Post-irradiation treatment with OK432 can prevent radiation-induced bone marrow death

International Nuclear Information System (INIS)

Kurishita, A.; Uehara, Y.; Tohoku Univ., Sendai; Katoh, H.; Hirose, S.; Uchida, A.; Mizutani, Y.; Okada, S.; Ono, T.

1991-01-01

The radioprotective effect of OK432, a Streptocuccus haemolyticus preparation, on bone marrow death was examined in mice. The LD 50 value was increased from 7.55 Gy in controls to 8.45 Gy in mice treated once with OK432 immediately after irradiation. Multiple administration of the agent further elevated the LD 50 value to 9.56 Gy. The radioprotective effect was also apparent when multiple treatments were commenced as late as 72 h after irradiation. (author)

Effect of soluble factors derived from oral cancer cells on the production of interferon-γ from peripheral blood mononuclear cells following stimulation with OK-432.

Science.gov (United States)

Ohe, Go; Sasai, Akiko; Uchida, Daisuke; Tamatani, Tetsuya; Nagai, Hirokazu; Miyamoto, Youji

2013-08-01

The streptococcal antitumor agent OK-432 is commonly used as an immunopotentiator for immunotherapy in various types of malignant tumors including oral cancer. It has been demonstrated that OK-432 elicits an antitumor effect by stimulating immunocompetent cells, thereby inducing multiple cytokines including interferon (IFN)-γ, interleukin (IL)-2 and IL-12. Serum concentrations of IFN-γ in patients with oral cancer were examined 24 h after administration of OK-432. Serum concentrations of IFN-γ in patients with advanced cancer were significantly lower than those in patients with early cancer. These results suggested that some soluble factors produced by cancer cells may inhibit IFN-γ production with OK-432. Thus, in the present study, an in vitro simulation model was established for the immune status of patients with oral cancer by adding conditioned medium (CM) derived from oral cancer cell lines into a culture of peripheral blood mononuclear cells (PBMCs) derived from a healthy volunteer. We investigated whether soluble factors derived from oral cancer cells affected IFN-γ production from PBMCs following stimulation with OK-432. PBMCs stimulated with OK-432 produced a large amount of IFN-γ; however, both IFN-γ production and cytotoxic activity from PBMCs induced by OK-432 were inhibited by the addition of CM in a dose-dependent manner. In order to examine these inhibitory effects against IFN-γ production, the contribution of inhibitory cytokines such as IL-4, IL-6, IL-10, transforming growth factor-β and vascular endothelial growth factor was investigated. However, neutralization of these inhibitory cytokines did not recover IFN-γ production inhibited by CM. These results indicated that unknown molecules may inhibit IFN-γ production from PBMCs following stimulation with OK-432.

The effect of OK-432 (Picibanil) injection on the histopathology of nasal turbinate.

Science.gov (United States)

Sengul, S; Kaygusuz, I; Akin, M M; Yalcin, Ş; Karlidag, T; Keles, E; Arslan, I

2015-12-01

This study aimed to assess the histopathological effect of OK-432 (Picibanil) on rabbit nasal turbinates. A total of 21 rabbits were divided into 3 treatment groups and various parts of both nasal turbinates were injected with 0.5 ml OK-432, 0.2 ml OK-432 or 0.6 ml saline (control). Bilateral nasal turbinates were later excised and studied under light microscopy to assess any histopathological changes. Animals in the 0.2 ml and 0.5 ml OK-432 groups exhibited mild ciliary loss, goblet cell loss and epithelial damage, and a marked increase in inflammatory cell infiltration, submucosal vascularisation and fibrosis. There was a significant difference in histopathological changes between the two OK-432 treated groups. In addition, each OK-432 treated group had significantly more inflammatory cell infiltration, increased submucosal vascularisation and fibrosis compared with controls. The marked fibrosis observed in OK-432-injected turbinates may be responsible for a reduction in turbinate size.

The prognostic advantage of preoperative intratumoral injection of OK-432 for gastric cancer patients

Science.gov (United States)

Gochi, A; Orita, K; Fuchimoto, S; Tanaka, N; Ogawa, N

2001-01-01

To investigate, by a multi-institutional randomized trial, the prognostic significance of the augmentation of tumour-infiltrating lymphocytes (TILs) by preoperative intratumoral injection of OK-432 (OK-432 it), a bacterial biological response modifier, in patients with gastric cancer. The 10-year survival and disease-free survival were examined and analysis of the factors showing survival benefit was performed. 370 patients who had undergone curative resection of gastric cancer were enrolled in this study and followed up for 10 years postoperatively. Patients were randomized into either an OK-432 it group or a control group. Ten Klinishe Einheit (KE) of OK-432 was endoscopically injected at 1 to 2 weeks before the operation in the OK-432 it group. Both groups received the same adjuvant chemoimmunotherapy consisting of a bolus injection of mitomycin C (0.4 mg kg−1i.v.) and administration of tegafur and OK-432 from postoperative day 14 up to 1 year later. Tegafur (600 mg day−1) was given orally and OK-432 (5 KE/2 weeks) was injected intradermally for a maintenance therapy. The TILs grades in resected tumour specimens and presence of metastasis and metastatic pattern in dissected lymph nodes were examined. Multivariate analysis was performed to determine the efficacy of OK-432 it on prognostic factors. All patients were followed up for 10 years. The overall 5- and 10-year survival rates and disease-free survival rates of the OK-432 it group were not significantly higher than those of the control group. However, OK-432 it significantly increased the 5- and 10-year survival rates of patients with stage IIIA + IIIB, moderate lymph node metastasis (pN2), and positive TILs. OK-432 it was most effective at prolonging the survival of patients who had both positive TILs and lymph node metastasis. The OK-432 it group with positive TILs showed a significant decrease in metastatic lymph node frequency and in the number of lymph node micro- metastatic foci when compared to

OK-432 as a sclerosing agent to treat wound-healing impairment.

Science.gov (United States)

Fasching, G; Sinzig, M

2007-12-01

We report on the application of OK-432 (picibanil) in a patient with prolonged wound healing impairment. A 13-year-old girl had suffered a polytrauma with a displaced fracture of the sacrum which required neurosurgical decompression of the sacral plexus. Postoperatively, a seroma with recurrent fistulation was seen. Excision of the wound, prolonged suction drainage and the instillation of hypertonic glucose solution did not have any effect over a period of four months postoperatively. Relying on our personal experience of the treatment of lymphangiomas using OK-432 we instilled OK-432 into the wound. Leakage stopped immediately, there was a regression of fluid accumulation and four weeks later the ultrasound examination was normal. The patient is still asymptomatic four years after treatment. OK-432 can be used effectively for the treatment of chronic wound healing impairment.

Acute behavioral effects of intrapleural OK-432 (Picibanil) administration in preterm fetal sheep.

Science.gov (United States)

Cowie, Rosalind V; Stone, Peter R; Parry, Emma; Jensen, Ellen C; Gunn, Alistair J; Bennet, Laura

2009-01-01

To develop a model to study the fetal effects of intrapleural infusion of OK-432 (Picibanil), a pleurodesis agent derived from killed Gram-positive streptococci. OK-432 (0.1 mg, n = 5), or normal saline (n = 5) were infused over 20 min into the pleural space of chronically instrumented preterm fetal sheep at 0.7 gestation. Fetal physiological parameters, including breathing and nuchal activity were monitored in utero from 6 h before infusion until 12 h afterward, and fetuses were killed after 7 days recovery. OK-432 was associated with transient suppression of fetal EEG activity, breathing and body movements from 3-6 h after infusion. Hypotension and hypoxia did not occur. At postmortem, local pleural adhesions were seen around the site of OK-432 infusion but not in saline treated fetuses. Intrapleural administration of OK-432 is associated with marked but transient fetal behavioral effects. This model will enable preclinical investigation of the neural and cardiovascular safety of OK-432 at a clinical relevant stage of development. Copyright 2009 S. Karger AG, Basel.

Whole abdominal irradiation for ovarian cancer in combined treatment with OK-432 picibanil

International Nuclear Information System (INIS)

Morita, Shinroku; Arai, Tatsuo; Tsunemoto, Hiroshi

1986-01-01

One hundred seventeen patients with postoperative ovarian cancer who were treated with whole abdominal irradiation by the open-field technique were analyzed as to the effectiveness of combined therapy with or without OK-432. OK-432, 0.2 to 2.0 (KE) (kev) daily, has been used to prevent bone marrow suppression since 1978 at NIRS. Cumulative five-year survival rates were 63.6 % in the OK-432 group (37 patients) and 54.5 % in the NON-OK-432 group (34 patients). The complete rates of previously arranged treatment schedules were 81 % and 66 % in the two groups, respectively, as we originally intended. (author)

[Treatment of lymphangioma with OK-432 infiltration].

Science.gov (United States)

Rodríguez, J; Cáceres, F; Vargas, P

2012-10-01

The management of lymphangioma using sclerotherapy has proven to be an effective therapeutic. Our aim was to evaluate the therapeutic efficacy of OK-432 (Picibanil) in patients with lymphagioma. The study was performed from November 2010 to July 2011. Fifteen patients of both genders were diagnosed with lymphangioma, 12 days to 12 years old. All patients were infiltrated with OK-432. The studied variables were: previous surgery, localization, type of lymphangioma, number of effective injections, reduction of mass valued as excellent (100% reduction), good (reduction > 50%) and bad (reduction < 50%), presence of recurrence and complications. 40% of pacients had prior surgery and 53.3% were located in the cervical-face region. The type of macrocystic lymphangioma was present in 40% of the series, mixed type in 46.6% and microcystic type in 13.4%. The number of effective infiltrations were 3. In 6 cases (40%) the result was excellent in 5 cases (33.4%) the result was good and in 4 cases (26.6%). We had 1 recurrence (6.6%) and we haven't had complications. Injection of OK-432 in macrocystic lymphangioma and mixed had a safe therapeutic modality with satisfactory results. So it is a valid alternative to conventional surgery.

Inhibitory effects of OK-432 (Picibanil) on cellular proliferation and adhesive capacity of breast carcinoma cells.

Science.gov (United States)

Horii, Yoshio; Iino, Yuichi; Maemura, Michio; Horiguchi, Jun; Morishita, Yasuo

2005-02-01

We investigated the potent inhibitory effects of OK-432 (Picibanil) on both cellular adhesion and cell proliferation of estrogen-dependent (MCF-7) or estrogen-independent (MDA-MB-231) breast carcinoma cells. Cellular proliferation of both MCF-7 and MDA-MB-231 cells was markedly inhibited in a dose-dependent manner, when the carcinoma cells were exposed to OK-432. Cell attachment assay demonstrated that incubation with OK-432 for 24 h reduced integrin-mediated cellular adhesion of both cell types. However, fluorescence activated cell sorter (FACS) analysis revealed that incubation with OK-432 for 24 h did not decrease the cell surface expressions of any integrins. These results suggest that the binding avidity of integrins is reduced by OK-432 without alteration of the integrin expression. We conclude that OK-432 inhibits integrin-mediated cellular adhesion as well as cell proliferation of breast carcinoma cells regardless of estrogen-dependence, and that these actions of OK-432 contribute to prevention or inhibition of breast carcinoma invasion and metastasis.

Efficacy and safety of OK-432 immunotherapy of lymphatic malformations.

Science.gov (United States)

Smith, Mark C; Zimmerman, M Bridget; Burke, Diane K; Bauman, Nancy M; Sato, Yutaka; Smith, Richard J H

2009-01-01

To determine the efficacy and safety of the immunostimulant OK-432 (Picibanil) as a treatment option in the management of children with cervicofacial lymphatic malformations. A prospective, randomized, multi-institutional phase II clinical trial at 27 U.S. academic medical centers. 182 patients with lymphatic malformations (LM) were enrolled between January 1998 and November 2004. Of the 151 patients with complete case report forms, 117 patients were randomized into immediate or delayed treatment groups; 34 patients were nonrandomized and assigned to the open-label group. Treatment consisted of a four-dose intralesional injection series of OK-432 at eight-week intervals. Patients randomized into the delayed treatment group served as observational controls for spontaneous regression. Response to therapy was measured radiographically by quantitating change in lesion size and graded as complete (90%-100%), substantial (60%-89%), intermediate (20%-59%), or none (<20%). Of 117 patients randomized with intent-to-treat, 68% demonstrated a complete or substantial response to OK-432 immunotherapy. Response data for macrocystic LM were higher, with a complete or substantial response in 94% of patients; 63% of patients with mixed macrocystic-microcystic LM responded to treatment; no patients with microcystic LM responded to treatment. Spontaneous resolution occurred in less than 2% of patients. Median follow-up of 2.9 years demonstrated a 9% recurrence rate. Major adverse effects related to therapy occurred in 11 patients. As compared to historical surgical data on LM, OK-432 immunotherapy is more effective (P < .001) and has a lower morbidity (P < .001). OK-432 immunotherapy is an effective, safe, and simple treatment option for the management of macrocystic cervicofacial LM. ClinicalTrials.gov Identifier: NCT00010452.

OK-432 sclerotherapy of cervical chylous lymphocele after neck dissection.

Science.gov (United States)

Roh, Jong-Lyel; Park, Chan Il

2008-06-01

Postoperative cervical chylous lymphoceles are extremely rare circumscribed collections of lymph which are usually treated by drainage or surgical exploration, but rarely by sclerotherapy. We investigated the efficacy of OK-432 (Picibanil, Chungai Pharmaceutical Co., Tokyo, Japan) sclerotherapy in the treatment of cervical lymphocele after neck dissection. Four patients with postoperative lymphocele who could not be cured by repeated percutaneous needle aspiration and pressure dressing were treated with intralesional injection of 0.1-0.2 mg OK-432 after aspiration of fluid. The aspirated fluid was assessed biochemically and cytologically, and regular palpation and ultrasonography/computed tomography were used to evaluate outcomes and recurrences. Two patients with chyle leak during neck dissection had lymphoceles in the left supraclavicular region 3 weeks later. The other two patients had lymphoceles on the right neck 9 and 12 months, respectively, after neck dissection. All aspirated fluids were chylous in origin without tumor cells. OK-432 sclerotherapy scored all four lesions with no major complications except for fever and local pain for several days. No lymphocele recurrences or metastatic cancers were observed in any patient for >1 year after sclerotherapy. Intralesional injection of OK-432 may be a safe and effective alternative to surgical exploration in the treatment of cervical lymphocele after neck dissection.

Combination therapy with radiation and OK-432 immunotherapy of cancer patients

International Nuclear Information System (INIS)

Hashimoto, Shozo; Miyamoto, Hiroshi

1978-01-01

We treated cancer patients with radiotherapy alone and with radiation plus immunotherapy at the Department of Radiology, Keio University Hospital. In all of the cancer patients who had radiationtherapy alone, a general depression in their immune reactivity was seen, but not seen in those who received radiationtherapy plus immunotherapy. Immunotherapy is defined as a stimulator of cancer patient's immune reaction. Usually radiationtherapy caused lymphopenia in which mainly T lymphocytes were decreased in number selectively, but there was no lymphopenia in cases treated with immunotherapy. We have performed nonspecific immunotherapy with OK-432. The result indicated that T lymphocytes were increased by OK-432 in spite of radiationtherapy. From this fact, OK-432 will be useful for suppression of metastasis and regression of tumors. (auth.)

Alleviating action of OK-432 (Picibanil) on the myelosuppression in medulloblastoma patients induced by whole axis irradiation

International Nuclear Information System (INIS)

Aoki, Yoshiro

1982-01-01

The test subjects termed as OK-432 group which consist of 4 patients of Medulloblastoma and 2 of Pinealoma, underwent the whole axis irradiation in combination with OK-432. The control group consisting of 9 Medulloblastoma patients was subjected to the same radiation treatment without OK-432. Six of the nine patients (66.7%) irradiated showed the decrease of peripheral white blood cell counts down to 2,500, whereas, only two of six patients showed a similar decrement in OK-432 group. Three of the nine patients (33.3%) in the control group showed the decrease of white blood cell down to 2,000, but only one of the six patients in OK-432 group. The neutrophil counts decreased below the level of 1,000 in three of the nine patients (33.3%) in the control group, but none in the OK-432 group. The platelet counts decreased below the level of 100,000 in five of the nine patients (55.6%) in the control group during the irradiation period, but only one patient in the OK-432 group showed a decrease down to 100,000 counts. Three of the nine patients (33.3%) in the control group had to be stopped irradiation due to the severe leukopenia and thrombocytopenia, in contrast to the OK-432 group, which completed whole axis irradiation without interruption. These results seem to indicate that OK-432 alleviated the myelosuppression induced in patients by whole axis irradiation. This alleviating action of OK-432 is considered to be applicable to the treatment of Medulloblastoma patients. (J.P.N.)

Alleviating action of OK-432 (Picibanil) on the myelosuppression in Medulloblastoma patients induced by whole axis irradiation

Energy Technology Data Exchange (ETDEWEB)

Aoki, Yoshiro (National Inst. of Radiological Sciences, Chiba (Japan))

1982-11-01

The test subjects termed as OK-432 group which consist of 4 patients of Medulloblastoma and 2 of Pinealoma, underwent the whole axis irradiation in combination with OK-432. The control group consisting of 9 Medulloblastoma patients was subjected to the same radiation treatment without OK-432. Six of the nine patients (66.7%) irradiated showed the decrease of peripheral white blood cell counts down to 2,500, whereas, only two of six patients showed a similar decrement in OK-432 group. Three of the nine patients (33.3%) in the control group showed the decrease of white blood cell down to 2,000, but only one of the six patients in OK-432 group. The neutrophil counts decreased below the level of 1,000 in three of the nine patients (33.3%) in the control group, but none in the OK-432 group. The platelet counts decreased below the level of 100,000 in five of the nine patients (55.6%) in the control group during the irradiation period, but only one patient in the OK-432 group showed a decrease down to 100,000 counts. Three of the nine patients (33.3%) in the control group had to be stopped irradiation due to the severe leukopenia and thrombocytopenia, in contrast to the OK-432 group, which completed whole axis irradiation without interruption. These results seem to indicate that OK-432 alleviated the myelosuppression induced in patients by whole axis irradiation. This alleviating action of OK-432 is considered to be applicable to the treatment of Medulloblastoma patients.

OK-432 sclerotherapy for benign cystic head and neck lesions

International Nuclear Information System (INIS)

Kim, Chang Hyun; Rho, Myung Ho; Lee, Sang Wook

2003-01-01

To evaluate the efficacy of OK-432 solution for slerotheraphy of cystic lesions of the head and neck. Nineteen cystic lesions comprising ten plunging ranulas, three simple ranulas, three cystic lymphangiomas, one first branchial cleft cyst and two unknown supraclavicular cysts considered to be lymphangiomas were treated by sucking out as much liquid content as possible and then injecting the same volume of OK-432 solution under ultrasound guidance. Patients were followed up clinically and radiologically. Follow-up sonography or CT- performed after a mean interval of nine months showed total or near-total shrinkage of four plunging ranulas. However, six such lesions recurred in spite of more than one (mean, two) sclerotherapy sessions. In cases involving two simple ranulas at the floor of the mouth, failure resulted from extracystic leakage of OK-432 solution via the puncture site. Two unilocular cystic lymphangiomas completely regressed during the follow-up period (mean, seven months), but the multiocular type showed a 65% volume reduction after 12 months. A first branchial cleft cyst was markedly reduced in size, with only a small cystic portion remaining after eight months, follow-up. Two supraclavicular cysts with straw-color fluid did not respond to sclerotherapy. OK-432 sclerotherapy of macrocystic lymphangiomas is an effective and promising alternative to surgery. For other cysts, however, including plunging ranula, efficacy, varied, and 64% of such lesions recurred

OK-432 sclerotherapy for benign cystic head and neck lesions

Energy Technology Data Exchange (ETDEWEB)

Kim, Chang Hyun; Rho, Myung Ho; Lee, Sang Wook [Masan Samsung Hospital, Masan (Korea, Republic of)

2003-12-01

To evaluate the efficacy of OK-432 solution for slerotheraphy of cystic lesions of the head and neck. Nineteen cystic lesions comprising ten plunging ranulas, three simple ranulas, three cystic lymphangiomas, one first branchial cleft cyst and two unknown supraclavicular cysts considered to be lymphangiomas were treated by sucking out as much liquid content as possible and then injecting the same volume of OK-432 solution under ultrasound guidance. Patients were followed up clinically and radiologically. Follow-up sonography or CT- performed after a mean interval of nine months showed total or near-total shrinkage of four plunging ranulas. However, six such lesions recurred in spite of more than one (mean, two) sclerotherapy sessions. In cases involving two simple ranulas at the floor of the mouth, failure resulted from extracystic leakage of OK-432 solution via the puncture site. Two unilocular cystic lymphangiomas completely regressed during the follow-up period (mean, seven months), but the multiocular type showed a 65% volume reduction after 12 months. A first branchial cleft cyst was markedly reduced in size, with only a small cystic portion remaining after eight months, follow-up. Two supraclavicular cysts with straw-color fluid did not respond to sclerotherapy. OK-432 sclerotherapy of macrocystic lymphangiomas is an effective and promising alternative to surgery. For other cysts, however, including plunging ranula, efficacy, varied, and 64% of such lesions recurred.

The therapeutic effect of OK-432 (picibanil) sclerotherapy for benign neck cysts.

Science.gov (United States)

Kim, Myung Gu; Kim, Sun Gon; Lee, Jun Ho; Eun, Young Gyu; Yeo, Seung Geun

2008-12-01

In general, benign neck cysts are treated by surgical excision. This can present technical difficulties and frequent recurrences, because of insufficient surgery. Sclerosing agents such as OK-432 have been tested for the nonsurgical treatment of these cysts. We have assessed the efficacy of OK-432 sclerotherapy for benign neck cysts. The study group consisted of 75 patients (42 men, 33 women) diagnosed with and treated for benign neck cysts between March 2001 and December 2007 by intralesional injection of OK-432. The liquid content of each cyst was aspirated as much as possible, and the same volume of OK-432 solution was injected. Patients were assessed by ultrasonography or computerized tomography, and therapeutic outcomes and adverse effects were evaluated by patient age, sex, cyst type, and number of injections. Of the 75 treated patients, 31 (41.3%) showed total shrinkage, seven (9.3%) showed near-total shrinkage (>90% of cyst volume), five (6.6%) showed marked shrinkage (>70% of cyst volume), and 17 (22.7%) showed partial shrinkage (<70% of cyst volume). No response was seen in 15 patients (20%). Despite repeated sclerotherapy, eight patients (10.7%) showed recurrences. Minor adverse effects of therapy included fever, localized pain, and odynophagia but these complications spontaneously disappeared within several days. OK-432 sclerotherapy is a safe and effective primary alternative to surgery in patients with benign neck cysts.

[Unsuccessful treatment with OK-432 picibanil for orbital lymphangioma].

Science.gov (United States)

Lanuza García, A; Bañón Navarro, R; Llorca Cardeñosa, A; Delgado Navarro, C

2012-01-01

Lymphangioma is a malformation of the lymphatic system. The classic approach is surgery. We report a case of orbital lymphangioma in a girl who was given OK-432 to avoid surgery and its complications. OK-432 is a lyophilized mixture of group A Streptococcus pyogenes which produces a fibrosis limited to the lesion with a high cure rate. The main advantages are the easy intra-lesional application. with no scars and or damage of closed areas. Its main disadvantage is a significant local inflammatory reaction. Copyright © 2011 Sociedad Española de Oftalmología. Published by Elsevier Espana. All rights reserved.

Effect of concomitant use of immunomodulator (OK-432 and/or PSK) on primary lung cancer (stages III, IV) treated with radiation combined with chemotherapy

International Nuclear Information System (INIS)

Kimura, S.; Ogawa, Y.; Imajo, Y.

1982-01-01

OK-432 (a lyophilized preparation of a low virulent strain, Su, of Streptococcus hemolytics (Group A) treated with penicillin G) and/or PSK (a protein-bound polysaccharide prepared from Coriolus versicolor) as an immunomodulator was administered to 209 patients of advanced lung cancer treated with radiation with combined chemotherapy. Their effects on immunological parameters and patients' survival periods were examined. Suppression of both PHA (phytohemagglutinin) skin test activities and lymphocyte blastoid transformation with PHA were reduced in the immunomodulator administered group compared with the non-administered group. Survival curves were evaluated between the patients with OK-432 and/or PSK and those without immunomodulator. It was suggested that OK-432 and/or PSK combined with radiation with combined chemotherapy was effective for the elongation of the survival period. These results indicated that the long-term administration of OK-432 and/or PSK was recommended for patients with advanced lung cancer. (author)

Primary treatment of pediatric plunging ranula with nonsurgical sclerotherapy using OK-432 (Picibanil).

Science.gov (United States)

Roh, Jong-Lyel; Kim, Hyo Sun

2008-09-01

Although surgery is the first choice of therapy for plunging ranula, it is associated with technical difficulties, morbidity and recurrence. Plunging ranula may be also primarily treated with nonsurgical sclerotherapy, but there is little experience in pediatric patients. We, therefore, assessed the efficacy of OK-432 sclerotherapy for pediatric plunging ranula. Nine children with plunging ranula were prospectively treated with intracystic injections of OK-432. At the outpatient clinic, the ranula was punctured in the neck and aspirated mucus was replaced with 0.1-0.2mg OK-432 solution. The size of the ranula was compared before and after sclerotherapy. Total or nearly total shrinkage was observed in 6 of 9 patients; marked reduction (>50% of original size) in 2; and partial reduction (<50% of original size) in 1. At a mean follow-up of 26 months after last sclerotherapy, recurrence was observed in only 1 patient; this patient showed complete response after reinjection of OK-432 solution. No significant complications were observed, with only fever and mild local pain observed in 4 patients for 2-4 days after treatment. OK-432 sclerotherapy is safe and effective in the treatment of pediatric plunging ranula. Sclerotherapy may become a primary treatment modality prior to surgery.

Treatment of lymphatic malformations of head and neck with OK-432 sclerotherapy induce systemic inflammatory response.

Science.gov (United States)

Närkiö-Mäkelä, Mervi; Mäkelä, Teppo; Saarinen, Pia; Salminen, Päivi; Julkunen, Ilkka; Pitkäranta, Anne

2011-01-01

Systemic immune responses after OK-432 (Picibanil) sclerotherapy in patients with head and neck lymphatic malformations (LM) were examined to achieve a better understanding of the mechanism of OK-432 sclerotherapy and to evaluate the long-term treatment outcome. Serum samples from 17 consecutive patients with head and neck LMs were collected during a total of 26 OK-432 treatment episodes. Serum C-reactive protein (CRP), interleukins (IL) 1β, 6, 8, 10, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, RANTES, immune protein (IP)-10 and macrophage chemoattractant protein (MCP)-1 as well as blood leukocyte counts were determined. Clinical outcome of the treatment was evaluated at the last visit and from patient files. Elevated serum levels of IP-10 (means at baseline 702 ng/L, after 1 day 1180 ng/L, after 4 weeks 691 ng/L) were seen on day one after OK-432 sclerotherapy (p < 0.05). C-reactive protein and leukocyte counts 1 day after treatment differed statistically significantly (p < 0.05) from the baseline. No significant differences with other cytokines investigated were observed. Patients with macrocystic LM responded better than patients with microcystic LM (p = 0.01). The elevated levels of IP-10, C-reactive protein and leukocyte levels indicate that OK-432 sclerotherapy induces systemic immune responses in patients with LM. The mechanisms of OK-432 sclerotherapy are still not precisely understood, but the IP-10 elevation may reflect local antiangiogenetic properties of immunoactivation induced by OK-432.

Treatment of lymphatic malformations with OK-432 (Picibanil): review of the literature.

Science.gov (United States)

Poldervaart, Michelle T; Breugem, Corstiaan C; Speleman, Lucienne; Pasmans, Suzanne

2009-07-01

Lymphatic malformations (LM) are benign structural defects that can cause serious complications because of their size and location. Traditionally, surgical removal was the first treatment modality, but this could be associated with many complications and risks. Since Ogita introduced OK-432 (picibanil) in 1987 as a treatment method, this sclerosant has become popular. This paper is a review of the trials published so far on this topic. A literature search of English trials with 5 or more patients in it with LM who had never been treated before was done. The paper had to use the microcystic-macrocystic classification and have a mean follow-up of more than a year to be included in this review. Results were classified as "excellent" when the lesions show a regression of more than 90%, "good" when regression is more than 50%, and "poor" when shrinkage is less than 50% (this also includes no response at all). Twenty-seven percent of microcystic LMs show an excellent result; 33%, a good result; and 40%, a poor result. Of the macrocystic LMs, 88% have excellent results. Recurrence rates vary from 5% to 8%. The adverse effects are mostly mild. Most trials have a short follow-up; therefore, there are uncertainties when it comes to cure and regression. Mostly, the adverse effects of OK-432 are trivial and disappear after a week, but the need for a temporary tracheostomy has been described. Screening for allergic reactions to penicilline is needed, with the risk of anaphylactic shock in mind. It is difficult to compare the different techniques used by the authors, and none of the trials included in this study are randomized controlled trials; most are retrospective and were so-called level 4 studies. This review demonstrates that OK-432 is an effective way to treat LM. Because of a possible risk of airway obstruction, treatment should always take place in specialized treatment facilities. Macrocystic lesions show a better response to OK-432 treatment than microcystic lesions

Evaluation of OK-432 Injection Therapy as Possible Primary Treatment of Intraoral Ranula.

Science.gov (United States)

Kono, Michihide; Satomi, Takafumi; Abukawa, Harutsugi; Hasegawa, On; Watanabe, Masato; Chikazu, Daichi

2017-02-01

A ranula is a pseudocyst caused by mucous extravasation from the sublingual gland. Recently, a sclerosing agent, OK-432 (picibanil), has been reported to be highly effective for treating lymphangioma and cervical cystic lesions. The present study assessed the effectiveness of OK-432 injection therapy for intraoral ranula to clarify whether it can be used as the primary treatment. The present study was a retrospective clinical study of patients with intraoral ranula who received OK-432 injection therapy from 2005 to 2015. The ranula size was measured on computed tomography or magnetic resonance imaging studies. We dissolved 1 Klinische Einheit (KE) unit of OK-432 powder in normal saline equal to the aspiration volume. The primary endpoint was the treatment results. The secondary endpoints were the relation between the treatment results and the lesion length and aspiration volume. A total of 23 patients received OK-432 injection therapy for an intraoral ranula. The mean lesion size was 19.96 mm. The mean aspiration volume was 2.14 mL. The number of injections was 1 to 4 (mean 1.70). The treatment results were complete regression (CR) in 18 (78.2%), partial regression (PR) in 3 (13.0%), and no response (NR) in 2 (8%) patients after the last injection. The overall efficacy rate was 91.2% (21 of 23). No serious complications were observed. The lesion length and aspiration volume of the CR group was 17.38 mm and 1.40 mL, respectively. The lesion length and aspiration volume of the PR/NR group was 29.20 mm and 4.80 mL, respectively. The PR/NR group lesions were significantly larger than the CR group lesions. OK-432 injection therapy for intraoral ranula is safe and effective compared with other surgical therapies. This therapy could potentially become a primary treatment of intraoral ranula. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

OK-432 reduces mortality and bacterial translocation in irradiated and granulocyte-colony stimulating factor (G-CSF)-treated mice

Energy Technology Data Exchange (ETDEWEB)

Nose, Masako; Uzawa, Akiko; Ogyu, Toshiaki [National Inst. of Radiological Sciences, Chiba (Japan); Suzuki, Gen

2001-06-01

Acute radiation induces bacterial translocation from the gut, followed by systemic infection and sepsis. In order to reduce the mortality after acute whole body irradiation, it is essential to control bacterial translocation. In this study, we established a bacterial translocation assay as a sensitive method to detect minor mucosal injury by radiation. By utilizing this assay, we evaluated the adverse effects, if any, of hematopoietic reagents on the mucosal integrity in the respiratory and gastro-intestinal tracts. Bacterial translocation to the liver and spleen occurred after whole-body irradiation if the dose exceeded 6 Gy. The administration of G-CSF unexpectedly increased the bacterial translocation in 8 Gy-irradiated mice. The pharmaceutical preparation of low-virulent Streptococcus pyogenes, OK-432, significantly reduced the endotoxin levels in peripheral blood without any reduction of bacterial translocation. A combined treatment with G-CSF and OK-432 decreased bacterial translocation and prevented death. This result indicates that the early administration of G-CSF has an adverse effect on bacterial translocation, and that a combined treatment of G-CSF and OK-432 attenuates the adverse effect of G-CSF and improves the survival rate after acute irradiation. (author)

[Effect of intravenous treatment with OK-432 on the bone marrow in patients with lung cancer].

Science.gov (United States)

Fujii, M; Ishikawa, M; Toki, H

1984-03-01

We studied effects of OK-432 on the bone marrow and peripheral blood cells of lung cancer patients. The nuclear cell count of bone marrow increased in 5 to 7 patients upon intravenous treatment with OK-432 compared with 3 of 6 patients who were intramuscularly treated with OK-432. Serial neutrophil counts of bone marrow increased in all 7 patients treated intravenously compared with 3 of 6 patients treated intramuscularly. The mean nuclear cell count or the serial neutrophil count of bone marrow in intravenously treated patients was significantly higher than the pretreatment values (p less than 0.001). In the peripheral blood picture, the difference in white blood cells or neutrophils before and after intravenous treatment was also statistically significant (p less than 0.01). There was no change in the erythrocytic series count of bone marrow and the hemoglobin count. Our results support the superiority of intravenous OK-432 treatment over intramuscular treatment in the growth-accelerating effect on bone marrow cells, especially regarding the neutrophil series.

Randomized controlled study on the effect of adjuvant immunotherapy with OK-432 on malignant gliomas

International Nuclear Information System (INIS)

Shibata, Shobu; Mori, Kazuo; Moriyama, Tadayoshi; Tanaka, Keisei; Moroki, Jiro.

1985-01-01

During periods from January, 1981 to December, 1983, 51 patients (31 malignant astrocytomas, 17 glioblastomas, and others 3) were treated with radiochemotherapy using Nimustine hydrochloride, ACNU (group B) and radiochemoimmunotherapy with Picibanil, OK-432 (group A) by randomized controlled study. Group A consisted of 24 patients and group B of 27 patients. The differences in the background of the two groups were not statistically significant. Survival curves of both groups were shown by the Kaplan-Meier method. The postoperative survival rate at 1 year and 2 years were 70 % and 30 %, respectively, equal in both groups, and the differences between groups A and B were not statistically significant by the Cox-Mantel test. The side effects by group B therapy were most prominent in the bone marrow, and severe leukopenia occurred. However, group A therapy suppressed leukopenia after 2 months. Immunological parameters, such as purified protein derivative skin reaction test did not change, but streptococcal Su-polysaccharide skin reaction test became positive after group A therapy. (author)

Treatment of lymphangiomas with OK-432 (Picibanil) sclerotherapy: a prospective multi-institutional trial.

Science.gov (United States)

Giguère, Chantal M; Bauman, Nancy M; Sato, Yutaka; Burke, Diane K; Greinwald, John H; Pransky, Seth; Kelley, Peggy; Georgeson, Keith; Smith, Richard J H

2002-10-01

To describe and to determine the robustness of our study evaluating the efficacy of OK-432 (Picibanil) as a therapeutic modality for lymphangiomas. Prospective, randomized trial and parallel-case series at 13 US tertiary care referral centers. Thirty patients diagnosed as having lymphangioma. Ages in 25 ranged from 6 months to 18 years. Twenty-nine had lesions located in the head-and-neck area. Every patient received a 4-dose injection series of OK-432 scheduled 6 to 8 weeks apart unless a contraindication existed or a complete response was observed before completion of all injections. A control group was observed for 6 months. Successful outcome of therapy was defined as a complete or a substantial (>60%) reduction in lymphangioma size as determined by calculated lesion volumes on computed tomographic or magnetic resonance imaging scans. Overall, 19 (86%) of the 22 patients with predominantly macrocystic lymphangiomas had a successful outcome. OK-432 should be efficacious in the treatment of lymphangiomas. Our study design is well structured to clearly define the role of this treatment agent.

Treatment of Primary Fetal Hydrothorax with OK-432 (Picibanil): Outcome in 14 Fetuses and a Review of the Literature.

Science.gov (United States)

O'Brien, Brooke; Kesby, Greg; Ogle, Robert; Rieger, Ingrid; Hyett, Jon A

2015-01-01

Primary fetal hydrothorax (PFHT) is an uncommon condition with an estimated prevalence of 1 in 10,000/15,000 pregnancies. Therapeutic interventions include thoracocentesis, thoraco-amniotic shunting (TAS), and pleurodesis using OK-432. A review of the literature was performed to identify all cases of PFHT treated with TAS and OK-432. All cases of PFHT referred to the Fetal Maternal Unit at Royal Prince Alfred Hospital between 2002 and 2012 were retrospectively reviewed. In the cohort of fetuses treated with OK-432, the main perinatal outcomes evaluated were termination of pregnancy, live birth, neonatal death, and fetal death in utero. Secondary outcomes included gestational age (GA) at diagnosis, GA at treatment, GA at resolution, birth weight, and GA at birth. The development of the children was screened using the Ages and Stages Questionnaires, Version 3 (ASQ-3, 2009). Primary hydrothorax was diagnosed in 31 fetuses, of which 14 had treatment with OK-432. One pregnancy terminated after treatment with OK-432. Survival was 85% (11/13): 100% in fetuses treated with OK-432 without hydrops, and 78% in those treated with hydrops. This compares well to the cases of TAS in the literature with an average survival of 63%: 85% in fetuses without hydrops and 55% with hydrops. The mean GA at birth was 36(+4) weeks and mean birth weight 3,007 g. Eight of the 9 children screened with ASQ-3 scored well within the normal range. OK-432 appears to be a valid treatment option in fetuses with PFHT, particularly in those diagnosed at early GAs. © 2014 S. Karger AG, Basel.

Experimental intraperitoneal infusion of OK-432 in rats: Evaluation of peritoneal complications and pathology

Energy Technology Data Exchange (ETDEWEB)

Kim, Dong Wook [Department of Radiology, Busan Paik Hospital, Inje University College of Medicine, Busan (Korea, Republic of); Kim, Hak Jin, E-mail: hakjink@pusan.ac.k [Department of Radiology, Pusan National University Hospital, Pusan National University College of Medicine, Medical Research Institute, Busan (Korea, Republic of); Lee, Jun Woo [Department of Radiology, Pusan National University Hospital, Pusan National University College of Medicine, Medical Research Institute, Busan (Korea, Republic of)

2010-06-15

Purpose: OK-432 is known to be a potent sclerosant of cystic lesions. The purpose of this study was to evaluate both its safety and pathologic effects after the infusion of OK-432 into the peritoneal cavity of rats. Materials and methods: Twenty male rats were used in this study. Twelve rats were infused intraperitoneally with 0.2 Klinishe Einheit of OK-432 melted in 2 mL of normal saline (group 1: the treated group); four rats each were infused intraperitoneally with 0.5 mL of 99% ethanol (group 2) and normal saline (group 3), and served as the control groups. An abdominal ultrasonographic examination was performed both before and after the infusions in all rats. Three rats in group 1 and one rat in each of groups 2 and 3 were sacrificed each week following the infusion. Gross and microscopic evaluations of the peritoneum and abdominal cavity were performed on each rat. Results: In group 1, the abdomen was clear on gross inspection and the peritoneum was unremarkable on microscopic examination. In group 2, mild-to-moderate peritoneal adhesions were revealed grossly, and inflammation and fibrosis of the peritoneum were demonstrated microscopically. In group 3, no specific abnormalities were noted on gross or microscopic examinations. Conclusion: Leakage or abnormal infusion of OK-432 solution into the peritoneal cavity during sclerotherapy of intra-abdominal or retroperitoneal cystic lesions does not result in any significant complications.

Experimental intraperitoneal infusion of OK-432 in rats: Evaluation of peritoneal complications and pathology

International Nuclear Information System (INIS)

Kim, Dong Wook; Kim, Hak Jin; Lee, Jun Woo

2010-01-01

Purpose: OK-432 is known to be a potent sclerosant of cystic lesions. The purpose of this study was to evaluate both its safety and pathologic effects after the infusion of OK-432 into the peritoneal cavity of rats. Materials and methods: Twenty male rats were used in this study. Twelve rats were infused intraperitoneally with 0.2 Klinishe Einheit of OK-432 melted in 2 mL of normal saline (group 1: the treated group); four rats each were infused intraperitoneally with 0.5 mL of 99% ethanol (group 2) and normal saline (group 3), and served as the control groups. An abdominal ultrasonographic examination was performed both before and after the infusions in all rats. Three rats in group 1 and one rat in each of groups 2 and 3 were sacrificed each week following the infusion. Gross and microscopic evaluations of the peritoneum and abdominal cavity were performed on each rat. Results: In group 1, the abdomen was clear on gross inspection and the peritoneum was unremarkable on microscopic examination. In group 2, mild-to-moderate peritoneal adhesions were revealed grossly, and inflammation and fibrosis of the peritoneum were demonstrated microscopically. In group 3, no specific abnormalities were noted on gross or microscopic examinations. Conclusion: Leakage or abnormal infusion of OK-432 solution into the peritoneal cavity during sclerotherapy of intra-abdominal or retroperitoneal cystic lesions does not result in any significant complications.

Modification of radiation therapy by RP-170, hypoxic cell sensitizer and OK-432, biological response modifier (BRM)

International Nuclear Information System (INIS)

Murayama, Chieko; Mori, Tomoyuki; Tamauchi, Hidekazu

1995-01-01

Studies have shown that the combination therapy with RP-170, irradiation and OK-432 could produce significantly higher antitumor effect. The multiple local administration of OK-432 showed superior sensitizing effect in tumor growth delay, tumor control and survival rate. DMF from TCD 50 assay was 2.09 which might be equivalent to that from irradiation with over several hundred mg/kg of RP-170. Additionally combined with 50 mg/kg RP-170, nearly available dose in clinical use, the combined treatment with RP-170, irradiation and OK-432 produced DMF of 1.4, which could be gotten by over 100 mg/kg of RP-170. The success of this combination therapy on murine tumors might also suggest a possibility for a great benefit in clinical radiotherapy. More detailed investigations, histological and immunological research, are under progress. 14 refs., 2 tabs., 3 figs

Sclerotherapy of cervical cysts with Picibanil (OK-432).

Science.gov (United States)

Knipping, Stephan; Goetze, Gerrit; Neumann, Kerstin; Bloching, Marc

2007-04-01

The effectiveness of intralesional sclerotherapy of lymphangiomas and ranulas with OK-432 (Picibanil) has been proved in several clinical studies. The aim of our study was to review the effectiveness of sclerotherapy of benign cervical cysts with Picibanil as an alternative method to surgical excision. Between March 2002 and March 2006, a prospective observational study was carried out to assess the effects of Picibanil on cervical cysts. Between 2002 and 2006 we treated 14 patients having cervical cysts through intralesional application of Picibanil with a dose of 0.01 mg/ml. So far we used Picibanil with 13 patients achieving a high success rate. In eight cases we observed, both clinically and ultrasonographically, a nearly complete regression, and a complete regression of the cysts in three cases. In two cases the cysts atrophied. In these cases only residual findings could be observed. In one case we extirpated the remaining cyst. If there is no clear reaction of the cyst to the treatment, an excision is indicated 6 weeks after the injections to gain meaningful histological examination. No significant complication after sclerotherapy with Picibanil was observed. According to our results the application of OK-432 (Picibanil) is a safe and effective primary method for sclerotherapy of benign cervical cysts which can replace surgical extirpation in special cases. However, the risk of malign diseases has to be excluded before the commencement of the Picibanil treatment.

Effect of Picibanil (OK 432) on the Scavenging Effect of Free Radicals Produced during Liver Regeneration in the Rat

OpenAIRE

Okamoto, Ko; Hamazaki, Keisuke; Iwagaki, Hiromi; Orita, Kunzo; Mori, Akitane

1995-01-01

We administered a biological response modifier Picibanil (OK-432), attenuated Streptococcus pyogenes, via the dorsal vein of the penis after 70% hepatectomy in rats, and clarified the scavenging effect of Picibanil on free radicals generated in the regenerating liver. A group of 5 rats was intravenously administered with 25 KE/kg of OK-432 after hepatectomy, while the control group was given saline after hepatectomy. Serum levels of aspartate aminotransferase and alanine aminotransferase and ...

Effect of concomitant use of immunomodulator (OK-432 and/or PSK) on advanced lung cancer (squamous cell carcinoma and adenocarcinoma) treated with radiation with combined chemotherapy

International Nuclear Information System (INIS)

Ogawa, Yasuhiro; Kimura, Shuji; Imajo, Yoshinari

1982-01-01

Between 1975 and 1979, 209 cases of primary lung cancer admitted to the department of radiology were treated with radiation with combined chemotherapy. OK-432 and/or PSK as an immunomodulator was administered to 130 of these cases, and survival curves were evaluated between the patients with OK-432 and/or PSK and those without immunomodulator. In 61 cases (squamous cell carcinoma and adenocarcinoma) in stage III (UICC, 1978), fifty percent survival period was found to be 12.5 months for 16 cases with OK-432, 13.5 months for 9 cases with OK-432 and PSK, 9.0 months for 18 cases with PSK, and 8.0 months for 18 cases without immunotherapy, respectively. (author)

Vaccination with OK-432 followed by TC-1 tumor lysate leads to significant antitumor effects.

Science.gov (United States)

Chen, I-Ju; Yen, Chih-Feng; Lin, Kun-Ju; Lee, Chyi-Long; Soong, Yung-Kuei; Lai, Chyong-Huey; Lin, Cheng-Tao

2011-07-01

Human papillomavirus (HPV) infects large numbers of women worldwide and is present in more than 99% of all cervical cancer. TC-1 cell is a cell line with high expression of E7 antigen of HPV type 16 and its cell lysate has been demonstrated as an ideal inducer of E7-specific, antitumor immunity. OK-432 (Picibanil), a penicillin-killed Streptococcus pyogenes, has been reported with potent immunomodulation properties in cancer treatment by stimulating the maturation of dendritic cells (DCs) and secretion of Th-1 type cytokines. The current study demonstrated that a protocol to immunize the C57BL/6 mice with OK-432 followed by treatment with TC-1 lysate can generate markedly increased immune responses of E7-specific CD4(+) T cells and a moderate increase of natural killer (NK) cell, as well as a satisfactorily protective and therapeutic antitumor effect by triggering the DCs to prime T cells. Depletion of lymphocyte subset in vivo suggested that the antitumor effects could be dominantly executed by CD8+ T cells and followed by NK cells, and both of these reactions were induced by the generation of robust E7-specific CD4(+) T helper cell response. These findings warrant OK-432 combination with tumor-lysate as an effective and safe vaccine in future clinical application of cervical cancer.

Percutaneous sclerotherapy of massive macrocystic lymphatic malformations of the face and neck using fibrin glue with OK-432 and bleomycin.

Science.gov (United States)

Chen, W-l; Huang, Z-q; Chai, Q; Zhang, D-m; Wang, Y-y; Wang, H-j; Wang, L; Fan, S

2011-06-01

Picibanil (OK-432) and bleomycin have been used as alternative sclerosing agents for lymphatic malformations. This study evaluated the clinical curative effect of sclerotherapy using fibrin glue combined with OK-432 and bleomycin for the treatment of macrocystic lymphatic malformations of the face and neck. Fifteen paediatric patients (6 males; 9 females, aged 13 months to 14 years) who had received percutaneous sclerotherapy for massive macrocystic lymphatic malformations of the face and neck were retrospectively reviewed. Affected regions included the neck, parotid region and parapharynx, mouth floor, face and cheek, and orbital regions. All patients showed preoperative symptoms of space-occupying lesions between 4 cm × 5 cm and 12 cm × 16 cm in size. Fibrin glue with OK-432 and bleomycin was injected under general anaesthesia. All patients received preoperative and follow-up CT scans. Outcomes were assessed by three surgeons. All patients exhibited mid-facial swelling for 3-4 weeks after surgery, but no major complications. Follow-up periods ranged from 8 to 16 months. Eight lesions were completely involuted, five were mostly involuted, and two were partially involuted. Percutaneous sclerotherapy using fibrin glue with OK-432 and bleomycin provided a simple, safe, and reliable alternative treatment for massive macrocystic lymphatic malformations of the face and neck. Copyright © 2011 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

O uso de Picibanil (OK-432 no tratamento do linfangioma de cabeça e pescoço

Directory of Open Access Journals (Sweden)

Mello-Filho Francisco V.

2002-01-01

Full Text Available Introdução e Objetivo: O Linfangioma Cérvico-Facial (LCF é geralmente um tumor volumoso, envolvendo estruturas importantes da face e do pescoço. A terapia habitualmente recomendada é a retirada cirúrgica, porém, esta é geralmente seguida de seqüelas importantes, causando deformidade da região. Com o objetivo de avaliarmos uma terapêutica alternativa, analisamos a eficiência do Picibanil (OK 432 no tratamento de LCF em crianças. Forma de Estudo: Clínico retrospectivo. Material e Método: Estudo retrospectivo de seis crianças com diagnóstico de LCF tratadas com OK-432 no HCFMRP-USP no período de 1997 a 2001. Foram analisadas as seguintes características dos LCF: dimensões, tipos de cistos e volume aspirado. Avaliamos, também, o número de aplicações de OK 432 com os respectivos intervalos de tempo utilizados, sua evolução, intercorrências e o resultado final do tratamento. Resultados: Os LCFs apresentavam de oito a 15cm em seu maior diâmetro, na ocasião da primeira consulta, sendo o tipo de cisto mais freqüentemente encontrado o tipo macro cisto. O volume de liquido aspirado variou de dois a 60 ml e o número de aplicações de uma a cinco vezes em intervalos variáveis de um mês a um ano. Em todos os pacientes ocorreu regressão da massa tumoral, sendo que em três houve o desaparecimento total do LCF. A única intercorrência observada foi febre em media de 38.2º C em todos pacientes. Conclusão: O OK 432 é uma droga segura, eficaz e que pode ser utilizada como medida de primeira escolha no tratamento do LCF.

Treatment of lymphangiomas of the head and neck in children by intralesional injection of OK-432 (Picibanil).

Science.gov (United States)

Brewis, C; Pracy, J P; Albert, D M

2000-04-01

The treatments previously used for lymphangiomas of the head and neck in children-surgery and intralesional injection of sclerosants-are associated with significant morbidity. A new treatment-intralesional injection of OK-432-was used for lymphangiomas of the head and neck in 11 children. The results were total shrinkage in two, marked shrinkage in two, slight shrinkage in five and no response in two. The results were not affected by previous surgery nor by whether aspiration prior to injection was possible. There were no recurrences in those children in whom shrinkage occurred and no child had subsequent surgery following injection. The results of this series support those of previous series showing that OK-432 injection is an effective and safe treatment for lymphangiomas of the head and neck in children.

Therapie einer postoperativ entstandenen zystischen Raumforderung mit Picibanil (OK-432): Ein Fallbericht

OpenAIRE

Schlüter, A; Weller, P; Mattheis, S; Lang, S

2014-01-01

Einleitung: Picibanil (=OK432) ist ein Lysat bestehend aus Penicillin G und mit H2O2 attenuiertem Streptococcus pyogenes. In den letzten Jahrzehnten wurde Picibanil zur Therapie von Pleuraergüssen, Lymphangiomen, Chylusfisteln, medianen Halszysten und Ranulae eingesetzt. Es verursacht eine Immunreaktion mit aseptischer Entzündung. Dies führt zu einer Zerstörung des Endothels und konsekutiv zu einer Verklebung und Schrumpfung des Zystensacks.Falldarstellung: Wir berichten über einen 40-jähri...

Combination therapy of radiation and immunomodulators in the treatment of MM46 tumor transplanted in C3H/He mice

International Nuclear Information System (INIS)

Miyaji, Chihiro; Imanaka, Kazufumi; Gose, Kyuhei; Ichiyanagi, Akihiro; Imajo, Yoshinari

1983-01-01

Female C3H/He mice aged 13 weeks with transplanted MM 46 tumor were used in histological and enzymohistochemical studies on the timing of administration of immunomodulators, PSK (a protein bound polysaccharide prepared from Coriolus versicolor), or OK-432 (Streptococcal preparation) combined with two fractionated local irradiation with the total dose of 3,000 rad. The daily dose of 250 mg/kg of PSK, or 1 KE/mouse of OK-432 was respectively injected intraperitoneally for four consecutive days before or after irradiation. Mice were sacrificed before irradiation and 7, 14 and 21 days after irradiation. Resected tumor tissues were examined using H-E staining and α-naphtyl acetate esterase (ANAE) staining to observe the stromal reactions such as the infiltration of mononuclear cells and fibroblasts around tumor tissues. When PSK or OK-432 was administered after irradiation, remarkable lymphocytic infiltration was observed compared with the control group and the group to which PSK or OK-432 was administered before irradiation. ANAE staining revealed most of infiltrating lymphocytes were T-cells. These results suggested that PSK and OK-432 which were received after radiotherapy enhanced the immunological responses against tumors which were represented by remarkable lymphocytic infiltration. (author)

Combination therapy of radiation and immunomodulators in the treatment of MM46 tumor transplanted in C3H/He mice. Histological and histoenzymatic studies using alpha-naphtyl acetate esterase staining

Energy Technology Data Exchange (ETDEWEB)

Miyaji, Chihiro; Imanaka, Kazufumi; Gose, Kyuhei; Ichiyanagi, Akihiro; Imajo, Yoshinari (Kobe Univ. (Japan). School of Medicine)

1983-12-01

Female C3H/He mice aged 13 weeks with transplanted MM 46 tumor were used in histological and enzymohistochemical studies on the timing of administration of immunomodulators, PSK (a protein bound polysaccharide prepared from Coriolus versicolor), or OK-432 (Streptococcal preparation) combined with two fractionated local irradiation with the total dose of 3,000 rad. The daily dose of 250 mg/kg of PSK, or 1 KE/mouse of OK-432 was respectively injected intraperitoneally for four consecutive days before or after irradiation. Mice were sacrificed before irradiation and 7, 14 and 21 days after irradiation. Resected tumor tissues were examined using H-E staining and ..cap alpha..-naphtyl acetate esterase (ANAE) staining to observe the stromal reactions such as the infiltration of mononuclear cells and fibroblasts around tumor tissues. When PSK or OK-432 was administered after irradiation, remarkable lymphocytic infiltration was observed compared with the control group and the group to which PSK or OK-432 was administered before irradiation. ANAE staining revealed most of infiltrating lymphocytes were T-cells. These results suggested that PSK and OK-432 which were received after radiotherapy enhanced the immunological responses against tumors which were represented by remarkable lymphocytic infiltration.

Picibanil (OK-432) in the treatment of head and neck lymphangiomas in children

OpenAIRE

Rebuffini, Elena; Zuccarino, Luca; Grecchi, Emma; Carinci, Francesco; Merulla, Vittorio Emanuele

2012-01-01

Background: Picibanil (OK-432) is a lyophilized mixture of group A Streptococcus pyogenes with antineoplastic activity. Because of its capacity to produce a selective fibrosis of lymphangiomas (LMs), it has been approved by Japanese administration in 1995 for the treatment of LMs. Materials and Methods: We treated 15 children (age range: 6-60 months) affected by head and neck macrocystic LMs with intracystic injections (single dose of 0.2 mL) of Picibanil (1-3 injections). Results: Co...

New combined therapy of radiation and local administration of OK-432 for esophageal cancer

International Nuclear Information System (INIS)

Mukai, Minoru; Morita, Shinroku; Tsunemoto, Hiroshi

1990-01-01

We devised new combination therapy of radiation and local administration of OK-432 and performed for 26 patients with esophageal cancer between March, 1987 and December, 1988 as a pilot study. The average age was 73 years. Among 26 patients, males were 20 and females were six. Patients were irradiated at the schedule of under 2 Gy/day and the dose of TDF (time, dose and fractionation factor) 100 totally. OK-432, 10KE was endoscopically administered around cancer lesion at the beginning of the radiotherapy, and two weeks later, 5KE was given in the same manner. Complete response was obtained in 20 out of 26 cases (77%) and partial response was obtained in the remaining six cases (23%). All six patients with tumor length less than five cm showed complete response. All 16 patients who could not eat food orally before treatment, became to take food enough orally after the treatment and could discharge in good condition. One year and two years survival rate of 26 patients by Kaplan Meier method were 67.4% and 47.2%, respectively. Six patients with tumor length less than five cm, are all alive without a sign of recurrence. This combination therapy will improve not only the response rate and the survival rate, but also the quality of life of patients with esophageal cancer. (author)

A Case of Sublingual Ranula That Responded Successfully to Localized Injection Treatment with OK-432 after Healing from Drug Induced Hypersensitivity Syndrome

Directory of Open Access Journals (Sweden)

Kunio Yoshizawa

2016-01-01

Full Text Available A ranula is a mucus retention cyst or pseudocyst caused by leakage of mucus from the sublingual gland and generally occurs in the oral floor. In addition, drug induced hypersensitivity syndrome (DIHS is a rare but well-recognized serious adverse effect characterized by fever, skin rashes, generalized lymphadenopathy, hepatitis, and hepatosplenomegaly and oral stomatitis. This paper presents the first case of successfully treated sublingual ranula with localized injection of OK-432 after healing from drug induced hypersensitivity syndrome, which has previously been unreported in the literature. We present the case of a 38-year-old Japanese woman with sublingual ranula that responded successfully to localized injection treatment with OK-432 after healing from drug induced hypersensitivity syndrome. She was affected with cutaneous myositis and interstitial lung disease when she was 26 years old. At the age 34 years, she received additional oral treatment of diaminodiphenyl-sulfone due to deterioration of the cutaneous myositis, which resulted in drug induced hypersensitivity syndrome (DIHS with severe oral stomatitis. Local injection of OK-432 to the ranula may be a very safe and useful treatment method even if the patient has a history of drug allergy and has connective tissue disease such as cutaneous myositis.

OK-432 (Picibanil) sclerotherapy for recurrent dislocation of the temporomandibular joint in elderly edentulous patients: Case reports.

Science.gov (United States)

Matsushita, Kazuhiro; Abe, Takae; Fujiwara, Toshikatsu

2007-09-01

Dislocation of the temporomandibular joint (TMJ) is a thorny problem not only for a patient but also a doctor. Especially for the elderly edentulous patients, it is very hard to treat the condition although there are many surgical and non-surgical procedures. We successfully treated it in two elderly edentulous patients by injection of OK-432 as a sclerosing agent.

Combination therapy of radiation and immunomodulators in the treatment of MM46 tumor transplanted in C3H/He mice

Energy Technology Data Exchange (ETDEWEB)

Miyaji, C.; Ogawa, Y.; Imajo, Y.; Kimura, S. (Kobe Univ. (Japan). School of Medicine)

1982-06-01

Female C3H/He mice aged 12 weeks, transplanted MM46 tumor, were used in this study on the timing of administration of immunomodulators, such as PSK (a proteinbound polysaccharide prepared from Coriolus versicolor), OK-432 (Streptococcal preparation), bestatin (inhibitor of aminopeptidases of microbial origin) and levamisole (a chemical substance belonging to anthelmintics) combined with two fractionated local irradiation with the total dose of 3,000 rads. The daily dose of 250 ng/kg of PSK, 1 KE/mouse of OK-432, 300 mu g/mouse of bestatin or 3mg/kg of levamisole was respectively injected intraperitoneally for four consecutive days before or after irradiation. The anti-tumor effect was evaluated by the changes of tumor volume and survival curves. When PSK, OK-432 or levamisole was administered after irradiation, tumor growth was decreased and sixty-day survival rate and survival curve were significantly elongated compared with the control group and the group to which PSK, OK-432 or levamisole administered before irradiation (p lt 0.01). As for bestatin, no remarkable difference was observed irrespective of the timing of administration. These results suggested that some immunomodulators showed different anti-tumor activity depending on its timing of administration in the combination with radiotherapy. Concerning PSK, OK-432 and levamisole, they seemed to be beneficial in combination with prior radiotherapy in the treatment of MM46 tumor.

Combination therapy of radiation and immunomodulators in the treatment of MM46 tumor transplanted in C3H/He mice

International Nuclear Information System (INIS)

Miyaji, Chihiro; Ogawa, Yasuhiro; Imajo, Yoshinari; Kimura, Shuji

1982-01-01

Female C3H/He mice aged 12 weeks, transplanted MM46 tumor, were used in this study on the timing of administration of immunomodulators, such as PSK (a proteinbound polysaccharide prepared from Coriolus versicolor), OK-432 (Streptococcal preparation), bestatin (inhibitor of aminopeptidases of microbial origin) and levamisole (a chemical substance belonging to anthelmintics) combined with two fractionated local irradiation with the total dose of 3,000 rads. The daily dose of 250 ng/kg of PSK, 1 KE/mouse of OK-432, 300 mu g/mouse of bestatin or 3mg/kg of levamisole was respectively injected intraperitoneally for four consecutive days before or after irradiation. The anti-tumor effect was evaluated by the changes of tumor volume and survival curves. When PSK, OK-432 or levamisole was administered after irradiation, tumor growth was decreased and sixty-day survival rate and survival curve were significantly elongated compared with the control group and the group to which PSK, OK-432 or levamisole administered before irradiation (p lt 0.01). As for bestatin, no remarkable difference was observed irrespective of the timing of administration. These results suggested that some immunomodulators showed different anti-tumor activity depending on its timing of administration in the combination with radiotherapy. Concerning PSK, OK-432 and levamisole, they seemed to be beneficial in combination with prior radiotherapy in the treatment of MM46 tumor. (author)

Treatment of lymphangiomas in children: an update of Picibanil (OK-432) sclerotherapy.

Science.gov (United States)

Greinwald, J H; Burke, D K; Sato, Y; Poust, R I; Kimura, K; Bauman, N M; Smith, R J

1999-10-01

Picibanil (OK-432) is a sclerosing agent derived from a low-virulence strain of Streptococcus pyogenes that induces regression of macrocystic lymphangiomas. This report describes a prospective, nonrandomized trial to evaluate the efficacy of Picibanil in the treatment of 13 affected children ranging in age from 1 to 94 months. On average, 4.1 fluoroscopically guided intracystic injections were performed per child, with an average total dose of 0.56 mg of Picibanil. As judged by physical examination and radiographic studies, 5 children (42%) showed a complete or substantial response, and 2 children (16%) showed an intermediate response. No response was seen in 5 children (42%), 2 of whom had massive craniofacial lymphangioma. Factors that contribute to failure with Picibanil sclerotherapy are the presence of a significant microcystic component to the lesion, massive craniofacial involvement, and previous surgical resection. Macrocystic lymphangiomas of the infratemporal fossa or cervical area have the best response to therapy.

A phase II study of cisplatin, oral administration of etoposide, OK-432 and radiation therapy for inoperable stage III non-small cell lung cancer

International Nuclear Information System (INIS)

Abe, Yoshinao; Takahashi, Jutaro; Fukuda, Hiroshi

1998-01-01

This study was designed to evaluate the feasibility and efficiency of giving cisplatin, etoposide, and OK-432 concurrently with conventional radiotherapy (RTx) for patient's with inoperable stage III, based on the TNM classification according to the International Union against Cancer staging system for lung cancer (1987) non-small cell lung cancer (NSCLC). From January 1992 to December 1994, 31 patients with cytologically or histologically confirmed stage III NSCLC were treated with RTx, to a total dose of 56-64 Gy, with concurrent daily oral administration of etoposide (25 mg) and cisplatin (20 mg) for 5 days during the third or fourth week from the start of RTx. The subcutaneous injection of 1 or 2 KE of OK-432, three times a week, for the duration of radiotherapy also started from the beginning of RTx. The number of eligible patients was 29 (26 men and 3 women). Their mean age was 66 years (range, 55-77 years). Six patients had an Eastern Cooperative Oncology Group performance status (PS) of 0; 15, 1; 8; 2. Three were stage IIIA, and 26, stage IIIB. Histologically, 2 had adenocarcinoma, 23, squamous cell carcinoma, and 4, large cell carcinoma. In 27 of the 29 patients, the RTx schedule was completed. There were no treatment-related deaths. Grade 4 toxicity (according to World Health Organisation criteria) leukopenia (700/μl) was observed in 1 patient. The response rate was 79% and the median survival was 17 months. Survival rates at 1, 2 and 3 years were 62%, 31%, and 21%, respectively. The local failure rate was 51%. The combination of cisplatin, etoposide, and OK-432, given concurrently with conventional RTx is feasible and effective for inoperable stage III NSCLC. (author)

Picibanil (OK-432) in the treatment of head and neck lymphangiomas in children.

Science.gov (United States)

Rebuffini, Elena; Zuccarino, Luca; Grecchi, Emma; Carinci, Francesco; Merulla, Vittorio Emanuele

2012-12-01

Picibanil (OK-432) is a lyophilized mixture of group A Streptococcus pyogenes with antineoplastic activity. Because of its capacity to produce a selective fibrosis of lymphangiomas (LMs), it has been approved by Japanese administration in 1995 for the treatment of LMs. We treated 15 children (age range: 6-60 months) affected by head and neck macrocystic LMs with intracystic injections (single dose of 0.2 mL) of Picibanil (1-3 injections). Complete disappearance of the lesion was noticed in eight (53.33%) cases, a marked (>50%) reduction of LMs was found five (33.33%) cases, while a moderate (Picibanil side effects included fever, local inflammation, and transitory increase of blood platelets' concentration; a single case of anemia was resolved with concentrated red blood cells transfusion. Intracystic injection of Picibanil is an effective and safe treatment for macrocystic LMs in pediatric patients and may represent the treatment of choice in such cases, especially where surgical excision is associated with the risk of functional/cosmetic side effects.

OK432 (picibanil) efficacy in an adult with cystic cervical lymphangioma. A case report.

Science.gov (United States)

Alonso, Juan; Barbier, Luis; Alvarez, Julio; Romo, Laura; Martín, Jesús C; Arteagoitia, Iciar; Santamaría, Joseba

2005-01-01

Cervical cystic lymphangioma (CCL) is a rare and benign tumour involving congenital and cystic abnormalities derived from lymphatic vessels. The most accepted treatment continues to be surgical excision. However, when this infiltrates vital neurovascular neck structures, complete excision is difficult and if only partial, the recurrence rate is very high. The most frequently used alternative treatment is to inject sclerosants into the lesion. The use of these techniques has reported good results in children; however, there are few references thereof with regard to adults. We are reporting on a cervical cystic lymphangioma in a male aged 22, treated with an intra-lesion injection of 20 cc with 0.01 mg/cc dilution of OK-432 (picibanil) in physiological serum. Sole complications were fever and local reaction where the solution was injected. One month after treatment the lymphangioma had totally remitted and sixteen months later continues in remittance.

