WorldWideScience

Sample records for storage myopathy revealed

  1. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    Directory of Open Access Journals (Sweden)

    Benech Philippe

    2009-08-01

    Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

  2. Lipid storage myopathies.

    Science.gov (United States)

    Bruno, Claudio; Dimauro, Salvatore

    2008-10-01

    The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.

  3. Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.

    Science.gov (United States)

    Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian

    2015-08-01

    The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.

  4. Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.

    Science.gov (United States)

    Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin

    2015-08-01

    Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.

  5. Myopathies

    Science.gov (United States)

    ... find appropri- ate therapists, and to locate and purchase important assistive devices. And today, people with disabilities ... in inheritable myopathies • Anesthesia: People with myopathies can experience a range of adverse reactions to certain anesthetic ...

  6. Lipid storage myopathy with clinical markers of Marfan syndrome: A rare association

    Directory of Open Access Journals (Sweden)

    Subasree Ramakrishnan

    2012-01-01

    Full Text Available Disorders of lipid metabolism can cause variable clinical presentations, often involving skeletal muscle, alone or together with other tissues. A 19-year-old boy presented with a 2-year history of muscle pain, cramps, exercise intolerance and progressive weakness of proximal lower limbs. Examination revealed skeletal markers of Marfan syndrome in the form of increased arm span compared with height, Kyphoscoliois, moderate pectus excavatum, high arched palate and wrist sign. He also had mild neck flexor weakness and proximal lower limb weakness with areflexia. Pathologic findings revealed lipid-laden fine vacuoles in the muscle fibers. Possibility of carnitine deficiency myopathy was considered and the patient was started on carnitine and Co Q. The patient made remarkable clinical improvement over the next 2 months. This case is reported for rarity of the association of clinical markers of Marfan syndrome and lipid storage myopathy and sparse literature on lipid storage myopathy in the Indian context.

  7. Analysis of lipid profile in lipid storage myopathy.

    Science.gov (United States)

    Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi

    2016-09-01

    Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct

  8. Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.

    Science.gov (United States)

    Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello

    2016-04-01

    Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.

  9. Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.

    Science.gov (United States)

    Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J

    1997-05-01

    A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.

  10. Myopathy

    Science.gov (United States)

    ... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...

  11. A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.

    Science.gov (United States)

    Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio

    2012-09-01

    Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.

  12. A novel PNPLA2 mutation causes neutral lipid storage disease with myopathy (NLSDM) presenting muscular dystrophic features with lipid storage and rimmed vacuoles.

    Science.gov (United States)

    Chen, J; Hong, D; Wang, Z; Yuan, Y

    2010-01-01

    Neutral lipid storage disease with myopathy (NLSDM) is a type of lipid storage myopathy arising due to a mutation in the PNPLA2 gene encoding an adipose triglyceride lipase responsible for the degradation of intracellular triglycerides. Herein, we report the cases of two siblings manifesting slowly progressive proximal and distal limb weakness in adulthood. One of the patients had dilated cardiomyopathy, hearing loss and short stature. Muscle specimens of the 2 patients revealed muscular dystrophic features with massive lipid droplets and numerous rimmed vacuoles in the fibers. A novel homozygous mutation IVS2+1G > A in the PNPLA2 gene was identified in the 2 cases, but not in the healthy familial individuals. The presence of massive lipid droplets with muscular dystrophic changes and rimmed vacuoles in muscle fibers might be one of the characteristic pathological changes of NLSDM.

  13. Muscle MRI in neutral lipid storage disease with myopathy carrying mutation c.187+1G>A.

    Science.gov (United States)

    Xu, Chunxiao; Zhao, Yawen; Liu, Jing; Zhang, Wei; Wang, Zhaoxia; Yuan, Yun

    2015-06-01

    We describe the clinical and muscle MRI changes in 2 siblings with neutral lipid storage disease with myopathy (NLSDM) carrying the mutation c.187+1G>A. Peripheral blood smears, genetic tests, and muscle biopsies were performed. Thigh MRI was performed to observe fatty replacement, muscle edema, and muscle bulk from axial sections. Both siblings had similar fatty infiltration and edema. T1-weighted images of the gluteus maximus, adductor magnus, semitendinosus, and semimembranosus revealed marked and diffuse fatty infiltration. There was asymmetric involvement in biceps femoris and quadriceps. There was extensive fatty infiltration in the quadriceps, except for the rectus femoris. Gracilis and sartorius were relatively spared. Thigh muscle volume was decreased, while the gracilis and sartorius appeared to show compensatory hypertrophy. Compared with previous reports in NLSDM, MRI changes in this myopathy tended to be more severe. Asymmetry and relatively selective fatty infiltration were characteristics. © 2014 Wiley Periodicals, Inc.

  14. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    International Nuclear Information System (INIS)

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio; Minutoli, Fabio; Toscano, Antonio; Musumeci, Olimpia

    2008-01-01

    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  15. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    Energy Technology Data Exchange (ETDEWEB)

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio [University of Messina, Department of Radiological Sciences, Messina (Italy); Minutoli, Fabio [University of Messina, Department of Radiological Sciences, Messina (Italy); A.O.U. ' ' Policlinico G. Martino' ' , Dipartimento di Scienze Radiologiche, Messina (Italy); Toscano, Antonio; Musumeci, Olimpia [University of Messina, Department of Neurosciences, Psychiatry and Anaesthesiology, Messina (Italy)

    2008-11-15

    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  16. Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study

    International Nuclear Information System (INIS)

    Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno; Bassez, Guillaume; Carlier, Pierre G.; Clement, Karine; Petit, Francois M.; Carlier, Robert-Yves

    2013-01-01

    Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)

  17. Neutral lipid storage disease with myopathy: A whole-body nuclear MRI and metabolic study

    Energy Technology Data Exchange (ETDEWEB)

    Laforet, Pascal; Stojkovic, Tanya; Wahbi, Karim; Eymard, Bruno [AP-HP, Centre de Reference de pathologie neuromusculaire Paris-Est, Groupe Hospitalier Pitie-Salpetriere, Assistance Publique-Hopitaux de Paris, Paris, (France); Bassez, Guillaume [AP-HP, Centre de Reference de Pathologie Neuromusculaire Paris-Ouest, CHU Henri Mondor, Creteil, (France); Carlier, Pierre G. [CEA, I2BM, MIRCen, IdM NMR Laboratory, T-75651 Paris, (France); Clement, Karine [AP-HP, Institute of Cardiometabolism and Nutrition, ICAN, Pitie-Salpetriere Hospital, University Pierre et Marie-Curie Paris6, Paris, INSERM, U872 team 7, Paris, (France); Petit, Francois M. [AP-HP, Molecular Genetics and Metabolic Diseases Laboratory, Antoine Beclere Hospital, Clamart, (France); Carlier, Robert-Yves [AP-HP, Departement d' imagerie Medicale et Centre d' innovation Technologique, CHU Raymond-Poincare, Garches, (France)

    2013-07-01

    Neutral lipid storage disease with myopathy (NLSDM) is caused by a mutation in the gene encoding adipose triglyceride lipase (ATGL), and is characterized by the presence of numerous triglyceride-containing cytoplasmic droplets in type I muscle fibers. Major clinical manifestations concern the heart and skeletal muscle, and some patients also present diabetes mellitus. We report the clinical, metabolic, and whole-body nuclear magnetic resonance imaging findings of three patients with NLSDM. Muscle MRI study was consistent with previous descriptions, and allowed to show a common pattern of fatty replacement. Muscle changes predominated in the paravertebral muscles, both compartments of legs, and posterior compartment of the thighs. A more variable distribution of muscle involvement was observed on upper limbs, with marked asymmetry in one patient, and alterations predominating on supra and infra spinatus, biceps brachialis and anterior compartment of arms. Cardiac NMR studies revealed anomalies despite normal echocardiography in two patients. Endocrine studies showed low leptin and adiponectine levels, a moderate increase in insulin levels at fasting state, and even greater increase after oral glucose tolerance test in one patient. Two patients had elevated triglycerides and low cholesterol-HDL. Based on these analyses, regular control of cardio-metabolic risks appear mandatory in the clinical follow-up of these subjects. (authors)

  18. Metabolic Myopathies.

    Science.gov (United States)

    Tarnopolsky, Mark A

    2016-12-01

    Metabolic myopathies are genetic disorders that impair intermediary metabolism in skeletal muscle. Impairments in glycolysis/glycogenolysis (glycogen-storage disease), fatty acid transport and oxidation (fatty acid oxidation defects), and the mitochondrial respiratory chain (mitochondrial myopathies) represent the majority of known defects. The purpose of this review is to develop a diagnostic and treatment algorithm for the metabolic myopathies. The metabolic myopathies can present in the neonatal and infant period as part of more systemic involvement with hypotonia, hypoglycemia, and encephalopathy; however, most cases present in childhood or in adulthood with exercise intolerance (often with rhabdomyolysis) and weakness. The glycogen-storage diseases present during brief bouts of high-intensity exercise, whereas fatty acid oxidation defects and mitochondrial myopathies present during a long-duration/low-intensity endurance-type activity or during fasting or another metabolically stressful event (eg, surgery, fever). The clinical examination is often normal between acute events, and evaluation involves exercise testing, blood testing (creatine kinase, acylcarnitine profile, lactate, amino acids), urine organic acids (ketones, dicarboxylic acids, 3-methylglutaconic acid), muscle biopsy (histology, ultrastructure, enzyme testing), MRI/spectroscopy, and targeted or untargeted genetic testing. Accurate and early identification of metabolic myopathies can lead to therapeutic interventions with lifestyle and nutritional modification, cofactor treatment, and rapid treatment of rhabdomyolysis.

  19. A novel mutation in PNPLA2 causes neutral lipid storage disease with myopathy and triglyceride deposit cardiomyovasculopathy: a case report and literature review.

    Science.gov (United States)

    Kaneko, Kimihiko; Kuroda, Hiroshi; Izumi, Rumiko; Tateyama, Maki; Kato, Masaaki; Sugimura, Koichiro; Sakata, Yasuhiko; Ikeda, Yoshihiko; Hirano, Ken-Ichi; Aoki, Masashi

    2014-07-01

    Mutations in PNPLA2 cause neutral lipid storage disease with myopathy (NLSDM) or triglyceride deposit cardiomyovasculopathy (TGCV). We report a 59-year-old patient with NLSDM/TGCV presenting marked asymmetric skeletal myopathy and cardiomyovasculopathy. Skeletal muscle and endomyocardial biopsies showed cytoplasmic vacuoles containing neutral lipid. Gene analysis revealed a novel homozygous mutation (c.576delC) in PNPLA2. We reviewed 37 genetically-proven NLSDM/TGCV cases; median age was 30 years; distribution of myopathy was proximal (69%) and distal predominant (16%); asymmetric myopathy (right>left) was reported in 41% of the patients. Frequently-affected muscles were posterior compartment of leg (75%), shoulder girdle to upper arm (50%), and paraspinal (33%). Skeletal muscle biopsies showed lipid accumulation in 100% and rimmed vacuoles in 22%. Frequent comorbidities were cardiomyopathy (44%), hyperlipidemia (23%), diabetes mellitus (24%), and pancreatitis (14%). PNPLA2 mutations concentrated in Exon 4-7 without apparent genotype-phenotype correlations. To know the characteristic features is essential for the early diagnosis of NLSDM/TGCV. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Glycogen storage disease type III: modified Atkins diet improves myopathy.

    Science.gov (United States)

    Mayorandan, Sebene; Meyer, Uta; Hartmann, Hans; Das, Anibh Martin

    2014-11-28

    Frequent feeds with carbohydrate-rich meals or continuous enteral feeding has been the therapy of choice in glycogen storage disease (Glycogenosis) type III. Recent guidelines on diagnosis and management recommend frequent feedings with high complex carbohydrates or cornstarch avoiding fasting in children, while in adults a low-carb-high-protein-diet is recommended. While this regimen can prevent hypoglycaemia in children it does not improve skeletal and heart muscle function, which are compromised in patients with glycogenosis IIIa. Administration of carbohydrates may elicit reactive hyperinsulinism, resulting in suppression of lipolysis, ketogenesis, gluconeogenesis, and activation of glycogen synthesis. Thus, heart and skeletal muscle are depleted of energy substrates. Modified Atkins diet leads to increased blood levels of ketone bodies and fatty acids. We hypothesize that this health care intervention improves the energetic balance of muscles. We treated 2 boys with glycogenosis IIIa aged 9 and 11 years with a modified Atkins diet (10 g carbohydrate per day, protein and fatty acids ad libitum) over a period of 32 and 26 months, respectively. In both patients, creatine kinase levels in blood dropped in response to Atkins diet. When diet was withdrawn in one of the patients he complained of chest pain, reduced physical strength and creatine kinase levels rapidly increased. This was reversed when Atkins diet was reintroduced. One patient suffered from severe cardiomyopathy which significantly improved under diet. Patients with glycogenosis IIIa benefit from an improved energetic state of heart and skeletal muscle by introduction of Atkins diet both on a biochemical and clinical level. Apart from transient hypoglycaemia no serious adverse effects were observed.

  1. Late onset of neutral lipid storage disease due to novel PNPLA2 mutations causing total loss of lipase activity in a patient with myopathy and slight cardiac involvement.

    Science.gov (United States)

    Missaglia, Sara; Maggi, Lorenzo; Mora, Marina; Gibertini, Sara; Blasevich, Flavia; Agostoni, Piergiuseppe; Moro, Laura; Cassandrini, Denise; Santorelli, Filippo Maria; Gerevini, Simonetta; Tavian, Daniela

    2017-05-01

    Neutral lipid storage disease with myopathy (NLSDM) presents with skeletal muscle myopathy and severe dilated cardiomyopathy in nearly 40% of cases. NLSDM is caused by mutations in the PNPLA2 gene, which encodes the adipose triglyceride lipase (ATGL). Here we report clinical and genetic findings of a patient carrying two novel PNPLA2 mutations (c.696+4A>G and c.553_565delGTCCCCCTTCTCG). She presented at age 39 with right upper limb abduction weakness slowly progressing over the years with asymmetric involvement of proximal upper and lower limb muscles. Cardiological evaluation through ECG and heart echo scan was normal until the age 53, when mild left ventricular diastolic dysfunction was detected. Molecular analysis revealed that only one type of PNPLA2 transcript, with exon 5 skipping, was expressed in patient cells. Such aberrant mRNA causes the production of a shorter ATGL protein, lacking part of the catalytic domain. This is an intriguing case, displaying severe PNPLA2 mutations with clinical presentation characterized by slight cardiac impairment and full expression of severe asymmetric myopathy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Metabolic encephalopathy and lipid storage myopathy associated with a presumptive mitochondrial fatty acid oxidation defect in a dog

    Directory of Open Access Journals (Sweden)

    Vanessa R Biegen

    2015-11-01

    Full Text Available A 1-year-old spayed female Shih Tzu presented for episodic abnormalities of posture and mentation. Neurologic examination was consistent with a bilaterally symmetric multifocal encephalopathy. The dog had a waxing-and-waning hyperlactemia and hypoglycemia. Magnetic resonance imaging revealed bilaterally symmetric cavitated lesions of the caudate nuclei with less severe abnormalities in the cerebellar nuclei. Empirical therapy was unsuccessful and the patient was euthanized. Post-mortem histopathology revealed bilaterally symmetric necrotic lesions of the caudate and cerebellar nuclei and multi-organ lipid accumulation, including a lipid storage myopathy. Malonic aciduria and ketonuria were found on urinary organic acid screen. Plasma acylcarnitine analysis suggested a fatty acid oxidation defect. Fatty acid oxidation disorders are inborn errors of metabolism documented in humans, but poorly described in dogs. Although neurologic signs have been described in humans with this group of diseases, descriptions of advanced imaging and histopathology are severely lacking. This report suggests that abnormalities of fatty acid metabolism may cause severe, bilateral gray matter necrosis and lipid accumulation in multiple organs including the skeletal muscles, liver, and kidneys. Veterinarians should be aware that fatty acid oxidation disorders, although potentially fatal, may be treatable. A timely definitive diagnosis is essential in guiding therapy.

  3. Novel duplication mutation in the patatin domain of adipose triglyceride lipase (PNPLA2) in neutral lipid storage disease with severe myopathy.

    Science.gov (United States)

    Akiyama, Masashi; Sakai, Kaori; Ogawa, Masaya; McMillan, James R; Sawamura, Daisuke; Shimizu, Hiroshi

    2007-12-01

    Recently, mutations in PNPLA2 encoding adipose triglyceride lipase (ATGL) were reported to underlie a neutral lipid storage disease (NLSD) subgroup characterized by mild myopathy and the absence of ichthyosis. In the present study a novel homozygous PNPLA2 mutation c.475_478dupCTCC (p.Gln160ProfsX19) in the patatin domain, the ATGL active site, was detected in a woman with NLSD and severe myopathy. The present results suggest that a premature truncation mutation in the patatin domain causes NLSD with severe myopathy.

  4. A GYS1 gene mutation is highly associated with polysaccharide storage myopathy in Cob Normand draught horses.

    Science.gov (United States)

    Herszberg, B; McCue, M E; Larcher, T; Mata, X; Vaiman, A; Chaffaux, S; Chérel, Y; Valberg, S J; Mickelson, J R; Guérin, G

    2009-02-01

    Glycogen storage diseases or glycogenoses are inherited diseases caused by abnormalities of enzymes that regulate the synthesis or degradation of glycogen. Deleterious mutations in many genes of the glyco(geno)lytic or the glycogenesis pathways can potentially cause a glycogenosis, and currently mutations in fourteen different genes are known to cause animal or human glycogenoses, resulting in myopathies and/or hepatic disorders. The genetic bases of two forms of glycogenosis are currently known in horses. A fatal neonatal polysystemic type IV glycogenosis, inherited recessively in affected Quarter Horse foals, is due to a mutation in the glycogen branching enzyme gene (GBE1). A second type of glycogenosis, termed polysaccharide storage myopathy (PSSM), is observed in adult Quarter Horses and other breeds. A severe form of PSSM also occurs in draught horses. A mutation in the skeletal muscle glycogen synthase gene (GYS1) was recently reported to be highly associated with PSSM in Quarter Horses and Belgian draught horses. This GYS1 point mutation appears to cause a gain-of-function of the enzyme and to result in the accumulation of a glycogen-like, less-branched polysaccharide in skeletal muscle. It is inherited as a dominant trait. The aim of this work was to test for possible associations between genetic polymorphisms in four candidate genes of the glycogen pathway or the GYS1 mutation in Cob Normand draught horses diagnosed with PSSM by muscle biopsy.

