in the interaction between pathogenic bacteria and their host. We isolated a pool of hydrophobic, surface-associated proteins of Streptococcus pneumoniae. The opsonophagocytic activity of hyperimmune

  9. Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Paterson, Neil G.; Riboldi-Tunicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.

    2006-01-01

    The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V M = 2.77 Å 3 Da −1 ) and shows a diffraction limit of 3.5 Å

  10. Uptake of extracellular DNA: Competence induced pili in natural transformation of Streptococcus pneumoniae

    Science.gov (United States)

    Muschiol, Sandra; Balaban, Murat; Normark, Staffan; Henriques-Normark, Birgitta

    2015-01-01

    Transport of DNA across bacterial membranes involves complex DNA uptake systems. In Gram-positive bacteria, the DNA uptake machinery shares fundamental similarities with type IV pili and type II secretion systems. Although dedicated pilus structures, such as type IV pili in Gram-negative bacteria, are necessary for efficient DNA uptake, the role of similar structures in Gram-positive bacteria is just beginning to emerge. Recently two essentially very different pilus structures composed of the same major pilin protein ComGC were proposed to be involved in transformation of the Gram-positive bacterium Streptococcus pneumoniae – one is a long, thin, type IV pilus-like fiber with DNA binding capacity and the other one is a pilus structure that was thicker, much shorter and not able to bind DNA. Here we discuss how competence induced pili, either by pilus retraction or by a transient pilus-related opening in the cell wall, may mediate DNA uptake in S. pneumoniae. PMID:25640084

  11. Purpura fulminans associated with Streptococcus pneumoniae septicemia in an asplenic pediatric patient.

    Science.gov (United States)

    Konda, S; Zell, D; Milikowski, C; Alonso-Llamazares, J

    2013-09-01

    Purpura fulminans is a rapidly progressive syndrome of small-vessel thrombosis and hemorrhagic necrosis of the skin accompanied by disseminated intravascular coagulation. We describe a case of Streptococcus pneumoniae septicemia in an asplenic 5-year-old boy on oral tacrolimus, with a past medical history of multivisceral organ transplantation and subsequent development of purpura fulminans on his chest and distal extremities. The acute infectious form of purpura fulminans is usually caused by gram-negative bacteria. Cases secondary to gram-positive encapsulated bacteria usually occur when individuals are immuno-suppressed or have anatomic or functional asplenia. Our patient had both, which likely increased his susceptibility, and he responded well to antimicrobial therapy in addition to prophylactic coverage in the setting of his immunosuppression. We review the literature for similar cases due to S. pneumoniae in the pediatric population and discuss the etiology and treatment of purpura fulminans. Copyright © 2011 Elsevier España, S.L. and AEDV. All rights reserved.

  12. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  13. Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)

    2006-07-01

    The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V{sub M} = 2.77 Å{sup 3} Da{sup −1}) and shows a diffraction limit of 3.5 Å.

  14. Pneumococcal conjugate vaccines: proceedings from an interactive symposium at the 41st Interscience Conference on Antimicrobial Agents and Chemotherapy.

    Science.gov (United States)

    Pelton, Stephen I; Dagan, Ron; Gaines, Beverly M; Klugman, Keith P; Laufer, Dagna; O'Brien, Katherine; Schmitt, Heinz J

    2003-04-02

    Globally, Streptococcus pneumoniae is a leading cause of invasive and noninvasive disease in infants and young children. The emergence of antibiotic-resistant strains has increased interest in prevention through immunization. Currently, the only available conjugate pneumococcal vaccine is a seven-valent formulation, PNCRM7. This paper presents excerpts from a symposium that provided an update of ongoing surveillance data and clinical trials evaluating pneumococcal conjugate vaccines. The topics addressed included: (1) PNCRM7 postmarketing safety data; (2) the impact of PNCRM7 in premature infants; (3) the direct and indirect effect of pneumococcal conjugate vaccines on colonization; (4) the effect of pneumococcal conjugate vaccines on replacement disease and the rate of resistance among replacement serotypes; (5) the current recommendations for the use of PNCRM7; and (6) the potential impact of conjugate vaccines in Europe and the Asia-Pacific region.

  15. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  16. Multidrug Resistance in Non-PCV13 Serotypes of Streptococcus pneumoniae in Northern Japan, 2014.

    Science.gov (United States)

    Kawaguchiya, Mitsuyo; Urushibara, Noriko; Kobayashi, Nobumichi

    2017-03-01

    Since the implementation of routine PCV13 immunization in Japan, nonvaccine serotypes (NVTs) have been increasing among clinical isolates of Streptococcus pneumoniae. In this study, susceptibility to 18 antibiotics was tested for all the 231 isolates with NVTs, which were collected from children Japan in 2014 (July-November). High resistance rates were observed for macrolides (>90.9%), tetracycline (91.3%), and clindamycin (75.3%), while penicillin (PEN) nonsusceptibility (PNSP; MIC ≥0.12 μg/ml) was detected in 42.9% of the pneumococci [39.4%; PEN-intermediate S. pneumoniae (PISP), 3.5%; PEN-resistant S. pneumoniae (PRSP)]. All serotype 15A isolates were PRSP (MIC, ≥2 μg/ml) or PISP, and PNSP was prevalent in also serotypes 23A (96.9%), 6C (41%), and 35B (33.3%). Overall, 42.0% of the isolates showed multidrug resistance (MDR). Sequence types (STs) determined for 20 PNSP isolates with NVTs were ST63 (15A), STs 242 or 5832 (6C), STs 338 or 5242 (23A), and ST558 (35B). All the PNSP isolates possessed tet(M), and erm(B) or mefA(A/E), and 70% of them were gPRSP having three altered genes pbp1a, pbp2x, and pbp2b. Among alterations in transpeptidase-coding region of penicillin-binding proteins (PBPs), two substitutions of T 371 S in the STMK motif and TSQF 574-577 NTGY in PBP1a were common to all PRSP isolates. The present study showed the spread of PNSP in NVTs 15A, 23A, 6C, and 35B, and the emergence of the MDR international clone Sweden 15A -ST63 in northern Japan.

  17. Induced hypothermia is protective in a rat model of pneumococcal pneumonia associated with increased adenosine triphosphate availability and turnover

    NARCIS (Netherlands)

    Beurskens, Charlotte J. P.; Aslami, Hamid; Kuipers, Maria T.; Horn, Janneke; Vroom, Margreeth B.; van Kuilenburg, André B. P.; Roelofs, Joris J. T. H.; Schultz, Marcus J.; Juffermans, Nicole P.

    2012-01-01

    Objective: To determine the effect of induced hypothermia on bacterial growth, lung injury, and mitochondrial function in a rat model of pneumococcal pneumosepsis. Design: Animal study. Setting: University research laboratory. Subjects: Male Sprague-Dawley rats. Interventions: Subjects were

  18. A Community-acquired Lung Abscess Attributable to Streptococcus pneumoniae which Extended Directly into the Chest Wall.

    Science.gov (United States)

    Ko, Yuki; Tobino, Kazunori; Yasuda, Yuichiro; Sueyasu, Takuto; Nishizawa, Saori; Yoshimine, Kouhei; Munechika, Miyuki; Asaji, Mina; Yamaji, Yoshikazu; Tsuruno, Kosuke; Miyajima, Hiroyuki; Mukasa, Yosuke; Ebi, Noriyuki

    We herein report the case of 75-year-old Japanese female with a community-acquired lung abscess attributable to Streptococcus pneumoniae (S. penumoniae) which extended into the chest wall. The patient was admitted to our hospital with a painful mass on the left anterior chest wall. A contrast-enhanced chest computed tomography scan showed a lung abscess in the left upper lobe which extended into the chest wall. Surgical debridement of the chest wall abscess and percutaneous transthoracic tube drainage of the lung abscess were performed. A culture of the drainage specimen yielded S. pneumoniae. The patient showed a remarkable improvement after the initiation of intravenous antibiotic therapy.

  19. Identification, variation and transcription of pneumococcal repeat sequences

    Science.gov (United States)

    2011-01-01

    Background Small interspersed repeats are commonly found in many bacterial chromosomes. Two families of repeats (BOX and RUP) have previously been identified in the genome of Streptococcus pneumoniae, a nasopharyngeal commensal and respiratory pathogen of humans. However, little is known about the role they play in pneumococcal genetics. Results Analysis of the genome of S. pneumoniae ATCC 700669 revealed the presence of a third repeat family, which we have named SPRITE. All three repeats are present at a reduced density in the genome of the closely related species S. mitis. However, they are almost entirely absent from all other streptococci, although a set of elements related to the pneumococcal BOX repeat was identified in the zoonotic pathogen S. suis. In conjunction with information regarding their distribution within the pneumococcal chromosome, this suggests that it is unlikely that these repeats are specialised sequences performing a particular role for the host, but rather that they constitute parasitic elements. However, comparing insertion sites between pneumococcal sequences indicates that they appear to transpose at a much lower rate than IS elements. Some large BOX elements in S. pneumoniae were found to encode open reading frames on both strands of the genome, whilst another was found to form a composite RNA structure with two T box riboswitches. In multiple cases, such BOX elements were demonstrated as being expressed using directional RNA-seq and RT-PCR. Conclusions BOX, RUP and SPRITE repeats appear to have proliferated extensively throughout the pneumococcal chromosome during the species' past, but novel insertions are currently occurring at a relatively slow rate. Through their extensive secondary structures, they seem likely to affect the expression of genes with which they are co-transcribed. Software for annotation of these repeats is freely available from ftp://ftp.sanger.ac.uk/pub/pathogens/strep_repeats/. PMID:21333003

  20. Use of Pneumococcal Disease Epidemiology to Set Policy and Prevent Disease during 20 Years of the Emerging Infections Program.

    Science.gov (United States)

    Moore, Matthew R; Whitney, Cynthia G

    2015-09-01

    Two decades ago, the Emerging Infections Program of the US Centers for Disease Control and Prevention implemented what seemed like a simple yet novel idea: a population- and laboratory-based surveillance system designed to identify and characterize invasive bacterial infections, including those caused by Streptococcus pneumoniae. This system, known as Active Bacterial Core surveillance, has since served as a flexible platform for following trends in invasive pneumococcal disease and studying vaccination as the most effective method for prevention. We report the contributions of Active Bacterial Core surveillance to every pneumococcal vaccine policy decision in the United States during the past 20 years.

  1. Antimicrobial activity of innate immune molecules against Streptococcus pneumoniae, Moraxella catarrhalis and nontypeable Haemophilus influenzae

    Directory of Open Access Journals (Sweden)

    Teufert Karen

    2004-05-01

    Full Text Available Abstract Background Despite its direct connection to the nasopharynx which harbors otitis media pathogens as part of its normal flora, the middle ear cavity is kept free of these bacteria by as yet unknown mechanisms. Respiratory mucosal epithelia, including those of the middle ear and eustachian tube, secrete antimicrobial effectors including lysozyme, lactoferrin and β defensins-1 and -2. To elucidate the role of these innate immune molecules in the normal defense and maintenance of sterility of respiratory mucosa such as that of the middle ear, we assessed their effect on the respiratory pathogens nontypeable Haemophilus influenzae (NTHi 12, Moraxella catarrhalis 035E, and Streptococcus pneumoniae 3, and 6B. Methods Two assay methods, the radial assay and the liquid broth assay, were employed for testing the antimicrobial activity of the molecules. This was done in order to minimize the possibility that the observed effects were artifacts of any single assay system employed. Also, transmission electron microscopy (TEM was employed to evaluate the effect of antimicrobial innate immune molecules on OM pathogens. For the statistical analysis of the data, Student's t-test was performed. Results Results of the radial diffusion assay showed that β defensin-2 was active against all four OM pathogens tested, while treatment with β defensin-1 appeared to only affect M. catarrhalis. The radial assay results also showed that lysozyme was quite effective against S. pneumoniae 3 and 6B and was partially bacteriostatic/bactericidal against M. catarrhalis. Lysozyme however, appeared not to affect the growth of NTHi. Thus, lysozyme seems to have a more pronounced impact on the growth of the Gram-positive S. pneumoniae as compared to that of Gram-negative pathogens. Lactoferrin on the other hand, enhanced the growth of the bacteria tested. The results of the radial assays were confirmed using liquid broth assays for antimicrobial activity, and showed that

  2. The response regulator YycF inhibits expression of the fatty acid biosynthesis repressor FabT in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Mohedano, Maria L.; Amblar, Mónica; La Fuente, De Alicia; Wells, Jerry M.; López, Paloma

    2016-01-01

    The YycFG (also known as WalRK, VicRK, MicAB, or TCS02) two-component system (TCS) is highly conserved among Gram-positive bacteria with a low G+C content. In Streptococcus pneumoniae the YycF response regulator has been reported to be essential due to its control of pcsB gene expression.

  3. Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa.

    OpenAIRE

    Smith, A M; Klugman, K P; Coffey, T J; Spratt, B G

    1993-01-01

    Streptococcus pneumoniae (the pneumococcus) is believed to have developed resistance to penicillin by the production of altered forms of penicillin-binding proteins (PBPs) that have decreased affinity for penicillin. Sixty-eight clinical isolates of serogroup 6 and 19 pneumococci (MICs, < 0.015 to 8 micrograms/ml) were randomly selected from hospitals across South Africa which are at substantial geographic distance from each other. The polymerase chain reaction was used to isolate the penicil...

  4. Post-infective transverse myelitis following Streptococcus pneumoniae meningitis with radiological features of acute disseminated encephalomyelitis: a case report

    Directory of Open Access Journals (Sweden)

    Williams Thomas

    2012-09-01

    Full Text Available Abstract Introduction Post-infectious autoimmune demyelination of the central nervous system is a rare neurological disorder typically associated with exanthematous viral infections. We report an unusual presentation of the condition and a previously undocumented association with Streptococcus pneumonia meningitis. Case presentation A 50-year-old Caucasian woman presented to our facility with an acute myelopathy three days after discharge following acute Streptococcus pneumoniae meningitis. Imaging studies of the spine ruled out an infective focus and no other lesions were seen within the cord. Diffuse, bilateral white matter lesions were seen within the cerebral hemispheres, and our patient was diagnosed as having a post-infective demyelination syndrome that met the diagnostic criteria for an acute transverse myelitis. Our patient clinically and radiologically improved following treatment with steroids. Conclusions The novel association of a Streptococcus pneumoniae infection with post-infectious autoimmune central nervous system demyelination should alert the reader to the potentially causative role of this common organism, and gives insights into the pathogenesis. The unusual dissociation between the clinical presentation and the location of the radiological lesions should also highlight the potential for the condition to mimic the presentation of others, and stimulates debate on the definitions of acute transverse myelitis and acute disseminated encephalomyelitis, and their potential overlap.