Sclerotherapy with picibanil (OK-432) for congenital lymphatic malformation in the head and neck.

Science.gov (United States)

Sung, M W; Lee, D W; Kim, D Y; Lee, S J; Hwang, C H; Park, S W; Kim, K H

2001-08-01

Congenital lymphatic malformations of the head and neck (LMHN) present special challenges to the otolaryngologist-head and neck surgeon. Recently, a number of sclerotherapy trials have shown promising results. In this study, we present our experiences with picibanil (OK-432) sclerotherapy for this lesion. Retrospectively review. We retrospectively reviewed 21 patients who have undergone sclerotherapy with picibanil for LMHN. Satisfactory response with complete or nearly complete shrinkage of the lesions was observed in 15 cases after repeated sclerotherapy (average, two times). We did not observe any significant morbidity or complications in the patients treated with picibanil. Reduction in size of the mass was achieved in weeks to months. Some of the patients who had not had any other previous treatment showed remarkable reductions in size even after the first therapy. When we used picibanil sclerotherapy as a primary treatment for the LMHN, most of our patients showed satisfactory results regardless of the size or location of the lesions. Given with our experience and the reports that failure of picibanil sclerotherapy does not hinder subsequent surgical salvage procedures, we recommend trying picibanil sclerotherapy as a primary treatment for the LMHN and performing surgical excision as a secondary modality if the response to the sclerotherapy is not satisfactory.

Efficacy of dendritic cells matured early with OK-432 (Picibanil), prostaglandin E2, and interferon-alpha as a vaccine for a hormone refractory prostate cancer cell line.

Science.gov (United States)

Yoo, Changhee; Do, Hyun-Ah; Jeong, In Gab; Park, Hongzoo; Hwang, Jung-Jin; Hong, Jun Hyuk; Cho, Jin Seon; Choo, Myong-Soo; Ahn, Hanjong; Kim, Choung-Soo

2010-09-01

Dendritic cells (DCs) are potent antigen-presenting cells. OK432 (Picibanil) was introduced as a potent stimulator of DC maturation in combination with prostaglandin-E(2) and interferon-alpha. We compared the efficacy of a DC-prostate cancer vaccine using early-mature DCs stimulated with OK432, PGE2 and INF-alpha (OPA) with that of vaccines using other methods. On days 3 or 7 of DC culture, TNF-alpha (T), TNF-alpha and LPS (TL) or OPA were employed as maturation stimulators. DU145 cells subjected to heat stress were hybridized with mature DCs using polyethyleneglycol. T cells were sensitized by the hybrids, and their proliferative and cytokine secretion activities and cytotoxicity were measured. The yields of early-mature DCs were higher, compared to yields at the conventional maturation time (P<0.05). In the early maturation setting, the mean fusion ratios, calculated from the fraction of dual-positive cells, were 13.3%, 18.6%, and 39.9%, respectively (P=0.051) in the T only, TL, and OPA-treated groups. The function of cytotoxic T cells, which were sensitized with the hybrids containing DCs matured early with OPA, was superior to that using other methods. The antitumor effects of DC-DU145 hybrids generated with DCs subjected to early maturation with the OPA may be superior to that of the hybrids using conventional maturation methods.

Efficacy of Dendritic Cells Matured Early with OK-432 (Picibanil®), Prostaglandin E2, and Interferon-α as a Vaccine for a Hormone Refractory Prostate Cancer Cell Line

Science.gov (United States)

Yoo, Changhee; Do, Hyun-Ah; Jeong, In Gab; Park, Hongzoo; Hwang, Jung-Jin; Hong, Jun Hyuk; Cho, Jin Seon; Choo, Myong-Soo; Ahn, Hanjong

2010-01-01

Dendritic cells (DCs) are potent antigen-presenting cells. OK432 (Picibanil®) was introduced as a potent stimulator of DC maturation in combination with prostaglandin-E2 and interferon-α. We compared the efficacy of a DC-prostate cancer vaccine using early-mature DCs stimulated with OK432, PGE2 and INF-α (OPA) with that of vaccines using other methods. On days 3 or 7 of DC culture, TNF-α (T), TNF-α and LPS (TL) or OPA were employed as maturation stimulators. DU145 cells subjected to heat stress were hybridized with mature DCs using polyethyleneglycol. T cells were sensitized by the hybrids, and their proliferative and cytokine secretion activities and cytotoxicity were measured. The yields of early-mature DCs were higher, compared to yields at the conventional maturation time (P<0.05). In the early maturation setting, the mean fusion ratios, calculated from the fraction of dual-positive cells, were 13.3%, 18.6%, and 39.9%, respectively (P=0.051) in the T only, TL, and OPA-treated groups. The function of cytotoxic T cells, which were sensitized with the hybrids containing DCs matured early with OPA, was superior to that using other methods. The antitumor effects of DC-DU145 hybrids generated with DCs subjected to early maturation with the OPA may be superior to that of the hybrids using conventional maturation methods. PMID:20808670

Vaccination with NY-ESO-1 overlapping peptides mixed with Picibanil OK-432 and montanide ISA-51 in patients with cancers expressing the NY-ESO-1 antigen.

Science.gov (United States)

Wada, Hisashi; Isobe, Midori; Kakimi, Kazuhiro; Mizote, Yu; Eikawa, Shingo; Sato, Eiichi; Takigawa, Nagio; Kiura, Katsuyuki; Tsuji, Kazuhide; Iwatsuki, Keiji; Yamasaki, Makoto; Miyata, Hiroshi; Matsushita, Hirokazu; Udono, Heiichiro; Seto, Yasuyuki; Yamada, Kazuhiro; Nishikawa, Hiroyoshi; Pan, Linda; Venhaus, Ralph; Oka, Mikio; Doki, Yuichiro; Nakayama, Eiichi

2014-01-01

We conducted a clinical trial of an NY-ESO-1 cancer vaccine using 4 synthetic overlapping long peptides (OLP; peptides #1, 79-108; #2, 100-129; #3, 121-150; and #4, 142-173) that include a highly immunogenic region of the NY-ESO-1 molecule. Nine patients were immunized with 0.25 mg each of three 30-mer and a 32-mer long NY-ESO-1 OLP mixed with 0.2 KE Picibanil OK-432 and 1.25 mL Montanide ISA-51. The primary endpoints of this study were safety and NY-ESO-1 immune responses. Five to 18 injections of the NY-ESO-1 OLP vaccine were well tolerated. Vaccine-related adverse events observed were fever and injection site reaction (grade 1 and 2). Two patients showed stable disease after vaccination. An NY-ESO-1-specific humoral immune response was observed in all patients and an antibody against peptide #3 (121-150) was detected firstly and strongly after vaccination. NY-ESO-1 CD4 and CD8 T-cell responses were elicited in these patients and their epitopes were identified. Using a multifunctional cytokine assay, the number of single or double cytokine-producing cells was increased in NY-ESO-1-specific CD4 and CD8 T cells after vaccination. Multiple cytokine-producing cells were observed in PD-1 (-) and PD-1 (+) CD4 T cells. In conclusion, our study indicated that the NY-ESO-1 OLP vaccine mixed with Picibanil OK-432 and Montanide ISA-51 was well tolerated and elicited NY-ESO-1-specific humoral and CD4 and CD8 T-cell responses in immunized patients.

7 CFR 58.432 - Catalase.

Science.gov (United States)

2010-01-01

... 7 Agriculture 3 2010-01-01 2010-01-01 false Catalase. 58.432 Section 58.432 Agriculture... Material § 58.432 Catalase. The catalase preparation shall be a stable, buffered solution, neutral in pH, having a potency of not less than 100 Keil units per milliliter. The source of the catalase, its...

Increased tumor uptake of 67Ga citrate following a course of picibanil (NSC-B116209)

International Nuclear Information System (INIS)

Okuyama, Shinichi; Matsuzawa, Taiju; Mishina, Hitoshi.

1979-01-01

Exposure to exponential dose schedules of OK-432, penicillin-inactivated preparation of streptococcus hemolyticus (NSC-B116209), resulted in an increased retention of 67 Ga citrate. Its uptake in footpad tumors of AH 109A was also increased. The results may suggest that pretreatment with OK-432 would increase tumor uptake of 67 Ga citrate and help scintigraphic delineation of malignancies in man. It may probably augment tumor concentration of anticancer chemotherapeutics, too. Thus, the tumor affinitive property of OK-432 can be taken advantage of in anticancer strategy as well as cancer detection by 67 Ga scanning. (author)

Local Delivery System of Immune Modulating Drug for Unresectable Adenocarcinoma: In Vitro Experimental Study and In Vivo Animal Study

International Nuclear Information System (INIS)

Lee, Don Haeng; Kang, Sung-Gwon; Jeong, Seok; Yoon, Chang Jin; Choi, Jung-Ah; Byun, Ju Nam; Park, Jae Hyung; Lee, Kyu Back

2006-01-01

The purpose of the study was to evaluate the efficacy and safety of a developed drug delivery system containing OK-432 through in vitro and animal study. An OK-432-impregnated polycarbonate/polyurethane stent membrane was used to develop a drug delivery system (DDS) enabling the locoregional release of OK-432. Polyethyleneglycol was used as a detergent and porosity generator. The stability of OK-432 in solvent, releasing kinetics of drug, and cytotoxicity of the DDS were evaluated. OK-432-impregnated DDS was implanted in mice in which a human adenocarcinoma cell line was injected and grown in their back. Flow cytometry and enzyme-linked immunosorbent assay were used for quantifying the amount of drug. OK-432 exposed to phosphate-buffered saline and OK-432 exposed to N,N-dimethylacetamide showed similar results on dot graphs and histograms. However, OK-432 exposed to tetrahydrofurane showed different dot graphs and histograms, which means that the antigenicity of the drug was changed. The release rate of OK-432 was maintained at a constant level for 6 weeks. The local delivery of OK-432 was found to have an antitumor effect on a human adenocarcinoma cell line in an animal study, but no effect on this cell line in in vitro cell culture. Histologic examination showed minimal inflammatory reaction in surrounding tissue. Our study shows that local treatment using this OK-432 release system is safe and effective in reducing adenocarcinoma in a mouse model

Clinical effect of concomitant use of non-specific immunopotentiator on 172 cases of primary lung cancer (stage 3, 4) treated with radiation combined with chemotherapy

International Nuclear Information System (INIS)

Hiyoshi, Yukio; Ogawa, Yasuhiro; Imajo, Yoshinari

1981-01-01

Between 1975 and 1979, 209 cases of primary lung cancer admitted the department of radiology were treated with radiation combined with chemotherapy. The clinical effect of concomitant use of non-specific immunopotentiator OK-432 and PSK was studied about stage 3, and stage 4. Survival curves were evaluated between the patients with OK-432 and/or PSK and those without immunotherapy. In 91 cases in stage 3, fifty percent survival period was found to be 12.2 months for 27 cases with OK-432, 14.4 months for 12 cases with combined use of OK-432 and PSK, 9.0 months for 24 cases with PSK, and 7.5 months for 28 cases without immunotherapy, respectively. Noticeable prolongation of fifty percent survival period was observed in the cases with combined use of OK-432 and PSK, OK-432, and PSK, inorder, as compared with those without immunotherapy. One-year survival rate was 51.9% for cases with OK-432, 66.7% with combined use OK-432 and PSK, 34.8% with PSK, and 25.0% without immunotherapy, respectively. In 81 cases in stage 4, fifty percent survival period was found to be 7.0 months for 24 cases with OK-432, 5.0 months for 8 cases with combined use of OK-432 and PSK, 7.6 months for 13 cases with PSK, and 3.3 months for 36 cases without immunotherapy, respectively. One-year survival rate was 16.7% for cases with OK-432, 25.0% with combined use of OK-432 and PSK, 15.4% with PSK and 5.6% without immunotherapy, respectively. (J.P.N.)

Metallothionein induction: a measure of radioprotective action

Energy Technology Data Exchange (ETDEWEB)

Matsubara, J.

1988-08-01

Mice treated to induce metallothionein (MT) synthesis in the liver prior to irradiation were resistant to radiation; this also was true of mice that had a portion of skin surgically removed or an immunomodulator administered. Mice given Mn, Cd or Zn subcutaneously prior to irradiation showed increased tolerance to an LD50 level (6-8 Gy) of x rays compared with controls that received no pretreatments (p less than 0.01). All the mice were evaluated during a 30-d postirradiation period. Weight loss in control mice peaked two weeks after irradiation, whereas body weight in mice pretreated with Mn continued to increase after irradiation with x rays. The normal level of MT in mouse liver (25 micrograms g-1 tissue) increased to 70 micrograms g-1 liver tissue in mice irradiated with 6.3-Gy x rays. However, following subcutaneous injection of Cd, Mn or Zn, or intraperitoneal injection of OK-432 (Picibanil, a killed streptococcal preparation, MT levels in liver increased by a factor of 2-8 compared to irradiated that were not treated with the reagents listed above. The mortality rate of mice with a surgically excised 2 X 2-cm2 portion of dorsal skin or of those administered OK-432 was lower than that of controls, and MT levels in liver (150-400 micrograms g-1 tissue) were higher than those of irradiated mice that were not surgically treated. These results suggest that the body's protective action against radiation correlates with the biosynthesis of MT, or that MT acts as a scavenger of radiation-induced peroxides.

Metallothionein induction: a measure of radioprotective action

International Nuclear Information System (INIS)

Matsubara, J.

1988-01-01

Mice treated to induce metallothionein (MT) synthesis in the liver prior to irradiation were resistant to radiation; this also was true of mice that had a portion of skin surgically removed or an immunomodulator administered. Mice given Mn, Cd or Zn subcutaneously prior to irradiation showed increased tolerance to an LD50 level (6-8 Gy) of x rays compared with controls that received no pretreatments (p less than 0.01). All the mice were evaluated during a 30-d postirradiation period. Weight loss in control mice peaked two weeks after irradiation, whereas body weight in mice pretreated with Mn continued to increase after irradiation with x rays. The normal level of MT in mouse liver (25 micrograms g-1 tissue) increased to 70 micrograms g-1 liver tissue in mice irradiated with 6.3-Gy x rays. However, following subcutaneous injection of Cd, Mn or Zn, or intraperitoneal injection of OK-432 (Picibanil, a killed streptococcal preparation, MT levels in liver increased by a factor of 2-8 compared to irradiated that were not treated with the reagents listed above. The mortality rate of mice with a surgically excised 2 X 2-cm2 portion of dorsal skin or of those administered OK-432 was lower than that of controls, and MT levels in liver (150-400 micrograms g-1 tissue) were higher than those of irradiated mice that were not surgically treated. These results suggest that the body's protective action against radiation correlates with the biosynthesis of MT, or that MT acts as a scavenger of radiation-induced peroxides

Combined effects of radiotherapy and non-specific immunotherapy

International Nuclear Information System (INIS)

Yamashita, Takashi; Hayakawa, Yukiko; Mochizuki, Yukio

1985-01-01

Local and systemic effects of the combined use of radiotherapy and administration of OK-432 were examined using tumor-bearing mice. Tumor regrowth was inhibited by local administration of OK-432 following radiotherapy. Systemic inhibitory effects of OK-432 on tumors were not seen. When radiotherapy is performed in combination with administration of OK-432, synergistic effects will be observed. (Namekawa, K.)

Multi-institutional randomized clinical study on the comparative effects of intracavital chemotherapy alone versus immunotherapy alone versus immunochemotherapy for malignant effusion

Science.gov (United States)

Nio, Y; Nagami, H; Tamura, K; Tsubono, M; Nio, M; Sato, M; Kawabata, K; Hayashi, H; Shiraishi, T; Imai, S; Tsuchitani, T; Mizuta, J; Nakagawa, M; Fukumoto, M

1999-01-01

The current prospective randomized study was designed to compare the effects of intracavitary (i.c.) chemotherapy vs immunotherapy vs immunochemotherapy for malignant effusion. Between 1992 and 1995, a total of 42 patients with malignant effusion were registered, and 41 patients were eligible for statistical analysis. The primary diseases of the eligible patients included 27 gastric, four colorectal, four pancreatic, three lung, two liver and one oesophageal cancers. The patients with malignant effusion were randomly assigned into one of three i.c. therapeutic regimens: chemotherapy alone with weekly injection of anticancer agents (ACAs: cisplatin, mitomycin-C, adriamycin, etc.) (Group A, n = 13); immunotherapy alone with weekly injection of streptococcal preparation OK-432 (Group B, n = 14); or immunochemotherapy with ACAs and OK-432 (Group C, n = 14). The response of the effusion, patient survival and the kinetics of cytokines in the effusion were compared. There were no differences in the patients' backgrounds. The side-effects of the regimens included pain, anorexia, fever, leucopenia and anaemia and there were no differences in their incidence among the three groups. One patient died after cisplatin (CDDP) administration in Group A. Cytologic examination revealed that tumour cells in the effusion disappeared in 23% of Group A cases, 36% of Group B cases and 36% of Group C cases. The malignant effusion did not disappear in any of the Group A cases; however, the effusion disappeared in 29% of Group B cases and 43% of Group C cases (P = 0.03, Group A vs Group C). Furthermore, the 50% survival period was 1.6 months for Group A, 2.4 months for Group B and 3.5 months for Group C. The 6-month survival rate was 7% for Group A, 6% for Group B and 34% for Group C, and the 1-year survival rate was 0%, 0% and 17% respectively (P = 0.048, Group A vs Group C by the log-rank test). The analysis of the cytokine kinetics revealed a prominent increase in the level of

Code OK3 - An upgraded version of OK2 with beam wobbling function

Science.gov (United States)

Ogoyski, A. I.; Kawata, S.; Popov, P. H.

2010-07-01

For computer simulations on heavy ion beam (HIB) irradiation onto a target with an arbitrary shape and structure in heavy ion fusion (HIF), the code OK2 was developed and presented in Computer Physics Communications 161 (2004). Code OK3 is an upgrade of OK2 including an important capability of wobbling beam illumination. The wobbling beam introduces a unique possibility for a smooth mechanism of inertial fusion target implosion, so that sufficient fusion energy is released to construct a fusion reactor in future. New version program summaryProgram title: OK3 Catalogue identifier: ADST_v3_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADST_v3_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 221 517 No. of bytes in distributed program, including test data, etc.: 2 471 015 Distribution format: tar.gz Programming language: C++ Computer: PC (Pentium 4, 1 GHz or more recommended) Operating system: Windows or UNIX RAM: 2048 MBytes Classification: 19.7 Catalogue identifier of previous version: ADST_v2_0 Journal reference of previous version: Comput. Phys. Comm. 161 (2004) 143 Does the new version supersede the previous version?: Yes Nature of problem: In heavy ion fusion (HIF), ion cancer therapy, material processing, etc., a precise beam energy deposition is essentially important [1]. Codes OK1 and OK2 have been developed to simulate the heavy ion beam energy deposition in three-dimensional arbitrary shaped targets [2, 3]. Wobbling beam illumination is important to smooth the beam energy deposition nonuniformity in HIF, so that a uniform target implosion is realized and a sufficient fusion output energy is released. Solution method: OK3 code works on the base of OK1 and OK2 [2, 3]. The code simulates a multi-beam illumination on a target with arbitrary shape and

Experimental study on active specific immunotherapy utilizing the immune reaction of low-dose irradiated tumor tissue, 5

International Nuclear Information System (INIS)

Ogawa, Yasuhiro; Imanaka, Kazufumi; Gose, Kyuhei; Imajo, Yoshinari; Kimura, Shuji

1982-01-01

We have already reported the remarkable effect of the active specific immunotherapy utilizing cryopreserved tumor cells and infiltrating mononuclear cells prepared from a low-dose irradiated tumor tissue after cytoreductive radiotherapy. In the present study, the effect of a biological response modifier, OK-432 combined with this active specific immunotherapy was investigated. Twelve-week-aged female C3H/He mice transplanted with MM46 tumor cells were received local radiotherapy with the dose of 3,000 rads by high energy electron beam on the sixth day after inoculation. This active specific immunotherapy was performed on the thirteenth day, and daily dose of 1.0 KE of OK-432 was injected intraperitoneally from the thirteenth day to the seventeenth day. The inhibition of the tumor growth was observed in the group which received this active specific immunotherapy combined with a biological response modifier, OK-432 compared with that received this active specific immunotherapy alone. (author)

Is Dieting OK for Kids?

Science.gov (United States)

... First Aid & Safety Doctors & Hospitals Videos Recipes for Kids Kids site Sitio para niños How the Body ... Educators Search English Español Is Dieting OK for Kids? KidsHealth / For Kids / Is Dieting OK for Kids? ...

Chemical pleurodesis for prolonged postoperative air leak in primary spontaneous pneumothorax.

Science.gov (United States)

How, Cheng-Hung; Tsai, Tung-Ming; Kuo, Shuenn-Wen; Huang, Pei-Ming; Hsu, Hsao-Hsun; Lee, Jang-Ming; Chen, Jin-Shing; Lai, Hong-Shiee

2014-05-01

Prolonged air leak is the most common complication after thoracoscopic operation for primary spontaneous pneumothorax (PSP), and the role of chemical pleurodesis in treating air leaks remains unclear. This study evaluated the safety and efficacy of chemical pleurodesis with a comparison between minocycline and OK-432. Between 1994 and 2011, 1083 PSP patients were treated by thoracoscopic operation. After the operation, patients with persistent air leak for 3 days or more were managed by minocycline or OK-432 pleurodesis. The demographic and outcome data for these patients were collected by retrospective chart review. Seventy-nine patients (7.3%) with prolonged air leak after thoracoscopy underwent minocycline pleurodesis (60 patients) or OK-432 pleurodesis (19 patients) as the primary treatment. The primary success rate was 63% (38/60) for minocycline pleurodesis and 95% (18/19) for OK-432 pleurodesis (p = 0.009). Postpleurodesis pain was common and comparable between the two groups. No major complications were noted after a total of 121 treatments. Patients undergoing primary OK-432 pleurodesis had shorter durations of postpleurodesis chest drainage (mean 8.5 vs. 2.3 days; p < 0.001) and postoperative hospital stay (mean 11.9 vs. 6.8 days; p < 0.001) than those undergoing primary minocycline pleurodesis. After a median follow-up of 16 months, recurrence was noted in one patient in the OK-432 group and none in the minocycline group. Long-term pulmonary function in the two groups was comparable. Chemical pleurodesis using OK-432 or minocycline is safe and convenient for prolonged air leak after thoracoscopic treatment for PSP. Our experience suggested that OK-432 may be more effective than minocycline in reducing air leak. Copyright © 2013. Published by Elsevier B.V.

Pulmonary Renal Syndrome After Streptococcal Pharyngitis

Directory of Open Access Journals (Sweden)

Gopi Mara-Koosham PhD

2016-04-01

Full Text Available Pulmonary renal syndrome is a class of small vessel vasculitides that are characterized by the dual presentation of diffuse alveolar hemorrhage (DAH and glomerulonephritis. Pulmonary renal syndrome has multiple etiologies, but its development has been rarely reported following infection with group A streptococcus. We present the case of a 36-year-old Native American male who was transferred to our facility due to refractory hypoxic respiratory failure. He had been diagnosed with streptococcal pharyngitis 2 weeks prior to admission. Given the presence of hemoptysis, bronchoscopy was performed and was consistent with DAH. Urinalysis demonstrated hematuria and proteinuria, in the setting of elevated creatinine and blood urea nitrogen. Additionally, antistreptolysin O titer was positive. Given the constellation of laboratory findings and history of streptococcal pharyngitis, the patient was diagnosed with PRS secondary to streptococcal infection. High-dose methylprednisolone was initiated with concomitant plasmapheresis. He was extubated successfully after his respiratory status improved and was eventually discharged home after making a full recovery within 2 weeks after admission. This case illustrates the importance of clinically relevant sequelae of streptococcal infection as well as the appropriate treatment of PRS secondary to streptococcal pharyngitis with plasmapheresis and intravenous corticosteroids.

Experimental study on active specific immunotherapy utilizing the immune reaction of low-dose irradiated tumor tissue, 9

International Nuclear Information System (INIS)

Ogawa, Yasuhiro; Maeda, Tomoho; Yoshida, Shoji

1983-01-01

We have already reported the remarkable effect of an active specific immunotherapy using cryopreserved tumor cells and infiltrating mononuclear cells prepared from a low-dose irradiated tumor tissue after cytoreductive radiotherapy. In the present study, the effect of a biological response modifier, OK-432 combined with the active specific immunotherapy was investigated. Twelve-week-aged female C3H/He mice transplanted with MM 46 tumor cells were received local radiotherapy with a dose of 3,000 rads by high energy electron beams on the fifth day after inoculation. The tumor cells and infiltrating mononuclear cells cryopreserved for two months were thawed and treated with mitomycin-C at concentration of 20 μg/10 7 cells at 37 0 C for 30 min. Then, these cells were injected subcutaneously into the left hind paws as a mitomycin C-treated, cryopreserved active specific immunotherapy on the thirteenth day, and daily dose of 1 KE of OK-432 was injected intraperitoneally from the sixth to the tenth days. The inhibition of the tumor growth was similarly observed in the group which received this active specific immunotherapy combined with a biological response modifier, OK-432. (author)

The OKS persistent in-memory object manager

International Nuclear Information System (INIS)

Jones, R.; Mapelli, L.; Soloviev, I.

1998-01-01

The OKS (Object Kernel Support) is a library to support a simple, active persistent in-memory object manager. It is suitable for applications which need to create persistent structured information with fast access but do not require full database functionality. It can be used as the frame of configuration databases and real-time object managers for Data Acquisition and Detector Control Systems in such fields as setup, diagnostics and general configuration description. OKS is based on an object model that supports objects, classes, associations, methods, inheritance, polymorphism, object identifiers, composite objects, integrity constraints, schema evolution, data migration and active notification. OKS stores the class definitions and their instances in portable ASCII files. It provides query facilities, including indices support. The OKS has a C++ API (Application Program Interface) and includes Motif based GUI applications to design class schema and to manipulate objects. OKS has been developed on top of the Rogue Wave Tools h++ C++ class library

Tics, OCD and Streptococcal Infection (PANDAS

Directory of Open Access Journals (Sweden)

J Gordon Millichap

2008-07-01

Full Text Available Forty matched pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS case-control pairs were prospectively evaluated clinically and with testing for group A b-hemolytic streptococcus for an average of 2 years, in a study at University of Rochester School of Medicine, New York; and WHO Streptococcal Reference Laboratory, Minneapolis, MN.

Chemical pleurodesis for prolonged postoperative air leak in primary spontaneous pneumothorax

Directory of Open Access Journals (Sweden)

Cheng-Hung How

2014-05-01

Conclusion: Chemical pleurodesis using OK-432 or minocycline is safe and convenient for prolonged air leak after thoracoscopic treatment for PSP. Our experience suggested that OK-432 may be more effective than minocycline in reducing air leak.

Disease: H01471 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available HORS ... Ogita S, Tsuto T, Nakamura K, Deguchi E, Tokiwa K, Iwai N ... TITLE ... OK-432 therapy for lymphangioma in child...Rautio R, Rautiainen M, Airaksinen M ... TITLE ... OK-432 (Picibanil) therapy for lymphangiomas in children. ...

New treatment of early fetal chylothorax

DEFF Research Database (Denmark)

Nygaard, Ulrikka; Sundberg, Karin; Nielsen, Henriette Svarre

2007-01-01

OBJECTIVE: To evaluate OK-432, a preparation of Streptococcus pyogenes, in the treatment of early fetal chylothorax. METHODS: A prospective study of all fetuses (n=7) with persistent early chylothorax (gestational ages 16-21 weeks) referred to the tertiary center of fetal medicine in Denmark in 2...

Association of streptococcal throat infection with mental disorders

DEFF Research Database (Denmark)

Orlovska, Sonja; Vestergaard, Claus Hostrup; Bech, Bodil Hammer

2017-01-01

IMPORTANCE Streptococcal infection has been linked with the development of obsessive-compulsive disorder (OCD) and tic disorders, a concept termed pediatric autoimmune neuropsychiatric disorders associated with streptococcal infection (PANDAS). However, previous studies of this association have b...

Evaluation of concomitant use of non-specific immunopotentiator on 172 cases of primary lung cancer (Stage III, IV) treated with radiation combined with chemotherapy

International Nuclear Information System (INIS)

Ogawa, Yasuhiro; Kimura, Shuji; Imajo, Yoshinari; Hamada, Fumio; Miyaji, Chihiro

1982-01-01

The clinical effect of concomitant use of non-specific immunopotentiator OK-432 and/or PSK was studied about 172 cases of primary lung cancer (Stage III, IV). In 91 cases in stage III, fifty percent survival period was found to be 11.5 months for 63 cases with OK-432 and/or PSK, and 7.5 months for 28 cases without immunotherapy, respectively. In 81 cases in stage IV, fifty percent survival period was found to be 6.7 months for 45 cases with OK-432 and/or PSK, and 3.3 months for 36 cases without immunotherapy, respectively. (author)

48 CFR 432.001 - Definitions.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Definitions. 432.001 Section 432.001 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING 432.001 Definitions. The agency contract finance office is the office, other...

Dicty_cDB: SLC432 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available SL (Link to library) SLC432 (Link to dictyBase) - - - Contig-U09715-1 | Contig-U16382-1 SLC4...32P (Link to Original site) SLC432F 633 SLC432Z 188 SLC432P 821 - - Show SLC432 Library SL (Link to library) Clone ID SLC4...15-1 | Contig-U16382-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...32Q.Seq.d/ Representative seq. ID SLC432P (Link to Original site) Representative DNA sequence >SLC432 (SLC4...32Q) /CSM/SL/SLC4-B/SLC432Q.Seq.d/ ATTAAATTAAATAAAAAATAAAAATGGATGGTGAAGATGTTCAAGCTTTAGTTATTGATA

42 CFR 426.432 - Discovery.

Science.gov (United States)

2010-10-01

... 42 Public Health 3 2010-10-01 2010-10-01 false Discovery. 426.432 Section 426.432 Public Health... § 426.432 Discovery. (a) General rule. If the ALJ orders discovery, the ALJ must establish a reasonable timeframe for discovery. (b) Protective order—(1) Request for a protective order. Any party receiving a...

Management of group B streptococcal bacteriuria in pregnancy.

Science.gov (United States)

Allen, Victoria M; Yudin, Mark H

2012-05-01

To provide information regarding the management of group B streptococcal (GBS) bacteriuria to midwives, nurses, and physicians who are providing obstetrical care. The outcomes considered were neonatal GBS disease, preterm birth, pyelonephritis, chorioamnionitis, and recurrence of GBS colonization. Medline, PubMed, and the Cochrane database were searched for articles published in English to December 2010 on the topic of GBS bacteriuria in pregnancy. Bacteriuria is defined in this clinical practice guideline as the presence of bacteria in urine, regardless of the number of colony-forming units per mL (CFU/mL). Low colony counts refer to pregnancies in which it is appropriate to treat GBS bacteriuria to optimize maternal and perinatal outcomes, to reduce the occurrences of antibiotic anaphylaxis, and to prevent increases in antibiotic resistance to GBS and non-GBS pathogens. No cost-benefit analysis is provided. 1. Treatment of any bacteriuria with colony counts ≥ 100 000 CFU/mL in pregnancy is an accepted and recommended strategy and includes treatment with appropriate antibiotics. (II-2A) 2. Women with documented group B streptococcal bacteriuria (regardless of level of colony-forming units per mL) in the current pregnancy should be treated at the time of labour or rupture of membranes with appropriate intravenous antibiotics for the prevention of early-onset neonatal group B streptococcal disease. (II-2A) 3. Asymptomatic women with urinary group B streptococcal colony counts pregnancy should not be treated with antibiotics for the prevention of adverse maternal and perinatal outcomes such as pyelonephritis, chorioamnionitis, or preterm birth. (II-2E) 4. Women with documented group B streptococcal bacteriuria should not be re-screened by genital tract culture or urinary culture in the third trimester, as they are presumed to be group B streptococcal colonized. (II-2D).

Streptococcal acute pharyngitis

Directory of Open Access Journals (Sweden)

Lais Martins Moreira Anjos

2014-07-01

Full Text Available Acute pharyngitis/tonsillitis, which is characterized by inflammation of the posterior pharynx and tonsils, is a common disease. Several viruses and bacteria can cause acute pharyngitis; however, Streptococcus pyogenes (also known as Lancefield group A β-hemolytic streptococci is the only agent that requires an etiologic diagnosis and specific treatment. S. pyogenes is of major clinical importance because it can trigger post-infection systemic complications, acute rheumatic fever, and post-streptococcal glomerulonephritis. Symptom onset in streptococcal infection is usually abrupt and includes intense sore throat, fever, chills, malaise, headache, tender enlarged anterior cervical lymph nodes, and pharyngeal or tonsillar exudate. Cough, coryza, conjunctivitis, and diarrhea are uncommon, and their presence suggests a viral cause. A diagnosis of pharyngitis is supported by the patient's history and by the physical examination. Throat culture is the gold standard for diagnosing streptococcus pharyngitis. However, it has been underused in public health services because of its low availability and because of the 1- to 2-day delay in obtaining results. Rapid antigen detection tests have been used to detect S. pyogenes directly from throat swabs within minutes. Clinical scoring systems have been developed to predict the risk of S. pyogenes infection. The most commonly used scoring system is the modified Centor score. Acute S. pyogenes pharyngitis is often a self-limiting disease. Penicillins are the first-choice treatment. For patients with penicillin allergy, cephalosporins can be an acceptable alternative, although primary hypersensitivity to cephalosporins can occur. Another drug option is the macrolides. Future perspectives to prevent streptococcal pharyngitis and post-infection systemic complications include the development of an anti-Streptococcus pyogenes vaccine.

20 CFR 702.432 - Debarment process.

Science.gov (United States)

2010-04-01

... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Debarment process. 702.432 Section 702.432 Employees' Benefits EMPLOYMENT STANDARDS ADMINISTRATION, DEPARTMENT OF LABOR LONGSHOREMEN'S AND HARBOR... § 702.432 Debarment process. (a) Pertaining to health care providers. Upon receipt of information...

48 CFR 432.412 - Contract clause.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Contract clause. 432.412 Section 432.412 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Advance Payments for Non-Commercial Items 432.412 Contract clause. The decision...

Synergistic inhibition of Streptococcal biofilm by ribose and xylitol.

Science.gov (United States)

Lee, Heon-Jin; Kim, Se Chul; Kim, Jinkyung; Do, Aejin; Han, Se Yeong; Lee, Bhumgey David; Lee, Hyun Ho; Lee, Min Chan; Lee, So Hui; Oh, Taejun; Park, Sangbin; Hong, Su-Hyung

2015-02-01

Streptococcus mutans and Streptococcus sobrinus are the major causative agents of human dental caries. Therefore, the removal or inhibition of these streptococcal biofilms is essential for dental caries prevention. In the present study, we evaluated the effects of ribose treatment alone or in combination with xylitol on streptococcal biofilm formation for both species. Furthermore, we examined the expression of genes responsible for dextran-dependent aggregation (DDAG). In addition, we investigated whether ribose affects the biofilm formation of xylitol-insensitive streptococci, which results from long-term exposure to xylitol. The viability of streptococci biofilms formed in a 24-well polystyrene plate was quantified by fluorescent staining with the LIVE/DEAD bacterial viability and counting kit, which was followed by fluorescence activated cell sorting analysis. The effects of ribose and/or xylitol on the mRNA expression of DDAG-responsible genes, gbpC and dblB, was evaluated by RT-qPCR. Our data showed that ribose and other pentose molecules significantly inhibited streptococcal biofilm formation and the expression of DDAG-responsible genes. In addition, co-treatment with ribose and xylitol decreased streptococcal biofilm formation to a further extent than ribose or xylitol treatment alone in both streptococcal species. Furthermore, ribose attenuated the increase of xylitol-insensitive streptococcal biofilm, which results in the reduced difference of biofilm formation between S. mutans that are sensitive and insensitive to xylitol. These data suggest that pentose may be used as an additive for teeth-protective materials or in sweets. Furthermore, ribose co-treatment with xylitol might help to increase the anti-cariogenic efficacy of xylitol. Copyright © 2014 Elsevier Ltd. All rights reserved.

5 CFR 551.432 - Sleep time.

Science.gov (United States)

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Sleep time. 551.432 Section 551.432... FAIR LABOR STANDARDS ACT Hours of Work Special Situations § 551.432 Sleep time. (a) Except as provided in paragraph (b) of this section, bona fide sleep time that fulfills the following conditions shall...

46 CFR 153.432 - Cooling systems.

Science.gov (United States)

2010-10-01

... 46 Shipping 5 2010-10-01 2010-10-01 false Cooling systems. 153.432 Section 153.432 Shipping COAST... Control Systems § 153.432 Cooling systems. (a) Each cargo cooling system must have an equivalent standby... cooling system. (b) Each tankship that has a cargo tank with a required cooling system must have a manual...

Identity of streptococcal blood isolates and oral isolates from two patients with infective endocarditis

DEFF Research Database (Denmark)

Fiehn, N E; Gutschik, E; Larsen, Tove

1995-01-01

The purpose of this study was to isolate streptococcal strains from the oral cavities of streptococcal endocarditis patients and compare these strains biochemically and genetically with the corresponding streptococcal blood isolates. Total identity was observed between the blood and oral cavity...

48 CFR 432.113 - Customary contract financing.

Science.gov (United States)

2010-10-01

... financing. 432.113 Section 432.113 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.113 Customary contract financing. The contracting officer may determine the necessity for customary contract financing. The...

Alleviation of acute radiation damages by post-irradiation treatments

International Nuclear Information System (INIS)

Kurishita, A.; Ono, T.

1992-01-01

Radiation induced hematopoietic and gastro-intestinal damages in mice were tried to alleviate experimentally by post-treatment. Combined treatment of OK-432 and aztreonam clearly prevented the radiation induced sepsis and elevated the survival rate in mice; the survival was 80% in the OK-432 plus aztreonam group while it was 55% in the group treated with OK-432 alone and 0% with saline. Irsogladine maleate, an anti-ulcer drug, increased the survival rate of jejunal crypt stem cells with a clear dose-related trend. The D 0 for irsogladine maleate was 2.8 Gy although it was 2.3 Gy for saline, These findings suggest that some conventional drugs are effective for radiation induced hematopoietic and gastro-intestinal damages and the possibility that they can be applied for people exposed to radiation accidentally. (author)

A phase I study of vaccination with NY-ESO-1f peptide mixed with Picibanil OK-432 and Montanide ISA-51 in patients with cancers expressing the NY-ESO-1 antigen.

Science.gov (United States)

Kakimi, Kazuhiro; Isobe, Midori; Uenaka, Akiko; Wada, Hisashi; Sato, Eiichi; Doki, Yuichiro; Nakajima, Jun; Seto, Yasuyuki; Yamatsuji, Tomoki; Naomoto, Yoshio; Shiraishi, Kenshiro; Takigawa, Nagio; Kiura, Katsuyuki; Tsuji, Kazuhide; Iwatsuki, Keiji; Oka, Mikio; Pan, Linda; Hoffman, Eric W; Old, Lloyd J; Nakayama, Eiichi

2011-12-15

We conducted a phase I clinical trial of a cancer vaccine using a 20-mer NY-ESO-1f peptide (NY-ESO-1 91-110) that includes multiple epitopes recognized by antibodies, and CD4 and CD8 T cells. Ten patients were immunized with 600 μg of NY-ESO-1f peptide mixed with 0.2 KE Picibanil OK-432 and 1.25 ml Montanide ISA-51. Primary end points of the study were safety and immune response. Subcutaneous injection of the NY-ESO-1f peptide vaccine was well tolerated. Vaccine-related adverse events observed were fever (Grade 1), injection-site reaction (Grade 1 or 2) and induration (Grade 2). Vaccination with the NY-ESO-1f peptide resulted in an increase or induction of NY-ESO-1 antibody responses in nine of ten patients. The sera reacted with recombinant NY-ESO-1 whole protein as well as the NY-ESO-1f peptide. An increase in CD4 and CD8 T cell responses was observed in nine of ten patients. Vaccine-induced CD4 and CD8 T cells responded to NY-ESO-1 91-108 in all patients with various HLA types with a less frequent response to neighboring peptides. The findings indicate that the 20-mer NY-ESO-1f peptide includes multiple epitopes recognized by CD4 and CD8 T cells with distinct specificity. Of ten patients, two with lung cancer and one with esophageal cancer showed stable disease. Our study shows that the NY-ESO-1f peptide vaccine was well tolerated and elicited humoral, CD4 and CD8 T cell responses in immunized patients. Copyright © 2011 UICC.

7 CFR 28.432 - Middling Tinged Color.

Science.gov (United States)

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Middling Tinged Color. 28.432 Section 28.432... REGULATIONS COTTON CLASSING, TESTING, AND STANDARDS Standards Tinged Cotton § 28.432 Middling Tinged Color. Middling Tinged Color is color which is within the range represented by a set of samples in the custody of...

Severe acute post-streptococcal glomerulonephritis in an infant

Directory of Open Access Journals (Sweden)

Jameela A Kari

2013-01-01

Full Text Available Acute post-streptococcal glomerulonephritis (APSGN is very rare below the age of two years. We report a 14-month-old girl who presented with frank hematuria and nephrotic syndrome following group A streptococcal pharyngitis (GAS, which was confirmed by laboratory investigations. The patient underwent a renal biopsy to confirm the diagnosis and was treated with prednisolone. The proteinuria and hematuria resolved completely in eight weeks. Our case demonstrates that APSGN should be considered in evaluating hematuria and nephrotic syndrome in infants and children below two years of age.

48 CFR 432.003 - Simplified acquisition procedures financing.

Science.gov (United States)

2010-10-01

... procedures financing. 432.003 Section 432.003 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING 432.003 Simplified acquisition procedures financing. (a) The chief of the contracting office may approve contract financing on a contract to be...

Streptococcal peritonitis in Australian peritoneal dialysis patients: predictors, treatment and outcomes in 287 cases

Directory of Open Access Journals (Sweden)

McDonald Stephen P

2009-07-01

Full Text Available Abstract Background There has not been a comprehensive, multi-centre study of streptococcal peritonitis in patients on peritoneal dialysis (PD to date. Methods The predictors, treatment and clinical outcomes of streptococcal peritonitis were examined by binary logistic regression and multilevel, multivariate poisson regression in all Australian PD patients involving 66 centres between 2003 and 2006. Results Two hundred and eighty-seven episodes of streptococcal peritonitis (4.6% of all peritonitis episodes occurred in 256 individuals. Its occurrence was independently predicted by Aboriginal or Torres Strait Islander racial origin. Compared with other organisms, streptococcal peritonitis was associated with significantly lower risks of relapse (3% vs 15%, catheter removal (10% vs 23% and permanent haemodialysis transfer (9% vs 18%, as well as a shorter duration of hospitalisation (5 vs 6 days. Overall, 249 (87% patients were successfully treated with antibiotics without experiencing relapse, catheter removal or death. The majority of streptococcal peritonitis episodes were treated with either intraperitoneal vancomycin (most common or first-generation cephalosporins for a median period of 13 days (interquartile range 8–18 days. Initial empiric antibiotic choice did not influence outcomes. Conclusion Streptococcal peritonitis is a not infrequent complication of PD, which is more common in indigenous patients. When treated with either first-generation cephalosporins or vancomycin for a period of 2 weeks, streptococcal peritonitis is associated with lower risks of relapse, catheter removal and permanent haemodialysis transfer than other forms of PD-associated peritonitis.

40 CFR 432.41 - Special definitions.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Special definitions. 432.41 Section 432.41 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND... definitions. For the purpose of this subpart: High-processing packinghouse means a packinghouse which...

Dendritic Cell-Based Adjuvant Vaccination Targeting Wilms’ Tumor 1 in Patients with Advanced Colorectal Cancer

Directory of Open Access Journals (Sweden)

Shigetaka Shimodaira

2015-12-01

Full Text Available Despite significant recent advances in the development of immune checkpoint inhibitors, the treatment of advanced colorectal cancer involving metastasis to distant organs remains challenging. We conducted a phase I study to investigate the safety and immunogenicity of Wilms’ tumor (WT1 class I/II peptides-pulsed dendritic cell DC vaccination for patients with advanced colorectal cancer. Standard treatment comprising surgical resection and chemotherapy was followed by one course of seven biweekly administrations of 1–2 × 107 DCs with 1–2 KE of OK-432 (streptococcal preparation in three patients. Clinical efficacy was confirmed based on WT1 expression using immunohistochemistry on paraffin-embedded tissues and immune monitoring using tetramer analysis and enzyme-linked immunosorbent spot (ELISPOT assays. WT1 expression with human leukocyte antigen (HLA-class I molecules was detected in surgical resected tissues. Adverse reactions to DC vaccinations were tolerable under an adjuvant setting. WT1-specific cytotoxic T cells were detected by both modified WT1-peptide/HLA-A*24:02 tetramer analysis and/or interferon-γ-producing cells through the use of ELISPOT assays after the first DC vaccination. Immunity acquired from DC vaccination persisted for two years with prolonged disease-free and overall survival. The present study indicated that DC vaccination targeting WT1 demonstrated the safety and immunogenicity as an adjuvant therapy in patients with resectable advanced colorectal cancer.

40 CFR 432.31 - Special definitions.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Special definitions. 432.31 Section 432.31 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND... definitions. For the purpose of this subpart: Low-processing packinghouse means a packinghouse that processes...

40 CFR 432.111 - Special definitions.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Special definitions. 432.111 Section 432.111 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND... definitions. For the purpose of this subpart: Poultry first processing means slaughtering of poultry and...

Guttate Psoriasis Following Streptococcal Vulvovaginitis in a Five-year-old Girl.

Science.gov (United States)

Hernandez, Melia; Simms-Cendan, Judith; Zendell, Kathleen

2015-10-01

Guttate psoriasis is frequently associated with a preceding pharyngeal or perianal streptococcal infection in children. Despite Group A beta-hemolytic streptococci (GABHS) being the most common cause of specific bacterial vulvovaginitis in prepubertal girls, there are no reports of streptococcal vulvovaginitis triggering guttate psoriasis. A five-year-old girl presented with guttate psoriasis following an episode of Streptococcal pyogenes vulvovaginitis. Following antibiotic treatment and bacterial eradication she developed vulvar psoriasis that resolved with high potency topical steroids. Identification of an antecedent streptoccocal infection can help predict the long term prognosis in children with guttate psoriasis. The vulvovaginal area should be considered as a source of GABHS infection in young girls with guttate psoriasis, and cultures should be considered if symptoms are present. Published by Elsevier Inc.

Identification of streptococcal proteins reacting with sera from Behçet's disease and rheumatic disorders.

Science.gov (United States)

Cho, Sung Bin; Lee, Ju Hee; Ahn, Keun Jae; Cho, Suhyun; Park, Yong-Beom; Lee, Soo-Kon; Bang, Dongsik; Lee, Kwang Hoon

2010-01-01

We evaluated the reactivity of sera from Behçet's disease (BD), systemic lupus erythematosus (SLE), dermatomyositis (DM), rheumatoid arthritis (RA), and Takayasu's arteritis (TA) patients against human α-enolase and streptococcal α-enolase, and identified additional streptococcal antigens. Enzyme-linked immunosorbent assay (ELISA) and immunoblotting were performed using sera from patients with BD, SLE, DM, RA, and TA and healthy volunteers (control) against human α-enolase and streptococcal α-enolase. Immunoblot analysis and matrix-assisted laser desorption ionisation-time-of-flight mass spectrometry were used to identify and recombine other streptococcal antigens. Specific positive signals against recombinant human α-enolase were detected by IgM ELISA of serum samples from 50% of BD, 14.3% of SLE, 57.1% of DM, 42.9% of RA, and 57.1% of TA patients. Specific positive signals against streptococcal α-enolase were detected from 42.9% of BD, 14.3% of DM, and 14.3% of TA patients. No SLE and RA sera reacted against streptococcal α-enolase antigen. Streptococcal proteins reacting with sera were identified as hypothetical protein (HP) for SLE and DM patients, acid phosphatase (AP) for RA patients, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for TA patients. We observed that RA patients did not present serum reactivity against either HP or GAPDH though BD, SLE, DM, and TA patients did. Also, AP reacted with sera from BD, SLE, DM, RA, and TA patients.

48 CFR 432.202-4 - Security for Government financing.

Science.gov (United States)

2010-10-01

... financing. 432.202-4 Section 432.202-4 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Commercial Item Purchase Financing 432.202-4 Security for Government financing. Prior to determining that an offeror's financial condition is adequate...

48 CFR 432.102 - Description of contract financing methods.

Science.gov (United States)

2010-10-01

... financing methods. 432.102 Section 432.102 Federal Acquisition Regulations System DEPARTMENT OF AGRICULTURE GENERAL CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.102 Description of contract financing methods. Progress payments based on a percentage or stage of completion are...

[Severe iatrogenic airway obstruction due to lingual lymphangioma].

Science.gov (United States)

Segado Arenas, A; Flores González, J-C; Rubio Quiñones, F; Quintero Otero, S; Hernández González, A; Pantoja Rosso, S

2011-09-01

Lymphangioma of the tongue is a rare and benign tumour involving congenital and cystic abnormalities derived from lymphatic vessels. Treatment modalities include surgery and a large number of different intralesional injections of sclerosing agents. Presently, OK-432 (Picibanil(®)) is the preferred sclerosant and when administered intralesionally will result in inflammation, sclerosis, and cicatricial contraction of the lesion. We report a case of microcystic lymphangioma of the tongue in a 5-year-old boy treated with an intralesional injection of OK-432. In the immediate postoperative period, the patient suffered severe diffuse swelling, progressive upper airway obstruction with inspiratory stridor, and respiratory distress requiring emergency fiberoptic nasotracheal intubation. Although OK-432 injections are found to be safe and effective as a first line of treatment for lymphangiomas, local swelling with potentially life-threatening airway compromise should be anticipated, especially when treating lesions near the upper airway. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Intrapleural chemo- and hyperthermotherapies for malignant pleural effusion: a randomized prospective study.

Science.gov (United States)

Chen, Wen-Jun; Yuan, Shao-Fei; Yan, Qing-Yuan; Xiong, Jian-Ping; Wang, Sen-Ming; Zheng, Wei-E; Zhang, Wu; Sun, Hong-Yu; Chen, Hua; Wu, Li-Li

2012-02-01

The current prospective randomized study was designed to evaluate the safety and efficacy of combined intrapleural cisplatin and OK-432 (picibanil) plus hyperthermotherapy in patients with malignant pleural effusion (MPE). A total of 358 patients with MPE due to end-stage malignancies were enrolled and randomly divided into two groups, A and B: the intrapleural combination of cisplatin and OK-432 with hyperthermotherapy (n = 179) or without hyperthermotherapy (n = 179), respectively. Mild toxicities such as nausea, vomiting or anorexia, bone marrow depression, and pyrexia were similar in both groups. Patients in Group A (with hyperthermotherapy) showed a significantly higher overall response (93.4%) compared to those in Group B (79.8%, χ(2) = 43.11, p .05). After treatment, the quality of life scores were significantly increased in both groups as compared to prior treatment (p < .05). In conclusion, our study suggests that combined intrapleural cisplatin and OK-432 followed by hyperthermotherapy are more effective in the control of MPE and improve patients' quality of life.

Balance control impairment induced after OKS in patients with vestibular migraine: an intercritical marker.

Science.gov (United States)

Panichi, R; Cipriani, L; Sarchielli, P; Di Mauro, M; Pettorossi, V E; Ricci, G; Faralli, M

2015-09-01

The aim of the study was to assess the effects of optokinetic stimulation (OKS) on vestibular postural control in migraine patients with recurrent vertigo. 15 patients with vestibular migraine (VM) were enrolled in a posturographic study in eyes open (OE) and eyes closed (CE) condition. The tests were performed between attacks of headache and vertigo at three different time: before, during, and 60 min after OKS. Data of patients with VM were compared with those obtained from two control groups matched for sex and age (15 for each group): (a) normal subjects not suffering from migraine without history of recurrent vertigo (N group); (b) subjects suffering from migraine with no history of recurrent vertigo (M group). Mean sway path velocity and sway area were analyzed. OKS increased the instability in all groups during the stimulus, and both the velocity and area values were higher in M and VM group. However, there was not significant difference between these two groups when stability was examined in OE condition before, during and after OKS stimulation. Conversely, in CE condition a significant greater instability was induced after OKS stimulation only in VM. In particular, post-stimulus values were significantly higher than the pre-stimulus one only in this group, while no significant difference was observed in other groups. A spatial analysis of the sway area evidenced that the instability induced by the OKS in VM group occurred along the direction of OKS. We suggest that this enhanced instability observed after OKS during the intercritical period may be considered an useful marker to support the diagnostic definition of VM in the absence of other vestibular signs.

OK-Net Arable online knowledge platform

DEFF Research Database (Denmark)

Rasmussen, Ilse Ankjær; Jensen, Allan Leck; Jørgensen, Margit Styrbæk

2017-01-01

The complexity of organic farming requires farmers to have a very high level of knowledge and skills, but exchange on organic farming techniques remains limited. In order to increase productivity and quality in organic arable cropping in Europe, the thematic network OK-Net Arable under Horizon 20...

40 CFR 86.432-78 - Deterioration factor.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Deterioration factor. 86.432-78... 1978 and Later New Motorcycles, General Provisions § 86.432-78 Deterioration factor. (a) Deterioration factors shall be developed for each test vehicle from the emission test results. A separate factor shall...

CURRENT ASPECTS OF ACUTE STREPTOCOCCAL TONSILLOPHARYNGITIS DIAGNOSTICS IN CHILDREN

Directory of Open Access Journals (Sweden)

D. P. Polyakov

2013-01-01

Full Text Available Acute tonsillopharyngitis in children is one of the most common reasons for medical consultations. The majority of acute pharyngeal inflammatory diseases are viral. The frequency of bacterial tonsillopharyngitis in children (the main causative agent is group A Streptococcus, GAS is about 20–30%. In spite of it antibiotics are prescribed for 95% of patients, thus it is inappropriate. On the other hand misdiagnosis of acute streptococcal tonsillopharyngitis and antibiotics refusal can lead to suppurative and nonsuppurative rheumatic complications. Some prominent trials have shown a poor ability of signs and inflammatory biomarkers to identify tonsillopharyngitis streptococcal vs. viral. So it is impossible to use them as indication for antibiotic. The experience of clinical score use (McIsaac etc. have also demonstrated a poor prognostic value. As a result the throat swab culture is the «gold standard» of acute streptococcal tonsillopharyngitis. It has such limitations as rare microbiology labs, method technology, the price and the delay in obtaining result. An alternative technique is GAS rapid antigen detecting test (RADT for the identification of GAS directly from throat swabs. The world data shows a high sensitivity and specificity of modern RADTs.

Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal Infections: Role of Otolaryngologist

Directory of Open Access Journals (Sweden)

Emrah Kara

2015-03-01

Full Text Available Pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections, refers to a disorder in children who manifest symptoms of obsessive-compulsive disorder and/or tic disorders associated with acute exacerbations. Although autoimmune responses following infections with streptococcus have been hypothesized to be responsible, there is still controversies about the pathophysiology and treatment. In this article, the treatment methods of pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections and the role of otolaryngologist were discussed.

Effect of streptococcal preparation (picibanil) on the postoperative rise in serum alanine aminotransferase activity in patients with urogenital cancer.

OpenAIRE

Taketa, Kazuhisa; Ohmori, Hiroyuki; Matsumura, Yonesuke; Asahi, Toshihiko; Okimune, Masaaki

1980-01-01

The effect of Picibanil, a streptococcal agent, on the development of liver injury after operations for urogenital cancer was studied retrospectively in the light of serum alanine aminotransferase (ALT) activity. The series comprised 32 cases receiving Picibanil and 33 controls with otherwise comparable clinical backgrounds. Picibanil reduced the incidence of postoperative ALT rise over 50 U/l within 6 weeks but increased it thereafter. The increase in ALT activity after 6 weeks was relativel...

Brutally Unfair Tactics Totally OK Now

DEFF Research Database (Denmark)

Wilson, Douglas

2011-01-01

In this paper, I use a party game that I co-designed, Brutally Unfair Tactics Totally OK Now (B.U.T.T.O.N.), as a case study to suggest some alternative possibilities for the design of digitally-mediated play and games. Specifically, I argue that that intentionally “broken” or otherwise incomplet...

Microbubbles in macrocysts - Contrast-enhanced ultrasound assisted sclerosant therapy of a congenital macrocystic lymphangioma: a case report.

Science.gov (United States)

Menendez-Castro, Carlos; Zapke, Maren; Fahlbusch, Fabian; von Goessel, Heiko; Rascher, Wolfgang; Jüngert, Jörg

2017-07-06

Congenital cystic lymphangiomas are benign malformations due to a developmental disorder of lymphatic vessels. Besides surgical excision, sclerosant therapy of these lesions by intracavitary injection of OK-432 (Picibanil®), a lyophilized mixture of group A Streptococcus pyogenes, is a common therapeutical option. For an appropriate application of OK-432, a detailed knowledge about the structure and composition of the congenital cystic lymphangioma is essential. SonoVue® is a commercially available contrast agent commonly used in sonography by intravenous and intracavitary application. Here we report the case of 2 month old male patient with a large thoracic congenital cystic lymphangioma. Preinterventional imaging of the malformation was performed by contrast-enhanced ultrasound after intracavitary application of SonoVue® immediately followed by a successful sclerotherapy with OK-432. Contrast agent-enhanced ultrasound imaging offers a valuable option to preinterventionally clarify the anatomic specifications of a congenital cystic lymphangioma in more detail than by single conventional sonography. By the exact knowledge about the composition and especially about the intercystic communications of the lymphangioma sclerosant therapy becomes safer and more efficient.

Images and Metaphors, Mirrors of Social Concern in the Saga af Viktor ok Blavus

OpenAIRE

Mester, Annegret

2002-01-01

Images and Metaphors, Mirrors of Social Concern in the Saga af Viktor ok Blavus I wish to examine how the images and metaphors in the Saga af Viktor ok Blavus reflect the concerns of Icelandic society. Included among the metaphors are the personae which populate the saga. As in the Saints’ legends they are not characters but types and are therefore themselves metaphors. The opening stanzas of the Saga af Viktor ok Blavus comprise a reference to the translated riddarasögur which the ano...

Streptococcal Subdural Empyema as a Complication of Varicella

Directory of Open Access Journals (Sweden)

J Gordon Millichap

2005-01-01

Full Text Available A 3-month-old male infant who presented with a group A streptococcal subdural empyema on day 5 of a varicella skin rash is reported from the University of British Columbia, Vancouver, BC, Canada.

Beta-hemolytic Streptococcal Bacteremia

DEFF Research Database (Denmark)

Nielsen, Hans Ulrik; Kolmos, Hans Jørn; Frimodt-Møller, Niels

2002-01-01

Bacteremia with beta-hemolytic Streptococci groups A, B, C and G has a mortality rate of approximately 20%. In this study we analyzed the association of various patient risk factors with mortality. Records from 241 patients with beta-hemolytic streptococcal bacteremia were reviewed with particular...... attention to which predisposing factors were predictors of death. A logistic regression model found age, burns, immunosuppressive treatment and iatrogenic procedures prior to the infection to be significant predictors of death, with odds ratios of 1.7 (per decade), 19.7, 3.6 and 6.8, respectively...

Streptococcal tonsillopharyngitis – principles ofdiagnosis and treatment

Directory of Open Access Journals (Sweden)

Marcin Dziekiewicz

2016-06-01

Full Text Available Tonsillopharyngitis is one of the main causes of medical appointments. In fact, a seemingly simple diagnosis and treatment causes various problems and is the reason of many problems and errors, including antibiotic misuse or overuse. The most frequent aetiological agents of pharyngitis relate to viruses. A carefully taken medical history and physical examination can help distinguish patients in whom bacterial (streptococcal aetiology should be suspected. However, signs and symptoms themselves do not usually allow the correct diagnosis to be established. A clinical suspicion of bacterial infection must be confirmed microbiologically. The best practice is a throat culture. Rapid tests for the presence of Streptococcus pyogenes antigen are a convenient alternative. They are characterised by high sensitivity and specificity. The  first-line treatment in streptococcal tonsillopharyngitis is phenoxymethylpenicillin used for 10 days. Streptococcus pyogenes is uniformly sensitive to this antibiotic. Cefadroxil is reserved for patients with non-immediate hypersensitivity to penicillin and Streptococcus pyogenes carriers. Macrolides, in turn, should be used only if immediate hypersensitivity occurs. In this case, 3–5-day treatment with azithromycin is a convenient alternative to clarithromycin. It is important to use its high, double doses – the standard dose is ineffective. Treatment of streptococcal tonsillopharyngitis with amoxicillin, amoxicillin with clavulanic acid and cefuroxime axetil is considered inappropriate and harmful. These are relatively broad-spectrum antibiotics, but their overuse is conductive to the spread of pneumococci of reduced penicillin sensitivity.

28 CFR 43.2 - Obligations of persons receiving care and treatment.

Science.gov (United States)

2010-07-01

... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Obligations of persons receiving care and treatment. 43.2 Section 43.2 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) RECOVERY OF COST OF HOSPITAL AND MEDICAL CARE AND TREATMENT FURNISHED BY THE UNITED STATES § 43.2 Obligations of persons...

27 CFR 4.32a - Voluntary disclosure of major food allergens.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Voluntary disclosure of major food allergens. 4.32a Section 4.32a Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX... Requirements for Wine § 4.32a Voluntary disclosure of major food allergens. (a) Definitions. For purposes of...

Percutaneous sclerotherapy of pediatric lymphatic malformations: experience and outcomes according to the agent used.

Science.gov (United States)

Gallego Herrero, C; Navarro Cutillas, V

Analyze statistically the success, number of sessions required and complete duration of treatment of agents used in pediatric percutaneous sclerotherapy of lymphatic malformations, to determine the most suitable. Retrospective study based on outcomes from percutaneous sclerotherapy performed on lymphatic malformations of 56 patients conducted by pediatric interventional radiologist for 14 years. As first approach, the procedure consists of ultrasound-guided introduction of sclerosing agent. Sessions were repeated until clinical resolution. Success, number of sessions and the duration of treatment were recorded and statistical treatment of the data was performed to obtain further conclusions. Lost patients in follow up and other minority agents used were excluded from the data. Eventually, 52 patients treated with OK432 (n=29), Ethibloc (n=5) and combination therapy (n=18) were included. The average number of sessions and duration in months of treatment was respectively 2.38 and 8.6 for OK432, 1.4 and 5.6 for Ethibloc, and 1.83 and 2.30 for dual therapy. The results were statistically significant for the difference in duration between OK432 and dual therapy. Also, 60-80% of patients reached proper results related to success, but the difference was no significant among the agents. Other demographic and anatomical variables were analyzed, not showing any difference, which supports the homogeneity of the sample. Despite of no significant difference in success and number of sessions among agents, longer duration of treatment with OK432 than dual therapy could mean greater health costs and probably greater disturb for patient and family. Copyright © 2017 SERAM. Publicado por Elsevier España, S.L.U. All rights reserved.

77 FR 19691 - Notice of Inventory Completion: Sam Noble Oklahoma Museum of Natural History, Norman, OK

Science.gov (United States)

2012-04-02

... Natural History, Norman, OK. The human remains and associated funerary objects were removed from Le Flore... Flore County, OK. The mound site was excavated by the Works Progress Administration (WPA), under the...

40 CFR 52.432 - Significant deterioration of air quality.

Science.gov (United States)

2010-07-01

... quality. 52.432 Section 52.432 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... deterioration of air quality. (a) The requirements of sections 160 through 165 of the Clean Air Act are not met... air quality. (b) Regulation for preventing significant deterioration of air quality. The provisions of...

Acute Rheumatic Fever versus Post-Streptococcal Reactive Arthritis

International Nuclear Information System (INIS)

Ashry, K.M.

2009-01-01

Rheumatic fever is an inflammatory disease that may develop after a Group A streptococcal infection and can involve the heart, joints, skin, and brain. A migrating polyarthritis after throat infection with group A β-haemolytic streptococci is classically attributed to acute rheumatic fever (ARF). Sterile non-migratory arthritis may occur as a separate entity, the so called post streptococcal reactive arthritis (PSRA). This study aimed to identify clinical and serological differences of patients with reactive arthritis after infection with Lance field group Aβ-haemolytic streptococci, compared with acute rheumatic fever. Hundred and twenty patients were recruited for the study , they were classified into two groups according to the diagnosis of ARF and PSRA patients consecutively seen in the Rheumatology and the Pediatric wards. Clinical and laboratory data were assessed through a questionnaire. The diagnosis of rheumatic fever was made based on revised modified Jones' criteria, while the diagnosis of post streptococcal reactive arthritis was made based on Deighton criteria; these associated with laboratory data, electrocardiography, chest X-ray, and bi-dimensional echocardiography. Results revealed no significant differences between both groups as regard age where ρ>0.05, while there were a significant difference regarding the date of antecedent upper respiratory tract infection (ρ 0.05). Regarding the cardio logical changes P-R interval by ECG was prolonged in 19 patients (31.67%)and Echo study showed changes in 12 patient (20%) of cases of ARF patient only. On the basis of simple laboratory variables and management, it ws possible to differentiate ARF from PSRA patients. So it could be concluded that these two conditions are actually distinct identities

Tõeline elamus: Oks ja Edur viimast korda kodulaval / Kristiina Garancis

Index Scriptorium Estoniae

Garancis, Kristiina, 1969-

2009-01-01

7. veebruaril Jõhvi kontserdimajas balletifestivali raames etendunud P. Tšaikovski balletist "Uinuv kaunitar" Peterburi Riikliku Klassikalise Balleti Teatri trupi esituses, peaosades Age Oks, Toomas Edur

Chemotherapy and Sex: Is Sexual Activity OK during Treatment?