  5. Cardiovascular magnetic resonance imaging (CMR) reveals characteristic pattern of myocardial damage in patients with mitochondrial myopathy.

    Science.gov (United States)

    Yilmaz, Ali; Gdynia, Hans-Jürgen; Ponfick, Matthias; Rösch, Sabine; Lindner, Alfred; Ludolph, Albert C; Sechtem, Udo

    2012-04-01

    Mitochondrial myopathy comprises various clinical subforms of neuromuscular disorders that are characterised by impaired mitochondrial energy metabolism due to dysfunction of the mitochondrial respiratory chain. No comprehensive and targeted cardiovascular magnetic resonance (CMR) studies have been performed so far in patients with mitochondrial disorders. The present study aimed at characterising cardiac disease manifestations in patients with mitochondrial myopathy and elucidating the in vivo cardiac damage pattern of patients with different subforms of mitochondrial disease by CMR studies. In a prospective study, 37 patients with mitochondrial myopathy underwent comprehensive neurological and cardiac evaluations including physical examination, resting ECG and CMR. The CMR studies comprised cine-CMR, T2-weighted "edema" imaging and T1-weighted late-gadolinium-enhancement (LGE) imaging. Various patterns and degrees of skeletal myopathy were present in the participants of this study, whereas clinical symptoms such as chest pain symptoms (in eight (22%) patients) and various degrees of dyspnea (in 16 (43%) patients) were less frequent. Pathological ECG findings were documented in eight (22%) patients. T2-weighted "edema" imaging was positive in one (3%) patient with MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) only. LGE imaging demonstrated the presence of non-ischemic LGE in 12 (32%) patients: 10 out of 24 (42%) patients with CPEO (chronic progressive external ophthalmoplegia) or KSS (Kearns-Sayre syndrome) and 2 of 3 (67%) patients with MELAS were LGE positive. All 10 LGE-positive patients with CPEO or KSS demonstrated a potentially typical pattern of diffuse intramural LGE in the left-ventricular (LV) inferolateral segments. Cardiac involvement is a frequent finding in patients with mitochondrial myopathy. A potentially characteristic pattern of diffuse intramural LGE in the LV inferolateral segments was identified in

  6. DISTAL MYOPATHIES

    Science.gov (United States)

    Dimachkie, Mazen M.; Barohn, Richard J.

    2014-01-01

    Over a century ago, Gowers described two young patients in whom distal muscles weakness involved the hand, foot, sternocleidomastoid, and facial muscles in the other case the shoulder and distal leg musculature. Soon after, , similar distal myopathy cases were reported whereby the absence of sensory symptoms and of pathologic changes in the peripheral nerves and spinal cord at postmortem examination allowed differentiation from Charcot-Marie-Tooth disease. In 1951, Welander described autosomal dominant (AD) distal arm myopathy in a large Scandanavian cohort. Since then the number of well-characterized distal myopathies has continued to grow such that the distal myopathies have formed a clinically and genetically heterogeneous group of disorders. Affected kindred commonly manifest weakness that is limited to foot and toe muscles even in advanced stages of the disease, with variable mild proximal leg, distal arm, neck and laryngeal muscle involvement in selected individuals. An interesting consequence of the molecular characterization of the distal myopathies has been the recognition that mutation in a single gene can lead to more than one clinical disorder. For example, Myoshi myopathy (MM) and limb girdle muscular dystrophy (LGMD) type 2B are allelic disorders due to defects in the gene that encodes dysferlin. The six well described distal myopathy syndromes are shown in Table 1. Table 2 lists advances in our understanding of the myofibrillar myopathy group and Table 3 includes more recently delineated and less common distal myopathies. In the same manner, the first section of this review pertains to the more traditional six distal myopathies followed by discussion of the myofibrillar myopathies. In the third section, we review other clinically and genetically distinctive distal myopathy syndromes usually based upon single or smaller family cohorts. The fourth section considers other neuromuscular disorders that are important to recognize as they display prominent

  7. Axial myopathy

    DEFF Research Database (Denmark)

    Witting, Nanna; Andersen, Linda K; Vissing, John

    2016-01-01

    Classically, myopathies are categorized according to limb or cranial nerve muscle affection, but with the growing use of magnetic resonance imaging it has become evident that many well-known myopathies have significant involvement of the axial musculature. New disease entities with selective axial...

  8. Spectrum of metabolic myopathies.

    Science.gov (United States)

    Angelini, Corrado

    2015-04-01

    Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.

  9. Proteomic analysis reveals changes in carbohydrate and protein metabolism associated with broiler breast myopathy.

    Science.gov (United States)

    Kuttappan, Vivek A; Bottje, Walter; Ramnathan, Ranjith; Hartson, Steven D; Coon, Craig N; Kong, Byung-Whi; Owens, Casey M; Vazquez-Añon, Mercedes; Hargis, Billy M

    2017-08-01

    White Striping (WS) and Woody Breast (WB) are 2 conditions that adversely affect consumer acceptance as well as quality of poultry meat and meat products. Both WS and WB are characterized with degenerative myopathic changes. Previous studies showed that WS and WB in broiler fillets could result in higher ultimate pH, increased drip loss, and decreased marinade uptake. The main objective of the present study was to compare the proteomic profiles of muscle tissue (n = 5 per group) with either NORM (no or few minor myopathic lesions) or SEV (with severe myopathic changes). Proteins were extracted from these samples and analyzed using a hybrid LTQ-OrbitrapXL mass spectrometer (LC-MS/MS). Over 800 proteins were identified in the muscle samples, among which 141 demonstrated differential (P < 0.05) expression between NORM and SEV. The set of differentially (P < 0.05) expressed proteins was uploaded to Ingenuity Pathway Analysis® (IPA) software to determine the associated biological networks and pathways. The IPA analysis showed that eukaryotic initiation factor-2 (eIF-2) signaling, mechanistic target of rapamycin (mTOR) signaling, as well as regulation of eIF4 and p70S6K signaling were the major canonical pathways up-regulated (P < 0.05) in SEV muscle compared to NORM. The up-regulation of these pathways indicate an increase in protein synthesis which could be part of the rapid growth as well as cellular stress associated with ongoing muscle degeneration and the attempt to repair tissue damage in SEV birds. Furthermore, IPA analysis revealed that glycolysis and gluconeogenesis were the major down-regulated (P < 0.05) canonical pathways in SEV with respect to NORM muscle. Down-regulation of these pathways could be the reason for higher ultimate pH seen in SEV muscle samples indicating reduced glycolytic potential. In conclusion, comparison of proteomic profiles of NORM and SEV muscle samples showed differences in protein profile which explains some of the observed

  10. Mitochondrial myopathies.

    Science.gov (United States)

    DiMauro, Salvatore

    2006-11-01

    Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  11. Evidence-based treatment of metabolic myopathy

    Directory of Open Access Journals (Sweden)

    Yan LIN

    2014-05-01

    Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment.  Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature.  Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should

  12. Genuine myotubular myopathy

    International Nuclear Information System (INIS)

    Edstroem, L.; Wroblewski, R.; Mair, W.G.

    1982-01-01

    Two patients, a father and his 14-year-old son, were suffering from a facioperoneal syndrome, and muscle biopsy findings were consistent with a myotubular myopathy. The father exhibited central nuclei in most muscle fibers, but his son had typical changes exclusively in hypotrophic type I fibers. The cytochemical and ultrastructural analysis revealed a spectrum of pathological changes typical of myotubular myopathy. Energy-dispersive electron probe x-ray microanalysis was performed on 6- to 12-microns thick freeze-dried cryosections visualized in the scanning or scanning transmission mode of electron microscopy. We found a high intracellular sodium and chlorine concentration and a low potassium concentration in comparison with control muscles. These changes pointed in the direction similar to results from human fetal muscle. The changes in the intracellular elemental composition may indicate a membrane pump dysfunction, which might be caused by a partial arrest in muscle fiber maturation

  13. [Metabolic myopathies].

    Science.gov (United States)

    Papazian, Óscar; Rivas-Chacón, Rafael

    2013-09-06

    To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.

  14. Novel missense mutations in PNPLA2 causing late onset and clinical heterogeneity of neutral lipid storage disease with myopathy in three siblings.

    Science.gov (United States)

    Missaglia, Sara; Tasca, Elisabetta; Angelini, Corrado; Moro, Laura; Tavian, Daniela

    2015-01-01

    Neutral lipid storage disease with myopathy (NLSD-M) is a rare autosomal recessive disorder characterised by an abnormal accumulation of triacylglycerol into cytoplasmic lipid droplets (LDs). NLSD-M patients are mainly affected by progressive myopathy, cardiomyopathy and hepatomegaly. Mutations in the PNPLA2 gene cause variable phenotypes of NLSD-M. PNPLA2 codes for adipose triglyceride lipase (ATGL), an enzyme that hydrolyses fatty acids from triacylglycerol. This report outlines the clinical and genetic findings in a NLSD-M Italian family with three affected members. In our patients, we identified two novel PNPLA2 missense mutations (p.L56R and p.I193F). Functional data analysis demonstrated that these mutations caused the production of ATGL proteins able to bind to LDs, but with decreased lipase activity. The oldest brother, at the age of 38, had weakness and atrophy of the right upper arm and kyphosis. Now he is 61 years old and is unable to raise arms in the horizontal position. The second brother, from the age of 44, had exercise intolerance, cramps and pain in lower limbs. He is currently 50 years old and has an asymmetric distal amyotrophy. One of the two sisters, 58 years old, presents the same PNPLA2 mutations, but she is still oligo-symptomatic on neuromuscular examination with slight triceps muscle involvement. She suffered from diabetes and liver steatosis. This NLSD-M family shows a wide range of intra-familial phenotypic variability in subjects carrying the same mutations, both in terms of target-organs and in terms of rate of disease progression. Copyright © 2015. Published by Elsevier Inc.

  15. Molecular and Genetic Studies of Congenital Myopathies

    Science.gov (United States)

    2018-03-21

    Central Core Disease; Centronuclear Myopathy; Congenital Fiber Type Disproportion; Multiminicore Disease; Myotubular Myopathy; Nemaline Myopathy; Rigid Spine Muscular Dystrophy; Undefined Congenital Myopathy

  16. A diagnostic algorithm for metabolic myopathies.

    Science.gov (United States)

    Berardo, Andres; DiMauro, Salvatore; Hirano, Michio

    2010-03-01

    Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.

  17. Presence of the glycogen synthase 1 (GYS1) mutation causing type 1 polysaccharide storage myopathy in continental European draught horse breeds.

    Science.gov (United States)

    Baird, J D; Valberg, S J; Anderson, S M; McCue, M E; Mickelson, J R

    2010-11-13

    The purpose of this study was to determine which continental European draught horse breeds harbour a mutation in the glycogen synthase 1 gene (GYS1) that is known to be responsible for type 1 polysaccharide storage myopathy in quarter horses and North American draught horses. Of a non-random selection of continental European draught horses belonging to 13 breeds, 62 per cent (250 of 403) tested were found to carry the mutant allele. The horses were located in Belgium, France, Germany, The Netherlands, Spain and Sweden. The mutation was identified in animals from each of the breeds examined. In the breeds in which more than 15 animals were available for testing, the highest percentages of GYS1-positive horses were found in the Belgian trekpaard (92 per cent; 35 of 38 horses tested), Comtois (80 per cent; 70 of 88), Netherlands trekpaard (74 per cent; 17 of 23), Rheinisch-Deutsches kaltblut (68 per cent; 30 of 44) and Breton (64 per cent; 32 of 51).

  18. Hypothyroid myopathy. A clinical and pathologaical study.

    Science.gov (United States)

    McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G

    1980-09-01

    Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature

  19. Metabolic consequences of adipose triglyceride lipase deficiency in humans: an in vivo study in patients with neutral lipid storage disease with myopathy.

    Science.gov (United States)

    Natali, Andrea; Gastaldelli, Amalia; Camastra, Stefania; Baldi, Simona; Quagliarini, Fabiana; Minicocci, Ilenia; Bruno, Claudio; Pennisi, Elena; Arca, Marcello

    2013-09-01

    The role of adipose triglyceride lipase (ATGL) in intermediate substrates metabolism has not been fully elucidated in humans. Our objective was to evaluate the consequences of ATGL deficiency on body fat distribution, insulin sensitivity, fatty acids metabolism, and energy substrate utilization. Body composition and organ fat content were measured by bioimpedance and (1)H nuclear magnetic resonance spectroscopy; heart glucose metabolism by [(18)F]deoxyglucose positron emission tomography and insulin sensitivity and β-cell function by oral glucose tolerance and 2-step euglycemic-hyperinsulinemic clamp. Lipolysis ([(2)H5]glycerol turnover) and indirect calorimetry were evaluated at fasting, after oral glucose load, during the clamp, and also during an iv epinephrine infusion. These metabolic investigations were carried out during hospitalization. Three patients affected by neutral lipid storage disease with myopathy (NLSDM) due to homozygosity for loss-of-function mutations in the ATGL gene and 6 sex-, age-, and body mass index-matched controls were studied. As expected, NLSDM patients showed diffuse, although heterogeneous, fat infiltration in skeletal muscles associated with increased visceral fat. Although heart and liver were variably affected, fat content in the pancreas was increased in all patients. Compared with healthy controls, NLSDM patients showed impaired insulin response to glucose possibly related to the severe pancreatic steatosis, preserved whole-body insulin sensitivity, and a shift toward glucose metabolism in the heart. Fasting nonesterified fatty acid concentrations as well as basal lipolytic rates and the antilipolytic effect of insulin were normal in NLSDM patients, whereas the lipolytic effect of norepinephrine was impaired. Finally, no significant abnormality in the respiratory quotient was noted in NLSDM patients. In humans, ATGL has a remarkable effect on cellular lipid droplet handling, and its lack causes both perivisceral, skeletal

  20. Myopathy in acute hypothyroidism

    OpenAIRE

    Ma, JTC; Yu, YL; Kung, AWC

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  1. Myopathy in acute hypothyroidism.

    OpenAIRE

    Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  2. Genetics Home Reference: Miyoshi myopathy

    Science.gov (United States)

    ... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...

  3. Influence of chain length of pyrene fatty acids on their uptake and metabolism by Epstein-Barr-virus-transformed lymphoid cell lines from a patient with multisystemic lipid storage myopathy and from control subjects.

    OpenAIRE

    Radom, J; Salvayre, R; Levade, T; Douste-Blazy, L

    1990-01-01

    The uptake and intracellular metabolism of 4-(1-pyrene)butanoic acid (P4), 10-(1-pyrene)decanoic acid (P10) and 12-(1-pyrene)dodecanoic acid (P12) were investigated in cultured lymphoid cell lines from normal individuals and from a patient with multisystemic lipid storage myopathy (MLSM). The cellular uptake was shown to be dependent on the fatty-acid chain length, but no significant difference in the uptake of pyrene fatty acids was observed between MLSM and control lymphoid cells. After inc...

  4. [Descending ocular myopathy].

    Science.gov (United States)

    de Freitas, M R; Nascimento, O J

    1975-06-01

    The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  5. Lipid-storage myopathy and respiratory insufficiency due to ETFQO mutations in a patient with late-onset multiple acyl-CoA dehydrogenation deficiency

    DEFF Research Database (Denmark)

    Olsen, Rikke Katrine Jentoft; Pourfarzam, M; Morris, A A M

    2004-01-01

    response to treatment, she developed respiratory insufficiency at age 14 years and has required long-term overnight ventilation. Thus, MADD is one of the few conditions that can cause a myopathy with weakness of the respiratory muscles out of proportion to the limb muscles. Udgivelsesdato: 2004-null...

  6. Immune-mediated statin myopathy.

    Science.gov (United States)

    Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit

    2016-01-01

    Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.

  7. Skeletal Muscle Magnetic Resonance Imaging of the Lower Limbs in Late-onset Lipid Storage Myopathy with Electron Transfer Flavoprotein Dehydrogenase Gene Mutations

    Institute of Scientific and Technical Information of China (English)

    Xin-Yi Liu; Ming Jin; Zhi-Qiang Wang; Dan-Ni Wang; Jun-Jie He; Min-Ting Lin; Hong-Xia Fu

    2016-01-01

    Background:Lipid storage myopathy (LSM) is a genetically heterogeneous group with variable clinical phenotypes.Late-onset multiple acyl-coenzyme A dehydrogenation deficiency (MADD) is a rather common form of LSM in China.Diagnosis and clinical management of it remain challenging,especially without robust muscle biopsy result and genetic detection.As the noninvasion and convenience,muscle magnetic resonance imaging (MRI) is a helpful assistant,diagnostic tool for neuromuscular disorders.However,the disease-specific MRI patterns of muscle involved and its diagnostic value in late-onset MADD have not been systematic analyzed.Methods:We assessed the MRI pattern and fat infiltration degree of the lower limb muscles in 28 late-onset MADD patients,combined with detailed clinical features and gene spectrum.Fat infiltration degree of the thigh muscle was scored while that ofgluteus was described as obvious or not.Associated muscular atrophy was defined as obvious muscle bulk reduction.Results:The mean scores were significantly different among the anterior,medial,and posterior thigh muscle groups.The mean of fat infiltration scores on posterior thigh muscle group was significantly higher than either anterior or medial thigh muscle group (P < 0.001).Moreover,the mean score on medial thigh muscle group was significantly higher than that of anterior thigh muscle group (P < 0.01).About half of the patients displayed fat infiltration and atrophy in gluteus muscles.Of 28 patients,12 exhibited atrophy in medial and/or posterior thigh muscle groups,especially in posterior thigh muscle group.Muscle edema pattern was not found in all the patients.Conclusions:Late-onset MADD patients show a typical muscular imaging pattern of fat infiltration and atrophy on anterior,posterior,and medial thigh muscle groups,with major involvement of posterior thigh muscle group and gluteus muscles and a sparing involvement of anterior thigh compartment.Our findings also suggest that muscle MRI of

  8. Mitochondrial disorders in congenital myopathies

    Directory of Open Access Journals (Sweden)

    D. A. Kharlamov

    2014-01-01

    Full Text Available The literature review gives data on the role of mitochondrial disorders in the pathogenesis of congenital myopathies: congenital muscular dystrophies and congenital structural myopathies. It describes changes in congenital muscular dystrophies with type VI collagen, in myodystrophy with giant mitochondria, in congenital central core myopathies, myotubular myopathy, etc. Clinical and experimental findings are presented. Approaches to therapy for energy disorders in congenital myopathies are depicted.