  5. Interaction of SIGNR1 expressed by marginal zone macrophages with marginal zone B cells is essential to early IgM responses against Streptococcus pneumoniae

    NARCIS (Netherlands)

    Koppel, Estella A.; Litjens, Manja; van den Berg, Venice C.; van Kooyk, Yvette; Geijtenbeek, Teunis B. H.

    2008-01-01

    The spleen plays a pivotal role in the immune defense against encapsulated bacteria such as Streptococcus pneumoniae. Murine splenic marginal zone macrophages express the C-type lectin SIGNR1, which is crucial for the capture of S. pneumoniae from blood. In this study, we demonstrate that SIGNR1 is

  6. The alpha-tocopherol form of vitamin E boosts elastase activity of human PMNs and their ability to kill Streptococcus pneumoniae

    Science.gov (United States)

    Despite the availability of vaccines, Streptococcus pneumoniae remains a leading cause of life-threatening infections such as pneumonia, bacteremia and meningitis. Polymorphonuclear leukocytes (PMNs) are a key determinant of disease course, because optimal host defense requires an initial robust pul...

  7. Platelet Endothelial Cell Adhesion Molecule-1, a Putative Receptor for the Adhesion of Streptococcus pneumoniae to the Vascular Endothelium of the Blood-Brain Barrier

    NARCIS (Netherlands)

    Iovino, Federico; Molema, Grietje; Bijlsma, Jetta J. E.

    The Gram-positive bacterium Streptococcus pneumoniae is the main causative agent of bacterial meningitis. S. pneumoniae is thought to invade the central nervous system via the bloodstream by crossing the vascular endothelium of the blood-brain barrier. The exact mechanism by which pneumococci cross

  8. Efficacy of PPV23 in Preventing Pneumococcal Pneumonia in Adults at Increased Risk--A Systematic Review and Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Julia Schiffner-Rohe

    Full Text Available Pneumococcal community-acquired pneumonia (pCAP is the most frequent form of pneumonia. The elderly and adults with underlying diseases are at an increased risk of developing pCAP. The 23-valent pneumococcal polysaccharide vaccine (PPV23 was licensed over 30 years ago and is recommended as the standard intervention in many countries across the globe, although its efficacy continues to be debated. We performed a meta-analysis of randomized controlled trials (RCTs to investigate the effect of PPV23 for preventing pCAP in adults ≥60 years of age.An existing Cochrane Review was updated to Oct 2014 using a systematic literature search to select appropriate RCTs. DerSimonian and Laird random-effects meta-analyses were performed and odd ratios (OR with 95%-confidence intervals (CI and p-values were calculated for the descriptive analyses. Reasons for heterogeneity were explored by subgroup analyses.Meta-analysis of PPV23 efficacy included four studies. Three of them did not demonstrate efficacy for PPV23. The body of evidence indicated statistically significant heterogeneity (I2 = 78%, p = 0.004 that could be explained by subgroup analysis by "study setting". Further effect modifiers for pCAP were "continent of trial" (p<0.01, and "method of pneumococcal diagnostics" (p = 0.001. Subgroup analyses revealed that the only study showing efficacy for PPV23 was an outlier. Overall, the validity of the meta-analytic PPV23 efficacy assessment was confirmed by the meta-analysis of all-cause CAP including six studies.Inconsistencies in PPV23 treatment effects to prevent pCAP could solely be explained by one outlier study that was performed in nursing homes in Japan. The effect modifier "method of pneumococcal diagnostics" should be interpreted carefully, since methodological weaknesses are not restricted to one special method only, which would justify the exclusion of certain studies. Overall, we conclude from our meta-analysis that to date there is no proof

  9. The Pneumococcal Serotype 15C Capsule Is Partially O-Acetylated and Allows for Limited Evasion of 23-Valent Pneumococcal Polysaccharide Vaccine-Elicited Anti-Serotype 15B Antibodies

    OpenAIRE

    Spencer, Brady L.; Shenoy, Anukul T.; Orihuela, Carlos J.; Nahm, Moon H.

    2017-01-01

    As a species, Streptococcus pneumoniae (the pneumococcus) utilizes a diverse array of capsular polysaccharides to evade the host. In contrast to large variations in sugar composition and linkage formation, O-acetylation is a subtle capsular modification that nonetheless has a large impact on capsular shielding and recognition of the capsule by vaccine-elicited antibodies. Serotype 15B, which is included in the 23-valent pneumococcal polysaccharide vaccine (PPV23), carries the putative O-acety...

  10. Impaired CD4+ and T-helper 17 cell memory response to Streptococcus pneumoniae is associated with elevated glucose and percent glycated hemoglobin A1c in Mexican Americans with type 2 diabetes mellitus.

    Science.gov (United States)

    Martinez, Perla J; Mathews, Christine; Actor, Jeffrey K; Hwang, Shen-An; Brown, Eric L; De Santiago, Heather K; Fisher Hoch, Susan P; McCormick, Joseph B; Mirza, Shaper

    2014-01-01

    Individuals with type 2 diabetes are significantly more susceptible to pneumococcal infections than healthy individuals of the same age. Increased susceptibility is the result of impairments in both innate and adaptive immune systems. Given the central role of T-helper 17 (Th17) and T-regulatory (Treg) cells in pneumococcal infection and their altered phenotype in diabetes, this study was designed to analyze the Th17 and Treg cell responses to a whole heat-killed capsular type 2 strain of Streptococcus pneumoniae. Patients with diabetes demonstrated a lower frequency of total CD+T-cells, which showed a significant inverse association with elevated fasting blood glucose. Measurement of specific subsets indicated that those with diabetes had, low intracellular levels of interleukin (IL)-17, and lower pathogen-specific memory CD4+ and IL-17+ cell numbers. No significant difference was observed in the frequency of CD4+ and Th17 cells between those with and without diabetes. However, stratification of data by obesity indicated a significant increase in frequency of CD4+ and Th17 cells in obese individuals with diabetes compared with nonobese individual with diabetes. The memory CD+T-cell response was associated inversely with both fasting blood glucose and percent glycated hemoglobin A1c. This study demonstrated that those with type 2 diabetes have a diminished pathogen-specific memory CD4+ and Th17 response, and low percentages of CD+T-cells in response to S. pneumoniae stimulation. Copyright © 2014 Mosby, Inc. All rights reserved.

  11. Natural Genetic Transformation Generates a Population of Merodiploids in Streptococcus pneumoniae

    Science.gov (United States)

    Zomer, Aldert; Bootsma, Hester J.; Prudhomme, Marc; Granadel, Chantal; Hermans, Peter W. M.; Polard, Patrice; Martin, Bernard; Claverys, Jean-Pierre

    2013-01-01

    Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R) corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ∼3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD) formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ∼100 to ∼900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA). We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of merodiploids by

  12. A complex of equine lysozyme and oleic acid with bactericidal activity against Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Emily A Clementi

    Full Text Available HAMLET and ELOA are complexes consisting of oleic acid and two homologous, yet functionally different, proteins with cytotoxic activities against mammalian cells, with HAMLET showing higher tumor cells specificity, possibly due to the difference in propensity for oleic acid binding, as HAMLET binds 5-8 oleic acid molecules per protein molecule and ELOA binds 11-48 oleic acids. HAMLET has been shown to possess bactericidal activity against a number of bacterial species, particularly those with a respiratory tropism, with Streptococcus pneumoniae displaying the greatest degree of sensitivity. We show here that ELOA also displays bactericidal activity against pneumococci, which at lower concentrations shows mechanistic similarities to HAMLET's bactericidal activity. ELOA binds to S. pneumoniae and causes perturbations of the plasma membrane, including depolarization and subsequent rupture, and activates an influx of calcium into the cells. Selective inhibition of calcium channels and sodium/calcium exchange activity significantly diminished ELOA's bactericidal activity, similar to what we have observed with HAMLET. Finally, ELOA-induced death was also accompanied by DNA fragmentation into high molecular weight fragments - an apoptosis-like morphological phenotype that is seen during HAMLET-induced death. Thus, in contrast to different mechanisms of eukaryote cell death induced by ELOA and HAMLET, these complexes are characterized by rather similar activities towards bacteria. Although the majority of these events could be mimicked using oleic acid alone, the concentrations of oleic acid required were significantly higher than those present in the ELOA complex, and for some assays, the results were not identical between oleic acid alone and the ELOA complex. This indicates that the lipid, as a common denominator in both complexes, is an important component for the complexes' bactericidal activities, while the proteins are required both to solubilize

  13. Natural genetic transformation generates a population of merodiploids in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Calum Johnston

    Full Text Available Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ~3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ~100 to ~900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA. We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of

  14. Pneumococcal vaccination in adults: rationale, state of the art and perspectives.

    Science.gov (United States)

    Icardi, G; Sticchi, L; Bagnasco, A; Iudici, R; Durando, P

    2012-06-01

    Streptococcus pneumoniae (SP) is a leading cause of morbidity and mortality worldwide. Despite the availability, since the early 1980s, of a 23-valent pneumococcal polysaccharide vaccine (PP V23), its recommendation and increased use in the last decades, and the indirect benefits against invasive pneumococcal diseases following the pediatric immunization strategies with the 7-valent pneumococcal conjugate vaccine (PCV7), pneumoccal diseases, particularly Community Acquired Pneumonia (CAP), still remain a substantial burden among older adults in Western countries. The recent availability on the market of a second generation of pneumococcal conjugate vaccines, with an enlarged spectrum of protection against some serotypes not included in the PCV7 (i.e., the 13-valent pneumococcal conjugate vaccine--PCV13), opens new interesting perspectives for improving the control of this significant health-care issue among the entire population. The most interesting and up-dated epidemiological data regarding the impact of SP in adults and the elderly in Western countries, together with the available evidence concerning the efficacy and effectiveness of the PPV23 in the same population, are reported and discussed below.

  15. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1999-03-01

    Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P < 0,0001. Los resultados de este estudio indican la necesidad de mantener una vigilancia activa de los patrones de

  16. Cysteine-mediated gene expression and characterization of the CmbR regulon in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-12-01

    Full Text Available In this study, we investigated the transcriptomic response of Streptococcus pneumoniae D39 to cysteine. Transcriptome comparison of the D39 wild-type strain grown at a restricted concentration of cysteine (0.03 mM to one grown at a high concentration of cysteine (50 mM in chemically-define medium (CDM revealed elevated expression of various genes/operons, i.e. spd-0150, metQ, spd-0431, metEF, gshT, spd-0618, fhs, tcyB, metB-csd, metA, spd-1898, yvdE, and cysK, likely to be involved in the transport and utilization of cysteine and/or methionine. Microarray-based data were further confirmed by quantitative RT-PCR. Promoter lacZ-fusion studies and quantitative RT-PCR data showed that the transcriptional regulator CmbR acts as a transcriptional repressor of spd-0150, metEF, gshT, spd-0618, tcyB, metA, and yvdE, putatively involved in cysteine uptake and utilization. The operator site of CmbR in the promoter regions of CmbR-regulated genes is predicted and confirmed by mutating or deleting CmbR operator sites from the promoter regions of these genes.

  17. A multi-scale computational study on the mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic).

    Science.gov (United States)

    Ion, Bogdan F; Kazim, Erum; Gauld, James W

    2014-09-29

    Nicotinamidase (Nic) is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic). In particular, density functional theory (DFT), molecular dynamics (MD) and ONIOM quantum mechanics/molecular mechanics (QM/MM) methods have been employed. The overall mechanism occurs in two stages: (i) formation of a thioester enzyme-intermediate (IC2) and (ii) hydrolysis of the thioester bond to give the products. The polar protein environment has a significant effect in stabilizing reaction intermediates and in particular transition states. As a result, both stages effectively occur in one step with Stage 1, formation of IC2, being rate limiting barrier with a cost of 53.5 kJ·mol-1 with respect to the reactant complex, RC. The effects of dispersion interactions on the overall mechanism were also considered but were generally calculated to have less significant effects with the overall mechanism being unchanged. In addition, the active site lysyl (Lys103) is concluded to likely play a role in stabilizing the thiolate of Cys136 during the reaction.

  18. Penicillin-Resistant trend of Streptococcus pneumoniae in Asia: A systematic review.

    Science.gov (United States)

    Mamishi, Setareh; Moradkhani, Sepideh; Mahmoudi, Shima; Hosseinpour-Sadeghi, Reihaneh; Pourakbari, Babak

    2014-08-01

    The high prevalence of resistance to penicillin by Streptococcus pneumoniaeis considered as a great concern, particularly in Asian countries. The aim of this study was to investigate the changing trend of penicillin-resistant S. pneumoniae (PRSP) in Asia over a 20 years period. A review of the literature was conducted using the PubMed database, Google Scholar, Scopus, two Persian scientific search engines "Scientific Information Database" (www.sid.ir), and "Mag Iran" (www.magiran.com) through 1993 to 2013. Our study provides a unique chance to investigate the changing trend in PSSP in Asia over a 20 years period. Susceptibility rates among different centers in each country varied widely. In Malaysia, the PSSP rate decreased from 97.2% in 1995-1996 to 69% in 2000. In Singapore, PSSP levels decreased from 72.6% in 1997 to 30.5% in 2007-2008. In Iran, PSSP ranged from 0% to 100%. In Taiwan, the rate of PSSP was 60.3% in 1995 and countries such as Vietnam, Singapore, Philippines, Pakistan, Nepal, Kuwait, Korea and Indonesia.

  19. Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.