Science.gov (United States)

... OK during treatment? Is it safe to have sex with my husband while undergoing chemotherapy? Answers from ... best to discuss any concerns about chemotherapy and sex with your doctor, who's familiar with your individual ...

Emission analysis of Tb3+ -and Sm3+ -ion-doped (Li2 O/Na2 O/K2 O) and (Li2 O + Na2 O/Li2 O + K2 O/K2 O + Na2 O)-modified borosilicate glasses.

Science.gov (United States)

Naveen Kumar Reddy, B; Sailaja, S; Thyagarajan, K; Jho, Young Dahl; Sudhakar Reddy, B

2018-05-01

Four series of borosilicate glasses modified by alkali oxides and doped with Tb 3+ and Sm 3+ ions were prepared using the conventional melt quenching technique, with the chemical composition 74.5B 2 O 3 + 10SiO 2 + 5MgO + R + 0.5(Tb 2 O 3 /Sm 2 O 3 ) [where R = 10(Li 2 O /Na 2 O/K 2 O) for series A and C, and R = 5(Li 2 O + Na 2 O/Li 2 O + K 2 O/K 2 O + Na 2 O) for series B and D]. The X-ray diffraction (XRD) patterns of all the prepared glasses indicate their amorphous nature. The spectroscopic properties of the prepared glasses were studied by optical absorption analysis, photoluminescence excitation (PLE) and photoluminescence (PL) analysis. A green emission corresponding to the 5 D 4 → 7 F 5 (543 nm) transition of the Tb 3+ ions was registered under excitation at 379 nm for series A and B glasses. The emission spectra of the Sm 3+ ions with the series C and D glasses showed strong reddish-orange emission at 600 nm ( 4 G 5/2 → 6 H 7/2 ) with an excitation wavelength λ exci = 404 nm ( 6 H 5/2 → 4 F 7/2 ). Furthermore, the change in the luminescence intensity with the addition of an alkali oxide and combinations of these alkali oxides to borosilicate glasses doped with Tb 3+ and Sm 3+ ions was studied to optimize the potential alkali-oxide-modified borosilicate glass. Copyright © 2017 John Wiley & Sons, Ltd.

Group B streptococcal metastatic endophthalmitis.

Science.gov (United States)

Nagelberg, H P; Petashnick, D E; To, K W; Woodcome, H A

1994-04-15

Reports of invasive Group B Streptococcus infection in adults with underlying medical conditions have been increasing. Ocular infection with this organism is unusual. Metastatic endophthalmitis in adults caused by this organism has been reported rarely and has only been associated with endocarditis. We encountered two cases of Group B streptococcal metastatic endophthalmitis in adults who did not have endocarditis. These cases reflect the increasing incidence of invasive Group B Streptococcus infection with its varying manifestations. Additionally, they emphasize the importance of considering this pathogen as a cause of metastatic endophthalmitis in adults with predisposing illnesses.

Successful Treatment of Necrotizing Fasciitis and Streptococcal Toxic Shock Syndrome with the Addition of Linezolid

Directory of Open Access Journals (Sweden)

Hana Rac

2017-01-01

Full Text Available Necrotizing fasciitis is a deep-seated subcutaneous tissue infection that is commonly associated with streptococcal toxic shock syndrome (TSS. Surgical debridement plus penicillin and clindamycin are the current standard of care. We report a case of necrotizing fasciitis and streptococcal TSS where linezolid was added after a failure to improve with standard therapy. Briefly after isolation of Streptococcus pyogenes from tissue cultures, the patient underwent two surgical debridement procedures and was changed to standard of care therapy. While the patient was hemodynamically stable, the patient’s wounds, leukocytosis, and thrombocytopenia all progressively worsened. After initiation of linezolid, the patient slowly improved clinically. The present report is the first to highlight the role of linezolid in streptococcal necrotizing fasciitis and TSS not improving with standard therapy.

Post-streptococcal glomerulonephritis

Directory of Open Access Journals (Sweden)

Odalovic A.

2014-01-01

Full Text Available Post-streptococcal glomerulonephritis (PSGN is a frequent cause of acute nephritis in children. This case study was done with the aim to point out that the infections caused by Group A streptococci, in spite of antibiotic era, are still present in the population. An 8-year old boy was admitted in our hospital with a two-day history of fewer, tonsillopharyngitis. After hospital admission, patient was treated with penicillin during the period of 10 days, antihypertensive medications (captopril, furosemide, including restricted diet of salt. After the treatment, patient became better. On demission it was found proteinuria and microhematuria PSGN is very serious disease, which leaves severe complications if the valid therapy with penicillin is not used in propriety time, during the recommended period of 10 days.

Archaeological Investigations at Sites 45-OK-2 and 45-OK-2A, Chief Joseph Dam Project, Washington.

Science.gov (United States)

1984-01-01

on the floor of Feature 49. RANUNCULACEAE (Buttercup Family ) Clematis L. (virgin’s bower) , A small section of clematis stem was found in occupation...assemblage, 4,951 fragments (approximately 2%) were identified to at least the family level. Eighty-eight percent of the Identified elements represented...93 elements, 45-OK-2A -- 28 elements. Snake vertebrae were Identified to family on the basis of size. There are _1 at least four species of snakes

Pediatric Autoimmune Neuropsychiatric Disorder Associated with Streptococcal Infections (PANDAS): Experience at a Tertiary Referral Center

OpenAIRE

Singer, Harvey S.

2015-01-01

The entity Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal infections (PANDAS) was initially proposed in 1998 (Swedo, et al. 1998). The formal diagnosis required that the affected individual meet five specific criteria: prepubertal onset, obsessive compulsive disorder (OCD) and/or a tic disorder, the dramatic sudden explosive onset of symptoms, a relapsing and remitting course of symptoms that are temporally associated with Group A beta-hemolytic streptococcal (G...

Optic atrophy, necrotizing anterior scleritis and keratitis presenting in association with Streptococcal Toxic Shock Syndrome: a case report

Directory of Open Access Journals (Sweden)

Papageorgiou Konstantinos I

2008-02-01

Full Text Available Abstract Introduction We report a case of optic atrophy, necrotizing anterior scleritis and keratitis presenting in a patient with Streptococcal Toxic Shock Syndrome. Case presentation A 43-year-old woman developed streptococcal toxic shock syndrome secondary to septic arthritis of her right ankle. Streptococcus pyogenes (b-haemolyticus Group A was isolated from blood cultures and joint aspirate. She was referred for ophthalmology review as her right eye became injected and the pupil had become unresponsive to light whilst she was in the Intensive Therapy Unit (ITU. The iris appeared atrophic and was mid-dilated with no direct or consensual response to light. Three zones of sub-epithelial opacification where noted in the cornea. There where extensive posterior synechiae. Indirect ophthalmoscopy showed a pale right disc. The vision was reduced to hand movements (HM. A diagnosis of optic atrophy was made secondary to post-streptococcal uveitis. She subsequently developed a necrotizing anterior scleritis. Conclusion This case illustrates a previously unreported association of optic atrophy, necrotizing anterior scleritis and keratitis in a patient with post-streptococcal uveitis. This patient had developed Streptococcal Toxic Shock Syndrome secondary to septic arthritis. We recommend increased awareness of the potential risks of these patients developing severe ocular involvement.

Evolutionary paths of streptococcal and staphylococcal superantigens

Directory of Open Access Journals (Sweden)

Okumura Kayo

2012-08-01

Full Text Available Abstract Background Streptococcus pyogenes (GAS harbors several superantigens (SAgs in the prophage region of its genome, although speG and smez are not located in this region. The diversity of SAgs is thought to arise during horizontal transfer, but their evolutionary pathways have not yet been determined. We recently completed sequencing the entire genome of S. dysgalactiae subsp. equisimilis (SDSE, the closest relative of GAS. Although speG is the only SAg gene of SDSE, speG was present in only 50% of clinical SDSE strains and smez in none. In this study, we analyzed the evolutionary paths of streptococcal and staphylococcal SAgs. Results We compared the sequences of the 12–60 kb speG regions of nine SDSE strains, five speG+ and four speG–. We found that the synteny of this region was highly conserved, whether or not the speG gene was present. Synteny analyses based on genome-wide comparisons of GAS and SDSE indicated that speG is the direct descendant of a common ancestor of streptococcal SAgs, whereas smez was deleted from SDSE after SDSE and GAS split from a common ancestor. Cumulative nucleotide skew analysis of SDSE genomes suggested that speG was located outside segments of steeper slopes than the stable region in the genome, whereas the region flanking smez was unstable, as expected from the results of GAS. We also detected a previously undescribed staphylococcal SAg gene, selW, and a staphylococcal SAg -like gene, ssl, in the core genomes of all Staphylococcus aureus strains sequenced. Amino acid substitution analyses, based on dN/dS window analysis of the products encoded by speG, selW and ssl suggested that all three genes have been subjected to strong positive selection. Evolutionary analysis based on the Bayesian Markov chain Monte Carlo method showed that each clade included at least one direct descendant. Conclusions Our findings reveal a plausible model for the comprehensive evolutionary pathway of streptococcal and

Energy content of hybrid Rumex patienta L. x Rumex tianschanicus A. Los. (Rumex OK 2 samples from autumn months

Directory of Open Access Journals (Sweden)

Michal Rolinec

2018-03-01

Full Text Available Aim of this experiment was to determine the gross energy concentration of fresh, wilted and ensiled hybrid of Rumex patientia L. x Rumex tianschanicus A. Los. (Rumex OK 2. Samples were collected in autumn months of the year 2017. The plant of Rumex OK 2 consist during autumn months only from rosette of leaves. The height of leaves was in autumn months following, September 56.68±13.80 cm; October 59.29±11.93 cm and November 55.98±10.80 cm. Rumex OK 2 silage was made from wilted matter, with or without of addition of dried molasses. Gross energy was determined as the heat released after combustion of a sample (Leco AC 500 in MJ per kilogram of dry matter of the sample. By the autumn months the concentration of dry matter, as well as the concentration of gross energy increased, except Rumex OK 2 silage from November. The highest concentration of gross energy had wilted Rumex OK 2 from November (18.02 MJ.kg-1 of dry matter. There was no significant effect of addition of dried molasses to wilted Rumex OK 2 before ensiling on gross energy concentration in Rumex OK 2 silages (P>0.05. Gross energy concentration of all types of analysed samples had relative high value (16.98 to 18.02 MJ.kg-1 of dry matter. Fresh or ensiled Rumex OK 2 can be used as a part of feed ratio for ruminants or can be utilised in biogas station. However, due to the low content of dry mater in fresh or wilted material the production of silage can be in autumn months problematic.

Sclerotherapy for lymphatic malformations in children: a scoping review.

Science.gov (United States)

Churchill, Paige; Otal, Damanjot; Pemberton, Julia; Ali, Abdullah; Flageole, Helene; Walton, J Mark

2011-05-01

This scoping review assesses the literature and summarizes the current evidence on sclerotherapy for the treatment of lymphatic malformations in pediatric patients. A comprehensive search of published and unpublished literature was conducted using multiple databases. Title, abstract, and full-text screening was conducted by 2 independent clinicians. All discrepancies were resolved during consensus meetings. A total of 182 articles were retrieved. Forty-four articles were removed as duplicates, and 11 articles were added after reviewing prominent studies. After full-text abstraction, 44 articles and 2 conference proceedings (N = 882 patients) were included in the final results. Twelve articles were classified as level II and 34 articles as level IV evidence. Picibanil (OK-432) was the primary agent used in most included studies. Postinjection symptoms with OK-432 were primarily fever, swelling, and erythema at the site. Life-threatening complications were uncommon and involved postinjection swelling of cervical lesions causing airway compromise. The literature regarding sclerotherapy for lymphatic malformations is of a low level of evidence and suffers from a lack of standardization. Randomized clinical trials focused on OK-432, bleomycin, or alcoholic solution of zein; standardized dosing protocols; and consistent and reliable outcome reporting will be necessary for further development of treatment guidelines. Copyright © 2011 Elsevier Inc. All rights reserved.

48 CFR 432.006-4 - Procedures.

Science.gov (United States)

2010-10-01

... REQUIREMENTS CONTRACT FINANCING 432.006-4 Procedures. (a) Immediately upon submittal of the referral described... decision making process. (c) The OIG will determine the need for and the extent of an investigation. (d...

75 FR 5015 - Television Broadcasting Services; Oklahoma City, OK

Science.gov (United States)

2010-02-01

...] Television Broadcasting Services; Oklahoma City, OK AGENCY: Federal Communications Commission. ACTION... procedures for comments, see 47 CFR 1.415 and 1.420. List of Subjects in 47 CFR Part 73 Television, Television broadcasting. For the reasons discussed in the preamble, the Federal Communications Commission...

42 CFR 432.31 - Training and use of subprofessional staff.

Science.gov (United States)

2010-10-01

... 42 Public Health 4 2010-10-01 2010-10-01 false Training and use of subprofessional staff. 432.31...; Subprofessional and Volunteer Programs § 432.31 Training and use of subprofessional staff. (a) State plan requirement. A State plan must provide for the training and effective use of subprofessional staff as...

Effect of Fluoride Mouthrinse and Toothpaste on Number of Streptococcal Colony Forming Units of Dental Plaque

Directory of Open Access Journals (Sweden)

SE Jabbarifar

2005-11-01

Full Text Available Background: Frequent topical fluoride therapy through toothpaste, mouthrinse, professional gels and solutions causes decrease in incidence, pause and repair of dental caries in the enamel. These mechanisms are done through penetration of fluoride ions (F- and their replacement with hydroxyl ions (OH- of hydroxyappatite of enamel, interfere with microbial metabolism of dental plaque and bacteriostatic effect on some cariogenic bacterial strains such as streptococci. The aim of this study was to examine the effect of fluoride mouthrinse and toothpaste on the number of streptococcal colony forming units of dental plaque. Methods: 62 children with 6-7 years old were put in two groups. Samples of dental plaque from each group were collected both before and after use of the fluoride mouthrinse and or toothpaste. The samples were cultured on blood agar to find the number of streptococcal colony forming units (CFU. The mean colony forming unit was compared inter and intra groups before and after application of Fluoride products. Results: The streptococcal CFU of dental plaque before and after use of the mouthrinse and toothpaste respectively was (1240±1367, 1253±1341.5 and (551±716, 898±1151. Statistically, the streptococcal CFU in each group before and after use of the toothpaste and mouthrinse was significantly different. Conclusion: The findings of this study indicated that the fluoride toothpaste and mouthrinse reduce number of streptococcal colony forming units of dental plaque. Also this reduction was not depended on level of (F- Ions, sort of vehicle of fluoride and frequent application of the fluoride mouthrinse and toothpaste. Keywords: fluoride mouthrinse, fluoride toothpaste, colony forming unit (CFU, streptococcus

[Therapeutic response to plasmapheresis in four cases with obsessive-compulsive disorder and tic disorder triggered by streptococcal infections].

Science.gov (United States)

Beşiroğlu, Lütfullah; Ağargün, Mehmet Yücel; Ozbebit, Ozgür; Sözen, Mehmet; Dilek, Imdat; Güleç, Mustafa

2007-01-01

The acronym PANDAS (pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections) has been assigned to a subgroup of patients experiencing pediatric onset obsessive-compulsive symptoms and tics as a result of autoimmune response to group A beta-hemolytic streptococcal infection. It has been hypothesized that an immune process initiated by infection affects the basal ganglia and causes neuropsychiatric symptoms. In cases with severe neuropsychiatric symptoms, the use of treatment strategies that interrupt the autoimmune process responsible for the pathogenesis of PANDAS, such as therapeutic plasmapheresis or intravenous immunoglobulin, has been proposed. In this paper, we discuss the effect of plasmapheresis treatment in 4 adult cases of obsessive-compulsive disorder and tic disorder triggered by streptococcal infections.

Behavioral, Pharmacological, and Immunological Abnormalities after Streptococcal Exposure: A Novel Rat Model of Sydenham Chorea and Related Neuropsychiatric Disorders

Science.gov (United States)

Brimberg, Lior; Benhar, Itai; Mascaro-Blanco, Adita; Alvarez, Kathy; Lotan, Dafna; Winter, Christine; Klein, Julia; Moses, Allon E; Somnier, Finn E; Leckman, James F; Swedo, Susan E; Cunningham, Madeleine W; Joel, Daphna

2012-01-01

Group A streptococcal (GAS) infections and autoimmunity are associated with the onset of a spectrum of neuropsychiatric disorders in children, with the prototypical disorder being Sydenham chorea (SC). Our aim was to develop an animal model that resembled the behavioral, pharmacological, and immunological abnormalities of SC and other streptococcal-related neuropsychiatric disorders. Male Lewis rats exposed to GAS antigen exhibited motor symptoms (impaired food manipulation and beam walking) and compulsive behavior (increased induced-grooming). These symptoms were alleviated by the D2 blocker haloperidol and the selective serotonin reuptake inhibitor paroxetine, respectively, drugs that are used to treat motor symptoms and compulsions in streptococcal-related neuropsychiatric disorders. Streptococcal exposure resulted in antibody deposition in the striatum, thalamus, and frontal cortex, and concomitant alterations in dopamine and glutamate levels in cortex and basal ganglia, consistent with the known pathophysiology of SC and related neuropsychiatric disorders. Autoantibodies (IgG) of GAS rats reacted with tubulin and caused elevated calcium/calmodulin-dependent protein kinase II signaling in SK-N-SH neuronal cells, as previously found with sera from SC and related neuropsychiatric disorders. Our new animal model translates directly to human disease and led us to discover autoantibodies targeted against dopamine D1 and D2 receptors in the rat model as well as in SC and other streptococcal-related neuropsychiatric disorders. PMID:22534626

75 FR 13236 - Television Broadcasting Services; Oklahoma City, OK

Science.gov (United States)

2010-03-19

... FEDERAL COMMUNICATIONS COMMISSION 47 CFR Part 73 [DA 10-395; MB Docket No. 10-19; RM-11589] Television Broadcasting Services; Oklahoma City, OK AGENCY: Federal Communications Commission. ACTION: Final... review Act, see 5 U.S.C. 801(a)(1)(A). List of Subjects in 47 CFR Part 73 Television, Television...

Management of guttate psoriasis in patients with associated streptococcal infection

Directory of Open Access Journals (Sweden)

Karabudak Abuaf O

2012-11-01

Full Text Available Özlem Karabudak Abuaf, Bilal DoganDepartment of Dermatology, GATA Haydarpasa Teaching Hospital, Istanbul, TurkeyAbstract: Psoriasis is a T cell-mediated inflammatory skin disease. It can be provoked or exacerbated by environmental factors, particularly medications and infections. Guttate psoriasis is a distinctive acute form of psoriasis that generally occurs in children and young adults. The association between guttate psoriasis and Streptococcus pyogenes is well established in medical literature; however, the exact mechanism can only be theorized. Treatment guidelines are not established, and it is unclear how necessary antibiotics are for acute state guttate psoriasis. Many dermatologists have recommended using antibiotic therapy or tonsillectomy, especially for patients with recurrent streptococcal infections. This paper briefly summarizes the possible mechanisms of pathogenesis and the recent research results on this topic and examines under what conditions a curative treatment of streptococcal infection by tonsillectomy or antibiotic treatment may benefit psoriasis patients.Keywords: guttate, psoriasis, treatment, Streptococcus pyogenes

The transcriptome of the Didelphis virginiana opossum kidney OK proximal tubule cell line.

Science.gov (United States)

Eshbach, Megan L; Sethi, Rahil; Avula, Raghunandan; Lamb, Janette; Hollingshead, Deborah J; Finegold, David N; Locker, Joseph D; Chandran, Uma R; Weisz, Ora A

2017-09-01

The OK cell line derived from the kidney of a female opossum Didelphis virginiana has proven to be a useful model in which to investigate the unique regulation of ion transport and membrane trafficking mechanisms in the proximal tubule (PT). Sequence data and comparison of the transcriptome of this cell line to eutherian mammal PTs would further broaden the utility of this culture model. However, the genomic sequence for D. virginiana is not available and although a draft genome sequence for the opossum Monodelphis domestica (sequenced in 2012 by the Broad Institute) exists, transcripts sequenced from both species show significant divergence. The M. domestica sequence is not highly annotated, and the majority of transcripts are predicted rather than experimentally validated. Using deep RNA sequencing of the D. virginiana OK cell line, we characterized its transcriptome via de novo transcriptome assembly and alignment to the M. domestica genome. The quality of the de novo assembled transcriptome was assessed by the extent of homology to sequences in nucleotide and protein databases. Gene expression levels in the OK cell line, from both the de novo transcriptome and genes aligned to the M. domestica genome, were compared with publicly available rat kidney nephron segment expression data. Our studies demonstrate the expression in OK cells of numerous PT-specific ion transporters and other key proteins relevant for rodent and human PT function. Additionally, the sequence and expression data reported here provide an important resource for genetic manipulation and other studies on PT cell function using these cells. Copyright © 2017 the American Physiological Society.

Group B streptococcal immunisation of pregnant women for the prevention of early and late onset Group B streptococcal infection of the neonate as well as adult disease

DEFF Research Database (Denmark)

Kenchington, Anna L.; Lamont, Ronald F.

2017-01-01

of specific polyvalent vaccines continues, but testing has challenges and may require surrogate markers or molecular-based techniques to manipulate antigenicity and immunogenicity. Expert commentary: Group B streptococcal vaccination using conjugated polyvalent vaccines against the major disease causing...

Development of a panel of seven duplex real-time PCR assays for detecting 13 streptococcal superantigens.

Science.gov (United States)

Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi

2013-07-30

Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.

Influence of surface roughness on streptococcal adhesion forces to composite resins

NARCIS (Netherlands)

Mei, Li; Busscher, Henk J; van der Mei, Henny C; Ren, Yijin

OBJECTIVE: To determine streptococcal adhesion forces with composite resins with different surface roughness. METHODS: Polishing and grinding were applied to obtain smooth (roughness 20 nm), moderately rough (150 nm) and rough (350 nm) surfaces of two orthodontic, light-cured composites. Adhesion

Is neonatal group B streptococcal infection preventable?

LENUS (Irish Health Repository)

Azam, M

2011-05-01

Early onset group B streptococcal (EOGBS) infection causes significant neonatal morbidity and mortality. We determined the incidence of EOGBS at Galway University Hospital (GUH) and examined any "missed opportunities" for preventing neonatal infection between 2004 and 2009. Our obstetric approach is risk-based. The incidence was 0.45\\/1,000 live-births; one death and one with neurological sequelae. A single mother received IAP; however we could not determine any potential for reducing cases of EOGBS by improving current IAP usage.

Group C streptococcal sepsis complicating Fournier gangrene.

Science.gov (United States)

Marinella, Mark A

2005-09-01

Fournier gangrene is a life-threatening necrotizing fasciitis of the perineal-scrotal area that occurs in diabetic males. Patients typically present with systemic toxicity and significant inflammatory changes in the scrotum and perineum. Most cases of Fournier gangrene are polymicrobic and require urgent surgical debridement and broad-spectrum antibiotic therapy. We describe a case of Fournier gangrene in a young diabetic man that was associated with group C streptococcal bacteremia, an association previously unreported in the literature to our knowledge.

40 CFR 432.101 - Special definitions.

Science.gov (United States)

2010-07-01

... slaughterhouse, packinghouse or poultry dressing or processing operation, uses raw material at rates greater than... STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY Renderers § 432.101 Special definitions. For the... animal and poultry trimmings, bones, meat scraps, dead animals, feathers and related usable by-products...

Preparation of aluminium lakes by electrocoagulation

OpenAIRE

Prapai Pradabkham

2008-01-01

Aluminium lakes have been prepared by electrocoagulation employing aluminium as electrodes. The electrocoagulation is conducted in an aqueous alcoholic solution and is completed within one hour. The dye content in the lake ranges approximately between 4-32%.

40 CFR 432.1 - General Applicability.

Science.gov (United States)

2010-07-01

... waters of the U.S. from facilities engaged in the slaughtering, dressing and packing of meat and poultry products for human consumption and/or animal food and feeds. Meat and poultry products for human... STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY § 432.1 General Applicability. As defined more...

Preparation of aluminium lakes by electrocoagulation

Directory of Open Access Journals (Sweden)

Prapai Pradabkham

2008-07-01

Full Text Available Aluminium lakes have been prepared by electrocoagulation employing aluminium as electrodes. The electrocoagulation is conducted in an aqueous alcoholic solution and is completed within one hour. The dye content in the lake ranges approximately between 4-32%.

40 CFR 432.73 - Effluent limitations attainable by the application of the best available technology economically...

Science.gov (United States)

2010-07-01

... application of the best available technology economically achievable (BAT). 432.73 Section 432.73 Protection... POULTRY PRODUCTS POINT SOURCE CATEGORY Sausage and Luncheon Meats Processors § 432.73 Effluent limitations attainable by the application of the best available technology economically achievable (BAT). Except as...

40 CFR 432.72 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.72 Section 432.72... AND POULTRY PRODUCTS POINT SOURCE CATEGORY Sausage and Luncheon Meats Processors § 432.72 Effluent limitations attainable by the application of the best practicable control technology currently available (BPT...

40 CFR 432.77 - Effluent limitations attainable by the application of the best control technology for...

Science.gov (United States)

2010-07-01

... application of the best control technology for conventional pollutants (BCT). 432.77 Section 432.77 Protection... POULTRY PRODUCTS POINT SOURCE CATEGORY Sausage and Luncheon Meats Processors § 432.77 Effluent limitations attainable by the application of the best control technology for conventional pollutants (BCT). Except as...

OkCupid Data for Introductory Statistics and Data Science Courses

Science.gov (United States)

Kim, Albert Y.; Escobedo-Land, Adriana

2015-01-01

We present a data set consisting of user profile data for 59,946 San Francisco OkCupid users (a free online dating website) from June 2012. The data set includes typical user information, lifestyle variables, and text responses to 10 essay questions. We present four example analyses suitable for use in undergraduate introductory probability and…

Experimental performance of R432A to replace R22 in residential air-conditioners and heat pumps

International Nuclear Information System (INIS)

Park, Ki-Jung; Shim, Yun-Bo; Jung, Dongsoo

2009-01-01

In this study, thermodynamic performance of R432A and HCFC22 is measured in a heat pump bench tester under both air-conditioning and heat pumping conditions. R432A has no ozone depletion potential and very low greenhouse warming potential of less than 5. R432A also offers a similar vapor pressure to HCFC22 for 'drop-in' replacement. Test results showed that the coefficient of performance and capacity of R432A are 8.5-8.7% and 1.9-6.4% higher than those of HCFC22 for both conditions. The compressor discharge temperature of R432A is 14.1-17.3 deg. C lower than that of HCFC22 while the amount of charge for R432A is 50% lower than that of HCFC22 due to its low density. Overall, R432A is a good long term 'drop-in' environmentally friendly alternative to replace HCFC22 in residential air-conditioners and heat pumps due to its excellent thermodynamic and environmental properties

48 CFR 432.114 - Unusual contract financing.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Unusual contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 432.114 Unusual contract financing. The HCA is authorized to approve unusual contract financing. The signed determination and finding...

48 CFR 432.007 - Contract financing payments.

Science.gov (United States)

2010-10-01

... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING 432.007 Contract financing payments. The HCA may prescribe, on a case-by-case basis, a shorter period for financing payments. [61 FR 53646, Oct. 15, 1996. Redesignated...

Factors Associated with Streptococcal Bacteremia in Diarrheal Children under Five Years of Age and Their Outcome in an Urban Hospital in Bangladesh.

Directory of Open Access Journals (Sweden)

Abu Sadat Mohammad Sayeem Bin Shahid

Full Text Available Although Streptococcal bacteremia is common in diarrheal children with high morbidity and mortality, no systematic data are available on Streptococcal bacteremia in diarrheal children. We sought to evaluate the factors associated with Streptococcal bacteremia in diarrheal children under five years of age and their outcome.We used an unmatched case-control design to investigate the associated factors with Streptococcal bacteremia in all the diarrheal children under five years of age through electronic medical record system of Dhaka hospital of International Centre for Diarrhoeal Disease Research, Bangladesh. We had simultaneously used a retrospective cohort design to further evaluate the outcome of our study children. All the enrolled children had their blood culture done between January 2010 and December 2012. Comparison was made among the children with (cases = 26 and without Streptococcal bacteremia (controls = 78. Controls were selected randomly from hospitalized diarrheal children under five years of age.Cases had proportionately higher deaths compared to controls, but it was statistically insignificant (15% vs. 10%, p = 0.49. The cases more often presented with severe dehydration, fever, respiratory distress, severe sepsis, and abnormal mental status compared to the controls (for all p<0.05. In the logistic regression analysis, after adjusting for potential confounders, it has been found that Streptococcal bacteremia in diarrheal children under five years of age was independently associated with nutritional edema (OR: 5.86, 95% CI = 1.28-26.80, hypoxemia (OR: 19.39, 95% CI = 2.14-175.91, fever (OR: 4.44, 95% CI = 1.13-17.42, delayed capillary refill time (OR: 7.00, 95% CI = 1.36-35.93, and respiratory distress (OR: 2.69, 95% CI = 1.02-7.12.The results of our analyses suggest that diarrheal children under five years of age presenting with nutritional edema, hypoxemia, fever, delayed capillary refill time, and respiratory distress may be at

The effect of C1-esterase inhibitor in definite and suspected streptococcal toxic shock syndrome. Report of seven patients.

Science.gov (United States)

Fronhoffs, S; Luyken, J; Steuer, K; Hansis, M; Vetter, H; Walger, P

2000-10-01

To evaluate the effect of adjunctive C1-esterase inhibitor substitution therapy on clinical characteristics and outcome of patients with streptococcal toxic shock syndrome (TSS). Observational. Medizinische Poliklinik, University of Bonn, Germany. Seven patients with direct or indirect evidence of streptococcal TSS. In addition to conventional and supportive therapy, all patients received 2-3 single doses of C1-esterase inhibitor totaling 6,000-10,000 U within the first 24 h after admission. All patients developed fulminant septic shock, multiorgan failure and/or capillary leak syndrome and necrotizing fasciitis within 10-72 h following the onset of first symptoms. Between 1 and 4 days following administration of C1-esterase inhibitor, a marked shift of fluid from extravascular to intravascular compartments took place in all but one patient, accompanied by a transient intra-alveolar lung edema and rapidly decreasing need for adrenergic agents. Six of seven patients survived. These clinical observations in a small series of patients and the favorable outcome point towards a positive effect of early and high-dose administration of C1-esterase inhibitor as adjunctive therapy in streptococcal TSS. The possible mechanism involved may be the attenuation of capillary leak syndrome (CLS) via early inactivation of complement and contact systems. Controlled studies are needed to establish an improvement of the survival rates of patients with streptococcal TSS following administration of C1-esterase inhibitor.

27 CFR 4.32b - Petitions for exemption from major food allergen labeling.

Science.gov (United States)

2010-04-01

... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Petitions for exemption from major food allergen labeling. 4.32b Section 4.32b Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS LABELING AND ADVERTISING OF WINE...

40 CFR 432.5 - Incorporation by reference.

Science.gov (United States)

2010-07-01

... AND STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY § 432.5 Incorporation by reference. (a... Federal Register. The material is available for purchase at the address in paragraph (b) of this section..., Washington, DC. (b) The following material is available for purchase from the National Technical Information...

Experimental study on active specific immunotherapy utilizing the immune reaction of low-dose irradiated tumor tissue, 4

International Nuclear Information System (INIS)

Imanaka, Kazufumi; Ogawa, Yasuhiro; Gose, Kyuhei; Imajo, Yoshinari; Kimura, Shuji

1982-01-01

We have already reported that the effectiveness of active specific immunotherapy using low-dose irradiated tumor cells and infiltrating mononuclear cells. The present study was designed to investigate the effect of non-specific immunopotentiator combined with the active specific immunotherapy. Twelve-week-aged female C3H/He mice transplanted with MM46 tumor were received local radiotherapy with the dose of 3,000 rads by high energy electron beam on the sixth day after inoculation. Active specific immunotherapy was performed on the 13th day, and daily dose of 1.0 KE of OK-432 was injected intraperitoneally from the 13th day to the 17th day. The inhibition of the tumor growth and the elongation of survival period were noted in the group which received active specific immunotherapy combined with non-specific immunopotentiator, OK-432 compared with that active specific immunotherapy alone. (author)

Projekt OK-NET-ARABLE : mahetootmiseks vajalik teave tuleb tuua praktikuteni / Airi Vetemaa

Index Scriptorium Estoniae

Vetemaa, Airi

2015-01-01

OK-NET-ARABLE, mida võiks tõlkida kui põllukultuuride kasvatuse alast maheteabe võrgustikku, on ELi teadusrahastu Horisont 2020 projekt, mille eesmärk on vahendada innovaatilist ja traditsioonilist teavet mahetootjate, nõustajate ja teadlaste vahel, suurendamaks mahepõllukultuuride produktiivsust ja kvaliteeti üle Euroopa

Prepubertal unilateral gynecomastia and the presence of 47,XXY mosaicism in breast epithelial cells

DEFF Research Database (Denmark)

Andersen, Peter Stemann; Petersen, Bodil Laub; Juul, Anders

2013-01-01

, and sclerotherapy with Picibanil (OK-432) was attempted without any detectable effect on size. The mass was later excised. The pathological examination revealed mammary gland tissue suggestive of idiopathic gynecomastia. FISH revealed 47, XXY mosaicism in the abnormal breast epithelial cells, but not in peripheral...

42 CFR 412.432 - Method of payment under the inpatient psychiatric facility prospective payment system.

Science.gov (United States)

2010-10-01

... facility prospective payment system. 412.432 Section 412.432 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM PROSPECTIVE PAYMENT SYSTEMS FOR INPATIENT HOSPITAL SERVICES Prospective Payment System for Inpatient Hospital Services of Inpatient...

Do Vaccines Cause Autism? Is it OK to Skip Certain Vaccines? Get the facts

Science.gov (United States)

... Lifestyle Infant and toddler health Do vaccines cause autism? Is it OK to skip certain vaccines? Get ... their potentially serious complications. Vaccines do not cause autism. Despite much controversy on the topic, researchers haven' ...

Aproksymacja środkowej powierzchni powłok

OpenAIRE

Preweda, Edward

1997-01-01

Konstrukcjom cienkościennym stawiany jest warunek zgodności ich powierzchni środkowej z powierzchnią określoną założeniami projektowymi. Grubość powłoki uzależniona jest od panujących w niej naprężeń i najczęściej nie jest stała dla całej powłoki. W pracy przedstawiono algorytm badania kształtu powłok uwzględniający powyższe uwarunkowania. Weryfikacja algorytmu na przykładzie hiperboloidalnych chłodni jednopowłokowych wyraźnie uwidacznia różnice pomiędzy aproksymacją powierzchni zewnętrznej i...

Streptococcal necrotizing myositis: a case report and clinical review.

Science.gov (United States)

Hourmozdi, Justin J; Hawley, Dean A; Hadi, Christiane M; Tahir, Bilal; Seupaul, Rawle A

2014-03-01

Streptococcal necrotizing myositis, also known as gangrenous myositis, is a very rare and severe soft tissue infection that predominately involves skeletal muscle and, eventually, superficial fascia and surrounding tissues. The presentation is often nonspecific until the rapidly progressing clinical course becomes apparent. A high morbidity and mortality rate has been reported in the small number of cases since 1900. Despite several attempts to better define the different entities causing necrotizing myositis, no single definitive causal relationship has been defined. A review of the literature is presented here to help clinicians distinguish those with necrotizing myositis from those with nonnecrotizing myositis when the clinician is at all confronted with the suspicion for such an infection. The case presented is that of a 48-year-old woman who had streptococcal necrotizing myositis. She died roughly 72 h after admission. After the patient's death, the clinical team sought consent for autopsy. Hospital staff made contact with family, and information was obtained from the family that the onset of the patient's symptoms was allegedly temporally related to her acquisition of a new tattoo on the right back, where the tattoo process allegedly included injection of cremated ashes of a pet dog. A high level of suspicion for necrotizing myositis must be maintained for a patient with unexplained severe muscle pain and soft tissue swelling accompanied by systemic inflammatory response syndrome. Copyright © 2014 Elsevier Inc. All rights reserved.

40 CFR 432.105 - New source performance standards (NSPS).

Science.gov (United States)

2010-07-01

... GUIDELINES AND STANDARDS MEAT AND POULTRY PRODUCTS POINT SOURCE CATEGORY Renderers § 432.105 New source... renderer that does not cure cattle hide as part of the plant operations. If a renderer does cure hide, the...

Compliance With Protocols for Prevention of Neonatal Group B Streptococcal Sepsis: Practicalities and Limitations

Directory of Open Access Journals (Sweden)

Gwendolyn L. Gilbert

2003-01-01

Full Text Available Objective: To compare two protocols for intrapartum antibiotic prophylaxis (IAP against neonatal group B streptococcal (GBS sepsis, with respect to staff compliance, in a prospective cohort study in the obstetric units of a community hospital (A and a university teaching hospital (B.

Status of the USNRC/PNL Halden test IFA-432

International Nuclear Information System (INIS)

Bradley, E.R.; Cunningham, M.E.; Lanning, D.D.; Williford, R.E.

1980-01-01

The NRC/PNL fuel assembly IFA-432 began irradiation in December 1975 and as of January 1980 had reached an assembly average burnup of 2120 GJ/kgU (24.5 GWd/MTM). The rods in this assembly are heavily instrumented and this has allowed a fairly thorough analysis of fuel behavior. The emphasis of the analysis has been to evaluate the observed changes in thermal/mechanical behavior. These changes are related to estimates of fuel density changes, fission gas release, and fuel cracking and relocation. The following conclusions have been reached concerning the irradiation of IFA-432. Based on analysis of steady-state and transient thermal data, the fuel in all rods is extensively cracked and relocated. Significant reductions in the effective fuel thermal conductivity have been deduced from the analysis of the transient thermal data

17 CFR 4.32 - Trading on a Registered Derivatives Transaction Execution Facility for Non-Institutional Customers.

Science.gov (United States)

2010-04-01

... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Trading on a Registered Derivatives Transaction Execution Facility for Non-Institutional Customers. 4.32 Section 4.32 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION COMMODITY POOL OPERATORS AND COMMODITY TRADING...

40 CFR 432.12 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.12 Section 432.12... attainable by the application of the best practicable control technology currently available (BPT). Except as...) In the case of process wastewater associated with the slaughtering of animals on-site or the...

40 CFR 432.42 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.42 Section 432.42... attainable by the application of the best practicable control technology currently available (BPT). Except as...) In the case of process wastewater associated with the slaughtering of animals on-site or the...

40 CFR 432.32 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.32 Section 432.32... attainable by the application of the best practicable control technology currently available (BPT). Except as...) In the case of process wastewater associated with slaughtering of animals on-site or the processing...

40 CFR 432.22 - Effluent limitations attainable by the application of the best practicable control technology...

Science.gov (United States)

2010-07-01

... application of the best practicable control technology currently available (BPT). 432.22 Section 432.22... attainable by the application of the best practicable control technology currently available (BPT). Except as... limitations: (1) In the case of process wastewater associated with the slaughtering of animals on-site or the...

U Jóok'ol T'aan, "La salida del habla" U Jóok'ol T'aan, "The Coming Out of Speech"

Directory of Open Access Journals (Sweden)

Hilario Chi Canul

2012-01-01

Full Text Available En este escrito pretendo desarrollar la concepción, la metodología, epistemología, la didáctica y la pedagogía que está detras de U jóok'ol t'aan, "La salida del habla", desde y con las voces de algunas madres mayas, obtenidas mediante una investigación etnográfica que forma parte de mi investigación de tesis "La vitalidad del Maaya T'aan. Estudio etnográfico de la comunicación intergeneracional de los mayas de Naranjal Poniente". Por otro lado, también examino la enseñanza escolarizada de la lengua maya, específicamente el currículo estatal que se emplea para la enseñanza de la lengua maya, y la contrapongo con la adquisición de la misma lengua en las familias para generar caminos hacia una posible interculturalización de la enseñanza de las lenguas indígenas.In this writing I am trying to develop the conception of the methodology, epistemology, didactics and the pedagogy that are standing of the u jóok'ol t'aan, "the exit of the speech", from and with the voices of some Mayan mothers, obtained by means of an ethnographic investigation that comprises of my thesis research, "La vitalidad del Maaya T'aan. Estudio etnográfico de la comunicación intergeneracional de los mayas de Naranjal Poniente". On the other hand, also I try to work and oppose the sent to school education of the Mayan language, specifically the state curriculum that is used for teaching Mayan language, with the acquisition of the same language in the families, to generate ways towards a possible interculturalization of the education of the indigenous languages.

Superantigen profiles of emm and emm-like typeable and nontypeable pharyngeal streptococcal isolates of South India

Directory of Open Access Journals (Sweden)

Anand Thangarajan

2012-02-01

Full Text Available Abstract Background The major virulence factors determining the pathogenicity of streptococcal strains include M protein encoded by emm and emm-like (emmL genes and superantigens. In this study, the distribution of emm, emmL and superantigen genes was analyzed among the streptococcal strains isolated from the patients of acute pharyngitis. Methods The streptococcal strains were isolated from the throat swabs of 1040 patients of acute pharyngitis. The emm and emmL genes were PCR amplified from each strain and sequenced to determine the emm types. The dot-blot hybridization was performed to confirm the pathogens as true emm nontypeable strains. The presence of eleven currently known superantigens was determined in all the strains by multiplex PCR. Results Totally, 124 beta-hemolytic streptococcal strains were isolated and they were classified as group A streptococcus (GAS [15.3% (19/124], group C streptococcus (GCS [59.7% (74/124] and group G streptococcus (GGS [25.0% (31/124]. Among 124 strains, only 35 strains were emm typeable and the remaining 89 strains were emm nontypeable. All GAS isolates were typeable, whereas most of the GCS and GGS strains were nontypeable. These nontypeable strains belong to S. anginosus [75.3% (67/89] and S. dysgalactiae subsp. equisimilis [24.7% (22/89]. The emm and emmL types identified in this study include emm12.0 (28.6%, stG643.0 (28.6%, stC46.0 (17.0%, emm30.11 (8.5%, emm3.0 (2.9%, emm48.0 (5.7%, st3343.0 (2.9%, emm107.0 (2.9% and stS104.2 (2.9%. Various superantigen profiles were observed in typeable as well as nontypeable strains. Conclusions Multiplex PCR analysis revealed the presence of superantigens in all the typeable strains irrespective of their emm types. However, the presence of superantigen genes in emm and emmL nontypeable strains has not been previously reported. In this study, presence of at least one or a combination of superantigen coding genes was identified in all the emm and emmL nontypeable

Intensive care management of severe hypernatraemia in the context of group A streptococcal septicaemia.

Science.gov (United States)

Davies, Bethan; Jesty, Robert; Uddin, Shahana; Metaxa, Victoria

2018-04-26

This case describes a 54-year-old woman with exudative eczema, who was admitted to the intensive care unit with a serum sodium concentration of 191 mmol/L, secondary to profound dehydration in the context of group A streptococcal septicaemia. Successful rehydration and electrolyte normalisation was achieved with continuous venovenous haemodiafiltration (CVVHDF), the replacement fluid of which was infused with hypertonic saline to limit the rate of sodium reduction. This case report comments on three areas of interest. First, hypernatraemia of this level is unusual. Second, the infusion of hypertonic saline into the replacement fluid of the CVVHDF filter is not common practice but successfully ensured a controlled reduction in serum sodium concentration while aggressively replacing a 9 L water deficit. Third, the notable physiological reserve demonstrated by the patient: despite an extraordinary serum sodium concentration in the context of overwhelming streptococcal septicaemia, she has made a full cognitive recovery. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Structure of the Mature Streptococcal Cysteine Protease Exotoxin mSpeB in Its Active Dimeric Form

DEFF Research Database (Denmark)

Olsen, Johan G; Dagil, Robert; Niclasen, Louise Meinert

2009-01-01

Invasive infections of Streptococcus pyogenes are dependent on the cysteine protease streptococcal pyrogenic exotoxin B. Previous structures of the enzyme have not disclosed the proper active-site configuration. Here, the crystal structure of the mature enzyme is presented to 1.55 A, disclosing...

GROUPING OF ORAL STREPTOCOCCAL SPECIES USING FOURIER-TRANSFORM INFRARED-SPECTROSCOPY IN COMPARISON WITH CLASSICAL MICROBIOLOGICAL IDENTIFICATION

NARCIS (Netherlands)

VANDERMEI, HC; NAUMANN, D; BUSSCHER, HJ

1993-01-01

The grouping and identification made by Fourier-transform infrared spectroscopy (FT-IR) of 40 oral streptococcal strains was compared with their known taxonomic positions. Grouping was obtained by cluster analysis on the spectral distances between the first derivative spectra of the strains. Spectra

Streptococcal toxic-shock syndrome due to Streptococcus dysgalactiae subspecies equisimilis in breast cancer-related lymphedema: a case report.

Science.gov (United States)

Sumazaki, Makoto; Saito, Fumi; Ogata, Hideaki; Yoshida, Miho; Kubota, Yorichika; Magoshi, Syunsuke; Kaneko, Hironori

2017-07-14

Breast cancer-related lymphedema often causes cellulitis and is one of the most common complications after breast cancer surgery. Streptococci are the major pathogens underlying such cellulitis. Among the streptococci, the importance of the Lancefield groups C and G is underappreciated; most cases involve Streptococcus dysgalactiae subspecies equisimilis. Despite having a relatively weak toxicity compared with group A streptococci, Streptococcus dysgalactiae subspecies equisimilis is associated with a mortality rate that is as high as that of group A streptococci in cases of invasive infection because Streptococcus dysgalactiae subspecies equisimilis mainly affects elderly individuals who already have various comorbidities. An 83-year-old Japanese woman with breast cancer-related lymphedema in her left upper limb was referred to our hospital with high fever and acute pain with erythema in her left arm. She showed septic shock with disseminated intravascular coagulation. Blood culture showed positive results for Streptococcus dysgalactiae subspecies equisimilis, confirming a diagnosis of streptococcal toxic-shock syndrome. She survived after successful intensive care. To the best of our knowledge, this case represents the first report of Streptococcus dysgalactiae subspecies equisimilis-induced streptococcal toxic-shock syndrome in a patient with breast cancer-related lymphedema. Breast cancer-related lymphedema is a common problem, and we must pay attention to invasive streptococcal soft tissue infections, particularly in elderly patients with chronic disease.

Detection of anti-streptococcal, antienolase, and anti-neural antibodies in subjects with early-onset psychiatric disorders.

Science.gov (United States)

Nicolini, Humberto; López, Yaumara; Genis-Mendoza, Alma D; Manrique, Viana; Lopez-Canovas, Lilia; Niubo, Esperanza; Hernández, Lázaro; Bobes, María A; Riverón, Ana M; López-Casamichana, Mavil; Flores, Julio; Lanzagorta, Nuria; De la Fuente-Sandoval, Camilo; Santana, Daniel

2015-01-01

Infection with group A Streptococcus (StrepA) can cause post-infectious sequelae, including a spectrum of childhood-onset obsessive-compulsive (OCD) and tic disorders with autoimmune origin (PANDAS, Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal Infections). Until now, no single immunological test has been designed that unequivocally diagnoses these disorders. In this study, we assessed the detection of serum antibodies against human brain enolase (AE), neural tissue (AN) and Streptococcus (AS) as a laboratory tool for the diagnosis of early-onset psychiatric disorders. Serum antibodies against human brain enolase, total brain proteins, and total proteins from StrepA were detected by ELISA in 37 patients with a presumptive diagnosis of PANDAS and in 12 healthy subjects from Mexico and Cuba. The antibody titers against human brain enolase (AE) and Streptococcal proteins (AS) were higher in patients than in control subjects (t-student, tAE=-2.17, P=0.035; tAS=-2.68, P=0.01, n=12 and 37/group, df=47, significance level 0.05), while the neural antibody titers did not differ between the two groups (P(t)=0.05). The number of subjects (titers> meancontrol + CI95) with simultaneous seropositivity to all three antibodies was higher in the patient group (51.4%) than in the control group (8.3%) group (X2=5.27, P=0.022, df=1, n=49). The simultaneous detection of all three of these antibodies could provide valuable information for the etiologic diagnosis of individuals with early-onset obsessive-compulsive disorders associated with streptococcal infection and, consequently, for prescribing suitable therapy.

Paedatric Autoimmune Neuropsychiatric Disorder Associated with Streptococcal Infection in an Indian Adolescent--A Case Report

Science.gov (United States)

Sharma, Sachin; Vaish, Supriya; Chopra, Saurabh; Singh, Vindyaprakash; Sharma, Priyanka

2012-01-01

Pediatric Autoimmune Neuropsychiatric Disorders associated with Streptococcal infection (PANDAS) is a unique constellation of signs and symptoms that exist in a subset of children with rapid onset or exacerbation of obsessive-compulsive disorder (OCD) and/or tic disorders due to an initial autoimmune reaction to a Group A Beta Hemolytic…

Streptococcal pyogenic exotoxin B (SpeB) boosts the contact system via binding of a-1 antitrypsin

DEFF Research Database (Denmark)

Meinert Niclasen, Louise; Olsen, Johan G; Dagil, Robert

2011-01-01

The Streptococcus pyogenes cysteine protease SpeB (streptococcal pyrogenic exotoxin B) is important for the invasive potential of the bacteria, but its production is down-regulated following systemic infection. This prompted us to investigate if SpeB potentiated the host immune response after sys...

GENES, IN ADDITION TO TOLL-LIKE RECEPTOR 2, PLAY A ROLE IN ANTIBACTERIAL DEFENSE TO STREPTOCOCCAL PNEUMONIA

Science.gov (United States)

Streptococcus infection in human populations continues to be a major cause of morbidity and mortality. To evaluate the effect of genetic background and toll-like receptor 2 (TLR2) on antibacterial defense to streptococcal infection, eight genetically diverse strains of mic...

Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal Infections (PANDAS: An Evolving Concept

Directory of Open Access Journals (Sweden)

Antonella Macerollo

2013-09-01

Full Text Available Pediatric autoimmune neuropsychiatric disorders associated with streptococcus infections (PANDAS originated from the observational work of Swedo and collaborators, who formalized their definition in 1998 in a set of operational criteria. The application of these criteria, which focuses on tics and obsessive-compulsive symptoms as core symptoms, has encountered difficulties, eventually leading to a high rate of misdiagnosis. In particular, the core feature represented by the association between newly diagnosed infections and neuropsychiatric symptom relapses in youths with this diagnosis could not be demonstrated by longitudinal studies. Exploratory studies aiming to identify clinical or cognitive features that could discriminate PANDAS from other pediatric obsessive-compulsive and tic disorders present methodological limitations, and therefore are not conclusive. Other behavioral features, in addition to obsessive-compulsive symptoms and tics, have been included in pediatric acute-onset neuropsychiatric syndromes (PANS and childhood acute neuropsychiatric syndromes (CANS, two new concepts recently proposed in order to define a much broader clinical spectrum encompassing etiologically diverse entities. Given the uncertainties on the clinical definition of PANDAS, it is not surprising that evidence in support of a post-infectious, immune-mediated pathophysiology is also insufficient. Anti-dopamine receptor antibodies might be relevant to both Sydenham’s chorea (SC—the prototypical post-streptococcal neuropsychiatric disorder—and some rare forms of encephalitis targeting the basal ganglia specifically, but studies exploring their association with children fulfilling Swedo’s criteria for PANDAS have been inconclusive. Moreover, we lack evidence in favor of the efficacy of antibiotic prophylaxis or tonsillectomy in patients fulfilling Swedo’s criteria for PANDAS, whereas a response to immune-mediated treatments like intravenous

[A postpartum woman with toxic shock syndrome: group A streptococcal infection, a much feared postpartum complication.

NARCIS (Netherlands)

Abbink, K.; Kortekaas, J.C.; Buise, M.P.; Dokter, J.; Kuppens, S.M.; Hasaart, T.H.M.

2016-01-01

BACKGROUND: The development of toxic shock syndrome (TSS) after an invasive group A streptococcal (GAS) infection in the postpartum period is a much feared complication. The mortality rate of TSS with necrotizing fasciitis is 30 to 50%. CASE DESCRIPTION: We present the case of a woman with atypical

Aplikace legislativních norem u pojišťovacího zprostředkovatele OK GROUP

OpenAIRE

Kubiš, Michal

2015-01-01

Tato bakalářská práce se zabývá analýzou činností, vedoucích k bezproblémovému chodu společnosti OK GROUP a.s. v návaznosti na kontrolní činnost České národní banky. Analyzuje a podrobně popisuje kontrolní činnost jako takovou. V praktické části se zaměřím na sestavení návrhu vnitropodnikových směrnic pro zákonné fungování této firmy. This bachelor´s thesis deals with analysis of activities, which is going streight trought the smooth run of this in surance broker company OK GROUP a.s. in c...

Identification of non-streptococcal organisms from human dental plaque grown on the Streptococcus-selective medium mitis-salivarius agar.

Science.gov (United States)

Kim, Yeon-Hee; Lee, Si Young

2015-02-01

Mitis-salivarius (MS) agar has been used widely in microbial epidemiological studies because oral viridans streptococci can be selectively grown on this medium. Even though the previous findings reported the limited selecting power of MS agar for streptococcus strains, the identities of non-streptococcal strains from human oral samples which can grow on this medium are not clear yet. In this study, we identified non-streptococcal organisms grown on MS agar plates by polymerase chain reaction (PCR) amplification and sequencing of the 16S ribosomal RNA (rRNA) gene. Eighty bacterial colonies on MS plates were isolated from plaque samples, and bacterial identification was achieved with the rapid ID 32 Strep system and mini API reader. The bacterial colonies identified as non-streptococci by the API system were selected for further identification. The 16S rRNA gene was amplified by PCR and verified using DNA sequencing analysis for identification. Sequences were compared with those of reference organisms in the genome database of the National Center for Biotechnology Information using the Basic Local Alignment Search Tool (BLAST). Among the 11 isolated non-streptococcal strains on MS plates, 3 strains were identified as Actinomyces naeslundii, 7 strains were identified as Actinomyces oris and 1 strain were identified as Actinomyces sp. using Blastn. In this study, we showed that some oral Actinomyces species can grow on Streptococcus-selective MS agar plates. Copyright © 2014 Elsevier Ltd. All rights reserved.

Inflammasome/IL-1β Responses to Streptococcal Pathogens

Directory of Open Access Journals (Sweden)

Christopher N. LaRock

2015-10-01

Full Text Available Inflammation mediated by the inflammasome and the cytokine IL-1β are some of the earliest and most important alarms to infection. These pathways are responsive to the virulence factors that pathogens use to subvert immune processes, and thus are typically activated only by microbes with potential to cause severe disease. Among the most serious human infections are those caused by the pathogenic streptococci, in part because these species numerous strategies for immune evasion. Since the virulence factor armament of each pathogen is unique, the role of IL-1β and the pathways leading to its activation varies for each infection. This review summarizes the role of IL-1β during infections caused by streptococcal pathogens, with emphasis on emergent mechanisms and concepts countering paradigms determined for other organisms.

Streptococcal Upper Respiratory Tract Infections and Exacerbations of Tic and Obsessive-Compulsive Symptoms: A Prospective Longitudinal Study

Science.gov (United States)

Leckman, James F.; King, Robert A.; Gilbert, Donald L.; Coffey, Barbara J.; Singer, Harvey S.; Dure, Leon S., IV; Grantz, Heidi; Katsovich, Liliya; Lin, Haiqun; Lombroso, Paul J.; Kawikova, Ivana; Johnson, Dwight R.; Kurlan, Roger M.; Kaplan, Edward L.

2011-01-01

Objective: The objective of this blinded, prospective, longitudinal study was to determine whether new group A beta hemolytic streptococcal (GABHS) infections are temporally associated with exacerbations of tic or obsessive-compulsive (OC) symptoms in children who met published criteria for pediatric autoimmune neuropsychiatric disorders…

Effect of administration of Streptococcus salivarius K12 on the occurrence of streptococcal pharyngo-tonsillitis, scarlet fever and acute otitis media in 3 years old children.

Science.gov (United States)

Di Pierro, F; Colombo, M; Giuliani, M G; Danza, M L; Basile, I; Bollani, T; Conti, A M; Zanvit, A; Rottoli, A S

2016-11-01

Streptococcus salivarius K12 (BLIS K12) is a probiotic strain strongly antagonistic to the growth of Streptococcus pyogenes, the most important bacterial cause of pharyngeal infections in humans. Shown to colonize the oral cavity and to be safe for human use, BLIS K12 has previously been reported to reduce pharyngo-tonsillitis episodes in children or adults known to have experienced recurrent streptococcal infection. The present study was focussed upon evaluating the role of BLIS K12 in the control of streptococcal disease and acute otitis media in children attending the first year of kindergarten. By randomization, 222 enrolled children attending the first year of kindergarten were divided into a treated group (N = 111) receiving for 6 months a daily treatment with BLIS K12 (Bactoblis®) and a control group (N = 111) who were monitored as untreated controls. During the 6 months of treatment and 3 months of follow-up, the children were evaluated for treatment tolerance, and for episodes of streptococcal pharyngo-tonsillitis, scarlet fever and acute otitis media. During the 6-month trial (N = 111 per group) the incidence of streptococcal pharyngo-tonsillitis, scarlet fever and acute otitis media was approximately 16%, 9% and 44% respectively in the treated group and 48%, 4% and 80% in the control group. During the 3-months follow-up (N = 29 per group) the corresponding rates of infection were 15%, 0% and 12% in the treated group and 26%, 6% and 36% in the controls. No apparent side effects were detected in the treated group either during treatment or follow-up. All of the enrolled children completed the study. The daily administration of BLIS K12 to children attending their first year of kindergarten was associated with a significant reduction in episodes of streptococcal pharyngitis and acute otitis media. No protection against scarlet fever was detected.

Development of a high-power 432 MHz DTL

International Nuclear Information System (INIS)

Naito, F.; Kato, T.; Takasaki, E.; Yamazaki, Y.; Kawasumi, T.; Suzuki, K.; Iino, Y.

1992-01-01

A high-power model of a 432 MHz Drift-Tube Linac is under construction. It will accelerate H - ions from 3 to 5.4 MeV, and is a prototype of the DTL for the Japanese Hadron Project. Several new techniques have been developed for constructing the DTL: fabricating and assembling methods of permanent quadrupole magnet and a drift tube, alignment of the drift tube, and a method of connecting the tanks. (Author) 6 refs., 5 figs

[Prevention of neonatal group B streptococcal sepsis in Hungary in 2012. Preliminary data of a nation-wide survey].

Science.gov (United States)

Sziller, István; Szabó, Miklós; Valek, Andrea; Rigó, Barbara; Ács, Nándor

2014-07-20

At present, there is no obligatory guideline for the prevention of early-onset neonatal group B streptococcal disease in Hungary. The aim of the present study was to gain insight into the spontaneously developed preventive strategy of the domestic obstetric divisions and departments in Hungary. Standardized questionnaire was sent out to each of the 71 obstetric divisions and departments in Hungary. Overall, 20 (27.4%) of the chairpersons replied, and thus, 39.9% of the total number of live births in Hungary were included in the study. Despite missing public health guidelines, each of the divisions and departments developed their own strategy to prevent neonatal group B streptococcal disease. In 95% of cases, bacterial culture of the lower vagina was the method of identifying pregnant women at risk. In 5% of the cases intrapartum antibiotic prophylaxis was based on risk assessment only. Of the departments using culture-based prophylaxis, 58% departments sampled women after completion of 36th gestational weeks. Antibiotic of choice was penicillin or ampicillin in 100% of cases. Of the study participants, 80% reported on multiple administration of colonized pregnant women after onset of labor or rupture of the membranes. The authors concluded that the rate of participation in the study was low. However, prevention of early-onset neonatal group B streptococcal infection is a priority of obstetric care in Hungary. Lack of a nation-wide public health policy did not prevent obstetric institutions in this country to develop their own prevention strategy. In the majority of cases and institutions, the policy is consistent with the widely accepted international standards.

Viridans streptococcal shock syndrome during bone marrow transplantation.

Science.gov (United States)

Martino, R; Manteiga, R; Sánchez, I; Brunet, S; Sureda, A; Badell, I; Argilés, B; Subirá, M; Bordes, R; Domingo-Albós, A

1995-01-01

Of 320 patients receiving a marrow transplant at the Hospital de Sant Pau between 1986 and 1992, 12% developed viridans streptococcal bacteremia during severe neutropenia. Five of these patients (13%) developed a rapidly progressive fatal shock syndrome characterized by bilateral pulmonary infiltrates, acute respiratory failure (ARDS) and septic shock early in the transplantation course (6 or 7 days posttransplantation). All patients were transplanted for acute leukemia in remission, and 2 received an allogeneic and 3 an autologous transplant. Four of these subjects were younger than 15 years of age and all had received cyclophosphamide and total body irradiation as conditioning regimen for marrow transplantation. All 5 patients died, and postmortem examinations revealed diffuse pulmonary lesions characteristic of the ARDS. These observations contribute to defining the clinical and pathologic characteristics of this serious complication of intensive anticancer treatment.

Novel Curcumin Diclofenac Conjugate Enhanced Curcumin Bioavailability and Efficacy in Streptococcal Cell Wall-induced Arthritis.

Science.gov (United States)

Jain, S K; Gill, M S; Pawar, H S; Suresh, Sarasija

2014-09-01

Curcumin-diclofenac conjugate as been synthesized by esterification of phenolic group of curcumin with the acid moiety of diclofenac, and characterized by mass spectrometry, NMR, FTIR, DSC, thermogravimetric analysis and X-ray diffraction analysis. The relative solubility of curcumin-diclofenac conjugate, curcumin and diclofenac; stability of curcumin-diclofenac conjugate in intestinal extract; permeability study of curcumin-diclofenac conjugate using the everted rat intestinal sac method; stability of curcumin-diclofenac conjugate in gastrointestinal fluids and in vitro efficacy have been evaluated. In vivo bioavailability of curcumin-diclofenac conjugate and curcumin in Sprague-Dawley rats, and antiarthritic activity of curcumin-diclofenac conjugate, curcumin and diclofenac in modified streptococcal cell wall-induced arthritis model in Balb/c mice to mimic rheumatoid arthritis in humans have also been studied. In all of the above studies, curcumin-diclofenac conjugate exhibited enhanced stability as compared to curcumin; its activity was twice that of diclofenac in inhibiting thermal protein denaturation taken as a measure of in vitro antiinflammatory activity; it enhanced the bioavailability of curcumin by more than five folds, and significantly (Parthritis in streptococcal cell wall-induced arthritis model as compared to both diclofenac and curcumin.

Invasive group A streptococcal disease in The Netherlands : Evidence for a protective role of anti-exotoxin A antibodies

NARCIS (Netherlands)

Mascini, EM; Jansze, M; Schellekens, JFP; Musser, JM; Faber, JAJ; Verhoef-Verhage, LAE; Schouls, L; van Leeuwen, WJ; Verhoef, J; van Dijk, H

As part of a nationwide surveillance in The Netherlands during 1994-1997, 53 patients with invasive group A streptococcal (GAS) infections were evaluated for medical history, symptoms, and outcome. Patients' isolates were tested for the production of pyrogenic exotoxins A (SPE-A) and B (SPE-B).

Group G streptococcal myositis in a patient with myeloproliferative neoplasm

Directory of Open Access Journals (Sweden)

Monica Midha, MD MBS

2016-01-01

Full Text Available While many cases of streptococcal infection are due to Lancefield groups A and B, there has been a rise in reported cases of infections due to group G streptococcus. We present a case of an individual with a hematologic malignancy who developed myositis secondary to group G streptococcus, with no clearly identifiable source of infection. The patient was managed with antibiotic therapy rather than surgical intervention due to high surgical risk related to severe thrombocytopenia. Targeted antibiotics initiated early in the course of disease may prevent the need for surgical intervention. Early diagnosis and treatment are critical to avoid the high morbidity and mortality of life-threatening infections caused by group G streptococcus.

Treatment of Lymphatic Malformations With OK-432 (Picibanil) : Review of the Literature

NARCIS (Netherlands)

Poldervaart, Michelle T.; Breugem, Corstiaan C.; Speleman, Lucienne; Pasmans, Suzanne

Introduction: Lymphatic malformations (LM) are benign structural defects that call cause serious complications because of their size and location. Traditionally surgical removal was the first treatment modality, but this Could be associated with many complications and risks. Since Ogita introduced

Empirical validation of Polish guidelines for the management of acute streptococcal pharyngitis in children.

Science.gov (United States)

Mazur, Elżbieta; Bochyńska, Ewa; Juda, Marek; Kozioł-Montewka, Maria

2014-01-01

Group A Streptococcus (GAS) pharyngitis is currently the only commonly occurring form of acute pharyngitis for which antibiotic therapy is definitely indicated. Polish guidelines advocate the use of modified Centor score (MCS) to assess the probability of GAS pharyngitis. They advise performing throat culture or rapid antigen detection test (RADT) in children with score 2-3 in MCS and treating with antibiotic only those in whom GAS was detected. Negative RADT results should be confirmed by culture. In children with score 4, the guidelines allow to introduce empiric antibiotic therapy. Phenoxymethyl penicillin is recommended as a drug of choice to treat GAS pharyngitis. The aim of our study was to evaluate the accuracy of strategy recommended by Polish guidelines in identifying those children with acute pharyngitis who require antibiotic treatment. Hence, diagnostic values of score 4 in MCS and RADT were assessed using throat culture as a reference standard. Phenoxymethyl penicillin efficacy in GAS eradication and prevention of post-streptococcal complications were estimated as well. Ninety children between 2 and 15 years of age with acute pharyngitis symptoms suggesting GAS etiology (MCS ≥ 2), participated in our study. At the initial visit MCS was evaluated and two throat swabs were collected to perform RADT and culture. In children with GAS pharyngitis treated with penicillin, microbiological cure was assessed by performing two control throat cultures. Next, children were under observation for 3 months. Positive predictive value of score 4 in MCS turned out to be 48.05% (95% CI: 36.5-59.7%). RADT sensitivity, specificity and diagnostic accuracy proved to be 100%, 96%, and 98%, respectively. GAS eradication rate in children treated with penicillin turned out to be 92.5%. No post-streptococcal sequelae occurred in any child in 3-month observation. Empiric antibiotic therapy in children with score 4 in MCS will result in significant overtreatment of those with

Fatty acid profile and in vitro antioxidant and antibacterial activities of red grape (Vitis vinifera L. cvs. Oküzgözü and Boğazkere) Marc extracts.