  9. STATINS AND MYOPATHY: MOLECULAR MECHANISMS

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2012-01-01

    Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered. 

  10. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis.

    Science.gov (United States)

    Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa

    2013-10-01

    Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  11. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis

    Directory of Open Access Journals (Sweden)

    Aralikatte Onkarappa Saroja

    2013-01-01

    Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  12. Dietary intervention rescues myopathy associated with neurofibromatosis type 1.

    Science.gov (United States)

    Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron

    2018-02-15

    Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For

  13. A knock-in/knock-out mouse model of HSPB8-associated distal hereditary motor neuropathy and myopathy reveals toxic gain-of-function of mutant Hspb8.

    Science.gov (United States)

    Bouhy, Delphine; Juneja, Manisha; Katona, Istvan; Holmgren, Anne; Asselbergh, Bob; De Winter, Vicky; Hochepied, Tino; Goossens, Steven; Haigh, Jody J; Libert, Claude; Ceuterick-de Groote, Chantal; Irobi, Joy; Weis, Joachim; Timmerman, Vincent

    2018-01-01

    Mutations in the small heat shock protein B8 gene (HSPB8/HSP22) have been associated with distal hereditary motor neuropathy, Charcot-Marie-Tooth disease, and recently distal myopathy. It is so far not clear how mutant HSPB8 induces the neuronal and muscular phenotypes and if a common pathogenesis lies behind these diseases. Growing evidence points towards a role of HSPB8 in chaperone-associated autophagy, which has been shown to be a determinant for the clearance of poly-glutamine aggregates in neurodegenerative diseases but also for the maintenance of skeletal muscle myofibrils. To test this hypothesis and better dissect the pathomechanism of mutant HSPB8, we generated a new transgenic mouse model leading to the expression of the mutant protein (knock-in lines) or the loss-of-function (functional knock-out lines) of the endogenous protein Hspb8. While the homozygous knock-in mice developed motor deficits associated with degeneration of peripheral nerves and severe muscle atrophy corroborating patient data, homozygous knock-out mice had locomotor performances equivalent to those of wild-type animals. The distal skeletal muscles of the post-symptomatic homozygous knock-in displayed Z-disk disorganisation, granulofilamentous material accumulation along with Hspb8, αB-crystallin (HSPB5/CRYAB), and desmin aggregates. The presence of the aggregates correlated with reduced markers of effective autophagy. The sciatic nerve of the homozygous knock-in mice was characterized by low autophagy potential in pre-symptomatic and Hspb8 aggregates in post-symptomatic animals. On the other hand, the sciatic nerve of the homozygous knock-out mice presented a normal morphology and their distal muscle displayed accumulation of abnormal mitochondria but intact myofiber and Z-line organisation. Our data, therefore, suggest that toxic gain-of-function of mutant Hspb8 aggregates is a major contributor to the peripheral neuropathy and the myopathy. In addition, mutant Hspb8 induces

  14. Cerebrovascular Accidents In Myopathies

    Directory of Open Access Journals (Sweden)

    Farzad Fatehi

    2017-02-01

    Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.

  15. Muscle regeneration in mitochondrial myopathies

    DEFF Research Database (Denmark)

    Krag, T O; Hauerslev, S; Jeppesen, T D

    2013-01-01

    Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...

  16. Centronuclear myopathy in a Border collie dog.

    Science.gov (United States)

    Eminaga, S; Cherubini, G B; Shelton, G D

    2012-10-01

    A two-year old, male entire Border collie was presented with a one-year history of exercise-induced collapsing on the pelvic limbs. Physical examination revealed generalised muscle atrophy. Neurological examination supported a generalised neuromuscular disorder. Electromyography revealed spontaneous electrical activity in almost all muscles. Unfixed and formaldehyde-fixed biopsy samples were collected from the triceps brachii, longissimus and vastus lateralis muscles. Histopathological, histochemical and ultrastructural examinations of biopsy specimens were consistent with either centronuclear or myotubular myopathy. The dog clinically improved with supportive treatment with L-carnitine, co-enzyme Q10 and vitamin B compound. To the authors' knowledge, this is the first report of centronuclear/myotubular myopathy in a Border collie. © 2012 British Small Animal Veterinary Association.

  17. Inherited myopathies and muscular dystrophies

    NARCIS (Netherlands)

    Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.

    The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and

  18. Becker muscular dystrophy-like myopathy regarded as so-called "fatty muscular dystrophy" in a pig: a case report and its diagnostic method.

    Science.gov (United States)

    Horiuchi, Noriyuki; Aihara, Naoyuki; Mizutani, Hiroshi; Kousaka, Shinichi; Nagafuchi, Tsuneyuki; Ochiai, Mariko; Ochiai, Kazuhiko; Kobayashi, Yoshiyasu; Furuoka, Hidefumi; Asai, Tetsuo; Oishi, Koji

    2014-03-01

    We describe a case of human Becker muscular dystrophy (BMD)-like myopathy that was characterized by the declined stainability of dystrophin at sarcolemma in a pig and the immunostaining for dystrophin on the formalin-fixed, paraffin-embedded (FFPE) tissue. The present case was found in a meat inspection center. The pig looked appeared healthy at the ante-mortem inspection. Muscular abnormalities were detected after carcass dressing as pale, discolored skeletal muscles with prominent fat infiltrations and considered so-called "fatty muscular dystrophy". Microscopic examination revealed following characteristics: diffused fat infiltration into the skeletal muscle and degeneration and regeneration of the remaining skeletal muscle fibers. Any lesions that were suspected of neurogenic atrophy, traumatic muscular degeneration, glycogen storage disease or other porcine muscular disorders were not observed. The immunostaining for dystrophin was conducted and confirmed to be applicable on FFPE porcine muscular tissues and revealed diminished stainability of dystrophin at the sarcolemma in the present case. Based on the histological observations and immunostaining results, the present case was diagnosed with BMD-like myopathy associated with dystrophin abnormality in a pig. Although the genetic properties were not clear, the present BMD-like myopathy implied the occurrence of dystrophinopathy in pigs. To the best of our knowledge, this is the first report of a natural case of myopathy associated with dystrophin abnormalities in a pig.

  19. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.

    Science.gov (United States)

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-03-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  20. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency

    OpenAIRE

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-01-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  1. Influence of chain length of pyrene fatty acids on their uptake and metabolism by Epstein-Barr-virus-transformed lymphoid cell lines from a patient with multisystemic lipid storage myopathy and from control subjects.

    Science.gov (United States)

    Radom, J; Salvayre, R; Levade, T; Douste-Blazy, L

    1990-01-01

    The uptake and intracellular metabolism of 4-(1-pyrene)butanoic acid (P4), 10-(1-pyrene)decanoic acid (P10) and 12-(1-pyrene)dodecanoic acid (P12) were investigated in cultured lymphoid cell lines from normal individuals and from a patient with multisystemic lipid storage myopathy (MLSM). The cellular uptake was shown to be dependent on the fatty-acid chain length, but no significant difference in the uptake of pyrene fatty acids was observed between MLSM and control lymphoid cells. After incubation for 1 h the distribution of fluorescent fatty acids taken up by the lymphoid cell lines also differed with the chain length, most of the fluorescence being associated with phospholipid and triacylglycerols. In contrast with P10 and P12, P4 was not incorporated into neutral lipids. When the cells were incubated for 24 h with the pyrene fatty acids, the amount of fluorescent lipids synthesized by the cells was proportional to the fatty acid concentration in the culture medium. After a 24 h incubation in the presence of P10 or P12, at any concentration, the fluorescent triacylglycerol content of MLSM cells was 2-5-fold higher than that of control cells. Concentrations of pyrene fatty acids higher than 40 microM seemed to be more toxic for mutant cells than for control cells. This cytotoxicity was dependent on the fluorescent-fatty-acid chain length (P12 greater than P10 greater than P4). Pulse-chase experiments permitted one to demonstrate the defect in the degradation of endogenously biosynthesized triacylglycerols in MLSM cells (residual activity was around 10-25% of controls on the basis of half-lives and initial rates of P10- or P12-labelled-triacylglycerol catabolism); MLSM lymphoid cells exhibited a mild phenotypic expression of the lipid storage (less severe than that observed in fibroblasts). P4 was not utilized in the synthesis of triacylglycerols, and thus did not accumulate in MLSM cells: this suggests that natural short-chain fatty acids might induce a lesser

  2. Stepwise approach to myopathy in systemic disease.

    Science.gov (United States)

    Chawla, Jasvinder

    2011-01-01

    Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.

  3. Effect of dietary fats with odd or even numbers of carbon atoms on metabolic response and muscle damage with exercise in Quarter Horse-type horses with type 1 polysaccharide storage myopathy.

    Science.gov (United States)

    Borgia, Lisa A; Valberg, Stephanie J; McCue, Molly E; Pagan, Joe D; Roe, Charles R

    2010-03-01

    To evaluate effects of fats with odd and even numbers of carbon atoms on muscle metabolism in exercising horses with polysaccharide storage myopathy (PSSM). 8 horses with PSSM (6 females and 2 males; mean +/- SD age, 6.3 +/- 3.9 years). Isocaloric diets (grain, triheptanoin, corn oil, and high-fat, low-starch [HFLS] feed) were fed for 3 weeks each; horses performed daily treadmill exercise. Grain was fed to establish an exercise target, and HFLS feed was fed as a negative control diet. Daily plasma samples were obtained. For each diet, a 15-minute exercise test was performed, and gluteus medius muscle specimens and blood samples were obtained before and after exercise. Feeding triheptanoin, compared with the corn oil diet, resulted in exercise intolerance; higher plasma creatine kinase (CK) activity and concentrations of C3:0- and C7:0-acylcarnitine and insulin; and lower concentrations of nonesterified fatty acids (NEFA) and C16:0-, C18:1-, and C18:2-acylcarnitine, without changes in concentrations of plasma glucose or resting muscle substrates and metabolites. Feeding grain induced higher CK activity and insulin concentrations and lower NEFA concentrations than did corn oil or HFLS feed. Feeding grain induced higher glucose concentrations than did triheptanoin and corn oil. In muscle, feeding grain resulted in lower glucose-6-phosphate, higher citrate, and higher postexercise lactate concentrations than did the other diets. Triheptanoin had detrimental effects, reflecting decreased availability of NEFA, increased insulin stimulation of glycogen synthesis, and potential inhibition of lipid oxidation. Long-chain fats are the best dietetic for PSSM.

  4. Exercise training in metabolic myopathies

    DEFF Research Database (Denmark)

    Vissing, J

    2016-01-01

    metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...

  5. Genetics Home Reference: nemaline myopathy

    Science.gov (United States)

    ... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...

  6. Symptomatic lipid storage in carriers for the PNPLA2 gene.

    Science.gov (United States)

    Janssen, Mirian C H; van Engelen, Baziel; Kapusta, Livia; Lammens, Martin; van Dijk, Martin; Fischer, Judith; van der Graaf, Marinette; Wevers, Ron A; Fahrleitner, Manuela; Zimmermann, Robert; Morava, Eva

    2013-08-01

    Neutral lipid storage disease comprises a heterogeneous group of inherited disorders characterized by severe accumulation of cytoplasmic triglyceride droplets in several tissues and neutrophils. A novel type of autosomal recessive lipid myopathy due to PNPLA2 mutations was recently described with associated cardiac disease, myopathy and frequent infections, but without ichthyosis. Here we describe the clinical and biochemical characteristics of a long surviving patient and report on four carrier family members with diverse clinical involvement. Interestingly, heterozygous patients show neutral lipid storage in muscle and in the keratocytes of the skin, Jordans' bodies, mild myopathy and frequent infections. Biochemical analysis of fibroblasts obtained from patients revealed increased triglyceride storage and reduced lipid droplet-associated triglyceride hydrolase activity. Together, our data implicate that the wild-type allele cannot fully compensate for the mutated dysfunctional allele of PNPLA2 leading to triglyceride accumulation in muscle and mild myopathy in PNPLA2 mutation carriers. The presence of neutral lipid droplets in the skin in PNPLA2 mutation carriers strengthens the link between NLSD and other neutral lipid storage diseases with ichthyosis.

  7. Glucocorticoid-induced myopathy in the intensive care unit

    DEFF Research Database (Denmark)

    Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner

    2015-01-01

    Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...

  8. A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome

    Directory of Open Access Journals (Sweden)

    Kang Won Lee

    2015-12-01

    Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.

  9. [Cardiac myopathy due to overt hypothyroidism].

    Science.gov (United States)

    Harbeck, B; Berndt, M J; Lehnert, H

    2014-03-01

    A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.

  10. Endocrine myopathy: Case-based review

    Directory of Open Access Journals (Sweden)

    Babul Reddy Hanmayyagari

    2016-01-01

    Full Text Available Endocrine myopathy means muscle weakness in the presence of an abnormal endocrine state. Most of the endocrine disorders are associated with myopathy and it is usually reversible with correction of the underlying disturbance, though, there is an increasing knowledge of the metabolic effects of hormones, endocrine myopathy is a less recognized and often overlooked entity in clinical practice. Here, we describe this association in three of our patients, then, we discuss systematically about endocrine myopathy.

  11. Changes in cod muscle proteins during frozen storage revealed by proteome analysis and multivariate data analysis

    DEFF Research Database (Denmark)

    Kjærsgård, Inger Vibeke Holst; Nørrelykke, M.R.; Jessen, Flemming

    2006-01-01

    Multivariate data analysis has been combined with proteomics to enhance the recovery of information from 2-DE of cod muscle proteins during different storage conditions. Proteins were extracted according to 11 different storage conditions and samples were resolved by 2-DE. Data generated by 2-DE...... was subjected to principal component analysis (PCA) and discriminant partial least squares regression (DPLSR). Applying PCA to 2-DE data revealed the samples to form groups according to frozen storage time, whereas differences due to different storage temperatures or chilled storage in modified atmosphere...... light chain 1, 2 and 3, triose-phosphate isomerase, glyceraldehyde-3-phosphate dehydrogenase, aldolase A and two ?-actin fragments, and a nuclease diphosphate kinase B fragment to change in concentration, during frozen storage. Application of proteomics, multivariate data analysis and MS/MS to analyse...

  12. Resveratrol and Myopathy

    Science.gov (United States)

    Bastin, Jean; Djouadi, Fatima

    2016-01-01

    Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581

  13. Amyloid myopathy: a diagnostic challenge

    Directory of Open Access Journals (Sweden)

    Heli Tuomaala

    2009-08-01

    Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.

  14. Idiopathic Inflammatory Myopathies: An update

    Directory of Open Access Journals (Sweden)

    Bulent KURT

    2016-06-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45

  15. Localized scleroderma and regional inflammatory myopathy.

    Science.gov (United States)

    Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A

    2014-05-01

    Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.

  16. Technological quality, mineral profile, and sensory attributes of broiler chicken breasts affected by White Striping and Wooden Breast myopathies.

    Science.gov (United States)

    Tasoniero, G; Cullere, M; Cecchinato, M; Puolanne, E; Dalle Zotte, A

    2016-11-01

    The aim of the research was to study the impact of white striping and wooden breast myopathies on the technological quality, mineral, and sensory profile of poultry meat. With this purpose, a total of 138 breasts were selected for a control group with normal breasts (N), a group of breasts characterised by white striping (WS) myopathy, and a group of breasts having both white striping and wooden breast myopathies (WSWB). Data revealed that the simultaneous presence of the two myopathies, with respect to the WS lesion individually considered, had a further detrimental effect on pH (6.04 vs. 5.96; P white striping and wooden breast myopathies. © 2016 Poultry Science Association Inc.

  17. Search for Pompe disease among patients with undetermined myopathies.

    Science.gov (United States)

    Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A

    2015-07-20

    Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    International Nuclear Information System (INIS)

    Ohana, Mickael; Durand, Marie-Christine; Marty, Catherine; Lazareth, Jean-Philippe; Maisonobe, Thierry; Mompoint, Dominique; Carlier, Robert-Yves

    2014-01-01

    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  19. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Ohana, Mickael [Nouvel Hopital Civil - Hopitaux Universitaires de Strasbourg, Service de Radiologie B, Strasbourg (France); Durand, Marie-Christine [AP-HP - Hopital Raymond Poincare, Service de Neurologie, Garches (France); Marty, Catherine; Lazareth, Jean-Philippe [AP-HP - Hopital Raymond Poincare, Service de Rhumatologie, Garches (France); Maisonobe, Thierry [APH-HP - Hopital de la Pitie-Salpetriere, Service de Neuropathologie, Paris (France); Mompoint, Dominique; Carlier, Robert-Yves [AP-HP - Hopital Raymond Poincare, Service de Radiologie, Garches (France)

    2014-08-15

    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  20. LAMA2-related myopathy

    DEFF Research Database (Denmark)

    Løkken, Nicoline; Born, Alfred Peter; Duno, Morten

    2015-01-01

    INTRODUCTION: Muscular dystrophy caused by LAMA2-gene mutations is an autosomal recessive disease typically presenting as a severe, early-onset congenital muscular dystrophy (CMD). However, milder cases with a limb-girdle type muscular dystrophy (LGMD) have been described. METHODS: In this study......, we assessed the frequency and phenotypic spectrum of LAMA2-related muscular dystrophy in CMD (n = 18) and LGMD2 (n = 128) cohorts identified in the last 15 years in eastern Denmark. The medical history, brain-MRI, muscle pathology, muscle laminin-α2 expression, and genetic analyses were assessed....... RESULTS: Molecular genetics revealed 2 pathogenic LAMA2 mutations in 5 of 18 CMD and 3 of 128 LGMD patients, corresponding to a LAMA2-mutation frequency of 28% in the CMD and 2.3% in the LGMD cohorts, respectively. CONCLUSIONS: This study demonstrates a wide clinical spectrum of LAMA2-related muscular...