    Science.gov (United States)

    Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A

    2001-11-01

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

  20. Transport of Streptococcus pneumoniae capsular polysaccharide in MHC Class II tubules.

    Directory of Open Access Journals (Sweden)

    Tom Li Stephen

    2007-03-01

    Full Text Available Bacterial capsular polysaccharides are virulence factors and are considered T cell-independent antigens. However, the capsular polysaccharide Sp1 from Streptococcus pneumoniae serotype 1 has been shown to activate CD4(+ T cells in a major histocompatibility complex (MHC class II-dependent manner. The mechanism of carbohydrate presentation to CD4(+ T cells is unknown. We show in live murine dendritic cells (DCs that Sp1 translocates from lysosomal compartments to the plasma membrane in MHCII-positive tubules. Sp1 cell surface presentation results in reduction of self-peptide presentation without alteration of the MHCII self peptide repertoire. In DM-deficient mice, retrograde transport of Sp1/MHCII complexes resulting in T cell-dependent immune responses to the polysaccharide in vitro and in vivo is significantly reduced. The results demonstrate the capacity of a bacterial capsular polysaccharide antigen to use DC tubules as a vehicle for its transport as an MHCII/saccharide complex to the cell surface for the induction of T cell activation. Furthermore, retrograde transport requires the functional role of DM in self peptide-carbohydrate exchange. These observations open new opportunities for the design of vaccines against microbial encapsulated pathogens.

  1. A Multi-Scale Computational Study on the Mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic

    Directory of Open Access Journals (Sweden)

    Bogdan F. Ion

    2014-09-01

    Full Text Available Nicotinamidase (Nic is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic. In particular, density functional theory (DFT, molecular dynamics (MD and ONIOM quantum mechanics/molecular mechanics (QM/MM methods have been employed. The overall mechanism occurs in two stages: (i formation of a thioester enzyme-intermediate (IC2 and (ii hydrolysis of the thioester bond to give the products. The polar protein environment has a significant effect in stabilizing reaction intermediates and in particular transition states. As a result, both stages effectively occur in one step with Stage 1, formation of IC2, being rate limiting barrier with a cost of 53.5 kJ•mol−1 with respect to the reactant complex, RC. The effects of dispersion interactions on the overall mechanism were also considered but were generally calculated to have less significant effects with the overall mechanism being unchanged. In addition, the active site lysyl (Lys103 is concluded to likely play a role in stabilizing the thiolate of Cys136 during the reaction.

  2. Coordinated Bacteriocin Expression and Competence in Streptococcus pneumoniae Contributes to Genetic Adaptation through Neighbor Predation.

    Directory of Open Access Journals (Sweden)

    Wei-Yun Wholey

    2016-02-01

    Full Text Available Streptococcus pneumoniae (pneumococcus has remained a persistent cause of invasive and mucosal disease in humans despite the widespread use of antibiotics and vaccines. The resilience of this organism is due to its capacity for adaptation through the uptake and incorporation of new genetic material from the surrounding microbial community. DNA uptake and recombination is controlled by a tightly regulated quorum sensing system that is triggered by the extracellular accumulation of competence stimulating peptide (CSP. In this study, we demonstrate that CSP can stimulate the production of a diverse array of blp bacteriocins. This cross stimulation occurs through increased production and secretion of the bacteriocin pheromone, BlpC, and requires a functional competence regulatory system. We show that a highly conserved motif in the promoter of the operon encoding BlpC and its transporter mediates the upregulation by CSP. The accumulation of BlpC following CSP stimulation results in augmented activation of the entire blp locus. Using biofilm-grown organisms as a model for competition and genetic exchange on the mucosal surface, we demonstrate that DNA exchange is enhanced by bacteriocin secretion suggesting that co-stimulation of bacteriocins with competence provides an adaptive advantage. The blp and com regulatory pathways are believed to have diverged and specialized in a remote ancestor of pneumococcus. Despite this, the two systems have maintained a regulatory connection that promotes competition and adaptation by targeting for lysis a wide array of potential competitors while simultaneously providing the means for incorporation of their DNA.

  3. Live Attenuated Influenza Vaccine Enhances Colonization of Streptococcus pneumoniae and Staphylococcus aureus in Mice

    Science.gov (United States)

    Mina, Michael J.; McCullers, Jonathan A.; Klugman, Keith P.

    2014-01-01

    ABSTRACT Community interactions at mucosal surfaces between viruses, like influenza virus, and respiratory bacterial pathogens are important contributors toward pathogenesis of bacterial disease. What has not been considered is the natural extension of these interactions to live attenuated immunizations, and in particular, live attenuated influenza vaccines (LAIVs). Using a mouse-adapted LAIV against influenza A (H3N2) virus carrying the same mutations as the human FluMist vaccine, we find that LAIV vaccination reverses normal bacterial clearance from the nasopharynx and significantly increases bacterial carriage densities of the clinically important bacterial pathogens Streptococcus pneumoniae (serotypes 19F and 7F) and Staphylococcus aureus (strains Newman and Wright) within the upper respiratory tract of mice. Vaccination with LAIV also resulted in 2- to 5-fold increases in mean durations of bacterial carriage. Furthermore, we show that the increases in carriage density and duration were nearly identical in all aspects to changes in bacterial colonizing dynamics following infection with wild-type (WT) influenza virus. Importantly, LAIV, unlike WT influenza viruses, had no effect on severe bacterial disease or mortality within the lower respiratory tract. Our findings are, to the best of our knowledge, the first to demonstrate that vaccination with a live attenuated viral vaccine can directly modulate colonizing dynamics of important and unrelated human bacterial pathogens, and does so in a manner highly analogous to that seen following wild-type virus infection. PMID:24549845

  4. Whole genome analysis of linezolid resistance in Streptococcus pneumoniae reveals resistance and compensatory mutations

    Directory of Open Access Journals (Sweden)

    Légaré Danielle

    2011-10-01

    Full Text Available Abstract Background Several mutations were present in the genome of Streptococcus pneumoniae linezolid-resistant strains but the role of several of these mutations had not been experimentally tested. To analyze the role of these mutations, we reconstituted resistance by serial whole genome transformation of a novel resistant isolate into two strains with sensitive background. We sequenced the parent mutant and two independent transformants exhibiting similar minimum inhibitory concentration to linezolid. Results Comparative genomic analyses revealed that transformants acquired G2576T transversions in every gene copy of 23S rRNA and that the number of altered copies correlated with the level of linezolid resistance and cross-resistance to florfenicol and chloramphenicol. One of the transformants also acquired a mutation present in the parent mutant leading to the overexpression of an ABC transporter (spr1021. The acquisition of these mutations conferred a fitness cost however, which was further enhanced by the acquisition of a mutation in a RNA methyltransferase implicated in resistance. Interestingly, the fitness of the transformants could be restored in part by the acquisition of altered copies of the L3 and L16 ribosomal proteins and by mutations leading to the overexpression of the spr1887 ABC transporter that were present in the original linezolid-resistant mutant. Conclusions Our results demonstrate the usefulness of whole genome approaches at detecting major determinants of resistance as well as compensatory mutations that alleviate the fitness cost associated with resistance.

  5. [Impact of PCV10 pneumococcal vaccine on mortality from pneumonia in children less than one year of age in Santa Catarina State, Brazil].

    Science.gov (United States)

    Kupek, Emil; Vieira, Ilse Lisiane Viertel

    2016-03-01

    The aim of this study was to evaluate the impact of PCV10 pneumococcal vaccine on mortality from pneumonia in children less than one year of age in Santa Catarina State, Brazil, comparing the four years prior and the four years subsequent to the vaccine's introduction in 2010. This ecological study used data from the Mortality Information System and vaccination coverage of children less than one year. Data were grouped by municipalities of residence and regions. Average mortality from pneumonia in children under one year decreased from 29.69 to 23.40 per 100,000, comparing 2006-2009 and 2010-2013, or a reduction of 11%. However there were differences between regions with a drop in mortality (Grande Florianópolis, Sul, Planalto Norte, and Nordeste) and others with an increase in the annual rates (Oeste, Itajaí, and Serra). In short, the state as a whole showed 11% reduction in mortality from pneumonia in children less than one year of age, four years after implementing routine PCV10 vaccination in the National Immunization Program, but with heterogeneous effects when comparing regions of the state.

  6. The adult nasopharyngeal microbiome as a determinant of pneumococcal acquisition

    NARCIS (Netherlands)

    Cremers, Amelieke Jh; Zomer, Aldert L; Gritzfeld, Jenna F; Ferwerda, Gerben; van Hijum, Sacha Aft; Ferreira, Daniela M; Shak, Joshua R; Klugman, Keith P; Boekhorst, Jos; Timmerman, Harro M; de Jonge, Marien I; Gordon, Stephen B; Hermans, Peter Wm

    2014-01-01

    BACKGROUND: Several cohort studies have indicated associations between S. pneumoniae and other microbes in the nasopharynx. To study causal relationships between the nasopharyngeal microbiome and pneumococcal carriage, we employed an experimental human pneumococcal carriage model. Healthy adult

  7. Impact of pneumococcal vaccines use on invasive pneumococcal disease in Nunavik (Quebec from 1997 to 2010

    Directory of Open Access Journals (Sweden)

    Jean-Baptiste Le Meur

    2014-01-01

    Full Text Available Background: In 2000, an outbreak of severe pneumonia caused by a virulent clone of serotype 1 Streptococcus pneumoniae was detected in the Nunavik region of Quebec. A mass immunization campaign was implemented in the spring of 2002, targeting persons ≥5 years of age and using the 23-valent pneumococcal polysaccharide vaccine (PPSV23. At the same time, the 7-valent pneumococcal conjugate vaccine (PCV7 was introduced into the routine immunization programme of infants, with catch-up for children up to 4 years of age. Objectives: To describe the epidemiology of invasive pneumococcal disease (IPD in relation to PPSV23 and PCV7 use. Study design and methods: Retrospective analysis of IPD cases identified by the Quebec public health laboratory during the period 1997–2010. Results: A total of 82 IPD cases were identified during the study period. In adults, serotype 1 incidence decreased following the 2002 PPSV23 mass campaign but breakthrough cases continued to occur. Following PCV7 use in children, there was a decrease in the incidence of vaccine-type IPD and replacement by other serotypes in adults. In children, a marked decrease in the annual incidence of serotypes included in PCV7 was observed following PCV7 introduction: 162/100,000 in 1997–2001 vs. 10/100,000 in 2004–2010 (p<0.01. Concomitantly, the incidence of IPD caused by serotypes not included in PCV7 increased from 29/100,000 to 109/100,000 (p=0.11. Conclusion: The mass immunization campaign using the PPSV23 in 2002 and the introduction of PCV7 for the routine immunization of infants induced important modifications in the epidemiology of IPD. IPD rates in Nunavik remain much higher than in the southern part of the province both in children and adults. More effective pneumococcal vaccines are needed to eliminate geographic disparities in IPD risk.

  8. Inflammasome activation mediates inflammation and outcome in humans and mice with pneumococcal meningitis

    Science.gov (United States)

    2013-01-01

    Background Inflammasomes are multi-protein intracellular signaling complexes that have recently been hypothesized to play a role in the regulation of the inflammation response. We studied associations between inflammasome-associated cytokines IL-1β and IL-18 in cerebrospinal fluid (CSF) of patients with bacterial meningitis and clinical outcome, and pneumococcal serotype. In a murine model of pneumococcal meningitis we examined the pathophysiological roles of two inflammasome proteins, NLRP3 (Nod-like receptor protein-3) and adaptor protein ASC (apoptosis-associated speck-like protein). Methods In a nationwide prospective cohort study, CSF cytokine levels were measured and related to clinical outcome and pneumococcal serotype. In a murine model of pneumococcal meningitis using Streptococcus pneumoniae serotype 3, we examined bacterial titers, cytokine profiles and brain histology at 6 and 30 hours after inoculation in wild-type (WT), Asc and Nlrp3 deficient mice. Results In patients with bacterial meningitis, CSF levels of inflammasome associated cytokines IL-1β and IL-18 were related to complications, and unfavorable disease outcome. CSF levels of IL-1β were associated with pneumococcal serotype (pmeningitis, which may dependent on the pneumococcal serotype. PMID:23902681

  9. Prevalência de sorotipos e resistência antimicrobiana de cepas invasivas do Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Mantese Orlando C.

    2003-01-01

    Full Text Available OBJETIVO: Avaliar o perfil de sorotipos e a susceptibilidade aos antimicrobianos de cepas de Streptococcus pneumoniae obtidas em espécimes clínicos de pacientes com doença invasiva, bem como suas implicações na formulação de vacinas pneumocócicas. MÉTODOS: Cepas de pneumococo isoladas no Laboratório de Análises Clínicas do Hospital de Clínicas da Universidade Federal de Uberlândia a partir de amostras clínicas de pacientes com doença invasiva foram identificadas e enviadas ao Instituto Adolfo Lutz em São Paulo para confirmação da identificação, sorotipagem e determinação da susceptibilidade aos antimicrobianos. RESULTADOS: De abril de 1999 a março de 2003, foram isoladas 148 cepas invasivas de pneumococo, sendo 84 (56,7% provenientes de pacientes do sexo masculino. A idade variou de um dia a 88,83 anos, com média de 21,33+25,82 anos e mediana de 4,42 anos. Os diagnósticos clínicos mais comuns foram pneumonia (91 casos; 61,4%, meningite (32 casos; 21,6% e bacteremia sem foco evidente (15 casos; 10,1%. As principais fontes de recuperação foram sangue (76 amostras; 51,3%, líquido pleural (39; 26,3% e liquor (30; 20,2%. No total, foram identificados 23 diferentes sorotipos entre 143 amostras testadas, sendo os mais comuns os seguintes: 14, 3, 1, 5, 6A, 6B e 18C. Dentre 30 (20,2% cepas oxacilina-resistentes, 23 (15,5% confirmaram a resistência à penicilina (12,8% com nível intermediário e 2,7%, com nível pleno, que esteve restrita aos sorotipos 14, 23F, 19A e 6B, predominando em indivíduos com até dois anos de idade (p = 0,0008. Foi detectada susceptibilidade diminuída ao cotrimoxazol (63,4%, à eritromicina (8,3%, à clindamicina (8,7% e à ofloxacina (0,8%. A resistência à cefotaxima foi detectada em três das 30 cepas testadas (2% das 148, todas elas com resistência confirmada à penicilina. Não foi observada resistência a cloranfenicol, rifampicina ou vancomicina. CONCLUSÕES: A resistência

  10. Development of new synthetic oligosaccharide vaccines : the immunogenicity of oligosaccharide-CRM197 neoconjugates and oligosaccharide/peptide hybrid gold nanoparticles based on the capsular polysaccharide structure of Streptococcus pneumoniae type 14

    NARCIS (Netherlands)

    Safari, D.