Science.gov (United States)

Cibik, Bilge; Ozaydin, Zuhal; Böke, Nazli; Karabay, Ulkü; Pekmez, Murat; Arda, Nazhi; Kirmizigüla, Süheyla

2009-03-01

The marcs of two red grape (V. vinifera L.) varieties (Boğazkere and Oküzgözü), grown in eastern Anatolia (Elazig), were evaluated for their fatty acid composition, and antioxidant and antibacterial activities. The hexane extracts of both varieties were found to contain linoleic, palmitic, stearic and oleic acids by GC-MS analyses. The major fatty acid (linoleic acid) was detected relatively as 57.13% in Oküzgözü and 59.07% in Bogazkere in methylated hexane extracts. In addition, myristic and palmitoleic acids were observed in Boğazkere as minor components. The free radical (DPPH) scavenging activity of Oküzgözü was higher than that of Bogazkere. The IC50 values were calculated as 403.0 +/- 7.8 microg/mL for Oküzgozü and 552.0 +/- 23.6 microg/mL for Bogazkere. The extracts were found to be effective on the four gram (+) and four gram (-) test bacteria, but not as good as standard antibiotic, gentamycine by MIC method.

[Streptococcal mediastinitis after thyroidectomy. A literature review].

Science.gov (United States)

Bures, C; Zielinski, V; Klatte, T; Swietek, N; Kober, F; Tatzgern, E; Bobak-Wieser, R; Gschwandtner, E; Gilhofer, M; Wechsler-Fördös, A; Hermann, M

2015-12-01

Surgical site infections after thyroid surgery are mostly superficial and can be well treated. Streptococcal mediastinitis in contrast is a rare but life-threatening complication. A 57-year-old female patient experienced septic fever, increase of inflammation parameters and erythema 2 days after thyroid surgery for Graves' disease. This process was triggered by a three-compartment infection by group A Streptococcus (GAS) with involvement of the mediastinum. Therapy over 6 weeks including seven wound revisions with the patient under general anesthesia, pathogen-adapted antibiotic treatment and cervical negative pressure treatment managed to control the infection. A total of 21 cases have been published on this phenomenon, 11 of which had a fatal outcome. High fever and surgical site erythema in the early postoperative period after thyroid surgery can be signs of a GAS infection, which might lead to necrotizing, descending, life-threatening mediastinitis. Early diagnosis with support of computed tomography (CT) scans, immediate therapy including wound opening, lavage, intravenous antibiotic treatment with penicillin and clindamycin are vital. If treatment resistance occurs, cervical negative pressure treatment should be considered.

The Effect of a Silver Nanoparticle Polysaccharide System on Streptococcal and Saliva-Derived Biofilms

Directory of Open Access Journals (Sweden)

Luigina Cellini

2013-06-01

Full Text Available In this work, we studied the antimicrobial properties of a nanocomposite system based on a lactose-substituted chitosan and silver nanoparticles: Chitlac-nAg. Twofold serial dilutions of the colloidal Chitlac-nAg solution were both tested on Streptococcus mitis, Streptococcus mutans, and Streptococcus oralis planktonic phase and biofilm growth mode as well as on saliva samples. The minimum inhibitory and bactericidal concentrations of Chitlac-nAg were evaluated together with its effect on sessile cell viability, as well as both on biofilm formation and on preformed biofilm. In respect to the planktonic bacteria, Chitlac-nAg showed an inhibitory/bactericidal effect against all streptococcal strains at 0.1% (v/v, except for S. mitis ATCC 6249 that was inhibited at one step less. On preformed biofilm, Chitlac-nAg at a value of 0.2%, was able to inhibit the bacterial growth on the supernatant phase as well as on the mature biofilm. For S. mitis ATCC 6249, the biofilm inhibitory concentration of Chitlac-nAg was 0.1%. At sub-inhibitory concentrations, the Streptococcal strains adhesion capability on a polystyrene surface showed a general reduction following a concentration-dependent-way; a similar effect was obtained for the metabolic biofilm activity. From these results, Chitlac-nAg seems to be a promising antibacterial and antibiofilm agent able to hinder plaque formation.

Semiquantitative bacterial observations with group B streptococcal vulvovaginitis.

Science.gov (United States)

Monif, G R

1999-01-01

OBJECTIVE: Group B streptococcal (GBS) vulvovaginitis is a poorly-delineated clinical entity. The purpose of this study is to report semiquantitative data from four cases of GBS vulvovaginitis and to comment on their significance in terms of the in vitro inhibitory capabilities of GBS. METHODOLOGY: Four patients whose clinical presentations were consistent with GBS vulvovaginitis, from whom GBS was isolated and for whom semi-quantitative as well as qualitative microbiologic data existed, were identified. RESULTS: To produce vulvovaginitis, GBS must be at a high multiplicity (10(8) CFU/g of vaginal fluid). Single coisolates were identified in three of the four cases (two cases of Escherichia coli and one case of Staphylococcus aureus). Group B streptococcus does not inhibit either of these bacteria in vitro. CONCLUSION: When the growth requirements for the demonstration of in vitro inhibition for GBS or lack thereof are met in vivo, the in vivo observations are consistent with those projected from the in vitro data. PMID:10524667

Preparation and photocatalytic property of a novel dumbbell-shaped ZnO microcrystal photocatalyst

DEFF Research Database (Denmark)

Sun, Jian-Hui; Dong, Shu-Ying; Wang, Yong-Kui

2009-01-01

achieved 68.0%, 99.0% and 98.5%, the TOC removal efficiencies achieved 43.2%, 59.4% and 70.6%, respectively. Compared to commercial ZnO, 16-22% higher TOC removal efficiency was obtained by the dumbbell-shaped ZnO. The results indicated that the prepared dumbbell-shaped ZnO microcrystal photocatalyst...

Microbial analysis of bite marks by sequence comparison of streptococcal DNA.

Directory of Open Access Journals (Sweden)

Darnell M Kennedy

Full Text Available Bite mark injuries often feature in violent crimes. Conventional morphometric methods for the forensic analysis of bite marks involve elements of subjective interpretation that threaten the credibility of this field. Human DNA recovered from bite marks has the highest evidentiary value, however recovery can be compromised by salivary components. This study assessed the feasibility of matching bacterial DNA sequences amplified from experimental bite marks to those obtained from the teeth responsible, with the aim of evaluating the capability of three genomic regions of streptococcal DNA to discriminate between participant samples. Bite mark and teeth swabs were collected from 16 participants. Bacterial DNA was extracted to provide the template for PCR primers specific for streptococcal 16S ribosomal RNA (16S rRNA gene, 16S-23S intergenic spacer (ITS and RNA polymerase beta subunit (rpoB. High throughput sequencing (GS FLX 454, followed by stringent quality filtering, generated reads from bite marks for comparison to those generated from teeth samples. For all three regions, the greatest overlaps of identical reads were between bite mark samples and the corresponding teeth samples. The average proportions of reads identical between bite mark and corresponding teeth samples were 0.31, 0.41 and 0.31, and for non-corresponding samples were 0.11, 0.20 and 0.016, for 16S rRNA, ITS and rpoB, respectively. The probabilities of correctly distinguishing matching and non-matching teeth samples were 0.92 for ITS, 0.99 for 16S rRNA and 1.0 for rpoB. These findings strongly support the tenet that bacterial DNA amplified from bite marks and teeth can provide corroborating information in the identification of assailants.

UV-VUV FEL program at DUKE storage ring with OK-4 optical klystron

International Nuclear Information System (INIS)

Litvinenko, V.N.; Madey, J.M.J.; Vinokurov, N.A.

1993-01-01

A 1 GeV electron storage ring dedicated for UV-VUV FEL operation is under construction at the Duke University Free Electron Laser Laboratory. The UV-VUV-FEL project, based on the collaboration of the Duke FEL Laboratory and Budker Institute for Nuclear Physics is described. The main parameters of the DFELL storage ring, of the OK-4 optical klystron, and the experimental set-up are presented. The parameters of UV-VUV FEL are given and the possible future upgrades to this system are discussed

11 CFR 105.1 - Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Place of filing; House candidates and their authorized committees (2 U.S.C. 432(g)(1)). 105.1 Section 105.1 Federal Elections FEDERAL ELECTION COMMISSION GENERAL DOCUMENT FILING (2 U.S.C. 432(g)) § 105.1 Place of filing; House candidates and their authorized...

18 CFR 367.4320 - Account 432, Allowance for borrowed funds used during construction-Credit.

Science.gov (United States)

2010-04-01

... ACT OF 2005, FEDERAL POWER ACT AND NATURAL GAS ACT Income Statement Chart of Accounts Service Company Operating Income § 367.4320 Account 432, Allowance for borrowed funds used during construction—Credit. This...

Antibiotic Resistance Patterns in Invasive Group B Streptococcal Isolates

Directory of Open Access Journals (Sweden)

Mei L. Castor

2008-01-01

Full Text Available Antibiotics are used for both group B streptococcal (GBS prevention and treatment. Active population-based surveillance for invasive GBS disease was conducted in four states during 1996—2003. Of 3813 case-isolates, 91.0% (3471 were serotyped, 77.1% (2937 had susceptibility testing, and 46.6% (3471 had both. All were sensitive to penicillin, ampicillin, cefazolin, cefotaxime, and vancomycin. Clindamycin and erythromycin resistance was 12.7% and 25.6%, respectively, and associated with serotype V (P<.001. Clindamycin resistance increased from 10.5% to 15.0% (X2 for trend 12.70; P<.001; inducible clindamycin resistance was associated with the erm genotype. Erythromycin resistance increased from 15.8% to 32.8% (X2 for trend 55.46; P<.001. While GBS remains susceptible to beta-lactams, resistance to alternative agents such as erythromycin and clindamycin is an increasing concern.

Neurobiologia da síndrome de Tourette: a hipótese auto-imune pós-estreptocócica Neurobiology of Tourette's syndrome: the autoimmune post-streptococcal hypothesis

Directory of Open Access Journals (Sweden)

Fernando Machado Vilhena Dias

2008-01-01

Full Text Available CONTEXTO: A síndrome de Tourette (ST caracteriza-se pela presença de tiques motores e pelo menos um tique fônico. Algumas semelhanças clínicas com a coréia reumática ou de Sydenham (CS incentivaram a formulação da hipótese da existência de um grupo de transtornos neuropsiquiátricos associados a processo auto-imune decorrente de infecção estreptocócica (PANDAS. OBJETIVO: Revisar a literatura quanto às evidências em relação à hipótese de que mecanismos auto-imunes pós-estreptocócicos estão envolvidos na etiopatogênese da ST. MÉTODOS: Revisão sistemática na base de dados MedLine com os termos "Tourette", "tic", "PANDAS", "antibodies", "streptococcal" e "rheumatic". RESULTADOS: Retornaram 238 artigos da busca. Selecionaram-se 53 trabalhos, os quais tiveram suas referências bibliográficas também revisadas. São apresentados os resultados de estudos que avaliaram aspectos imunes na ST, incluindo anticorpos antiestreptocócicos e antinúcleos da base, e sua terapêutica imunebaseada, discutindo a validade do conceito de PANDAS. CONCLUSÕES: As evidências ainda não são satisfatórias no que tange a uma base auto-imune pós-estreptocócica para a ST. Um aprimoramento dos métodos investigativos e na seleção das amostras pode trazer maiores contribuições à questão.BACKGROUND: Tourette's syndrome (TS is characterized by the presence of motor tics and at least one phonic tic. Some clinical similarities with Sydenham's chorea (SC lead to the hypothesis of a new group of disorders associated with an autoimmune process due to a streptococcal infection (PANDAS. Objective: To review the literature in search of evidence on the existence of post-streptococcal autoimmune mechanisms involved with the etiopathogenesis of TS. METHODS: A systematic review with the terms "Tourette", "tic", "PANDAS", "antibodies", "streptococcal" and "rheumatic" was carried on using the MedLine. RESULTS: The search found 238 articles. Fifty and

42 CFR 488.432 - Civil money penalties: When a penalty is collected.

Science.gov (United States)

2010-10-01

... 42 Public Health 5 2010-10-01 2010-10-01 false Civil money penalties: When a penalty is collected... PROCEDURES Enforcement of Compliance for Long-Term Care Facilities with Deficiencies § 488.432 Civil money... hearing on the determination of the noncompliance that is the basis for imposition of the civil money...

Facial nerve conduction after sclerotherapy in children with facial lymphatic malformations: report of two cases.

Science.gov (United States)

Lin, Pei-Jung; Guo, Yuh-Cherng; Lin, Jan-You; Chang, Yu-Tang

2007-04-01

Surgical excision is thought to be the standard treatment of choice for lymphatic malformations. However, when the lesions are limited to the face only, surgical scar and facial nerve injury may impair cosmetics and facial expression. Sclerotherapy, an injection of a sclerosing agent directly through the skin into a lesion, is an alternative method. By evaluating facial nerve conduction, we observed the long-term effect of facial lymphatic malformations after intralesional injection of OK-432 and correlated the findings with anatomic outcomes. One 12-year-old boy with a lesion over the right-side preauricular area adjacent to the main trunk of facial nerve and the other 5-year-old boy with a lesion in the left-sided cheek involving the buccinator muscle were enrolled. The follow-up data of more than one year, including clinical appearance, computed tomography (CT) scan and facial nerve evaluation were collected. The facial nerve conduction study was normal in both cases. Blink reflex in both children revealed normal results as well. Complete resolution was noted on outward appearance and CT scan. The neurophysiologic data were compatible with good anatomic and functional outcomes. Our report suggests that the inflammatory reaction of OK-432 did not interfere with adjacent facial nerve conduction.

77 FR 57112 - Notice of Inventory Completion: U.S. Department of Defense, Army, Fort Sill Museum, Lawton, OK

Science.gov (United States)

2012-09-17

... Landmark and Museum, U.S. Army Fires Center of Excellence, Fort Sill, OK 73503, telephone (580) 442-6570... trapping, 3 metal rings, 2 metal rivets, 17 metal nails, 53 metal bracelets, 1 metal pail, 1,500 glass... A. Neel, Director, Fort Sill National Historic Landmark and Museum, U.S. Army Fires Center of...

Recurrent group A streptococcal vulvovaginitis in adult women: family epidemiology.

Science.gov (United States)

Sobel, Jack D; Funaro, Deana; Kaplan, Edward L

2007-03-01

Group A beta-hemolytic streptococcal (GAS) vulvovaginitis has been reported in prepubertal girls. In adult women, a vaginal carrier state has been described, but vulvovaginitis is rarely reported. We describe 2 cases of recurrent GAS vulvovaginitis in women whose husbands were gastrointestinal carriers of GAS. Characterization of the isolated strains demonstrated that identical emm types of GAS were shared by partners. Treatment of both partners resulted in resolution of vaginitis. On the basis of negative vaginal culture results obtained after treatment of each individual episode of vaginitis, we believe that the female patients were reinfected as a result of exposure to their husbands, with shedding likely to have occurred in bed. These cases reiterate the necessity for adequate screening of the patient's family and contacts in cases of recurrent GAS infection by culturing all potential areas of GAS carriage.

Streptococcal Pharyngitis and Appendicitis in Children.

Science.gov (United States)

Nielsen, Jason W; Abel, Stuart A; Kenney, Brian

2018-01-01

Several pathologies, including pharyngitis, are associated with abdominal pain that can mimic appendicitis. We sought to further understand the link between appendicitis-like symptoms and streptococcal (strep) pharyngitis. All patients undergoing ultrasound imaging for appendicitis in our emergency department during 2013 were reviewed (n = 1572). A total of 207 patients were identified who underwent both ultrasound for appendicitis and testing for strep pharyngitis. Demographic and outcomes data between rule out appendicitis patients who underwent strep testing and those who did not were compared. Strep testing was more common in younger patients (mean age = 8.26 vs 10.26 years P appendicitis and 35 (16.9%) patients tested positive for strep pharyngitis. No cases of concurrent strep pharyngitis and appendicitis were identified. The negative appendectomy rate in the strep pharyngitis tested group was 38.5% (5/13), compared with 7.7% (23/296) ( P = .003) in the nontested group. The appendicitis rate among the strep tested group was 3.8% (8/207) compared with 20% (273/1365) in the nontested group ( P appendicitis, and had a higher rate of negative appendectomy. A diagnosis of concurrent appendicitis and strep pharyngitis is rare. In cases of patients with sufficient symptoms to warrant testing for strep pharyngitis a diagnosis of appendicitis is less likely and surgical intervention leads to higher negative appendectomy rates.

Picibanil (OK-432 in the treatment of head and neck lymphangiomas in children

Directory of Open Access Journals (Sweden)

Elena Rebuffini

2012-01-01

Conclusions: Intracystic injection of Picibanil is an effective and safe treatment for macrocystic LMs in pediatric patients and may represent the treatment of choice in such cases, especially where surgical excision is associated with the risk of functional/cosmetic side effects.

OK-432 sclerotherapy in head and neck lymphangiomas: long-term follow-up result.

Science.gov (United States)

Yoo, Jae Chul; Ahn, Youngjin; Lim, Yune Syung; Hah, J Hun; Kwon, Tack-Kyun; Sung, Myung-Whun; Kim, Kwang Hyun

2009-01-01

Nonsurgical treatments, such as sclerotherapy have been attempted for head and neck lymphagiomas. Of the available sclerosing agents, picibanil has shown satisfactory short-term treatment results in many studies, but no study has presented long-term treatment results. Accordingly, in the present study, the authors retrospectively reviewed the long-term treatment results of picibanil sclerotherapy. Fifty-five lymphangioma patients who underwent picibanil sclerotherapy were enrolled. Data about initial and long-term response, recurrence, and excision rate were collected. Initial response rates were 83.5 percent and long-term response rates were 76.3 percent. Initial and the long-term response rate were equally good for lymphangioma.

11 CFR 101.1 - Candidate designations (2 U.S.C. 432(e)(1)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate designations (2 U.S.C. 432(e)(1)). 101.1 Section 101.1 Federal Elections FEDERAL ELECTION COMMISSION GENERAL CANDIDATE STATUS AND... and address, party affiliation, and office sought, the District and State in which Federal office is...

11 CFR 102.11 - Petty cash fund (2 U.S.C. 432(h)(2)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false Petty cash fund (2 U.S.C. 432(h)(2)). 102.11 Section 102.11 Federal Elections FEDERAL ELECTION COMMISSION GENERAL REGISTRATION, ORGANIZATION, AND... and Congressional district) sought by such candidate. ...

Comparison of 432 Pseudomonas strains through integration of genomic, functional, metabolic and expression data

NARCIS (Netherlands)

Koehorst, Jasper J.; Dam, van Jesse C.J.; Heck, van Ruben G.A.; Saccenti, Edoardo; Martins dos Santos, Vitor; Suarez-Diez, Maria; Schaap, Peter J.

2016-01-01

Pseudomonas is a highly versatile genus containing species that can be harmful to humans and plants while others are widely used for bioengineering and bioremediation. We analysed 432 sequenced Pseudomonas strains by integrating results from a large scale functional comparison using protein

Prevention of perinatal group B streptococcal disease: screening during a pregnancy

Directory of Open Access Journals (Sweden)

Rosella Bruno

2012-12-01

Full Text Available The prevention of perinatal group B streptococcal (GBS disease is based on the screening of all pregnant women at 35-37 weeks’ gestation for vaginal and rectal GBS colonization. The colonized women receive intrapartum antibiotic prophylaxis. Our study reports the different rates of maternal GBS colonization between April 2008 and March 2011. We have collected 3430 samples by swabbing both the lower vagina and rectum and we have employed two different laboratory methods: direct agar plating and selective enrichment broth. The rates of maternal GBS colonization increased from 10.5% during 2008-2009, to 12.2% during 2009-2010 and to 14.4% during 2010-2011, when we have introduced the Todd Hewitt broth. Our results show that the use of an enrichment broth improves detection of GBS carriers women.

Invasive Group A streptococcal disease in Ireland, 2004 to 2010.

LENUS (Irish Health Repository)

Martin, J

2011-01-01

Invasive group A streptococcal infections (iGAS) are a major clinical and public health challenge. iGAS is a notifiable disease in Ireland since 2004. The aim of this paper is to describe the epidemiology of iGAS in Ireland for the first time over the seven-year period from 2004 to 2010. The Irish national electronic infectious disease reporting system was used by laboratories to enter the source of iGAS isolates, and by departments of public health to enter clinical and epidemiological details. We extracted and analysed data from 1 January 2004 to 31 December 2010. Over the study period, 400 iGAS cases were notified. The annual incidence of iGAS doubled, from 0.8 per 100,000 population in 2004 to 1.6 in 2008, and then remained the same in 2009 and 2010. The reported average annual incidence rates were highest among children up to five years of age (2.3\\/100,000) and adults aged over 60 years (3.2\\/100,000). The most common risk factors associated with iGAS were skin lesions or wounds. Of the 174 people for whom clinical syndrome information was available, 28 (16%) cases presented with streptococcal toxic shock syndrome and 19 (11%) with necrotising fasciitis. Of the 141 cases for whom seven-day outcomes were recorded, 11 people died with iGAS identified as the main cause of death (seven-day case fatality rate 8%). The notification rate of iGAS in Ireland was lower than that reported in the United Kingdom, Nordic countries and North America but higher than southern and eastern European countries. The reasons for lower notification rates in Ireland compared with other countries may be due to a real difference in incidence, possibly due to prescribing practices, or due to artefacts resulting from the specific Irish case definition and\\/or low reporting in the early stages of a new surveillance system. iGAS disease remains an uncommon but potentially severe disease in Ireland. Ongoing surveillance is required in order to undertake appropriate control measures and

A clinical and bacteriologic investigation of invasive streptococcal infections in Japan on the basis of serotypes, toxin production, and genomic DNA fingerprints.

Science.gov (United States)

Nakashima, K; Ichiyama, S; Iinuma, Y; Hasegawa, Y; Ohta, M; Ooe, K; Shimizu, Y; Igarashi, H; Murai, T; Shimokata, K

1997-08-01

In a survey of invasive streptococcal infections in Japan, we analyzed isolates of Streptococcus pyogenes collected between 1992 and 1994. Genomic DNA fingerprints produced by pulsed-field gel electrophoresis (PFGE) were compared by computer-assisted analysis. Conventional serologic M types were subdivided into PFGE types showing close genetic similarity. Among the 42 isolates from patients with invasive diseases, 16 PFGE types were identified and genetic diversity was clearly demonstrated. Identical fingerprints were observed in both invasive and noninvasive isolates. Only 43% of invasive isolates produced streptococcal pyrogenic exotoxin A (SPE A), and 31% did not contain the speA gene. These findings suggest that the dissemination of a specific clone is not sufficient to explain all cases of these diseases in Japan and pose a question as to the role of SPE A as a major virulent factor. Bacterial factors other than SPE A and host factors should be considered in evaluation of the pathogenesis of the diseases.

Spatial distribution and polarization of gamma-rays generated via Compton backscattering in the Duke/OK-4 storage ring FEL

CERN Document Server

Park, S H; Tornow, W; Montgomery, C

2001-01-01

Beams of nearly monochromatic gamma-rays are produced via intracavity Compton backscattering in the OK-4/Duke storage ring FEL, the high-intensity gamma-ray source (HI gamma S). Presently, HI gamma S generates gamma-ray beams with an energy tunable from 2 to 58 MeV and a maximum flux of 5x10 sup 7 gamma-rays per second. The gamma-rays are linearly polarized with a degree of polarization close to 100% (V.N. Litvinenko, et al., Predictions and expected performance for the VUV OK-5/Duke Storage Ring FEL with variable polarization, Nucl. Instr. and Meth. A, to be published in this proceeding) and they are collimated to pencil-like semi-monoenergetic beams with RMS energy spreads as low as 0.2%. The detailed theoretical and experimental studies of the gamma-ray beam quality were conducted during the last two years (S.H. Park, Thesis, Duke University, Durham, NC, USA, 2000). In this paper, we present the theoretical analysis and the experimental results on the spatial distribution and polarization of gamma-rays fro...

Spatial distribution and polarization of {gamma}-rays generated via Compton backscattering in the Duke/OK-4 storage ring FEL

Energy Technology Data Exchange (ETDEWEB)

Park, S.H. E-mail: shpark@nanum.kaeri.re.kr; Litvinenko, V.N.; Tornow, W.; Montgomery, C

2001-12-21

Beams of nearly monochromatic {gamma}-rays are produced via intracavity Compton backscattering in the OK-4/Duke storage ring FEL, the high-intensity {gamma}-ray source (HI{gamma}S). Presently, HI{gamma}S generates {gamma}-ray beams with an energy tunable from 2 to 58 MeV and a maximum flux of 5x10{sup 7} {gamma}-rays per second. The {gamma}-rays are linearly polarized with a degree of polarization close to 100% (V.N. Litvinenko, et al., Predictions and expected performance for the VUV OK-5/Duke Storage Ring FEL with variable polarization, Nucl. Instr. and Meth. A, to be published in this proceeding) and they are collimated to pencil-like semi-monoenergetic beams with RMS energy spreads as low as 0.2%. The detailed theoretical and experimental studies of the {gamma}-ray beam quality were conducted during the last two years (S.H. Park, Thesis, Duke University, Durham, NC, USA, 2000). In this paper, we present the theoretical analysis and the experimental results on the spatial distribution and polarization of {gamma}-rays from the HI{gamma}S facility.

Spatial distribution and polarization of γ-rays generated via Compton backscattering in the Duke/OK-4 storage ring FEL

International Nuclear Information System (INIS)

Park, S.H.; Litvinenko, V.N.; Tornow, W.; Montgomery, C.

2001-01-01

Beams of nearly monochromatic γ-rays are produced via intracavity Compton backscattering in the OK-4/Duke storage ring FEL, the high-intensity γ-ray source (HIγS). Presently, HIγS generates γ-ray beams with an energy tunable from 2 to 58 MeV and a maximum flux of 5x10 7 γ-rays per second. The γ-rays are linearly polarized with a degree of polarization close to 100% (V.N. Litvinenko, et al., Predictions and expected performance for the VUV OK-5/Duke Storage Ring FEL with variable polarization, Nucl. Instr. and Meth. A, to be published in this proceeding) and they are collimated to pencil-like semi-monoenergetic beams with RMS energy spreads as low as 0.2%. The detailed theoretical and experimental studies of the γ-ray beam quality were conducted during the last two years (S.H. Park, Thesis, Duke University, Durham, NC, USA, 2000). In this paper, we present the theoretical analysis and the experimental results on the spatial distribution and polarization of γ-rays from the HIγS facility

A glimpse of streptococcal toxic shock syndrome from comparative genomics of S. suis 2 Chinese isolates

DEFF Research Database (Denmark)

Chen, Chen; Tang, Jiaqi; Dong, Wei

2007-01-01

shock syndrome (STSS), which was originally associated with Streptococcus pyogenes (GAS) in Streptococci. However, the molecular mechanisms underlying STSS are poorly understood. METHODS AND FINDINGS: To elucidate the genetic determinants of STSS caused by SS2, whole genome sequencing of 3 different......BACKGROUND: Streptococcus suis serotype 2 (SS2) is an important zoonotic pathogen, causing more than 200 cases of severe human infection worldwide, with the hallmarks of meningitis, septicemia, arthritis, etc. Very recently, SS2 has been recognized as an etiological agent for streptococcal toxic...

Amino acid sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for cleavage by streptococcal IgA1 proteases

DEFF Research Database (Denmark)

Batten, MR; Senior, BW; Kilian, Mogens

2003-01-01

The amino acid sequence requirements in the hinge of human immunoglobulin A1 (IgA1) for cleavage by IgA1 proteases of different species of Streptococcus were investigated. Recombinant IgA1 antibodies were generated with point mutations at proline 227 and threonine 228, the residues lying on either...... side of the peptide bond at which all streptococcal IgA1 proteases cleave wild-type human IgA1. The amino acid substitutions produced no major effect upon the structure of the mutant IgA1 antibodies or their functional ability to bind to Fcalpha receptors. However, the substitutions had a substantial...... effect upon sensitivity to cleavage with some streptococcal IgA1 proteases, with, in some cases, a single point mutation rendering the antibody resistant to a particular IgA1 protease. This effect was least marked with the IgA1 protease from Streptococcus pneumoniae, which showed no absolute requirement...

KADIN AKADEMİSYENLER: CAM TAVANLAR HÂLÂ ÇOK KALIN!

OpenAIRE

Özkaplan, Nurcan

2015-01-01

Cam tavan Feminist teorilerde, işgücü piyasasındaki dikey katmanlaşmayı işaret eder. Erkeklerle aynı işyerinde çalışan beyaz yakalı kadınların, daha çok orta ve alt düzey yönetici konumuna sıkışıp kaldığı ve Finansman müdürü, mütevelli heyeti başkanı, rektör, dekan vb. gibi üst düzey yönetici pozisyonlarının %95’den fazlasının erkekler tarafından temsil edildiği işgücü piyasalarının yaygın ve dirençli bir özelliğidir. Bu makalede, cam tavan konusundaki Feminist teorilerin kısa bir değerlendir...

Atomoxetine Use in Attention-Deficit/Hyperactivity Disorder and Comorbid Tic Disorder in Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal Infections.

Science.gov (United States)

Demirkaya, Sevcan Karakoç; Demirkaya, Mithat; Yusufoğlu, Canan; Akın, Elif

2017-02-01

Attention-deficit/hyperactivity disorder (ADHD) is a common comorbid disease in children with pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS), in which tic-like involuntary movements are frequently seen clinical conditions. In contrast to psychostimulants, atomoxetine is considered as having minimal effects on tics. Here we report two cases with ADHD and PANDAS who were treated with atomoxetine for their ADHD and comorbid tics.

Severe form of streptococcal necrotizing fasciitis of the upper limb - diagnostic and therapeutic challenge: A case report

Directory of Open Access Journals (Sweden)

Mikić Dragan

2015-01-01

Full Text Available Introduction. Since delay in recognition and effective treatment of necrotizing fasciitis (NF caused by invasive group A streptococcus increases the mortality and disability, the early diagnosis and management of this disease are essential for a better outcome. We presented a patient with a severe form of streptococcal NF of the left upper limb in whom amputation was performed as a life saving procedure. Case report. A 65-year-old man, previously healthy, suffered an injury to his left hand by sting on a fish bone. Two days after that the patient got fever, redness, swelling and pain in his left hand. Clinical examination of the patient after admission indicated NF that spread quickly to the entire left upper limb, left armpit, and the left side of the chest and abdomen. Despite the use of aggressive antibiotic and surgical therapy severe destruction of the skin and subcutaneous tissues developed with the development of gangrene of the left upper limb. In this situation, the team of specialists decided that the patient must be operated on submited to amputation of the left arm, at the shoulder. After amputation and aggressive debridement of soft tissue on the left side of the trunk, the patient completely recovered. β-hemolytic streptococcus group A was isolated from the skin and tissue obtained during the surgery. Conclusion. In the most severe forms of streptococcal NF of the extremities, adequate multidisciplinary treatment, including limb amputation, can save the life of a patient.

La tuberculosis de “Doc” Holliday en el cine. La hora de las pistolas/ Hour Of The Gun (1967 y Duelo a muerte en O.K. Corral/ “Doc” (1971

Directory of Open Access Journals (Sweden)

José Elías García Sánchez

2008-10-01

Full Text Available La hora de las pistolas (1967 de John Sturges comienza en el famoso duelo en el O.K. Corral mientras que Duelo a muerte en O.K. Corral (1971 de Frank Perry, como sus predecesoras Pasión de los fuertes (1946 y Duelo de titanes (1957 termina en él. Ambas películas muestran la tuberculosis pulmonar de “Doc” Holliday. La primera incide especialmente en sus últimos días en el sanatorio antituberculoso de Glenwood Springs y la segunda, en la que es el protagonista, con sus intensos ataques de tos.

After Prism & Tempora: How much monitoring is OK for CERN?

CERN Multimedia

Computer Security Team

2013-01-01

Edward Snowden’s revelations about the “Prism” and “Tempora” surveillance operations, run by the NSA in the US and GCHQ in the UK respectively, created quite a stir! Why has the witch hunt of a whistle-blower dominated newspaper headlines when there appears to have been no outcry over the fact that two countries have deeply penetrated our digital lives for so long?!   With echoes of George Orwell’s 1984, the two agencies collected a huge amount of Internet traffic, tapping into as much data per day as the LHC produces per year (see here). How much privacy are we willing to give up in order to protect ourselves against terrorist attacks? How much monitoring of our Internet activity is justified in order to feel safer? And how much monitoring is OK in the academic environment of CERN? As the world’s largest high-energy physics research lab and the home of the LHC, CERN is a target for hacktivists and cyber-attackers. CERN mu...

Invasive Group A Streptococcal Infection and Vaccine Implications, Auckland, New Zealand

Science.gov (United States)

Safar, Atheer; Stewart, Joanna; Trenholme, Adrian; Drinkovic, Dragana; Peat, Briar; Taylor, Susan; Read, Kerry; Roberts, Sally; Voss, Lesley

2011-01-01

We aimed to assess the effect of invasive group A streptococcal (GAS) infection and the potential effects of a multivalent GAS vaccine in New Zealand. During January 2005–December 2006, we conducted prospective population-based laboratory surveillance of Auckland residents admitted to all public hospitals with isolation of GAS from normally sterile sites. Using emm typing, we identified 225 persons with confirmed invasive GAS infection (median 53 years of age; range 0–97 years). Overall incidence was 8.1 cases per 100,00 persons per year (20.4/100,000/year for Maori and Pacific Islanders; 24.4/100,000/year for persons >65 years of age; 33/100,000/year for infants Auckland’s lowest socioeconomic quintile. Twenty-two persons died, for an overall case-fatality rate of 10% (63% for toxic shock syndrome). Seventy-four percent of patients who died had an underlying condition. To the population in our study, the proposed 26-valent vaccine would provide limited benefit. PMID:21749758

Posterior reversible encephalopathy syndrome and acute post-streptococcal glomerulonephritis mimicking breakthrough seizures

Directory of Open Access Journals (Sweden)

Kamille Abdool

2015-05-01

Full Text Available We report the case of a 14-year-old boy with a past history of primary generalized seizures, who had been seizure-free for 2 years on sodium valproate and presented with generalized tonic clonic seizures suggestive of breakthrough seizures. Examination revealed hypertension, impetiginous lesions of the lower limbs, microscopic hematuria, elevated antistreptolysin O titre and low complement levels consistent with acute post-streptococcal glomerulonephritis. Cranial magnetic resonance imaging (MRI demonstrated changes consistent with posterior reversible encephalopathy syndrome. Hypertension was controlled with intravenous nitroglycerin followed by oral captopril and amlodipine. Brain MRI changes returned normal within 2 weeks. The nephritis went in to remission within 2 months and after 8 months the patient has been seizure free again. Posterior reversible encephalopathy syndrome appeared to have neither short nor intermediate effect on seizure control in this patient. The relationship between posterior reversible encephalopathy syndrome and seizures is reviewed.

Lymphatic malformations: a proposed management algorithm.

LENUS (Irish Health Repository)

Oosthuizen, J C

2012-02-01

OBJECTIVE: The aim of this study was to develop a management algorithm for cervicofacial lymphatic malformations, based on the authors\\' experience in managing these lesions as well as current literature on the subject. STUDY DESIGN AND METHODS: A retrospective medical record review of all the patients treated for lymphatic malformations at our institution during a 10-year period (1998-2008) was performed. DATA COLLECTED: age at diagnosis, location and type of lesion, radiologic investigation performed, presenting symptoms, treatment modality used, complications and results achieved. RESULTS: 14 patients were identified. Eight (57%) male and six (43%) female. There was an equal distribution between the left and right sides. The majority (71%) of cases were diagnosed within the first year of life. The majority of lesions were located in the suprahyoid region. The predominant reason for referral was an asymptomatic mass in 7 cases (50%) followed by airway compromise (36%) and dysphagia (14%). Management options employed included: observation, OK-432 injection, surgical excision and laser therapy. In 5 cases (36%) a combination of these were used. CONCLUSION: Historically surgical excision has been the management option of choice for lymphatic malformations. However due to the morbidity and high complication rate associated this is increasingly being questioned. Recent advances in sclerotherapy e.g. OK-432 injection have also shown significant promise. Based on experience in managing these lesions as well as current literature the authors of this paper have developed an algorithm for the management of cervicofacial lymphatic malformations.

Differential action on cancer and normal tissue by adrenochrome monoaminoguanidine methanesulfonate and cytochrome C combined with radiotherapy

International Nuclear Information System (INIS)

Nakatsugawa, S.; Sugahara, T.

1994-01-01

The possibility that radioprotective effects on potent natural killer (NK) cells by adrenochrome monoaminoguanidine methanesulfonate (AMM) + cytochrome C during radiotherapy (RT) for lung cancer might result in the radiosensitization of human lung cancer cells in vivo is examined. Human lung cancer xenografts in the right hind legs of KSN mice (10 weeks old) were locally irradiated with 20 Gy of X ray. AMM (10 mg/kg/day) and/or cytochrome C (CCC) (5 mg/kg/day) were given intraperitoneally immediately before or after RT, followed by daily administration for 4 days. Natural killer activities of host splenocytes were also tested with the standard 51 Cr releasing assay with YAC-1 cells as target cells. In a clinical study, 65 patients with lung cancer were treated with more than 50 Gy of RT with or without combination with AMM + CCC, OK-432 or AMM + CCC + OK-432. Before and after RT, lymphocyte subsets in the peripheral blood were examined with dichromatic analysis using an Ortho Spectrum IIIFCM system and fluorescent MABs. In this study, the change in the absolute number of each subset was investigated. AMM + cytochrome C augumented NK activity in KSN nude mice, protected potent NK cells in patients with lung cancer against RT and sensitized the human lung cancer xenografts to RT. AMM + cytochrome C may have potential as a differential modulator of radiosensitivity of normal tissues and of tumors. 8 refs., 2 figs., 1 tab

Puerperal and intrapartum group A streptococcal infection.

Science.gov (United States)

Anteby, E Y; Yagel, S; Hanoch, J; Shapiro, M; Moses, A E

1999-01-01

OBJECTIVE: To determine the demographic and clinical variables characteristic of non-epidemic intrapartum or puerperal group A streptococcal (GAS) infection. METHODS: The records of 47 patients diagnosed with intrapartum or puerperal GAS infection over a 6 1/2 year period at Hadassah-University Hospital-Mt. Scopus, Jerusalem were reviewed. Data regarding 25,811 women, the general population of women that delivered during that period, were obtained from their computerized medical records. Frequency distributions, t-test, chi-square, and Spearman's Rank Correlation were used, as appropriate, to analyze and compare demographic and clinical variables associated with development of GAS infection, its clinical course and subsequent development of septic shock. RESULTS: Mean age of mothers with GAS infection was higher than that of our general pregnant population (30.4 versus 27.4 years, P = 0.0019), and a higher proportion of GAS infected patients (30% versus 12%, P < 0.005) experienced PROM. Thirty-one (66%) women had fever as their sole presenting symptom, eight (17%) had fever and abdominal pain, seven (15%) had fever and abnormal vaginal bleeding, and one patient (2%) presented with a rash. Three patients (6%) developed a septic shock. Two of these patients presented with symptoms more than 14 days after delivery. CONCLUSIONS: We describe the characteristics of non-epidemic intrapartum or puerperal GAS infection. Data from our study and review of the literature suggest that some patients who develop septic shock may present later in the puerperium than patients with an uncomplicated GAS infection. PMID:10598916

Codevelopment of Microbiota and Innate Immunity and the Risk for Group B Streptococcal Disease

Directory of Open Access Journals (Sweden)

Julia Kolter

2017-11-01

Full Text Available The pathogenesis of neonatal late-onset sepsis (LOD, which manifests between the third day and the third month of life, remains poorly understood. Group B Streptococcus (GBS is the most important cause of LOD in infants without underlying diseases or prematurity and the third most frequent cause of meningitis in the Western world. On the other hand, GBS is a common intestinal colonizer in infants. Accordingly, despite its adaption to the human lower gastrointestinal tract, GBS has retained its potential virulence and its transition from a commensal to a dangerous pathogen is unpredictable in the individual. Several cellular innate immune mechanisms, in particular Toll-like receptors, the inflammasome and the cGAS pathway, are engaged by GBS effectors like nucleic acids. These are likely to impact on the GBS-specific host resistance. Given the long evolution of streptococci as a normal constituent of the human microbiota, the emergence of GBS as the dominant neonatal sepsis cause just about 50 years ago is remarkable. It appears that intensive usage of tetracycline starting in the 1940s has been a selection advantage for the currently dominant GBS clones with superior adhesive and invasive properties. The historical replacement of Group A by Group B streptococci as a leading neonatal pathogen and the higher frequency of other β-hemolytic streptococci in areas with low GBS prevalence suggests the existence of a confined streptococcal niche, where locally competing streptococcal species are subject to environmental and immunological selection pressure. Thus, it seems pivotal to resolve neonatal innate immunity at mucous surfaces and its impact on microbiome composition and quality, i.e., genetic heterogeneity and metabolism, at the microanatomical level. Then, designer pro- and prebiotics, such as attenuated strains of GBS, and oligonucleotide priming of mucosal immunity may unfold their potential and facilitate adaptation of potentially

Codevelopment of Microbiota and Innate Immunity and the Risk for Group B Streptococcal Disease.

Science.gov (United States)

Kolter, Julia; Henneke, Philipp

2017-01-01

The pathogenesis of neonatal late-onset sepsis (LOD), which manifests between the third day and the third month of life, remains poorly understood. Group B Streptococcus (GBS) is the most important cause of LOD in infants without underlying diseases or prematurity and the third most frequent cause of meningitis in the Western world. On the other hand, GBS is a common intestinal colonizer in infants. Accordingly, despite its adaption to the human lower gastrointestinal tract, GBS has retained its potential virulence and its transition from a commensal to a dangerous pathogen is unpredictable in the individual. Several cellular innate immune mechanisms, in particular Toll-like receptors, the inflammasome and the cGAS pathway, are engaged by GBS effectors like nucleic acids. These are likely to impact on the GBS-specific host resistance. Given the long evolution of streptococci as a normal constituent of the human microbiota, the emergence of GBS as the dominant neonatal sepsis cause just about 50 years ago is remarkable. It appears that intensive usage of tetracycline starting in the 1940s has been a selection advantage for the currently dominant GBS clones with superior adhesive and invasive properties. The historical replacement of Group A by Group B streptococci as a leading neonatal pathogen and the higher frequency of other β-hemolytic streptococci in areas with low GBS prevalence suggests the existence of a confined streptococcal niche, where locally competing streptococcal species are subject to environmental and immunological selection pressure. Thus, it seems pivotal to resolve neonatal innate immunity at mucous surfaces and its impact on microbiome composition and quality, i.e., genetic heterogeneity and metabolism, at the microanatomical level. Then, designer pro- and prebiotics, such as attenuated strains of GBS, and oligonucleotide priming of mucosal immunity may unfold their potential and facilitate adaptation of potentially hazardous streptococci as

Irradiation history and final postirradiation data for IFA-432

International Nuclear Information System (INIS)

Lanning, D.D.

1986-11-01

The irradiation history and final postirradiation examination (PIE) results are presented for the Halden fuel assembly IFA-432. In particular, the three instrumented rods (Rods 2, 3, and 5) that continued to the highest burnup (46 MWd/kgM) are emphasized. The long survival rate of the fuel instrumentation allowed a continuous record to be kept of linear heat generation rate and fuel temperatures throughout the operating history of the asembly. Fission gas release was estimated based on a combination of gas retention and ceramographic data. The PIE data show that the postirradiation condition of the rods is qualitatively consistent with the power/temperature histories experienced. Fission gas release estimates are: Rod 2 (380 μm as-fabricated gap), 20-40%; Rod 5 (230 μm as-fabricated gap), 20-40%; and Rod 3 (76 μm as-fabricated gap), 0-20%

Prospective Surveillance of Invasive Group A Streptococcal Disease, Fiji, 2005–2007

Science.gov (United States)

Jenney, Adam; Kado, Joseph; Good, Michael F.; Batzloff, Michael; Waqatakirewa, Lepani; Mullholland, E. Kim; Carapetis, Jonathan R.

2009-01-01

We undertook a prospective active surveillance study of invasive group A streptococcal (GAS) disease in Fiji over a 23-month period, 2005–2007. We identified 64 cases of invasive GAS disease, which represents an average annualized all-ages incidence of 9.9 cases/100,000 population per year (95% confidence interval [CI] 7.6–12.6). Rates were highest in those >65 years of age and in those <5 years, particularly in infants, for whom the incidence was 44.9/100,000 (95% CI 18.1–92.5). The case-fatality rate was 32% and was associated with increasing age and underlying coexisting disease, including diabetes and renal disease. Fifty-five of the GAS isolates underwent emm sequence typing; the types were highly diverse, with 38 different emm subtypes and no particular dominant type. Our data support the view that invasive GAS disease is common in developing countries and deserves increased public health attention. PMID:19193265

Acute Streptococcal Tonsillitis in a Child. Questions asked by Life (Scientific Answers to the Question Put by the Practice

Directory of Open Access Journals (Sweden)

N.V. Nagornaya

2013-11-01

Full Text Available The problem of acute tonsillitis remains relevant in clinical pediatrics. A special role in its etiology belongs to group A β-hemolytic streptococcus (Streptococcus pyogenes, which is found in every fourth child with acute bacterial tonsillitis. In this article there is presented an analysis of the clinical case of streptococcal tonsillitis in children and the pathogen, epidemiology and prognosis of the disease are described. The authors reviewed the current diagnosis criteria and international treatment approaches. There has been grounded the use of cefuroxime axetil for eradication of Streptococcus pyogenes.

The role of group A beta hemolytic streptococcal infections in patients with tic and tourett's disorders

Directory of Open Access Journals (Sweden)

Noorbakhsh S

2010-12-01

% PPV; Anti- streptokinase (cut off level> 332IU/ml had 34% sensitivity; 85% specificity, and 90% PPV; Anti-DNase (cut off level> 140IU/ml had 70% sensitivity; 99% specificity and PPV 90%."n"nConclusion: Patients with tic disorder had a significant high antibody titer against streptococcal infection in comparison with healthy children. It presents possible role for streptococcal infection in tic disorders. Treatment of streptococcal infection is achievable by using of long acting Penicillin in our country. Use of aggressive treatment like plasmaphresis etc needs future RCT studies.

The Prevalence of Antibiotic and Toothpaste Sensitivity found in Oral Streptococcal Isolates in Healthy Individuals in the Okada Community of Nigeria

Directory of Open Access Journals (Sweden)

Maureen U Okwu

2017-04-01

Full Text Available Background: This study aimed to determine the prevalence, antibiotic, and toothpaste sensitivity of oral streptococcal isolates in healthy individuals in the Okada community of Nigeria. Methods: Oral samples were collected from 230 volunteers and were subjected to standard microbiological tests. Antibacterial sensitivity tests were carried out on the streptococcal isolates that were obtained using a disk diffusion technique, and eight kinds of toothpaste (A-H were screened for their antibacterial effects on Streptococcus mutans (S. mutans. Results: The prevalence of oral streptococci found in this study was 26.1% and the predominant species was S. salivarius (13.9%. S. salivarius was highly resistant to cloxacillin (100% and Augmentin (96.9%, whilst resistance to gentamicin and erythromycin was low at 21.9% and 3.1% respectively. S. mutans were completely sensitive to gentamicin whilst resistance to erythromycin was 33.3%. The entire Streptococcus species showed the lowest resistance to erythromycin (20.0%, followed by gentamicin (31.7%. At 100 mg/mL all toothpaste samples had antibacterial effects on S. mutans. At 50 mg/mL all samples except toothpastes G and H inhibited the bacterium. Toothpastes A and E had the lowest minimum inhibitory concentration of 25 mg/mL. Conclusions: Toothpastes A and E were the most effective toothpastes of the eight assessed in this study.

Final irradiation and postirradiation data from the NRC/PNL instrumented assembly IFA-432

International Nuclear Information System (INIS)

Lanning, D.D.; Bradley, E.R.

1986-02-01

The instrumented six-rod test assembly IFA-432, sponsored by USNRC, operated in the Halden Reactor from December 1975 to May 1984, with surviving fuel thermocouples, neutron detectors and pressure transducers. Peak burnups of 46 MWd/kgM were achieved. Interim destructive examination data were obtained at peak burnups of 24 and 34 MWd/kgM. This paper presents a synopsis of the irradiation histories and postirradiation examination data for the high burnup rods. The postirradiation condition of the rods correlates well with their individual design parameters and operating conditions

Purification of a Streptococcus mutans protein that binds to heart tissue and glycosaminoglycans.

OpenAIRE

Choi, S H; Stinson, M W

1989-01-01

Proteins of Streptococcus mutans MT703 were isolated by differential filtration from chemically defined culture medium following growth of the bacteria. Incubation of this preparation with cryostat-cut sections of fresh rabbit cardiac muscle resulted in deposition of streptococcal components on basement membranes of sarcolemmal sheaths and capillary walls, as indicated by indirect immunofluorescence assay. Binding of radioiodinated streptococcal proteins to heart in vitro was time dependent a...

[Five days ceftibuten versus 10 days penicillin in the treatment of 2099 patients with A-streptococcal tonsillopharyngitis].

Science.gov (United States)

Adam, D; Scholz, H; Helmerking, M

2001-07-19

Group A Streptococci have remained sensitive to penicillins and other betalactam antibiotics, e. g. cephalosporins. Since the beginning of the 1950s oral penicillin V given three times daily in a dose of 50,000 IU daily has been the drug of choice against Group A streptococcal infection. The German Society for Pediatric Infectious Diseases (DGPI) undertook a large scale multicenter randomized study of culture-proven A-streptococcal tonsillopharyngitis to compare the efficacy and safety of a five day regimen of ceftibuten (9 mg/kg KG, once daily) with 10 days of penicillin V (50,000 I.E./kg KG, divided in three doses), testing for equivalence of clinical and bacteriological efficacy. A one year follow-up served to assess poststreptococcal sequelae like rheumatic fever or glomerulonephritis. The clinical efficacy at the clinical end-point 7-9 days after end of treatment was 86.9% (419/482) for ceftibuten and 88.6% (1,198/1,352) for penicillin V. This result is statistically equivalent (P = 0.0152). Resolution of clinical symptoms was significantly faster in the ceftibuten group (P = 0.043/Fisher-Test) and compliance was significantly superior as well (P (0.001). Eradication of group A streptococci at an early control 2-4 days after end of treatment was not equivalent, 78.49% for ceftibuten and 84.42% for penicillin V (P = 0.5713). Both eradication rates were comparable 7-8 weeks after end of treatment (84.65%, 375/443 ceftibuten vs. 86.82%, 1,067/1,229 penicillin V), the difference not being significant. No cases of poststreptococcal sequelae, e.g. rheumatic fever or glomerulonephritis, attributable to either ceftibuten or penicillin were observed in the course of the study.

Cross-sectional study comparing different therapeutic modalities for cystic lymphangiomas in children

Directory of Open Access Journals (Sweden)

Hugo de Oliveira Olímpio

2014-08-01

Full Text Available OBJECTIVE: Here, we describe our experience with different therapeutic modalities used to treat cystic lymphangiomas in children in our hospital, including single therapy with OK-432, bleomycin and surgery, and a combination of the three modalities. METHODS: We performed a retrospective, cross-sectional study including patients treated from 1998 to 2011. The effects on macrocystic lymphangiomas and adverse reactions were evaluated. Twenty-nine children with cystic lymphangiomas without any previous treatment were included. Under general anesthesia, patients given sclerosing agents underwent puncture of the lesion (guided by ultrasound when necessary and complete aspiration of the intralesional liquid. The patients were evaluated with ultrasound and clinical examinations for a maximum follow-up time of 4 years. RESULTS: The proportions of patients considered cured after the first therapeutic approach were 44% in the surgery group, 29% in the bleomycin group and 31% in the OK-432 group. These proportions were not significantly different. Sequential treatment increased the rates of curative results to 71%, 74% and 44%, respectively, after the final treatment, which in our case was approximately 1.5 applications per patient. CONCLUSION: The results of this study indicate that most patients with cystic lymphangiomas do not show complete resolution after the initial therapy, regardless of whether the therapy is surgical or involves the use of sclerosing agents. To achieve complete resolution of the lesions, either multiple operations or a combination of surgery and sclerotherapy must be used and should be tailored to the characteristics of each patient.

[Outcome of rapidly progressive glomerulonephritis post-streptococcal disease in children].

Science.gov (United States)

Jellouli, Manel; Maghraoui, Sondos; Abidi, Kamel; Hammi, Yosra; Goucha, Rim; Naija, Ouns; Zarrouk, Chokri; Gargah, Tahar

2015-11-01

Rapidly progressive glomerulonephritis is a rare form of postinfectious glomerulonephritis. The aim of this study was to describe the outcome of our patients with severe post-streptococcal glomerulonephritis. This retrospective study was conducted in the department of pediatrics in Charles-Nicolle Hospital during a period of 13 years (1997-2009). Twenty-seven children were identified. The mean age was 8.7 years. All patients presented renal failure at presentation. The mean serum creatinine at presentation was 376.9 μmol/L. Six patients presented nephrotic syndrome. Twenty-six children had renal biopsies. Renal biopsies showed crescents in 24 cases. Eighteen children received pulse dose of corticosteroids (66.6%) and 6 children (22%) received pulse dose of corticosteroids and cyclophosphamide. Eleven patients required dialysis. At last follow-up, 22 patients (81.5%) had normal kidney function, 2 had renal dysfunction and 3 reached end stage renal disease. The only significant determinant for renal survival was the supportive dialysis (P=0.015). Rapidly progressive glomerulonephritis is uncommon. There have been significant advancements in supportive, as well as specific therapy, but the outcome continues to be poor. Copyright © 2015 Association Société de néphrologie. Published by Elsevier SAS. All rights reserved.

A Cluster of Paediatric Invasive Group A Streptococcal and Chicken Pox Infections

LENUS (Irish Health Repository)

Ó Maoldomhnaigh, C

2018-03-01

Group A streptococcus (GAS) causes a variety of acute clinical syndromes from pharyngitis and scarlet fever commonly seen in primary care to more severe life-threatening invasive disease. Invasive GAS, categorised into three groups - necrotising fasciitis, streptococcal toxic shock syndrome and sepsis with or without an identifiable source of infection- is a notifiable disease to the Health Protection Surveillance Centre (HPSC)1. Laboratory criteria for a confirmed case require isolation of GAS from a normally sterile site. The HPSC previously reported a marked increase in the incidence of invasive GAS infections from 1.65\\/100,000 population in 2011 to 3.65\\/100,000 in 20132. The increased incidence was notable also for a 300% increase in the proportion of invasive GAS cases in children. After a slight decrease in incidence in 20153 (2.3\\/100000), we noted a cluster of invasive GAS cases referred to the paediatric infectious disease (PID) department of Children’s University Hospital (CUH), Temple Street, in 2016. We sought to further characterise this cluster of paediatric invasive GAS infections.

Stability of the octameric structure affects plasminogen-binding capacity of streptococcal enolase.

Directory of Open Access Journals (Sweden)

Amanda J Cork

Full Text Available Group A Streptococcus (GAS is a human pathogen that has the potential to cause invasive disease by binding and activating human plasmin(ogen. Streptococcal surface enolase (SEN is an octameric α-enolase that is localized at the GAS cell surface. In addition to its glycolytic role inside the cell, SEN functions as a receptor for plasmin(ogen on the bacterial surface, but the understanding of the molecular basis of plasmin(ogen binding is limited. In this study, we determined the crystal and solution structures of GAS SEN and characterized the increased plasminogen binding by two SEN mutants. The plasminogen binding ability of SENK312A and SENK362A is ~2- and ~3.4-fold greater than for the wild-type protein. A combination of thermal stability assays, native mass spectrometry and X-ray crystallography approaches shows that increased plasminogen binding ability correlates with decreased stability of the octamer. We propose that decreased stability of the octameric structure facilitates the access of plasmin(ogen to its binding sites, leading to more efficient plasmin(ogen binding and activation.

Çok Etmenli Sistemlerde NetLogo İle Karınca Kolonisi Optimizasyonu

Directory of Open Access Journals (Sweden)

Mustafa Tüker

2013-02-01

Full Text Available Çok etmenli sistemler (ÇES, karmaşık optimizasyon problemlerinin modellenmesi ve çözülmesi için etkin bir yol sunarlar. Bu çalışmada, Gezgin Satıcı Problemi (GSP'ni çözmek için ÇES ve karınca kolonileri birlikte kullanılmıştır. Sistem benzetimi, etmen tabanlı bir programlama ortamı olan NetLogo ile gerçekleştirilmiştir. Problemin modellenmesi ve benzetimi için NetLogo'nun nasıl kullanılacağı kodlarla ayrıntılı olarak açıklanmıştır. Algoritma farklı düğüm sayıları için denenmiş ve elde edilen sonuçlar tartışılmıştır.

The prevention of early-onset neonatal group B streptococcal disease.

Science.gov (United States)

Money, Deborah; Allen, Victoria M

2013-10-01

To review the evidence in the literature and to provide recommendations on the management of pregnant women in labour for the prevention of early-onset neonatal group B streptococcal disease. The key revisions in this updated guideline include changed recommendations for regimens for antibiotic prophylaxis, susceptibility testing, and management of women with pre-labour rupture of membranes. Maternal outcomes evaluated included exposure to antibiotics in pregnancy and labour and complications related to antibiotic use. Neonatal outcomes of rates of early-onset group B streptococcal infections are evaluated. Published literature was retrieved through searches of MEDLINE, CINAHL, and The Cochrane Library from January 1980 to July 2012 using appropriate controlled vocabulary and key words (group B streptococcus, antibiotic therapy, infection, prevention). Results were restricted to systematic reviews, randomized control trials/controlled clinical trials, and observational studies. There were no date or language restrictions. Searches were updated on a regular basis and incorporated in the guideline to May 2013. Grey (unpublished) literature was identified through searching the websites of health technology assessment and health technology-related agencies, clinical practice guideline collections, clinical trial registries, and national and international medical specialty societies. The quality of evidence in this document was rated using the criteria described in the Report of the Canadian Task Force on Preventive Health Care (Table 1). The recommendations in this guideline are designed to help clinicians identify and manage pregnancies at risk for neonatal group B streptococcal disease to optimize maternal and perinatal outcomes. No cost-benefit analysis is provided. There is good evidence based on randomized control trial data that in women with pre-labour rupture of membranes at term who are colonized with group B streptococcus, rates of neonatal infection are

Structure of a streptococcal adhesion carbohydrate receptor

International Nuclear Information System (INIS)

Cassels, F.J.; Fales, H.M.; London, J.; Carlson, R.W.; van Halbeek, H.

1990-01-01

Interactions between complementary protein and carbohydrate structures on different genera of human oral bacteria have been implicated in the formation of dental plaque. The carbohydrate receptor on Streptococcus sanguis H1 that is specific for the adhesion on Capnocytophaga ochracea ATCC 33596 has been isolated from the streptococcal cell wall, purified, and structurally characterized. The hexasaccharide repeating unit of the polysaccharide was purified by reverse-phase, amino-bonded silica, and gel permeation high performance liquid chromatography. Earlier studies established that the repeating unit was a hexasaccharide composed of rhamnose, galactose, and glucose in the ration of 2:3:1, respectively. In the present study, determination of absolute configuration by gas chromatography of the trimethylsilyl (+)-2-butyl glycosides revealed that the rhamnose residues were of the L configuration while the hexoses were all D. 252Californium plasma desorption mass spectrometry of the native, the acetylated and the reduced and acetylated hexasaccharide determined that the molecular mass of the native hexasaccharide was 959, and that the 2 rhamnose residues were linked to each other at the nonreducing terminus of the linear molecule. Methylation analysis revealed the positions of the glycosidic linkages in the hexasaccharide and showed that a galactose residue was present at the reducing end. The structural characterization of the hexasaccharide was completed by one and two dimensional 1H and 13C NMR spectroscopy. Complete 1H and 13C assignments for each glycosyl residue were established by two-dimensional (1H,1H) correlation spectroscopy, homonuclear Hartmann-Hahn, and (13C,1H) correlation experiments. The configurations of the glycosidic linkages were inferred from the chemical shifts and coupling constants of the anomeric 1H and 13C resonances

Identification and Structural Basis of Binding to Host Lung Glycogen by Streptococcal Virulence Factors

Energy Technology Data Exchange (ETDEWEB)

Lammerts van Bueren,A.; Higgins, M.; Wang, D.; Burke, R.; Boraston, A.

2007-01-01

The ability of pathogenic bacteria to recognize host glycans is often essential to their virulence. Here we report structure-function studies of previously uncharacterized glycogen-binding modules in the surface-anchored pullulanases from Streptococcus pneumoniae (SpuA) and Streptococcus pyogenes (PulA). Multivalent binding to glycogen leads to a strong interaction with alveolar type II cells in mouse lung tissue. X-ray crystal structures of the binding modules reveal a novel fusion of tandem modules into single, bivalent functional domains. In addition to indicating a structural basis for multivalent attachment, the structure of the SpuA modules in complex with carbohydrate provides insight into the molecular basis for glycogen specificity. This report provides the first evidence that intracellular lung glycogen may be a novel target of pathogenic streptococci and thus provides a rationale for the identification of the streptococcal {alpha}-glucan-metabolizing machinery as virulence factors.

Alkylation of 2,6-di-tert-butylphenol with methyl acrylate catalyzed by potassium-2,6-di-tert-butylphenoxide

OpenAIRE

Zaikov, Gennady; Volod’kin, Alexander

2010-01-01

The kinetics of catalytic alkylation of 2,6-ditert- butylphenol (ArOH) with methyl acrylate (MA) in the presence of potassium 2,6-di-tert-butylphenoxide (ArOK) depends on the method for the preparation of ArOK. The reaction ofArOH withKOHat temperatures > 453 Kaffords monomeric ArOK, which properties differ from those in the case of potassium 2,6-di-tert-butylphenoxide synthesized by the earliermethods.The regularities ofArOH alkylation depend ontheArOKconcentration, theArOH...

Clinical Presentation of Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal infections in Research and Community Settings

Science.gov (United States)

Seidlitz, Jakob; Kovacevic, Miro; Latimer, M. Elizabeth; Hommer, Rebecca; Lougee, Lorraine; Grant, Paul

2015-01-01

Abstract Background: The first cases of pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS) were described>15 years ago. Since that time, the literature has been divided between studies that successfully demonstrate an etiologic relationship between Group A streptococcal (GAS) infections and childhood-onset obsessive-compulsive disorder (OCD), and those that fail to find an association. One possible explanation for the conflicting reports is that the diagnostic criteria proposed for PANDAS are not specific enough to describe a unique and homogeneous cohort of patients. To evaluate the validity of the PANDAS criteria, we compared clinical characteristics of PANDAS patients identified in two community practices with a sample of children meeting full research criteria for PANDAS. Methods: A systematic review of clinical records was used to identify the presence or absence of selected symptoms in children evaluated for PANDAS by physicians in Hinsdale, Illinois (n=52) and Bethesda, Maryland (n=40). Results were compared against data from participants in National Institute of Mental Health (NIMH) research investigations of PANDAS (n=48). Results: As described in the original PANDAS cohort, males outnumbered females (95:45) by ∼ 2:1, and symptoms began in early childhood (7.3±2.7 years). Clinical presentations were remarkably similar across sites, with all children reporting acute onset of OCD symptoms and multiple comorbidities, including separation anxiety (86–92%), school issues (75–81%), sleep disruptions (71%), tics (60–65%), urinary symptoms (42–81%), and others. Twenty of the community cases (22%) failed to meet PANDAS criteria because of an absence of documentation of GAS infections. Conclusions: The diagnostic criteria for PANDAS can be used by clinicians to accurately identify patients with common clinical features and shared etiology of symptoms. Although difficulties in documenting an association

Clinical presentation of pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections in research and community settings.

Science.gov (United States)

Swedo, Susan E; Seidlitz, Jakob; Kovacevic, Miro; Latimer, M Elizabeth; Hommer, Rebecca; Lougee, Lorraine; Grant, Paul

2015-02-01

The first cases of pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS) were described >15 years ago. Since that time, the literature has been divided between studies that successfully demonstrate an etiologic relationship between Group A streptococcal (GAS) infections and childhood-onset obsessive-compulsive disorder (OCD), and those that fail to find an association. One possible explanation for the conflicting reports is that the diagnostic criteria proposed for PANDAS are not specific enough to describe a unique and homogeneous cohort of patients. To evaluate the validity of the PANDAS criteria, we compared clinical characteristics of PANDAS patients identified in two community practices with a sample of children meeting full research criteria for PANDAS. A systematic review of clinical records was used to identify the presence or absence of selected symptoms in children evaluated for PANDAS by physicians in Hinsdale, Illinois (n=52) and Bethesda, Maryland (n=40). RESULTS were compared against data from participants in National Institute of Mental Health (NIMH) research investigations of PANDAS (n=48). As described in the original PANDAS cohort, males outnumbered females (95:45) by ∼ 2:1, and symptoms began in early childhood (7.3±2.7 years). Clinical presentations were remarkably similar across sites, with all children reporting acute onset of OCD symptoms and multiple comorbidities, including separation anxiety (86-92%), school issues (75-81%), sleep disruptions (71%), tics (60-65%), urinary symptoms (42-81%), and others. Twenty of the community cases (22%) failed to meet PANDAS criteria because of an absence of documentation of GAS infections. The diagnostic criteria for PANDAS can be used by clinicians to accurately identify patients with common clinical features and shared etiology of symptoms. Although difficulties in documenting an association between GAS infection and symptom onset/exacerbations may

Synergistic streptococcal phage λSA2 and B30 endolysins kill streptococci in cow milk and in a mouse model of mastitis.