  1. Suspected myofibrillar myopathy in Arabian horses with a history of exertional rhabdomyolysis.

    Science.gov (United States)

    Valberg, S J; McKenzie, E C; Eyrich, L V; Shivers, J; Barnes, N E; Finno, C J

    2016-09-01

    Although exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER. To prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER). Prospective and retrospective histopathological description. Middle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests. Centrally located myonuclei in mature myofibres were found in significantly more (Prhabdomyolysis, ectopic accumulation of cytoskeletal proteins and Z-disc degeneration bear a strong resemblance to a myofibrillar myopathy. While many of these horses were previously diagnosed with type 2 polysaccharide storage myopathy, pools of glycogen forming within disrupted myofibrils appeared to give the false appearance of a glycogen storage disorder. © 2015 EVJ Ltd.

  2. Genetics Home Reference: idiopathic inflammatory myopathy

    Science.gov (United States)

    ... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...

  3. Insuficiências respiratória e renal desencadeadas por miopatia metabólica por acúmulo de lipídios: relato de caso Respiratory and renal dysfunctions due to lipid storage metabolic myopathy: case report

    Directory of Open Access Journals (Sweden)

    Walther de Oliveira Campos Filho

    2002-09-01

    Full Text Available Relatamos o caso de um paciente de 26 anos que apresentou quadro clínico de rabdomiólise e mioglobinúria associadas a insuficiência renal e respiratória, três dias após o início de infecção de vias aéreas superiores. Os dados clínicos e laboratoriais, eletroneuromiografia e biópsia muscular conduziram ao diagnóstico de miopatia metabólica por deficiência enzimática relacionada ao metabolismo dos ácidos graxos. O paciente evoluiu favoravelmente com a instituição de suporte avançado de vida, incluindo assistência ventilatória e terapia dialítica, adequação dietética e reposição de L-carnitina. Discorremos sobre as diversas miopatias metabólicas, o diagnóstico, o diagnóstico diferencial e o tratamento.We report a case of a 26-years old male patient with rhabdomyolisis with myoglobinuria associated with acute renal and respiratory failure, that occurred three days after upper airway infection. In the clinical and laboratory investigation of the patient, including electromyography and muscular biopsy, the diagnostic lead to a metabolic myopathy due to an enzymatic deficiency related to a disorder of lipid metabolism. The patient improved successfully with institution of advanced life support, including ventilatory assistence, dialysis, dietary adjust and L-carnitine reposition.

  4. Lipid myopathy associated with renal tubular acidosis and spastic diplegia in two brothers.

    Science.gov (United States)

    Tung, Y C; Tsau, Y K; Chu, L W; Young, C; Shen, Y Z

    2001-07-01

    Lipid myopathy is a group of disorders involving mitochondrial fatty acid oxidation. We describe two brothers, 3 years 8 months old and 2 years 9 months old, respectively, with progressive spastic diplegia, developmental delay, failure to thrive, and chronic metabolic acidosis who had lipid myopathy and renal tubular acidosis. Brain magnetic resonance imaging revealed demyelinating changes in the periventricular white matter, which was compatible with spastic diplegia. These symptoms may be related to errors in fatty acid metabolism. Cerebral palsy had been misdiagnosed in both of these patients at another hospital. Therefore, for patients with late-onset and progressive spastic diplegia, detailed investigations for underlying diseases are warranted.

  5. Understanding mitochondrial myopathies: a review

    Directory of Open Access Journals (Sweden)

    Abhimanyu S. Ahuja

    2018-05-01

    Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.

  6. An integrated diagnosis strategy for congenital myopathies.

    Directory of Open Access Journals (Sweden)

    Johann Böhm

    Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.

  7. Systemic calciphylaxis presenting as a painful, proximal myopathy.

    OpenAIRE

    Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.

    1992-01-01

    A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.

  8. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy

    NARCIS (Netherlands)

    Westermann, C. M.; Dorland, L.; Votion, D. M.; de Sain-van der Velden, M. G. M.; Wijnberg, I. D.; Wanders, R. J. A.; Spliet, W. G. M.; Testerink, N.; Berger, R.; Ruiter, J. P. N.; van der Kolk, J. H.

    2008-01-01

    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid,

  9. Adult-onset nemaline myopathy presenting as respiratory failure.

    LENUS (Irish Health Repository)

    Kelly, Emer

    2008-11-01

    Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.

  10. Zircon reveals protracted magma storage and recycling beneath Mount St. Helens

    Science.gov (United States)

    Claiborne, L.L.; Miller, C.F.; Flanagan, D.M.; Clynne, M.A.; Wooden, J.L.

    2010-01-01

    Current data and models for Mount St. Helens volcano (Washington, United States) suggest relatively rapid transport from magma genesis to eruption, with no evidence for protracted storage or recycling of magmas. However, we show here that complex zircon age populations extending back hundreds of thousands of years from eruption age indicate that magmas regularly stall in the crust, cool and crystallize beneath the volcano, and are then rejuvenated and incorporated by hotter, young magmas on their way to the surface. Estimated dissolution times suggest that entrained zircon generally resided in rejuvenating magmas for no more than about a century. Zircon elemental compositions reflect the increasing influence of mafic input into the system through time, recording growth from hotter, less evolved magmas tens of thousands of years prior to the appearance of mafic magmas at the surface, or changes in whole-rock geochemistry and petrology, and providing a new, time-correlated record of this evolution independent of the eruption history. Zircon data thus reveal the history of the hidden, long-lived intrusive portion of the Mount St. Helens system, where melt and crystals are stored for as long as hundreds of thousands of years and interact with fresh influxes of magmas that traverse the intrusive reservoir before erupting. ?? 2010 Geological Society of America.

  11. Myopathies of endocrine disorders: A prospective clinical and biochemical study

    Directory of Open Access Journals (Sweden)

    Vikas Sharma

    2014-01-01

    Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.

  12. Climate model biases in seasonality of continental water storage revealed by satellite gravimetry

    Science.gov (United States)

    Swenson, Sean; Milly, P.C.D.

    2006-01-01

    Satellite gravimetric observations of monthly changes in continental water storage are compared with outputs from five climate models. All models qualitatively reproduce the global pattern of annual storage amplitude, and the seasonal cycle of global average storage is reproduced well, consistent with earlier studies. However, global average agreements mask systematic model biases in low latitudes. Seasonal extrema of low‐latitude, hemispheric storage generally occur too early in the models, and model‐specific errors in amplitude of the low‐latitude annual variations are substantial. These errors are potentially explicable in terms of neglected or suboptimally parameterized water stores in the land models and precipitation biases in the climate models.

  13. Acute steroid myopathy: a highly overlooked entity.

    Science.gov (United States)

    Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev

    2018-02-15

    Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.

  14. Global terrestrial water storage connectivity revealed using complex climate network analyses

    Science.gov (United States)

    Sun, A. Y.; Chen, J.; Donges, J.

    2015-07-01

    Terrestrial water storage (TWS) exerts a key control in global water, energy, and biogeochemical cycles. Although certain causal relationship exists between precipitation and TWS, the latter quantity also reflects impacts of anthropogenic activities. Thus, quantification of the spatial patterns of TWS will not only help to understand feedbacks between climate dynamics and the hydrologic cycle, but also provide new insights and model calibration constraints for improving the current land surface models. This work is the first attempt to quantify the spatial connectivity of TWS using the complex network theory, which has received broad attention in the climate modeling community in recent years. Complex networks of TWS anomalies are built using two global TWS data sets, a remote sensing product that is obtained from the Gravity Recovery and Climate Experiment (GRACE) satellite mission, and a model-generated data set from the global land data assimilation system's NOAH model (GLDAS-NOAH). Both data sets have 1° × 1° grid resolutions and cover most global land areas except for permafrost regions. TWS networks are built by first quantifying pairwise correlation among all valid TWS anomaly time series, and then applying a cutoff threshold derived from the edge-density function to retain only the most important features in the network. Basinwise network connectivity maps are used to illuminate connectivity of individual river basins with other regions. The constructed network degree centrality maps show the TWS anomaly hotspots around the globe and the patterns are consistent with recent GRACE studies. Parallel analyses of networks constructed using the two data sets reveal that the GLDAS-NOAH model captures many of the spatial patterns shown by GRACE, although significant discrepancies exist in some regions. Thus, our results provide further measures for constraining the current land surface models, especially in data sparse regions.

  15. Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B

    2017-11-01

    Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  16. Skeletal muscle repair in a mouse model of nemaline myopathy.

    Science.gov (United States)

    Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H

    2006-09-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

  17. A case of congenital myopathy masquerading as paroxysmal dyskinesia

    Directory of Open Access Journals (Sweden)

    Harsh Patel

    2014-01-01

    Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.

  18. Leiomodin-3-deficient mice display nemaline myopathy with fast-myofiber atrophy

    Directory of Open Access Journals (Sweden)

    Lei Tian

    2015-06-01

    Full Text Available Nemaline myopathy (NM is one of the most common forms of congenital myopathy, and affects either fast myofibers, slow myofibers, or both. However, an animal model for congenital myopathy with fast-myofiber-specific atrophy is not available. Furthermore, mutations in the leiomodin-3 (LMOD3 gene have recently been identified in a group of individuals with NM. However, it is not clear how loss of LMOD3 leads to NM. Here, we report a mouse mutant in which the piggyBac (PB transposon is inserted into the Lmod3 gene and disrupts its expression. Lmod3PB/PB mice show severe muscle weakness and postnatal growth retardation. Electron microscopy and immunofluorescence studies of the mutant skeletal muscles revealed the presence of nemaline bodies, a hallmark of NM, and disorganized sarcomeric structures. Interestingly, Lmod3 deficiency caused muscle atrophy specific to the fast fibers. Together, our results show that Lmod3 is required in the fast fibers for sarcomere integrity, and this study offers the first NM mouse model with muscle atrophy that is specific to fast fibers. This model could be a valuable resource for interrogating myopathy pathogenesis and developing therapeutics for NM as well as other pathophysiological conditions with preferential atrophy of fast fibers, including cancer cachexia and sarcopenia.

  19. Evidence for marsh mallow (Malva parviflora) toxicosis causing myocardial disease and myopathy in four horses.

    Science.gov (United States)

    Bauquier, J; Stent, A; Gibney, J; Jerrett, I; White, J; Tennent-Brown, B; Pearce, A; Pitt, J

    2017-05-01

    Investigation of toxicosis caused by Malva parviflora was required after 4 horses from the same farm developed severe muscle fasciculations, tachycardia, sweating and periods of recumbency leading to death or euthanasia after ingesting the plant. To describe historical, clinical, clinicopathological and pathological findings of 4 horses with suspected M. parviflora toxicosis. The role of cyclopropene fatty acids (found in M. parviflora) and mechanism for toxicosis are proposed. Case series. Historical, physical examination, clinicopathological and pathological findings are reported. Due to similarities with atypical myopathy or seasonal pasture myopathy acyl carnitine profiles were performed on sera from 2 cases and equine controls. Presence of cyclopropene fatty acids was also examined in sera of 2 cases. M. parviflora had been heavily grazed by the horses with little other feed available. Horse 1 deteriorated rapidly and was subjected to euthanasia. Horse 2 was referred to hospital where severe myocardial disease and generalised myopathy was determined; this horse was subjected to euthanasia 36 h after admission. Horse 3 died rapidly and Horse 4 was subjected to euthanasia at onset of clinical signs. Post-mortem examinations performed on 3 horses revealed acute, multifocal cardiac and skeletal myonecrosis. Myocyte glycogen accumulation was absent when examined in Horse 2. Acyl carnitine profiles revealed increased C14-C18 acyl carnitine concentrations in cases relative to controls. Cyclopropene fatty acids were detected in sera of cases but not controls. These findings suggest aetiology different to that of atypical myopathy or seasonal pasture myopathy. We hypothesise that cyclopropene fatty acids in M. parviflora interfere with fatty acid β-oxidation in horses in negative energy balance, causing the clinical signs and abnormal acyl carnitine profiles. These equine cases suggest a pathophysiological course that closely mimics the human genetic condition very

  20. Evaluation of ubiquinone concentration and mitochondrial function relative to cerivastatin-induced skeletal myopathy in rats

    International Nuclear Information System (INIS)

    Schaefer, William H.; Lawrence, Jeffery W.; Loughlin, Amy F.; Stoffregen, Dana A.; Mixson, Lori A.; Dean, Dennis C.; Raab, Conrad E.; Yu, Nathan X.; Lankas, George R.; Frederick, Clay B.

    2004-01-01

    As a class, hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors can potentially cause skeletal myopathy. One statin, cerivastatin, has recently been withdrawn from the market due to an unacceptably high incidence of rhabdomyolysis. The mechanism underlying statin-induced myopathy is unknown. This paper sought to investigate the relationship among statin-induced myopathy, mitochondrial function, and muscle ubiquinone levels. Rats were administered cerivastatin at 0.1, 0.5, and 1.0 (mg/kg)/day or dose vehicle (controls) by oral gavage for 15 days. Samples of type I-predominant skeletal muscle (soleus) and type II-predominant skeletal muscle [quadriceps and extensor digitorum longus (EDL)], and blood were collected on study days 5, 10, and 15 for morphological evaluation, clinical chemistry, mitochondrial function tests, and analysis of ubiquinone levels. No histological changes were observed in any of the animals on study days 5 or 10, but on study day 15, mid- and high-dose animals had necrosis and inflammation in type II skeletal muscle. Elevated creatine kinase (CK) levels in blood (a clinical marker of myopathy) correlated with the histopathological diagnosis of myopathy. Ultrastructural characterization of skeletal muscle revealed disruption of the sarcomere and altered mitochondria only in myofibers with degeneration, while adjacent myofibers were unaffected and had normal mitochondria. Thus, mitochondrial effects appeared not to precede myofiber degeneration. Mean coenzyme Q9 (CoQ9) levels in all dose groups were slightly decreased relative to controls in type II skeletal muscle, although the difference was not significantly different in most cases. Mitochondrial function in skeletal muscle was not affected by the changes in ubiquinone levels. The ubiquinone levels in high-dose-treated animals exhibiting myopathy were not significantly different from low-dose animals with no observable toxic effects. Furthermore, ubiquinone levels did not correlate

  1. Aerobic Training in Patients with Congenital Myopathy

    DEFF Research Database (Denmark)

    Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen

    2016-01-01

    INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066....

  2. Comprehensive metabolomic study of platelets reveals the expression of discrete metabolic phenotypes during storage

    DEFF Research Database (Denmark)

    Paglia, Giuseppe; Sigurjónsson, Ólafur E; Rolfsson, Óttar

    2014-01-01

    performed on both the extracellular and the intracellular environments. During storage we measured 174 different variables in 6 PLT units, collected by apheresis. Samples were collected at eight different time points resulting in a data set containing more than 8000 measurements. RESULTS: Stored PLTs did...

  3. The expanding phenotype of mitochondrial myopathy.

    Science.gov (United States)

    DiMauro, Salvatore; Gurgel-Giannetti, Juliana

    2005-10-01

    Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  4. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. [Bonn Univ. (Germany); Knapp, F.F. [Oak Ridge National Lab., TN (United States)

    1992-03-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  5. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-(I-123)iodophenyl) pentadecanoic acid (IPPA) SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. (Bonn Univ. (Germany)); Knapp, F.F. (Oak Ridge National Lab., TN (United States))

    1992-01-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-(I-123)iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  6. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    International Nuclear Information System (INIS)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St.; Knapp, F.F.

    1992-01-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of β-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques

  7. A Case of Myopathy, Encephalopathy, Lactic Acidosis and Stroke-Like Episodes (MELAS) Syndrome with Intracardiac Thrombus [corrected].

    Science.gov (United States)

    Joo, Jung-Chul; Seol, Myung Do; Yoon, Jin Won; Lee, Young Soo; Kim, Dong-Keun; Choi, Yong Hoon; Ahn, Hyo Seong; Cho, Wook Hyun

    2013-03-01

    Myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystem clinical syndrome manifested by mitochondrial myopathy, encephalopathy, lactic acidosis and recurrent stroke-like episodes. A 27-year-old female with MELAS syndrome presented with cerebral infarction. Echocardiography revealed a thrombus attached to the apex of the hypertrophied left ventricle, with decreased systolic function. The embolism of the intracardiac thrombus might have been the cause of stroke. There should be more consideration given to the increased possibility of intracardiac thrombus formation when a MELAS patient with cardiac involvement is encountered.

  8. Water Storage Changes over the Tibetan Plateau Revealed by GRACE Mission

    Science.gov (United States)

    Guo, Jinyun; Mu, Dapeng; Liu, Xin; Yan, Haoming; Sun, Zhongchang; Guo, Bin

    2016-04-01

    We use GRACE gravity data released by the Center for Space Research (CSR) and the Groupe de Recherches en Geodesie Spatiale (GRGS) to detect the water storage changes over the Tibetan Plateau (TP). A combined filter strategy is put forward to process CSR RL05 data to remove the effect of striping errors. After the correction for GRACE by GLDAS and ICE-5G, we find that TP has been overall experiencing the water storage increase during 2003-2012. During the same time, the glacier over the Himalayas was sharply retreating. Interms of linear trends, CSR's results derived by the combined filter are close to GRGS RL03 with the Gaussian filter of 300-km window. The water storage increasing rates determined from CSR's RL05 products in the interior TP, Karakoram Mountain, Qaidam Basin, Hengduan Mountain, and middle Himalayas are 9.7, 6.2, 9.1,-18.6, and-20.2 mm/yr, respectively. These rates from GRGS's RL03 products are 8.6, 5.8, 10.5,-19.3 and-21.4 mm/yr, respectively.