    2010-01-01

    Streptococcus pneumoniae is a leading cause of bacterial pneumonia, meningitis, and sepsis in children worldwide. Nowadays, the antibiotic resistance of S. pneumoniae bacteria has increased worldwide. This makes treatment of S. pneumoniae infections more difficult and stresses the importance of the

  11. Endocarditis in Greenland with special reference to endocarditis caused by Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Madsen, Rasmus Gaarde; Ladefoged, Karin; Kjaergaard, Jens Jørgen

    2009-01-01

    in studies on Caucasian populations, where pneumococcal infection was seen in 1-3% of endocarditis cases. The overall mortality rate was 12%. Pneumococcal endocarditis (PE) had the clinical characteristics of fulminant disease with frequent heart failure, complications and need for surgery. Among cases...... with PE, 67% needed acute valve replacement and the mortality rate was 33%. CONCLUSIONS: The high incidence rate, clinical characteristics and grave prognosis of PE are consistent with another study of an Inuit population in Alaska....

  12. Mechanisms of genome evolution of Streptococcus.

    Science.gov (United States)

    Andam, Cheryl P; Hanage, William P

    2015-07-01

    The genus Streptococcus contains 104 recognized species, many of which are associated with human or animal hosts. A globally prevalent human pathogen in this group is Streptococcus pneumoniae (the pneumococcus). While being a common resident of the upper respiratory tract, it is also a major cause of otitis media, pneumonia, bacteremia and meningitis, accounting for a high burden of morbidity and mortality worldwide. Recent findings demonstrate the importance of recombination and selection in driving the population dynamics and evolution of different pneumococcal lineages, allowing them to successfully evade the impacts of selective pressures such as vaccination and antibiotic treatment. We highlight the ability of pneumococci to respond to these pressures through processes including serotype replacement, capsular switching and horizontal gene transfer (HGT) of antibiotic resistance genes. The challenge in controlling this pathogen also lies in the exceptional genetic and phenotypic variation among different pneumococcal lineages, particularly in terms of their pathogenicity and resistance to current therapeutic strategies. The widespread use of pneumococcal conjugate vaccines, which target only a small subset of the more than 90 pneumococcal serotypes, provides us with a unique opportunity to elucidate how the processes of selection and recombination interact to generate a remarkable level of plasticity and heterogeneity in the pneumococcal genome. These processes also play an important role in the emergence and spread of multi-resistant strains, which continues to pose a challenge in disease control and/or eradication. The application of population of genomic approaches at different spatial and temporal scales will help improve strategies to control this global pathogen, and potentially other pathogenic streptococci. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Variant mannose-binding lectin alleles are not associated with susceptibility to or outcome of invasive pneumococcal infection in randomly included patients

    DEFF Research Database (Denmark)

    Kronborg, Gitte; Weis, Nina; Madsen, Hans O

    2002-01-01

    for pneumococcal infections. To assess the influence of MBL genotypes on the course and outcome of invasive pneumococcal disease, clinical data for 141 adult patients were collected prospectively and their genotypes were determined. All patients included had positive blood cultures for Streptococcus pneumoniae....... The distribution of variant MBL alleles related to low MBL serum concentrations was similar among the patients and healthy individuals, and MBL genotype was not associated with infection outcome. Thus, in a random adult population with invasive pneumococcal infection, MBL does not seem to play a role......Invasive pneumococcal disease is a serious infection that primarily affects very young children and elderly or immunocompromised individuals but also affects previously healthy people. Variant mannose-binding lectin (MBL) alleles are associated with recurrent infections and may be a risk factor...

  14. Circulation of Streptococcus pneumoniae clone Colombia5 ST289 in nine Latin American countries Circulación de Streptococcus pneumoniae clon Colombia5 ST289 en nueve países de América Latina

    Directory of Open Access Journals (Sweden)

    Carolina Firacative

    2009-04-01

    Full Text Available OBJECTIVE: To determine genetic relatedness of clone Colombia5 ST289 with invasive Streptococcus pneumoniae serotype 5 isolates recovered in nine Latin American countries. METHODS: Forty-four invasive S. pneumoniae serotype 5 isolates recovered from children under 5 years of age in Bolivia, Chile, Dominican Republic, Ecuador, Nicaragua, Panama, Paraguay, Peru, and Venezuela were studied. Pulsed-field gel electrophoresis patterns of DNA treated with SmaI restriction enzyme were classified using Tenover's criteria and analyzed with the Fingerprinting II program to determine their genetic relatedness with the Colombian clone. RESULTS: All isolates had a genetic similarity of 78.5% or more with the Colombian clone. Thirteen electrophoretic subtypes derived of pattern A were identified, and five of them (A5, A6, A8, A13, A27 comprised 61.4% of the isolates. CONCLUSIONS: Clone Colombia5 ST289 is disseminated in Latin America. This is important because S. pneumoniae serotype 5 frequently causes invasive disease in the region and is associated with trimethoprim-sulfamethoxazole resistance.OBJETIVO: Determinar la relación genética del clon Colombia5 ST289 con los aislamientos invasores de Streptococcus pneumoniae serotipo 5 provenientes de nueve países latinoamericanos. MÉTODOS: Se estudiaron 45 aislamientos invasores de Streptococcus pneumoniae serotipo 5 procedentes de niños menores de 5 años de Bolivia, Chile, Ecuador, Nicaragua, Panamá, Paraguay, Perú, República Dominicana y Venezuela. Los patrones en electroforesis en gel de campo pulsante del ADN tratado con la enzima de restricción SmaI se clasificaron mediante el criterio de Tenover y se analizaron con el programa Fingerprinting II para determinar su relación genética con el clon colombiano. RESULTADOS: Todos los aislamientos tuvieron una similitud genética de 78,5% o mayor con el clon colombiano. Se identificaron 13 subtipos electroforéticos derivados del patrón A y cinco de ellos

  15. Streptococcus pneumoniae aislados durante 2002-2006: serotipos y resistencia antibiótica. Correlación con las vacunas existentes

    Directory of Open Access Journals (Sweden)

    José María Guevara-Duncan

    2008-03-01

    Full Text Available Objetivos: Identificar los serotipos de S. pneumoniae aislados, correlacionándolos con los incluidos en las vacunas existentes y su resistencia antimicrobiana. Diseño: Estudio descriptivo, observacional y longitudinal. Lugar: Instituto de Medicina Tropical Daniel A. Carrión, Facultad de Medicina, UNMSM. Material biológico: Cepas de Streptococcus pneumoniae. Intervenciones: Cuarenta Streptococcus pneumoniae de nuestro cepario, aislados entre el 2002 y 2006, fueron serotipificados en el Instituto de Salud Carlos III en Madrid -España; 15 fueron invasivos, 11 aislados de infecciones localizadas, 6 de portadores y 8 eran multiresistentes. Principales medidas de resultados: Protección de las vacunas existentes en nuestro medio a las infecciones causadas por Streptococcus pneumoniae. Resultados: Hubo 14 serotipos diferentes y los serogrupos más identificados fueron 23, 19 y 6. El 28,6% estaba contenido en la vacuna 7-valente, 42,9% en la 9-valente, 50% en la 11-valente y el 71,4% en la 23-valente; 57,5% fue resistente a la penicilina y 30% a eritromicina. El grupo de Streptococcus invasivo resultó más sensible a los antibióticos que los otros grupos. Los serotipos asociados a multirresistencia fueron 19F y 23F. Conclusiones: Ninguna de las vacunas protege a todas las infecciones causadas por Streptococcus pneumoniae, en nuestro medio.

  16. Nonencapsulated Streptococcus pneumoniae causes otitis media during single-species infection and during polymicrobial infection with nontypeable Haemophilus influenzae.

    Science.gov (United States)

    Murrah, Kyle A; Pang, Bing; Richardson, Stephen; Perez, Antonia; Reimche, Jennifer; King, Lauren; Wren, John; Swords, W Edward

    2015-07-01

    Streptococcus pneumoniae strains lacking capsular polysaccharide have been increasingly reported in carriage and disease contexts. Since most cases of otitis media involve more than one bacterial species, we aimed to determine the capacity of a nonencapsulated S. pneumoniae clinical isolate to induce disease in the context of a single-species infection and as a polymicrobial infection with nontypeable Haemophilus influenzae. Using the chinchilla model of otitis media, we found that nonencapsulated S. pneumoniae colonizes the nasopharynx following intranasal inoculation, but does not readily ascend into the middle ear. However, when we inoculated nonencapsulated S. pneumoniae directly into the middle ear, the bacteria persisted for two weeks post-inoculation and induced symptoms consistent with chronic otitis media. During coinfection with nontypeable H. influenzae, both species persisted for one week and induced polymicrobial otitis media. We also observed that nontypeable H. influenzae conferred passive protection from killing by amoxicillin upon S. pneumoniae from within polymicrobial biofilms in vitro. Therefore, based on these results, we conclude that nonencapsulated pneumococci are a potential causative agent of chronic/recurrent otitis media, and can also cause mutualistic infection with other opportunists, which could complicate treatment outcomes. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Frequency of Streptococcus pneumonia and Haemophilus influenza in acute exacerbation of chronic obstructive airway disease and their sensitivity to levofloxacin

    International Nuclear Information System (INIS)

    Furqan, S.; Paracha, S.A.U.

    2014-01-01

    Objective: To determine the frequency of Streptococcus pneumoniae and Haemophilus influenzae in acute exacerbation of chronic obstructive pulmonary disease and their sensitivity to levofloxacin. Methods: The cross-sectional study was conducted at the Department of Medicine, AbbasiShaheed Hospital, Karachi, between July 2009 and January 2010. Patients already diagnosed with chronic obstructive pulmonary disease and admitted with symptoms of acute exacerbation were included in the study and their sputum samples were sent for microbiological evaluation. SPSS 16 was used for statistical analysis. Results: Of the total 105 patients in the study, 90 (85.17%) were males. Overall mean age at presentation was 62+-10.2 years. S. pneumoniae was isolated from sputum culture of 33 (31.4%) patients, while 13 (12.4%) patients showed growth of H. influenzae. Out of the 33 sputum specimens of S. pneumoniae, 32 (97.0%) were sensitive to levofloxacin, while 1 (3.0%) was resistant. All the 13 isolates of H. influenzae were sensitive to levofloxacin. Conclusion: S. pneumoniae and H. influenzae are still the most prevalent organisms isolated in acute exacerbation of chronic obstructive pulmonary disease in our population. Levofloxacin is still considered a highly sensitive antibiotic against these common micro-organisms in our population, but S. pneumoniae has started developing resistance against levofloxacin. Therefore, intermittent surveillance regarding development of resistance pattern of common micro-organisms against commonly prescribed antibiotics is required. (author)

  18. Pneumococcal DNA-binding proteins released through autolysis induce the production of proinflammatory cytokines via toll-like receptor 4.

    Science.gov (United States)

    Nagai, Kosuke; Domon, Hisanori; Maekawa, Tomoki; Oda, Masataka; Hiyoshi, Takumi; Tamura, Hikaru; Yonezawa, Daisuke; Arai, Yoshiaki; Yokoji, Mai; Tabeta, Koichi; Habuka, Rie; Saitoh, Akihiko; Yamaguchi, Masaya; Kawabata, Shigetada; Terao, Yutaka

    2018-03-01

    Streptococcus pneumoniae is a leading cause of bacterial pneumonia. Our previous study suggested that S. pneumoniae autolysis-dependently releases intracellular pneumolysin, which subsequently leads to lung injury. In this study, we hypothesized that pneumococcal autolysis induces the leakage of additional intracellular molecules that could increase the pathogenicity of S. pneumoniae. Liquid chromatography tandem-mass spectrometry analysis identified that chaperone protein DnaK, elongation factor Tu (EF-Tu), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were released with pneumococcal DNA by autolysis. We demonstrated that recombinant (r) DnaK, rEF-Tu, and rGAPDH induced significantly higher levels of interleukin-6 and tumor necrosis factor production in peritoneal macrophages and THP-1-derived macrophage-like cells via toll-like receptor 4. Furthermore, the DNA-binding activity of these proteins was confirmed by surface plasmon resonance assay. We demonstrated that pneumococcal DnaK, EF-Tu, and GAPDH induced the production of proinflammatory cytokines in macrophages, and might cause host tissue damage and affect the development of pneumococcal diseases. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Antithyroid drug-induced agranulocytosis complicated by pneumococcal sepsis and upper airway obstruction.

    Science.gov (United States)

    Ishimaru, Naoto; Ohnishi, Hisashi; Nishiuma, Teruaki; Doukuni, Ryota; Umezawa, Kanoko; Oozone, Sachiko; Kuramoto, Emi; Yoshimura, Sho; Kinami, Saori

    2013-01-01

    Streptococcus pneumoniae is a rare pathogen of sepsis in patients with antithyroid drug-induced agranulocytosis. We herein describe a case of antithyroid drug-induced agranulocytosis complicated by pneumococcal sepsis and upper airway obstruction. A 27-year-old woman who was previously prescribed methimazole for nine months presented with a four-day history of a sore throat. She nearly choked and was diagnosed with febrile agranulocytosis. She was successfully treated with intubation, intravenous antibiotics and granulocyte colony-stimulating factor. Her blood cultures yielded S. pneumoniae. Emergency airway management, treatment of sepsis and the administration of granulocyte colony-stimulating factor can improve the clinical course of antithyroid drug-induced pneumococcal sepsis in patients with airway obstruction.

  20. Community-acquired pneumonia among smokers.

    Science.gov (United States)

    Almirall, Jordi; Blanquer, José; Bello, Salvador

    2014-06-01

    Recent studies have left absolutely no doubt that tobacco increases susceptibility to bacterial lung infection, even in passive smokers. This relationship also shows a dose-response effect, since the risk reduces spectacularly 10 years after giving up smoking, returning to the level of non-smokers. Streptococcus pneumoniae is the causative microorganism responsible for community-acquired pneumonia (CAP) most frequently associated with smoking, particularly in invasive pneumococcal disease and septic shock. It is not clear how it acts on the progress of pneumonia, but there is evidence to suggest that the prognosis for pneumococcal pneumonia is worse. In CAP caused by Legionella pneumophila, it has also been observed that smoking is the most important risk factor, with the risk rising 121% for each pack of cigarettes smoked a day. Tobacco use may also favor diseases that are also known risk factors for CAP, such as periodontal disease and upper respiratory viral infections. By way of prevention, while giving up smoking should always be proposed, the use of the pneumococcal vaccine is also recommended, regardless of the presence of other comorbidities. Copyright © 2013 SEPAR. Published by Elsevier Espana. All rights reserved.