Science.gov (United States)

Schmelcher, Mathias; Powell, Anne M; Camp, Mary J; Pohl, Calvin S; Donovan, David M

2015-10-01

Bovine mastitis results in billion dollar losses annually in the USA alone. Streptococci are among the most relevant causative agents of this disease. Conventional antibiotic therapy is often unsuccessful and contributes to development of antibiotic resistance. Bacteriophage endolysins represent a new class of antimicrobials against these bacteria. In this work, we characterized the endolysins (lysins) of the streptococcal phages λSA2 and B30 and evaluated their potential as anti-mastitis agents. When tested in vitro against live streptococci, both enzymes exhibited near-optimum lytic activities at ionic strengths, pH, and Ca(2+) concentrations consistent with cow milk. When tested in combination in a checkerboard assay, the lysins were found to exhibit strong synergy. The λSA2 lysin displayed high activity in milk against Streptococcus dysgalactiae (reduction of CFU/ml by 3.5 log units at 100 μg/ml), Streptococcus agalactiae (2 log), and Streptococcus uberis (4 log), whereas the B30 lysin was less effective. In a mouse model of bovine mastitis, both enzymes significantly reduced intramammary concentrations of all three streptococcal species (except for B30 vs. S. dysgalactiae), and the effects on mammary gland wet weights and TNFα concentrations were consistent with these findings. Unexpectedly, the synergistic effect determined for the two enzymes in vitro was not observed in the mouse model. Overall, our results illustrate the potential of endolysins for treatment of Streptococcus-induced bovine mastitis.

Preparation and properties of high-Tc Bi-oxide superconductors

International Nuclear Information System (INIS)

Maeda, H.

1989-01-01

Bulk superconductors of Pb-doped Bi-oxide system (BSCCO) dominated with the high-Tc phase have the critical transition temperature, Tc of 110 K, and the upper critical fields, H c2 of 140 T at OK and 60 T at 77 K. A highly dense and a highly oriented microstructure is obtained by inserting an intermediate uniaxial pressing process. The critical current density, Jc at 77 K in zero field, Jc (77K,OT) of some 5000 A/cm 2 can be easily obtained by this process, and the field dependence of Jc is also improved. Flexible high-Tc BSCCO ribbons with a Jc (77K,Ot) of 1850 A/cm 2 have been successfully prepared by the combined process of doctor blade casting, cold rolling and sintering. Aq-sheeted multifilamentary wires with 1330 filaments and tapes with 30 filaments have also been successfully fabricated and the 36-filament tape shows a Jc(77K,OT) of 1050 A/cm 2 . (Auth.). 7 refs.; 7 figs

Evaluation of a rapid antigen detection test in the diagnosis of streptococcal pharyngitis in children and its impact on antibiotic prescription.

Science.gov (United States)

Maltezou, Helen C; Tsagris, Vasilios; Antoniadou, Anastasia; Galani, Labrini; Douros, Constantinos; Katsarolis, Ioannis; Maragos, Antonios; Raftopoulos, Vasilios; Biskini, Panagiota; Kanellakopoulou, Kyriaki; Fretzayas, Andreas; Papadimitriou, Theodoros; Nicolaidou, Polyxeni; Giamarellou, Helen

2008-12-01

To study the performance of the Becton-Dickinson Link 2 Strep A Rapid Test, a rapid antigen detection test (RADT) for diagnosing streptococcal pharyngitis in children presenting to private offices and to the Pediatric Outpatient Clinic of a university hospital, in relation to clinical criteria (fever, tender anterior cervical lymph nodes, tonsillar exudate and absence of cough), and its impact on antibiotic prescription. Children were enrolled in Group A (enrolment by private-practice paediatricians; diagnosis by clinical picture only), Group B (enrolment by private-practice paediatricians; diagnosis by RADT and culture) or Group C (enrolment by hospital-affiliated paediatricians in the Pediatric Outpatient Clinic; diagnosis by RADT and culture). During a 2 year period, 820 children were enrolled [369 (45%) in Group A, 270 (33%) in Group B and 181 (22%) in Group C]. Streptococcal pharyngitis was diagnosed by RADT and culture in 146 (32.4%) of the 451 tested children. The sensitivity, specificity and positive and negative predictive values of the RADT were 83.1%, 93.3%, 82.4% and 93.6%, respectively. A stepwise increase in the sensitivity of the RADT was noted among children with one, two, three or four clinical criteria (60.9% to 95.8%). Paediatricians without access to laboratory tests were more likely to prescribe antibiotics compared with paediatricians with access to tests (72.2% versus 28.2%, P antibiotics more frequently compared with hospital-affiliated paediatricians (55.7% versus 19.9%, P antibiotic administration. Such a strategy has an important impact on limiting throat culture testing and is associated with reduced antibiotic prescription.

Clinical score and rapid antigen detection test to guide antibiotic use for sore throats: randomised controlled trial of PRISM (primary care streptococcal management).

Science.gov (United States)

Little, Paul; Hobbs, F D Richard; Moore, Michael; Mant, David; Williamson, Ian; McNulty, Cliodna; Cheng, Ying Edith; Leydon, Geraldine; McManus, Richard; Kelly, Joanne; Barnett, Jane; Glasziou, Paul; Mullee, Mark

2013-10-10

To determine the effect of clinical scores that predict streptococcal infection or rapid streptococcal antigen detection tests compared with delayed antibiotic prescribing. Open adaptive pragmatic parallel group randomised controlled trial. Primary care in United Kingdom. Patients aged ≥ 3 with acute sore throat. An internet programme randomised patients to targeted antibiotic use according to: delayed antibiotics (the comparator group for analyses), clinical score, or antigen test used according to clinical score. During the trial a preliminary streptococcal score (score 1, n=1129) was replaced by a more consistent score (score 2, n=631; features: fever during previous 24 hours; purulence; attends rapidly (within three days after onset of symptoms); inflamed tonsils; no cough/coryza (acronym FeverPAIN). Symptom severity reported by patients on a 7 point Likert scale (mean severity of sore throat/difficulty swallowing for days two to four after the consultation (primary outcome)), duration of symptoms, use of antibiotics. For score 1 there were no significant differences between groups. For score 2, symptom severity was documented in 80% (168/207 (81%) in delayed antibiotics group; 168/211 (80%) in clinical score group; 166/213 (78%) in antigen test group). Reported severity of symptoms was lower in the clinical score group (-0.33, 95% confidence interval -0.64 to -0.02; P=0.04), equivalent to one in three rating sore throat a slight versus moderate problem, with a similar reduction for the antigen test group (-0.30, -0.61 to -0.00; P=0.05). Symptoms rated moderately bad or worse resolved significantly faster in the clinical score group (hazard ratio 1.30, 95% confidence interval 1.03 to 1.63) but not the antigen test group (1.11, 0.88 to 1.40). In the delayed antibiotics group, 75/164 (46%) used antibiotics. Use of antibiotics in the clinical score group (60/161) was 29% lower (adjusted risk ratio 0.71, 95% confidence interval 0.50 to 0.95; P=0.02) and in the

Pleural empyema and streptococcal toxic shock syndrome due to Streptococcus pyogenes in a healthy Spanish traveler in Japan

Directory of Open Access Journals (Sweden)

Tetsuya Sakai

2017-01-01

Full Text Available Group A Streptococcus (GAS, Streptococcus pyogenes causes invasive infections including streptococcal toxic shock syndrome (STSS and local infections. To our knowledge, this is the first report of a case of an invasive GAS infection with pneumonia and pleural empyema (PE followed by STSS (disseminated intravascular coagulation [DIC] and acute renal insufficiency in a healthy male adult. He received combined supportive therapies of PE drainage, anti-DIC agent, hemodialysis, and antimicrobials and eventually made a clinical recovery. GAS isolated from PE was found to have emm1/speA genes, suggestive of a pathogenic strain. Clinicians should be aware of the possibility of this disease entity (pneumonia, PE, and STSS in healthy male adults as well as children and adult women.

IFPE/IFA-432, Fission Gas Release, Mechanical Interaction BWR Fuel Rods, Halden

International Nuclear Information System (INIS)

Turnbull, J.A.

1996-01-01

Description: It contains data from experiments that have been performed at the IFE/OECD Halden Reactor Project, available for use in fuel performance studies. It covers experiments on thermal performance, fission product release, clad properties and pellet clad mechanical interaction. It includes also experimental data relevant to high burn-up behaviour. IFA-432: Measurements of fuel temperature response, fission gas release and mechanical interaction on BWR-type fuel rods up to high burn-ups. The assembly featured several variations in rod design parameters, including fuel type, fuel/cladding gap size, fill gas composition (He and Xe) and fuel stability. It contained 6 BWR-type fuel rods with fuel centre thermocouples at two horizontal planes, rods were also equipped with pressure transducers and cladding extensometers. Only data from 6 rods are compiled here

Kurumsal Sürdürülebilirlik Performansının Ölçümü İçin Çok Kriterli Bir Çerçeve: Henkel Örneği

OpenAIRE

Ahmet Öztel; Mehmet Said Köse; İhsan Aytekin

2012-01-01

Kurumsal sürdürülebilirlik performans ölçümü, kurumsal sürdürülebilirliğin çevresel, sosyal ve ekonomik yönlerini ele almayı amaçlamaktadır. Bu üç boyutun tek bir boyuta indirgenmesinde sorunlar ortaya çıkmaktadır. Çok kriterli karar verme yöntemleri, bu değişkenlerin birlikte değerlendirilmesi için kullanışlı bir çerçeve sunmaktadır. Bu çalışmada, çok kriterli karar verme yöntemlerinden uzlaşık programlama (compromise programing) çerçevesi kullanılarak Henkel firmasının kurumsal sürdürülebil...

The period analysis of V418 AQL, SU BOO, RV CVn, CR CAS, GV CYG, V432 PER, and BD+42 2782

International Nuclear Information System (INIS)

Zasche, P.; Wolf, M.; Kučáková, H.; Uhlař, R.

2014-01-01

The minimum timings of eclipsing binaries V418 Aql, SU Boo, RV CVn, CR Cas, GV Cyg, V432 Per, and BD+42 2782 were collected and analyzed. Their long-term behavior was studied via period analysis, revealing a periodic term in eclipse times. We derived 576 new times of minimum. Hence, to describe the periodic variation, a third-body hypothesis was proposed and the resulting orbital periods are as follows: 70, 7.4, 53, 37, 27, 53, and 18 yr, respectively. For the system V432 Per an additional 9.5 yr variation was also found. The predicted minimum masses of these distant bodies were calculated and their detectability discussed. The light curves of SU Boo and RV CVn were analyzed using the PHOEBE program, resulting in physical parameters of the components. New variable stars in the field of V418 Aql were discovered.

Güneş enerjisi destekli çok fonksiyonlu trijenerasyon sisteminin termodinamik analizi

Directory of Open Access Journals (Sweden)

Önder KIZILKAN

2016-02-01

Full Text Available Bu çalışmada güneş enerjisi destekli çok fonksiyonlu bir trijenerasyon sisteminin modellemesi ve termodinamik analizleri yapılmıştır. Sistemde, gaz türbinleri için yeni bir teknoloji olan güneş kulesi vasıtasıyla gaz çevrimi ve buhar çevirimi için gerekli termal enerji sağlanmaktadır. Ayrıca, sisteme absorbsiyonlu soğutma sistemi, buhar üretim prosesi, kurutma prosesi ve kullanım sıcak suyu ısıtma prosesi entegre edilmiştir. Trijenerasyon sisteminin birinci kanun ve ikinci kanun analizleri yapılarak enerji ve ekserji verimleri tespit edilmiştir. Analizler sonucunda gaz çevrimi verimi %31, buhar çevrimi verimi %28, soğutma sisteminin performans katsayısı (COP değeri ise 0.77 olarak tespit edilmiştir. Ekserji kayıpları incelendiğinde ise en yüksek ekserji kaybının 4154 kW ile güneş kulesinde meydana geldiği tespit edilmiştir.Anahtar Kelimeler: Güneş kulesi, Trijenerasyon, Gaz çevrimi, Buhar çevrimi, Enerji, Ekserji

Biodegradation of Mexel 432 By Bacteria From the Seine River

International Nuclear Information System (INIS)

Allonier, A.S.; Khalanski, M.

1996-01-01

This report deals with a study of the biodegradation of a filmogenic organic product (Mexel 432) usable in the fight against corrosion, scale and fouling, presenting a certain interest in the research of processes enabling a functional and environmental efficiency for the cooling systems of thermal power stations. The study of the degradation of this product is followed by a global colorimetric method. It shows that the product is stable on the long-term in demineralized water. On the other hand, its rate of disappearance in river waters is significant (50 % in 2 or 3 days). In this phenomenon of disappearance, biodegradation seems to play a part. Some bacteria from the natural environment (river Seine) have been isolated. Two of them seem to play a significant part, since they can degrade the product in three weeks. During the degradation, the amines with long chains (more than six carbons) of the Mexel, measured by the colorimetric method, disappear. The other compounds generated by the biodegradation process are not identified. (authors)

The version control service for ATLAS data acquisition configuration filesDAQ ; configuration ; OKS ; XML

CERN Document Server

Soloviev, Igor; The ATLAS collaboration

2012-01-01

To configure data taking session the ATLAS systems and detectors store more than 160 MBytes of data acquisition related configuration information in OKS XML files. The total number of the files exceeds 1300 and they are updated by many system experts. In the past from time to time after such updates we had experienced problems caused by XML syntax errors or inconsistent state of files from a point of view of the overall ATLAS configuration. It was not always possible to know who made a modification causing problems or how to go back to a previous version of the modified file. Few years ago a special service addressing these issues has been implemented and deployed on ATLAS Point-1. It excludes direct write access to XML files stored in a central database repository. Instead, for an update the files are copied into a user repository, validated after modifications and committed using a version control system. The system's callback updates the central repository. Also, it keeps track of all modifications providi...

75 FR 15419 - Notice of Intent To Grant Exclusive License of U.S. Patent Application No. 12/432,842 Filed April...

Science.gov (United States)

2010-03-29

... Exclusive License of U.S. Patent Application No. 12/432,842 Filed April 30, 2009 Entitled: ``A Soil Stabilization Soil Comprising Same, and a Method of Stabilizing Soil'' AGENCY: Department of the Army, U.S. Army... climates with sandy, gravelly soils where emulsions and hydraulic cements will not effectively cure. If...

One-step Conversion of Levulinic Acid to Succinic Acid Using I2/t-BuOK System: The Iodoform Reaction Revisited.

Science.gov (United States)

Kawasumi, Ryosuke; Narita, Shodai; Miyamoto, Kazunori; Tominaga, Ken-Ichi; Takita, Ryo; Uchiyama, Masanobu

2017-12-21

The iodoform reaction has long been used as a qualitative test for acetyl and/or ethanol units in organic molecules. However, its synthetic applications are quite limited. Here, we describe a tuned iodoform reaction for oxidative demethylation reaction with I 2 and t-BuOK in t-BuOH, in which in situ-generated t-BuOI serves as the chemoselective iodinating agent. This system enables one-step conversion of levulinic acid to succinic acid, a major four-carbon chemical feedstock. This oxidative demethylation is also applicable to other compounds containing an acetyl group/ethanol unit, affording the corresponding carboxylic acids in a selective manner.

Cryo-electron Microscopy Reconstruction and Stability Studies of the Wild Type and the R432A Variant of Adeno-associated Virus Type 2 Reveal that Capsid Structural Stability Is a Major Factor in Genome Packaging.

Science.gov (United States)

Drouin, Lauren M; Lins, Bridget; Janssen, Maria; Bennett, Antonette; Chipman, Paul; McKenna, Robert; Chen, Weijun; Muzyczka, Nicholas; Cardone, Giovanni; Baker, Timothy S; Agbandje-McKenna, Mavis

2016-10-01

The adeno-associated viruses (AAV) are promising therapeutic gene delivery vectors and better understanding of their capsid assembly and genome packaging mechanism is needed for improved vector production. Empty AAV capsids assemble in the nucleus prior to genome packaging by virally encoded Rep proteins. To elucidate the capsid determinants of this process, structural differences between wild-type (wt) AAV2 and a packaging deficient variant, AAV2-R432A, were examined using cryo-electron microscopy and three-dimensional image reconstruction both at an ∼5.0-Å resolution (medium) and also at 3.8- and 3.7-Å resolutions (high), respectively. The high resolution structures showed that removal of the arginine side chain in AAV2-R432A eliminated hydrogen bonding interactions, resulting in altered intramolecular and intermolecular interactions propagated from under the 3-fold axis toward the 5-fold channel. Consistent with these observations, differential scanning calorimetry showed an ∼10°C decrease in thermal stability for AAV2-R432A compared to wt-AAV2. In addition, the medium resolution structures revealed differences in the juxtaposition of the less ordered, N-terminal region of their capsid proteins, VP1/2/3. A structural rearrangement in AAV2-R432A repositioned the βA strand region under the icosahedral 2-fold axis rather than antiparallel to the βB strand, eliminating many intramolecular interactions. Thus, a single amino acid substitution can significantly alter the AAV capsid integrity to the extent of reducing its stability and possibly rendering it unable to tolerate the stress of genome packaging. Furthermore, the data show that the 2-, 3-, and 5-fold regions of the capsid contributed to producing the packaging defect and highlight a tight connection between the entire capsid in maintaining packaging efficiency. The mechanism of AAV genome packaging is still poorly understood, particularly with respect to the capsid determinants of the required capsid

Morphologic and functional alterations induced by low doses of mercuric chloride in the kidney OK cell line: ultrastructural evidence for an apoptotic mechanism of damage

International Nuclear Information System (INIS)

Carranza-Rosales, Pilar; Said-Fernandez, Salvador; Sepulveda-Saavedra, Julio; Cruz-Vega, Delia E.; Gandolfi, A. Jay

2005-01-01

Mercury produces acute renal failure in experimental animal models, but the mechanism of tubular injury has not completely been clarified. There is an increased interest in the role of apoptosis in the pathogenesis of renal diseases that result primarily from injury to renal tubular epithelial cells. However, detailed studies of morpho-functional alterations induced by mercuric chloride in kidney cell lines are scarce. This work characterizes these alterations in OK cell cultures. Morphological alterations were profiled using light microscopy, transmission electron microscopy, and confocal microscopy, as well as mitochondrial functional assays in the cells exposed to low concentrations of HgCl 2 . At concentrations of 1 and 10 μM of HgCl 2 there were no morphological or ultrastructural alterations, but the mitochondrial function (MTT assay) and intracellular ATP content was increased, especially at longer incubation times (6 and 9 h). At 15 μM HgCl 2 , both the mitochondrial activity and the endogenous ATP decreased significantly. At this concentration the OK cells rounded up, had increased number of cytoplasmic vacuoles, and detached from the cell monolayer. At 15 μM HgCl 2 ultrastructural changes were characterized by dispersion of the ribosomes, dilatation of the cisterns of the rough endoplasmic reticulum, increase of number of cytoplasmic vacuoles, chromatin condensation, invaginations of the nuclear envelope, presence of cytoplasmic inclusion bodies, and alterations in the size and morphology of mitochondria. At 15 μM HgCl 2 apoptotic signs included membrane blebbing, chromatin condensation, mitochondrial alterations, apoptotic bodies, and nuclear envelope rupture. Using confocal microscopy and the mitochondrial specific dye MitoTracker Red, it was possible to establish qualitative changes induced by mercury on the mitochondrial membrane potential after incubation of the cells for 6 and 9 h with 15 μM HgCl 2 . This effect was not observed at short times

Precision cancer immunotherapy: optimizing dendritic cell-based strategies to induce tumor antigen-specific T-cell responses against individual patient tumors.

Science.gov (United States)

Osada, Takuya; Nagaoka, Koji; Takahara, Masashi; Yang, Xiao Yi; Liu, Cong-Xiao; Guo, Hongtao; Roy Choudhury, Kingshuk; Hobeika, Amy; Hartman, Zachary; Morse, Michael A; Lyerly, H Kim

2015-05-01

Most dendritic cell (DC)-based vaccines have loaded the DC with defined antigens, but loading with autologos tumor-derived antigens would generate DCs that activate personalized tumor-specific T-cell responses. We hypothesized that DC matured with an optimized combination of reagents and loaded with tumor-derived antigens using a clinically feasible electroporation strategy would induce potent antitumor immunity. We first studied the effects on DC maturation and antigen presentation of the addition of picibanil (OK432) to a combination of zoledronic acid, tumor necrosis factor-α, and prostaglandin E2. Using DC matured with the optimized combination, we tested 2 clinically feasible sources of autologous antigen for electroloading, total tumor mRNA or total tumor lysate, to determine which stimulated more potent antigen-specific T cells in vitro and activated more potent antitumor immunity in vivo. The combination of tumor necrosis factor-α/prostaglandin E2/zoledronic acid/OK432 generated DC with high expression of maturation markers and antigen-specific T-cell stimulatory function in vitro. Mature DC electroloaded with tumor-derived mRNA [mRNA electroporated dendritic cell (EPDC)] induced greater expansion of antigen-specific T cells in vitro than DC electroloaded with tumor lysate (lysate EPDC). In a therapeutic model of MC38-carcinoembryonic antigen colon cancer-bearing mice, vaccination with mRNA EPDC induced the most efficient anti-carcinoembryonic antigen cellular immune response, which significantly suppressed tumor growth. In conclusion, mature DC electroloaded with tumor-derived mRNA are a potent cancer vaccine, especially useful when specific tumor antigens for vaccination have not been identified, allowing autologous tumor, and if unavailable, allogeneic cell lines to be used as an unbiased source of antigen. Our data support clinical testing of this strategy.

Streptococcal necrotizing fasciitis with toxic shock syndrome and rapid fatal outcome

Directory of Open Access Journals (Sweden)

Kojić Miroslav

2015-01-01

Full Text Available Introduction. Streptococcal necrotizing fasciitis (NF is a serious soft tissue infection with rapid progression of inflammatory process among superficial or deep fascia, systemic host response to infection leading to toxic shock syndrome (TSS, and multiple organ failure. Lethality is high. Case Outline. A 46-year-old male without co-morbidities was admitted to the Emergency Department with redness, swelling and pain on his right lower leg. He became sick two day s ea rlier with m alaise, chills and shivering. On admission he was hypotensive, anuric, with erythematous rash on his face, neck and chest, with acute ren al failure and elevated creatine phosphokinase level. During the next several hours, the changes on his right lower leg rapidly spread to the whole leg, followed by skin destruction and subcutaneo us bleeding, indicating NF. Aggressive antimicrobial, supportive and symptom atic therapy was initiated immediately and on the same evening surgical intervention was performed. Despite these measures, a rapid development of severe TSS, with lethal outcome, occurred in less than 40 hours after the admission. Stre ptococcus pyogenes (group A β-hemolytic Streptococcus was isolated from the throat, skin and tissue obtained duri ng the surgery. Conclusion. Necrotizing fasciitis is a very serious disease with unpre dictable course. For that reason doctors must devote a great deal of a ttention to early, i.e. timely diagnosis of this disease, whose treatment with a multid isciplinary approach is very important.

Streptococcal Immunity Is Constrained by Lack of Immunological Memory following a Single Episode of Pyoderma.

Directory of Open Access Journals (Sweden)

Manisha Pandey

2016-12-01

Full Text Available The immunobiology underlying the slow acquisition of skin immunity to group A streptococci (GAS, is not understood, but attributed to specific virulence factors impeding innate immunity and significant antigenic diversity of the type-specific M-protein, hindering acquired immunity. We used a number of epidemiologically distinct GAS strains to model the development of acquired immunity. We show that infection leads to antibody responses to the serotype-specific determinants on the M-protein and profound protective immunity; however, memory B cells do not develop and immunity is rapidly lost. Furthermore, antibodies do not develop to a conserved M-protein epitope that is able to induce immunity following vaccination. However, if re-infected with the same strain within three weeks, enduring immunity and memory B-cells (MBCs to type-specific epitopes do develop. Such MBCs can adoptively transfer protection to naïve recipients. Thus, highly protective M-protein-specific MBCs may never develop following a single episode of pyoderma, contributing to the slow acquisition of immunity and to streptococcal endemicity in at-risk populations.

Phase formation in K2O(K2CO3)-CdO-MoO3 system

International Nuclear Information System (INIS)

Tsirenova, G.D.; Tsybikova, B.A.; Bazarova, Zh.G.; Solodovnikov, S.F.; Zolotova, E.S.

2000-01-01

Phase formation in K 2 O(K 2 CO 3 )-CdO-MoO 3 system are studied by the methods of x-ray diffraction, thermal and crystal optical analyses. Three potassium-cadmium molybdates are detected: K 4 Cd(MoO 4 ) 3 with a new structure, alluodite-like K 4-2x Cd 1+x (MoO 4 ) 3 (0.26≤x≤0.38 at 470 Deg C) and K 4 CdMo 4 O 15 of K 4 MnMo 4 O 15 type. First of them decomposes in solid phase at 580 Deg C, and others melt incongruently at 720 and 515 Deg C correspondingly. It is established that K 4-2x Cd 1+x (MoO 4 ) 3 compound undergoes phase transition of the second type in the temperature interval of 500-550 Deg C. Phase diagram of quasibinary cross section K 2 MoO 4 -CdMoO 4 is plotted [ru

Nagasaki cooperative group study of radio-chemo-immunotherapy following surgery for glioma

International Nuclear Information System (INIS)

Shibata, Shobu; Moriyama, Tadayoshi; Tanaka, Keisei; Moroki, Jiro.

1984-01-01

The purpose of this interinstitutional controlled study was to assess the usefulness of radio-chemo-immunotherapy following surgery for glioma. Immediately after surgery for glioma, patients were randomly allocated into the group A with radiotherapy (5,000 to 6,000 rad), ACNU, and OK-432 and the group B with radiotherapy and ACNU. Fifty-one patients consisting of 24 in the froup A and 27 in the group B entered the study from January 1981 to December 1983. No significant differences in one-year, two-year, and three-year survival rates were observed between the groups. Protective effects on leukopenia were observed in the group A, compared with the group B, with a significant difference. (Namekawa, K.)

Evaluation of the in-pile pressure data from instrumented fuel assemblies IFA-431 and IFA-432

International Nuclear Information System (INIS)

Bradley, E.R.; Cunningham, M.E.; Lanning, D.D.; Williford, R.E.

1979-10-01

This report includes results of the examination of the in-pile pressure data from instrumented test assemblies IFA-431 and 432. The pressure data have been used to estimate the fission gas release fraction as a function of fuel burnup. Included are comparisons of the estimated release functions and those predicted by three fission gas release models using the experimental temperature histories of the fuel rods. These comparisons show that fuel temperature is the primary factor in determining fission gas release and that burnup-enhanced fission gas release is not important in UO 2 fuels irradiated to 1700 GJ/kgU

Characterisation and Properties of Lithium Disilicate Glass Ceramics in the SiO2-Li2O-K2O-Al2O3 System for Dental Applications

Directory of Open Access Journals (Sweden)

Naruporn Monmaturapoj

2013-01-01

Full Text Available This work proposes four different glass formulas derived from the SiO2-Li2O-K2O-Al2O3 system to investigate the effect of glass composition on their crystal formations and properties. Glass LD1 was SiO2-Li2O-K2O-Al2O3 system with the addition of P2O5 and CaF2 as nucleating agents. In Glass LD2, a slight amount of MgO was mixed in order to increase the viscosity of the melting glass. Finally, the important factor of Si : Li ratio was increased in Glasses LD3 and LD4 with compositions otherwise the same as LD1 and LD2. The results found that P2O5 and CaF2 served as a nucleating site for lithium phosphate and fluorapatite to encourage heterogenous nucleation and produce a fine-grained interlocking microstructure of lithium disilicate glass ceramics. MgO content in this system seemed to increase the viscosity of the melting glass and thermal expansion coefficient including the chemical solubility. Increasing the Si : Li ratio in glass compositions resulted in the change of the microstructure of Li2Si2O5 crystals.

Lyme disease and pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS: an overview

Directory of Open Access Journals (Sweden)

Rhee H

2012-02-01

Full Text Available Hanna Rhee1, Daniel J Cameron21Medicine, San Diego, CA, 2Northern Westchester Hospital, Mount Kisco, NY, USAAbstract: Lyme disease (LD is a complex, multisystemic illness. As the most common vector-borne disease in the United States, LD is caused by bacterial spirochete Borrelia burgdorferi sensu stricto, with potential coinfections from agents of anaplasmosis, babesiosis, and ehrlichiosis. Persistent symptoms and clinical signs reflect multiorgan involvement with episodes of active disease and periods of remission, not sparing the coveted central nervous system. The capability of microorganisms to cause and exacerbate various neuropsychiatric pathology is also seen in pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS, a recently described disorder attributed to bacterium Streptococcus pyogenes of group A beta-hemolytic streptococcus in which neurologic tics and obsessive-compulsive disorders are sequelae of the infection. In the current overview, LD and PANDAS are juxtaposed through a review of their respective infectious etiologies, clinical presentations, mechanisms of disease development, courses of illness, and treatment options. Future directions related to immunoneuropsychiatry are also discussed.Keywords: neuroborreliosis, infection, obsessive-compulsive disorder, tic disorder, Borrelia burgdorferi, strep throat

Challenges to developing effective streptococcal vaccines to prevent rheumatic fever and rheumatic heart disease

Directory of Open Access Journals (Sweden)

Sharma A

2014-05-01

Full Text Available Abhinay Sharma, D Patric Nitsche-SchmitzDepartment of Medical Microbiology, Helmholtz Center for Infection Research, Braunschweig, GermanyAbstract: Acute rheumatic fever is a sequela of Streptococcus pyogenes and potentially of Streptococcus dysgalactiae subsp. equisimilis infections. Acute rheumatic fever is caused by destructive autoimmunity and inflammation in the extracellular matrix and can lead to rheumatic heart disease, which is the most frequent cardiologic disease that is acquired in youth. Although effective treatments are available, acute rheumatic fever and rheumatic heart disease remain serious threats to human health, which affect millions and cause high economic losses. This has motivated the search for a vaccine that prevents the causative streptococcal infections. A variety of potential vaccine candidates have been identified and investigated in the past. Today, new approaches are applied to find alternative candidates. Nevertheless, several obstacles lie in the way of an approved S. pyogenes vaccine for use in humans. Herein, a subjective selection of promising vaccine candidates with respect to the prevention of acute rheumatic fever/rheumatic heart disease and safety regarding immunological side effects is discussed.Keywords: autoimmune disease, side effects, M protein vaccine, molecular mimicry, coiled-coil, collagen binding, PARF

Preparation and characterization of UV-curable cationic composite adhesive

International Nuclear Information System (INIS)

Shen Yan; Yang Wenbin; Li Yintao; Xie Changqiong; Li Yingjun; Cheng Yafei; Zhou Yuanlin; Lu Zhongyuan

2011-01-01

UV-curable cationic composite adhesives containing TiO 2 nanostructures were prepared by using 3, 4-epoxycyclohexylmethyl-3, 4-epoxycyclohexanecarboxylate(CE) as monomer, triphenylsulfonium hexafluorophosphate salt (PI-432) as photoinitiator and titanium isopropoxide (TIP) as inorganic precursor. The morphology of the composite adhesives was characterized by atom force microscopy (AFM). The effect of TIP content on refractive index and transmittance of adhesives were studied. The results show that TiO 2 nanostructures, the average diameter of which is 20 nm or so, can be uniformly dispersed in polymers of composite adhesives. The refractive index of adhesives can be adjusted from 1.501 9 to 1.544 9 with the change of TIP content. The transmittance of adhesives has a slight reduce with the increase of TIP content. When TIP content is up to 40%, the transmittance of composite adhesives remains around 90% or so. (authors)

Bactericidal activity of M protein conserved region antibodies against group A streptococcal isolates from the Northern Thai population

Directory of Open Access Journals (Sweden)

Pruksachatkunakorn Chulabhorn

2006-08-01

Full Text Available Abstract Background Most group A streptococcal (GAS vaccine strategies have focused on the surface M protein, a major virulence factor of GAS. The amino-terminus of the M protein elicits antibodies, that are both opsonic and protective, but which are type specific. J14, a chimeric peptide that contains 14 amino acids from the M protein conserved C-region at the carboxy-terminus, offers the possibility of a vaccine which will elicit protective opsonic antibodies against multiple different GAS strains. In this study, we searched for J14 and J14-like sequences and the number of their repeats in the C-region of the M protein from GAS strains isolated from the Northern Thai population. Then, we examined the bactericidal activity of J14, J14.1, J14-R1 and J14-R2 antisera against multiple Thai GAS strains. Results The emm genes of GAS isolates were sequenced and grouped as 14 different J14-types. The most diversity of J14-types was found in the C1-repeat. The J14.1 type was the major sequence in the C2 and C3-repeats. We have shown that antisera raised against the M protein conserved C-repeat region peptides, J14, J14.1, J14-R1 and J14-R2, commonly found in GAS isolates from the Northern Thai population, are able to kill GAS of multiple different emm types derived from an endemic area. The mean percent of bactericidal activities for all J14 and J14-like peptide antisera against GAS isolates were more than 70%. The mean percent of bactericidal activity was highest for J14 antisera followed by J14-R2, J14.1 and J14-R1 antisera. Conclusion Our study demonstrated that antisera raised against the M protein conserved C-repeat region are able to kill multiple different strains of GAS isolated from the Northern Thai population. Therefore, the four conserved "J14" peptides have the potential to be used as GAS vaccine candidates to prevent streptococcal infections in an endemic area.

A density functional theory study of models for the N3 and OK1 EPR centres in diamond

International Nuclear Information System (INIS)

Etmimi, K M; Goss, J P; Briddon, P R; Gsiea, A M

2010-01-01

The defects observed in natural and synthetic diamonds provide a fingerprint of their differing growth conditions, as well as the thermal and mechanical processes they have experienced. Of the first row elements it is perhaps surprising that little evidence exists for oxygen in the form of distributed point-defects. Paramagnetic centres labelled N3 and OK1 have been assigned to two structural arrangements of pairs of substitutional nitrogen and oxygen, but there is no direct evidence for the involvement of the oxygen. In this paper we present the results of density functional simulations of N-O pairs in diamond, and review them in light of the experimental evidence. We also present analysis for other structures proposed in the literature (Ti-N, Ti-V-N, NV 2 and NVO), and show that none are particularly plausible.

Effect of Early-Life Treatment of Piglets with Long-Acting Ceftiofur on Colonization of Streptococcus suis Serotype 7 and Elicitation of Specific Humoral Immunity in a Farm Dealing with Streptococcal Diseases

Directory of Open Access Journals (Sweden)

Christine Unterweger

2018-03-01

Full Text Available In newborn piglets treatment with long-acting ceftiofur is a common approach to reduce losses due to streptococcal diseases on farms, even if problems start after weaning. The purpose of this study was to examine the influence of a single early-life treatment on Streptococcus (S. suis colonization, transmission, immunoreaction, and drug resistance over an observation period of 14 weeks. In a farm with a history of streptococcal disease and isolation of a S. suis cps 7 mrp+, arcA+ isolate from diseased piglets, half of each litter was treated with a long-acting ceftiofur on day 1. S. suis-isolates were profiled and serum samples were tested for opsonizing antibodies. Treated and untreated pigs did not differ according to average daily weight gains, S. suis-isolation rates and level of opsonizing antibodies. Although the invasive cps 7 strain was not detected in a single piglet over 14 weeks, all animals developed bactericidal activity. No resistance to ceftiofur, but resistance to tetracyclins (100%, and trimethoprim/sulfamethoxazole (53% was shown. Our results indicate that early treatment with ceftiofur does not prevent colonization and transmission of S. suis or the induction of bactericidal humoral immunity in nursery and fattening pigs. The necessity of continuous usage should be reconsidered.

Importance of diagnostic laboratory methods of beta hemolytic streptococcus group A in comparison with clinical findings in the diagnosis of streptococcal sore throat and unnecessary antibacterial therapy

Directory of Open Access Journals (Sweden)

Peiman Eini

2012-04-01

Full Text Available Background: Streptococcus Pyogenes (group A streptococcus, GAS is the most important cause of bacterial pharyngitis in children and adolescents. Acute pharyngitis is one of the most common conditions in all ages but it is most common in children. Over diagnosis of acute pharyngitis represents one of the major causes of antibiotic abuse. The goal of this study is to make an estimate of the frequency of group A streptococcus in sore throat patients in Farshchian hospital emergency department and clinic in Hamadan. Methods: For estimation of the clinical features role in diagnosis of streptococcal sore throat, we took samples of 100 patients with average age of 32.96±29.86 years with sore throat. We took samples from pharynx and used standard methods of bacteriology in order to detect streptococcus. Results: Group A Streptococcus (GAS accounts for 3 percent of all cases of pharyngitis. Clinically, all of the patients had sore throat. The percent breakdowns are as follows: 30% had exudate, 78% had fever, 8% had lymphadenopathy and 7.7 percent of exudative pharyngitis was streptococcal. The cost for unnecessary antibiotic therapy for every single patient who had negative pharynx culture was approximately 32160 Rails. Conclusion: The low frequency of streptococcus pharyngitis in treated patients reveal that diagnosis based on clinical features is not reliable. We recommend use of other diagnostic methods such as Rapid Antigen Detection Tests (RATs. Only reliable and scientific protocols for antibiotic to therapy.

Association between pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections disease and tumor necrosis factor-? gene?308 g/a, ?850 c/t polymorphisms in 4-12-year-old children in Adana/Turkey

OpenAIRE

Luleyap, H. Umit; Onatoglu, Dilge; Yilmaz, M. Bertan; Alptekin, Davut; Tahiroglu, Aysegul Y.; Cetiner, Salih; Pazarbasi, Ayfer; Unal, Ilker; Avci, Ayse; Comertpay, Gamze

2013-01-01

Objectives: Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal Infections (PANDAS) is a newly defined disease in neuropsychiatry and occurs with an autoimmune mechanism after Group A Beta Hemolytic Streptococcus (GABHS) infection. Tumor necrosis factor (TNF), encoded by TNF-α gene has an important role in the apoptotic mechanisms of autoimmune diseases. Recently, TNF-α polymorphisms and autoimmune/psychiatric disorders have been reported to be related. In this regar...

Vitamin D Deficiency in Obsessive-Compulsive Disorder Patients with Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal Infections: A Case Control Study.

Science.gov (United States)

Çelik, Gonca; Taş, Didem; Tahiroğlu, Ayşegül; Avci, Ayşe; Yüksel, Bilgin; Çam, Perihan

2016-03-01

Previous studies have indicated that vitamin D deficiency is common in psychiatric patients, particularly in those with neuropsychiatric disorders such as autism and schizophrenia. Vitamin D is an important neurosteroid hormone and immunomodulatory agent that also has bone metabolic effects. There has been an increasing interest in immune-related neuropsychiatric symptoms that are triggered by group A beta-hemolytic streptococcal infections. In this study, we aimed to compare the serum levels of vitamin D between obsessive-compulsive disorder (OCD) patients with pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS) and control subjects. Thirty-three OCD patients with PANDAS and 20 healthy controls were enrolled in the study. Serum 25-hydroxyvitamin D (25-(OH) D), calcium, phosphorus, alkaline phosphatase, and parathormone levels of the two groups were compared. Serum 25-(OH) D levels of vitamin D deficiency. The children's Yale-Brown Obsessive Compulsive Scale (YBOCS) and Clinical Global Impression (CGI) were used to assess the severity of OCD symptoms. There was no significant difference in serum 25-(OH) D levels between the patient and control groups. However, vitamin D deficiency was significantly more frequent in the patient group than in the control group (48.5% vs. 20.0%; p=0.038). Moreover, OCD patients with vitamin D deficiency had higher rates of comorbid ADHD than those without vitamin D deficiency (87.5% vs. 52.6%; p=0.027). While serum phosphorus levels were negatively correlated with age as well as alkaline phosphatase and ASO levels, they were positively correlated with the YBOCS total score and global severity score. Serum parathormone levels were positively correlated with the YBOCS total score, compulsion score, obsession score, and global severity score. This study supports the hypothesis that an association between vitamin D metabolism and PANDAS-related OCD exists. We suggest that biochemical

Dietary supplementation of cumin (Cuminum cyminum preventing streptococcal disease during first-feeding of Mozambique tilapia (Oreochromis mossambicus

Directory of Open Access Journals (Sweden)

Sevdan Yılmaz

2013-01-01

Full Text Available This study was conducted to investigate the effect of dietary cumin (Cuminum cyminum powder (CP as a feed additive on growth performance and disease resistance during first-feeding of Mozamique tilapia (Oreochromis mossambicus. Five isonitrogenous (40% crude protein and isocaloric (18.9 kj g-1 diets were formulated to contain 0 (control, 0.5, 1, 1.5, and 2.0% CP. In a 45-day feeding trial, 15 plastic tanks (21 L were stocked with 40 fry (0.012 ± 0.001 g each. After feeding experiment, fish were infected with Streptococcus iniae and mortalities were recorded. The second-order polynomial regression indicated that a dietary CP level of 1.14% provided the best survival rate challenge infection with S. iniae, growth performance and feed utilization. In conclusion, CP can be used as growth promoter to improve feed utilization and weight gain in tilapia fry, and it can be also used as an antimicrobial agent during first-feeding of O. mossambicus. Therefore, CP can be suggested as an alternative to antibiotics in controlling streptococcal disease in tilapia culture.

Assessment of periodontitis and its role in viridans streptococcal bacteremia and infective endocarditis

Directory of Open Access Journals (Sweden)

Shree Dhotre

2018-03-01

Full Text Available Objectives: To evaluate the role of periodontitis in viridans group streptococci (VGS bacteremia and infective endocarditis (IE. Methods: A total of 200 subjects including two groups. Group A- 34 subjects undergoing tooth extraction with periodontitis, 46 subjects undergoing tooth extraction without periodontitis and 40 healthy controls. Group B: 40 confirmed cases of IE (17 with and 23 without periodontitis and 40 healthy controls. Subgingival plaque and blood samples were obtained and processed by standard procedures. Results: A total of 53 blood samples (66.25% yielded positive cultures after tooth extraction. The relationship between the presence of periodontitis and a positive blood culture was significantly higher (p = 0.05 for tooth extraction cases with periodontitis (79.40% than tooth extraction cases without periodontitis (56.50%. Periodontitis was observed in 42.5% of IE cases. Out of the 40 patients of IE, the blood samples yielded 40 different isolates, majority were viridans streptococci 15 (37.5% and staphylococci nine (22.5%. No statistically significant difference was observed between the subgingival plaque and blood isolates of periodontitis in both the groups, indicating similarity of biotypes of viridans streptococci isolated from the blood and the subgingival plaque. Similarity was also observed between the antibiogram profiles of viridans streptococci from both the groups. Conclusions: Periodontitis enhances viridans streptococcal bacteremia and may be a potential risk factor for IE. Keywords: Infective endocarditis, Periodontitis, Viridans group streptococci

Bütünleşik Tedarik Zinciri Ağında Tesis Yeri Seçimi için Bulanık Çok Amaçlı Programlama Modeli

Directory of Open Access Journals (Sweden)

Hüseyin Ali Sarıkaya

2014-05-01

Full Text Available Geleneksel tedarik zinciri ağı tasarım problemleri genellikle tek amaçlı olarak ele alınmıştır. Ancak, tedarik zincirleri gerçek hayatta birbirleri ile çelişen amaçları olan organizasyonların meydana getirdiği karmaşık ağlardır. Bu çalışmada, piyasa taleplerinin belirsiz olduğu bütünleşik bir tedarik zinciri ağındaki birden fazla ölçülemeyen amacı gerçekleştirmek için çok ürünlü, çok aşamalı ve çok dönemli planlama modeli önerilmiştir. Tedarik zinciri planlama modeli, birbiriyle çelişen birkaç amacı doyurmak için karışık tam sayılı doğrusal olmayan programlama problemi olarak bina edilmiştir. Önerilen model iki amaç fonksiyonundan oluşmaktadır. Birincisi, tedarik zincirindeki sabit tesis açma ve işletme maliyetleri ile mesafelere bağlı olarak belirlenen taşıma maliyetlerinin en azlanmasıdır. İkincisi, Ekonomik Üretim Miktarı (EÜM modeline göre satın alma, sipariş verme, stok bulundurma ve yok satma maliyetlerinin en azlanmasıdır. Önerilen modelde, karar vericilerin kesin olmayan hedef değerlerini dahil edebilmek için bulanık hedef programlama yaklaşımı kullanılmıştır. Model, GAMS optimizasyon programı kullanılarak çözülmüştür. Çalışmada sunulan uygulama sonuçları, bulanık modelleme ve çözüm yaklaşımlarının daha gerçekçi tedarik zinciri modelleri oluşturulmasında kullanılabileceğini göstermiştir.

Data report for the NRC/PNL Halden Assembly IFA-432

International Nuclear Information System (INIS)

Hann, C.R.; Bradley, E.R.; Cunningham, M.E.; Lanning, D.D.; Marshall, R.K.; Williford, R.E.

1978-08-01

The report presents the in-reactor data collected from the NRC/PNL Halden Assembly IFA-432 as a part of the program entitled ''Experimental Vertification of Steady State Fuel Codes,'' sponsored by the Fuel Behavior Research Branch of the USNRC. The purpose of this program is to reduce the uncertainties of calculating the thermal stored energy in an operating nuclear fuel rod. The report presents fuel centerline thermocouple readings, cladding elongation monitor readings, rod internal pressure readings, and neutron detector readings. The neutron detector readings were corrected to represent rod local powers at the thermocouple locations. These data are presented in the form of plots of the variables versus time during the portion of the irradiation period from December 1975 to January 1978. Also included are descriptions of the test rationale, assembly and rod designs, test facility, instrument array and calibration, and data processing methods. Topical reports discussing specific aspects and results of the data analysis are referenced. As of May 1978, the assembly burnup had reached its design goal of 20,000 MWd/MTM. However, it has been decided to leave the assembly in core to collect high burnup fission gas release data. The xenon-filled Rod 4 was replaced with the non-instrumented Rod 8 (Rod 1 design) after the first cycle. Six of the twelve original thermocouples, four of the six cladding elongation monitors, all SPND'S and all pressure transducers remain operable at this writing

Streptococcal toxic shock syndrome caused by Streptococcus suis serotype 2.

Directory of Open Access Journals (Sweden)

Jiaqi Tang

2006-05-01

Full Text Available BACKGROUND: Streptococcus suis serotype 2 (S. suis 2, SS2 is a major zoonotic pathogen that causes only sporadic cases of meningitis and sepsis in humans. Most if not all cases of Streptococcal toxic shock syndrome (STSS that have been well-documented to date were associated with the non-SS2 group A streptococcus (GAS. However, a recent large-scale outbreak of SS2 in Sichuan Province, China, appeared to be caused by more invasive deep-tissue infection with STSS, characterized by acute high fever, vascular collapse, hypotension, shock, and multiple organ failure. METHODS AND FINDINGS: We investigated this outbreak of SS2 infections in both human and pigs, which took place from July to August, 2005, through clinical observation and laboratory experiments. Clinical and pathological characterization of the human patients revealed the hallmarks of typical STSS, which to date had only been associated with GAS infection. Retrospectively, we found that this outbreak was very similar to an earlier outbreak in Jiangsu Province, China, in 1998. We isolated and analyzed 37 bacterial strains from human specimens and eight from pig specimens of the recent outbreak, as well as three human isolates and two pig isolates from the 1998 outbreak we had kept in our laboratory. The bacterial isolates were examined using light microscopy observation, pig infection experiments, multiplex-PCR assay, as well as restriction fragment length polymorphisms (RFLP and multiple sequence alignment analyses. Multiple lines of evidence confirmed that highly virulent strains of SS2 were the causative agents of both outbreaks. CONCLUSIONS: We report, to our knowledge for the first time, two outbreaks of STSS caused by SS2, a non-GAS streptococcus. The 2005 outbreak was associated with 38 deaths out of 204 documented human cases; the 1998 outbreak with 14 deaths out of 25 reported human cases. Most of the fatal cases were characterized by STSS; some of them by meningitis or severe

Streptococcal cell wall-induced arthritis and adjuvant arthritis in F344----Lewis and in Lewis----F344 bone marrow chimeras

International Nuclear Information System (INIS)

van Bruggen, M.C.; van den Broek, M.F.; van den Berg, W.B.

1991-01-01

Streptococcal cell wall (SCW)-induced arthritis and adjuvant arthritis (AA) are rat models for chronic, erosive polyarthritis. Both models can be induced in susceptible Lewis rats, whereas F344 rats are resistant. In AA as well as in SCW arthritis, antigen-specific T lymphocytes have been demonstrated to be crucial for chronic disease. In this communication the authors describe their studies to probe the cellular mechanism responsible for the difference in susceptibility of Lewis and F344, using bone marrow chimeras. By transplanting bone marrow cells from F344 into lethally irradiated Lewis recipients, Lewis rats were rendered resistant to SCW arthritis induction. F344 rats reconstituted with Lewis bone marrow, i.e., Lewis----F344 chimeras, develop an arthritis upon SCW injection. For AA comparable results were obtained. These data suggest that both resistance and susceptibility to bacterium-induced chronic arthritis are mediated by hemopoietic/immune cells and that the recipiental environment does not influence the susceptibility to chronic joint inflammation

Regulatory RNAs in the Less Studied Streptococcal Species: from Nomenclature to Identification

Directory of Open Access Journals (Sweden)

Mohamed Amine Zorgani

2016-07-01

Full Text Available Streptococcal species are Gram-positive bacteria involved in severe and invasive diseases in humans and animals. Although this group includes different pathogenic species involved in life-threatening infections for humans, it also includes beneficial species, such as Streptococcus thermophilus, which is used in yogurt production. In bacteria virulence factors are controlled by various regulatory networks including regulatory RNAs. For clearness and to develop logical thinking, we start this review with a revision of regulatory RNAs nomenclature. Previous reviews are mostly dealing with Streptococcus pyogenes and Streptococcus pneumoniae regulatory RNAs. We especially focused our analysis on regulatory RNAs in Streptococcus agalactiae, Streptococcus mutans, Streptococcus thermophilus and other less studied Streptococcus species. Although S. agalactiae RNome remains largely unknown, sRNAs (small RNAs are supposed to mediate regulation during environmental adaptation and host infection. In the case of S. mutans, sRNAs are suggested to be involved in competence regulation, carbohydrate metabolism and Toxin-Antitoxin systems. A new category of miRNA-size small RNAs (msRNAs was also identified for the first time in this species. The analysis of S. thermophilus sRNome shows that many sRNAs are associated to the bacterial immune system known as CRISPR-Cas system. Only few of the other different Streptococcus species have been the subject of studies pointed toward the characterization of regulatory RNAs. Finally, understanding bacterial sRNome can constitute one step forward to the elaboration of new strategies in therapy such as substitution of antibiotics in the management of S. agalactiae neonatal infections, prevention of S. mutans dental caries or use of S. thermophilus CRISPR-Cas system in genome editing applications.

Clinical response, drug survival and predictors thereof in 432 patients with ankylosing spondylitis switching anti tumor necrosis factor α therapy: Results from the Danish nationwide Danbio registry

DEFF Research Database (Denmark)

Glintborg, Bente; Østergaard, Mikkel; Krogh, N.

2012-01-01

, 432 patients (30%) switched to a second and 137 (10%) to a third biological drug. Compared with non-switchers, switchers were more frequently women (33%/22%), had shorter disease duration (3 years/5 years) and higher BASDAI (62(52-76) mm/56(43-69) mm (median(interquartile-range))), Bath AS Functional...

Naval Health Research Center (NHRC) Report for the Calendar Year 1981.

Science.gov (United States)

1981-01-01

naval careers. Following many months of preparation, with reviews by MSC Specialty Advisors and the USC Division (BUMED), a mail questionnaire was sent...PublZic:tion, DTIC AD# A104-813) of Clinical . robo ~oji, (in press) Abstract: The diagnosis of group A streptococcal disease still relies on isolation on

链球菌感染及家庭因素与小儿抽动障碍的关系%Relationship of streptococcal infection and family factors with tic disorder among children

Institute of Scientific and Technical Information of China (English)

高翠琴

2017-01-01

目的 探讨小儿抽动障碍与链球菌感染、家庭因素的关系.方法 选取小儿抽动障碍患儿共60例为观察组、100例健康儿童作为对照组.检测并比较两组链球菌感染情况、血清抗DNA酶B和肿瘤坏死因子-α(TNF-α)水平,同时对两组进行相关家庭因素的问卷调查;采用logistic回归模型分析影响小儿抽动障碍发生的危险因素.结果 观察组链球菌感染率为41.67%,高于对照组的18.00%(P<0.05).观察组抗DNA酶B滴度、TNF-α水平均高于对照组(P<0.05).对照组存在打骂体罚、孕期营养不良、任性发脾气、注意力分散、压力大、近期有感染症状者的比例高于观察组(P<0.05).Logistic回归分析结果显示打骂体罚、孕期营养不良、高抗DNA酶B滴度、压力大和任性发脾气是小儿抽动障碍的独立危险因素(P<0.05).结论 抽动障碍与链球菌感染相关,而父母打骂、母亲孕期营养不良以及家庭环境和个性也是小儿抽动障碍发生的危险因素,在临床上应该高度重视.%Objective To explore the relationship of streptococcal infection and family factors with tic disorder among children.Methods Sixty children with tic disorder were enrolled as observation group and 100 healthy children as control group.The incidence of streptococcal infection,and the levels of serum anti-deoxyribonuclease B(ADNase B) and tumor necrosis factors-α(TNF-α) were determined and compared between the two groups.A questionnaire survey on relevant family factors was conducted in both groups.Multivariate logistic regression model was used to analyze the risk factors for the incidence of tic disorder in children.Results The streptococcal infection rate of the observation group was 41.67%,and was higher than that of the control group(18.00%;P<0.05).The titer of ADNase B and TNF-α level of the observation group were higher than those of the control group(P<0.05).The proportions of children with scold and corporal

Nonlinear-Optical and Fluorescent Properties of Ag Aqueous Colloid Prepared by Silver Nitrate Reduction

Directory of Open Access Journals (Sweden)

Xiaoqiang Zhang

2010-01-01

Full Text Available The nonlinear-optical properties of metal Ag colloidal solutions, which were prepared by the reduction of silver nitrate, were investigated using Z-scan method. Under picosecond 532 nm excitation, the Ag colloidal solution exhibited negative nonlinear refractive index (n2=−5.17×10−4 cm2/W and reverse saturable absorption coefficient (β=4.32 cm/GW. The data fitting result of optical limiting (OL response of metal Ag colloidal solution indicated that the nonlinear absorption was attributed to two-photon absorption effect at 532 nm. Moreover, the fluorescence emission spectra of Ag colloidal solution were recorded under excitations at both 280 nm and 350 nm. Two fluorescence peaks, 336 nm and 543 nm for 280 nm excitation, while 544 nm and 694 nm for 350 nm excitation, were observed.

Metallation of N-allenylpyrroles by superbase reagents. Synthesis of new N-substituted pyrroles

International Nuclear Information System (INIS)

Tarasova, O.A.; Brandsma, L.; Verkrajsse, Kh.D.; Mal'kina, A.G.; Trofimov, B.A.

1996-01-01

Metallation of N-allenylpyrrole by BuLi-Et 2 O (THP), BuLi-t-BuOK-THP superbases and reactions of carbanions formed with different electrophilic agents have been studied. Fundamental data on mutual influence of allene group and pyrrole ring have been obtained. Alpha-proton features the highest acidity and it is the first one to be replaced by metal. In BuLi excess (more than 3-fold) in ether or in BuLi-t-BuOK-THP system a through metallation of allene group occurs. New pyrroles functionally substituted in allene chain have been prepared. 19 refs.; 3 tabs

Geometric analysis of root canals prepared by four rotary NiTi shaping systems.

Science.gov (United States)

Hashem, Ahmed Abdel Rahman; Ghoneim, Angie Galal; Lutfy, Reem Ahmed; Foda, Manar Yehia; Omar, Gihan Abdel Fatah

2012-07-01

A great number of nickel-titanium (NiTi) rotary systems with noncutting tips, different cross-sections, superior resistance to torsional fracture, varying tapers, and manufacturing method have been introduced to the market. The purpose of this study was to evaluate and compare the effect of 4 rotary NiTi preparation systems, Revo-S (RS; Micro-Mega, Besancon Cedex, France), Twisted file (TF; SybronEndo, Amersfoort, The Netherlands), ProFile GT Series X (GTX; Dentsply, Tulsa Dental Specialties, Tulsa, OK), and ProTaper (PT; Dentsply Maillefer, Ballaigues, Switzerland), on volumetric changes and transportation of curved root canals. Forty mesiobuccal canals of mandibular molars with an angle of curvature ranging from 25° to 40° were divided according to the instrument used in canal preparation into 4 groups of 10 samples each: group RS, group TF, group GTX, and group PT. Canals were scanned using an i-CAT CBCT scanner (Imaging Science International, Hatfield, PA) before and after preparation to evaluate the volumetric changes. Root canal transportation and centering ratio were evaluated at 1.3, 2.6, 5.2, and 7.8 mm from the apex. The significance level was set at P ≤ .05. The PT system removed a significantly higher amount of dentin than the other systems (P = .025). At the 1.3-mm level, there was no significant difference in canal transportation and centering ratio among the groups. However, at the other levels, TF maintained the original canal curvature recording significantly the least degree of canal transportation as well as the highest mean centering ratio. The TF system showed superior shaping ability in curved canals. Revo-S and GTX were better than ProTaper regarding both canal transportation and centering ability. Copyright © 2012 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Early-onset group B streptococcal disease following culture-based screening in Japan: a single center study.

Science.gov (United States)

Miyata, Akane; Takahashi, Hironori; Kubo, Takahiko; Watanabe, Noriyoshi; Tsukamoto, Keiko; Ito, Yushi; Sago, Haruhiko

2012-08-01

We investigated trends in early-onset group B streptococcal disease (EOD) after the introduction of culture-based screening in Japan. A retrospective cohort study examined EOD trends in 9506 pregnancies and 10 715 neonates at our center from 2002 to 2009. EOD occurred in four neonates (4/7332: 0.55/1000 live births). The EOD incidence among infants born to women positive for GBS by screening was 0.90 cases per 1000 live births (1/1107). In contrast, the EOD incidence among infants negative by GBS screening was 0.48 cases per 1000 live births (3/6225). Thus, of the four affected neonates, three had mothers who tested negative on antepartum GBS screening. Two neonates had symptoms of infection during labor and intrapartum antibiotic agents were administered. The other two neonates received no antibiotics because deliveries were uneventful and they were negative on GBS screening. The incidence of EOD is 0.90 cases per 1000 live births among GBS-positive women and 0.48 cases per 1000 live births among GBS-negative women. The results of our study implied that EOD can develop regardless of GBS screening and intrapartum clinical course, although the method of sample collection, indications for antibiotic prophylaxis, and the antibiotics regimen should be considered. © 2012 The Authors. Journal of Obstetrics and Gynaecology Research © 2012 Japan Society of Obstetrics and Gynecology.

Infusion sclerotherapy of microcystic lymphatic malformation: Clinico-radiological mid-term results

Energy Technology Data Exchange (ETDEWEB)

Lee, Jong Min; Lee, Seok Jong; Chung, Ho Yun; Huh, Seung; Kim, Hyung Kee [Dept. of urgery, Kyungpook National University Hospital, Daegu (Korea, Republic of)

2016-01-15

A new sclerotherapy technique by slow mechanical infusion of sclerosant was validated for treatment of microcystic lymphatic malformation (mLM). Seventeen consecutive patients with mLM in extremities, cervicofacial area, and trunk were included (21.8 ± 21.5 years old, male:female = 5:12). All patients diagnosed as mLM were included. A total 4-32 mL 20-38% OK-432 solution was mechanically infused at the rate of 10 mL/hour into the mLM lesions. The treatment effect was estimated clinic-radiologically at the 4-month follow-up. Repeated sclerotherapy followed in the 6th month, if required. The therapeutic effect was evaluated using quantitative ultrasonographic examination including soft tissue thickness, cyst size and number. In 17 patients, total 31 infusion sclerotherapy sessions were performed and monitored for 425 ± 266 days. Fifteen patients (88%) showed improvement in all symptoms, signs, and ultrasonographic findings. In all cases, at least one finding presented improvement. The maximal number of cysts per ultrasonographic window and maximal diameter of the largest cyst decreased by 57 ± 57% and 51 ± 67%, respectively (p = 0.102, 0.004). The soft tissue thickness decreased by 18 ± 15% (p < 0.01). No significant complications such as distal lymphedema or skin necrosis occurred. Infusion sclerotherapy is a safe and effective treatment technique for microcystic LM, with improved outcome.

75 FR 61377 - Proposed Flood Elevation Determinations

Science.gov (United States)

2010-10-05

..., Environmental Consideration. An environmental impact assessment has not been prepared. Regulatory Flexibility..., OK 73075. Beaver County, Pennsylvania (All Jurisdictions) Beaver River Approximately 50 feet None... upstream of Angela Drive. North Fork Little Beaver Creek...... At the confluence with None +911 Township of...

A case of malignant melanoma of the maxilla treated by adoptive immunotherapy after fast neutron therapy

International Nuclear Information System (INIS)

Morifuji, Masayo; Ohishi, Masamichi; Higuchi, Yoshinori; Ozeki, Satoru; Tashiro, Hideo

1992-01-01

A 77-year-old male patient with malignant melanoma was treated by fast neutron therapy and immunotherapy. Total dose of fast neutron applied to the primary lesion was 1905 cGy per 21 fractionation for 46 days. For adoptive immunotherapy, lymphocytes were collected from the peripheral blood drawn from the patient 2 days after the injection of cyclophosphamide. T cells were further purified by passing the lymphocytes through nylon wool. Cytotoxic T cells were induced by incubating the T cells mixed with allogeneic malignant melanoma cells and a small number of patient's adherent cells, and activated with recombinant interleukin-2 (γ IL-2). Our patient and the patient from whom stimulating melanoma cells were derived shared A locous 24 and B locous 51 of MHC class I antigens in common. Thus prepared cytotoxic T cells were inoculated to the patient via the maxillary artery, 3 to 4 times a week for one month. Total amount of cells transferred was 5.6 x 10 8 (97% lymphocytes). Primary lesion reduced markedly by the therapies. During adoptive immunotherapy, increase in natural killer cells and decrease in both suppressor/inducer T-cells and macrophages were observed. However, lung metastases appeared 3 months after adoptive immunotherapy. While the nonspecific immunotherapy (OK-432 injection) was being conducted thereafter, growth of the metastatic lesions of the lung was kept gentle but became obvious after the suspension of the treatment. (author)

Identification of Group G Streptococcal Isolates from Companion Animals in Japan and Their Antimicrobial Resistance Patterns.

Science.gov (United States)

Tsuyuki, Yuzo; Kurita, Goro; Murata, Yoshiteru; Goto, Mieko; Takahashi, Takashi

2017-07-24

In this study, we conducted a species-level identification of group G streptococcal (GGS) isolates from companion animals in Japan and analyzed antimicrobial resistance (AMR) patterns. Strains were isolated from sterile and non-sterile specimens collected from 72 animals with clinical signs or symptoms in April-May, 2015. We identified the strain by 16S rRNA sequencing, mass spectrometry (MS), and an automated method based on their biochemical properties. Antimicrobial susceptibility was determined using the broth microdilution method and E-test. AMR determinants (erm(A), erm(B), mef(A), tet(M), tet(O), tet(K), tet(L), and tet(S)) in corresponding resistant isolates were amplified by PCR. The 16S rRNA sequencing identified the GGS species as Streptococcus canis (n = 68), Streptococcus dysgalactiae subsp. equisimilis (n = 3), and S. dysgalactiae subsp. dysgalactiae (n = 1). However, there were discrepancies between the sequencing data and both the MS and automated identification data. MS and the automated biochemical technique identified 18 and 37 of the 68 sequencing-identified S. canis strains, respectively. The AMR rates were 20.8% for tetracycline and 5.6% for clarithromycin, with minimum inhibitory concentrations (MIC) 50 -MIC 90 of 2-64 and ≤ 0.12-0.25μg/mL, respectively. AMR genotyping showed single or combined genotypes: erm(B) or tet(M)-tet(O)-tet(S). Our findings show the unique characteristics of GGS isolates from companion animals in Japan in terms of species-level identification and AMR patterns.

The Energetics of Streptococcal Enolase Octamer Formation: The Quantitative Contributions of the Last Eight Amino Acids at the Carboxy-Terminus.

Directory of Open Access Journals (Sweden)

Jack A Kornblatt

Full Text Available The enolase produced by Streptococcus pyogenes is a homo-octamer whose overall shape resembles that of a donut. The octamer is best described as a tetramer of dimers. As such, it contains two types of interfaces. The first is common to almost all enolases as most enolases that have been studied are dimers. The second is unique to the octamers and includes residues near the carboxy-terminus. The primary sequence of the enolase contains 435 residues with an added 19 as an N-terminal hexahistine tag. We have systematically truncated the carboxy-terminus, individually removing the first 8 residues. This gave rise to a series of eight structures containing respectively, 435, 434, 433, 432, 431, 430, 429 and 427 residues. The truncations cause the protein to gradually dissociate from octamers to enzymatically inactive monomers with very small amounts of intermediate tetramers and dimers. We have evaluated the contributions of the missing residues to the monomer/octamer equilibrium using a combination of analytical ultracentrifugation and activity assays. For the dissociation reaction, octamer 8 monomer truncation of all eight C-terminal residues resulted in a diminution in the standard Gibbs energy of dissociation of about 59 kJ/mole of octamer relative to the full length protein. Considering that this change is spread over eight subunits, this translates to a change in standard Gibbs interaction energy of less than 8 kJ/mole of monomer distributed over the eight monomers. The resulting proteins, containing 434, 433, 432, 431, 430, 429 and 427 residues per monomer, showed intermediate free energies of dissociation. Finally, three other mutations were introduced into our reference protein to establish how they influenced the equilibrium. The main importance of this work is it shows that for homo-multimeric proteins a small change in the standard Gibbs interaction energy between subunits can have major physiological effects.

Hydrogenation of imines catalysed by ruthenium(II) complexes based on lutidine-derived CNC pincer ligands.

Science.gov (United States)

Hernández-Juárez, Martín; Vaquero, Mónica; Álvarez, Eleuterio; Salazar, Verónica; Suárez, Andrés

2013-01-14

The preparation of new Ru(II) complexes incorporating fac-coordinated lutidine-derived CNC ligands is reported. These derivatives are selectively deprotonated by (t)BuOK at one of the methylene arms of the pincer, leading to catalytically active species in the hydrogenation of imines.

Gut Microbiota Profiling and Gut-Brain Crosstalk in Children Affected by Pediatric Acute-Onset Neuropsychiatric Syndrome and Pediatric Autoimmune Neuropsychiatric Disorders Associated With Streptococcal Infections.