  9. Hereditary myopathies with early respiratory insufficiency in adults.

    Science.gov (United States)

    Naddaf, Elie; Milone, Margherita

    2017-11-01

    Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.

  10. Meeting the challenges in the diagnosis of inflammatory myopathies ...

    African Journals Online (AJOL)

    Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...

  11. Treatment Opportunities in Patients With Metabolic Myopathies

    DEFF Research Database (Denmark)

    Ørngreen, Mette Cathrine; Vissing, John

    2017-01-01

    the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...

  12. Exertional Myopathy in a Juvenile Green Sea Turtle (Chelonia mydas Entangled in a Large Mesh Gillnet

    Directory of Open Access Journals (Sweden)

    Brianne E. Phillips

    2015-01-01

    Full Text Available A juvenile female green sea turtle (Chelonia mydas was found entangled in a large mesh gillnet in Pamlico Sound, NC, and was weak upon presentation for treatment. Blood gas analysis revealed severe metabolic acidosis and hyperlactatemia. Plasma biochemistry analysis showed elevated aspartate aminotransferase and creatine kinase, marked hypercalcemia, hyperphosphatemia, and hyperkalemia. Death occurred within 24 hours of presentation despite treatment with intravenous and subcutaneous fluids and sodium bicarbonate. Necropsy revealed multifocal to diffuse pallor of the superficial and deep pectoral muscles. Mild, multifocal, and acute myofiber necrosis was identified by histopathological examination. While histological changes in the examined muscle were modest, the acid-base, mineral, and electrolyte abnormalities were sufficiently severe to contribute to this animal’s mortality. Exertional myopathy in reptiles has not been well characterized. Sea turtle mortality resulting from forced submergence has been attributed to blood gas derangements and seawater aspiration; however, exertional myopathy may also be an important contributing factor. If possible, sea turtles subjected to incidental capture and entanglement that exhibit weakness or dull mentation should be clinically evaluated prior to release to minimize the risk of delayed mortality. Treatment with appropriate fluid therapy and supportive care may mitigate the effects of exertional myopathy in some cases.

  13. Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.

    Science.gov (United States)

    Karalliedde, Lakshman; Baker, David; Marrs, Timothy C

    2006-01-01

    -15 days and even up to 21 days. Weaning from ventilatory care is best carried out in stages, with provision of continuous positive airway pressure prior to complete weaning. Continuous and close monitoring of respiratory function (arterial oxygen saturation, partial pressure of oxygen in arterial blood, partial pressure of carbon dioxide in arterial blood) and acid-base status are an absolute necessity. Prophylactic antibiotics are usually not required unless there has been evidence of aspiration of material into the lungs. Close monitoring of fluid and electrolyte balance is mandatory in view of the profuse offensive diarrhoea that most patients develop. Maintenance of nutrition, physiotherapy, prevention of bed sores and other routine measures to minimise discomfort during ventilatory care are necessary. Recovery from the intermediate syndrome is normally complete and without any sequelae. The usefulness of oximes during the IMS remains uncertain. In animal experiments, very early administration of oximes has prevented the occurrence of myopathy. There are reports from developed countries where administration of oximes at recommended doses and within 2 hours of ingestion of OP insecticide did not prevent the onset of the IMS. Controlled randomised clinical studies are necessary to evaluate the efficacy of oximes in combating the IMS. Electrophysiological studies following OP poisoning have revealed three characteristic phenomena: (i) repetitive firing following a single stimulus; (ii) gradual reduction in twitch height or compound muscle action potential followed by an increase with repetitive stimulation (the 'decrement-increment response'); and (iii) continued reduction in twitch height or compound muscle action potential with repetitive simulation ('decrementing response'). Of these, the decrementing response is the most frequent finding during the IMS, whilst repetitive firing is observed during the acute cholinergic syndrome. The distribution of the weakness in

  14. Transcriptome Analysis of Polyhydroxybutyrate Cycle Mutants Reveals Discrete Loci Connecting Nitrogen Utilization and Carbon Storage in Sinorhizobium meliloti.

    Science.gov (United States)

    D'Alessio, Maya; Nordeste, Ricardo; Doxey, Andrew C; Charles, Trevor C

    2017-01-01

    Polyhydroxybutyrate (PHB) and glycogen polymers are produced by bacteria as carbon storage compounds under unbalanced growth conditions. To gain insights into the transcriptional mechanisms controlling carbon storage in Sinorhizobium meliloti , we investigated the global transcriptomic response to the genetic disruption of key genes in PHB synthesis and degradation and in glycogen synthesis. Under both nitrogen-limited and balanced growth conditions, transcriptomic analysis was performed with genetic mutants deficient in PHB synthesis ( phbA , phbB , phbAB , and phbC ), PHB degradation ( bdhA , phaZ , and acsA2 ), and glycogen synthesis ( glgA1 ). Three distinct genomic regions of the pSymA megaplasmid exhibited altered expression in the wild type and the PHB cycle mutants that was not seen in the glycogen synthesis mutant. An Fnr family transcriptional motif was identified in the upstream regions of a cluster of genes showing similar transcriptional patterns across the mutants. This motif was found at the highest density in the genomic regions with the strongest transcriptional effect, and the presence of this motif upstream of genes in these regions was significantly correlated with decreased transcript abundance. Analysis of the genes in the pSymA regions revealed that they contain a genomic overrepresentation of Fnr family transcription factor-encoding genes. We hypothesize that these loci, containing mostly nitrogen utilization, denitrification, and nitrogen fixation genes, are regulated in response to the intracellular carbon/nitrogen balance. These results indicate a transcriptional regulatory association between intracellular carbon levels (mediated through the functionality of the PHB cycle) and the expression of nitrogen metabolism genes. IMPORTANCE The ability of bacteria to store carbon and energy as intracellular polymers uncouples cell growth and replication from nutrient uptake and provides flexibility in the use of resources as they are available to

  15. Genetics Home Reference: neutral lipid storage disease with myopathy

    Science.gov (United States)

    ... named? Additional Information & Resources MedlinePlus (6 links) Encyclopedia: Hypothyroidism Encyclopedia: Type 2 Diabetes Health Topic: Cardiomyopathy Health Topic: Lipid Metabolism Disorders Health Topic: Muscle Disorders Health Topic: Pancreatitis Genetic and Rare Diseases ...

  16. Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A

    Energy Technology Data Exchange (ETDEWEB)

    Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others

    1995-08-28

    The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.

  17. The physics of highly charged heavy ions revealed by storage/cooler rings

    International Nuclear Information System (INIS)

    Mokler, P.H.; Stoehlker, T.

    1996-01-01

    With the successful commissioning of storage and cooler rings for bright beams of very heavy ions near the threshold of the last decade of this century, not only did a prosperous development in heavy ion accelerator technology come to its present summit, but also fundamental fields in heavy ion physics were opened widely for exciting explorations. Now, essential aspects in this area are accessible, aspects one only dared to dream of another decade ago. In the meantime, great progress already has been made in the fundamental physics in this field. This is particularly true for achievements in the atomic physics of highly charged heavy ions. In this chapter, we present a review of the current advances in this rapidly developing field. There are two general domains to be considered in the atomic physics of highly charged heavy ions: the fields of collisions and of atomic structure. Both aspects have to be explored equally, as they are strongly interconnected. One has to investigate the interaction processes to know, for instance, the population of excited states to help answer questions on the atomic structure; and conversely, one has to know the structure to understand the interactions. In both the fields, fundamental principles can be studied uniquely. This is in particular true for the heaviest ion species with only a few- or even zero-electrons left. 140 refs., 39 figs

  18. [Biologic therapy in idiopathic inflammatory myopathy].

    Science.gov (United States)

    Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M

    2014-09-15

    The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  19. Flaccid quadriplegia due to thyrotoxic myopathy.

    Science.gov (United States)

    Couillard, Philippe; Wijdicks, Eelco F M

    2014-04-01

    Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.

  20. Mitochondrial dysfunction in human skeletal muscle biopsies of lipid storage disorder.

    Science.gov (United States)

    Debashree, Bandopadhyay; Kumar, Manish; Keshava Prasad, Thottethodi Subrahmanya; Natarajan, Archana; Christopher, Rita; Nalini, Atchayaram; Bindu, Parayil Sankaran; Gayathri, Narayanappa; Srinivas Bharath, Muchukunte Mukunda

    2018-02-09

    Mitochondria regulate the balance between lipid metabolism and storage in the skeletal muscle. Altered lipid transport, metabolism and storage influence the bioenergetics, redox status and insulin signalling, contributing to cardiac and neurological diseases. Lipid storage disorders (LSDs) are neurological disorders which entail intramuscular lipid accumulation and impaired mitochondrial bioenergetics in the skeletal muscle causing progressive myopathy with muscle weakness. However, the mitochondrial changes including molecular events associated with impaired lipid storage have not been completely understood in the human skeletal muscle. We carried out morphological and biochemical analysis of mitochondrial function in muscle biopsies of human subjects with LSDs (n = 7), compared to controls (n = 10). Routine histology, enzyme histochemistry and ultrastructural analysis indicated altered muscle cell morphology and mitochondrial structure. Protein profiling of the muscle mitochondria from LSD samples (n = 5) (vs. control, n = 5) by high-throughput mass spectrometric analysis revealed that impaired metabolic processes could contribute to mitochondrial dysfunction and ensuing myopathy in LSDs. We propose that impaired fatty acid and respiratory metabolism along with increased membrane permeability, elevated lipolysis and altered cristae entail mitochondrial dysfunction in LSDs. Some of these mechanisms were unique to LSD apart from others that were common to dystrophic and inflammatory muscle pathologies. Many differentially regulated mitochondrial proteins in LSD are linked with other human diseases, indicating that mitochondrial protection via targeted drugs could be a treatment modality in LSD and related metabolic diseases. © 2018 International Society for Neurochemistry.

  1. Groundwater storage changes in the Tibetan Plateau and adjacent areas revealed from GRACE satellite gravity data

    Science.gov (United States)

    Xiang, Longwei; Wang, Hansheng; Steffen, Holger; Wu, Patrick; Jia, Lulu; Jiang, Liming; Shen, Qiang

    2016-09-01

    Understanding groundwater storage (GWS) changes is vital to the utilization and control of water resources in the Tibetan Plateau. However, well level observations are rare in this big area, and reliable hydrology models including GWS are not available. We use hydro-geodesy to quantitate GWS changes in the Tibetan Plateau and surroundings from 2003 to 2009 using a combined analysis of satellite gravity and satellite altimetry data, hydrology models as well as a model of glacial isostatic adjustment (GIA). Release-5 GRACE gravity data are jointly used in a mascon fitting method to estimate the terrestrial water storage (TWS) changes during the period, from which the hydrology contributions and the GIA effects are effectively deducted to give the estimates of GWS changes for 12 selected regions of interest. The hydrology contributions are carefully calculated from glaciers and lakes by ICESat-1 satellite altimetry data, permafrost degradation by an Active-Layer Depth (ALD) model, soil moisture and snow water equivalent by multiple hydrology models, and the GIA effects are calculated with the new ICE-6G_C (VM5a) model. Taking into account the measurement errors and the variability of the models, the uncertainties are rigorously estimated for the TWS changes, the hydrology contributions (including GWS changes) and the GIA effect. For the first time, we show explicitly separated GWS changes in the Tibetan Plateau and adjacent areas except for those to the south of the Himalayas. We find increasing trend rates for eight basins: + 2.46 ± 2.24 Gt/yr for the Jinsha River basin, + 1.77 ± 2.09 Gt/yr for the Nujiang-Lancangjiang Rivers Source Region, + 1.86 ± 1.69 Gt/yr for the Yangtze River Source Region, + 1.14 ± 1.39 Gt/yr for the Yellow River Source Region, + 1.52 ± 0.95 Gt/yr for the Qaidam basin, + 1.66 ± 1.52 Gt/yr for the central Qiangtang Nature Reserve, + 5.37 ± 2.17 Gt/yr for the Upper Indus basin and + 2.77 ± 0.99 Gt/yr for the Aksu River basin. All these

  2. Internal Domains of Natural Porous Media Revealed: Critical Locations for Transport, Storage, and Chemical Reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zachara, John M.; Brantley, Susan L.; Chorover, Jon D.; Ewing, Robert P.; Kerisit, Sebastien N.; Liu, Chongxuan; Perfect, E.; Rother, Gernot; Stack, Andrew G.

    2016-03-16

    Internal pore domains exist within rocks, lithic fragments, subsurface sediments and soil aggregates. These domains, which we term internal domains in porous media (IDPM), contain a significant fraction of their porosity as nanopores, dominate the reactive surface area of diverse porous media types, and are important locations for chemical reactivity and hydrocarbon storage. Traditionally difficult to interrogate, advances in instrumentation and imaging methods are providing new insights on the physical structures and chemical attributes of IDPM. In this review we: discuss analytical methods to characterize IDPM, evaluate what has been learned about their size distributions, connectivity, and extended structures; determine whether they exhibit unique chemical reactivity; and assess potential for their inclusion in reactive transport models. Three key findings are noteworthy. 1) A combination of methods now allows complete characterization of the porosity spectrum of natural materials and its connectivity; while imaging microscopies are providing three dimensional representations of the interconnected pore network. 2) Chemical reactivity in pores <10 nm is expected to be different from micro and macropores, yet research performed to date is inconclusive on the nature, direction, and magnitude of effect. 3) Existing continuum reactive transport models treat IDPM as a sub-grid feature with average, empirical, scale-dependent parameters; and are not formulated to include detailed information on pore networks. Overall we find that IDPM are key features controlling hydrocarbon release from shales in hydrofracking systems, organic matter stabilization and recalcitrance in soil, weathering and soil formation, and long term inorganic and organic contaminant behavior in the vadose zone and groundwater. We conclude with an assessment of impactful research opportunities to advance understanding of IDPM, and to incorporate their important effects in reactive transport models

  3. Radiological features of Paget disease of bone associated with VCP myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)

    2012-03-15

    Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)

  4. Mutation-specific effects on thin filament length in thin filament myopathy.

    Science.gov (United States)

    Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C

    2016-06-01

    Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.

  5. Atypical presentation of GNE myopathy with asymmetric hand weakness

    Science.gov (United States)

    de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria

    2014-01-01

    GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749

  6. Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy

    Science.gov (United States)

    ... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...

  7. Statin Induced Myopathy a Patient with Multiple Systemic Diseases

    Directory of Open Access Journals (Sweden)

    Özgül Uçar

    2011-04-01

    Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.

  8. Blocked muscle fat oxidation during exercise in neutral lipid storage disease

    DEFF Research Database (Denmark)

    Laforêt, Pascal; Ørngreen, Mette; Preisler, Nicolai

    2012-01-01

    To determine whether impaired exercise capacity in neutral lipid storage disease with myopathy is solely caused by muscle weakness or whether a defect in energy metabolism (blocked fat oxidation) may also play a role.......To determine whether impaired exercise capacity in neutral lipid storage disease with myopathy is solely caused by muscle weakness or whether a defect in energy metabolism (blocked fat oxidation) may also play a role....

  9. Congenital myopathy is caused by mutation of HACD1

    OpenAIRE

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti

    2013-01-01

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...

  10. Skeletal muscle repair in a mouse model of nemaline myopathy

    OpenAIRE

    Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.

    2006-01-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...

  11. Aerobic Training in Patients with Congenital Myopathy.

    Directory of Open Access Journals (Sweden)

    Gitte Hedermann

    Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066.

  12. Association between statin-associated myopathy and skeletal muscle damage.

    Science.gov (United States)

    Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette

    2009-07-07

    Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.

  13. OCULAR ASPECTS OF HYPERTHYROIDISM WITH SPECIAL REFERENCE TO OCULAR MYOPATHY

    Directory of Open Access Journals (Sweden)

    Mallika O. U

    2017-04-01

    Full Text Available BACKGROUND Hyperthyroidism can result in ocular manifestations even before systemic signs and symptoms develop. It is seen more in females and severe forms are more common in males. Early detection of ocular involvement can prevent vision threatening complications and troublesome discomforts affecting quality of vision. This clinical study highlights the importance of detailed ocular examination in hyperthyroidism. MATERIALS AND METHODS Fifty consecutive patients with ocular signs of hyperthyroidism were evaluated and followed up for an average period of 1 year. Detailed ocular examination included exophthalmometric measurements, ocular movements and Worth four-dot test. T3, T4, TSH, CT scan and antimicrosomal antibodies and antithyroglobulin antibodies were done along with routine investigations. Study Design- Prospective cohort study. RESULTS Statistical analysis did not reveal any correlation between the level of serum T3 and severity of ocular findings. Majority of the cases were euthyroid with moderate ocular myopathy having multiple muscle involvement. Inferior rectus was affected most. CONCLUSION The ocular signs of hyperthyroidism in the present study seem to be mild. The severe eye changes like corneal involvement and optic nerve changes were less common.

  14. Genetics Home Reference: hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis

    Science.gov (United States)

    ... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...

  15. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    NARCIS (Netherlands)

    I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)

    2011-01-01

    textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute

  16. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    NARCIS (Netherlands)

    Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.

    2011-01-01

    To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We

  17. Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme

    Science.gov (United States)

    ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...

  18. Genetics Home Reference: inclusion body myopathy with early-onset Paget disease and frontotemporal dementia

    Science.gov (United States)

    ... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...

  19. Severe insulin-resistant diabetes mellitus in patients with congenital muscle fiber type disproportion myopathy

    DEFF Research Database (Denmark)

    Vestergaard, H; Klein, H H; Hansen, T

    1995-01-01

    Congenital muscle fiber type disproportion myopathy (CFTDM) is a chronic, nonprogressive muscle disorder characterized by universal muscle hypotrophy and growth retardation. Histomorphometric examination of muscle shows a preponderance of smaller than normal type 1 fibers and overall fiber size....... Insulin receptor function and glycogen synthase (GS) activity and expression were examined in biopsies of vastus lateralis muscle. Despite a 45-90-fold increase in both fasting and postprandial serum insulin levels, both CFTDM patients had diabetes mellitus. Clamp studies revealed that the oldest boy had...