  1. [Antibiotic resistance analysis of Streptococcus pneumoniae isolates from the hospitalized children in Shanxi Children's Hospital from 2012 to 2014].

    Science.gov (United States)

    Ge, L L; Han, Z Y; Liu, A H; Zhu, L; Meng, J H

    2017-02-02

    Objective: To investigate the antibiotic resistance status of Streptococcus pneumoniae isolates from hospitalized children in Shanxi Children's Hospital. Method: E-test and Kirby-Bauer methods were applied to determine drug sensitivity of the isolates collected from the body fluid specimens of hospitalized children in Shanxi Children's Hospital from January 2012 to December 2014. The antimicrobial sensitivity and minimum inhibitory concentration (MIC) of Streptococcus pneumoniae to the conventional antibiotics were analyzed, in order to compare the annual trends of non-invasive isolates, while the differentiation of sensitivity from specimens. The comparison of rates was performed by Chi-squared test and Fisher's exact test. Result: A total of 671 isolates of streptococcus pneumoniae were obtained, which could be divided as non-invasive isolates(607), invasive isolates from non-cerebrospinal fluid(non-CSF)(40) and invasive isolates from cerebrospinal fluid(CSF)(24). The antimicrobial sensitivity(isolates(%)) of the 671 isolates were respectively vancomycin 671(100.0%), linezolid 671(100.0%), levofloxacin 665(99.1%), penicillin 595(88.7%), ceftriaxone 516(76.9%), cefotaxime 512(76.3%), sulfamethoxazole-trimethoprin(SMZ-TMP) 103(15.4%), clindamycin 28(4.2%), tetracycline 26(3.9%), erythromycin 12(1.8%). From 2012 to 2014, the susceptibility rates of non-invasive isolates to penicillin every year were 95.0%(96/101), 97.3%(110/113), 87.3%(343/393), respectively, and there was significant difference among the three years(χ(2)=13.266, P penicillin were 0.064, 2.000, 6.000 in 2012, which grew up to 1.000, 3.000, 16.000 in 2014. There was no significant difference in the susceptibility rate of non-invasive isolates to ceftriaxone and cefotaxime during these three years, (χ(2)=1.172, 1.198, both P >0.05). On the other hand, the values of MIC(50, )MIC(90) and the maximum value of MIC(mg/L) of ceftriaxone and cefotaxime both increased from 0.500, 2.000, 8.000 in 2012 to 0

  2. Co-Transcriptomes of Initial Interactions In Vitro between Streptococcus Pneumoniae and Human Pleural Mesothelial Cells.

    Directory of Open Access Journals (Sweden)

    Claire J Heath

    Full Text Available Streptococcus pneumoniae (Spn is a major causative organism of empyema, an inflammatory condition occurring in the pleural sac. In this study, we used human and Spn cDNA microarrays to characterize the transcriptional responses occurring during initial contact between Spn and a human pleural mesothelial cell line (PMC in vitro. Using stringent filtering criteria, 42 and 23 Spn genes were up-and down-regulated respectively. In particular, genes encoding factors potentially involved in metabolic processes and Spn adherence to eukaryotic cells were up-regulated e.g. glnQ, glnA, aliA, psaB, lytB and nox. After Spn initial contact, 870 human genes were differentially regulated and the largest numbers of significant gene expression changes were found in canonical pathways for eukaryotic initiation factor 2 signaling (60 genes out of 171, oxidative phosphorylation (32/103, mitochondrial dysfunction (37/164, eIF4 and p70S6K signaling (28/142, mTOR signaling (27/182, NRF2-mediated oxidative stress response (20/177, epithelial adherens junction remodeling (11/66 and ubiquitination (22/254. The cellular response appeared to be directed towards host cell survival and defense. Spn did not activate NF-kB or phosphorylate p38 MAPK or induce cytokine production from PMC. Moreover, Spn infection of TNF-α pre-stimulated PMC inhibited production of IL-6 and IL-8 secretion by >50% (p<0.01. In summary, this descriptive study provides datasets and a platform for examining further the molecular mechanisms underlying the pathogenesis of empyema.

  3. Identification of EloR (Spr1851) as a regulator of cell elongation in Streptococcus pneumoniae.

    Science.gov (United States)

    Stamsås, Gro Anita; Straume, Daniel; Ruud Winther, Anja; Kjos, Morten; Frantzen, Cyril Alexander; Håvarstein, Leiv Sigve

    2017-09-01

    In a screen for mutations suppressing the lethal loss of PBP2b in Streptococcus pneumoniae we identified Spr1851 (named EloR), a cytoplasmic protein of unknown function whose inactivation removed the requirement for PBP2b as well as RodA. It follows from this that EloR and the two elongasome proteins must be part of the same functional network. This network also includes StkP, as this serine/threonine kinase phosphorylates EloR on threonine 89 (T89). We found that ΔeloR cells, and cells expressing the phosphoablative form of EloR (EloR T89A ), are significantly shorter than wild-type cells. Furthermore, the phosphomimetic form of EloR (EloR T89E ) is not tolerated unless the cell in addition acquires a truncated MreC or non-functional RodZ protein. By itself, truncation of MreC as well as inactivation of RodZ gives rise to less elongated cells, demonstrating that the stress exerted by the phosphomimetic form of EloR is relieved by suppressor mutations that reduce or abolish the activity of the elongasome. Of note, it was also found that loss of elongasome activity caused by truncation of MreC elicits increased StkP-mediated phosphorylation of EloR. Together, the results support a model in which phosphorylation of EloR stimulates cell elongation, while dephosphorylation has an inhibitory effect. © 2017 John Wiley & Sons Ltd.

  4. Streptococcus pneumoniae eradicates preformed Staphylococcus aureus biofilms through a mechanism requiring physical contact

    Directory of Open Access Journals (Sweden)

    Faidad Khan

    2016-09-01

    Full Text Available Staphylococcus aureus (Sau strains are a main cause of disease, including nosocomial infections which have been linked to the production of biofilms and the propagation of antibiotic resistance strains such as methicillin-resistant Staphylococcus aureus (MRSA. A previous study found that Streptococcus pneumoniae (Spn strains kill planktonic cultures of Sau strains. In this work, we have further evaluated in detail the eradication of Sau biofilms and investigated ultrastructural interactions of the biofilmicidal effect. Spn strain D39, which produces the competence stimulating peptide 1 (CSP1, reduced Sau biofilms within 8 h of inoculation, while TIGR4, producing CSP2, eradicated Sau biofilms and planktonic cells within 4 h. Differences were not attributed to pherotypes as other Spn strains producing different pheromones eradicated Sau within 4 h. Experiments using Transwell devices, which physically separated both species growing in the same well, demonstrated that direct contact between Spn and Sau was required to efficiently eradicate Sau biofilms and biofilm-released planktonic cells. Physical contact-mediated killing of Sau was not related to production of hydrogen peroxide as an isogenic TIGR4spxB mutant eradicated Sau bacteria within 4 h. Confocal micrographs confirmed eradication of Sau biofilms by TIGR4 and allowed us to visualize ultrastructural point of contacts between Sau and Spn. A time-course study further demonstrated spatial colocalization of Spn chains and Sau tetrads as early as 30 min post-inoculation (Pearson’s coefficient >0.72. Finally, precolonized biofilms produced by Sau strain Newman, or MRSA strain USA300, were eradicated by mid-log phase cultures of washed TIGR4 bacteria within 2 h post-inoculation. In conclusion, Spn strains rapidly eradicate pre-colonized Sau aureus biofilms, including those formed by MRSA strains, by a mechanism(s requiring bacterium-bacterium contact, but independent from the production of

  5. Digital gene expression analysis in mice lung with coinfection of influenza and streptococcus pneumoniae.

    Science.gov (United States)

    Luo, Jun; Zhou, Linlin; Wang, Hongren; Qin, Zhen; Xiang, Li; Zhu, Jie; Huang, Xiaojun; Yang, Yuan; Li, Wanyi; Wang, Baoning; Li, Mingyuan

    2017-12-22

    Influenza A virus (IAV) and Streptococcus pneumoniae (SP) are two major upper respiratory tract pathogens that can also cause infection in polarized bronchial epithelial cells to exacerbate disease in coinfected individuals which may result in significant morbidity. However, the underlying molecular mechanism is poorly understood. Here, we employed BALB/c ByJ mice inflected with SP, IAV, IAV followed by SP (IAV+SP) and PBS (Control) as models to survey the global gene expression using digital gene expression (DGE) profiling. We attempt to gain insights into the underlying genetic basis of this synergy at the expression level. Gene expression profiles were obtain using the Illimina/Hisseq sequencing technique, and further analyzed by enrichment analysis of Gene Ontology (GO) and Pathway function. The hematoxylin-eosin (HE) staining revealed different tissue changes in groups during which IAV+SP group showed the most severe cell apoptosis. Compared with Control, a total of 2731, 3221 and 3946 differentially expressed genes (DEGs) were detected in SP, IAV and IAV+SP respectively. Besides, sixty-two GO terms were identified by Gene Ontology functional enrichment analysis, such as cell killing, biological regulation, response to stimulus, signaling, biological adhesion, enzyme regulator activity, receptor regulator activity and translation regulator activity. Pathway significant enrichment analysis indicated the dysregulation of multiple pathways, including apoptosis pathway. Among these, five selected genes were further verified by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). This study shows that infection with SP, IAV or IAV+SP induces apoptosis with different degrees which might provide insights into the molecular mechanisms to facilitate further research.

  6. Characteristics of Streptococcus pneumoniae Strains Colonizing Upper Respiratory Tract of Healthy Preschool Children in Poland

    Directory of Open Access Journals (Sweden)

    Izabela Korona-Glowniak

    2012-01-01

    Full Text Available Antibiotic resistant and invasive pneumococci may spread temporally and locally in day care centers (DCCs. We examined 267 children attending four DCCs located in the same city and 70 children staying at home in three seasons (autumn, winter, and spring to determine prevalence, serotype distribution, antibiotic resistance patterns, and transmission of pneumococcal strains colonizing upper respiratory tract of healthy children without antipneumococcal vaccination. By pheno- and genotyping, we determined clonality of pneumococci, including drug-resistant strains. The average carriage of pneumococci in three seasons was 38.2%. 73.4% and 80.4% of the isolates belonged to serotypes present in 10- and 13-valent conjugate vaccine, respectively. Among the pneumococcal strains, 33.3% were susceptible to all antimicrobial tested and 39.2% had decreased susceptibility to penicillin. Multidrug resistance was common (35.7%; 97.5% of drug-resistant isolates represented serotypes included to 10- and 13-valent conjugate vaccine. According to BOX-PCR, clonality definitely was observed only in case of serotype 14. Multivariate analysis determined DCC attendance as strongly related to pneumococcal colonization in all three seasons, but important seasonal differences were demonstrated. In children attending DCCs, we observed dynamic turnover of pneumococcal strains, especially penicillin nonsusceptible and multidrug resistant, which were mostly distributed among serotypes included to available pneumococcal conjugate vaccines.

  7. Streptococcus pneumoniae Colonization Is Required To Alter the Nasal Microbiota in Cigarette Smoke-Exposed Mice.

    Science.gov (United States)

    Shen, Pamela; Whelan, Fiona J; Schenck, L Patrick; McGrath, Joshua J C; Vanderstocken, Gilles; Bowdish, Dawn M E; Surette, Michael G; Stämpfli, Martin R

    2017-10-01

    Smokers have nasal microbiota dysbiosis, with an increased frequency of colonizing bacterial pathogens. It is possible that cigarette smoke increases pathogen acquisition by perturbing the microbiota and decreasing colonization resistance. However, it is difficult to disentangle microbiota dysbiosis due to cigarette smoke exposure from microbiota changes caused by increased pathogen acquisition in human smokers. Using an experimental mouse model, we investigated the impact of cigarette smoke on the nasal microbiota in the absence and presence of nasal pneumococcal colonization. We observed that cigarette smoke exposure alone did not alter the nasal microbiota composition. The microbiota composition was also unchanged at 12 h following low-dose nasal pneumococcal inoculation, suggesting that the ability of the microbiota to resist initial nasal pneumococcal acquisition was not impaired in smoke-exposed mice. However, nasal microbiota dysbiosis occurred as a consequence of established high-dose nasal pneumococcal colonization at day 3 in smoke-exposed mice. Similar to clinical reports on human smokers, an enrichment of potentially pathogenic bacterial genera such as Fusobacterium , Gemella , and Neisseria was observed. Our findings suggest that cigarette smoke exposure predisposes to pneumococcal colonization independent of changes to the nasal microbiota and that microbiota dysbiosis observed in smokers may occur as a consequence of established pathogen colonization. Copyright © 2017 American Society for Microbiology.

  8. Increased Zinc Availability Enhances Initial Aggregation and Biofilm Formation of Streptococcus pneumoniae.

    Science.gov (United States)

    Brown, Lindsey R; Caulkins, Rachel C; Schartel, Tyler E; Rosch, Jason W; Honsa, Erin S; Schultz-Cherry, Stacey; Meliopoulos, Victoria A; Cherry, Sean; Thornton, Justin A

    2017-01-01

    Bacteria growing within biofilms are protected from antibiotics and the immune system. Within these structures, horizontal transfer of genes encoding virulence factors, and promoting antibiotic resistance occurs, making biofilms an extremely important aspect of pneumococcal colonization and persistence. Identifying environmental cues that contribute to the formation of biofilms is critical to understanding pneumococcal colonization and infection. Iron has been shown to be essential for the formation of pneumococcal biofilms; however, the role of other physiologically important metals such as copper, zinc, and manganese has been largely neglected. In this study, we investigated the effect of metals on pneumococcal aggregation and early biofilm formation. Our results show that biofilms increase as zinc concentrations increase. The effect was found to be zinc-specific, as altering copper and manganese concentrations did not affect biofilm formation. Scanning electron microscopy analysis revealed structural differences between biofilms grown in varying concentrations of zinc. Analysis of biofilm formation in a mutant strain lacking the peroxide-generating enzyme pyruvate oxidase, SpxB, revealed that zinc does not protect against pneumococcal H 2 O 2 . Further, analysis of a mutant strain lacking the major autolysin, LytA, indicated the role of zinc as a negative regulator of LytA-dependent autolysis, which could affect biofilm formation. Additionally, analysis of cell-cell aggregation via plating and microscopy revealed that high concentrations of zinc contribute to intercellular interaction of pneumococci. The findings from this study demonstrate that metal availability contributes to the ability of pneumococci to form aggregates and subsequently, biofilms.