Science.gov (United States)

Quagliariello, Andrea; Del Chierico, Federica; Russo, Alessandra; Reddel, Sofia; Conte, Giulia; Lopetuso, Loris R; Ianiro, Gianluca; Dallapiccola, Bruno; Cardona, Francesco; Gasbarrini, Antonio; Putignani, Lorenza

2018-01-01

Pediatric acute-onset neuropsychiatric syndrome (PANS) and pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections syndrome (PANDAS) are conditions that impair brain normal neurologic function, resulting in the sudden onset of tics, obsessive-compulsive disorder, and other behavioral symptoms. Recent studies have emphasized the crosstalk between gut and brain, highlighting how gut composition can influence behavior and brain functions. Thus, the present study investigates the relationship between PANS/PANDAS and gut microbiota ecology. The gut composition of a cohort of 30 patients with PANS/PANDAS was analyzed and compared to control subjects using 16S rRNA-based metagenomics. Data were analyzed for their α- and β-diversity; differences in bacterial distribution were detected by Wilcoxon and LEfSe tests, while metabolic profile was predicted via PICRUSt software. These analyses demonstrate the presence of an altered bacterial community structure in PANS/PANDAS patients with respect to controls. In particular, ecological analysis revealed the presence of two main clusters of subjects based on age range. Thus, to avoid age bias, data from patients and controls were split into two groups: 4-8 years old and >9 years old. The younger PANS/PANDAS group was characterized by a strong increase in Bacteroidetes; in particular, Bacteroides , Odoribacter , and Oscillospira were identified as potential microbial biomarkers of this composition type. Moreover, this group exhibited an increase of several pathways concerning the modulation of the antibody response to inflammation within the gut as well as a decrease in pathways involved in brain function (i.e., SCFA, D-alanine and tyrosine metabolism, and the dopamine pathway). The older group of patients displayed a less uniform bacterial profile, thus impairing the identification of distinct biomarkers. Finally, Pearson's analysis between bacteria and anti-streptolysin O titer reveled a

抽动障碍患儿432例血铅水平对脑电图活动的影响%Influence of Blood Lead Level on Electrical Activity of Brain in 432 Children with Tic Disorder

Institute of Scientific and Technical Information of China (English)

田广燕; 梁向荣; 高在芬; 刘勇

2011-01-01

目的 探讨抽动障碍患儿血铅水平变化对脑电活动的影响及其发病机制的研究,对比不同血铅水平患儿脑电图变化的特点.方法 对本院2005年1月- 2011年4月临床确诊的432例抽动障碍患儿进行血铅水平及脑电图检测.采用原子吸收光谱分析法测定其血铅水平,并进行t检验.将432例抽动障碍患儿分为3组,Ⅰ组:血铅水平＜50μg·L-1；Ⅱ组:血铅水平50 ～ 100μg·L-1；Ⅲ组:血铅水平＞ 100 μg·L-1.结果 1.Ⅰ组患儿脑电图异常发生率为7.14％(2/28例),Ⅱ组患儿脑电图异常发生率为14.23％(40/281例),Ⅲ组患儿脑电图异常发生率为46.34％(57/123例).Ⅰ组与Ⅱ组脑电图异常发生率比较差异无统计学意义(P＞0.05),Ⅰ组与Ⅲ组脑电图异常发生率比较差异有统计学意义(P＜0.01),Ⅱ组与Ⅲ组脑电图异常发生率比较差异有统计学意义(P＜0.01).2.除年龄≤4岁患儿外,脑电图异常患儿较脑电图正常患儿血铅水平明显升高(P＜0.01,0.05).结论 血铅水平升高会加重抽动障碍患儿的脑功能损伤.及早进行驱铅治疗可能对抽动障碍患儿脑功能损伤的恢复有重要意义.%Objective To study the influence and pathogenesis of blood lead level on electrical activity of brain in children with tic disorder, and to research the characteristics of electroencephalogram (EEG) in children with different concentrations of blood lead. Methods The level of blood lead and EEG were assessed in 432 children with tic disorder from Jan. 2005 to Apr. 2011. The level of blood lead were examined by atomic absorption spectrophotometry method. Statistical analysis were performed by t - test. According to the blood lead level, the children were divided into 3 groups, group Ⅰ :blood lead 100 μg · L-1. Results 1. The EEG abnormal statistics results showed abnormal rate in group Ⅰ ,group Ⅱ and group Ⅲ were 7. 14% (2/28 cases) , 14.23% (40/ 281 cases) and 46. 34% (57/123 cases

[An intractable gastric cancer showing an extremely effective response to immunochemotherapy].

Science.gov (United States)

Takashima, S; Komaki, H; Yokota, H; Kiriyama, M; Kinami, Y

1988-07-01

Reported herein is the case of a terminal patient with advanced gastric cancer who was shown an extremely effective response to immunochemotherapy. The patient, a 62-year-old female, was determined as having a gastric cancer, Borr. type 2, originating in the pyloric antrum. The tumor was found to be H3P3S2N2 (stage IV), and its histology revealed a mucus-producing papillary adeno-carcinoma, ss gamma, n(+), ly2, and V1. Thus the patient underwent a distal gastrectomy, and was given an operative administration of MMC, followed by postoperative immunochemotherapy with FT 207 and OK 432. Consequently, no ascites were noticed throughout the recuperative course, and repeated CT scannings of the hepatic metastatic lesions, revealed a remarkable regression. Two years after this operation, she resumed normal daily life. Further, her preoperatively elevated tumor markers have returned to normal.

Mucosal melanoma of the head and neck. A treatment result of 25 cases

International Nuclear Information System (INIS)

Asakura, Kohji; Kataura, Akikatsu; Harabuchi, Yasuaki; Himi, Tetsuo; Hamamoto, Makoto; Hareyama, Masato; Sakata, Kouichi

2001-01-01

A retrospective review of 25 primary patients with head and neck mucosal melanoma, treated at Sapporo Medical University from 1970 to 1996, was performed. The disease-specific 5-year cumulative survival rate was 37.2% for all the cases, and 39.6% for cases with nasal cavity melanoma. The patients with tumors confined within one anatomical site showed a better prognosis than those with more advanced tumors. In relation to the treatment methods, the 5-year survival rate was 75% in the patients that received pre-operative radiotherapy, and 100% in those that received an adjuvant immunotherapy of daily intratumorous injections of OK432 during radiotherapy. The patients with poor prognoses tended to show a high incidence of residual tumors and earlier local recurrences than those with good prognoses. No recurrences have been noted in the long-term survivors that received adjuvant immunotherapy during radiotherapy. (author)

[Successful continuous renal replacement therapy in a neonate with early-onset group B streptococcal sepsis and multi-organ dysfunction syndrome].

Science.gov (United States)

von Schnakenburg, C; Hufnagel, M; Superti-Furga, A; Rieger-Fackeldey, E; Berner, R

2009-01-01

Group B streptococcal early-onset sepsis (GBS EOS) in neonates has a mortality rate of approximately 5%, particularly in the presence of multi-organ dysfunction. Fluid management is crucial in these patients, and continuous venovenous haemofiltration (CVVH) should be considered a therapeutic option even in newborn babies. After an uneventful pregnancy within hours after birth, a female term infant presented with dyspnoea, irritability and cyanosis. The systemic inflammatory response syndrome (SIRS) progressed to multi-organ dysfunction with acute respiratory distress syndrome (ARDS), impaired myocardial contractility, pulmonary hypertension and fluid overload. The maximum PRISM score was 51. The child required maximal respiratory and inotropic support with high volume intravenous fluid administration. However, only by using of CVVH from day 5 to 14, we successfully resolved progressive pulmonary and cardiovascular dysfunction. The child improved directly after initiation of fluid removal, was extubated on day 17 and discharged without obvious sequelae on day 57. All microbiology studies revealed GBS. Perinatal GBS-infections remain a major life-threatening event for newborn babies. CVVH should be considered an option for reversing fluid overload even in neonates with overwhelming SIRS. Alternatively, extracorporeal membrane oxygenation (ECMO) is discussed.

Oriental medicine Kyung-Ok-Ko prevents and alleviates dehydroepiandrosterone-induced polycystic ovarian syndrome in rats.

Directory of Open Access Journals (Sweden)

Minhee Jang

Full Text Available Kyung-Ok-Ko (KOK, a traditional herbal prescription composed of Rehmannia glutinosa Liboschitz var. purpurae, Lycium chinense, Aquillaria agallocha, Poria cocos, Panax ginseng, and honey, has been widely used in traditional Oriental medicine as a vitalizing medicine or as the prescription for patients with age-associated disorders such as amnesia and stroke. However, the potential protective value of KOK for the treatment of polycystic ovarian syndrome (PCOS is largely unknown. We investigated whether pre-administration (daily from 2 hours before PCOS induction and post-administration (daily after induction of PCOS of KOK (0.5, 1.0, and 2.0 g/kg/day, p.o. could have a protective effect in a dehydroepiandrosterone (DHEA, s.c.-induced PCOS rat model. Pre-administration of KOK significantly decreased the elevated body weight and ovary weight, elevated size and number of follicular cysts, elevated level of serum glucose, and estradiol after DHEA injection. KOK reduced the elevated percentage of CD8 (+ T lymphocytes in lymph nodes, the elevated mRNA expression of CD11b and CD3 in ovaries, and infiltration of macrophages in ovarian tissue with PCOS. KOK diminished the increased mRNA expression of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α, chemokines (IL-8, MCP-1, and iNOS in the ovaries, and increased the reduced mRNA expression of growth factors (EGF, TGF-β by DHEA injection. Post-administration of KOK also improved the DHEA-induced PCOS-like symptoms, generally similar to those evident from pre-administration of KOK. KOK may effectively prevent and improve DHEA-induced PCOS via anti-inflammatory action, indicating its preventive and therapeutic potential for suppressing PCOS.

Behavioral and neural effects of intra-striatal infusion of anti-streptococcal antibodies in rats

Science.gov (United States)

Lotan, Dafna; Benhar, Itai; Alvarez, Kathy; Mascaro-Blanco, Adita; Brimberg, Lior; Frenkel, Dan; Cunningham, Madeleine W.; Joel, Daphna

2014-01-01

Group A β-hemolytic streptococcal (GAS) infection is associated with a spectrum of neuropsychiatric disorders. The leading hypothesis regarding this association proposes that a GAS infection induces the production of auto-antibodies, which cross-react with neuronal determinants in the brain through the process of molecular mimicry. We have recently shown that exposure of rats to GAS antigen leads to the production of anti-neuronal antibodies concomitant with the development of behavioral alterations. The present study tested the causal role of the antibodies by assessing the behavior of naïve rats following passive transfer of purified antibodies from GAS-exposed rats. Immunoglobulin G (IgG) purified from the sera of GAS-exposed rats was infused directly into the striatum of naïve rats over a 21-day period. Their behavior in the induced-grooming, marble burying, food manipulation and beam walking assays was compared to that of naïve rats infused with IgG purified from adjuvant-exposed rats as well as of naïve rats. The pattern of in vivo antibody deposition in rat brain was evaluated using immunofluorescence and colocalization. Infusion of IgG from GAS-exposed rats to naïve rats led to behavioral and motor alterations partially mimicking those seen in GAS-exposed rats. IgG from GAS-exposed rats reacted with D1 and D2 dopamine receptors and 5HT-2A and 5HT-2C serotonin receptors in vitro. In vivo, IgG deposits in the striatum of infused rats colocalized with specific brain proteins such as dopamine receptors, the serotonin transporter and other neuronal proteins. Our results demonstrate the potential pathogenic role of autoantibodies produced following exposure to GAS in the induction of behavioral and motor alterations, and support a causal role for autoantibodies in GAS-related neuropsychiatric disorders. PMID:24561489

Torsional Performance of ProTaper Gold Rotary Instruments during Shaping of Small Root Canals after 2 Different Glide Path Preparations.

Science.gov (United States)

Arias, Ana; de Vasconcelos, Rafaela Andrade; Hernández, Alexis; Peters, Ove A

2017-03-01

The purpose of this study was to assess the ex vivo torsional performance of a novel rotary system in small root canals after 2 different glide path preparations. Each independent canal of 8 mesial roots of mandibular molars was randomly assigned to achieve a reproducible glide path with a new set of either PathFile #1 (Dentsply Maillefer, Ballaigues, Switzerland) and #2 or ProGlider (Dentsply Maillefer) after negotiation with a 10 K-file. After glide path preparation, root canals in both groups were shaped with the same sequence of ProTaper Gold (Dentsply Tulsa Dental Specialties, Tulsa, OK) following the directions for use recommended by the manufacturer. A total of 16 new sets of each instrument of the ProTaper Gold (PTG) system were used. The tests were run in a standardized fashion in a torque-testing platform. Peak torque (Ncm) and force (N) were registered during the shaping procedure and compared with Student t tests after normal distribution of data was confirmed. No significant differences were found for any of the instruments in peak torque or force after the 2 different glide path preparations (P > .05). Data presented in this study also serve as a basis for the recommended torque for the use of PTG instruments. Under the conditions of this study, differences in the torsional performance of PTG rotary instruments after 2 different glide path preparations could not be shown. The different geometry of glide path rotary systems seemed to have no effect on peak torque and force induced by PTG rotary instruments when shaping small root canals in extracted teeth. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Neutrophil migration through preexisting holes in the basal laminae of alveolar capillaries and epithelium during streptococcal pneumonia.

Science.gov (United States)

Walker, D C; Behzad, A R; Chu, F

1995-11-01

The purpose of this study was to determine whether or not there are preexisting holes in the endothelial and epithelial basal laminae of alveolar walls and to determine the path taken by neutrophils as they migrate from the capillaries to the airspace of the alveoli during inflammation. Using transmission electron microscopy and serial thin sections of normal rabbit and mouse lung, we have demonstrated the presence of slit-like holes in the capillary basal laminae and round holes in the basal laminae of type 2 pneumocytes. The slits in the capillary basal laminae were observed at the intersection of the thick and thin walls where endothelium, pericytes, and fibroblasts make close contact. The round holes in the type 2 cell basal laminae were observed at sites of close contact with fibroblasts. Neutrophils were observed to migrate through these slits and holes during streptococcal pneumonia in rabbit lungs. We conclude that during inflammation in the lung, migrating neutrophils displace pericytes and fibroblasts from the slits in the capillary basal lamina and then crawl through these slits into the alveolar interstitium. We postulate that neutrophils find their way to type 2 pneumocytes by following interstitial fibroblasts. We believe that neutrophils displace fibroblasts from their close contacts with the type 2 cells and then crawl through the holes in the basal lamina into the basal lateral space of the type 2 cells. From there, neutrophils migrate into the alveolar airspace.

AÇIK VE UZAKTAN EĞİTİM SİSTEMİ SEÇİMİ İÇİN ÇOK ÖLÇÜTLÜ BİR KARAR VERME YAKLAŞIMININ KULLANILMASI

Directory of Open Access Journals (Sweden)

Zehra KAMIŞLI ÖZTÜRK

2014-02-01

Full Text Available Bugün, dünya çapında çeşitli açık ve uzaktan eğitim (ODL sistemleri bulunmaktadır. Bu noktada, yaşam boyu öğrenme kapsamında kariyer yolundaki yeteneklerini geliştirmek isteyen bir öğrenen için bir ODL programını nasıl seçeceği önemli bir soru haline gelmektedir. Bu ise birbirine bağlı ölçütlerden oluşan karmaşık bir karar problemidir. Analitik Serim Süreci (ANP , bu bağlılıkları ele alan çok ölçütlü bir karar verme yöntemidir. ANP’deki serimler en iyi kararı vermek için hem nitel hem de nicel tüm faktör ve ölçütleri içermektedir. Bu çalışmada, ODL sistemlerini etkileyen ölçütleri araştırmak ve önceliklendirmek ile öğrenenlere bir ODL programı seçiminde yardımcı olmak amacıyla bir ANP modeli kurulmuştur. Çalışma sonucunda, lisans programları en çok tercih edilen ODL programı olmuştur. Ayrıca önerilen ANP modeli, her bir program türünün yürütülmesi için hangi ölçüt ve/veya ölçütlere dikkat edilmesi konusunda da uzaktan eğitim kurumlarına yardımcı olacaktır. Bu nedenle bu çalışma, ODL politikası geliştirme açısından da kurumlara destek verecektir.

Effect of a Traditional Herbal Prescription, Kyung-Ok-Ko, on Male Mouse Spermatogenic Ability after Heat-Induced Damage

Directory of Open Access Journals (Sweden)

Deok-Sang Hwang

2015-01-01

Full Text Available Kyung-Ok-Ko (KOK, a well-known traditional Korean medicinal formula, has long been used to invigorate the essential qi. This use of KOK may be associated with reproductive ability as a more modern concept. The protective effect of KOK was evaluated against deterioration of testicular function induced by heat exposure in male mice. Male fertility was disrupted by scrotal heat stress at 43°C for 5 weeks. KOK (0.25, 0.50, and 2.00 g/kg/day was administered orally at 3 h after the stress. To evaluate the protective effect of KOK, body weight, testicular weight, sperm count, sperm motility, and histopathological changes in the testes were evaluated. KOK-treated mice significantly recovered their general health, as evidenced by body weight. KOK-treated mice also showed significantly higher testes weights, sperm counts, and sperm motility than did the heat stress group. KOK-treated mice significantly recovered the morphological appearance of the seminiferous tubules and seminiferous epithelium. Furthermore, KOK-treated mice significantly increased antioxidant enzyme activities and reduced the protein expressions of apoptosis in the testes. KOK significantly protects against heat-induced damage to testicular function in male mice by inhibiting oxidative stress and apoptosis, indicating that KOK may be an effective agent for treatment of heat-induced male infertility.

Neonatal Encephalopathy With Group B Streptococcal Disease Worldwide: Systematic Review, Investigator Group Datasets, and Meta-analysis.

Science.gov (United States)

Tann, Cally J; Martinello, Kathryn A; Sadoo, Samantha; Lawn, Joy E; Seale, Anna C; Vega-Poblete, Maira; Russell, Neal J; Baker, Carol J; Bartlett, Linda; Cutland, Clare; Gravett, Michael G; Ip, Margaret; Le Doare, Kirsty; Madhi, Shabir A; Rubens, Craig E; Saha, Samir K; Schrag, Stephanie; Sobanjo-Ter Meulen, Ajoke; Vekemans, Johan; Heath, Paul T

2017-11-06

Neonatal encephalopathy (NE) is a leading cause of child mortality and longer-term impairment. Infection can sensitize the newborn brain to injury; however, the role of group B streptococcal (GBS) disease has not been reviewed. This paper is the ninth in an 11-article series estimating the burden of GBS disease; here we aim to assess the proportion of GBS in NE cases. We conducted systematic literature reviews (PubMed/Medline, Embase, Latin American and Caribbean Health Sciences Literature [LILACS], World Health Organization Library Information System [WHOLIS], and Scopus) and sought unpublished data from investigator groups reporting GBS-associated NE. Meta-analyses estimated the proportion of GBS disease in NE and mortality risk. UK population-level data estimated the incidence of GBS-associated NE. Four published and 25 unpublished datasets were identified from 13 countries (N = 10436). The proportion of NE associated with GBS was 0.58% (95% confidence interval [CI], 0.18%-.98%). Mortality was significantly increased in GBS-associated NE vs NE alone (risk ratio, 2.07 [95% CI, 1.47-2.91]). This equates to a UK incidence of GBS-associated NE of 0.019 per 1000 live births. The consistent increased proportion of GBS disease in NE and significant increased risk of mortality provides evidence that GBS infection contributes to NE. Increased information regarding this and other organisms is important to inform interventions, especially in low- and middle-resource contexts. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

Response of the rare biosphere to environmental stressors in a highly diverse ecosystem (Zodletone spring, OK, USA).

Science.gov (United States)

Coveley, Suzanne; Elshahed, Mostafa S; Youssef, Noha H

2015-01-01

Within highly diverse ecosystems, the majority of bacterial taxa are present in low abundance as members of the rare biosphere. The rationale for the occurrence and maintenance of the rare biosphere, and the putative ecological role(s) and dynamics of its members within a specific ecosystem is currently debated. We hypothesized that in highly diverse ecosystems, a fraction of the rare biosphere acts as a backup system that readily responds to environmental disturbances. We tested this hypothesis by subjecting sediments from Zodletone spring, a sulfide- and sulfur-rich spring in Southwestern OK, to incremental levels of salinity (1, 2, 3, 4, and 10% NaCl), or temperature (28°, 30°, 32°, and 70 °C), and traced the trajectories of rare members of the community in response to these manipulations using 16S rRNA gene analysis. Our results indicate that multiple rare bacterial taxa are promoted from rare to abundant members of the community following such manipulations and that, in general, the magnitude of such recruitment is directly proportional to the severity of the applied manipulation. Rare members that are phylogenetically distinct from abundant taxa in the original sample (unique rare biosphere) played a more important role in the microbial community response to environmental disturbances, compared to rare members that are phylogenetically similar to abundant taxa in the original sample (non-unique rare biosphere). The results emphasize the dynamic nature of the rare biosphere, and highlight its complexity and non-monolithic nature.

You're OK, I'm OK

Science.gov (United States)

Kelleher, Joanne

2016-01-01

The author looks through Albert Bandura's self-efficacy lens onto the effects it likely has on school principals' effectiveness. Self-efficacy should be viewed as a principal's belief in his or her capabilities to structure a particular course of action in order to produce desired outcomes. Principal self-efficacy has been linked with effective…

Successful treatment of refractory hepatic lymphorrhea after gastrectomy for early gastric cancer, using surgical ligation and subsequent OK-432 (Picibanil) sclerotherapy.

Science.gov (United States)

Tanaka, Kouji; Ohmori, Yukinari; Mohri, Yasuhiko; Tonouchi, Hitoshi; Suematsu, Mina; Taguchi, Yukiko; Adachi, Yukihiko; Kusunoki, Masato

2004-01-01

Postoperative hepatic lymphorrhea is a very rare complication after abdominal surgery. Hepatic lymphorrhea, not containing chyle, involves an internal lymph fistula between the lymphatic channels toward the cisterna chyli and the peritoneal cavity. Over the past 20 years, 17 cases have been reported in Japan. Here, we report a further case, of a patient with successfully treated intractable hepatic lymphorrhea following gastrectomy for early gastric cancer. We review 18 cases, including the present case, with respect to the management of postoperative lymphorrhea refractory to conventional medical treatment.

Differing Efficacies of Lead Group A Streptococcal Vaccine Candidates and Full-Length M Protein in Cutaneous and Invasive Disease Models

Directory of Open Access Journals (Sweden)

Tania Rivera-Hernandez

2016-06-01

Full Text Available Group A Streptococcus (GAS is an important human pathogen responsible for both superficial infections and invasive diseases. Autoimmune sequelae may occur upon repeated infection. For this reason, development of a vaccine against GAS represents a major challenge, since certain GAS components may trigger autoimmunity. We formulated three combination vaccines containing the following: (i streptolysin O (SLO, interleukin 8 (IL-8 protease (Streptococcus pyogenes cell envelope proteinase [SpyCEP], group A streptococcal C5a peptidase (SCPA, arginine deiminase (ADI, and trigger factor (TF; (ii the conserved M-protein-derived J8 peptide conjugated to ADI; and (iii group A carbohydrate lacking the N-acetylglucosamine side chain conjugated to ADI. We compared these combination vaccines to a “gold standard” for immunogenicity, full-length M1 protein. Vaccines were adjuvanted with alum, and mice were immunized on days 0, 21, and 28. On day 42, mice were challenged via cutaneous or subcutaneous routes. High-titer antigen-specific antibody responses with bactericidal activity were detected in mouse serum samples for all vaccine candidates. In comparison with sham-immunized mice, all vaccines afforded protection against cutaneous challenge. However, only full-length M1 protein provided protection in the subcutaneous invasive disease model.

Streptococcal toxic shock syndrome occurred during postoperative radiotherapy in a cancer patient with preexisting lymphedema and chronic illness -case report-

Energy Technology Data Exchange (ETDEWEB)

Jang, Ji Young; Oh, Yoon Kyeong; Kim, Dong Min [Chosun University College of Medicine, Gwangju (Korea, Republic of)

2006-12-15

A case is reported of a man with malignant fibrous histiocytoma (MFH) in right thigh who developed streptococcal toxic shock syndrome (STSS) during postoperative radiotherapy. Before radiotherapy, a patient complained wax and wane lymphedema following wide excision of tumor mass which was confirmed as MFH. He took some nonsteroidal antiinflammatory drug (NSAID) for about one month. He suffered preexisting hepatitis C virus (HCV) infection, diabetes and well-controlled hypertension. The patient received conventional radiotherapy to right thigh with a total dose of 32.4 Gy at 1.8 Gy per day. At last radiotherapy fraction, cutaneous erythematous inflammation was suddenly developed at his affected thigh. At that time, he also complained of oliguria, fever and chills. The patient was consulted to internal medicine for adequate evaluation and management. The patient was diagnosed as suggested septic shock and admitted without delay. At admission, he showed hypotension, oliguria, constipation, abnormal renal and liver function. As a result of blood culture, Streptococcus pyogenes was detected. The patient was diagnosed to STSS. He was treated with adequate intravenous antibiotics and fluid support. STSS is one of oncologic emergencies and requires immediate medical intervention to prevent loss of life. In this patient, underlying HCV infection, postoperative lymphedema, prolonged NSAID medication, and radiotherapy may have been multiple precipitating factors of STSS.

Teachers' attitudes and perceptions about preparation of public schools to assist students with type 1 diabetes.

Science.gov (United States)

Carral San Laureano, Florentino; Gutiérrez Manzanedo, José Vicente; Moreno Vides, Pablo; de Castro Maqueda, Guillermo; Fernández Santos, Jorge R; Ponce González, Jesús Gustavo; Ayala Ortega, María Del Carmen

2018-04-01

To assess teachers' attitudes and perceptions about preparation of public primary and secondary education schools in the Puerto Real University Hospital (Cádiz, Spain) area to care for students with type 1 diabetes mellitus (T1DM) METHODS: A descriptive observational study where answers to an attitude and perception questionnaire on the preparation of schools to care for pupils with T1DM were analyzed. A total of 765 teachers (mean age, 44.3±8.8 years; 61.7% women) from 44 public schools in the area of the Puerto Real University Hospital were selected by random sampling. Overall, 43.2% of teachers surveyed had or had previously had students with T1DM, but only 0.8% had received specific training on diabetes. 18.9% of teachers reported that one of their students with T1DM had experienced at least one episode of hypoglycemia at school, and half of them felt that their school was not prepared to deal with diabetic emergencies. 6.4% stated that their school had glucagon in its first aid kit, and 46.9% would be willing to administer it personally. Women, physical education teachers, and headmasters had a more positive perception of the school than their colleagues. Teachers with a positive perception of school preparation and with a positive attitude to administer glucagon were significantly younger than those with no positive perception and attitude. The study results suggest that teachers of public schools in our health area have not been specifically trained in the care of patients with T1DM and perceive that their educational centers are not qualified to address diabetic emergencies. Copyright © 2017 SEEN y SED. Publicado por Elsevier España, S.L.U. All rights reserved.

Preferential Acquisition and Activation of Plasminogen Glycoform II by PAM Positive Group A Streptococcal Isolates.

Science.gov (United States)

De Oliveira, David M P; Law, Ruby H P; Ly, Diane; Cook, Simon M; Quek, Adam J; McArthur, Jason D; Whisstock, James C; Sanderson-Smith, Martina L

2015-06-30

Plasminogen (Plg) circulates in the host as two predominant glycoforms. Glycoform I Plg (GI-Plg) contains glycosylation sites at Asn289 and Thr346, whereas glycoform II Plg (GII-Plg) is exclusively glycosylated at Thr346. Surface plasmon resonance experiments demonstrated that Plg binding group A streptococcal M protein (PAM) exhibits comparative equal affinity for GI- and GII-Plg in the "closed" conformation (for GII-Plg, KD = 27.4 nM; for GI-Plg, KD = 37.0 nM). When Plg was in the "open" conformation, PAM exhibited an 11-fold increase in affinity for GII-Plg (KD = 2.8 nM) compared with that for GI-Plg (KD = 33.2 nM). The interaction of PAM with Plg is believed to be mediated by lysine binding sites within kringle (KR) 2 of Plg. PAM-GI-Plg interactions were fully inhibited with 100 mM lysine analogue ε-aminocaproic acid (εACA), whereas PAM-GII-Plg interactions were shown to be weakened but not inhibited in the presence of 400 mM εACA. In contrast, binding to the KR1-3 domains of GII-Plg (angiostatin) by PAM was completely inhibited in the presence 5 mM εACA. Along with PAM, emm pattern D GAS isolates express a phenotypically distinct SK variant (type 2b SK) that requires Plg ligands such as PAM to activate Plg. Type 2b SK was able to generate an active site and activate GII-Plg at a rate significantly higher than that of GI-Plg when bound to PAM. Taken together, these data suggest that GAS selectively recruits and activates GII-Plg. Furthermore, we propose that the interaction between PAM and Plg may be partially mediated by a secondary binding site outside of KR2, affected by glycosylation at Asn289.

Anti-platelet and anti-thrombotic effect of a traditional herbal medicine Kyung-Ok-Ko.

Science.gov (United States)

Kim, Tae-Ho; Lee, Kyoung Mee; Hong, Nam Doo; Jung, Yi-Sook

2016-02-03

Kyung-Ok-Ko (KOK), a traditional herbal prescription, contains six main ingredients; Rehmannia glutinosa var. purpurae, Lycium chinense, Aquillaria agallocha, Poria cocos, Panax ginseng, and honey. KOK has been widely taken as a traditional oriental medicine for improving blood circulation or age-related symptoms, such as dementia and stroke. However, the effect of KOK on platelet activity has not been clarified. To evaluate the effect of KOK on platelet function, we evaluated its effect on functional markers of platelet activation such as aggregation and shape change. As a mechanism study for the effect of KOK, we examined its effect on granule secretion, intracellular Ca(2+) increase, and PLCγ and Akt activation. To investigate the effect of orally administered KOK (0.5, 1, 2 g/kg), we examined its ex vivo effect on platelet aggregation in rat, and its in vivo anti-thrombotic effect in mice thromboembolism model. Furthermore, the effect of KOK on bleeding time was examined to estimate its potential side effect. KOK (0.3, 1, 3, 10 mg/ml) inhibited collagen-induced platelet aggregation and shape change in rat platelets in a concentration-dependent manner. The mechanism for the anti-platelet effect of KOK seems to involve the inhibition of ATP release, intracellular Ca(2+) elevation, and the phosphorylation of PLCγ and Akt. In rat ex vivo study, KOK (2 g/kg, p.o. for 1 day, and 0.5, 1, 2 g/kg, p.o. for 7 days) also had significant inhibitory effects on collagen-induced platelet aggregation. In addition, KOK showed a significant protective effect against thrombosis attack in mice. The prolongation of bleeding time by KOK was much less than that by ASA, suggesting a beneficial potential of KOK than ASA in view of side effect. These findings suggest that KOK elicits remarkable anti-platelet and anti-thrombotic effects with less side effect of bleeding, and therefore, it may have a therapeutic potential for the prevention of platelet-associated cardiovascular diseases

Source characteristics of the Fairview, OK, earthquake sequence and its relationship to industrial activities

Science.gov (United States)

Yeck, W. L.; Weingarten, M.; Benz, H.; McNamara, D. E.; Herrmann, R. B.; Rubinstein, J. L.; Earle, P. S.; Bergman, E.

2016-12-01

We characterize the spatio-temporal patterns of seismicity surrounding the February 13, 2016, Mw 5.1 Fairview, Oklahoma earthquake. This earthquake sequence accounts for the largest moment release in the central and eastern US since the November 06, 2011 Mw 5.6 Prague, OK earthquake sequence. To improve the location accuracy of the sequence and measure near-source ground motions, the United States Geological Survey (USGS) deployed eight seismometers and accelerometers in the epicentral region. With the added depth control from these stations, we show that earthquakes primarily occur in the Precambrian basement, at depths of 6-10 km below sea level. The Mw 5.1 mainshock, the largest event in the cluster, locates near the base of the seismicity. Relocated aftershocks delineate a partially unmapped, 14-km-long fault segment that strikes approximately N40°E, partially bridging the gap between previously mapped basement faults to the southwest and northeast. Gas production and hydraulic fracking data from the region show no evidence that either of these activities correlates spatio-temporally with the Fairview sequence. Instead, we suggest that a series of high-rate, Arbuckle injection wells (> 300,000 bbls/month) 8-25 km northeast of this sequence pressurized the reservoir in the far field. Regional injection into the Arbuckle formation increased 7-fold in the 24 months before the initiation of the sequence with some wells operating at rates greater than 1 million barrels per month. Seismicity in the proximity of the high-rate wells is diffuse whilst the energetic Fairview sequence occurs more than 15 km from this region. Our observations point to the critical role pre-existing geologic structures play in the occurrence of large induced earthquakes. This study demonstrates the need for a better understanding of the role of far-field pressurization. High-quality data sets such as this facilitate the USGS mission to improve earthquake hazard identification, especially

Structural Diversity of Streptococcal Mutans Synthesized under Different Culture and Environmental Conditions and Its Effect on Mutanase Synthesis

Directory of Open Access Journals (Sweden)

Katarzyna Próchniak

2012-10-01

Full Text Available Streptococcal mutans synthesized under different conditions by growing cultures or by their glucosyltransferases were shown to exhibit a great structural and property diversity. Culturing and environmental factors causing structural differences in mutans were specified. All of the obtained biopolymers (76 samples were water-insoluble and most of them (72 had a structure with a predominance of α-(1→3-linked glucose (i.e., the content of α-(1→3-linkages in the glucan was always higher than 50%, but did not exceed 76%. An exception were four glucans containing more than 50% of α-(1→6-sequences. In these structurally unique mutans, the ratio of α-(1→3- to α-(1→6-bonds ranged from 0.75 to 0.97. Aside from one polymer, all others had a heavily branched structures and differed in the number of α-(1→3, α-(1→6, and α-(1→3,6 linkages and their mutual proportion. The induction of mutanase production in shaken flask cultures of Trichoderma harzianum by the structurally diverse mutans resulted in enzyme activities ranging from 0.144 to 1.051 U/mL. No statistical correlation was found between the total percentage content of α-(1→3-linkages in the α-glucan and mutanase activity. Thus, despite biosynthetic differences causing structural variation in the mutans, it did not matter which mutan structures were used to induce mutanase production.

Neuronal antibody biomarkers for Sydenham's chorea identify a new group of children with chronic recurrent episodic acute exacerbations of tic and obsessive compulsive symptoms following a streptococcal infection.

Science.gov (United States)

Singer, Harvey S; Mascaro-Blanco, Adda; Alvarez, Kathy; Morris-Berry, Christina; Kawikova, Ivana; Ben-Pazi, Hilla; Thompson, Carol B; Ali, Syed F; Kaplan, Edward L; Cunningham, Madeleine W

2015-01-01

Several autoantibodies (anti-dopamine 1 (D1R) and 2 (D2R) receptors, anti-tubulin, anti-lysoganglioside-GM1) and antibody-mediated activation of calcium calmodulin dependent protein kinase II (CaMKII) signaling activity are elevated in children with Sydenham's chorea (SC). Recognizing proposed clinical and autoimmune similarities between SC and PANDAS (pediatric autoimmune neuropsychiatric disorder associated with a streptococcal infection), we sought to identify serial biomarker changes in a slightly different population. Antineuronal antibodies were measured in eight children (mean 11.3 years) with chronic, dramatic, recurrent tics and obsessive-compulsive disorder (OCD) associated with a group A β-hemolytic streptococcal (GABHS) respiratory tract infection, but differing because they lacked choreiform movements. Longitudinal serum samples in most subjects included two pre-exacerbation samples, Exac), one midst Exac (abrupt recurrence of tic/OCD; temporally association with a GABHS infection in six of eight subjects), and two post-Exac. Controls included four groups of unaffected children (n = 70; mean 10.8 years) obtained at four different institutions and published controls. Clinical exacerbations were not associated with a significant rise in antineuronal antibody titers. CaMKII activation was increased at the GABHS exacerbation point in 5/6 subjects, exceeded combined and published control's 95th percentile at least once in 7/8 subjects, and median values were elevated at each time point. Anti-tubulin and anti-D2R titers did not differ from published or combined control group's 95th percentile or median values. Differences in anti-lysoganglioside-GM1 and anti-D1R titers were dependent on the selected control. Variances in antibody titers and CaMKII activation were identified among the institutional control groups. Based on comparisons to published studies, results identify two groups of PANDAS: 1) a cohort, represented by this study, which lacks choreiform

Neuronal antibody biomarkers for Sydenham's chorea identify a new group of children with chronic recurrent episodic acute exacerbations of tic and obsessive compulsive symptoms following a streptococcal infection.

Directory of Open Access Journals (Sweden)

Harvey S Singer

Full Text Available Several autoantibodies (anti-dopamine 1 (D1R and 2 (D2R receptors, anti-tubulin, anti-lysoganglioside-GM1 and antibody-mediated activation of calcium calmodulin dependent protein kinase II (CaMKII signaling activity are elevated in children with Sydenham's chorea (SC. Recognizing proposed clinical and autoimmune similarities between SC and PANDAS (pediatric autoimmune neuropsychiatric disorder associated with a streptococcal infection, we sought to identify serial biomarker changes in a slightly different population. Antineuronal antibodies were measured in eight children (mean 11.3 years with chronic, dramatic, recurrent tics and obsessive-compulsive disorder (OCD associated with a group A β-hemolytic streptococcal (GABHS respiratory tract infection, but differing because they lacked choreiform movements. Longitudinal serum samples in most subjects included two pre-exacerbation samples, Exac, one midst Exac (abrupt recurrence of tic/OCD; temporally association with a GABHS infection in six of eight subjects, and two post-Exac. Controls included four groups of unaffected children (n = 70; mean 10.8 years obtained at four different institutions and published controls. Clinical exacerbations were not associated with a significant rise in antineuronal antibody titers. CaMKII activation was increased at the GABHS exacerbation point in 5/6 subjects, exceeded combined and published control's 95th percentile at least once in 7/8 subjects, and median values were elevated at each time point. Anti-tubulin and anti-D2R titers did not differ from published or combined control group's 95th percentile or median values. Differences in anti-lysoganglioside-GM1 and anti-D1R titers were dependent on the selected control. Variances in antibody titers and CaMKII activation were identified among the institutional control groups. Based on comparisons to published studies, results identify two groups of PANDAS: 1 a cohort, represented by this study, which lacks

Analysis of fuel relocation for the NRC/PNL Halden assemblies IFA-431, IFA-432, and IFA-513. Interim report

International Nuclear Information System (INIS)

Williford, R.E.; Mohr, C.L.; Lanning, D.D.; Cunningham, M.E.; Rausch, W.N.

1980-06-01

The effects of the thermally-induced cracking and subsequent relocation of UO2 fuel pellets on the thermal and mechanical behavior of light-water reactor fuel rods during irradiation are quantified in this report. Data from the Nuclear Regulatory Commission/Pacific Northwest Laboratory Halden experiments on instrumented fuel assemblies (IFA) IFA-431, IFA-432, and IFA-513 are analyzed. Beginning-of-life in-reactor measurements of fuel center temperatures, linear heat ratings, and cladding axial elongations are used in a new model to solve for the effective thermal conductivity and elastic moduli of the cracked fuel column. The primary assumptions of the new model are that (1) the cracked fuel is in a hydrostatic state of stress in the (r,theta) plane, and that (2) there is no axial slipping between fuel and cladding. Three basic parameters are used to describe the cracked fuel: (1) the crack pattern, (2) the crack roughness, and (3) the fuel surface (gap) roughness. Recommendations are made on refining the model

Convergent synthetic methodology for the construction of self-adjuvanting lipopeptide vaccines using a novel carbohydrate scaffold

Directory of Open Access Journals (Sweden)

Vincent Fagan

2014-07-01

Full Text Available A novel convergent synthetic strategy for the construction of multicomponent self-adjuvanting lipopeptide vaccines was developed. A tetraalkyne-functionalized glucose derivative and lipidated Fmoc-lysine were prepared by novel efficient and convenient syntheses. The carbohydrate building block was coupled to the self-adjuvanting lipidic moiety (three lipidated Fmoc-lysines on solid support. Four copies of a group A streptococcal B cell epitope (J8 were then conjugated to the glyco-lipopeptide using a copper-catalyzed cycloaddition reaction. The approach was elaborated by the preparation of a second vaccine candidate which incorporated an additional promiscuous T-helper epitope.

Environmentally friendly wood preservatives formulated with enzymatic-hydrolyzed okara, copper and/or boron salts

International Nuclear Information System (INIS)

Ahn, Sye Hee; Oh, Sei Chang; Choi, In-gyu; Han, Gyu-seong; Jeong, Han-seob; Kim, Ki-woo; Yoon, Young-ho; Yang, In

2010-01-01

Novel biocides, such as copper azole (CuAz) and ammoniacal copper quaternary (ACQ), are extensively used as substitutes for chromate copper arsenate (CCA) in wood preservation. However, the expense of these biocides has necessitated the development of cost-effective and environmentally friendly wood preservatives. This study was conducted to investigate the effectiveness against decaying fungi of the preservatives formulated with enzymatic-hydrolyzed okara (OK), which is an organic waste produced from the manufacture of tofu, CuCl 2 (CC) and/or Na 2 B 4 O 7 .10H 2 O (B). With the addition of NH 4 OH as a dissociating agent, the addition of OK facilitated the target retention of most of the OK/CC and OK/CC/B preservative formulations in wood blocks. The OK-based wood preservatives (OK-WPs) were stable against hot-water leaching. When compared with control and CC-treated wood blocks, the leached wood blocks treated with OK/CC and OK/CC/B formulations showed excellent decay resistance against both Postia placenta and Gloeophyllum trabeum, especially when OK was hydrolyzed by Celluclast at a loading level of 0.1 ml/g. Scanning electron microscopy (SEM) and SEM-energy dispersive X-ray (SEM-EDX) spectrometry analyses demonstrated that preservative complexes, such as OK-CC and OK-CC-B, existed in the wood blocks treated with OK/CC and OK/CC/B formulations. This study results support the potential application of OK-WPs as environmentally friendly wood preservatives capable of replacing CuAz and ACQ.

Environmentally friendly wood preservatives formulated with enzymatic-hydrolyzed okara, copper and/or boron salts

Energy Technology Data Exchange (ETDEWEB)

Ahn, Sye Hee; Oh, Sei Chang [Department of Forest Resources, Daegu University, Gyeongsan 712-714 (Korea, Republic of); Choi, In-gyu [Department of Forest Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Han, Gyu-seong [Department of Wood and Paper Sciences, Chungbuk National University, Cheongju 361-763 (Korea, Republic of); Jeong, Han-seob [Department of Forest Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Kim, Ki-woo [National Instrumentation Center for Environmental Management, Seoul National University, Seoul 151-921 (Korea, Republic of); Yoon, Young-ho [KCI Co. Ltd., Seosan, Chungcheongnam-do 356-874 (Korea, Republic of); Yang, In, E-mail: dahadad2000@yahoo.com [Research Institute for Agriculture and Life Sciences, Seoul National University, San 56-1 Sillim-Dong, Kwanak-gu, Seoul 151-921 (Korea, Republic of)

2010-06-15

Novel biocides, such as copper azole (CuAz) and ammoniacal copper quaternary (ACQ), are extensively used as substitutes for chromate copper arsenate (CCA) in wood preservation. However, the expense of these biocides has necessitated the development of cost-effective and environmentally friendly wood preservatives. This study was conducted to investigate the effectiveness against decaying fungi of the preservatives formulated with enzymatic-hydrolyzed okara (OK), which is an organic waste produced from the manufacture of tofu, CuCl{sub 2} (CC) and/or Na{sub 2}B{sub 4}O{sub 7}.10H{sub 2}O (B). With the addition of NH{sub 4}OH as a dissociating agent, the addition of OK facilitated the target retention of most of the OK/CC and OK/CC/B preservative formulations in wood blocks. The OK-based wood preservatives (OK-WPs) were stable against hot-water leaching. When compared with control and CC-treated wood blocks, the leached wood blocks treated with OK/CC and OK/CC/B formulations showed excellent decay resistance against both Postia placenta and Gloeophyllum trabeum, especially when OK was hydrolyzed by Celluclast at a loading level of 0.1 ml/g. Scanning electron microscopy (SEM) and SEM-energy dispersive X-ray (SEM-EDX) spectrometry analyses demonstrated that preservative complexes, such as OK-CC and OK-CC-B, existed in the wood blocks treated with OK/CC and OK/CC/B formulations. This study results support the potential application of OK-WPs as environmentally friendly wood preservatives capable of replacing CuAz and ACQ.

M protein typing of Thai group A streptococcal isolates by PCR-Restriction fragment length polymorphism analysis

Directory of Open Access Journals (Sweden)

Good Michael F

2005-10-01

Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.

Preparation of Egg White Liquid Hydrolysate (ELH) and Its Radical-Scavenging Activity

Science.gov (United States)

Noh, Dong Ouk; Suh, Hyung Joo

2015-01-01

In the present study, an optimum protease was selected to hydrolyze the egg white liquid protein for the antioxidant peptides. Alcalase treatment yielded the highest amount of α-amino groups (15.27 mg/mL), while the control (no enzymatic hydrolysis) showed the lowest amount of α-amino groups (1.53 mg/mL). Alcalase also gave the highest degree of hydrolysis (DH) value (43.2%) and was more efficient for egg white liquid hydrolysis than the other enzymes. The Alcalase hydrolysate had the highest radical-scavenging activity (82.5%) at a concentration of 5.0 mg/mL. The conditions for enzymatic hydrolysis of egg white liquid with Alcalase were selected as substrate : water ratio of 2:1. Five percent Alacalse treatment did not show significant (P>0.05) increases of DH and α-amino nitrogen content after 24 h-hydrolysis. Thirty two hour-hydrolysis with 5% Alcalase is sufficient to make antioxidative egg white liquid hydrolysate from egg white liquid. DPPH and ABTS radical-scavenging activities were significantly (P<0.05) higher after enzymatic digestion. These results suggest that active peptides released from egg-white protein are effective radical-scavengers. Thus, this approach may be useful for the preparation of potent antioxidant products. PMID:26451355

Streptococcal 5'-Nucleotidase A (S5nA), a Novel Streptococcus pyogenes Virulence Factor That Facilitates Immune Evasion.

Science.gov (United States)

Zheng, Lisa; Khemlani, Adrina; Lorenz, Natalie; Loh, Jacelyn M S; Langley, Ries J; Proft, Thomas

2015-12-25

Streptococcus pyogenes is an important human pathogen that causes a wide range of diseases. Using bioinformatics analysis of the complete S. pyogenes strain SF370 genome, we have identified a novel S. pyogenes virulence factor, which we termed streptococcal 5'-nucleotidase A (S5nA). A recombinant form of S5nA hydrolyzed AMP and ADP, but not ATP, to generate the immunomodulatory molecule adenosine. Michaelis-Menten kinetics revealed a Km of 169 μm and a Vmax of 7550 nmol/mg/min for the substrate AMP. Furthermore, recombinant S5nA acted synergistically with S. pyogenes nuclease A to generate macrophage-toxic deoxyadenosine from DNA. The enzyme showed optimal activity between pH 5 and pH 6.5 and between 37 and 47 °C. Like other 5'-nucleotidases, S5nA requires divalent cations and was active in the presence of Mg(2+), Ca(2+), or Mn(2+). However, Zn(2+) inhibited the enzymatic activity. Structural modeling combined with mutational analysis revealed a highly conserved catalytic dyad as well as conserved substrate and cation-binding sites. Recombinant S5nA significantly increased the survival of the non-pathogenic bacterium Lactococcus lactis during a human whole blood killing assay in a dose-dependent manner, suggesting a role as an S. pyogenes virulence factor. In conclusion, we have identified a novel S. pyogenes enzyme with 5'-nucleotidase activity and immune evasion properties. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Comparison of clinical characteristics of pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections and childhood obsessive-compulsive disorder.

Science.gov (United States)

Bernstein, Gail A; Victor, Andrea M; Pipal, Allison J; Williams, Kyle A

2010-08-01

The objectives of this study were to identify unique clinical characteristics of children with pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections (PANDAS) compared with a control group of children with non-PANDAS obsessive-compulsive disorder (OCD) with respect to ancillary symptoms, types of obsessions and compulsions, symptom severity, and co-morbid DSM-IV diagnoses. Classification of PANDAS was based on review of pediatric and psychiatric records using the criteria developed by Swedo and colleagues. Children aged 6-14 with PANDAS (n = 21) and non-PANDAS OCD (n = 18) were assessed by blind independent evaluators using the PANDAS Questionnaire, Children's Yale-Brown Obsessive Compulsive Scale, Yale Global Tic Severity Scale, and Anxiety Disorders Interview Schedule for DSM-IV. PANDAS children were significantly more likely to present with separation anxiety, urinary urgency, hyperactivity, impulsivity, deterioration in handwriting, and decline in school performance during their initial episode of neuropsychiatric illness compared with children with OCD. Total tics and vocal tics were more severe in PANDAS children. Separation anxiety disorder and social phobia were more prevalent in non-PANDAS OCD children. Children with non-PANDAS OCD were significantly more likely to include others in their rituals. There were no significant differences between groups on demographics or severity of OCD. Distinguishing clinical characteristics in PANDAS, which included urinary urgency, hyperactivity, impulsivity, and deterioration in handwriting, are linked to basal ganglia functions. These clinical characteristics will aid in the differentiation of PANDAS children for research and clinical purposes and ultimately advance our understanding and treatment of this disorder.

Multilayer bioactive glass/zirconium titanate thin films in bone tissue engineering and regenerative dentistry

Directory of Open Access Journals (Sweden)

Mozafari M

2013-04-01

Full Text Available Masoud Mozafari,1,2 Erfan Salahinejad,1,3 Vahid Shabafrooz,1 Mostafa Yazdimamaghani,1 Daryoosh Vashaee,4 Lobat Tayebi1,5 1Helmerich Advanced Technology Research Center, School of Materials Science and Engineering, Oklahoma State University, Tulsa, OK, USA; 2Biomaterials Group, Faculty of Biomedical Engineering (Center of Excellence, Amirkabir University of Technology, Tehran, Iran; 3Department of Materials Science and Engineering, School of Engineering, Shiraz University, Shiraz, Iran; 4Helmerich Advanced Technology Research Center, School of Electrical and Computer Engineering, Oklahoma State University, Tulsa, OK, USA; 5School of Chemical Engineering, Oklahoma State University, Tulsa, OK, USA Abstract: Surface modification, particularly coatings deposition, is beneficial to tissue-engineering applications. In this work, bioactive glass/zirconium titanate composite thin films were prepared by a sol-gel spin-coating method. The surface features of the coatings were studied by scanning electron microscopy, atomic force microscopy, and spectroscopic reflection analyses. The results show that uniform and sound multilayer thin films were successfully prepared through the optimization of the process variables and the application of carboxymethyl cellulose as a dispersing agent. Also, it was found that the thickness and roughness of the multilayer coatings increase nonlinearly with increasing the number of the layers. This new class of nanocomposite coatings, comprising the bioactive and inert components, is expected not only to enhance bioactivity and biocompatibility, but also to protect the surface of metallic implants against wear and corrosion. Keywords: bioactive glass, zirconium titanate, spin-coating, microstructural properties, bone/dental applications, tissue engineering

Characterization of a Streptococcus suis tet(O/W/32/O)-carrying element transferable to major streptococcal pathogens.

Science.gov (United States)

Palmieri, Claudio; Magi, Gloria; Mingoia, Marina; Bagnarelli, Patrizia; Ripa, Sandro; Varaldo, Pietro E; Facinelli, Bruna

2012-09-01

Mosaic tetracycline resistance determinants are a recently discovered class of hybrids of ribosomal protection tet genes. They may show different patterns of mosaicism, but their final size has remained unaltered. Initially thought to be confined to a small group of anaerobic bacteria, mosaic tet genes were then found to be widespread. In the genus Streptococcus, a mosaic tet gene [tet(O/W/32/O)] was first discovered in Streptococcus suis, an emerging drug-resistant pig and human pathogen. In this study, we report the molecular characterization of a tet(O/W/32/O) gene-carrying mobile element from an S. suis isolate. tet(O/W/32/O) was detected, in tandem with tet(40), in a circular 14,741-bp genetic element (39.1% G+C; 17 open reading frames [ORFs] identified). The novel element, which we designated 15K, also carried the macrolide resistance determinant erm(B) and an aminoglycoside resistance four-gene cluster including aadE (streptomycin) and aphA (kanamycin). 15K appeared to be an unstable genetic element that, in the absence of recombinases, is capable of undergoing spontaneous excision under standard growth conditions. In the integrated form, 15K was found inside a 54,879-bp integrative and conjugative element (ICE) (50.5% G+C; 55 ORFs), which we designated ICESsu32457. An ∼1.3-kb segment that apparently served as the att site for excision of the unstable 15K element was identified. The novel ICE was transferable at high frequency to recipients from pathogenic Streptococcus species (S. suis, Streptococcus pyogenes, Streptococcus pneumoniae, and Streptococcus agalactiae), suggesting that the multiresistance 15K element can successfully spread within streptococcal populations.

Antibiotic treatment attenuates behavioral and neurochemical changes induced by exposure of rats to group a streptococcal antigen.

Directory of Open Access Journals (Sweden)

Dafna Lotan

Full Text Available Post-streptococcal A (GAS sequelae including movement and neuropsychiatric disorders have been associated with improvement in response to antibiotic therapy. Besides eradication of infection, the underlying basis of attenuation of neuropsychiatric symptoms following antibiotic treatment is not known. The aim of the present study was to test the efficacy of antibiotic treatment in a rat model of GAS-related neuropsychiatric disorders. In the model, rats were not infected but were exposed to GAS-antigen or to adjuvants only (Control rats and treated continuously with the antibiotic ampicillin in their drinking water from the first day of GAS-antigen exposure. Two additional groups of rats (GAS and Control did not receive ampicillin in their drinking water. Behavior of the four groups was assessed in the forced swim, marble burying and food manipulation assays. We assessed levels of D1 and D2 dopamine receptors and tyrosine hydroxylase in the prefrontal cortex and striatum, and IgG deposition in the prefrontal cortex, striatum and thalamus. Ampicillin treatment prevented emergence of the motor and some of the behavioral alterations induced by GAS-antigen exposure, reduced IgG deposition in the thalamus of GAS-exposed rats, and tended to attenuate the increase in the level of TH and D1 and D2 receptors in their striatum, without concomitantly reducing the level of sera anti-GAS antibodies. Our results reinforce the link between exposure to GAS antigen, dysfunction of central dopaminergic pathways and motor and behavioral alterations. Our data further show that some of these deleterious effects can be attenuated by antibiotic treatment, and supports the latter's possible efficacy as a prophylactic treatment in GAS-related neuropsychiatric disorders.

FATAL GROUP A STREPTOCOCCAL TOXIC SHOCK-LIKE SYNDROME IN A CHILD WITH VARICELLA: REPORT OF THE FIRST WELL DOCUMENTED CASE WITH DETECTION OF THE GENETIC SEQUENCES THAT CODE FOR EXOTOXINS SPE A AND B, IN SÃO PAULO, BRAZIL

Directory of Open Access Journals (Sweden)

SZTAJNBOK Jaques

1999-01-01

Full Text Available A previously healthy seven-year-old boy was admitted to the intensive care unit because of toxaemia associated with varicella. He rapidly developed shock and multisystem organ failure associated with the appearance of a deep-seated soft tissue infection and, despite aggressive treatment, died on hospital day 4. An M-non-typable, spe A and spe B positive Group A Streptococcus was cultured from a deep soft tissue aspirate. The criteria for defining Streptococcal toxic shock-like syndrome were fulfilled. The authors discuss the clinical and pathophysiological aspects of this disease as well as some unusual clinical findings related to this case.

Unexpected Behavior of Enaminones: Interesting New Routes to 1,6-Naphthyridines, 2-Oxopyrrolidines and Pyrano[4,3,2-de][1,6]naphthyridines

Directory of Open Access Journals (Sweden)

Herbert Meier

2012-12-01

Full Text Available Reaction of enaminones 1a–d with 2-aminoprop-1-ene-1,1,3-tricarbonitrile (2 in the presence of AcOH/NH4OAc afforded 7-amino-5-oxo-5,6-dihydro-1,6-naphthyridine-8-carbonitrile derivatives 9a–d. On the other hand, 2-aminopyrano[4,3,2-de] [1,6]naphthyridine-3-carbonitriles 20a–c,e were the only obtained products from the reactions of 1a–d with 2 in the presence of AcOH/NaOAc, while 1d afforded [3,5-bis-(4-chloro-benzoyl-phenyl]-(4-chloro-phenyl-methanone 21 under the same condition. The reaction of 2 with diethyl acetylenedicarboxylate in the presence of AcOH/NH4OAc afforded (4-cyano-5-dicyanomethylene-2-oxo-2,5-dihydro-1H-pyrrol-3-yl-acetic acid ethyl ester 15B.

Selectivity and Activity of Iron Molybdate Catalysts in Oxidation of Methanol

OpenAIRE

Khalid Khazzal Hummadi; Karim H. Hassan; Phillip C.H. Mitchell

2009-01-01

The selectivity and activity of iron molybdate catalysts prepared by different methods are compared with those of a commercial catalyst in the oxidation of methanol to formaldehyde in a continuous tubular bed reactor at 200-350 oC (473-623 oK), 10 atm (1013 kPa), with a methanol-oxygen mixture fixed at 5.5% by volume methanol: air ratio. The iron(III) molybdate catalyst prepared by co-precipitation and filtration had a selectivity towards formaldehyde in methanol oxidation comparable with a c...

The sensitivity and the specifity of rapid antigen test in streptococcal upper respiratory tract infections.

Science.gov (United States)

Gurol, Yesim; Akan, Hulya; Izbirak, Guldal; Tekkanat, Zuhal Tazegun; Gunduz, Tehlile Silem; Hayran, Osman; Yilmaz, Gulden

2010-06-01

It is aimed to detect the sensitivity and specificity of rapid antigen detection of group A beta hemolytic streptococci from throat specimen compared with throat culture. The other goal of the study is to help in giving clinical decisions in upper respiratory tract infections according to the age group, by detection of sensitivity and positive predictive values of the rapid tests and throat cultures. Rapid antigen detection and throat culture results for group A beta hemolytic streptococci from outpatients attending to our university hospital between the first of November 2005 and 31st of December 2008 were evaluated retrospectively. Throat samples were obtained by swabs from the throat and transported in the Stuart medium and Quickvue Strep A [Quidel, San Diego, USA] cassette test was applied and for culture, specimen was inoculated on 5% blood sheep agar and identified according to bacitracin and trimethoprim-sulphametaxazole susceptibility from beta hemolytic colonies. During the dates between the first of November 2005 and 31st of December 2008, from 453 patients both rapid antigen detection and throat culture were evaluated. Rapid antigen detection sensitivity and specificity were found to be 64.6% and 96.79%, respectively. The positive predictive value was 80.95% whereas negative predictive value was 92.82%. Kappa index was 0.91. When the results were evaluated according to the age groups, the sensitivity and the positive predictive value of rapid antigen detection in children were 70%, 90.3% and in adults 59.4%, 70.4%. When bacterial infection is concerned to prevent unnecessary antibiotic use, rapid streptococcal antigen test (RSAT) is a reliable method to begin immediate treatment. To get the maximum sensitivity of RSAT, the specimen collection technique used and education of the health care workers is important. While giving clinical decision, it must be taken into consideration that the sensitivity and the positive predictive value of the RSAT is quite

Intrapartum Antibiotic Chemoprophylaxis Policies for the Prevention of Group B Streptococcal Disease Worldwide: Systematic Review.

Science.gov (United States)

Le Doare, Kirsty; O'Driscoll, Megan; Turner, Kim; Seedat, Farah; Russell, Neal J; Seale, Anna C; Heath, Paul T; Lawn, Joy E; Baker, Carol J; Bartlett, Linda; Cutland, Clare; Gravett, Michael G; Ip, Margaret; Madhi, Shabir A; Rubens, Craig E; Saha, Samir K; Schrag, Stephanie; Sobanjo-Ter Meulen, Ajoke; Vekemans, Johan; Kampmann, Beate

2017-11-06

Intrapartum antibiotic chemoprophylaxis (IAP) prevents most early-onset group B streptococcal (GBS) disease. However, there is no description of how IAP is used around the world. This article is the sixth in a series estimating the burden of GBS disease. Here we aimed to review GBS screening policies and IAP implementation worldwide. We identified data through (1) systematic literature reviews (PubMed/Medline, Embase, Literature in the Health Sciences in Latin America and the Caribbean [LILACS], World Health Organization library database [WHOLIS], and Scopus) and unpublished data from professional societies and (2) an online survey and searches of policies from medical societies and professionals. We included data on whether an IAP policy was in use, and if so whether it was based on microbiological or clinical risk factors and how these were applied, as well as the estimated coverage (percentage of women receiving IAP where indicated). We received policy information from 95 of 195 (49%) countries. Of these, 60 of 95 (63%) had an IAP policy; 35 of 60 (58%) used microbiological screening, 25 of 60 (42%) used clinical risk factors. Two of 15 (13%) low-income, 4 of 16 (25%) lower-middle-income, 14 of 20 (70%) upper-middle-income, and 40 of 44 (91%) high-income countries had any IAP policy. The remaining 35 of 95 (37%) had no national policy (25/33 from low-income and lower-middle-income countries). Coverage varied considerably; for microbiological screening, median coverage was 80% (range, 20%-95%); for clinical risk factor-based screening, coverage was 29% (range, 10%-50%). Although there were differences in the microbiological screening methods employed, the individual clinical risk factors used were similar. There is considerable heterogeneity in IAP screening policies and coverage worldwide. Alternative global strategies, such as maternal vaccination, are needed to enhance the scope of global prevention of GBS disease. © The Author 2017. Published by Oxford

DİŞ HEKİMLİĞİNDE ORAL CERRAHİ İŞLEMLER SONRASINDA EN ÇOK TERCİH EDİLEN ANALJEZİK İLAÇLAR (NSAİ) VE ETKİNLİKLERİ

OpenAIRE

KÖSE, İbrahim; KOPARAL, Mahmut; ALAN, Hilal; KIRTAY, Mustafa; ÇİÇEK, Yasin

2015-01-01

Diş hekimliğinde özellikle oral cerrahi müdahaleler neticesinde  ağrı, şişlik ve trismus gibi rahatsızlıklar meydana gelebilmektedir. Kuşkusuz, meydana gelen problemler ve inflamatuvar süreci farmakolojik olarak kontrol altına almak amacıyla birçok analjezik ilaç kullanılmaktadır. Bu çalışmanın amacı; oral cerrahi müdahaleler sonrası kullanılan ağrı kesici ilaçların, kullanımı ve etkinliği konusundaki mevcut bilgileri güncellemek ve daha önce yapılmış çalışmaların ışığı altında uygulama yönte...

c Nobl charact its an le silve terizat ntimicro er nano ion of obial e ...

African Journals Online (AJOL)

sunny

Thin film of the sample was prepared on a carbon coated copper grid by just dropping a very ... structural characterization of nanoparticles, so the sizes of the synthesized ... particles by showing surface Plasmon absorption maxima at 432 nm.

Adaptive Surface Modeling of Soil Properties in Complex Landforms

Directory of Open Access Journals (Sweden)

Wei Liu

2017-06-01

Full Text Available Abstract: Spatial discontinuity often causes poor accuracy when a single model is used for the surface modeling of soil properties in complex geomorphic areas. Here we present a method for adaptive surface modeling of combined secondary variables to improve prediction accuracy during the interpolation of soil properties (ASM-SP. Using various secondary variables and multiple base interpolation models, ASM-SP was used to interpolate soil K+ in a typical complex geomorphic area (Qinghai Lake Basin, China. Five methods, including inverse distance weighting (IDW, ordinary kriging (OK, and OK combined with different secondary variables (e.g., OK-Landuse, OK-Geology, and OK-Soil, were used to validate the proposed method. The mean error (ME, mean absolute error (MAE, root mean square error (RMSE, mean relative error (MRE, and accuracy (AC were used as evaluation indicators. Results showed that: (1 The OK interpolation result is spatially smooth and has a weak bull's-eye effect, and the IDW has a stronger ‘bull’s-eye’ effect, relatively. They both have obvious deficiencies in depicting spatial variability of soil K+. (2 The methods incorporating combinations of different secondary variables (e.g., ASM-SP, OK-Landuse, OK-Geology, and OK-Soil were associated with lower estimation bias. Compared with IDW, OK, OK-Landuse, OK-Geology, and OK-Soil, the accuracy of ASM-SP increased by 13.63%, 10.85%, 9.98%, 8.32%, and 7.66%, respectively. Furthermore, ASM-SP was more stable, with lower MEs, MAEs, RMSEs, and MREs. (3 ASM-SP presents more details than others in the abrupt boundary, which can render the result consistent with the true secondary variables. In conclusion, ASM-SP can not only consider the nonlinear relationship between secondary variables and soil properties, but can also adaptively combine the advantages of multiple models, which contributes to making the spatial interpolation of soil K+ more reasonable.

Primary Effusion Lymphoma Involving both Pleural and Abdominal Cavities in a Patient with Hepatitis B Virus-related Liver Cirrhosis

Directory of Open Access Journals (Sweden)

Pei-Ying Hsieh

2007-01-01

Full Text Available Primary effusion lymphoma (PEL is an unusual form of non-Hodgkin's lymphoma, which is characterized by lymphomatous effusion in body cavities, but no associated mass lesions. It is usually associated with an immunodeficient state most often with the human immunodeficiency virus (HIV. We describe a 54-year-old man with HIV-negative PEL, with a history of hepatitis B virus-related liver cirrhosis. Both abdominal and pleural cavities were involved; no solid tumor masses were found and bone marrow investigations were normal. The ascites and pleural effusion contained numerous pleomorphic lymphoid cells. Immunophenotyping was positive for CD138. Chromosome study showed complex cytogenetics. The genomic human herpesvirus-8 was detected in the lymphoma cells. It is postulated that the immuno-suppressed state in this patient may have been caused by cirrhosis. The patient received four cycles of chemotherapy of CHOP and Picibanil (OK-432 intraperitoneal administration. However, no durable remission was achieved. Adefovir failed to halt the progressive liver failure after the development of YMDD mutant related to lamivudine. He died of sepsis and hepatic failure.