  20. BAG3 myofibrillar myopathy presenting with cardiomyopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P

    2015-05-01

    Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Myofibrillar myopathies: State of the art, present and future challenges.

    Science.gov (United States)

    Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B

    2015-10-01

    Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  2. Mitochondrial myopathy presenting as fibromyalgia: a case report

    Directory of Open Access Journals (Sweden)

    Abdullah Mishal

    2012-02-01

    Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.

  3. Autosomal dominant distal myopathy: Linkage to chromosome 14

    Energy Technology Data Exchange (ETDEWEB)

    Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.

    1995-02-01

    We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.

  4. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy.

    Science.gov (United States)

    Westermann, C M; Dorland, L; Votion, D M; de Sain-van der Velden, M G M; Wijnberg, I D; Wanders, R J A; Spliet, W G M; Testerink, N; Berger, R; Ruiter, J P N; van der Kolk, J H

    2008-05-01

    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid, butyrylglycine, (iso)valerylglycine, hexanoylglycine, free carnitine, C2-, C3-, C4-, C5-, C6-, C8-, C8:1-, C10:1-, and C10:2-carnitine as compared with 15 control horses (12 healthy and three with acute myopathy due to other causes). Analysis of plasma revealed similar results for these predominantly short-chain acylcarnitines. Furthermore, measurement of dehydrogenase activities in lateral vastus muscle from one horse with atypical myopathy indeed showed deficiencies of short-chain acyl-CoA dehydrogenase (0.66 as compared with 2.27 and 2.48 in two controls), medium-chain acyl-CoA dehydrogenase (0.36 as compared with 4.31 and 4.82 in two controls) and isovaleryl-CoA dehydrogenase (0.74 as compared with 1.43 and 1.61 nmol min(-1) mg(-1) in two controls). A deficiency of several mitochondrial dehydrogenases that utilize flavin adenine dinucleotide as cofactor including the acyl-CoA dehydrogenases of fatty acid beta-oxidation, and enzymes that degrade the CoA-esters of glutaric acid, isovaleric acid, 2-methylbutyric acid, isobutyric acid, and sarcosine was suspected in 10 out of 10 cases as the possible etiology for a highly fatal and prevalent toxic equine muscle disease similar to the combined metabolic derangements seen in human multiple acyl-CoA dehydrogenase deficiency also known as glutaric acidemia type II.

  5. Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations

    DEFF Research Database (Denmark)

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2016-01-01

    airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....

  6. Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?

    NARCIS (Netherlands)

    Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.

    2013-01-01

    Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy

  7. Patterns of Storage, Synthesis and Changing Light Levels Revealed by Carbon Isotope Microsampling within Eocene Metasequoia Tree Rings

    Science.gov (United States)

    Jahren, H.; Sternberg, L.

    2005-12-01

    Fossil tree rings from Axel Heiberg Island were microanalyzed for δ13C value in order to assess patterns of tree growth and carbon storage within the Middle Eocene (~45 Ma) Arctic paleoenvironment. Wood from four Metasequoia-type individuals was subsampled for analysis: each individual fossil consisted of between 4 and 10 large (~1 cm thick) consecutive tree rings. One of the fossils displayed an obvious concentric pattern, allowing for the determination of the direction of growth with isotopic pattern. Each ring was divided into ~1 mm thick subsamples, resulting in 5-10 δ13C value determinations per period of ring growth (i.e., growing season). All rings revealed a distinct pattern that was characteristic across growing seasons and across individual fossils. Early in the season, δ13C was at its highest value but descended systematically and sharply to its lowest value at the end of the growing season. Total decrease ranged between 3 and 5 ‰ over the course of each growing season. Identical patterns were observed in the δ13C value of alpha-cellulose isolated from each subsample, indicating that the trends observed did not represent changing levels of secondary metabolites, but rather a seasonal adjustment in the bulk source of carbon used during biosynthesis. Our results are consistent with the following annual pattern of wood synthesis 1.) complete dependence on the mobilization of stored carbon compounds early in the growing season; 2.) systematically increasing use of actively-acquired photosynthate during the growing season; 3.) complete reliance on active photosynthate by the end of the growing season. An additional and significant source of 13C discrimination is declining light levels late in the growing season, and likely contributes to the extreme pattern of δ13C decrease seen across each ring. Our results mimic those seen from modern broadleaf deciduous trees (Helle & Schlesser 2004), but differ from those seen in modern conifers (Barbour et al 2002

  8. A Case Report of Inflammatory Myopathy and Sideroblastic Anemia

    Directory of Open Access Journals (Sweden)

    F Binesh

    2007-01-01

    Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.

  9. Hoffmann's disease: MR imaging of hypothyroid myopathy

    International Nuclear Information System (INIS)

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun

    2015-01-01

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  10. Hoffmann's disease: MR imaging of hypothyroid myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)

    2015-11-15

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  11. Internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and radiological characterization in a patient.

    Science.gov (United States)

    Guy, R J; Kamm, M A; Martin, J E

    1997-02-01

    We report a case of a distinctive familial internal anal sphincter myopathy with unique histological and radiological features. A 67-year-old woman presented with a 20-year history of proctalgia fugax and outlet obstruction; other family members were similarly affected. Computed tomograpy and magnetic resonance imaging demonstrated a grossly hypertrophied internal anal sphincter. Strip myectomy of the sphincter was carried out with improvement in evacuation but little relief of proctalgia. Further relief of symptoms was obtained using oral and transdermal nitrates and a calcium antagonist. Histological examination of the excised muscle revealed hypertrophy and an abnormal arrangement of fibres in whorls; many fibres contained vacuoles with inclusion bodies positive for periodic acid-Schiff. This description of a specific anal sphincter myopathy illustrates the potential importance of histopathological studies of smooth muscle in functional disorders of the gut.

  12. Specific binding of Ulex europaeus agglutinin I lectin to sarcolemma of distal myopathy with rimmed vacuole formation.

    Science.gov (United States)

    Yatabe, K; Kawai, M

    1997-08-01

    Ulex europaeus agglutinin I (UEA I) binding was studied in 83 patients with various neuromuscular disorders. UEA I labelled endomysial capillaries and endothelial cells of perimysial blood vessels in all the examined muscles. There was no UEA I binding to muscle fibres except for all (9) cases of distal myopathy with rimmed vacuole formation (DMRV), 1 of 5 cases of inclusion body myositis and 1 of 36 cases of inflammatory myopathies. The UEA I binding was completely eliminated by preincubation of UEA I solution with L-fucose. Using electron microscopy, the UEA I binding was localized to sarcolemma and intrasarco-plasmic membranous organelles other than mitochondria. Myosatellite cells were not labelled. These findings revealed the existence of fucosylated proteins or lipids in a subset of skeletal muscles suffering from DMRV. Biochemical identification of the fucosylated substance and further detailed study on subcellular localization of UEA I binding may yield important clues to the unknown pathogenesis of DMRV.

  13. Stac3 is a component of the excitation-contraction coupling machinery and mutated in Native American myopathy

    Science.gov (United States)

    Horstick, Eric J.; Linsley, Jeremy W.; Dowling, James J.; Hauser, Michael A.; McDonald, Kristin K.; Ashley-Koch, Allison; Saint-Amant, Louis; Satish, Akhila; Cui, Wilson W.; Zhou, Weibin; Sprague, Shawn M.; Stamm, Demetra S.; Powell, Cynthia M.; Speer, Marcy C.; Franzini-Armstrong, Clara; Hirata, Hiromi; Kuwada, John Y.

    2013-01-01

    Excitation-contraction coupling, the process that regulates contractions by skeletal muscles, transduces changes in membrane voltage by activating release of Ca2+ from internal stores to initiate muscle contraction. Defects in EC coupling are associated with muscle diseases. Here we identify Stac3 as a novel component of the EC coupling machinery. Using a zebrafish genetic screen, we generate a locomotor mutation that is mapped to stac3. We provide electrophysiological, Ca2+ imaging, immunocytochemical and biochemical evidence that Stac3 participates in excitation-contraction coupling in muscles. Furthermore, we reveal that a mutation in human STAC3 as the genetic basis of the debilitating Native American myopathy (NAM). Analysis of NAM stac3 in zebrafish shows that the NAM mutation decreases excitation-contraction coupling. These findings enhance our understanding of both excitation-contraction coupling and the pathology of myopathies. PMID:23736855

  14. Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy

    Science.gov (United States)

    Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn

    2014-01-01

    Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570

  15. Craniopharyngioma presenting with severe hyponatremia, hyponatremia-induced myopathy, and panhypopituitarism: a case report.

    Science.gov (United States)

    Dilrukshi, M D S A; Sandakumari, G V N; Abeysundara, P K; Chang, T

    2017-02-05

    Craniopharyngiomas are rare intracranial tumors commonly presenting with neurological symptoms. Reports of severe hyponatremia as a presenting manifestation of a craniopharyngioma and hyponatremia-induced myopathy are rare. We report the case of a patient with craniopharyngioma presenting with severe hyponatremia, panhypopituitarism, and hyponatremia-induced myopathy. A 52-year-old Sri Lankan man presented with anorexia, nausea, fatigue, generalized muscle weakness, and cramps for 1 week. The onset of his illness had been preceded by vomiting and diarrhea for 1 day which he attributed to food poisoning. On examination, he had an apathetic disposition with a generalized "sallow complexion." He was not dehydrated. Apart from reduced muscle power (4/5) and hyporeflexia, the neurological examination was normal. His serum sodium was 102 mmol/l; potassium 4.1 mmol/l; chloride 63 mmol/l; plasma osmolality 272 mosm/KgH 2 O; urine osmolality 642 mosm/KgH 2 O; and urine sodium 79 mmol/l. His creatine phosphokinase was 12,400 U/l, lactate dehydrogenase 628 U/l, aspartate aminotransferase 360 U/l, and alanine aminotransferase 64 U/l. His hormone profile revealed panhypopituitarism. An electromyogram showed nonspecific abnormalities while a muscle biopsy did not show any pathology. Magnetic resonance imaging of his brain demonstrated a well-defined craniopharyngioma with suprasellar extension. His pituitary gland was compressed and the pituitary stalk was displaced by the tumor. He had marked improvement in muscle power and rapid reduction of serum creatine phosphokinase levels paralleling the correction of severe hyponatremia, even before the initiation of hormone replacement. This case illustrates the rare presentation of severe hyponatremia and hyponatremia-induced myopathy in patients with craniopharyngioma, awareness of which would facilitate early appropriate investigations and treatment.

  16. BAG3-related myopathy, polyneuropathy and cardiomyopathy with long QT syndrome.

    Science.gov (United States)

    Kostera-Pruszczyk, Anna; Suszek, Małgorzata; Płoski, Rafał; Franaszczyk, Maria; Potulska-Chromik, Anna; Pruszczyk, Piotr; Sadurska, Elżbieta; Karolczak, Justyna; Kamińska, Anna M; Rędowicz, Maria Jolanta

    2015-12-01

    BAG3 belongs to BAG family of molecular chaperone regulators interacting with HSP70 and anti-apoptotic protein Bcl-2. It is ubiquitously expressed with strong expression in skeletal and cardiac muscle, and is involved in a panoply of cellular processes. Mutations in BAG3 and aberrations in its expression cause fulminant myopathies, presenting with progressive limb and axial muscle weakness, and respiratory insufficiency and neuropathy. Herein, we report a sporadic case of a 15-years old girl with symptoms of myopathy, demyelinating polyneuropathy and asymptomatic long QT syndrome. Genetic testing demonstrated heterozygous mutation Pro209Leu (c.626C > T) in exon 3 of BAG3 gene causing severe myopathy and neuropathy, often associated with restrictive cardiomyopathy. We did not find a mutation in any known LQT syndrome genes. Analysis of muscle biopsy revealed profound disintegration of Z-discs with extensive accumulation of granular debris and large inclusions within fibers. We demonstrated profound alterations in BAG3 distribution as the protein localized to long filamentous structures present across the fibers that were positively stained not only for α-actinin but also for desmin and filamin indicating that those disintegrated Z-disc regions contained also other sarcomeric proteins. The mutation caused a decrease in the content of BAG3 and HSP70, and also of α-actinin desmin, filamin and fast myosin heavy chain, confirming its severe effect on the muscle fiber morphology and thus function. We provide further evidence that BAG3 is associated with Z-disc maintenance, and the Pro209Leu mutation may occur worldwide. We also provide a summary of cases associated with this mutation reported so far.

  17. Equine atypical myopathy caused by hypoglycin A intoxication associated with ingestion of sycamore maple tree seeds.

    Science.gov (United States)

    Żuraw, A; Dietert, K; Kühnel, S; Sander, J; Klopfleisch, R

    2016-07-01

    Evidence suggest there is a link between equine atypical myopathy (EAM) and ingestion of sycamore maple tree seeds. To further evaluate the hypothesis that the ingestion of hypoglycin A (HGA) containing sycamore maple tree seeds causes acquired multiple acyl-CoA dehydrogenase deficiency and might be associated with the clinical and pathological signs of EAM. Case report. Necropsy and histopathology, using hematoxylin and eosin and Sudan III stains, were performed on a 2.5-year-old mare that died following the development of clinical signs of progressive muscle stiffness and recumbency. Prior to death, the animal ingested sycamore maple tree seeds (Acer pseudoplatanus). Detection of metabolites in blood and urine obtained post mortem was performed by rapid ultra-performance liquid chromatography-tandem mass spectrometry. Data from this case were compared with 3 geldings with no clinical history of myopathy. Macroscopic examination revealed fragments of maple tree seeds in the stomach and severe myopathy of several muscle groups including Mm. intercostales, deltoidei and trapezii. Histologically, the affected muscles showed severe, acute rhabdomyolysis with extensive accumulation of finely dispersed fat droplets in the cytoplasm of degenerated skeletal muscle cells not present in controls. Urine and serum concentrations of several acyl carnitines and acyl glycines were increased, and both contained metabolites of HGA, a toxic amino acid present in sycamore maple tree seeds. The study supports the hypothesis that ingestion of HGA-containing maple tree seeds may cause EAM due to acquired multiple acyl-CoA dehydrogenase deficiency. © 2015 EVJ Ltd.

  18. Single Cell Synchrotron FT-IR Microspectroscopy Reveals a Link between Neutral Lipid and Storage Carbohydrate Fluxes in S. cerevisiae

    Science.gov (United States)

    Jamme, Frédéric; Vindigni, Jean-David; Méchin, Valérie; Cherifi, Tamazight; Chardot, Thierry; Froissard, Marine

    2013-01-01

    In most organisms, storage lipids are packaged into specialized structures called lipid droplets. These contain a core of neutral lipids surrounded by a monolayer of phospholipids, and various proteins which vary depending on the species. Hydrophobic structural proteins stabilize the interface between the lipid core and aqueous cellular environment (perilipin family of proteins, apolipoproteins, oleosins). We developed a genetic approach using heterologous expression in Saccharomyces cerevisiae of the Arabidopsis thaliana lipid droplet oleosin and caleosin proteins AtOle1 and AtClo1. These transformed yeasts overaccumulate lipid droplets, leading to a specific increase in storage lipids. The phenotype of these cells was explored using synchrotron FT-IR microspectroscopy to investigate the dynamics of lipid storage and cellular carbon fluxes reflected as changes in spectral fingerprints. Multivariate statistical analysis of the data showed a clear effect on storage carbohydrates and more specifically, a decrease in glycogen in our modified strains. These observations were confirmed by biochemical quantification of the storage carbohydrates glycogen and trehalose. Our results demonstrate that neutral lipid and storage carbohydrate fluxes are tightly connected and co-regulated. PMID:24040242

  19. Single cell synchrotron FT-IR microspectroscopy reveals a link between neutral lipid and storage carbohydrate fluxes in S. cerevisiae.

    Directory of Open Access Journals (Sweden)

    Frédéric Jamme

    Full Text Available In most organisms, storage lipids are packaged into specialized structures called lipid droplets. These contain a core of neutral lipids surrounded by a monolayer of phospholipids, and various proteins which vary depending on the species. Hydrophobic structural proteins stabilize the interface between the lipid core and aqueous cellular environment (perilipin family of proteins, apolipoproteins, oleosins. We developed a genetic approach using heterologous expression in Saccharomyces cerevisiae of the Arabidopsis thaliana lipid droplet oleosin and caleosin proteins AtOle1 and AtClo1. These transformed yeasts overaccumulate lipid droplets, leading to a specific increase in storage lipids. The phenotype of these cells was explored using synchrotron FT-IR microspectroscopy to investigate the dynamics of lipid storage and cellular carbon fluxes reflected as changes in spectral fingerprints. Multivariate statistical analysis of the data showed a clear effect on storage carbohydrates and more specifically, a decrease in glycogen in our modified strains. These observations were confirmed by biochemical quantification of the storage carbohydrates glycogen and trehalose. Our results demonstrate that neutral lipid and storage carbohydrate fluxes are tightly connected and co-regulated.

  20. DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies

    Directory of Open Access Journals (Sweden)

    Alessandra Ruggieri

    2016-09-01

    Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic

  1. Genetics Home Reference: CAV3-related distal myopathy

    Science.gov (United States)

    ... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...

  2. Congenital myopathy is caused by mutation of HACD1.

    Science.gov (United States)

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti

    2013-12-20

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.

  3. Eosinophilic fasciitis in a child mimicking a myopathy.

    NARCIS (Netherlands)

    Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.

    2006-01-01

    A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,

  4. GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

    Science.gov (United States)

    Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

    2016-01-01

    Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

  5. Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy

    NARCIS (Netherlands)

    Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.

    1998-01-01

    OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared

  6. Requirement of NMDA receptor reactivation for consolidation and storage of nondeclarative taste memory revealed by inducible NR1 knockout.