  9. Clonal relationships among penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates recovered in Greece and France.

    Science.gov (United States)

    Syrogiannopoulos, G A; Doit, C; Grivea, I N; Geslin, P; Bingen, E

    2001-01-01

    In January 1996 the emergence of penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates resistant to chloramphenicol, tetracycline, erythromycin, clindamycin and trimethoprim-sulfamethoxazole was observed in young carriers in the city of Patras, located in the southwestern region of Greece. Later, a significant spread of pneumococci with this unusual phenotype was noted in carriers living in various other areas of the country. Using restriction fragment length polymorphism of the ribosomal RNA genes, clonal relationships were found between these Greek strains and serotype 6B penicillin-susceptible, multiresistant pneumococci isolated in France between January 1992 and September 1996. The French and Greek isolates appear to have a common ancestry.

  10. Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence

    OpenAIRE

    Hendriksen, Wouter T.; Bootsma, Hester J.; van Diepen, Angela; Estevao, Silvia; Kuipers, Oscar P.; de Groot, Ronald; Hermans, Peter W. M.

    2009-01-01

    Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray analysis identified three shared PsaR targets: the psa operon, pcpA and prtA. In addition, we found 31 genes to be regulated by PsaR in D39 only, most strikingly a cellobiose-specific phosphotrains...

  11. Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Yamada, Mototsugu; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo

    2008-01-01

    The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4 3 2 1 2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent

  12. Influence of the blood bacterial load on the meningeal inflammatory response in Streptococcus pneumoniae meningitis

    DEFF Research Database (Denmark)

    Østergaard, C; O´Reilly, T; Brandt, C

    2006-01-01

    BACKGROUND: Despite bacteraemia is present in the majority of patients with pneumococcal, little is known about the influence of the systemic infection on the meningeal inflammatory response. METHODS: To explore the role of systemic infection on the meningeal inflammation, experimental meningitis...... levels in 153 pneumococcal meningitis patients with and without presence of bacteraemia. RESULTS: As designed, blood bacterial concentrations were significantly different among three experimental groups during the 16 hours study period (Kruskal Wallis test, P ... to the two other groups between 12-16 hours from time of infection (P meningitis, no significant difference in CSF WBC was observed between patients with or without bacteraemia at admission (n = 103, 1740...

  13. CXCR1/2 Antagonism Is Protective during Influenza and Post-Influenza Pneumococcal Infection

    Directory of Open Access Journals (Sweden)

    Luciana P. Tavares

    2017-12-01

    Full Text Available RationaleInfluenza A infections are a leading cause of morbidity and mortality worldwide especially when associated with secondary pneumococcal infections. Inflammation is important to control pathogen proliferation but may also cause tissue injury and death. CXCR1/2 are chemokine receptors relevant for the recruitment of neutrophils. We investigated the role of CXCR1/2 during influenza, pneumococcal, and post-influenza pneumococcal infections.MethodsMice were infected with influenza A virus (IAV or Streptococcus pneumoniae and then treated daily with the CXCR1/2 antagonist DF2162. To study secondary pneumococcal infection, mice were infected with a sublethal inoculum of IAV then infected with S. pneumoniae 14 days later. DF2162 was given in a therapeutic schedule from days 3 to 6 after influenza infection. Lethality, weight loss, inflammation, virus/bacteria counts, and lung injury were assessed.ResultsCXCL1 and CXCL2 were produced at high levels during IAV infection. DF2162 treatment decreased morbidity and this was associated with decreased infiltration of neutrophils in the lungs and reduced pulmonary damage and viral titers. During S. pneumoniae infection, DF2162 treatment decreased neutrophil recruitment, pulmonary damage, and lethality rates, without affecting bacteria burden. Therapeutic treatment with DF2162 during sublethal IAV infection reduced the morbidity associated with virus infection and also decreased the magnitude of inflammation, lung damage, and number of bacteria in the blood of mice subsequently infected with S. pneumoniae.ConclusionModulation of the inflammatory response by blocking CXCR1/2 improves disease outcome during respiratory influenza and pneumococcal infections, without compromising the ability of the murine host to deal with infection. Altogether, inhibition of CXCR1/2 may be a valid therapeutic strategy for treating lung infections caused by these pathogens, especially controlling secondary bacterial

  14. Effect of decreased BCAA synthesis through disruption of ilvC gene on the virulence of Streptococcus pneumoniae.

    Science.gov (United States)

    Kim, Gyu-Lee; Lee, Seungyeop; Luong, Truc Thanh; Nguyen, Cuong Thach; Park, Sang-Sang; Pyo, Suhkneung; Rhee, Dong-Kwon

    2017-08-01

    Streptococcus pneumoniae (pneumococcus) is responsible for significant morbidity and mortality worldwide. It causes a variety of life-threatening infections such as pneumonia, bacteremia, and meningitis. In bacterial physiology, the metabolic pathway of branched-chain amino acids (BCAAs) plays an important role in virulence. Nonetheless, the function of IlvC, one of the enzymes involved in the biosynthesis of BCAAs, in S. pneumoniae remains unclear. Here, we demonstrated that downregulation of BCAA biosynthesis by ilvC ablation can diminish BCAA concentration and expression of pneumolysin (Ply) and LytA, and subsequently attenuate virulence. Infection with an ilvC mutant showed significantly reduced mortality and colonization in comparison with strain D39 (serotype 2, wild type), suggesting that ilvC can potentiate S. pneumoniae virulence due to adequate BCAA synthesis. Taken together, these results suggest that the function of ilvC in BCAA synthesis is essential for virulence factor and could play an important role in the pathogenesis of respiratory infections.

  15. Importance of Bacterial Replication and Alveolar Macrophage-Independent Clearance Mechanisms during Early Lung Infection with Streptococcus pneumoniae

    Science.gov (United States)

    Camberlein, Emilie; Cohen, Jonathan M.; José, Ricardo; Hyams, Catherine J.; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A.; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad

    2015-01-01

    Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

  16. Cefditoren and ceftriaxone enhance complement-mediated immunity in the presence of specific antibodies against antibiotic-resistant pneumococcal strains.

    Directory of Open Access Journals (Sweden)

    Elisa Ramos-Sevillano

    Full Text Available BACKGROUND: Specific antibodies mediate humoral and cellular protection against invading pathogens such as Streptococcus pneumoniae by activating complement mediated immunity, promoting phagocytosis and stimulating bacterial clearance. The emergence of pneumococcal strains with high levels of antibiotic resistance is of great concern worldwide and a serious threat for public health. METHODOLOGY/PRINCIPAL FINDINGS: Flow cytometry was used to determine whether complement-mediated immunity against three antibiotic-resistant S. pneumoniae clinical isolates is enhanced in the presence of sub-inhibitory concentrations of cefditoren and ceftriaxone. The binding of acute phase proteins such as C-reactive protein and serum amyloid P component, and of complement component C1q, to pneumococci was enhanced in the presence of serum plus either of these antibiotics. Both antibiotics therefore trigger the activation of the classical complement pathway against S. pneumoniae. C3b deposition was also increased in the presence of specific anti-pneumococcal antibodies and sub-inhibitory concentrations of cefditoren and ceftriaxone confirming that the presence of these antibiotics enhances complement-mediated immunity to S. pneumoniae. CONCLUSIONS/SIGNIFICANCE: Using cefditoren and ceftriaxone to promote the binding of acute phase proteins and C1q to pneumococci, and to increase C3b deposition, when anti-pneumococcal antibodies are present, might help reduce the impact of antibiotic resistance in S. pneumoniae infections.

  17. A novel computational method identifies intra- and inter-species recombination events in Staphylococcus aureus and Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Lisa Sanguinetti

    Full Text Available Advances in high-throughput DNA sequencing technologies have determined an explosion in the number of sequenced bacterial genomes. Comparative sequence analysis frequently reveals evidences of homologous recombination occurring with different mechanisms and rates in different species, but the large-scale use of computational methods to identify recombination events is hampered by their high computational costs. Here, we propose a new method to identify recombination events in large datasets of whole genome sequences. Using a filtering procedure of the gene conservation profiles of a test genome against a panel of strains, this algorithm identifies sets of contiguous genes acquired by homologous recombination. The locations of the recombination breakpoints are determined using a statistical test that is able to account for the differences in the natural rate of evolution between different genes. The algorithm was tested on a dataset of 75 genomes of Staphylococcus aureus and 50 genomes comprising different streptococcal species, and was able to detect intra-species recombination events in S. aureus and in Streptococcus pneumoniae. Furthermore, we found evidences of an inter-species exchange of genetic material between S. pneumoniae and Streptococcus mitis, a closely related commensal species that colonizes the same ecological niche. The method has been implemented in an R package, Reco, which is freely available from supplementary material, and provides a rapid screening tool to investigate recombination on a genome-wide scale from sequence data.

  18. Purification, crystallization and preliminary X-ray analysis of 3-hydroxy-3-methylglutaryl-coenzyme A reductase of Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Zhang, Liping; Feng, Lingling; Zhou, Li; Gui, Jie; Wan, Jian; Hu, Xiaopeng

    2010-01-01

    3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase of Streptococcus pneumoniae has been cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. Class II 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases are potential targets for novel antibiotic development. In order to obtain a precise structural model for use in virtual screening and inhibitor design, HMG-CoA reductase of Streptococcus pneumoniae was cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. A complete data set was collected from a single frozen crystal on a home X-ray source. The crystal diffracted to 2.3 Å resolution and belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 773.4836, b = 90.3055, c = 160.5592 Å, α = β = γ = 90°. Assuming the presence of two molecules in the asymmetric unit, the solvent content was estimated to be 54.1% (V M = 2.68 Å 3 Da −1 )

  19. Hyposplenism as a cause of pneumococcal meningoencephalitis in an adult patient with coeliac disease

    Directory of Open Access Journals (Sweden)

    Paolo Caraceni

    2013-03-01

    Full Text Available Introduction: Coeliac disease can be associated with hyposplenism and splenic atrophy, which may increase the patient’s risk for fatal infections caused by Streptococcus pneumoniae or Pneumococcus. It is general opinion that many more patients with coeliac disease have died from hyposplenism-related infections than those reported in literature. Case report: A 62-year-old woman with recently diagnosed coeliac disease was hospitalized with high fever, disorientation, and nuchal rigidity. Cerebral computed tomography was negative. Laboratory tests showed an elevated leukocyte count and very high levels of C reactive protein. The cerebrospinal fluid (CSF contained an increased number of mononuclear cells associated with a low glucose level and high protein concentrations. The CSF culture was positive for Streptococcus pneumoniae. Neurological conditions rapidly deteriorated with the onset of coma, and magnetic resonance imaging of the brain revealed initial signs of encephalitis extending above and below the tentorium. Abdominal ultrasonography disclosed splenic hypotrophy that raised the suspicion of hyposplenism. The diagnosis of hyposplenism was confirmed by demonstration of Howell-Jolly bodies in a peripheral blood smear. Discussion: This is the first reported case of pneumococcal meningoencephalitis caused by splenic hypofunction in a patient with coeliac disease. When coeliac disease is diagnosed with a marked delay in an elderly patient, spleen function should always be assessed. If impaired, the patient should undergo vaccination with pneumococcal conjugate vaccine to prevent pneumococcal infections.

  20. Risk Factors for Pneumococcal Colonization of the Nasopharynx in Alaska Native Adults and Children.

    Science.gov (United States)

    Reisman, Jonathan; Rudolph, Karen; Bruden, Dana; Hurlburt, Debby; Bruce, Michael G; Hennessy, Thomas

    2014-06-01

    Alaska Native children have high invasive pneumococcal disease (IPD) rates, and lack of in-home running water has been shown to have a significant association with infection. Pneumococcal conjugate vaccines reduced IPD; however, this population saw substantial replacement disease and colonization with nonvaccine serotypes. We evaluated risk factors for nasopharyngeal pneumococcal colonization in Alaska Native adults and children. We conducted annual surveys from 2008 through 2011 of residents of all ages in 8 rural Alaskan villages. Interviews were conducted, medical charts were reviewed, and nasopharyngeal swabs were cultured for Streptococcus pneumoniae. Multivariate logistic regression models were developed for 3 age groups (under 10 years, 10-17 years, and 18 years and older) to determine risk factors for colonization. We obtained 12 535 nasopharyngeal swabs from 4980 participants. Our population lived in severely crowded conditions, and 48% of households lacked in-home running water. In children water, household crowding, and more children in the home. Pneumococcal vaccination status was not associated with colonization. In older children and adults, increased number of persons in the household was associated with pneumococcal colonization. Higher colonization prevalence may partially explain increased IPD rates seen in those lacking in-home water services. Improving availability of sanitation services and reducing household crowding may reduce the burden of IPD in this population. © The Author 2013. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Characteristics and prognosis of pneumococcal endocarditis: a case-control study.

    Science.gov (United States)

    Daudin, M; Tattevin, P; Lelong, B; Flecher, E; Lavoué, S; Piau, C; Ingels, A; Chapron, A; Daubert, J-C; Revest, M

    2016-06-01

    Case series have suggested that pneumococcal endocarditis is a rare disease, mostly reported in patients with co-morbidities but no underlying valve disease, with a rapid progression to heart failure, and high mortality. We performed a case-control study of 28 patients with pneumococcal endocarditis (cases), and 56 patients with non-pneumococcal endocarditis (controls), not matched for sex and age, during the years 1991-2013, in one referral centre. Alcoholism (39.3% versus 10.7%; p endocarditis. Cardiac surgery was required in 64.3% of patients with pneumococcal endocarditis, much earlier than in patients with non-pneumococcal endocarditis (mean time from symptom onset, 14.1 ± 18.2 versus 69.0 ± 61.1 days). In-hospital mortality rates were similar (7.1% versus 12.5%). Streptococcus pneumoniae causes rapidly progressive endocarditis requiring life-saving early cardiac surgery in most cases. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  2. Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1997-04-01

    Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.