Groundwater Governance and the Growth of Center Pivot Irrigation in Cimarron County, OK and Union County, NM: Implications for Community Vulnerability to Drought

Directory of Open Access Journals (Sweden)

Kathryn Wenger

2017-01-01

Full Text Available Cimarron County, Oklahoma and Union County, New Mexico, neighboring counties in the Southern High Plains, are part of a vital agricultural region in the United States. This region experiences extended periods of cyclical drought threatening its ability to produce, creating an incentive for extensive center pivot irrigation (CPI. Center pivots draw from the rapidly depleting High Plains Aquifer System. As a result, the prospect of long-term sustainability for these agricultural communities is questionable. We use Remote Sensing and Geographic Information Systems to quantify growth in land irrigated by CPI between the 1950s and 2014, and key informant interviews to explore local perspectives on the causes and impact of such growth. In Cimarron County, OK, CPI increased by the mid-1980s, and has continually increased since. Results suggest adaptation to drought, a depleting aquifer, high corn prices, and less rigid groundwater regulations contribute to CPI growth. Conversely, CPI in Union County, NM, increased until 2010, and then declined. Results also suggest that drought-related agricultural changes and more aggressive well drilling regulations contribute to this decrease. Nevertheless, in both counties, there is a growing concern over the depleting aquifer, the long-term sustainability of CPI, and the region’s economic future.

The group A streptococcal collagen-like protein 1, Scl1, mediates biofilm formation by targeting the EDA-containing variant of cellular fibronectin expressed in wounded tissue

Science.gov (United States)

Oliver-Kozup, Heaven; Martin, Karen H.; Schwegler-Berry, Diane; Green, Brett J.; Betts, Courtney; Shinde, Arti V.; Van De Water, Livingston; Lukomski, Slawomir

2012-01-01

Summary Wounds are known to serve as portals of entry for group A Streptococcus (GAS). Subsequent tissue colonization is mediated by interactions between GAS surface proteins and host extracellular matrix components. We recently reported that the streptococcal collagen-like protein-1, Scl1, selectively binds the cellular form of fibronectin (cFn) and also contributes to GAS biofilm formation on abiotic surfaces. One structural feature of cFn, which is predominantly expressed in response to tissue injury, is the presence of a spliced variant containing extra domain A (EDA/EIIIA). We now report that GAS biofilm formation is mediated by the Scl1 interaction with EDA-containing cFn. Recombinant Scl1 proteins that bound cFn also bound recombinant EDA within the C-C′ loop region recognized by the α9β1 integrin. The extracellular 2-D matrix derived from human dermal fibroblasts supports GAS adherence and biofilm formation. Altogether, this work identifies and characterizes a novel molecular mechanism by which GAS utilizes Scl1 to specifically target an extracellular matrix component that is predominantly expressed at the site of injury in order to secure host tissue colonization. PMID:23217101

Trial of validation of two devices for self-measurement of blood pressure according to the European Society of Hypertension International Protocol: the Citizen CH-432B and the Citizen CH-656C.

Science.gov (United States)

Cotte, Uwe V; Faltenbacher, Verena H; von Willich, Werner; Bogner, Johannes R

2008-02-01

Two devices for self-measurement of blood pressure, one at the upper arm (Citizen CH-432B) and one at the wrist (Citizen CH-656C), were evaluated according to the International Protocol of the European Society of Hypertension. The International Protocol is divided into two phases: the first phase is performed on 15 selected participants with five participants in three different blood pressure ranges. If the devices passed this phase, 18 additional participants selected on the basis of the same criteria as in phase 1 were included. Two skilled observers performed the following blood pressure measurements: five measurements were performed with the mercury standard alternating with four measurements with each of the test devices per participant. The first measurement result from each device instrument was not included in the analysis. The difference between the blood pressure value given by the devices and that obtained by the two observers (mean of the two observers) was calculated for each pair of measurements and classified into three categories (within 5, 10 and 15 mmHg). The results were compared to the pass criteria established by the European Society of Hypertension. Afterwards the number of measurement differences falling within 5 mmHg was determined for every person. At least 22 of the 33 participants should have two of their three comparisons within 5 mmHg and there should be a maximum of three participants without a measurement difference within the 5 mmHg range. Both tested devices passed the first phase of the validation process by exceeding the required number of comparisons falling within the 5, 10 and 15 mmHg error zones. Even the second phase confirmed the validation criteria with average differences between the device and the mercury sphygmomanometer of 0.7+/-4.4 and -3.6+/-4.0 mmHg for systolic blood pressure and diastolic blood pressure, respectively, for the Citizen CH-432B device and -0.7+/-6.0 and -1.2+/-4.5 mmHg for the Citizen CH-656C device

Duke storage rink UV/VUV FEL: Status and prospects

Energy Technology Data Exchange (ETDEWEB)

Litvinenko, V.N.; Burnham, B.; Madey, J.M.J. [Duke Univ., Durham, NC (United States)] [and others

1995-12-31

The 1 GeV Duke storage ring was successfully commissioned with parameters exceeding initial specification. The OK-4 FEL has arrived at the Duke FEL laboratory from the Novosibirsk Institute of Nuclear Physics. The OK-4 installation and commissioning is in progress. In this paper we describe the up-to-date status of the Duke storage ring and the OK-4 FEL. The projected performance of the OK-4 UV/VUV FEL is presented based on the electron beam parameters achieved. Initial plans to operate the OK-4 UV/VUV FEL at the Duke 1 GeV storage ring are outlined. Future plans and prospects of both the OK-4 FEL and the Duke storage ring are discussed.

Analysis of a normalized QR filter using Bayesian description of propagated data

Czech Academy of Sciences Publication Activity Database

Kadlec, Jiří; Schier, Jan

1999-01-01

Roč. 13, č. 6 (1999), s. 487-505 ISSN 0890-6327 Grant - others:Commission EC(XE) ESPRIT 23544 HSLA; Commission EC(XE) ESPRIT 25729 ProDaCTool; MŠMT(CZ) OK 314; MŠMT(CZ) OK 317 Program:OK; OK Institutional research plan: AV0Z1075907 Subject RIV: JC - Computer Hardware ; Software Impact factor: 0.291, year: 1999

OYETOLA, OK

African Journals Online (AJOL)

ADOWIE PERE

2018-03-23

Mar 23, 2018 ... March 2018. Full-text Available ... performance of the controller depends on numerical value of koln .More so ... such as data mining, big data, database management system, data ... Institute for Advanced Study.”, presented a.

75 FR 76003 - Tricor Ten Section Hub LLC; Notice of Availability of the Environmental Assessment for the...

Science.gov (United States)

2010-12-07

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. CP09-432-000] Tricor Ten Section Hub LLC; Notice of Availability of the Environmental Assessment for the Proposed Ten Section Gas... Commission) has prepared an environmental assessment (EA) for the Ten Section Gas Storage Project, in Kern...

Comparison of mutans streptococcal strains of father, mother, and child in indian families using chromosomal DNA fingerprinting.

Science.gov (United States)

Katre, Amar N; Damle, Sg

2013-09-01

It is now understood and accepted that there is a direct transmission of mutans streptococci (MS) from the mother to the child. There is also a direct correlation between the levels of MS in the mother and the caries status of the child. Advanced technologies in molecular biology like chromosomal DNA fngerprinting have established beyond doubt that the mother and the child bear similar strains of MS. A study was designed with the aim of comparing the MS strains between the father, mother and the child in Indian families. A group of 20 Indian families comprising of the father, mother and child were selected and divided into caries free and caries active groups. Mixed salivary samples were collected from the individuals and were cultured for the growth of Mutans streptococci. The colonies were counted on a colony counter and a comparison was made between the mutans streptococcal counts of the mother and the caries status of the child. Further, the genotypes of the father, mother and the child were isolated and compared using the technique of chromosomal DNA fngerprinting. Following electrophoresis, the band pattern obtained was compared for similarities or differences. The results of the same were tabulated and evaluated statistically. When the colony counts of the mother (in CFU/ml) were compared with the 'dft' status of the child, a positive correlation was seen in group II. Intergroup comparison using the unpaired T test was statistically signifcant. Electrophoretic analysis of the chromosomal DNA on the agarose gels revealed identical band patterns in 13 mother-child pairs, which was statistically signifcant. Three of the father-child pairs showed identical band patterns, which was statistically signifcant. Intergroup comparison using Chi-square test was not statistically signifcant. One may conclude that irrespective of the caries status of the child, majority of the mother child pairs share identical strains of MS and hence the mother is the primary source of

Invasive bacterial disease trends and characterization of group B streptococcal isolates among young infants in southern Mozambique, 2001-2015.

Directory of Open Access Journals (Sweden)

Betuel Sigaúque

Full Text Available Maternal group B streptococcal (GBS vaccines under development hold promise to prevent GBS disease in young infants. Sub-Saharan Africa has the highest estimated disease burden, although data on incidence and circulating strains are limited. We described invasive bacterial disease (IBD trends among infants <90 days in rural Mozambique during 2001-2015, with a focus on GBS epidemiology and strain characteristics.Community-level birth and mortality data were obtained from Manhiça's demographic surveillance system. IBD cases were captured through ongoing surveillance at Manhiça district hospital. Stored GBS isolates from cases underwent serotyping by multiplex PCR, antimicrobial susceptibility testing, and whole genome sequencing.There were 437 IBD cases, including 57 GBS cases. Significant declines in overall IBD, neonatal mortality, and stillbirth rates were observed (P<0.0001, but not for GBS (P = 0.17. In 2015, GBS was the leading cause of young infant IBD (2.7 per 1,000 live births. Among 35 GBS isolates available for testing, 31 (88.6% were highly related serotype III isolates within multilocus sequence types (STs 17 (68.6% or 109 (20.0%. All seven ST109 isolates (21.9% had elevated minimum inhibitory concentration (MIC to penicillin (≥0.12 μg/mL associated with penicillin-binding protein (PBP 2x substitution G398A. Epidemiologic and molecular data suggest this is a well-established clone.A notable young infant GBS disease burden persisted despite improvements in overall maternal and neonatal health. We report an established strain with pbp2x point mutation, a first-step mutation associated with reduced penicillin susceptibility within a well-known virulent lineage in rural Mozambique. Our findings further underscores the need for non-antibiotic GBS prevention strategies.

I'm OK, Are You Y2K OK?

Science.gov (United States)

Wilson, Thomas F.

1999-01-01

Y2K problems include software programming issues involving chronology and microchips embedded in every conceivable piece of electronic equipment. Procrastination is not in schools' best interest. Administrators should initiate five conversion stages: awareness, assessment, renovation, validation, and implementation. A sample equipment checklist…

NCBI nr-aa BLAST: CBRC-CBRE-01-1378 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-CBRE-01-1378 ref|YP_001450257.1| streptococcal hemagglutinin [Streptococcus gordon...ii str. Challis substr. CH1] gb|ABV10391.1| streptococcal hemagglutinin [Streptococcus gordonii str. Challis substr. CH1] YP_001450257.1 2e-14 32% ...

NCBI nr-aa BLAST: CBRC-PMAR-01-0237 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PMAR-01-0237 ref|YP_001450257.1| streptococcal hemagglutinin [Streptococcus gordon...ii str. Challis substr. CH1] gb|ABV10391.1| streptococcal hemagglutinin [Streptococcus gordonii str. Challis substr. CH1] YP_001450257.1 8e-19 36% ...

NCBI nr-aa BLAST: CBRC-DMEL-03-0079 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-03-0079 ref|YP_001450257.1| streptococcal hemagglutinin [Streptococcus gordon...ii str. Challis substr. CH1] gb|ABV10391.1| streptococcal hemagglutinin [Streptococcus gordonii str. Challis substr. CH1] YP_001450257.1 2e-07 24% ...

NCBI nr-aa BLAST: CBRC-MMUS-07-0248 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-07-0248 ref|YP_001450257.1| streptococcal hemagglutinin [Streptococcus gordon...ii str. Challis substr. CH1] gb|ABV10391.1| streptococcal hemagglutinin [Streptococcus gordonii str. Challis substr. CH1] YP_001450257.1 5e-10 32% ...

NCBI nr-aa BLAST: CBRC-AGAM-03-0081 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-AGAM-03-0081 ref|YP_001450257.1| streptococcal hemagglutinin [Streptococcus gordon...ii str. Challis substr. CH1] gb|ABV10391.1| streptococcal hemagglutinin [Streptococcus gordonii str. Challis substr. CH1] YP_001450257.1 2e-13 26% ...

NCBI nr-aa BLAST: CBRC-ACAR-01-0466 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-ACAR-01-0466 ref|YP_001450257.1| streptococcal hemagglutinin [Streptococcus gordon...ii str. Challis substr. CH1] gb|ABV10391.1| streptococcal hemagglutinin [Streptococcus gordonii str. Challis substr. CH1] YP_001450257.1 2e-16 51% ...

NCBI nr-aa BLAST: CBRC-PMAR-01-0709 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PMAR-01-0709 ref|YP_001450257.1| streptococcal hemagglutinin [Streptococcus gordon...ii str. Challis substr. CH1] gb|ABV10391.1| streptococcal hemagglutinin [Streptococcus gordonii str. Challis substr. CH1] YP_001450257.1 3e-13 31% ...

NCBI nr-aa BLAST: CBRC-AGAM-07-0027 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-AGAM-07-0027 ref|YP_001450257.1| streptococcal hemagglutinin [Streptococcus gordon...ii str. Challis substr. CH1] gb|ABV10391.1| streptococcal hemagglutinin [Streptococcus gordonii str. Challis substr. CH1] YP_001450257.1 0.001 26% ...

NCBI nr-aa BLAST: CBRC-OLAT-26-0180 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-OLAT-26-0180 ref|YP_001450257.1| streptococcal hemagglutinin [Streptococcus gordon...ii str. Challis substr. CH1] gb|ABV10391.1| streptococcal hemagglutinin [Streptococcus gordonii str. Challis substr. CH1] YP_001450257.1 1e-134 32% ...

Comparing ordinary kriging and inverse distance weighting for soil as pollution in Beijing.

Science.gov (United States)

Qiao, Pengwei; Lei, Mei; Yang, Sucai; Yang, Jun; Guo, Guanghui; Zhou, Xiaoyong

2018-06-01

Spatial interpolation method is the basis of soil heavy metal pollution assessment and remediation. The existing evaluation index for interpolation accuracy did not combine with actual situation. The selection of interpolation methods needs to be based on specific research purposes and research object characteristics. In this paper, As pollution in soils of Beijing was taken as an example. The prediction accuracy of ordinary kriging (OK) and inverse distance weighted (IDW) were evaluated based on the cross validation results and spatial distribution characteristics of influencing factors. The results showed that, under the condition of specific spatial correlation, the cross validation results of OK and IDW for every soil point and the prediction accuracy of spatial distribution trend are similar. But the prediction accuracy of OK for the maximum and minimum is less than IDW, while the number of high pollution areas identified by OK are less than IDW. It is difficult to identify the high pollution areas fully by OK, which shows that the smoothing effect of OK is obvious. In addition, with increasing of the spatial correlation of As concentration, the cross validation error of OK and IDW decreases, and the high pollution area identified by OK is approaching the result of IDW, which can identify the high pollution areas more comprehensively. However, because the semivariogram constructed by OK interpolation method is more subjective and requires larger number of soil samples, IDW is more suitable for spatial prediction of heavy metal pollution in soils.

Oxford Knee Score: cross-cultural adaptation and validation of the Turkish version in patients with osteoarthritis of the knee.

Science.gov (United States)

Tuğay, Baki Umut; Tuğay, Nazan; Güney, Hande; Kınıklı, Gizem İrem; Yüksel, İnci; Atilla, Bülent

2016-01-01

The Oxford Knee Score (OKS) is a valid, short, self-administered, and site- specific outcome measure specifically developed for patients with knee arthroplasty. This study aimed to cross-culturally adapt and validate the OKS to be used in Turkish-speaking patients with osteoarthritis of the knee. The OKS was translated and culturally adapted according to the guidelines in the literature. Ninety-one patients (mean age: 55.89±7.85 years) with knee osteoarthritis participated in the study. Patients completed the Turkish version of the Oxford Knee Score (OKS-TR), Short-Form 36 Health Survey (SF-36), and Western Ontario and McMaster Universities Index (WOMAC) questionnaires. Internal consistency was tested using Cronbach's α coefficient. Patients completed the OKS-TR questionnaire twice in 7 days to determine the reproducibility. Correlation between the total results of both tests was determined by Spearman's correlation coefficient and intraclass correlation coefficients (ICC). Validity was assessed by calculating Spearman's correlation coefficient between the OKS, WOMAC, and SF-36 scores. Floor and ceiling effects were analyzed. Internal consistency was high (Cronbach's α: 0.90). The reproducibility tested by 2 different methods showed no significant difference (p>0.05). The construct validity analyses showed a significant correlation between the OKS and the other scores (p<0.05). There was no floor or ceiling effect in total OKS score. The OKS-TR is a reliable and valid measure for the self-assessment of pain and function in Turkish-speaking patients with osteoarthritis of the knee.

Seven-year surveillance of emm types of pediatric Group A streptococcal pharyngitis isolates in Western Greece.

Directory of Open Access Journals (Sweden)

George A Syrogiannopoulos

Full Text Available BACKGROUND: An experimental 26-valent M protein Group A streptococcal (GAS vaccine has entered clinical studies. Pharyngeal GAS emm type surveillances in different areas and time-periods enhance the understanding of the epidemiology of GAS pharyngitis. Moreover, these surveillances, combined with the data on GAS invasive disease, can play a significant role in the formulation of multivalent type-specific vaccines. METHODS: During a 7-year period (1999-2005, 2408 GAS isolates were recovered from consecutive children with pharyngitis in Western Greece. The overall macrolide resistance rate was 22.8%. Along the study period we noted a tendency towards significantly decreased rates of resistance, with the lowest rates occurring in 2002 (15.3%, 2003 (15% and 2004 (16.7%. A random sample of isolates from each year, 338 (61.7% of the 548 macrolide-resistant and 205 (11% of the macrolide-susceptible, underwent molecular analysis, including emm typing. RESULTS: The 543 typed isolates had 28 different emm types. A statistically significant association was found between macrolide resistance and emm4, emm22 and emm77, whereas emm1, emm3, emm6, emm12, emm87 and emm89 were associated with macrolide susceptibility. A significant yearly fluctuation was observed in emm4, emm28 and emm77. The most common macrolide-resistant GAS were emm77 isolates harboring erm(A, either alone or in combination with mef(A, emm4 carrying mef(A, emm28 possessing erm(B, emm75 carrying mef(A, emm12 harboring mef(A and emm22 carrying erm(A. We estimated that 82.8% of the isolates belonged to emm types included in the novel 26-valent M protein vaccine. The vaccine coverage rate was determined mainly by the increased frequency of nonvaccine emm4 isolates. CONCLUSIONS: A limited number of emm types dominated among macrolide-susceptible and macrolide-resistant GAS isolates. We observed seasonal fluctuations, which were significant for emm4, emm28 and emm77. This type of data can serve as

Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

Directory of Open Access Journals (Sweden)

Moore Landon L

2008-02-01

Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

Targeting TREM-1 signaling in the presence of antibiotics is effective against Streptococcal toxic-shock-like syndrome (STSLS caused by Streptococcus suis

Directory of Open Access Journals (Sweden)

Chao eYang

2015-11-01

Full Text Available Streptococcus suis (S. suis, a major swine pathogen, is also a severe threat to human health. Infection with highly virulent strains of S. suis can cause human Streptococcal toxic-shock-like syndrome (STSLS, which is associated with high serum pro-inflammatory cytokine levels and a high mortality rate. Our previous study indicated that highly virulent S. suis infection could activate the TREM-1 signaling pathway, which promotes host clearance of S. suis during early infection. However, it remained to be elicited whether TREM-1 signaling could be a target against STSLS in the presence of antibiotic. In the present study, mice were infected with a highly virulent S. suis strain and then treated with rTREM-1 (the recombinant extracellular domain of TREM-1 to block TREM-1 signaling, antibiotics, both rTREM-1 and antibiotics, or PBS. The survival rates, clinical signs, serum IL-1β and TNF-α levels, and serum bacterial loads were evaluated. Treatment with rTREM-1 could aggravate the outcome of infection as described previously. Although the conventional treatment with antibiotics contributed to effective S. suis clearance, it did not improve survival significantly. In comparison, due to the reduction of the exaggerated pro-inflammatory response, treatment combined with rTREM-1 and antibiotics not only led to efficient bacterial clearance but also alleviated inflammation. In conclusion, TREM-1 signaling contributed to severe inflammatory response and benefited S. suis clearance. Therefore, blocking TREM-1 signaling could still be a target for the treatment of STSLS in the presence of antibiotics.

ASO

African Journals Online (AJOL)

2014-06-02

Jun 2, 2014 ... potential source of complications such as heart diseases. 5 ; and post streptococcal arthritis 6,7 . The prevalence of post ..... streptococcal reactive arthritis in which lesions were detected with [18F]-fluorodeoxyglucose positron emission tomography-CT imaging and magnetic resonance imaging. Modern ...

A new power mapping method based on ordinary kriging and determination of optimal detector location strategy

International Nuclear Information System (INIS)

Peng, Xingjie; Wang, Kan; Li, Qing

2014-01-01

Highlights: • A new power mapping method based on Ordinary Kriging (OK) is proposed. • Measurements from DayaBay Unit 1 PWR are used to verify the OK method. • The OK method performs better than the CECOR method. • An optimal neutron detector location strategy based on ordinary kriging and simulated annealing is proposed. - Abstract: The Ordinary Kriging (OK) method is presented that is designed for a core power mapping calculation of pressurized water reactors (PWRs). Measurements from DayaBay Unit 1 PWR are used to verify the accuracy of the OK method. The root mean square (RMS) reconstruction errors are kept at less than 0.35%, and the maximum reconstruction relative errors (RE) are kept at less than 1.02% for the entire operating cycle. The reconstructed assembly power distribution results show that the OK method is fit for core power distribution monitoring. The quality of power distribution obtained by the OK method is partly determined by the neutron detector locations, and the OK method is also applied to solve the optimal neutron detector location problem. The spatially averaged ordinary kriging variance (AOKV) is minimized using simulated annealing, and then, the optimal in-core neutron detector locations are obtained. The result shows that the current neutron detector location of DayaBay Unit 1 reactor is near-optimal

Current concepts in the classification, diagnosis and treatment of vascular anomalies

International Nuclear Information System (INIS)

Ernemann, Ulrike; Kramer, Ulrich; Miller, Stephan; Bisdas, Sotirios; Rebmann, Hans; Breuninger, Helmut; Zwick, Christine; Hoffmann, Juergen

2010-01-01

Patients with extended vascular anomalies may suffer from significant aesthetic and functional impairment and represent a challenge to therapeutic planning, which is best met by an interdisciplinary concept. In agreement with the International Society for the Study of Vascular Anomalies (ISSVA), vascular lesions are classified into haemangiomas as proliferating endothelial tumours on the one hand and congenital vascular malformations on the other. According to the preponderant vascular channels and hemodynamic characteristics, malformations are subdivided into low flow (venous, lymphatic and capillary) lesions and high-flow malformations. Diagnostic imaging should be targeted at the specific structural and functional informations required for treatment planning. The imaging modality of choice to provide these informations is magnetic resonance imaging (MRI) supplemented by magnetic resonance angiography (MRA) with high spatial and temporal resolution. Treatment indications for haemangiomas depend on the proliferative behaviour of the lesion and comprise β-blockers in order to induce involution as well as cryotherapy, laser and open surgery. Interventional radiological procedures have evolved as an essential element in an interdisciplinary treatment plan for vascular malformations and include percutaneous sclerotherapy with ethanol and OK-432 for venous and lymphatic malformations and transarterial embolization for high-flow lesions.

Current concepts in the classification, diagnosis and treatment of vascular anomalies

Energy Technology Data Exchange (ETDEWEB)

Ernemann, Ulrike, E-mail: ulrike.ernemann@med.uni-tuebingen.d [Department of Diagnostic and Interventional Neuroradiology, Radiological Clinic, University Hospital Tuebingen, Hoppe-Seyler-Strasse 3, 72076 Tuebingen (Germany); Kramer, Ulrich; Miller, Stephan [Department of Diagnostic and Interventional Radiology, Radiological Clinic, University Hospital Tuebingen (Germany); Bisdas, Sotirios [Department of Diagnostic and Interventional Neuroradiology, Radiological Clinic, University Hospital Tuebingen, Hoppe-Seyler-Strasse 3, 72076 Tuebingen (Germany); Rebmann, Hans [Department of Paediatrics, Children' s Hospital, University Hospital Tuebingen (Germany); Breuninger, Helmut [Department of Dermatology, University Hospital Tuebingen (Germany); Zwick, Christine [Department of Hand, Plastic, Reconstructive and Burns Surgery, BG Trauma Clinic Tuebingen, University Hospital Tuebingen (Germany); Hoffmann, Juergen [Department of Oral and Maxillofacial Surgery, University Hospital Tuebingen (Germany)

2010-07-15

Patients with extended vascular anomalies may suffer from significant aesthetic and functional impairment and represent a challenge to therapeutic planning, which is best met by an interdisciplinary concept. In agreement with the International Society for the Study of Vascular Anomalies (ISSVA), vascular lesions are classified into haemangiomas as proliferating endothelial tumours on the one hand and congenital vascular malformations on the other. According to the preponderant vascular channels and hemodynamic characteristics, malformations are subdivided into low flow (venous, lymphatic and capillary) lesions and high-flow malformations. Diagnostic imaging should be targeted at the specific structural and functional informations required for treatment planning. The imaging modality of choice to provide these informations is magnetic resonance imaging (MRI) supplemented by magnetic resonance angiography (MRA) with high spatial and temporal resolution. Treatment indications for haemangiomas depend on the proliferative behaviour of the lesion and comprise {beta}-blockers in order to induce involution as well as cryotherapy, laser and open surgery. Interventional radiological procedures have evolved as an essential element in an interdisciplinary treatment plan for vascular malformations and include percutaneous sclerotherapy with ethanol and OK-432 for venous and lymphatic malformations and transarterial embolization for high-flow lesions.

432-μm laser's beam-waist measurement for the polarimeter / interferometer on the EAST Tokamak

Energy Technology Data Exchange (ETDEWEB)

Wang, Z. X.; Liu, H. Q.; Jie, Y. X. [Chinese Academy of Sciences, Anhui (China); and others

2014-10-15

A far-infrared (FIR) polarimeter / interferometer (PI) system is under development for measurements of the current-density and the electron-density profiles in the EAST tokamak. The system will utilize three identical 432-μm CHCOOH lasers pumped by a CO{sub 2} laser. Measurements of the laser beam's waist size and position are basic works. This paper will introduce three methods with a beam profiler and several focusing optical elements. The beam profiler can be used to show the spatial energy distribution of the laser beam. The active area of the profiler is 12.4 x 12.4 mm{sup 2}. Some focusing optical elements are needed to focus the beam in order for the beam profiler to receive the entire laser beam. Two principles and three methods are used in the measurement. The first and the third methods are based on the same principle, and the second method adopts an other principle. Due to the fast and convenient measurement, although the first method is a special form of the third and it can only give the size of beam waist, it is essential to the development of the experiment and it can provide guidance for the choices of the sizes of the optical elements in the next step. A concave mirror, a high-density polyethylene (HDPE) lens and a polymethylpentene (TPX) lens are each used in the measurement process. The results of these methods are close enough for the design of PI system's optical path.

BAZI YENİ İLAÇ ÖNCÜSÜ BENZOTİYAZOLİNON TÜREVLERİ ÜZERİNE ÇOK DEĞİŞKENLİ SAR ÇALIŞMALARI

Directory of Open Access Journals (Sweden)

Yadigar Gülseven Sıdır

2015-12-01

Full Text Available Yeni modellenen analjezik aktif otuziki benzotiyazolinon türevinin çok değişkenli yapı-aktivite ilişkileri iki farklı kemometric metot olan temel bileşen analizi (PCA ve hiyerarşik kümeleme analizi (HCA kullanılarak incelendi. Moleküllerin elektronik, termokimyasal ve hidrofobik özelliklerini tanımlayan yirmi moleküler tanımlayıcı Austin Modeli (AM1 ve yoğunluk fonksiyonel teorisi (DFT kullanılarak hesaplandı. HCA ve PCA metotları sıvı fazdaki (HOFSıvı polarizebilite (α, elektrofilik indis (ω ve oluşum ısısı ile uygulanır. Sonuçlar otuziki molekülü aktifve inaktif olarak iki grupta sınıflandırmak için oldukça etkili bulundu. Korelasyon matrisi ve değişken ağırlığı moleküllerin hesaplanan fizikokimyasal parametreleri arasındaki ilişkileri açıklamak için kullanıldı. İncelenen bileşiklerin ana halkasına F ve OCH3 sübstitüentlerin eklenmesi ve piperazin üzerindeki alkil gurubunun uzaması biyolojik aktiviteyi değiştir.

Deformation of the Northwestern Okhotsk Plate: How is it happening?

Science.gov (United States)

Hindle, D.; Fujita, K.; Mackey, K.

2009-09-01

The Eurasia (EU) - North America (NA) plate boundary zone across Northeast Asia still presents many open questions within the plate tectonic paradigm. Constraining the geometry and number of plates or microplates present in the plate boundary zone is especially difficult because of the location of the EU-NA euler pole close to or even upon the EU-NA boundary. One of the major challenges remains the geometry of the Okhotsk plate (OK). whose northwestern portion terminates on the EU-OK-NA triple junction and is thus caught and compressed between converging EU and NA. We suggest that this leads to a coherent and understandable large scale deformation pattern of mostly northwest-southeast trending strike-slip faults which split Northwest OK into several extruding slivers. When the fault geometry is analysed together with space geodetic and focal mechanism data it suggests a central block which is extruding faster bordered east and west by progressively slower extruding blocks until the OK plate boundary faults are encountered. Taking into account elastic loading from both the intra-OK faults and the OK-Pacific (PA) boundary reconciles geodetic motions with geologic slip rates on at least the OK-NA boundary which corresponds to the Ulakhan fault.

OnlineMin

DEFF Research Database (Denmark)

Brodal, Gerth Stølting; Moruz, Gabriel; Negoescu, Andrei

2015-01-01

OnlineMin that has optimal competitiveness and allows fast implementations. In fact, if k pages fit in internal memory the best previous solution required O(k2) time per request and O(k) space. We present two implementations of OnlineMin which use O(k) space, but only O(logk) worst case time and O...

Failure to Diagnose Hyperparathyroidism in 10,432 Patients With Hypercalcemia: Opportunities for System-level Intervention to Increase Surgical Referrals and Cure.

Science.gov (United States)

Balentine, Courtney J; Xie, Rongbing; Kirklin, James K; Chen, Herbert

2017-10-01

To determine whether a significant number of patients with hyperparathyroidism remain undiagnosed and untreated. Failure to diagnose primary hyperparathyroidism and refer patients to surgeons leads to impaired quality of life and increased costs. We hypothesized that many patients with hyperparathyroidism would be untreated due to not considering the diagnosis, inadequate evaluation of hypercalcemia, and under-referral to surgeons. We reviewed administrative data on 682,704 patients from a tertiary referral center between 2011 and 2015, and identified hypercalcemia (>10.5 mg/dL) in 10,432 patients. We evaluated whether hypercalcemic patients underwent measurement of parathyroid hormone (PTH), had documentation of hypercalcemia/hyperparathyroidism, or were referred to surgeons. The mean age of our cohort was 54 years, with 61% females, and 56% whites. Only 3200 (31%) hypercalcemic patients had PTH levels measured, 2914 (28%) had a documented diagnosis of hypercalcemia, and 880 (8%) had a diagnosis of hyperparathyroidism in the medical record. Only 592 (22%) out of 2666 patients with classic hyperparathyroidism (abnormal calcium and PTH) were referred to surgeons. A significant proportion of patients with hyperparathyroidism do not undergo appropriate evaluation and surgical referral. System-level interventions which prompt further evaluation of hypercalcemia and raise physician awareness about hyperparathyroidism could improve outcomes and produce long-term cost savings.

The streptococcal collagen-like protein-1 (Scl1 is a significant determinant for biofilm formation by group a Streptococcus

Directory of Open Access Journals (Sweden)

Oliver-Kozup Heaven A

2011-12-01

Full Text Available Abstract Background Group A Streptococcus (GAS is a human-specific pathogen responsible for a number of diseases characterized by a wide range of clinical manifestations. During host colonization GAS-cell aggregates or microcolonies are observed in tissues. GAS biofilm, which is an in vitro equivalent of tissue microcolony, has only recently been studied and little is known about the specific surface determinants that aid biofilm formation. In this study, we demonstrate that surface-associated streptococcal collagen-like protein-1 (Scl1 plays an important role in GAS biofilm formation. Results Biofilm formation by M1-, M3-, M28-, and M41-type GAS strains, representing an intraspecies breadth, were analyzed spectrophotometrically following crystal violet staining, and characterized using confocal and field emission scanning electron microscopy. The M41-type strain formed the most robust biofilm under static conditions, followed by M28- and M1-type strains, while the M3-type strains analyzed here did not form biofilm under the same experimental conditions. Differences in architecture and cell-surface morphology were observed in biofilms formed by the M1- and M41-wild-type strains, accompanied by varying amounts of deposited extracellular matrix and differences in cell-to-cell junctions within each biofilm. Importantly, all Scl1-negative mutants examined showed significantly decreased ability to form biofilm in vitro. Furthermore, the Scl1 protein expressed on the surface of a heterologous host, Lactococcus lactis, was sufficient to induce biofilm formation by this organism. Conclusions Overall, this work (i identifies variations in biofilm formation capacity among pathogenically different GAS strains, (ii identifies GAS surface properties that may aid in biofilm stability and, (iii establishes that the Scl1 surface protein is an important determinant of GAS biofilm, which is sufficient to enable biofilm formation in the heterologous host

End-preparation assessments and tests for compounded sterile preparations.

Science.gov (United States)

McElhiney, Linda F

2013-01-01

Outsourcing has become a necessity to obtain sterile products that are currently on backorder. Because of the expense of outsourcing sterile compounding, pharmacy leadership in health systems are now considering the option of insourcing and batch preparing compounded sterile preparations, which can be a viable option for a health system. It can significantly decrease drug-spending costs, and the pharmacy has a complete record of the compounding process. The key to preparing high-quality, safe, sterile preparations and meeting United States Pharmacopeia standards is end-preparation assessments and tests.

OnlineMin: A Fast Strongly Competitive Randomized Paging Algorithm

DEFF Research Database (Denmark)

Brodal, Gerth Stølting; Moruz, Gabriel; Negoescu, Andrei

2012-01-01

approach that both has optimal competitiveness and selects victim pages in subquadratic time. In fact, if k pages fit in internal memory the best previous solution required O(k 2) time per request and O(k) space, whereas our approach takes also O(k) space, but only O(logk) time in the worst case per page...

Adhesion of Pseudomonas aeruginosa to orthokeratology and alignment lenses.

Science.gov (United States)

Choo, Jennifer D; Holden, Brien A; Papas, Eric B; Willcox, Mark D P

2009-02-01

To determine whether contact lenses designed for orthokeratology (OK) are colonized by greater numbers of bacteria compared with standard (alignment fitted) design rigid gas permeable lenses before and after lens wear. Eighteen 1-year-old cats were randomly fitted with an OK lens in one eye and an alignment fitted (AF) lens in the other eye. Both lenses were made in the same diameter and central thickness and of the same material. Two separate wearing periods of 2 weeks and 6 weeks were used. After each wearing period, lenses were soaked in Pseudomonas aeruginosa (6294 or 6206) for 10 min. The lenses were then reinserted onto their respective corneas for a wearing period of 16 hours after which lenses were collected and remaining adhered bacteria quantified. Unworn control lenses were also soaked and bacteria enumerated for comparison. There were no significant differences in the number of bacteria adherent to unworn AF and OK lenses. Analysis of lenses after wear showed OK lenses retained significantly higher numbers of viable bacteria than AF lenses in all studies. OK lenses retain more bacteria than AF rigid gas permeable lenses after bacteria-loaded overnight lens wear. This may increase the risk for an infection in OK patients should suitable conditions be present. Specific education on the cleaning of OK lenses is essential.

Solution preparation

International Nuclear Information System (INIS)

Seitz, M.G.

1982-01-01

Reviewed in this statement are methods of preparing solutions to be used in laboratory experiments to examine technical issues related to the safe disposal of nuclear waste from power generation. Each approach currently used to prepare solutions has advantages and any one approach may be preferred over the others in particular situations, depending upon the goals of the experimental program. These advantages are highlighted herein for three approaches to solution preparation that are currently used most in studies of nuclear waste disposal. Discussion of the disadvantages of each approach is presented to help a user select a preparation method for his particular studies. Also presented in this statement are general observations regarding solution preparation. These observations are used as examples of the types of concerns that need to be addressed regarding solution preparation. As shown by these examples, prior to experimentation or chemical analyses, laboratory techniques based on scientific knowledge of solutions can be applied to solutions, often resulting in great improvement in the usefulness of results

Effect of preparation procedure on the formation of nanostructuredceria–zirconia mixed oxide catalysts for ethyl acetate oxidation:Homogeneous precipitation with urea vs template-assistedhydrothermal synthesis

Czech Academy of Sciences Publication Activity Database

Tsoncheva, T.; Ivanova, R.; Henych, Jiří; Dimitrov, M.; Kormunda, M.; Kovacheva, D.; Scotti, N.; Dal Santo, V.; Štengl, Václav

2015-01-01

Roč. 502, JUL (2015), s. 418-432 ISSN 0926-860X Institutional support: RVO:61388980 Keywords : Ceria–zirconia mixed oxides * Template -assisted hydrothermal method * Urea hydrolysis * Ethyl acetate oxidationa Subject RIV: CA - Inorganic Chemistry Impact factor: 4.012, year: 2015

Unveiling the participation of avian kinin ornithokinin and its receptors in the chicken inflammatory response.

Science.gov (United States)

Guabiraba, Rodrigo; Garrido, Damien; Bailleul, Geoffrey; Trotereau, Angélina; Pinaud, Mélanie; Lalmanach, Anne-Christine; Chanteloup, Nathalie K; Schouler, Catherine

2017-06-01

Vasoactive peptides are key early mediators of inflammation released through activation of different enzymatic systems. The mammalian kinin-kallikrein (K-KLK) system produces bradykinin (BK) through proteolytic cleavage of a kininogen precursor by enzymes named kallikreins. BK acts through specific ubiquitous G-protein coupled receptors (B1R and B2R) to participate in physiological processes and inflammatory responses, such as activation of mononuclear phagocytes. In chickens, the BK-like nonapeptide ornithokinin (OK) has been shown to promote intracellular calcium increase in embryonic fibroblasts and to be vasodilatory in vivo. Also, one of its receptors (B2R) was already cloned. However, the participation of chicken K-KLK system components in the inflammatory response remains unknown and was therefore investigated. We first showed that B1R, B2R and kininogen 1 (KNG1) are expressed in unstimulated chicken tissues and macrophages. We next showed that chicken B1R and B2R are expressed at transcript and protein levels in chicken macrophages and are upregulated by E. coli LPS or avian pathogenic E. coli (APEC) infection. Interestingly, exogenous OK induced internalization and degradation of OK receptors protein, notably B2R. Also, OK induced intracellular calcium increase and potentiated zymosan-induced ROS production and Dextran-FITC endocytosis by chicken macrophages. Exogenous OK itself did not promote APEC killing and had no pro-inflammatory effect. However, when combined with LPS or APEC, OK upregulated cytokine/chemokine gene expression and NO production by chicken macrophages. This effect was not blocked by canonical non-peptide B1R or B2R receptor antagonists but was GPCR- and PI3K/Akt-dependent. In vivo, pulmonary colibacillosis led to upregulation of OK receptors expression in chicken lungs and liver. Also, colibacillosis led to significant upregulation of OK precursor KNG1 expression in liver and in cultured hepatocytes (LMH). We therefore provide hitherto

Anti-Bacterial Activity of Phenolic Compounds against Streptococcus pyogenes

DEFF Research Database (Denmark)

Macé, Sabrina; Hansen, Lisbeth Truelstrup; P. Vasantha Rupasinghe, H.

2017-01-01

Background: Worldwide, Streptococcus pyogenes is the leading cause of bacterial pharyngitis. To reduce the use of antibiotics, antimicrobial phytochemical-containing remedies, which have long been in use in traditional medicine, may provide new approaches for management of streptococcal pharyngitis......,2-naphthoquinone and 5-hydroxy-1,4-naphthoquinone inhibit S. pyogenes and should be further investigated as candidates for the management of streptococcal pharyngitis....

Clinical and Immunological Characteristics of Acute Tonsillopharyngitis in Children

Directory of Open Access Journals (Sweden)

O.K. Koloskova

2015-02-01

Full Text Available The article deals with the pressing issues of timely diagnosis of acute tonsillopharyngitis in children. Particular attention is paid to early diagnosis of acute streptococcal tonsillopharyngitis. As additional paraclinical criteria to confirm the streptococcal nature of acute tonsillopharyngitis, there were selected indicators of cellular immunity (content in peripheral blood of CD3, CD4, CD8, CD22. Sufficient indicators of sensitivity (80 % and specificity (81.3 % enable to use integrated clinical and immunological parameters, which include the contents of CD8-lymphocytes > 10 %, CD-3 lymphocytes > 30 %, CD22-lymphocytes < 18 % in the peripheral blood with a total evaluation of the clinical status by McIsaac’s scale ≥ 4 points to confirm the streptococcal nature of acute tonsillopharyngitis in children.

Optimal preparation-to-colonoscopy interval in split-dose PEG bowel preparation determines satisfactory bowel preparation quality: an observational prospective study.

Science.gov (United States)

Seo, Eun Hee; Kim, Tae Oh; Park, Min Jae; Joo, Hee Rin; Heo, Nae Yun; Park, Jongha; Park, Seung Ha; Yang, Sung Yeon; Moon, Young Soo

2012-03-01

Several factors influence bowel preparation quality. Recent studies have indicated that the time interval between bowel preparation and the start of colonoscopy is also important in determining bowel preparation quality. To evaluate the influence of the preparation-to-colonoscopy (PC) interval (the interval of time between the last polyethylene glycol dose ingestion and the start of the colonoscopy) on bowel preparation quality in the split-dose method for colonoscopy. Prospective observational study. University medical center. A total of 366 consecutive outpatients undergoing colonoscopy. Split-dose bowel preparation and colonoscopy. The quality of bowel preparation was assessed by using the Ottawa Bowel Preparation Scale according to the PC interval, and other factors that might influence bowel preparation quality were analyzed. Colonoscopies with a PC interval of 3 to 5 hours had the best bowel preparation quality score in the whole, right, mid, and rectosigmoid colon according to the Ottawa Bowel Preparation Scale. In multivariate analysis, the PC interval (odds ratio [OR] 1.85; 95% CI, 1.18-2.86), the amount of PEG ingested (OR 4.34; 95% CI, 1.08-16.66), and compliance with diet instructions (OR 2.22l 95% CI, 1.33-3.70) were significant contributors to satisfactory bowel preparation. Nonrandomized controlled, single-center trial. The optimal time interval between the last dose of the agent and the start of colonoscopy is one of the important factors to determine satisfactory bowel preparation quality in split-dose polyethylene glycol bowel preparation. Copyright © 2012 American Society for Gastrointestinal Endoscopy. Published by Mosby, Inc. All rights reserved.

Factors related to axial length elongation and myopia progression in orthokeratology practice.

Directory of Open Access Journals (Sweden)

Bingjie Wang

Full Text Available To investigate which baseline factors are predictive for axial length growth over an average period of 2.5 years in a group of children wearing orthokeratology (OK contact lenses.In this retrospective study, the clinical records of 249 new OK wearers between January 2012 and December 2013 from the contact lens clinic at the Eye and ENT Hospital of Fudan University were reviewed. The primary outcome measure was axial length change from baseline to the time of review (July-August 2015. Independent variables included baseline measures of age at initiation of OK wear, gender, refractive error (spherical equivalent, astigmatism, average keratometry, corneal toricity, central corneal thickness, white-to-white corneal diameter, pupil size, corneal topography eccentricity value (e-value, intraocular pressure (IOP and total time in follow-up (months total. The contributions of all independent variables on axial length change at the time of review were assessed using univariate and multivariable regression analyses.Univariate analyses of the right eyes of 249 OK patients showed that smaller increases in axial length were associated with older age at the onset of OK lens wear, greater baseline spherical equivalent myopic refractive error, less time in follow-up and a smaller e-value. Multivariable analyses of the significant right eye variables showed that the factors associated with smaller axial length growth were older age at the onset of OK lens wear (p<0.0001, greater baseline spherical equivalent myopic refractive error (p = 0.0046 and less time in follow-up (p<0.0001.The baseline factors demonstrating the greatest correlation with reduced axial length elongation during OK lens wear in myopic children included greater baseline spherical equivalent myopic refractive error and older age at the onset of OK lens wear.

A Structural Molar Volume Model for Oxide Melts Part I: Li2O-Na2O-K2O-MgO-CaO-MnO-PbO-Al2O3-SiO2 Melts—Binary Systems

Science.gov (United States)

Thibodeau, Eric; Gheribi, Aimen E.; Jung, In-Ho

2016-04-01

A structural molar volume model was developed to accurately reproduce the molar volume of molten oxides. As the non-linearity of molar volume is related to the change in structure of molten oxides, the silicate tetrahedral Q-species, calculated from the modified quasichemical model with an optimized thermodynamic database, were used as basic structural units in the present model. Experimental molar volume data for unary and binary melts in the Li2O-Na2O-K2O-MgO-CaO-MnO-PbO-Al2O3-SiO2 system were critically evaluated. The molar volumes of unary oxide components and binary Q-species, which are model parameters of the present structural model, were determined to accurately reproduce the experimental data across the entire binary composition in a wide range of temperatures. The non-linear behavior of molar volume and thermal expansivity of binary melt depending on SiO2 content are well reproduced by the present model.

Treatment of streptococcal pharyngitis with once-daily compared with twice-daily amoxicillin: a noninferiority trial.

Science.gov (United States)

Clegg, Herbert W; Ryan, Amy G; Dallas, Steven D; Kaplan, Edward L; Johnson, Dwight R; Norton, H James; Roddey, Oliver F; Martin, Edward S; Swetenburg, Raymond L; Koonce, Elizabeth W; Felkner, Mary M; Giftos, P Michael

2006-09-01

Two relatively small previous studies comparing once-daily amoxicillin with conventional therapy for group A streptococcal (GAS) pharyngitis reported similar rates of bacteriologic success for each treatment group. The purpose of this study was to further evaluate once-daily amoxicillin for GAS pharyngitis in a larger study. In a single pediatric practice, from October through May for 2 consecutive years (2001-2003), we recruited children 3 to 18 years of age who had symptoms and signs suggestive of GAS pharyngitis. Patients with a positive rapid test for GAS were stratified by weight (or=40 kg) and then randomly assigned to receive once-daily (750 mg or 1000 mg) or twice-daily (2 doses of 375 mg or 500 mg) amoxicillin for 10 days. We determined bacteriologic failure rates for GAS in the pharynx from subsequent swabs taken at 14 to 21 (visit 2) and 28 to 35 (visit 3) days after treatment initiation. We conducted a randomized, controlled, investigator-blinded, noninferiority trial to evaluate whether amoxicillin given once daily would have a bacteriologic failure rate no worse than that of amoxicillin given twice daily within a prespecified margin of 10%. GAS isolates were characterized to distinguish bacteriologic failures from new acquisitions. Adverse events were described and adherence was evaluated by review of returned daily logs and dosage bottles. Of 2139 potential study patients during the 2-year period, we enrolled 652 patients, 326 into each treatment group. Children in the 2 groups were comparable with respect to all demographic and clinical characteristics except that children <40 kg more often presented with rash in each treatment group. At visit 2, failure rates were 20.1% (59 of 294) for the once-daily group and 15.5% (46 of 296) for the twice-daily group (difference, 4.53%; 90% confidence interval [CI], -0.6 to 9.7). At visit 3, failure rates were 2.8% (6 of 216) for the once-daily group and 7.1% (16 of 225) for the twice-daily group (difference, -4

First report of real-time monitoring of coagulation function potential and IgG subtype of anti-FVIII autoantibodies in a child with acquired hemophilia A associated with streptococcal infection and amoxicillin.

Science.gov (United States)

Takeyama, Masahiro; Nogami, Keiji; Kajimoto, Takahiro; Ogiwara, Kenichi; Matsumoto, Tomoko; Shima, Midori

2018-01-01

We describe an 8-year-old boy with acquired hemophilia A (AHA) associated with streptococcal infection and amoxicillin. Laboratory data revealed low factor VIII activity (FVIII:C, 1.5 IU/dl), and FVIII inhibitor (15.9 BU/ml). Comprehensive coagulation function assays, including rotation thromboelastometry (ROTEM ® ), revealed a markedly prolonged clotting time. Thrombin and plasmin generation (TG/PG) appeared to be moderately impaired. The inhibitor epitope of his anti-FVIII autoantibody recognized light and heavy chains. He was treated with Novoseven ® and prednisolone, resulting in rapid improvement. ROTEM showed the return of coagulation time to normal level on day 20, and TG gradually improved. PG was moderately reduced in the clinical early phase, but improved at day 20. The patient's IgG subtype was IgG 4 at onset. IgG 1 was transiently positive on day 20, but negative on day 46. FVIII inhibitor gradually decreased and was completely absent after day 46, along with the elevated FVIII:C. IgG4 was again elevated on day 83, followed by a rapid decrease, indicative of the presence of non-neutralizing antibody, which remains currently undetected. We for the first time report changes in comprehensive coagulation function and IgG subtype of anti-FVIII antibody in a rare pediatric case of AHA.

Hydroconversion of methyl laurate on bifunctional Ni2P/AlMCM-41 catalyst prepared via in situ phosphorization using triphenylphosphine

Science.gov (United States)

Zhao, Sha; Zhang, Zhena; Zhu, Kongying; Chen, Jixiang

2017-05-01

A series of Ni2P/AlMCM-41-x bifunctional catalysts with different Si/Al ratios (x) were synthesized by in situ phosphorization of Ni/AlMCM-41-x with triphenylphosphine (nominal Ni/P ratio of 0.75) at 300 °C on a fixed-bed reactor. For comparison, NiP/AlMCM-41-5-TPR was also prepared by the TPR method from the supported nickel phosphate with the Ni/P ratio of 1.0, during which metallic Ni rather than Ni2P formed. TEM images show that Ni and Ni2P particles uniformly distributed in Ni2P/AlMCM-41-x and NiP/AlMCM-41-5-TPR. The Ni2P/AlMCM-41-x acidity increased with decreasing the Si/Al ratio. In the hydroconversion of methyl laurate, the conversions were close to 100% on all catalysts at 360 °C, 3.0 MPa, methyl laurate WHSV of 2 h-1 and H2/methyl laurate ratio of 25. As to Ni2P/AlMCM-41-x, with decreasing the Si/Al ratio, the total selectivity to C11 and C12 hydrocarbons decreased, while the total selectivity to isoundecane and isododecane (Si-C11+i-C12) firstly increased and then decreased. Ni2P/AlMCM-41-5 gave the largest Si-C11+i-C12 of 43.2%. While NiP/AlMCM-41-5-TPR gave higher Si-C11+i-C12 than Ni2P/AlMCM-41-5, it was more active for the undesired Csbnd C bond cleavage and methanation. We propose that the in-situ phosphorization adopted here is a promising approach to preparing Ni2P-based bifunctional catalysts.

New Combined Medical Treatment With Etilefrine and Octreotide for Chylothorax After Esophagectomy

Science.gov (United States)

Ohkura, Yu; Ueno, Masaki; Iizuka, Toshiro; Haruta, Shusuke; Tanaka, Tsuyoshi; Udagawa, Harushi

2015-01-01

Abstract Postoperative chylothorax is a rare but well-known complication of general thoracic surgery. Medical treatment of chylothorax was reported in the past, but there is still considerable controversy on the appropriate management strategies. Two patients with esophageal cancer underwent esophagectomy, 2-field lymph node dissection, and resection of thoracic duct together with ileocolic reconstruction via the retrosternal route at our hospital. Chylothorax developed on the 32nd postoperative day (POD) in 1 patient and the 12th POD in the other, manifesting as a change in the character of thoracic drainage to turbid white. Both were immediately started on octreotide (300 μg/ day) and etilefrine (120 mg/day). When the amount of pleural effusion decreased to Picibanil (OK432). Thereafter, the patients gradually made satisfactory progress and resumed oral food intake, and the thoracotomy tubes were eventually removed. They have remained recurrence-free at the time of writing. In this report, we demonstrated the clinical efficacy of etilefrine for the management of postesophagectomy chylothorax. New medical treatment options for this condition are now broad and the usefulness of combined therapy consisting of a sclerosing agent, etilefrine, and octreotide is underscored, regardless of the status of the thoracic duct. PMID:26656358

New Combined Medical Treatment With Etilefrine and Octreotide for Chylothorax After Esophagectomy: A Case Report and Review of the Literature.

Science.gov (United States)

Ohkura, Yu; Ueno, Masaki; Iizuka, Toshiro; Haruta, Shusuke; Tanaka, Tsuyoshi; Udagawa, Harushi

2015-12-01

Postoperative chylothorax is a rare but well-known complication of general thoracic surgery. Medical treatment of chylothorax was reported in the past, but there is still considerable controversy on the appropriate management strategies.Two patients with esophageal cancer underwent esophagectomy, 2-field lymph node dissection, and resection of thoracic duct together with ileocolic reconstruction via the retrosternal route at our hospital. Chylothorax developed on the 32nd postoperative day (POD) in 1 patient and the 12th POD in the other, manifesting as a change in the character of thoracic drainage to turbid white. Both were immediately started on octreotide (300 μg/ day) and etilefrine (120 mg/day). When the amount of pleural effusion decreased to Picibanil (OK432). Thereafter, the patients gradually made satisfactory progress and resumed oral food intake, and the thoracotomy tubes were eventually removed. They have remained recurrence-free at the time of writing.In this report, we demonstrated the clinical efficacy of etilefrine for the management of postesophagectomy chylothorax. New medical treatment options for this condition are now broad and the usefulness of combined therapy consisting of a sclerosing agent, etilefrine, and octreotide is underscored, regardless of the status of the thoracic duct.

A difficult case of esophageal and gastric double cancer with pleural and pericardial effusion following chemo-radiotherapy (CRT)

International Nuclear Information System (INIS)

Aoki, Taro; Kobayashi, Kenji; Tanida, Tsukasa; Hatano, Hisanori; Komori, Takamichi; Matsumoto, Takashi; Nishioka, Kiyonori; Uemura, Yoshio

2007-01-01

A 70-year-old man was presented with esophageal and gastric cancer pointed by his personal doctor in November 2002. Both of the esophageal and gastric cancer were diagnosed as multiples with cStage II and cStage IA, respectively. In consideration of the patient's quality of life (QOL), chemo-radiotherapy (CRT) for esophageal cancer was preceded, and then total gastrectomy was done. Although esophageal cancer was responded as being complete response (CR), 14 courses of FP therapy were added as supportive chemotherapy. Ten months following CRT, pericardial effusion was noticed, so that pericardiocentesis was performed. Also diuretic has been administered up to the present. Nineteen months following CRT, pleural effusion was noticed and thoracentesis was performed several times into both of the pleural cavities, and that was depending on the degree with OK-432 infusion. Consequently, the patient has been controlled well. As a treatment for esophageal and gastric double cancer, we chose CRT rather than esophagectomy because of the excessive invasiveness. Despite of CR, we have had a difficulty with pleural and pericardial effusions due to the late toxicity of radiotherapy. We need to pay attention to the late toxicity in the case of long-term survival following CRT. (author)

Heritable genome editing with CRISPR/Cas9 in the silkworm, Bombyx mori.

Directory of Open Access Journals (Sweden)

Wei Wei

Full Text Available We report the establishment of an efficient and heritable gene mutagenesis method in the silkworm Bombyx mori using modified type II clustered regularly interspaced short palindromic repeats (CRISPR with an associated protein (Cas9 system. Using four loci Bm-ok, BmKMO, BmTH, and Bmtan as candidates, we proved that genome alterations at specific sites could be induced by direct microinjection of specific guide RNA and Cas9-mRNA into silkworm embryos. Mutation frequencies of 16.7-35.0% were observed in the injected generation, and DNA fragments deletions were also noted. Bm-ok mosaic mutants were used to test for mutant heritability due to the easily determined translucent epidermal phenotype of Bm-ok-disrupted cells. Two crossing strategies were used. In the first, injected Bm-ok moths were crossed with wild-type moths, and a 28.6% frequency of germline mutation transmission was observed. In the second strategy, two Bm-ok mosaic mutant moths were crossed with each other, and 93.6% of the offsprings appeared mutations in both alleles of Bm-ok gene (compound heterozygous. In summary, the CRISPR/Cas9 system can act as a highly specific and heritable gene-editing tool in Bombyx mori.

Cross-cultural adaptation and validation of the persian version of the oxford knee score in patients with knee osteoarthritis.

Science.gov (United States)

Ebrahimzadeh, Mohammad Hosein; Makhmalbaf, Hadi; Birjandinejad, Ali; Soltani-Moghaddas, Seyed Hosein

2014-11-01

The Oxford Knee Score (OKS) is a short patient-reported outcome instrument that measures pain and physical activity related to knee osteoarthritis. The purpose of this study is to evaluate, construct validity and consistent reliability of the Persian version of the OKS. The case series consisted of 80 patients who were clinically diagnosed with having knee osteoarthritis. All patients were requested to fill-in the Persian OKS and Short-Form 36 Health Survey (SF-36). Correlation analysis between the Persian versions of these two instruments was then carried out. The scores of the Persian SF-36 were used to evaluate convergent and divergent validity of the 12-item Persian OKS. From a total of 80 patients, 63 were female (79%) and the remaining 17 were male (21%) with a mean age of 52.2 years. In the present study, high Cronbach's alpha of 0.95 confirms excellent internal consistency of the Persian OKS scale similar to previous investigations. The results confirm that the Persian version of this instrument is valid and reliable, similar to its English index and its subsequent translations in different languages. The Persian OKS is a reliable instrument to evaluate knee function in patients with knee osteoarthritis and is a useful tool for outcome measurement in clinical research.

Streptococcus pyogenes as the cause of vulvovaginitis and balanitis in children.

Science.gov (United States)

Randjelovic, Gordana; Otasevic, Suzana; Mladenovic-Antic, Snezana; Mladenovic, Vesna; Radovanovic-Velickovic, Radmila; Randjelovic, Marina; Bogdanovic, Dragan

2017-04-01

Streptococcus pyogenes (group A Streptococcus) is the etiological agent of perineal infection in children, consisting of perianal infection, vulvovaginitis and balanitis. If it is not properly diagnosed and treated, it can persist for many months and can cause severe complications. Furthermore, treatment with penicillin can be followed by failures and recurrences. We report here the prevalence of S. pyogenes isolates in genital tract specimens from girls (n = 1692) with symptoms of vulvovaginitis and from boys (n = 52) with balanitis in the municipality of Nis, Southeast-Serbia (the Western Balkans) in a 10 year period, and the seasonal distribution, patient age and sensitivity to bacitracin and antimicrobial drugs used in the treatment of streptococcal infection. Streptococcal vulvovaginitis was diagnosed in 2.30% of examinees. Of those cases, 64.10% were detected from April to September, and it was most common (71.79%) in girls aged 3-7 years. Streptococcal balanitis was diagnosed in two instances: in a 4-year-old boy and in a 7-year-old boy. S. pyogenes strains resistant to bacitracin were identified in five girls. Two isolates with M phenotype and five isolates with cMLS B phenotype were identified. Streptococcal vulvovaginitis was diagnosed less often in the present study, but it was still far more common than streptococcal balanitis in childhood. Bacitracin resistance of S. pyogenes strains should be taken into account in routine microbiological identification, and the detection of S. pyogenes isolates resistant to erythromycin requires surveillance in the present geographical territory. © 2016 Japan Pediatric Society.

Relative costs of anesthesiologist prepared, hospital pharmacy prepared and outsourced anesthesia drugs.

Science.gov (United States)

Jelacic, Srdjan; Craddick, Karen; Nair, Bala G; Bounthavong, Mark; Yeung, Kai; Kusulos, Dolly; Knutson, Jennifer A; Somani, Shabir; Bowdle, Andrew

2017-02-01

Anesthesia drugs can be prepared by anesthesia providers, hospital pharmacies or outsourcing facilities. The decision whether to outsource all or some anesthesia drugs is challenging since the costs associated with different anesthesia drug preparation methods remain poorly described. The costs associated with preparation of 8 commonly used anesthesia drugs were analyzed using a budget impact analysis for 4 different syringe preparation strategies: (1) all drugs prepared by anesthesiologist, (2) drugs prepared by anesthesiologist and hospital pharmacy, (3) drugs prepared by anesthesiologist and outsourcing facility, and (4) all drugs prepared by outsourcing facility. A strategy combining anesthesiologist and hospital pharmacy prepared drugs was associated with the lowest estimated annual cost in the base-case budget impact analysis with an annual cost of $225 592, which was lower than other strategies by a margin of greater than $86 000. A combination of anesthesiologist and hospital pharmacy prepared drugs resulted in the lowest annual cost in the budget impact analysis. However, the cost of drugs prepared by an outsourcing facility maybe lower if the capital investment needed for the establishment and maintenance of the US Pharmacopeial Convention Chapter compliant facility is included in the budget impact analysis. Copyright © 2016 Elsevier Inc. All rights reserved.

Optokinetic Stimulation Modulates Neglect for the Number Space: Evidence from Mental Number Interval Bisection

Science.gov (United States)

Priftis, Konstantinos; Pitteri, Marco; Meneghello, Francesca; Umiltà, Carlo; Zorzi, Marco

2012-01-01

Behavioral, neuropsychological, and neuroimaging data support the idea that numbers are represented along a mental number line (MNL), an analogical, visuospatial representation of number magnitude. The MNL is left-to-right oriented in Western cultures, with small numbers on the left and larger numbers on the right. Left neglect patients are impaired in the mental bisection of numerical intervals, with a bias toward larger numbers that are relatively to the right on the MNL. In the present study we investigated the effects of optokinetic stimulation (OKS) – a technique inducing visuospatial attention shifts by means of activation of the optokinetic nystagmus – on number interval bisection. One patient with left neglect following right-hemisphere stroke (BG) and four control patients with right-hemisphere damage, but without neglect, performed the number interval bisection task in three conditions of OKS: static, leftward, and rightward. In the static condition, BG misbisected to the right of the true midpoint. BG misbisected to the left following leftward OKS, and again to the right of the midpoint following rightward OKS. Moreover, the variability of BG’s performance was smaller following both leftward and rightward OKS, suggesting that the attentional bias induced by OKS reduced the “indifference zone” that is thought to underlie the length effect reported in bisection tasks. We argue that shifts of visuospatial attention, induced by OKS, may affect number interval bisection, thereby revealing an interaction between the processing of the perceptual space and the processing of the number space. PMID:22363280

Preparing for Surgery

Science.gov (United States)

... Events Advocacy For Patients About ACOG Preparing for Surgery Home For Patients Search FAQs Preparing for Surgery ... Surgery FAQ080, August 2011 PDF Format Preparing for Surgery Gynecologic Problems What is the difference between outpatient ...

Should Israel screen all mothers-to-be to prevent early-onset of neonatal group B streptococcal disease? A cost-utility analysis

Directory of Open Access Journals (Sweden)

Ginsberg Gary M

2013-02-01

Full Text Available Abstract Background In Israel, an average of 37 children are born each year with sepsis and another four with meningitis as a result of Group B Streptococcal (GBS disease. Israel currently only screens mothers with defined risk factors (around 15% of all pregnancies in order to identify candidates for Intrapartum Antiobiotic Prophyhlaxis (IAP of GBS. This paper presents a cost-utility analysis of implementing an alternative strategy, which would expand the current protocol to one aiming to screen all pregnant women at 35–37 weeks gestation based on taking a vaginal culture for GBS. Methods A spreadsheet model was built incorporating technical, epidemiological, health service costs, demographic and economic data based primarily on Israeli sources. Results The intervention of universal screening (compared with the current scenario would increase screening costs from 580,000 NIS to 3,278,000 million NIS. In addition, the intervention would also increase penicillin costs from 39,000 NIS to 221,000 NIS. Current culture screening of approximately 15% of mothers-to-be with high risk factors resulted in 42 GBS births in 2008-9 (0.253/1000 births. Expanding culture screening to 85% of mothers-to-be, will decrease the number of GBS births to 17.3 (0.104/1000 births. The initial 2.9 million NIS incremental intervention costs are offset by decreased treatment costs of 1.9 million NIS and work productivity gains of 811,000 NIS as a result of a decrease in neurological sequelae from GBS caused meningitis. Thus the resultant net cost of the intervention is only around 134,000 NIS. Culture based screening will reduce the burden of disease by 12.6 discounted Quality Adjusted Life Years (QALYS, giving a very cost effective baseline incremental cost per QALY (cf. risk factor screening of 10,641 NIS per QALY. The data was very sensitive to rates of anaphylactic shock and changes in the percentage of meningitis cases that had associated long term

Should Israel screen all mothers-to-be to prevent early-onset of neonatal group B streptococcal disease? A cost-utility analysis.