    Science.gov (United States)

    Cui, Zhenzhong; Lindl, Kathryn A; Mei, Bing; Zhang, Shuqing; Tsien, Joe Z

    2005-08-01

    We employed an inducible, reversible and region-specific gene knockout technique to investigate the requirements for cortical NMDA receptors (NMDAR) during the various stages (acquisition, consolidation and storage, and retrieval) of nondeclarative, hippocampal-independent memory in mice using a conditioned taste aversion memory paradigm. Here we show that temporary knockout of the cortical NMDAR during either the learning or postlearning consolidation stage, but not during the retrieval stage, causes severe performance deficits in the 1-month taste memory retention tests. More importantly, we found that the consolidation and storage of the long-term nondeclarative taste memories requires cortical NMDAR reactivation. Thus, the dynamic engagement of the NMDAR during the postlearning stage leads us to postulate that NMDAR reactivation-mediated synaptic re-entry reinforcement is crucial for overcoming the destabilizing effects intrinsic to synaptic protein turnover and for achieving consolidation and storage of nondeclarative memories in the brain.

  7. REV-ERB and ROR: therapeutic targets for treating myopathies

    Science.gov (United States)

    Welch, Ryan D.; Flaveny, Colin A.

    2017-08-01

    Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.

  8. Mutation in the novel nuclear-encoded mitochondrial protein CHCHD10 in a family with autosomal dominant mitochondrial myopathy.

    Science.gov (United States)

    Ajroud-Driss, Senda; Fecto, Faisal; Ajroud, Kaouther; Lalani, Irfan; Calvo, Sarah E; Mootha, Vamsi K; Deng, Han-Xiang; Siddique, Nailah; Tahmoush, Albert J; Heiman-Patterson, Terry D; Siddique, Teepu

    2015-01-01

    Mitochondrial myopathies belong to a larger group of systemic diseases caused by morphological or biochemical abnormalities of mitochondria. Mitochondrial disorders can be caused by mutations in either the mitochondrial or nuclear genome. Only 5% of all mitochondrial disorders are autosomal dominant. We analyzed DNA from members of the previously reported Puerto Rican kindred with an autosomal dominant mitochondrial myopathy (Heimann-Patterson et al. 1997). Linkage analysis suggested a putative locus on the pericentric region of the long arm of chromosome 22 (22q11). Using the tools of integrative genomics, we established chromosome 22 open reading frame 16 (C22orf16) (later designated as CHCHD10) as the only high-scoring mitochondrial candidate gene in our minimal candidate region. Sequence analysis revealed a double-missense mutation (R15S and G58R) in cis in CHCHD10 which encodes a coiled coil-helix-coiled coil-helix protein of unknown function. These two mutations completely co-segregated with the disease phenotype and were absent in 1,481 Caucasian and 80 Hispanic (including 32 Puerto Rican) controls. Expression profiling showed that CHCHD10 is enriched in skeletal muscle. Mitochondrial localization of the CHCHD10 protein was confirmed using immunofluorescence in cells expressing either wild-type or mutant CHCHD10. We found that the expression of the G58R, but not the R15S, mutation induced mitochondrial fragmentation. Our findings identify a novel gene causing mitochondrial myopathy, thereby expanding the spectrum of mitochondrial myopathies caused by nuclear genes. Our findings also suggest a role for CHCHD10 in the morphologic remodeling of the mitochondria.

  9. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy

    Directory of Open Access Journals (Sweden)

    Vincent Lepori

    2018-05-01

    Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.

  10. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy.

    Science.gov (United States)

    Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion

    2018-05-04

    Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.

  11. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  12. Elevated risk of venous thromboembolic events in patients with inflammatory myopathies

    Directory of Open Access Journals (Sweden)

    Nowak M

    2016-06-01

    Full Text Available Michał Nowak, Katarzyna Królak-Nowak, Aleksandra Sobolewska-Włodarczyk, Jakub Fichna, Marcin Włodarczyk Department of Biochemistry, Faculty of Medicine, Medical University of Lodz, Lodz, Poland Abstract: Venous thromboembolism (VTE is a multifactorial disease manifesting as either deep vein thrombosis or pulmonary embolism. Its prevalence makes VTE a significant issue for both the individual – as a negative factor influencing the quality of life and prognosis – and the society due to economic burden. VTE is the third most common vascular disorder in Western countries, after myocardial infarction and stroke, making it a major cause of in-hospital mortality, responsible for 5%–10% of hospital deaths. Despite many studies conducted, only 50%–60% provoking factors have been identified, while the remaining 40%–50% have been classified as idiopathic or unprovoked. Chronic inflammatory disorders, with their underlying prothrombotic state, reveal an increased risk of VTE (six to eight times compared with the general population. Among the inflammatory disorders, we can identify inflammatory myopathies – a group of rare, chronic diseases featuring weakness and inflammation of muscles with periods of exacerbation and remission; their main classes are polymyositis and dermatomyositis. The objective of this review is to emphasize the need of VTE prophylaxis in individuals with inflammatory myopathies in order to reduce morbidity and mortality rates among those patients and improve their quality of life and prognosis. Keywords: deep vein thrombosis, pulmonary embolism, inflammation, polymyositis, dermatomyositis, prothrombotic state

  13. Relativistic, QED and nuclear effects in highly charged ions revealed by resonant electron-ion recombination in storage rings

    OpenAIRE

    Schippers, Stefan

    2008-01-01

    Dielectronic recombination (DR) of few-electron ions has evolved into a sensitive spectroscopic tool for highly charged ions. This is due to technological advances in electron-beam preparation and ion-beam cooling techniques at heavy-ion storage rings. Recent experiments prove unambiguously that DR collision spectroscopy has become sensitive to 2nd order QED and to nuclear effects. This review discusses the most recent developments in high-resolution spectroscopy of low-energy DR resonances, ...

  14. A buoyancy-based screen of Drosophila larvae for fat-storage mutants reveals a role for Sir2 in coupling fat storage to nutrient availability.

    Directory of Open Access Journals (Sweden)

    Tânia Reis

    2010-11-01

    Full Text Available Obesity has a strong genetic component, but few of the genes that predispose to obesity are known. Genetic screens in invertebrates have the potential to identify genes and pathways that regulate the levels of stored fat, many of which are likely to be conserved in humans. To facilitate such screens, we have developed a simple buoyancy-based screening method for identifying mutant Drosophila larvae with increased levels of stored fat. Using this approach, we have identified 66 genes that when mutated increase organismal fat levels. Among these was a sirtuin family member, Sir2. Sirtuins regulate the storage and metabolism of carbohydrates and lipids by deacetylating key regulatory proteins. However, since mammalian sirtuins function in many tissues in different ways, it has been difficult to define their role in energy homeostasis accurately under normal feeding conditions. We show that knockdown of Sir2 in the larval fat body results in increased fat levels. Moreover, using genetic mosaics, we demonstrate that Sir2 restricts fat accumulation in individual cells of the fat body in a cell-autonomous manner. Consistent with this function, changes in the expression of metabolic enzymes in Sir2 mutants point to a shift away from catabolism. Surprisingly, although Sir2 is typically upregulated under conditions of starvation, Sir2 mutant larvae survive better than wild type under conditions of amino-acid starvation as long as sugars are provided. Our findings point to a Sir2-mediated pathway that activates a catabolic response to amino-acid starvation irrespective of the sugar content of the diet.

  15. Symptomatic lipid storage in carriers for the PNPLA2 gene

    NARCIS (Netherlands)

    Janssen, M.C.H.; Engelen, B.G.M. van; Kapusta, L.; Lammens, M.M.; Dijk, M.; Fischer, J.; Graaf, M. van der; Wevers, R.A.; Fahrleitner, M.; Zimmermann, R.; Morava, E.

    2013-01-01

    Neutral lipid storage disease comprises a heterogeneous group of inherited disorders characterized by severe accumulation of cytoplasmic triglyceride droplets in several tissues and neutrophils. A novel type of autosomal recessive lipid myopathy due to PNPLA2 mutations was recently described with

  16. The effect of coenzyme Q10 in statin myopathy.

    Science.gov (United States)

    Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard

    2012-01-01

    Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.

  17. Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.

    Science.gov (United States)

    Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold

    2016-12-01

    Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Miopatia ocular descendente Descending ocular myopathy: a case report

    Directory of Open Access Journals (Sweden)

    Marcos R. G. de Freitas

    1975-06-01

    Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  19. Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy

    Directory of Open Access Journals (Sweden)

    Şenol Kobak

    2013-01-01

    Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.

  20. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy

    OpenAIRE

    Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.

    2010-01-01

    Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...

  1. Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies

    DEFF Research Database (Denmark)

    Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.

    2016-01-01

    Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....

  2. Diagnosis and treatment of the idiopathic inflammatory myopathies

    OpenAIRE

    Gazeley, David J.; Cronin, Mary E.

    2011-01-01

    The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...

  3. Association between statin-associated myopathy and skeletal muscle damage.

    OpenAIRE

    Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette

    2009-01-01

    BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...

  4. Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).

    Science.gov (United States)

    Yamini, B; Schillhorn van Veen, T W

    1988-10-01

    Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.

  5. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    International Nuclear Information System (INIS)

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya

    2010-01-01

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  6. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    Energy Technology Data Exchange (ETDEWEB)

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)

    2010-12-15

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  7. Zidovudine-induced myopathy: A study in Indian patients.

    Science.gov (United States)

    Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish

    2010-07-01

    Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.

  8. N-terminomics reveals control of Arabidopsis seed storage proteins and proteases by the Arg/N-end rule pathway.

    Science.gov (United States)

    Zhang, Hongtao; Gannon, Lucy; Hassall, Kirsty L; Deery, Michael J; Gibbs, Daniel J; Holdsworth, Michael J; van der Hoorn, Renier A L; Lilley, Kathryn S; Theodoulou, Frederica L

    2018-05-01

    The N-end rule pathway of targeted protein degradation is an important regulator of diverse processes in plants but detailed knowledge regarding its influence on the proteome is lacking. To investigate the impact of the Arg/N-end rule pathway on the proteome of etiolated seedlings, we used terminal amine isotopic labelling of substrates with tandem mass tags (TMT-TAILS) for relative quantification of N-terminal peptides in prt6, an Arabidopsis thaliana N-end rule mutant lacking the E3 ligase PROTEOLYSIS6 (PRT6). TMT-TAILS identified over 4000 unique N-terminal peptides representing c. 2000 protein groups. Forty-five protein groups exhibited significantly increased N-terminal peptide abundance in prt6 seedlings, including cruciferins, major seed storage proteins, which were regulated by Group VII Ethylene Response Factor (ERFVII) transcription factors, known substrates of PRT6. Mobilisation of endosperm α-cruciferin was delayed in prt6 seedlings. N-termini of several proteases were downregulated in prt6, including RD21A. RD21A transcript, protein and activity levels were downregulated in a largely ERFVII-dependent manner. By contrast, cathepsin B3 protein and activity were upregulated by ERFVIIs independent of transcript. We propose that the PRT6 branch of the pathway regulates protease activities in a complex manner and optimises storage reserve mobilisation in the transition from seed to seedling via control of ERFVII action. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  9. Live Cell Imaging During Germination Reveals Dynamic Tubular Structures Derived from Protein Storage Vacuoles of Barley Aleurone Cells

    Directory of Open Access Journals (Sweden)

    Verena Ibl

    2014-09-01

    Full Text Available The germination of cereal seeds is a rapid developmental process in which the endomembrane system undergoes a series of dynamic morphological changes to mobilize storage compounds. The changing ultrastructure of protein storage vacuoles (PSVs in the cells of the aleurone layer has been investigated in the past, but generally this involved inferences drawn from static pictures representing different developmental stages. We used live cell imaging in transgenic barley plants expressing a TIP3-GFP fusion protein as a fluorescent PSV marker to follow in real time the spatially and temporally regulated remodeling and reshaping of PSVs during germination. During late-stage germination, we observed thin, tubular structures extending from PSVs in an actin-dependent manner. No extensions were detected following the disruption of actin microfilaments, while microtubules did not appear to be involved in the process. The previously-undetected tubular PSV structures were characterized by complex movements, fusion events and a dynamic morphology. Their function during germination remains unknown, but might be related to the transport of solutes and metabolites.

  10. Gyrate atrophy of choroid and retina with myopia, cataract and systemic proximal myopathy: A rare case report from rural India

    Directory of Open Access Journals (Sweden)

    Surekha Bangal

    2012-12-01

    Full Text Available AbstractGyrate atrophy is a rare metabolic disease with autosomal recessive inheritance pattern characterised by hyperornithinemia and typical ocular findings. This report presents a 17-year-old intellectually challenged girl consulting for a progressive fall of visual acuity with night blindness. Fundus examination showed patches of chorioretinal atrophy with typical scalloped borders and peri vascular pigmentation in the equatorial region. Fundus fluroscein angiography revealed characteristic staining pattern. Other ocular associations included myopia and posterior sub capsular cataract. Progressive systemic proximal myopathy was one of the associated features. Dietary supplementation of vitamin B6 was advised.

  11. CT and the diagnosis of myopathies. Preliminary findings in 42 cases

    Energy Technology Data Exchange (ETDEWEB)

    Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M

    1986-01-01

    A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).

  12. Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review

    Directory of Open Access Journals (Sweden)

    V. A. Erokhina

    2013-08-01

    Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.

  13. Mutations in the satellite cell gene MEGF10 cause a recessive congenital myopathy with minicores.

    Science.gov (United States)

    Boyden, Steven E; Mahoney, Lane J; Kawahara, Genri; Myers, Jennifer A; Mitsuhashi, Satomi; Estrella, Elicia A; Duncan, Anna R; Dey, Friederike; DeChene, Elizabeth T; Blasko-Goehringer, Jessica M; Bönnemann, Carsten G; Darras, Basil T; Mendell, Jerry R; Lidov, Hart G W; Nishino, Ichizo; Beggs, Alan H; Kunkel, Louis M; Kang, Peter B

    2012-05-01

    We ascertained a nuclear family in which three of four siblings were affected with an unclassified autosomal recessive myopathy characterized by severe weakness, respiratory impairment, scoliosis, joint contractures, and an unusual combination of dystrophic and myopathic features on muscle biopsy. Whole genome sequence from one affected subject was filtered using linkage data and variant databases. A single gene, MEGF10, contained nonsynonymous mutations that co-segregated with the phenotype. Affected subjects were compound heterozygous for missense mutations c.976T > C (p.C326R) and c.2320T > C (p.C774R). Screening the MEGF10 open reading frame in 190 patients with genetically unexplained myopathies revealed a heterozygous mutation, c.211C > T (p.R71W), in one additional subject with a similar clinical and histological presentation as the discovery family. All three mutations were absent from at least 645 genotyped unaffected control subjects. MEGF10 contains 17 atypical epidermal growth factor-like domains, each of which contains eight cysteine residues that likely form disulfide bonds. Both the p.C326R and p.C774R mutations alter one of these residues, which are completely conserved in vertebrates. Previous work showed that murine Megf10 is required for preserving the undifferentiated, proliferative potential of satellite cells, myogenic precursors that regenerate skeletal muscle in response to injury or disease. Here, knockdown of megf10 in zebrafish by four different morpholinos resulted in abnormal phenotypes including unhatched eggs, curved tails, impaired motility, and disorganized muscle tissue, corroborating the pathogenicity of the human mutations. Our data establish the importance of MEGF10 in human skeletal muscle and suggest satellite cell dysfunction as a novel myopathic mechanism.

  14. Muscle structural changes in mitochondrial myopathy relate to genotype

    DEFF Research Database (Denmark)

    Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.

    2003-01-01

    It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...

  15. Reduction of the plastidial phosphorylase in potato (Solanum tuberosum L.) reveals impact on storage starch structure during growth at low temperature.

    Science.gov (United States)

    Orawetz, Tom; Malinova, Irina; Orzechowski, Slawomir; Fettke, Joerg

    2016-03-01

    Tubers of potato (Solanum tuberosum L.), one of the most important crops, are a prominent example for an efficient production of storage starch. Nevertheless, the synthesis of this storage starch is not completely understood. The plastidial phosphorylase (Pho1; EC 2.4.1.1) catalyzes the reversible transfer of glucosyl residues from glucose-1-phosphate to the non-reducing end of α-glucans with the release of orthophosphate. Thus, the enzyme is in principle able to act during starch synthesis. However, so far under normal growth conditions no alterations in tuber starch metabolism were observed. Based on analyses of other species and also from in vitro experiments with potato tuber slices it was supposed, that Pho1 has a stronger impact on starch metabolism, when plants grow under low temperature conditions. Therefore, we analyzed the starch content, granule size, as well as the internal structure of starch granules isolated from potato plants grown under low temperatures. Besides wild type, transgenic potato plants with a strong reduction in the Pho1 activity were analyzed. No significant alterations in starch content and granule size were detected. In contrast, when plants were cultivated at low temperatures the chain length distributions of the starch granules were altered. Thus, the granules contained more short glucan chains. That was not observed in the transgenic plants, revealing that Pho1 in wild type is involved in the formation of the short glucan chains, at least at low temperatures. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  16. [Insight into the training of patients with idiopathic inflammatory myopathy].

    Science.gov (United States)

    Váncsa, Andrea

    2016-09-01

    Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.

  17. Statin-associated myopathy: from genetic predisposition to clinical management.

    Science.gov (United States)

    Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R

    2014-01-01

    Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.

  18. Statin-associated immune-mediated myopathy: biology and clinical implications.

    Science.gov (United States)

    Christopher-Stine, Lisa; Basharat, Pari

    2017-04-01

    In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.

  19. Comparison of blood aminotransferase methods for assessment of myopathy and hepatopathy in Florida manatees (Trichechus manatus latirostris).