  3. Differences in genotype and virulence among four multidrug-resistant Streptococcus pneumoniae isolates belonging to the PMEN1 clone.

    Directory of Open Access Journals (Sweden)

    N Luisa Hiller

    Full Text Available We report on the comparative genomics and characterization of the virulence phenotypes of four S. pneumoniae strains that belong to the multidrug resistant clone PMEN1 (Spain(23F ST81. Strains SV35-T23 and SV36-T3 were recovered in 1996 from the nasopharynx of patients at an AIDS hospice in New York. Strain SV36-T3 expressed capsule type 3 which is unusual for this clone and represents the product of an in vivo capsular switch event. A third PMEN1 isolate - PN4595-T23 - was recovered in 1996 from the nasopharynx of a child attending day care in Portugal, and a fourth strain - ATCC700669 - was originally isolated from a patient with pneumococcal disease in Spain in 1984. We compared the genomes among four PMEN1 strains and 47 previously sequenced pneumococcal isolates for gene possession differences and allelic variations within core genes. In contrast to the 47 strains - representing a variety of clonal types - the four PMEN1 strains grouped closely together, demonstrating high genomic conservation within this lineage relative to the rest of the species. In the four PMEN1 strains allelic and gene possession differences were clustered into 18 genomic regions including the capsule, the blp bacteriocins, erythromycin resistance, the MM1-2008 prophage and multiple cell wall anchored proteins. In spite of their genomic similarity, the high resolution chinchilla model was able to detect variations in virulence properties of the PMEN1 strains highlighting how small genic or allelic variation can lead to significant changes in pathogenicity and making this set of strains ideal for the identification of novel virulence determinants.

  4. The accuracy of using the lytA-gene to distinguish Streptococcus pneumoniae from related species

    DEFF Research Database (Denmark)

    Greve, Thomas; Møller, Jens Kjølseth

    2012-01-01

    with primers and probes. The remaining 11 S. pneumoniae strains could be placed in a different cluster, which also contained the five S. mitis and two S. pseudopneumoniae strains. All strains had no match with primers and probes. The S. pneumoniae strains in the second cluster were all characterised by being....... The real-time PCR targeting the lytA-gene thus constitutes a sensitive and specific assay that distinguishes S. pneumoniae from its close relatives in the Mitis group....

  5. The alpha-tocopherol form of vitamin E reverses age-associated susceptibility to Streptococcus pneumoniae lung infection by modulating pulmonary neutrophil recruitment

    Science.gov (United States)

    Streptococcus pneumonia infections are an important cause of morbidity and mortality in older patients. Uncontrolled neutrophil-driven pulmonary inflammation exacerbates this disease. To test whether the alpha-tocopherol (alpha-Toc) form of vitamin E, a regulator of immunity, can modulate neutrophil...

  6. PENICILLIN-BINDING PROTEIN 2X OF STREPTOCOCCUS-PNEUMONIAE - EXPRESSION IN ESCHERICHIA-COLI AND PURIFICATION OF A SOLUBLE ENZYMATICALLY ACTIVE DERIVATIVE

    NARCIS (Netherlands)

    LAIBLE, G; KECK, W; LURZ, R; MOTTL, H; FRERE, JM; JAMIN, M; HAKENBECK, R

    1992-01-01

    A 2.5-kb DNA fragment including the structural gene coding for the penicillin-binding protein 2x (PBP 2x) of Streptococcus pneumoniae has been cloned into the vector pJDC9 and expressed in Escherichia coli. Mapping of RNA polymerase binding sites by electron microscopy indicated that the pbpX

  7. Sublingual flagellin protects against acute pneumococcal pneumonia in a TLR5-dependent and NLRC4-independent fashion.

    Science.gov (United States)

    Muñoz-Wolf, Natalia; Rial, Analía; Fougeron, Delphine; Tabareau, Julien; Sirard, Jean-Claude; Chabalgoity, José A

    2016-09-01

    To evaluate efficacy of sublingual flagellin to treat acute pneumonia. Mice were treated sublingually with flagellin and challenged intranasally with a lethal dose of pneumococcus. Flagellins lacking TLR5 or NLRC4 activation domains were used to assess their contribution to protection. Sublingual flagellin protected mice in a TLR5-dependent, NLRC4-independent fashion. Neutrophils were required for protection. Flagellin-stimulated lung epithelial cells recapitulated the lung's transcriptional profile suggesting they could be targeted by flagellin in vivo. Ligation of TLR5, a pathogen recognition receptor not naturally engaged by pneumococcus, protects mice from invasive pneumonia when administered via sublingual route. This can be a highly cost-effective alternative therapy against pneumonia.

  8. Serotipos prevalentes de Streptococcus pneumoniae colonizadores de nasofaringe, en niños del Distrito Federal Prevalence of Streptococcus pneumoniae serotypes on nasopharyngeal colonization in children of Mexico City

    Directory of Open Access Journals (Sweden)

    Fortino Solórzano-Santos

    2005-07-01

    Full Text Available OBJETIVO: Determinar frecuencia, serotipos y susceptibilidad a ocho antimicrobianos en Streptococcus pneumoniae aislados de la nasofaringe de una muestra representativa de niños menores de cinco años de edad residentes en el Distrito Federal. MATERIAL Y MÉTODOS: Estudio transversal, hecho de febrero de 2002 a enero de 2003. Se incluyeron niños de 2 meses a 5 años. A los seleccionados se les tomó una muestra de exudado faríngeo con hisopo de alginato de calcio. Bajo técnicas ya establecidas se realizó identificación, tipificación y susceptibilidad a ocho antimicrobianos de los aislamientos de S. pneumoniae. Se utilizó estadística descriptiva, prueba de Ji cuadrada y razón de momios (IC 95% para los factores de riesgo. RESULTADOS: Se estudiaron 573 niños. En 122/573 (21.4% niños se aisló S. pneumoniae. Los serotipos más frecuentes fueron el 23F, 35, 19F, 11A y 15A; 46% de los serotipos encontrados no son cubiertos con la vacuna heptavalente. Se encontró 12% de susceptibilidad reducida a la penicilina, con 3% de cepas con alta resistencia; la resistencia a eritromicina fue >30% y para trimetoprim-sulfametoxazol (TMP/SMX >40%. No hubo cepas resistentes a vancomicina, cefotaxima, amoxicilina-clavulanato, cloranfenicol o ampicilina. CONCLUSIONES: El porcentaje de serotipos de S. pneumoniae en portadores nasofaríngeos no cubiertos por la vacuna heptavalente es alto, y la resistencia a macrólidos y TMP/SMX es elevada, lo que debe alertar al grupo médico.OBJECTIVE: To determine the frequency, serotypes and susceptibility profiles to eight antimicrobials in Streptococcus pneumoniae nasopharyngeal isolates from a representative sample of children under 5 years of age, residents of Mexico City. PATIENTS AND METHODS: A cross-sectional survey was conducted in 573 children aged 2 months to 5 years. A nasopharyngeal sample was taken. S. pneumoniae identification, capsular serotyping and antimicrobial susceptibility to eight antimicrobials

  9. Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae.

    Science.gov (United States)

    Oggioni, M R; Claverys, J P

    1999-10-01

    A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.

  10. Meningitis caused by Neisseria Meningitidis, Hemophilus Influenzae Type B and Streptococcus Pneumoniae during 2005–2012 in Turkey

    Science.gov (United States)

    Ceyhan, Mehmet; Gürler, Nezahat; Ozsurekci, Yasemin; Keser, Melike; Aycan, Ahmet Emre; Gurbuz, Venhar; Salman, Nuran; Camcioglu, Yildiz; Dinleyici, Ener Cagri; Ozkan, Sengul; Sensoy, Gulnar; Belet, Nursen; Alhan, Emre; Hacimustafaoglu, Mustafa; Celebi, Solmaz; Uzun, Hakan; Faik Oner, Ahmet; Kurugol, Zafer; Ali Tas, Mehmet; Aygun, Denizmen; Oncel, Eda Karadag; Celik, Melda; Yasa, Olcay; Akin, Fatih; Coşkun, Yavuz

    2014-01-01

    Successful vaccination policies for protection from bacterial meningitis are dependent on determination of the etiology of bacterial meningitis. Cerebrospinal fluid (CSF) samples were obtained prospectively from children from 1 month to ≤ 18 years of age hospitalized with suspected meningitis, in order to determine the etiology of meningitis in Turkey. DNA evidence of Neisseria meningitidis (N. meningitidis), Streptococcus pneumoniae (S. pneumoniae), and Hemophilus influenzae type b (Hib) was detected using multiplex polymerase chain reaction (PCR). In total, 1452 CSF samples were evaluated and bacterial etiology was determined in 645 (44.4%) cases between 2005 and 2012; N. meningitidis was detected in 333 (51.6%), S. pneumoniae in 195 (30.2%), and Hib in 117 (18.1%) of the PCR positive samples. Of the 333 N. meningitidis positive samples 127 (38.1%) were identified as serogroup W-135, 87 (26.1%) serogroup B, 28 (8.4%) serogroup A and 3 (0.9%) serogroup Y; 88 (26.4%) were non-groupable. As vaccines against the most frequent bacterial isolates in this study are available and licensed, these results highlight the need for broad based protection against meningococcal disease in Turkey. PMID:25483487

  11. Cloning, recombinant production, crystallization and preliminary X-ray diffraction analysis of a family 101 glycoside hydrolase from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Gregg, Katie J.; Boraston, Alisdair B.

    2009-01-01

    The catalytic module of a family 101 glycoside hydrolase from S. pneumoniae was cloned, recombinantly produced and crystallized. Streptococcus pneumoniae is a serious human pathogen that is responsible for a wide range of diseases including pneumonia, meningitis, septicaemia and otitis media. The full virulence of this bacterium is reliant on carbohydrate processing and metabolism, as revealed by biochemical and genetic studies. One carbohydrate-processing enzyme is a family 101 glycoside hydrolase (SpGH101) that is responsible for catalyzing the liberation of galactosyl β1,3-N-acetyl-d-galactosamine (Galβ1,3GalNAc) α-linked to serine or threonine residues of mucin-type glycoproteins. The 124 kDa catalytic module of this enzyme (SpGH101CM) was cloned and overproduced in Escherichia coli and purified. Crystals were obtained in space group P2 1 and diffracted to 2.0 Å resolution, with unit-cell parameters a = 81.86, b = 88.91, c = 88.77 Å, β = 112.46°. SpGH101CM also qualitatively displayed good activity towards the synthetic substrate p-nitrophenyl-2-acetamido-2-deoxy-3-O-(β-d-galactopyranosyl) -α-d-galactopyranoside, which is consistent with the classification of this enzyme as an endo-α-N-acetylgalactosaminidase

  12. Antimicrobial resistance and serotyping of Streptococcus pneumoniae isolated from pediatric patients in Belo Horizonte, MG, Brazil Resistência antimicrobiana e sorotipagem de Streptococcus pneumoniae isolado de pacientes pediátricos em Belo Horizonte, MG

    Directory of Open Access Journals (Sweden)

    Ana Paula Gomes de Oliveira Magalhães

    2003-07-01

    Full Text Available Thirty one Streptococcus pneumoniae invasive strains were isolated from a pediatric population in Belo Horizonte from June, 1999 to May, 2001. Penicillin, trimethoprim-sulfamethoxazole, tetracycline and chloramphenicol resistance rates for the isolates were 41.9, 58.1, 25.8 and 3.2%, respectively. Intermediate penicillin resistant (MICs between 0.1 and 1.0 µg/ml and resistant (MICs > 2.0 µg/ml isolates occured at rates of 38.7 and 3.2%, respectively. Resistance to erythromycin, ofloxacin, rifampin or vancomicyn was not detected. Ten S. pneumoniae serotypes (14, 5, 10 A, 6B, 15B, 18C, 6 A, 18 A, 19 A and 19 F were identified. Serotype 14 (12 out of 31 was predominant among the isolates. Penicillin and trimethoprim-sulfamethoxazole resistance was more common in 14 and 6B serotypes.Trinta e três linhagens invasivas do S. pneumoniae foram isoladas a partir de pacientes pediátricos em Belo Horizonte, MG, Brasil, de junho de 1999 a maio de 2001. As taxas de resistência à penicilina, ao trimetoprim-sultametoxazol, tetraciclina e cloranfenicol foram respectivamente, 41, 9; 58,1 e 3,2%. A resistência intermediária à penicilina (MICs entre 0,1 e 1,0 µg/ml e resistência total (MICs>2.0 µg/ml ocorreram, respectivamente, nas porcentagens de 38,7 e 3,2%. Não foi detectada resistência à eritromicina, ofloxacin, rifampina e vancomicina. Foram identificados 9 sorotipos do S. pneumoniae (14, 5, 10 , 6B, 15B, 18C, 6 A, 18 19 A e 19F entre os isolados. O sorotipo 14 (12 de 31 foi predominate entre os isolados. A resistência à penicilina e ao trimetoprim-sulfametoxazol estava sempre associada aos sorotipos 14 e 6B.

  13. An audit of influenza and pneumococcal vaccination in rheumatology outpatients.

    Science.gov (United States)

    Sowden, Evin; Mitchell, William S

    2007-07-04

    Influenza and pneumococcal vaccination are recommended for a number of clinical risk groups including patients treated with major immunosuppressant disease modifying anti-rheumatic drugs. Such immunisation is not only safe but immunogenic in patients with rheumatic diseases. We sought to establish dual vaccination rates and significant influencing factors amongst our hospital rheumatology outpatients. We audited a sample of 101 patients attending hospital rheumatology outpatient clinics on any form of disease modifying treatment by clinical questionnaire and medical record perusal. Further data were collected from the local immunisation coordinating agency and analysed by logistic regression modelling. Although there was a high rate of awareness with regard to immunisation, fewer patients on major immunosuppressants were vaccinated than patients with additional clinical risk factors against influenza (53% vs 93%, p risk factors was confirmed as significant in determining vaccination status by logistic regression for both influenza (OR 10.89, p < 0.001) and streptococcus pneumoniae (OR 4.55, p = 0.002). The diagnosis of rheumatoid arthritis was also found to be a significant factor for pneumococcal vaccination (OR 5.1, p = 0.002). There was a negative trend suggesting that patients on major immunosuppressants are less likely to be immunised against pneumococcal antigen (OR 0.35, p = 0.067). Influenza and pneumococcal immunisation is suboptimal amongst patients on current immunosuppressant treatments attending rheumatology outpatient clinics. Raising awareness amongst patients may not be sufficient to improve vaccination rates and alternative strategies such as obligatory pneumococcal vaccination prior to treatment initiation and primary care provider education need to be explored.