Science.gov (United States)

Ginsberg, Gary M; Eidelman, Arthur I; Shinwell, Eric; Anis, Emilia; Peyser, Reuven; Lotan, Yoram

2013-02-20

In Israel, an average of 37 children are born each year with sepsis and another four with meningitis as a result of Group B Streptococcal (GBS) disease. Israel currently only screens mothers with defined risk factors (around 15% of all pregnancies) in order to identify candidates for Intrapartum Antiobiotic Prophyhlaxis (IAP) of GBS. This paper presents a cost-utility analysis of implementing an alternative strategy, which would expand the current protocol to one aiming to screen all pregnant women at 35-37 weeks gestation based on taking a vaginal culture for GBS. A spreadsheet model was built incorporating technical, epidemiological, health service costs, demographic and economic data based primarily on Israeli sources. The intervention of universal screening (compared with the current scenario) would increase screening costs from 580,000 NIS to 3,278,000 million NIS. In addition, the intervention would also increase penicillin costs from 39,000 NIS to 221,000 NIS. Current culture screening of approximately 15% of mothers-to-be with high risk factors resulted in 42 GBS births in 2008-9 (0.253/1000 births). Expanding culture screening to 85% of mothers-to-be, will decrease the number of GBS births to 17.3 (0.104/1000 births). The initial 2.9 million NIS incremental intervention costs are offset by decreased treatment costs of 1.9 million NIS and work productivity gains of 811,000 NIS as a result of a decrease in neurological sequelae from GBS caused meningitis. Thus the resultant net cost of the intervention is only around 134,000 NIS. Culture based screening will reduce the burden of disease by 12.6 discounted Quality Adjusted Life Years (QALYS), giving a very cost effective baseline incremental cost per QALY (cf. risk factor screening) of 10,641 NIS per QALY. The data was very sensitive to rates of anaphylactic shock and changes in the percentage of meningitis cases that had associated long term-sequelae. It is recommended that Israel adopt universal culture

Streptococcal vulvovaginitis.

Science.gov (United States)

Heymann, Warren R

2009-07-01

Dialogues in Dermatology, a monthly audio program from the American Academy of Dermatology, contains discussions between dermatologists on timely topics. Commentaries from Dialogues Editor-in-Chief Warren R. Heymann, MD, are provided after each discussion as a topic summary and are provided hear as a special service to readers of the Journal of the American Academy of Dermatology.

Reduced Bearing Excursion After Mobile-Bearing Unicompartmental Knee Arthroplasty is Associated With Poor Functional Outcomes.

Science.gov (United States)

Wahal, Naman; Gaba, Sahil; Malhotra, Rajesh; Kumar, Vijay; Pegg, Elise C; Pandit, Hemant

2018-02-01

A small proportion of patients with mobile unicompartmental knee arthroplasty (UKA) report poor functional outcomes in spite of optimal component alignment on postoperative radiographs. The purpose of this study is to assess whether there is a correlation between functional outcome and knee kinematics. From a cohort of consecutive cases of 150 Oxford medial UKA, patients with fair/poor functional outcome at 1-year postsurgery (Oxford Knee Score [OKS] bearing position with knee flexion angle. Mean OKS in the fair/poor group was 29.9 and the mean OKS in the good/excellent group was 41.1. The tibial slope, time taken to complete the exercises, and patellar tendon angle trend over the flexion range were similar in both the groups; however, bearing position and the extent of bearing excursion differed significantly. The total bearing excursion in the OKS bearing was positioned 1.7 mm more posterior on the tibia in the OKS bearing excursion and positioning, are associated with worse functional outcomes after mobile UKA. Copyright © 2017 Elsevier Inc. All rights reserved.

Cross-Cultural Adaptation and Validation of the Persian Version of the Oxford Knee Score in Patients with Knee Osteoarthritis

Directory of Open Access Journals (Sweden)

Mohammad Hosein Ebrahimzadeh

2014-11-01

Full Text Available Background: The Oxford Knee Score (OKS is a short patient-reported outcome instrument that measures pain and physical activity related to knee osteoarthritis. The purpose of this study is to evaluate, construct validity and consistent reliability of the Persian version of the OKS. Methods: The case series consisted of 80 patients who were clinically diagnosed with having knee osteoarthritis. All patients were requested to fill-in the Persian OKS and Short-Form 36 Health Survey (SF-36. Correlation analysis between the Persian versions of these two instruments was then carried out. The scores of the Persian SF-36 were used to evaluate convergent and divergent validity of the 12-item Persian OKS. Results: From a total of 80 patients, 63 were female (79% and the remaining 17 were male (21% with a mean age of 52.2 years. In the present study, high Cronbach’s alpha of 0.95 confirms excellent internal consistency of the Persian OKS scale similar to previous investigations. The results confirm that the Persian version of this instrument is valid and reliable, similar to its English index and its subsequent translations in different languages. Conclusion: The Persian OKS is a reliable instrument to evaluate knee function in patients with knee osteoarthritis and is a useful tool for outcome measurement in clinical research.

[Deficient identification of signs and symptoms in Streptoccoci amigdalitis].

Science.gov (United States)

Carranza-Martínez, Martha Imelda; Valdés-Croda, Oscar; Jaspersen-Gastelum, Víctor; Chavolla-Magaña, Rogelio; Villaseñor-Sierra, Alberto

2006-01-01

To evaluate the degree of identification of main signs and symptoms of streptococcal pharyngitis by resident doctors, general practitioners, family physicians and pediatricians. A prospective, cross-sectional and comparative study was done. A validated questionnaire was applied including the following topics: social demographic, main signs and symptoms, clinical cases; and clinical pictures. We interviewed resident doctors (n = 40), general physicians (n = 21), family physicians (n = 35) and pediatricians (n = 19) from different institutions (SSa, ISSSTE, IMSS) in Guadalajara, Mexico, from March to August 2005. Scores were interpreted as very good, good, regular and poor, and these scores were related with the specialty and clinical years of experience. chi2, student t test and linear regression. This study included 115 physicians between 22 to 60 years old (mean = 39) and with 0 to 31 (mean = 10) clinical years of experience. Regarding the conceptual identification of main signs and symptoms, tonsil exudates were recognized by 33 to 61% of physicians, and a clinical case of streptococcal tonsillitis was recognized by 50 to 70%. A clinical picture of tonsil caseum was misinterpreted as streptococcal tonsillitis by 13 to 35% of the physicians. There was no association between years of clinical experience and the scores obtained in clinical cases (r = 0.20) or clinical pictures (r = 0.09). The clinical identification of streptococcal tonsillitis was regular to poor among all the interviewed physicians, and there had no correlation with the years of clinical experience. The reinforcement in teaching to recognize the key signs and symptoms of streptococcal tonsillitis at medical school would result in better recognition, more rational use of antimicrobials and reduction in health institutions costs.

Validation of a prediction model that allows direct comparison of the Oxford Knee Score and American Knee Society clinical rating system.

Science.gov (United States)

Maempel, J F; Clement, N D; Brenkel, I J; Walmsley, P J

2015-04-01

This study demonstrates a significant correlation between the American Knee Society (AKS) Clinical Rating System and the Oxford Knee Score (OKS) and provides a validated prediction tool to estimate score conversion. A total of 1022 patients were prospectively clinically assessed five years after TKR and completed AKS assessments and an OKS questionnaire. Multivariate regression analysis demonstrated significant correlations between OKS and the AKS knee and function scores but a stronger correlation (r = 0.68, p Society of Bone & Joint Surgery.

Determination of electron temperature and electron density in ...

African Journals Online (AJOL)

It is seen that the electron temperature increases from 5.8 × 102 oK to 7.83 × 104 oK as the pd is reduced from 130mm Hg × mm to 60 mm Hg × mm for argon. The electron densities increases from 2.8 × 1011/cm3 to 3.2 × 1011 /cm3 for the same variation of pds. For air the electron temperature increases from 3.6 × 104 oK to ...

Using science to strengthen our Nation's resilience to tomorrow's challenges: understanding and preparing for coastal impacts

Science.gov (United States)

Simmons, Dale L.; Andersen, Matthew E.; Dean, Teresa A.; Focazio, Michael J.; Fulton, John W.; Haines, John W.; Mason, Jr., Robert R.; Tihansky, Ann B.; Young, John A.

2014-01-01

Hurricane Sandy caused unprecedented damage across some of the most densely populated coastal areas of the northeastern United States. The costly, landscape-altering destruction left in the wake of this storm is a stark reminder of our Nation’s need to become more resilient as we inevitably face future coastal hazards. As our Nation recovers from this devastating natural disaster, it is clear that accurate scientific information is essential as we seek to identify and develop strategies to address trends in coastal landscape change and reduce our future vulnerability to major storm events. To address this need, the U.S. Geological Survey (USGS) received $43.2 million in supplemental appropriations from the Department of the Interior (DOI) to conduct the scientific research needed to guide response, recovery, and rebuilding activities and to develop effective strategies for protecting coastal communities and resources in the future. This fact sheet describes how the USGS is combining interdisciplinary science with state-of-the-art technologies to achieve a comprehensive understanding of coastal change caused by Hurricane Sandy. By assessing coastal change impacts through research and by developing tools that enhance our science capabilities, support coastal stakeholders, and facilitate effective decision making, we continue to build a greater understanding of the processes at work across our Nation’s complex coastal environment—from wetlands, estuaries, barrier islands, and nearshore marine areas to infrastructure and human communities. This improved understanding will increase our resilience as we prepare for future short-term, extreme events as well as long-term coastal change.

Streptococcal upper respiratory tract infections and psychosocial stress predict future tic and obsessive-compulsive symptom severity in children and adolescents with Tourette syndrome and obsessive-compulsive disorder.

Science.gov (United States)

Lin, Haiqun; Williams, Kyle A; Katsovich, Liliya; Findley, Diane B; Grantz, Heidi; Lombroso, Paul J; King, Robert A; Bessen, Debra E; Johnson, Dwight; Kaplan, Edward L; Landeros-Weisenberger, Angeli; Zhang, Heping; Leckman, James F

2010-04-01

One goal of this prospective longitudinal study was to identify new group A beta-hemolytic streptococcal infections (GABHS) in children and adolescents with Tourette syndrome (TS) and/or obsessive-compulsive disorder (OCD) compared with healthy control subjects. We then examined the power of GABHS infections and measures of psychosocial stress to predict future tic, obsessive-compulsive (OC), and depressive symptom severity. Consecutive ratings of tic, OC, and depressive symptom severity were obtained for 45 cases and 41 matched control subjects over a 2-year period. Clinical raters were blinded to the results of laboratory tests. Laboratory personnel were blinded to case or control status and clinical ratings. Structural equation modeling for unbalanced repeated measures was used to assess the sequence of new GABHS infections and psychosocial stress and their impact on future symptom severity. Increases in tic and OC symptom severity did not occur after every new GABHS infection. However, the structural equation model found that these newly diagnosed infections were predictive of modest increases in future tic and OC symptom severity but did not predict future depressive symptom severity. In addition, the inclusion of new infections in the model greatly enhanced, by a factor of three, the power of psychosocial stress in predicting future tic and OC symptom severity. Our data suggest that a minority of children with TS and early-onset OCD were sensitive to antecedent GABHS infections. These infections also enhanced the predictive power of current psychosocial stress on future tic and OC symptom severity. Copyright 2010 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Fatigue in Persian Gulf Syndrome - Physiologic Mechanisms

National Research Council Canada - National Science Library

Haller, Ronald

2000-01-01

...)Veterans matched for age, height and weight. Serum OK, incidence of elevated OK, and muscle histology and fatigue rate and level of oxygen uptake relative to 02 delivery during forearm exercise were similar in both groups...

Immortalisation with hTERT Impacts on Sulphated Glycosaminoglycan Secretion and Immunophenotype in a Variable and Cell Specific Manner.

Directory of Open Access Journals (Sweden)

Tina P Dale

Full Text Available Limited options for the treatment of cartilage damage have driven the development of tissue engineered or cell therapy alternatives reliant on ex vivo cell expansion. The study of chondrogenesis in primary cells is difficult due to progressive cellular aging and senescence. Immortalisation via the reintroduction of the catalytic component of telomerase, hTERT, could allow repeated, longitudinal studies to be performed while bypassing senescent phenotypes.Three human cell types: bone marrow-derived stromal cells (BMA13, embryonic stem cell-derived (1C6 and chondrocytes (OK3 were transduced with hTERT (BMA13H, 1C6H and OK3H and proliferation, surface marker expression and tri-lineage differentiation capacity determined. The sulphated glycosaminoglycan (sGAG content of the monolayer and spent media was quantified in maintenance media (MM and pro-chondrogenic media (PChM and normalised to DNA.hTERT expression was confirmed in transduced cells with proliferation enhancement in 1C6H and OK3H cells but not BMA13H. All cells were negative for leukocyte markers (CD19, CD34, CD45 and CD73 positive. CD14 was expressed at low levels on OK3 and OK3H and HLA-DR on BMA13 (84.8%. CD90 was high for BMA13 (84.9% and OK3 (97.3% and moderate for 1C6 (56.7%, expression was reduced in BMA13H (33.7% and 1C6H (1.6%. CD105 levels varied (BMA13 87.7%, 1C6 8.2%, OK3 43.3% and underwent reduction in OK3H (25.1%. 1C6 and BMA13 demonstrated osteogenic and adipogenic differentiation but mineralised matrix and lipid accumulation appeared reduced post hTERT transduction. Chondrogenic differentiation resulted in increased monolayer-associated sGAG in all primary cells and 1C6H (p<0.001, and BMA13H (p<0.05. In contrast OK3H demonstrated reduced monolayer-associated sGAG in PChM (p<0.001. Media-associated sGAG accounted for ≥55% (PChM-1C6 and ≥74% (MM-1C6H.In conclusion, hTERT transduction could, but did not always, prevent senescence and cell phenotype, including

Cross-cultural adaptation and psychometric analysis of the Arabic version of the oxford knee score in adult male with knee osteoarthritis.

Science.gov (United States)

Alghadir, Ahmad H; Al-Eisa, Einas S; Anwer, Shahnawaz

2017-05-15

There are varieties of self-assessment questionnaire used for the evaluation of pain, functional disability, and health related quality of life in individuals with knee osteoarthritis (OA). The present study intended to adapt and translate the oxford knee score into the Arabic and investigated its psychometric properties in adult male with knee OA. Ninety-seven adult male (mean age 57.55 ± 11.49 years) with knee OA participated. Patients were requested to complete the adapted Arabic version of the Oxford knee score (OKS-Ar), reduced "Western Ontario and McMaster Universities Index (WOMAC)", and the Visual analogue scale (VAS). Patients were requested to complete 2 nd form of OKS-Ar at least 1 week apart to assess the reproducibility of the score. The OKS was adapted and translated into Arabic by two independent Arabic native speakers (one rehabilitation professional having experience of knee OA patients and another one a trained translator) according to the international guidelines. All the participants completed the 2 nd form of OKS-Ar (Response rate 100%). Reliability and internal consistency was high with an ICC of 0.97, and the Cronbach's alpha coefficient of 0.987, respectively. A significant relationship between the OKS-Ar and the WOMAC and VAS scores confirmed the construct validity (p < 0.001). The standard error of measurement (SEM) and the minimum detectable change (MDC) were 2.2 and 6.2, respectively. The adapted Arabic version of the OKS demonstrated acceptable psychometric properties, including reliability, internal consistency, and the validity. The present study indicates that the OKS-Ar is a suitable questionnaire to measure pain and physical function in the Arabic speaking adult male patients with knee OA.

Optokinetic stimulation modulates neglect for the number space: Evidence from mental number interval bisection

Directory of Open Access Journals (Sweden)

Konstantinos ePriftis

2012-02-01

Full Text Available Behavioral, neuropsychological, and neuroimaging data support the idea that numbers are represented along a mental number line (MNL, an analogical, visuo-spatial representation of number magnitude. The MNL is left-to-right oriented, with small numbers on the left and larger numbers on the right. Left neglect patients are impaired in processing the left side of the MNL and show a rightward deviation in the mental bisection of numerical intervals. In the present study we investigated the effects of optokinetic stimulation (OKS -a technique inducing spatial attention shifts by means of activation of the optokinetic nystagmus- on mental number interval bisection. One patient with left neglect following right hemisphere stroke (BG and four control patients with right hemisphere damage, but without neglect, performed the mental number interval bisection task in three experimental conditions of OKS: static, leftward, and rightward. In the static condition, BG misbisected to the right of the true midpoint. BG misbisected to the left following leftward OKS, but again to the right of the midpoint following rightward OKS. In contrast, the performance of controls was not significantly affected by the direction of OKS. We argue that shifts of visuospatial attention, induced by OKS, may affect the mental number interval bisection, suggesting the presence of an interaction between the processing of number magnitude and the processing of the perceptual space, in patients with neglect for the mental number space.

Getting Treatment for ADHD

Medline Plus

Full Text Available ... and Reimbursement Early Career Psychiatrists Education Center Ethics International Job Source Life Members Maintenance of Certification Resources ... My Profile Donate About AACAP Copyright © Advanced Solutions International . {1} ##LOC[OK]## {1} ##LOC[OK]## ##LOC[Cancel]## { ...

Evaluation of spatial and spatiotemporal estimation methods in simulation of precipitation variability patterns

Science.gov (United States)

Bayat, Bardia; Zahraie, Banafsheh; Taghavi, Farahnaz; Nasseri, Mohsen

2013-08-01

Identification of spatial and spatiotemporal precipitation variations plays an important role in different hydrological applications such as missing data estimation. In this paper, the results of Bayesian maximum entropy (BME) and ordinary kriging (OK) are compared for modeling spatial and spatiotemporal variations of annual precipitation with and without incorporating elevation variations. The study area of this research is Namak Lake watershed located in the central part of Iran with an area of approximately 90,000 km2. The BME and OK methods have been used to model the spatial and spatiotemporal variations of precipitation in this watershed, and their performances have been evaluated using cross-validation statistics. The results of the case study have shown the superiority of BME over OK in both spatial and spatiotemporal modes. The results have shown that BME estimates are less biased and more accurate than OK. The improvements in the BME estimates are mostly related to incorporating hard and soft data in the estimation process, which resulted in more detailed and reliable results. Estimation error variance for BME results is less than OK estimations in the study area in both spatial and spatiotemporal modes.

Knee awareness and functionality after simultaneous bilateral vs unilateral total knee arthroplasty

DEFF Research Database (Denmark)

Latifi, Roshan; Thomsen, Morten Grove; Kallemose, Thomas

2016-01-01

AIM: To investigate knee awareness and functional outcomes in patients treated with simultaneous bilateral vs unilateral total knee arthroplasty (TKA). METHODS: Through a database search, we identified 210 patients who had undergone unilateral TKA (UTKA) and 65 patients who had undergone......-surgical treatments were failed, thus preoperatively the patients had poor functionality. All patients were asked to complete Forgotten Joint Score (FJS) and Oxford Knee Score (OKS) questionnaires. The patients were matched according to age, gender, year of surgery, Kellgren-Lawrence score and pre- and postoperative...... overall knee alignment. The FJS and OKS questionnaire results of the two groups were then compared. RESULTS: A mixed-effects model was used to analyze differences between SBTKA and UTKA. OKS: The mean difference in the OKS between the patients who had undergone SBTKA and those who had undergone UTKA was 1...

Sample preparation

International Nuclear Information System (INIS)

Anon.

1992-01-01

Sample preparation prior to HPLC analysis is certainly one of the most important steps to consider in trace or ultratrace analysis. For many years scientists have tried to simplify the sample preparation process. It is rarely possible to inject a neat liquid sample or a sample where preparation may not be any more complex than dissolution of the sample in a given solvent. The last process alone can remove insoluble materials, which is especially helpful with the samples in complex matrices if other interactions do not affect extraction. Here, it is very likely a large number of components will not dissolve and are, therefore, eliminated by a simple filtration process. In most cases, the process of sample preparation is not as simple as dissolution of the component interest. At times, enrichment is necessary, that is, the component of interest is present in very large volume or mass of material. It needs to be concentrated in some manner so a small volume of the concentrated or enriched sample can be injected into HPLC. 88 refs

Fluoridated elastomers: effect on the microbiology of plaque.

Science.gov (United States)

Benson, Philip E; Douglas, C W Ian; Martin, Michael V

2004-09-01

The objective of this study was to investigate the effect of fluoridated elastomeric ligatures on the microbiology of local dental plaque in vivo. This randomized, prospective, longitudinal, clinical trial had a split-mouth crossover design. The subjects were 30 patients at the beginning of their treatment with fixed orthodontic appliances in the orthodontic departments of the Liverpool and the Sheffield dental hospitals in the United Kingdom. The study consisted of 2 experimental periods of 6 weeks with a washout period between. Fluoridated elastomers were randomly allocated at the first visit to be placed around brackets on tooth numbers 12, 11, 33 or 22, 21, 43. Nonfluoridated elastomers were placed on the contralateral teeth. Standard nonantibacterial fluoridated toothpaste and mouthwash were supplied. After 6 weeks (visit 2), the elastomers were removed, placed in transport media, and plated on agar within 2 hours. Nonfluoridated elastomers were placed on all brackets for 1 visit to allow for a washout period. At visit 3, fluoridated elastomers were placed on the teeth contralateral to those that received them at visit 1. At visit 4, the procedures at visit 2 were repeated. Samples were collected on visits 2 and 4. A logistic regression was performed, with the presence or absence of streptococcal or anaerobic growth as the dependent variable. A mixed-effects analysis of variance was carried out with the percentage of streptococcal or anaerobic bacterial count as the dependent variable. The only significant independent variables were the subject variable (P =bacterial count and the visit variable for the percentage of streptococcal count (P =fluoridated or nonfluoridated elastomers was not significant for percentage of either streptococcal (P =.288) or anaerobic count (P =.230). Fluoridated elastomers are not effective at reducing local streptococcal or anaerobic bacterial growth after a clinically relevant time in the mouth.

Bullying: It's Not OK

Science.gov (United States)

... and generally feel helpless. Facts About Bullying Both girls and boys can be bullies. Bullies target children who cry, ... teasing, threatening, or hurting someone. All children can learn to treat others ... with others. Together with the school principal, teachers, counselors, and parents ...

Is the interface OK?

Digital Repository Service at National Institute of Oceanography (India)

Suresh, T.

When a peripheral device fails, software methods can be initially resorted to before the usual hardware test procedures are used. A test program is presented here that allows various peripherals, inter-faced to a Norsk Data computer, to be tested...

The hospital preparation of radiopharmaceuticals

International Nuclear Information System (INIS)

The subject is covered in sections: introduction; preparation ((general - sterilization), production areas (laboratories), working methods for injections, working methods for oral preparations and iodination procedures); analytical testing (general, standards common to injections and oral preparations, standards for injections, standards for oral preparations); reliable methods of preparing sup(99m)Tc-radiopharmaceuticals and 51 Cr-red cells; commercial radiopharmaceutical kits. (U.K.)

Optokinetic and vestibular stimulation determines the spatial orientation of negative optokinetic afternystagmus in the rabbit.

Science.gov (United States)

Pettorossi, V E; Errico, P; Ferraresi, A; Barmack, N H

1999-02-15

Prolonged binocular optokinetic stimulation (OKS) in the rabbit induces a high-velocity negative optokinetic afternystagmus (OKAN II) that persists for several hours. We have taken advantage of this uniform nystagmus to study how changes in static head orientation in the pitch plane might influence the orientation of the nystagmus. After horizontal OKS, the rotation axis of the OKAN II remained almost constant in space as it was kept aligned with the gravity vector when the head was pitched by as much as 80 degrees up and 35 degrees down. Moreover, during reorientation, slow-phase eye velocity decreased according to the head pitch angle. Thereafter, we analyzed the space orientation of OKAN II after optokinetic stimulation during which the head and/or the OKS were pitched upward and downward. The rotation axis of OKAN II did not remain aligned with an earth vertical axis nor a head vertical axis, but it tended to be aligned with that of the OKS respace. The slow-phase eye velocity of OKAN II was also affected by the head pitch angle during OKS, because maximal OKAN II velocity occurred at the same head pitch angle as that during optokinetic stimulation. We suggest that OKAN II is coded in gravity-centered rather than in head-centered coordinates, but that this coordinate system may be influenced by optokinetic and vestibular stimulation. Moreover, the velocity attenuation of OKAN II seems to depend on the mismatch between the space-centered nystagmus rotation axis orientation and that of the "remembered" head-centered optokinetic pathway activated by OKS.

Radiation induced skin cancer the chest wall 30 years later from breast cancer operation

Energy Technology Data Exchange (ETDEWEB)

Miyamoto, Kouji; Togawa, Tamotsu; Hasegawa, Takeshi; Matsunami, Hidetoshi; Ikeda, Tsuneko [Matsunami General Hospital, Kasamatsu, Gifu (Japan); Matsuo, Youichi

1998-10-01

This paper describes the skin cancer on the frontal chest wall induced by postoperative irradiation 30 years later from mastectomy. The patients was a 62-year-old woman, who received mastectomy of the right breast cancer (invasive ductal carcinoma, comedo type) at 31 years old, and received the postoperative radiotherapy of total 11,628 rad over 38 times. On the first medical examination in author`s hospital, the patient had an ulcer of about 10 cm diameter and was diagnosed the radiation induced skin cancer (well differentiated squamous cell carcinoma) in the biopsy. Because of the general condition of the patient was extremely bad and the skin cancer had highly developed, the excision was thought to be impossible. The radiotherapy (16 Gy) and combined local chemotherapy by OK 432 and Bleomycin were performed. In spite of the short term treatment, these therapies were effective on the reduction of the tumor size and the hemostasis, and brought the patient the improvement of QOL. The general condition of the patient improved to be stable and she recovered enough to go out from the hospital for 6 months. After 10 months, she showed anorexia and dyspnea and died after about 1 year from the admission. The present case is extremely rare, and it is required the radical therapy like the excision of chest wall at early stage. (K.H.)

Retiform hemangioendothelioma developed on the site of an earlier cystic lymphangioma in a six-year-old girl.

Science.gov (United States)

Albertini, Anne-Fore; Brousse, Nicole; Bodemer, Christine; Calonje, Eduardo; Fraitag, Sylvie

2011-10-01

Retiform hemangioendothelioma (RH) is a rare low-grade malignancy angiosarcoma, with a high rate of local recurrence and a low metastatic risk. A 6 year-old girl with a large cervical cystic lymphangioma diagnosed by ultrasound and Doppler ultrasound, which showed a large multiloculated anechoic cyst with no flow. The lymphangioma was treated with injections of Picibanil (OK-432). The tumor regressed, but after a year, she developed a poorly limited infiltrated plaque spreading out regularly over her chest, back, and shoulder. The biopsy showed a poorly limited dermal and subcutaneous vascular proliferation composed of elongated arborising vessels lined with ovoid endothelial cells in a hobnail pattern. In addition, the deep part of the lesion showed typical features of a papillary intralymphatic angioendothelioma pattern (PILA) or Dabska tumor. The endothelial cells strongly expressed podoplanin (D2-40). A diagnosis of RH with focal areas of PILA was reached. The girl died 8 months after surgery of hypovolemic shock in a context of diffuse lymphangiomatosis with pulmonary localization. To our knowledge, RH has hardly ever been described in children. This entity exhibits a continuum with the PILA, sharing not only morphological and immunohistochemical similarities but also its ability to develop in a context of a vascular anomaly, particularly a lymphangioma. The role of Picibanil in the development of this tumor can be discussed.

Getting Treatment for ADHD

Medline Plus

Full Text Available ... ADHD? Common Signs and Symptoms Getting Treatment Supporting School Success The Teenage Years Working Together Resources Connect With Us Contact Us info@advsol.com My Profile Donate About AACAP Copyright © Advanced Solutions International . {1} ##LOC[OK]## {1} ##LOC[OK]## ##LOC[Cancel]## { ...

Getting Treatment for ADHD

Medline Plus

Full Text Available ... Common Signs and Symptoms Getting Treatment Supporting School Success The Teenage Years Working Together Resources Connect With Us Contact Us info@advsol.com My Profile Donate About AACAP Copyright © Advanced Solutions International . {1} ##LOC[OK]## {1} ##LOC[OK]## ##LOC[Cancel]## { ...

PANDAS: The Need to Use Definitive Diagnostic Criteria

Directory of Open Access Journals (Sweden)

Harvey S. Singer

2015-07-01

Full Text Available The entity Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal infections (PANDAS was initially proposed in 1998 (Swedo, et al. 1998. The formal diagnosis required that the affected individual meet five specific criteria: prepubertal onset, obsessive compulsive disorder (OCD and/or a tic disorder, the dramatic sudden explosive onset of symptoms, a relapsing and remitting course of symptoms that are temporally associated with Group A beta-hemolytic streptococcal (GABHS infection, and the presence of other neuropsychiatric abnormalities (hyperactivity, emotional lability, anxiety, or piano-playing choreiform movements. Since that original report, the PANDAS hypothesis has remained controversial based on both clinical grounds and the failure to confirm a definitive immune process.  This editorial was written in response to:Helm CE, Blackwood RA. Pediatric autoimmune neuropsychiatric disorder associated with streptococcal infections (PANDAS: Experience at a tertiary referral center. Tremor Other Hyperkinet Mov. 2015; 5. doi: 10.7916/D8348JCX 

Southern Hemisphere Measurement of the Anisotropy in the CosmicMicrowave Background Radiation

Energy Technology Data Exchange (ETDEWEB)

Smoot, George F.; Lubin, Phil M.

1979-06-01

A recent measurement of the anisotropy in the Cosmic Background Radiation from the southern hemisphere (Lima, Peru) is essentially in agreement with previous measurements from the northern hemisphere. The net anisotropy can be described as a first order spherical harmonic (Doppler) anisotropy of amplitude 3.1 {+-} 0.4 m{sup o}K with a quadrupole anisotropy of less than 1 m{sup o}K. In addition, measurements of the linear polarization yield an upper limit of 1 m{sup o}K, or one part in 3000, at 95% C.L. for the amplitudes of any spherical harmonic through third order.

I'm OK, You're (Not) OK: Teaching in a World of Relativism.

Science.gov (United States)

Ryder, Phyllis Mentzell

1995-01-01

Examines three techniques to overcome relativism: (1) a hierarchical view, in which the socially constructed view is superior; (2) a belief that a true understanding of personal experience will lead to political awareness; and (3) an assertion that the socially constructed view is more ethical than other views. Argues that first two approaches are…

75 FR 58426 - Notice of Intent to Repatriate Cultural Items: Thomas Gilcrease Institute of American History and...

Science.gov (United States)

2010-09-24

...: Thomas Gilcrease Institute of American History and Art, Tulsa, OK AGENCY: National Park Service, Interior... Thomas Gilcrease Institute of American History and Art (Gilcrease Museum), Tulsa, OK, that meet the... the Gilcrease Museum for the preservation of North American history. The first bundle is made of...

Increased β-haemolytic group A streptococcal M6 serotype and streptodornase B-specific cellular immune responses in Swedish narcolepsy cases.

Science.gov (United States)

Ambati, A; Poiret, T; Svahn, B-M; Valentini, D; Khademi, M; Kockum, I; Lima, I; Arnheim-Dahlström, L; Lamb, F; Fink, K; Meng, Q; Kumar, A; Rane, L; Olsson, T; Maeurer, M

2015-09-01

Type 1 narcolepsy is a neurological disorder characterized by excessive daytime sleepiness and cataplexy associated with the HLA allele DQB1*06:02. Genetic predisposition along with external triggering factors may drive autoimmune responses, ultimately leading to the selective loss of hypocretin-positive neurons. The aim of this study was to investigate potential aetiological factors in Swedish cases of postvaccination (Pandemrix) narcolepsy defined by interferon-gamma (IFNγ) production from immune cells in response to molecularly defined targets. Cellular reactivity defined by IFNγ production was examined in blood from 38 (HLA-DQB1*06:02(+) ) Pandemrix-vaccinated narcolepsy cases and 76 (23 HLA-DQB1*06:02(+) and 53 HLA-DQB1*06:02(-) ) control subjects, matched for age, sex and exposure, using a variety of different antigens: β-haemolytic group A streptococcal (GAS) antigens (M5, M6 and streptodornase B), influenza (the pandemic A/H1N1/California/7/09 NYMC X-179A and A/H1N1/California/7/09 NYMC X-181 vaccine antigens, previous Flu-A and -B vaccine targets, A/H1N1/Brisbane/59/2007, A/H1N1/Solomon Islands/3/2006, A/H3N2/Uruguay/716/2007, A/H3N2/Wisconsin/67/2005, A/H5N1/Vietnam/1203/2004 and B/Malaysia/2506/2004), noninfluenza viral targets (CMVpp65, EBNA-1 and EBNA-3) and auto-antigens (hypocretin peptide, Tribbles homolog 2 peptide cocktail and extract from rat hypothalamus tissue). IFN-γ production was significantly increased in whole blood from narcolepsy cases in response to streptococcus serotype M6 (P = 0.0065) and streptodornase B protein (P = 0.0050). T-cell recognition of M6 and streptodornase B was confirmed at the single-cell level by intracellular cytokine (IL-2, IFNγ, tumour necrosis factor-alpha and IL-17) production after stimulation with synthetic M6 or streptodornase B peptides. Significantly, higher (P = 0.02) titres of serum antistreptolysin O were observed in narcolepsy cases, compared to vaccinated controls. β-haemolytic GAS may be

Estimating the spatial distribution of soil moisture based on Bayesian maximum entropy method with auxiliary data from remote sensing

Science.gov (United States)

Gao, Shengguo; Zhu, Zhongli; Liu, Shaomin; Jin, Rui; Yang, Guangchao; Tan, Lei

2014-10-01

Soil moisture (SM) plays a fundamental role in the land-atmosphere exchange process. Spatial estimation based on multi in situ (network) data is a critical way to understand the spatial structure and variation of land surface soil moisture. Theoretically, integrating densely sampled auxiliary data spatially correlated with soil moisture into the procedure of spatial estimation can improve its accuracy. In this study, we present a novel approach to estimate the spatial pattern of soil moisture by using the BME method based on wireless sensor network data and auxiliary information from ASTER (Terra) land surface temperature measurements. For comparison, three traditional geostatistic methods were also applied: ordinary kriging (OK), which used the wireless sensor network data only, regression kriging (RK) and ordinary co-kriging (Co-OK) which both integrated the ASTER land surface temperature as a covariate. In Co-OK, LST was linearly contained in the estimator, in RK, estimator is expressed as the sum of the regression estimate and the kriged estimate of the spatially correlated residual, but in BME, the ASTER land surface temperature was first retrieved as soil moisture based on the linear regression, then, the t-distributed prediction interval (PI) of soil moisture was estimated and used as soft data in probability form. The results indicate that all three methods provide reasonable estimations. Co-OK, RK and BME can provide a more accurate spatial estimation by integrating the auxiliary information Compared to OK. RK and BME shows more obvious improvement compared to Co-OK, and even BME can perform slightly better than RK. The inherent issue of spatial estimation (overestimation in the range of low values and underestimation in the range of high values) can also be further improved in both RK and BME. We can conclude that integrating auxiliary data into spatial estimation can indeed improve the accuracy, BME and RK take better advantage of the auxiliary

76 FR 18547 - Grand River Dam Authority, Salina Pumped Storage Project; Notice of Proposed Restricted Service...

Science.gov (United States)

2011-04-04

... Practice and Procedure, 18 CFR 385.2010, provides that, to eliminate unnecessary expense or improve... all individual undertakings carried out in accordance with the license until the license expires or is... Nazih Zuhdi Muscogee (Creek) Nation, P.O. Drive, Oklahoma, OK 73105-7917. Box 580, Okmulgee, OK 74447...

PREPARATIVE SKIN PREPARATION AND SURGICAL WOUND INFECTION

Directory of Open Access Journals (Sweden)

Anjanappa

2015-01-01

Full Text Available BACKGROUND AND OBJECTIVE: It is an established fact now that the normal skin of healthy human beings harbours a rich bacterial fl ora. Normally considered non - pathogenic , these organisms way be a potential source of infection of the surgical wound. Approximately 20% of the resident flora is beyond the reach of surgical scrubs and antiseptics. The goal of surgical preparation of the skin with antiseptics is to remove transient and pathogenic microorganisms on the skin surface and to reduce the resident flora to a low level. Povidone iodine (I odophors and chlorhexidine are most often used antiseptics for pre - operative skin preparation. OBJECTIVES : To evaluate the efficacy of povidone iodine alone and in combination with antiseptic agent containing alcoholic chlorhexidine in preoperative skin p reparation by taking swab culture. (2 To compare the rate of postoperative wound infection in both the groups. METHODS: One hundred patients (fifty in each group undergoing clean elective surgery with no focus of infection on the body were included in th e study. The pre - operative skin preparation in each group is done with the respective antiseptic regimen. In both the groups after application of antiseptics , sterile saline swab culture was taken immediately from site of incision. In cases which showed gr owth of organisms , the bacteria isolated were identified by their morphological and cultural characteristics. Grams staining , coagulase test and antibiotic sensitivity test were done wherever necessary and difference in colonization rates was determined as a measure of efficacy of antiseptic regimen. RESULTS: The results of the study showed that when compared to povidone iodine alone , using a combination of povidone iodine and alcoholic solution of chlorhexidine , the colonization rates of the site of incisi on were reduced significantly. As for the rate of post - operative wound infection , it is also proven that wound infections are also

Preparation and characterization of genipin-cross-linked silk fibroin/chitosan sustained-release microspheres

Directory of Open Access Journals (Sweden)

Zeng SG

2015-05-01

Full Text Available Shuguang Zeng,1,* Manwen Ye,1,2,* Junqi Qiu,1 Wei Fang,1 Mingdeng Rong,1 Zehong Guo,1 Wenfen Gao11Department of Oral and Maxillofacial Surgery, Guangdong Provincial Stomatological Hospital, Southern Medical University, 2Department of Stomatology, Guangdong Women and Children Hospital, Guangzhou Medical University, Guangzhou, Guangdong, People’s Republic of China*These authors contributed equally to this workAbstract: We report the effects of distinct concentrations of genipin and silk fibroin (SF:chitosan (CS ratios on the formation of SF–CS composite microspheres. We selected microspheres featuring an SF:CS ratio of 1:1, encapsulated various concentrations of bovine serum albumin (BSA, and then compared their encapsulation efficiency and sustained-release rate with those of pure CS microspheres. We determined that the following five groups of microspheres were highly spherical and featured particle sizes ranging from 70 µm to 147 µm: mass ratio of CS:SF =1:0.5, 0.1 g or 0.5 g genipin; CS:SF =1:1, 0.05 g or 1 g genipin; and CS:SF =1:2, 0.5 g genipin. The microspheres prepared using 1:1 CS:SF ratio and 0.05 g genipin in the presence of 10 mg, 20 mg, and 50 mg of BSA exhibited encapsulation efficiencies of 50.16%±4.32%, 56.58%±3.58%, and 42.19%±7.47%, respectively. Fourier-transform infrared spectroscopy (FTIR results showed that SF and CS were cross-linked and that the α-helices and random coils of SF were converted into β-sheets. BSA did not chemically react with CS or SF. Moreover, thermal gravimetric analysis (TGA results showed that the melting point of BSA did not change, which confirmed the FTIR results, and X-ray diffraction results showed that BSA was entrapped in microspheres in a noncrystalline form, which further verified the TGA and FTIR data. The sustained-release microspheres prepared in the presence of 10 mg, 20 mg, and 50 mg of BSA burst release 30.79%±3.43%, 34.41%±4.46%, and 41.75%±0.96% of the

Balance disorder and increased risk of falls in osteoporosis and kyphosis: significance of kyphotic posture and muscle strength.

Science.gov (United States)

Sinaki, Mehrsheed; Brey, Robert H; Hughes, Christine A; Larson, Dirk R; Kaufman, Kenton R

2005-08-01

This controlled trial was designed to investigate the influence of osteoporosis-related kyphosis (O-K) on falls. Twelve community-dwelling women with O-K (Cobb angle, 50-65 degrees measured from spine radiographs) and 13 healthy women serving as controls were enrolled. Mean age of the O-K group was 76 years (+/-5.1), height 158 cm (+/-5), and weight 61 kg (+/-7.9), and mean age of the control group was 71 years (+/-4.6), height 161 cm (+/-3.8), and weight 66 kg (+/-11.7). Quantitative isometric strength data were collected. Gait was monitored during unobstructed level walking and during stepping over an obstacle of four different heights randomly assigned (2.5%, 5%, 10%, and 15% of the subject's height). Balance was objectively assessed with computerized dynamic posturography consisting of the sensory organization test. Back extensor strength, grip strength, and all lower extremity muscle groups were significantly weaker in the O-K group than the control group (P controls for all conditions of unobstructed and obstructed level walking. Obstacle height had a significant effect on all center-of-mass variables. The O-K subjects had significantly greater balance abnormalities on computerized dynamic posturography than the control group (P =0.002). Data show that thoracic hyperkyphosis on a background of reduced muscle strength plays an important role in increasing body sway, gait unsteadiness, and risk of falls in osteoporosis.

Çokşeritli Dönel Kavşaklarda Kapasite Analizi: Highway Capacity Manual 2010 Kapasite Modeliyle Bir Değerlendirme

Directory of Open Access Journals (Sweden)

Melike Ersoy

2014-06-01

Full Text Available Bu çalışmada, genel kabul görmüş çok şeritli dönel kavşak kapasite hesap yöntemlerinin uygulanabilirliği, yeni Highway Capacity Manual (HCM 2010 yöntemiyle karşılaştırılmıştır. Yöntemlerden elde edilen sonuçlar, yerel çalışmalardan toplanan verilerin ışığında değerlendirilmiştir. Karşılaştırma için regresyon analiz yöntemini temsilen Transportation Research Laboratory (TRL formülasyonu, Kritik aralık kabulü yöntemini temsilen Avusturya Hesap Yöntemi seçilmiştir. Bunlara ek olarak, sınırlı öncelik ve ters öncelik koşullarının göz önünde bulundurulduğu kalibre edilmiş kritik aralık yöntemi ve HCM 2010 da yerel uygulamalar için öngörülen kalibre edilmiş formüller ile hesaplamalar yapılmış ve HCM 2010'un olağan değerleriyle karşılaştırılmıştır.Çalışmanın sonucunda elde edilenler, kritik aralık kabul yöntemi ve regresyon yönteminin HCM 2010 olağan değerlerine kıyasla genellikle daha yüksek sonuçlar verdiğini göstermiştir. Yöntemler arasında yapılan regresyon analizleri sonucu, özellikle yüksek dönen akımlar altında kritik aralık kabul yönteminin HCM 2010 yönteminden daha uygun sonuçlar verdiği görülmüştür. Ancak HCM 2010'da yerel uygulamalar için kalibrasyon yapılmasını sağlayan formülasyon sonucunda elde edilenler, olağan formülasyonun verdiği düşük kapasite tahminlerini daha uygun değerlere yükseltmiştir.

Economic Intervention and Parenting: A Randomized Experiment of Statewide Child Development Accounts

Science.gov (United States)

Nam, Yunju; Wikoff, Nora; Sherraden, Michael

2016-01-01

Objective: We examine the effects of Child Development Accounts (CDAs) on parenting stress and practices. Methods: We use data from the SEED for Oklahoma Kids (SEED OK) experiment. SEED OK selected caregivers of infants from Oklahoma birth certificates using a probability sampling method, randomly assigned caregivers to the treatment (n = 1,132)…

Food preparation supplies predict children's family meal and home-prepared dinner consumption in low-income households.

Science.gov (United States)

Appelhans, Bradley M; Waring, Molly E; Schneider, Kristin L; Pagoto, Sherry L

2014-05-01

Frequent family meals and home food preparation are considered important for children's nutritional health and weight maintenance. This cross-sectional study tested whether these parent-driven behaviors are related to the availability of food preparation supplies in low-income urban households. Caregivers of children ages 6-13 provided information on family meal frequency, child consumption of home-prepared dinners, household food insecurity, and attitudes towards cooking. Researchers used a newly developed Food Preparation Checklist (FPC) to assess the availability of 41 food preparation supplies during a physical audit of the home environment. Caregivers and children provided anthropometric measurements and jointly reported on child dietary intake. In ordinal logistic regression models, greater home availability of food preparation supplies was associated with more frequent family meals and child consumption of home-prepared dinners. Associations were independent of household financial strain, food insecurity, caregiver attitudes toward cooking, and sociodemographic characteristics. Fewer food preparation supplies were available in households characterized by greater food insecurity, lower income, and negative caregiver attitudes towards cooking, but did not differ by child or caregiver weight status. As in prior studies, more frequent family meals and consumption of home-prepared dinners were associated with healthier child dietary intake in several areas. We conclude that food preparation supplies are often limited in the most socioeconomically disadvantaged households, and their availability is related to the frequency with which children consume family meals and home-prepared dinners. The potential role of food preparation supplies as contributors to socioeconomic disparities in child nutritional health and obesity deserves further study. Copyright © 2014 Elsevier Ltd. All rights reserved.

Bowel preparation for CT colonography

International Nuclear Information System (INIS)

Neri, Emanuele; Lefere, Philippe; Gryspeerdt, Stefaan; Bemi, Pietro; Mantarro, Annalisa; Bartolozzi, Carlo

2013-01-01

Bowel preparation represents an essential part of CT colonography, as the accuracy of the exam is strongly related to the adequacy of colonic cleansing, and a poor bowel preparation may compromise the diagnostic quality even despite optimization of all other acquisition parameters. Residual stool and fluid in the large bowel may affect the interpretation of the exam and may increase the number of false positives and false negatives. In this regard, the majority of patients having undergone CT colonography state that bowel preparation is the most unpleasant part. Unfortunately, to date no definite consensus has been reached about the ideal bowel preparation technique, and there is great variability in preparation strategies across diagnostic centers. The purpose of this review article is to describe the development and evolution of bowel preparation techniques in order to choose the best approach for optimizing the diagnostic quality of CT colonography in each patient

Bowel preparation for CT colonography

Energy Technology Data Exchange (ETDEWEB)

Neri, Emanuele, E-mail: emanuele.neri@med.unipi.it [Diagnostic and Interventional Radiology, University of Pisa (Italy); Lefere, Philippe; Gryspeerdt, Stefaan [Department of Radiology, Stedelijk Ziekenhuis, Roeselare (Belgium); Bemi, Pietro; Mantarro, Annalisa; Bartolozzi, Carlo [Diagnostic and Interventional Radiology, University of Pisa (Italy)

2013-08-15

Bowel preparation represents an essential part of CT colonography, as the accuracy of the exam is strongly related to the adequacy of colonic cleansing, and a poor bowel preparation may compromise the diagnostic quality even despite optimization of all other acquisition parameters. Residual stool and fluid in the large bowel may affect the interpretation of the exam and may increase the number of false positives and false negatives. In this regard, the majority of patients having undergone CT colonography state that bowel preparation is the most unpleasant part. Unfortunately, to date no definite consensus has been reached about the ideal bowel preparation technique, and there is great variability in preparation strategies across diagnostic centers. The purpose of this review article is to describe the development and evolution of bowel preparation techniques in order to choose the best approach for optimizing the diagnostic quality of CT colonography in each patient.

Dini ve Kültürel Çoğulculukta Varoluş Mücadelesine Bir Bakış: Malezya Tecrübesi / An Overview towards the Existence Struggle in Religious and Cultural Pluralism: Malaysia Experience

Directory of Open Access Journals (Sweden)

Saim Kayadibi

2016-11-01

Dini ve Kültürel Çoğulculukta Varoluş Mücadelesine Bir Bakış: Malezya Tecrübesi Öz Malezya sosyo-kültürel yapısı itibari ile çok dinli, çok dilli ve çok kültürlü toplumların barış ve huzur içerisinde yaşayabilme özelliğini göstermesinden dolayı birçok ülkeye örnek oluşturabilecek nadide birlikteliklerden biridir. Bu çok kültürlülük, çok dinlilik ve çok dillilik özelliklerini bir zenginlik olarak görüp, birlikte güçlü bir toplum oluşturabilmenin çabası içerisindedir. Birçok sahada, örneğin İslam Ekonomisi ve Bankacılığı, Helal Gıda, modern bir devlette İslam Hukuku kurallarının uygulanabilme özelliğinde öncü rol oynayabilen, hatta merkez ülke olma yarışında ciddi çalışmaları vardır. Tarihi tecrübe açısından Malezya, konum itibariyle ciddi işgallerin merkezi olmuş, birçok sömürge devletinin izlerini atabilmenin, sömürge psikolojisinden kurtulabilmenin, yaralarını sarabilmenin mücadelesini veren bir ülkedir. Geçmişte sömürge ülkelerinden kalan acı hatıraya rağmen Osmanlı devletinden gördüğü kardeş ve dost yardımlar hafızasının derinliklerinde sağlam izler bırakmıştır. Şimdi ise farklı etnik yapısını huzur ve barış içerisinde birlikte götürebilmenin mücadelesini veren ve diğer ülkelere de örnek oluşturabilecek model bir yapıya sahiptir. Bunun yanında Malezya’yı Türkiye ile karşılaştırmaya çalışmak yanlış sonuçlar doğurabilir. Sömürge geçmişi olmayan, gayr-i Müslim nüfusu neredeyse yok denecek kadar az olan Türkiye’nin Malezya ile kıyaslanması düşünülemez. Bu makalemizde çok dinli toplumlarda Müslümanlar incelenirken Malezya örnek olarak alınacak, onların yaşamları, tarihi ve sosyal evreleri, dini hayatın yaşanmasında sorunların olup olmadığı, milli bir bilinç oluşturmak için nasıl bir strateji geliştirildiği, topyekûn bir bakış açısı ile problemlerin neler olduğu ve ne tür �

Arithmetic on the European Logarithmic Microprocessor

Czech Academy of Sciences Publication Activity Database

Coleman, J. N.; Chester, E. I.; Softley, C. I.; Kadlec, Jiří

2000-01-01

Roč. 49, č. 7 (2000), s. 702-715 ISSN 0018-9340 Grant - others:MŠMT(CZ) OK 314; MŠMT(CZ) LN00B096; Commission EC(XE) ESPRIT 33544 HSLA Program:OK; LN Institutional research plan: AV0Z1075907 Subject RIV: JC - Computer Hardware ; Software Impact factor: 1.263, year: 2000

Evaluation of the Potency, Neutralizing Antibody Response, and Stability of a Recombinant Fusion Protein Vaccine for Streptococcus pyogenes.

Science.gov (United States)

Burlet, E; HogenEsch, H; Dunham, A; Morefield, G

2017-05-01

Streptococcus pyogenes or group A streptococcus (GAS) is a Gram-positive bacterium that can cause a wide range of diseases, including pharyngitis, impetigo, scarlet fever, necrotizing fasciitis, rheumatic fever, and streptococcal toxic shock syndrome. Despite the increasing burden on global health caused by GAS, there is currently no licensed vaccine available. In this study, we evaluated immunogenicity, induction of neutralizing antibodies, and stability of a new recombinant fusion protein vaccine that targets infections from GAS. The recombinant fusion protein (SpeAB) combines inactive mutant forms of streptococcal pyrogenic exotoxin A (SpeA) and streptococcal pyrogenic exotoxin B (SpeB). The SpeAB vaccine evaluated in this study was adsorbed to an aluminum adjuvant and demonstrated robust immunogenicity, eliciting production of specific neutralizing antibodies against SpeA and SpeB, two major virulence factors of S. pyogenes. Stability studies suggest that the vaccine will retain immunogenicity for at least 2 years when stored at refrigerated temperatures. This novel vaccine shows great potential to provide protection against GAS infections and to reduce the burden of GAS disease globally.

HÜCRESEL OTOMATA VE BİLGİSAYAR GRAFİKLERİ

Directory of Open Access Journals (Sweden)

Şen ÇAKIR

1999-01-01

Full Text Available Hücresel Otomata (CA çeşitli fiziksel işlemler için model temin eden basit matematik sistemleridir. Önemsiz veya küçük değişikliklerin ve basit kuralların sistemlerin davranışlarında nasıl çok büyük değişikliklere yolaçtığını gösterirler. İlginç şekillerin zengin bir kaynağı olarak bilgisayar grafikleri aracı olarak da kullanılmaktadırlar. Son yıllarda CA birçok bilim adamının dikkatini çekmiştir. Günümüzde CA ekolojiden görüntü işlemeye kadar birçok alanda kullanılır. Bu makalede oldukça basit CA kuralları ile çok sayıda karmaşık ve harika modelin yaratılabileceği gösterilmektedir

Selectivity and Activity of Iron Molybdate Catalysts in Oxidation of Methanol

Directory of Open Access Journals (Sweden)

Khalid Khazzal Hummadi

2009-06-01

Full Text Available The selectivity and activity of iron molybdate catalysts prepared by different methods are compared with those of a commercial catalyst in the oxidation of methanol to formaldehyde in a continuous tubular bed reactor at 200-350 oC (473-623 oK, 10 atm (1013 kPa, with a methanol-oxygen mixture fixed at 5.5% by volume methanol: air ratio. The iron(III molybdate catalyst prepared by co-precipitation and filtration had a selectivity towards formaldehyde in methanol oxidation comparable with a commercial catalyst; maximum selectivity (82.3% was obtained at 573oK when the conversion was 59.7%. Catalysts prepared by reacting iron (III and molybdate by kneading or precipitation followed by evaporation, omitting a filtration stage, were less active and less selective. The selectivity-activity relationships of these catalysts as a function of temperature were discussed in relation to the method of preparation, surface areas and composition. By combing this catalytic data with data from the patent literature we demonstrate a synergy between iron and molybdenum in regard to methanol oxidation to formaldehyde; the optimum composition corresponded to an iron mole fraction 0.2-0.3. The selectivity to formaldehyde was practically constant up to an iron mole fraction 0.3 and then decreased at higher iron concentrations. The iron component can be regarded as the activity promoter. The iron molybdate catalysts can thus be related to other two-component MoO3-based selective oxidation catalysts, e.g. bismuth and cobalt molybdates. The iron oxide functions as a relatively basic oxide abstracting, in the rate-controlling step, a proton from the methyl of a bound methoxy group of chemisorbed methanol. It was proposed that a crucial feature of the sought after iron(III molybdate catalyst is the presence of -O-Mo-O-Fe-O-Mo-O- groups as found in the compound Fe2(MoO43 and for Fe3+ well dispersed in MoO3 generally. At the higher iron(III concentrations the loss of

Prepare Healthy Foods with Toddlers

Science.gov (United States)

Izumi-Taylor, Satomi; Rike, Cheryl

2011-01-01

Toddlers--from about 16 to 36 months--can learn a variety of skills as they prepare food and follow recipes in developmentally appropriate ways. Early childhood teachers are encouraged to support young children's healthy eating habits by offering simple food preparation experiences. When toddlers--and preschoolers--safely prepare healthy snacks,…

VUV optical ring resonator for Duke storage ring free electron laser

Energy Technology Data Exchange (ETDEWEB)

Park, S.H.; Litvinenko, V.N.; Madey, J.M.J. [Duke Univ., Durham, NC (United States)] [and others

1995-12-31

The conceptual design of the multifaceted-mirror ring resonator for Duke storage ring VUV FEL is presented. The expected performance of the OK-4 FEL with ring resonator is described. We discuss in this paper our plans to study reflectivity of VUV mirrors and their resistivity to soft X-ray spontaneous radiation from OK-4 undulator.

Methods for preparing synthetic freshwaters.

Science.gov (United States)

Smith, E J; Davison, W; Hamilton-Taylor, J

2002-03-01

Synthetic solutions that emulate the major ion compositions of natural waters are useful in experiments aimed at understanding biogeochemical processes. Standard recipes exist for preparing synthetic analogues of seawater, with its relatively constant composition, but, due to the diversity of freshwaters, a range of compositions and recipes is required. Generic protocols are developed for preparing synthetic freshwaters of any desired composition. The major problems encountered in preparing hard and soft waters include dissolving sparingly soluble calcium carbonate, ensuring that the ionic components of each concentrated stock solution cannot form an insoluble salt and dealing with the supersaturation of calcium carbonate in many hard waters. For acidic waters the poor solubility of aluminium salts requires attention. These problems are overcome by preparing concentrated stock solutions according to carefully designed reaction paths that were tested using a combination of experiment and equilibrium modeling. These stock solutions must then be added in a prescribed order to prepare a final solution that is brought into equilibrium with the atmosphere. The example calculations for preparing hard, soft and acidic freshwater surrogates with major ion compositions the same as published analyses, are presented in a generalized fashion that should allow preparation of any synthetic freshwater according to its known analysis.

Communication Games Reveal Preparation Contextuality

Science.gov (United States)

Hameedi, Alley; Tavakoli, Armin; Marques, Breno; Bourennane, Mohamed

2017-12-01

A communication game consists of distributed parties attempting to jointly complete a task with restricted communication. Such games are useful tools for studying limitations of physical theories. A theory exhibits preparation contextuality whenever its predictions cannot be explained by a preparation noncontextual model. Here, we show that communication games performed in operational theories reveal the preparation contextuality of that theory. For statistics obtained in a particular family of communication games, we show a direct correspondence with correlations in spacelike separated events obeying the no-signaling principle. Using this, we prove that all mixed quantum states of any finite dimension are preparation contextual. We report on an experimental realization of a communication game involving three-level quantum systems from which we observe a strong violation of the constraints of preparation noncontextuality.

Bilimsel Araştırma Ödevlerinin Çok Yüzeyli Rasch Ölçme Modeli ile Değerlendirilmesi

Directory of Open Access Journals (Sweden)

Ramazan BAŞTÜRK

2010-06-01

Full Text Available The purpose of this study is to investigate the usefulness of the many-facet Rasch model (MFRM in evaluating the quality of performance related to preparing Research assignment in higher education. The Rasch Model utilizes item response theory stating that the probability of a correct response to a test item/task depends largely on a single parameter, the ability of the person. MFRM extends this one-parameter model to other facets, for example, rater severity, rating scale format, task difficulty levels. This paper specifically investigated research preparation ability in terms of items/task difficulty and rater severity/leniency. Fourth year counseling students prepared research assignments during the autumn semester of the 2009-2010 school years in the “Research Methods in Education” course. Six judges evaluated each students assignments using “Research Assignment Evaluation Rubric”. The results of this study demonstrated that the MFRM is a powerful tool for handling polytomous data in performance and peer assessment in higher education.

Integrated Work Management: Preparer, Course 31883

Energy Technology Data Exchange (ETDEWEB)

Simpson, Lewis Edward [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-08-07

The preparer (also called the “planner”) plays a key role in the integrated work management (IWM) process at Los Alamos National Laboratory (LANL). This course, Integrated Work Management: Preparer (COURSE 31883), describes the IWM roles and responsibilities of the preparer. This course also discusses IWM requirements that must be met by the preparer.

Documents preparation and review

International Nuclear Information System (INIS)

1999-01-01

Ignalina Safety Analysis Group takes active role in assisting regulatory body VATESI to prepare various regulatory documents and reviewing safety reports and other documentation presented by Ignalina NPP in the process of licensing of unit 1. The list of main documents prepared and reviewed is presented

A Fast Implicit Finite Difference Method for Fractional Advection-Dispersion Equations with Fractional Derivative Boundary Conditions

Directory of Open Access Journals (Sweden)

Taohua Liu

2017-01-01

Full Text Available Fractional advection-dispersion equations, as generalizations of classical integer-order advection-dispersion equations, are used to model the transport of passive tracers carried by fluid flow in a porous medium. In this paper, we develop an implicit finite difference method for fractional advection-dispersion equations with fractional derivative boundary conditions. First-order consistency, solvability, unconditional stability, and first-order convergence of the method are proven. Then, we present a fast iterative method for the implicit finite difference scheme, which only requires storage of O(K and computational cost of O(Klog⁡K. Traditionally, the Gaussian elimination method requires storage of O(K2 and computational cost of O(K3. Finally, the accuracy and efficiency of the method are checked with a numerical example.

Alignment of Duke free electron laser storage ring and optical beam delivery system

International Nuclear Information System (INIS)

Emamian, M.; Hower, N.

1999-01-01

Duke Free Electron Laser Laboratory (DFELL) hosts a 1.1 GeV electron beam storage ring facility which is capable of generating beams in the range of nearly monochromatic gamma rays to high peak power infra red (IR) laser. In this report specifications and procedures for alignment of OK-4 /Duke storage ring FEL wiggler and optical cavity mirrors will be discussed. The OK-4 FEL lasing has demonstrated a series of world record in the last few years. In August of this year the OK-4 FEL successfully commissioned to laser at 193.7 nm. Also in this article, alignment of the γ-ray and UV optical beam delivery system that is currently in progress will be described. (authors)

Development of glass/glass-ceramics materials and devices and their micro-structural studies

International Nuclear Information System (INIS)

Goswami, Madhumita; Sarkar, Arjun; Shingarvelan, Shobha; Kumar, Rakesh; Ananathanarayan, Arvind; Shrikhande, V.K.; Kothiyal, G.P.

2009-01-01

Materials and devices based on glass and glass-ceramics (GCs) find applications in various high pressure and vacuum applications. We have prepared different glasses/glass-ceramics with requisite thermal expansion coefficient, electrical, vacuum and wetting characteristics to fabricate hermetic seals with different metals/alloys as well as components for these applications. Some of these are, SiO 2 -Na 2 O-K 2 O-Al 2 O 3 -B 2O3 (BS) for matched type of seal fabricated with Kovar alloy, SiO 2 -Na 2 O-K 2 O-BaO-PbO(LS) for fabrication of compressive type seals with stainless steel and SS 446 alloys, P 2 O 5 -Na 2 O-B 2 O 3 -BaO-PbO(NAP) for fabrication of matched type of seal with relatively low melting metals/alloys like AI/Cu-Be and Li 2 O-ZnO-SiO 2 -P 2 O 5 -B 2 O 3 -Na 2 O (LZS) and Lithium aluminium silicate (LAS) glass-ceramics to fabricate matched and compression types feedtroughs/conductivity probes Magnesium aluminium silicate (MAS) machinable glass-ceramics is another development for high voltage and ultra high vacuum applications. Micro-structural studies have been carried out on these materials to understand the mechanism of their behaviour and have also been deployed in various systems and plants in DAE. (author)

Mental and Active Preparation: Examining Variations in Women's Processes of Preparing to Leave Abusive Relationships.

Science.gov (United States)

Bermea, Autumn M; Khaw, Lyndal; Hardesty, Jennifer L; Rosenbloom, Lindsay; Salerno, Craig

2017-02-01

Although the process of leaving abusive relationships has received increased research attention, preparing to leave is still largely understudied. Despite an emphasis on safety planning, not all women take active steps to prepare, and the characteristics and experiences of those who do or do not actively prepare are unknown. We address this gap with a secondary data analysis of interviews with 25 abused mothers in the process of leaving. All women initially engaged in mental planning, where they had emotionally disconnected from their partners. Using constructivist grounded theory techniques, we identified two distinct groups: those whose mental planning led to active planning ( n = 11), and those who moved directly from mental planning to leaving ( n = 14) with little time or need to actively plan. The groups differed on several individual, relationship, and child factors, which may have impacted the ability or decisions to prepare. This study supports the feminist view that survivors are not helpless victims but active agents who strategize for safety. Those who engage solely in mental planning still prepare to leave, even if they do not engage in active planning. Practitioners should consider factors affecting preparations and acknowledge mental planning as a necessary effort in leaving.

Reactor operation plan preparing device

International Nuclear Information System (INIS)

Sano, Hiroki; Maruyama, Hiromi; Kinoshita, Mitsuo; Fukuzaki, Koji; Banto, Masaru; Fukazawa, Yukihisa.

1993-01-01

The device comprises a means for retrieving a control rod pattern capable of satisfying a thermal limit upon aimed power/minimum flow rate and providing minimum xenon and a control rod pattern maximum xenon. It further comprises a means for selecting a control rod pattern corresponding to a xenon equilibrium condition, and selecting a control rod which provides a greater thermal margin to provide a control rod operation sequence for each of the patterns. Further, the device comprises an outline plan preparing means and a correction means therefor, a simplified sequence table reference means operated along with sequence change, an operation limit region input means, a control rod operation preferential region changing means, a thermal margin evaluation region and an input means. This can automatically prepare the operation plan, decrease the times for preparation of detailed plans by using the outline plan preparing function, thereby enabling to remarkably shorten the time for preparing of an operation plan. (N.H.)

Preparation of shaped bodies

International Nuclear Information System (INIS)

Sutcliffe, P.W.; Isaacs, J.W.; Lyon, C.E.

1979-01-01

A method for the preparation of a shaped body includes pressing a powder to give a 'green' shaped body, the powder having been made by comminuting a material prepared by means of a gelation process, the material prior to comminuting being of a selected physical configuration (e.g. spherical). Thus, a material prepared by means of a gelation process can be transported and handled in an environmentally desirable, substantially dust-free form (e.g. spherical particles) and then comminuted to produce a powder for pressing into e.g. a shaped nuclear fuel body (e.g. pellets of (70%U/30%Pu)O 2 ), which can be sintered. (author)

Systematic Search for Primary Immunodeficiency in Adults With Infections

Science.gov (United States)

2017-12-21

Complement Deficiency; Antibody Deficiency; Chronic Sinus Infection; Meningitis, Bacterial; Pneumonia, Bacterial; Otitis Media; Streptococcal Infection; Neisseria Infections; Haemophilus Influenza; Pneumococcal Infections

AS_638_A4 OK

African Journals Online (AJOL)

AKA BOKO

Le compost mur obtenu après une phase de fermentation aérobique de 6 mois est caractérisé par une humidité comprise entre 30 et 50 %, un pH de 7.8, un rapport C/N égale à 10, et une absence totale des germes indicateurs de contamination fécale : coliformes fécaux et streptocoques fécaux. Les tests agronomiques ...

AS_468_A4 OK

African Journals Online (AJOL)

AKA BOKO

Mots-clés : zones volcaniques de Madagascar, minéraux, fertilisant. Abstract. Characterization chemical physico of the volcanic products of Madagascar for its agricultural use. The volcanic zones are reputed to be fertile and have a big agricultural potentiality. Of this fact, a lot of people use the volcanic soils as fertilizing.

AS_643_A4 OK

African Journals Online (AJOL)

AKA BOKO

Évaluation des rejets d'eaux usées de la ville de Niamey dans le fleuve Niger. Haoua AMADOU* .... Problématique de la gestion des eaux usées dans la communauté urbaine de. Niamey ..... MALAVOI et Y. SOUCHON, Hydrologie et dynamique hydro écologique des cours d'eau ; Revue ... control Eichornia crassipes Mart.

AS_572_A4 OK

African Journals Online (AJOL)

AKA BOKO

à 34 % (Dron et Brivot, 1977). Cela veut dire que l'addition minérale contient une phase vitreuse appréciable. L'indice d'activité. L'indice d'activité noté I est une caractéristique importante, il est calculé en faisant le rapport entre les résistances à la compression à 28 jours du mortier de référence sans addition minérale et ...