  14. Frequency of resistance to penicillin and erythromycin of pneumococcal strains that caused ottis media

    Directory of Open Access Journals (Sweden)

    Jovanović Luka

    2017-01-01

    Full Text Available Introduction: Streptococcus pneumoniae is an important human pathogen and the most common cause of acute otitis media (AOM, especially in children. It is also a common cause of community acquired pneumonia, sepsis and bacterial meningitis. Drug of choice in the treatment of these disease are beta lactam antibiotics, and the first alternative are macrolides. The increasing prevalence of resistance to penicillin and macrolides, among pneumococci, has considerably complicated the treatment. Aim: The aim of this study was to determine susceptibility of pneumococcal isolates from pediatric AOM in Serbia to antibiotics. Material and methods: Antimicrobial susceptibility testing of 61 pneumococcal AOM was performed, collected from December 2014 to December 2015, using disk diffusion method and E test. Macrolide resistance profile was determined by double disk diffusion test. Results: In our study, 40 strains (65.6% showed reduced sensitivity to penicillin and erythromycin. There were 9 (14.8% high resistant isolates to penicillin, while 31 (50.8% showed reduced susceptibility. The most frequent resistance phenotype was cMLS. Co-resistance to penicillin and macrolides was found in 14.8% strains. Conclusion: Our results showed high resistance rate of S. pneumoniae, which causes AOM among children, to penicillin and macrolides. Further active surveillance of pneumococcal susceptibility to antibiotics is necessary, and use of these medications in empirical therapy should be limited.

  15. Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

    Science.gov (United States)

    Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-08-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

  16. Pneumonia

    OpenAIRE

    Coelho, Liana Sousa [UNESP; Tanni, Suzana Erico; Godoy, Irma de [UNESP

    2009-01-01

    Pneumonia is an infectious disease with great morbidity and mortality worldwide. According to the current guidelines recommendations the authors reviewed the treatment of community-acquired pneumonia (CAP) and hospital-acquired pneumonia (HAP). In this paper will be presented data about etiology, clinics and diagnostic tools. © Copyright Moreira Jr. Editora.

  17. Pneumonia

    OpenAIRE

    Coelho, Liana Sousa [UNESP; Do Vale, Simone Alves [UNESP; Godoy, Irma de [UNESP; Tanni, Suzana Erico [UNESP

    2012-01-01

    Pneumonia is an infectious disease with great morbidity and mortality worldwide. According to the current guidelines recommendations the authors reviewed the treatment of community-acquired pneumonia (CAP) and health care-associated pneumonia (HCAP). In this paper will be also presented data about etiology, clinics and diagnostic tools. © Copyright Moreira Jr. Editora.

  18. Molecular epidemiology of pneumococcal isolates from children in China

    Directory of Open Access Journals (Sweden)

    Li-Hua Kang

    2016-04-01

    Full Text Available Objectives: To investigate the molecular epidemiology of pneumococcal isolates in Chongqing, China. Methods: In this cross-sectional study, 51 invasive Streptococcus pneumoniae (S. pneumoniae strains were from children with invasive pneumococcal disease (IPD and 32 carriage strains from healthy children from January 2010 to December 2013 at the Children’s Hospital of Chongqing Medical University, Chongqing, China. Multilocus sequence typing was used to identify the sequence types (STs. Capsular serotypes were determined by multiplex polymerase chain reaction. Drug susceptibility and resistance was determined by minimum inhibitory concentrations. Results: In this study, 11 serotypes were identified among the 83 S. pneumoniae clinical isolates tested. Prevalent serotypes were 19A (20.4%, 6A/B (20.4%, 19F (15.7%, 14 (14.5%, and 23F (10.8%. Serotype 19F was the most frequent carriage strain, and serotype 19A was the most frequent invasive strain. The ST983 was the most prevalent ST for carriage strains, and ST320 was the most prevalent ST for invasive strains. For gene analysis, psaA (99.5% and piaA (98.6% were present and much conserved in all pneumococci tested. The cps2A and pcsB genes were more frequent in invasive isolates than carriage strains. Antimicrobial resistance rates of invasive pneumococcal isolates to erythromycin, penicillin, meropenem, cefotaxime, and clindamycin were higher than the carriage isolates from children. Conclusion: Our epidemiological evidence shows that 19A, 6A/B, 19F, 14, and 23F remain the most prevalent serotypes, which can be targeted by PCV13. Genotypes and drug resistance varied between carriage and invasive strains. The PsaA and PiaA may be good protein vaccine candidates.

  19. Pneumococcal meningitis post-cochlear implantation: preventative measures.

    Science.gov (United States)

    Wei, Benjamin P C; Shepherd, Robert K; Robins-Browne, Roy M; Clark, Graeme M; O'Leary, Stephen J

    2010-11-01

    Both clinical data and laboratory studies demonstrated the risk of pneumococcal meningitis post-cochlear implantation. This review examines strategies to prevent post-implant meningitis. Medline/PubMed database; English articles after 1980. Search terms: cochlear implants, pneumococcus meningitis, streptococcus pneumonia, immunization, prevention. Narrative review. All articles relating to post-implant meningitis without any restriction in study designs were assessed and information extracted. The presence of inner ear trauma as a result of surgical technique or cochlear implant electrode array design was associated with a higher risk of post-implant meningitis. Laboratory data demonstrated the effectiveness of pneumococcal vaccination in preventing meningitis induced via the hematogenous route of infection. Fibrous sealing around the electrode array at the cochleostomy site, and the use of antibiotic-coated electrode array reduced the risk of meningitis induced via an otogenic route. The recent scientific data support the U.S. Food and Drug Administration recommendation of pneumococcal vaccination for the prevention of meningitis in implant recipients. Nontraumatic cochlear implant design, surgical technique, and an adequate fibrous seal around the cochleostomy site further reduce the risk of meningitis. Copyright © 2010 American Academy of Otolaryngology–Head and Neck Surgery Foundation. Published by Mosby, Inc. All rights reserved.

  20. Pneumococcal lipoproteins involved in bacterial fitness, virulence, and immune evasion.

    Science.gov (United States)

    Kohler, Sylvia; Voß, Franziska; Gómez Mejia, Alejandro; Brown, Jeremy S; Hammerschmidt, Sven

    2016-11-01

    Streptococcus pneumoniae (pneumococcus) has evolved sophisticated strategies to survive in several niches within the human body either as a harmless commensal or as a serious pathogen causing a variety of diseases. The dynamic interaction between pneumococci and resident host cells during colonization of the upper respiratory tract and at the site of infection is critical for bacterial survival and the development of disease. Pneumococcal lipoproteins are peripherally anchored membrane proteins and have pivotal roles in bacterial fitness including envelope stability, cell division, nutrient acquisition, signal transduction, transport (as substrate-binding proteins of ABC transporter systems), resistance to oxidative stress and antibiotics, and protein folding. In addition, lipoproteins are directly involved in virulence-associated processes such as adhesion, colonization, and persistence through immune evasion. Conversely, lipoproteins are also targets for the host response both as ligands for toll-like receptors and as targets for acquired antibodies. This review summarizes the multifaceted roles of selected pneumococcal lipoproteins and how this knowledge can be exploited to combat pneumococcal infections. © 2016 Federation of European Biochemical Societies.

  1. Crystallization and preliminary X-ray diffraction studies of choline-binding protein F from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Molina, Rafael [Grupo de Cristalografía Macromolecular y Biología Estructural, Instituto Química Física Rocasolano, CSIC, Serrano 119, 28006 Madrid (Spain); González, Ana; Moscoso, Miriam; García, Pedro [Departamento de Microbiología Molecular, Centro de Investigaciones Biológicas, CSIC, Ramiro de Maeztu 9, 28040 Madrid (Spain); Stelter, Meike; Kahn, Richard [Institut de Biologie Structurale J.-P. Ebel CEA CNRS UJF, Laboratoire de Cristallographie Macromoléculaire, 41 Rue Jules Horowitz, 38027 Grenoble CEDEX 1 (France); Hermoso, Juan A., E-mail: xjuan@iqfr.csic.es [Grupo de Cristalografía Macromolecular y Biología Estructural, Instituto Química Física Rocasolano, CSIC, Serrano 119, 28006 Madrid (Spain)

    2007-09-01

    The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-quality orthorhombic crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L{sub III} absorption edge using synchrotron radiation.

  2. Crystallization and preliminary X-ray diffraction studies of choline-binding protein F from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Molina, Rafael; González, Ana; Moscoso, Miriam; García, Pedro; Stelter, Meike; Kahn, Richard; Hermoso, Juan A.

    2007-01-01

    The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-quality orthorhombic crystals belong to space group P2 1 2 1 2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L III absorption edge using synchrotron radiation

  3. Meningitis neonatal e infección puerperal por Streptococcus pneumoniae: Presentación de un caso

    Directory of Open Access Journals (Sweden)

    Cecilia Ortiz Rodríguez

    2003-06-01

    Full Text Available Las infecciones neonatales causadas por Streptococcus pneumoniae constituyen un fenómeno raro, poco reportado en la literatura médica; en el presente trabajo se describe el caso de una meningoencefalitis purulenta de aparición precoz, en un neonato nacido por parto eutócico, a termino y de buen peso. Se aisló el microorganismo en la sangre y en el líquido cefalorraquídeo del recién nacido, así como en los loquios de la madre. Las 3 antibiotipias fueron idénticas. La evolución del niño fue desfavorable, el cual falleció a las 81 horas de vida, en un cuadro de fallo multiorgánico. La necropsia corroboró el diagnóstico. La madre desarrolló una endometritis puerperal a los 4 días, con buena evolución.Neonatal infections caused by Streptococcus pneumoniae are a rare phenomenon that is barely reported in the medical literature. The present paper describes a case of early purulent meningoencephalitis occurred in an adequate birthweight neonate born to term eutocic delivery. The microorganism was isolated in the newborn's blood and cerebrospinal fluid as well as in his mother's lochia. The three antibiotypes were identical. The newborn did not recover and died after 81 hours due to a multiple organ failure. Necropsy confirmed the diagnosis. The mother developed puerperal endometritis after 4 days but did recover.

  4. Coinfection with Haemophilus influenzae promotes pneumococcal biofilm formation during experimental otitis media and impedes the progression of pneumococcal disease.

    Science.gov (United States)

    Weimer, Kristin E D; Armbruster, Chelsie E; Juneau, Richard A; Hong, Wenzhou; Pang, Bing; Swords, W Edward

    2010-10-01

    Otitis media is an extremely common pediatric infection and is mostly caused by bacteria that are carried within the nasopharyngeal microbiota. It is clear that most otitis media cases involve simultaneous infection with multiple agents. Chinchillas were infected with nontypeable Haemophilus influenzae, Streptococcus pneumoniae, or a combination of both organisms, and the course of disease was compared. In vitro experiments were also performed to address how coinfection impacts biofilm formation. The incidence of systemic disease was reduced in coinfected animals, compared with those infected with pneumococcus alone. Pneumococci were present within surface-attached biofilms in coinfected animals, and a greater proportion of translucent colony type was observed in the coinfected animals. Because this colony type has been associated with pneumococcal biofilms, the impact of coinfection on pneumococcal biofilm formation was investigated. The results clearly show enhanced biofilm formation in vitro by pneumococci in the presence of H. influenzae. Based on these data, we conclude that coinfection with H. influenzae facilitates pneumococcal biofilm formation and persistence on the middle ear mucosal surface. This enhanced biofilm persistence correlates with delayed emergence of opaque colony variants within the bacterial population and a resulting decrease in systemic infection.

  5. Impact of 10-valent pneumococcal conjugate vaccine on pneumococcal meningitis in children up to two years of age in Brazil

    Directory of Open Access Journals (Sweden)

    Indianara Maria Grando

    2015-02-01

    Full Text Available The objective of this study was to analyze the impact of vaccination against Streptococcus pneumoniae on the morbidity and mortality from pneumococcal meningitis in children ≤ 2 years in Brazil, from 2007 to 2012. This is a descriptive study and ecological analysis using data from the Information System on Notifiable Diseases. Pre-vaccination (2007-2009 and post-vaccination (2011-2012 periods were defined to compare incidence rates and mortality. A total of 1,311 cases and 430 deaths were reported during the study period. Incidence decreased from 3.70/100,000 in 2007 to 1.84/100,000 in 2012, and mortality decreased from 1.30/100,000 to 0.40/100,000, or 50% and 69% respectively, with the greatest impact in the 6-11 month age group. This decrease in Pneumococcal meningitis morbidity and mortality rates two years after introduction of the 10-valent pneumococcal conjugate vaccine suggests its effectiveness.

  6. Genetic Variation in NFKBIE Is Associated With Increased Risk of Pneumococcal Meningitis in Children

    DEFF Research Database (Denmark)

    Lundbo, Lene F; Harboe, Zitta Barrella; Clausen, Louise N

    2016-01-01

    NFKBIA, NFKBIE and NFKBIZ. We aimed to replicate previous findings of genetic variation associated with invasive pneumococcal disease (IPD), and to assess whether similar associations could be found in invasive meningococcal disease (IMD). METHODS: Cases with IPD and IMD and controls were identified......BACKGROUND: Streptococcus pneumoniae and Neisseria meningitidis are frequent pathogens in life-threatening infections. Genetic variation in the immune system may predispose to these infections. Nuclear factor-κB is a key component of the TLR-pathway, controlled by inhibitors, encoded by the genes.......86-1.35). The remaining SNPs were not associated with susceptibility to invasive disease. None of the SNPs were associated with risk of IMD or mortality. CONCLUSIONS: A NFKBIE polymorphism was associated with increased risk of pneumococcal meningitis....

  7. Cloning, expression, purification, crystallization and preliminary X-ray analysis of the pilus-associated sortase C from Streptococcus pneumoniae

    International Nuclear Information System (INIS)