    Science.gov (United States)

    Harr, Kendal E; Allison, Kathryn; Bonde, Robert K; Murphy, David; Harvey, John W

    2008-06-01

    Muscle injury is common in Florida manatees (Trichechus manatus latirostris). Plasma aspartate aminotransferase (AST) is frequently used to assess muscular damage in capture myopathy and traumatic injury. Therefore, accurate measurement of AST and alanine aminotransferase (ALT) is important in managed, free-ranging animals, as well as in those rehabilitating from injury. Activities of these enzymes, however, are usually not increased in manatees with either acute or chronic muscle damage, despite marked increases in plasma creatine kinase activity. It is hypothesized that this absence of response is due to apoenzymes in the blood not detected by commonly used veterinary assays. Addition of coenzyme pyridoxal-5-phosphate (P5P or vitamin B6) should, therefore, result in higher measured enzyme activities. The objective of this study was to determine the most accurate, precise, and diagnostically useful method for aminotransferase measurement in manatees that can be used in veterinary practices and diagnostic laboratories. Additionally, appropriate collection and storage techniques were assessed. The use of an optimized commercial wet chemical assay with 100 micromol P5P resulted in a positive bias of measured enzyme activities in a healthy population of animals. However, AST and ALT were still much lower than that typically observed in domestic animals and should not be used alone in the assessment of capture myopathy and muscular trauma. Additionally, the dry chemistry analyzer, typically used in clinics, reported significantly higher and less precise AST and ALT activities with poor correlation to those measured with wet chemical methods found in diagnostic laboratories. Therefore, these results cannot be clinically compared. Overall, the optimized wet chemical method was the most precise and diagnostically useful measurement of aminotransferase in samples. Additionally, there was a statistically significant difference between paired serum and plasma measurement

  20. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features

    Directory of Open Access Journals (Sweden)

    Zhiyv Niu

    2018-03-01

    Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy

  1. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.

    Science.gov (United States)

    Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita

    2018-01-01

    The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the

  2. Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache

    Directory of Open Access Journals (Sweden)

    R Burnham

    2006-01-01

    Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.

  3. Novel Homozygous Missense Mutation in RYR1 Leads to Severe Congenital Ptosis, Ophthalmoplegia, and Scoliosis in the Absence of Myopathy.

    Science.gov (United States)

    Dilaver, Nafi; Mazaheri, Neda; Maroofian, Reza; Zeighami, Jawaher; Seifi, Tahere; Zamani, Mina; Sedaghat, Alireza; Shariati, Gholam Reza; Galehdari, Hamid

    2017-12-01

    Ryanodine receptor 1 ( RYR1 ) is an intracellular calcium receptor primarily expressed in skeletal muscle with a role in excitation contraction. Both dominant and recessive mutations in the RYR1 gene cause a range of RYR1 -related myopathies and/or susceptibility to malignant hyperthermia (MH). Recently, an atypical manifestation of ptosis, variably presenting with ophthalmoplegia, facial paralysis, and scoliosis but without significant muscle weakness, has been reported in 9 cases from 4 families with bialleic variants in RYR1 . Two affected children from a consanguineous family with severe congenital ptosis, ophthalmoplegia, scoliosis, and distinctive long faces but without skeletal myopathy were studied. To identify the cause of the hereditary condition, DNA from the proband was subjected to whole exome sequencing (WES). WES revealed a novel homozygous missense variant in RYR1 (c.14066T>A; p.IIe4689Asn), which segregated within the family. Although the phenotype of the affected siblings in this study was similar to previously described cases, the clinical features were more severely expressed. Our findings contribute to the expansion of phenotypes related to RYR1 dysfunction. Additionally, it supports a new RYR1 -related clinical presentation without musculoskeletal involvement. It is important that individuals with RYR1 mutations are considered susceptible to MH, as 70% of the MH cases are caused by mutations in the RYR1 gene.

  4. The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.

    Science.gov (United States)

    Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W

    2013-07-01

    The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. In follow-up to our study defining the major clinical subgroup phenotypes of JIIM, we compared demographics, clinical features, laboratory measures, and outcomes among myositis-specific autoantibody (MSA) subgroups, as well as with published data on adult idiopathic inflammatory myopathy patients enrolled in a separate natural history study. In the present study, of 430 patients enrolled in a nationwide registry study who had serum tested for myositis autoantibodies, 374 had either a single specific MSA (n = 253) or no identified MSA (n = 121) and were the subject of the present report. Following univariate analysis, we used random forest classification and exact logistic regression modeling to compare autoantibody subgroups. Anti-p155/140 autoantibodies were the most frequent subgroup, present in 32% of patients with juvenile dermatomyositis (JDM) or overlap myositis with JDM, followed by anti-MJ autoantibodies, which were seen in 20% of JIIM patients, primarily in JDM. Other MSAs, including anti-synthetase, anti-signal recognition particle (SRP), and anti-Mi-2, were present in only 10% of JIIM patients. Features that characterized the anti-p155/140 autoantibody subgroup included Gottron papules, malar rash, "shawl-sign" rash, photosensitivity, cuticular overgrowth, lowest creatine kinase (CK) levels, and a predominantly chronic illness course. The features that differed for patients with anti-MJ antibodies included muscle cramps, dysphonia, intermediate CK levels, a high frequency of hospitalization, and a monocyclic disease course. Patients with anti-synthetase antibodies had higher frequencies of interstitial lung disease, arthralgia, and "mechanic's hands," and had an older age at diagnosis. The anti-SRP group, which had exclusively juvenile polymyositis, was characterized by high

  5. Sagging Eye Syndrome or Nemaline Rod Myopathy? Divergence Insufficiency with Levator Dehiscence as an Overlapping Symptom between Two Diagnoses

    Directory of Open Access Journals (Sweden)

    Stephanie S. L. Cheung

    2017-01-01

    Full Text Available A 78-year-old woman complained of gradual, painless onset of horizontal binocular diplopia associated with progressive axial weakness. Physical examination revealed esotropia that was greater at distance than at near vision, bilateral levator dehiscence, and normal abducting saccadic speeds. Given the age of the patient and compatible clinical findings, the diagnosis of Sagging Eye Syndrome (SES was made. However, further work-up with a muscle biopsy suggested Sporadic Late-Onset Nemaline Myopathy (SLONM as the cause of her progressive muscle weakness. Although rare, external ophthalmoplegia has been described in the literature as a presenting symptom in SLONM. To elucidate the pathological mechanism for the patient’s diplopia, an MRI of the orbits was performed, which revealed findings consistent with SES. This case aims to highlight the importance of integrating clinical findings during the diagnostic process and serves as a reminder that diplopia can be a common symptom for an uncommon diagnosis.

  6. Oculopharyngeal Weakness, Hypophrenia, Deafness, and Impaired Vision: A Novel Autosomal Dominant Myopathy with Rimmed Vacuoles

    Directory of Open Access Journals (Sweden)

    Ting Chen

    2016-01-01

    Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.

  7. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    NARCIS (Netherlands)

    Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.

    2015-01-01

    To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide

  8. Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.

    NARCIS (Netherlands)

    Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van

    2004-01-01

    BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on

  9. Acylcarnitines profile best predicts survival in horses with atypical myopathy.

    Directory of Open Access Journals (Sweden)

    François Boemer

    Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.

  10. Acylcarnitines profile best predicts survival in horses with atypical myopathy

    Science.gov (United States)

    Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie

    2017-01-01

    Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683

  11. Restrictive extraocular myopathy: A presenting feature of acromegaly

    Directory of Open Access Journals (Sweden)

    Steven Heireman

    2011-01-01

    Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.

  12. The genetic basis of pectoralis major myopathies in modern broiler chicken lines

    OpenAIRE

    Bailey, Richard A.; Watson, Kellie A.; Bilgili, S. F.; Avendano, Santiago

    2015-01-01

    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories)...

  13. Hereditary vacuolar internal anal sphincter myopathy causing proctalgia fugax and constipation: a new case contribution.

    Science.gov (United States)

    de la Portilla, Fernando; Borrero, Juan José; Rafel, Enrique

    2005-03-01

    Hereditary anal sphincter myopathy is rare. We present a family with one affected member with proctalgia fugax, constipation and internal anal sphincter hypertrophy. Ultrastructural findings show vacuolization of smooth muscle cells without the characteristic polyglucosan inclusion. Further relief of symptoms was obtained using an oral calcium antagonist. Based on clinical presentation, endosonography and morphological findings, we consider our case is a histological variant of the vacuolar myopathy originally described.

  14. Statin induced myopathy presenting as mechanical musculoskeletal pain observed in two chiropractic patients

    OpenAIRE

    Rodine, Robert J; Tibbles, Anthony C; Kim, Peter SY; Alikhan, Neetan

    2010-01-01

    Lipid lowering drugs, such as statins, are commonly used to treat approximately 10 million Canadians affected by hypercholesterolemia. The most commonly experienced side-effect of statin medication is muscle pain. Statin induced myopathy consists of a spectrum of myopathic disorders ranging from mild myalgia to fatal rhabdomyolysis. The following is a presentation of 2 cases of statin induced myopathy in patients presenting in a chiropractic setting. In addition, discussion will surround the ...

  15. White striping and woody breast myopathies in the modern poultry industry: a review.

    Science.gov (United States)

    Kuttappan, V A; Hargis, B M; Owens, C M

    2016-11-01

    Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.

  16. Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.

    Science.gov (United States)

    Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok

    GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.

  17. Comparative Transcriptome Analysis Reveals Critical Function of Sucrose Metabolism Related-Enzymes in Starch Accumulation in the Storage Root of Sweet Potato

    Directory of Open Access Journals (Sweden)

    Kai Zhang

    2017-06-01

    Full Text Available The starch properties of the storage root (SR affect the quality of sweet potato (Ipomoea batatas (L. Lam.. Although numerous studies have analyzed the accumulation and properties of starch in sweet potato SRs, the transcriptomic variation associated with starch properties in SR has not been quantified. In this study, we measured the starch and sugar contents and analyzed the transcriptome profiles of SRs harvested from sweet potatoes with high, medium, and extremely low starch contents, at five developmental stages [65, 80, 95, 110, and 125 days after transplanting (DAP]. We found that differences in both water content and starch accumulation in the dry matter affect the starch content of SRs in different sweet potato genotypes. Based on transcriptome sequencing data, we assembled 112336 unigenes, and identified several differentially expressed genes (DEGs involved in starch and sucrose metabolism, and revealed the transcriptional regulatory network controlling starch and sucrose metabolism in sweet potato SRs. Correlation analysis between expression patterns and starch and sugar contents suggested that the sugar–starch conversion steps catalyzed by sucrose synthase (SuSy and UDP-glucose pyrophosphorylase (UGPase may be essential for starch accumulation in the dry matter of SRs, and IbβFRUCT2, a vacuolar acid invertase, might also be a key regulator of starch content in the SRs. Our results provide valuable resources for future investigations aimed at deciphering the molecular mechanisms determining the starch properties of sweet potato SRs.

  18. Myotubular myopathy and the neuromuscular junction: a novel therapeutic approach from mouse models

    Directory of Open Access Journals (Sweden)

    James J. Dowling

    2012-11-01

    Myotubular myopathy (MTM is a severe congenital muscle disease characterized by profound weakness, early respiratory failure and premature lethality. MTM is defined by muscle biopsy findings that include centralized nuclei and disorganization of perinuclear organelles. No treatments currently exist for MTM. We hypothesized that aberrant neuromuscular junction (NMJ transmission is an important and potentially treatable aspect of the disease pathogenesis. We tested this hypothesis in two murine models of MTM. In both models we uncovered evidence of a disorder of NMJ transmission: fatigable weakness, improved strength with neostigmine, and electrodecrement with repetitive nerve stimulation. Histopathological analysis revealed abnormalities in the organization, appearance and size of individual NMJs, abnormalities that correlated with changes in acetylcholine receptor gene expression and subcellular localization. We additionally determined the ability of pyridostigmine, an acetylcholinesterase inhibitor, to ameliorate aspects of the behavioral phenotype related to NMJ dysfunction. Pyridostigmine treatment resulted in significant improvement in fatigable weakness and treadmill endurance. In all, these results describe a newly identified pathological abnormality in MTM, and uncover a potential disease-modifying therapy for this devastating disorder.

  19. Vitamin D Receptor Gene Polymorphisms and Haplotypes in Hungarian Patients with Idiopathic Inflammatory Myopathy

    Directory of Open Access Journals (Sweden)

    Levente Bodoki

    2015-01-01

    Full Text Available Idiopathic inflammatory myopathies are autoimmune diseases characterized by symmetrical proximal muscle weakness. Our aim was to identify a correlation between VDR polymorphisms or haplotypes and myositis. We studied VDR-BsmI, VDR-ApaI, VDR-TaqI, and VDR-FokI polymorphisms and haplotypes in 89 Hungarian poly-/dermatomyositis patients (69 females and 93 controls (52 females. We did not obtain any significant differences for VDR-FokI, BsmI, ApaI, and TaqI genotypes and allele frequencies between patients with myositis and healthy individuals. There was no association of VDR polymorphisms with clinical manifestations and laboratory profiles in myositis patients. Men with myositis had a significantly different distribution of BB, Bb, and bb genotypes than female patients, control male individuals, and the entire control group. Distribution of TT, Tt, and tt genotypes was significantly different in males than in females in patient group. According to four-marker haplotype prevalence, frequencies of sixteen possible haplotypes showed significant differences between patient and control groups. The three most frequent haplotypes in patients were the fbAt, FBaT, and fbAT. Our findings may reveal that there is a significant association: Bb and Tt genotypes can be associated with myositis in the Hungarian population we studied. We underline the importance of our result in the estimated prevalence of four-marker haplotypes.

  20. Hemolysis, myopathy, and cardiac disease associated with hereditary phosphofructokinase deficiency in two Whippets

    Science.gov (United States)

    Gerber, Karen; Harvey, John W.; D'Agorne, Sara; Wood, Jonathan; Giger, Urs

    2009-01-01

    Two male castrated Whippet littermates were presented at 1 year of age for pallor, tachycardia, systolic heart murmur, dark yellow to orange feces, intermittent lethargy, pigmenturia, and muscle shivering or cramping after exercise. Persistent macrocytic hypochromic anemia with marked reticulocytosis and metarubricytosis was found when CBC results were compared with reference values for Whippets. Increased serum creatine kinase activity and hyperkalemia also were sometimes present over the 4-year period of evaluation. Progressively increasing serum concentrations of N-terminal prohormone brain natriuretic peptide suggested cardiac disease. Erythrocytes from the whippets were less osmotically fragile but more alkaline fragile than those from control dogs. Erythrocyte phosphofructokinase (PFK) activities and 2,3-diphosphoglycerate concentrations were decreased. Restriction enzyme-based DNA test screening and DNA sequencing revealed the same mutation in the muscle-PFK gene of the Whippets as seen in English Springer Spaniel dogs with PFK deficiency. This is the first report of PFK deficiency in Whippet dogs. In addition to causing hemolysis and exertional myopathy, heart disease may be a prominent clinical component of PFK deficiency in this breed and has not been previously recognized in PFK-deficient English Springer Spaniels. PMID:19228357

  1. Mitochondrial myopathy, encephalopathy, lactate acidosis with stroke-like episodes syndrome (MELAS: A case report

    Directory of Open Access Journals (Sweden)

    Petrović Igor N.

    2012-01-01

    Full Text Available Introduction. Mitochondrial encephalopathy, lactacidosis and stroke-like episodes (MELAS represent a multisystemic dysfunction due to various mutations in mitochondrial DNA. Here we report a patient with genetically confirmed MELAS. Case Outline. A patient is presented whose clinical features involved short stature, easy tendency to fatigue, recurrent seizures, progressive cognitive decline, myopathy, sensorineural deafness, diabetes mellitus as well as stroke-like episodes. The major clinical feature of migraine type headache was not present. Neuroimaging studies revealed signs of ischemic infarctions localized in the posterior regions of the brain cortex. Electron microscopy of the skeletal muscle biopsy showed subsarcolemmal accumulation of a large number of mitochondria with paracristal inclusions in the skeletal muscle cells. The diagnosis of MELAS was definitively confirmed by the detection of a specific point mutation A to G at nucleotide position 3243 of mitochondrial DNA. Conclusion. When a relatively young patient without common risk factors for ischemic stroke presents with signs of occipitally localized brain infarctions accompanied with multisystemic dysfunction, MELAS syndrome, it is necessary to conduct investigations in order to diagnose the disease.

  2. Ascending paresis as presentation of an unusual association between necrotizing autoimmune myopathy and systemic lupus erythematosus.

    Science.gov (United States)

    García-Reynoso, Marco Julio; Veramendi-Espinoza, Liz Eliana; Ruiz-Garcia, Henry Jeison

    2014-01-01

    A 45 year-old man went to the emergency room due to disease duration of 15 days of insidious onset and progressive course. It began with symmetrical weakness and pain in feet and ankles that extends upward to the knees. Later, this progressed to paraparesis with Creatine phosphokinase levels of 44,270 U/L and respiratory failure that required mechanical ventilation. Electromyography and muscle biopsy of quadriceps were made. The patient responded to corticotherapy in pulses and supporting management. The presentation of ascending paresis suggested the diagnosis of Guillain-Barré syndrome. However, the degree of muscle involvement with rhabdomyolysis explains the neurological damage by itself. The biopsy revealed pathological criteria for necrotizing autoimmune myopathy (NAM), as well as other clinical and laboratory evidence. Patient disease continued and reached criteria for systemic lupus erythematosus (SLE). To our best knowledge, this is the first report of the NAM and SLE association. Copyright © 2012 Elsevier España, S.L. All rights reserved.

  3. Energy storage

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This chapter discusses the role that energy storage may have on the energy future of the US. The topics discussed in the chapter include historical aspects of energy storage, thermal energy storage including sensible heat storage, latent heat storage, thermochemical heat storage, and seasonal heat storage, electricity storage including batteries, pumped hydroelectric storage, compressed air energy storage, and superconducting magnetic energy storage, and production and combustion of hydrogen as an energy storage option

  4. Diagnostic criteria for idiopathic inflammatory myopathies. Problems of their optimization

    Directory of Open Access Journals (Sweden)

    O. A. Antelava

    2014-01-01

    Full Text Available The paper deals with the problems of optimizing the diagnostic criteria for idiopathic inflammatory myopathies (IIM, a group of heterogeneous rare autoimmune diseases characterized by inflammatory lesion in the skeletal muscles. The representatives of this group are traditionally considered to be polymyositis (PM, dermatomyositis (DM, and inclusion-body myositis. The authors detail the history of classification criteria for IIM from those proposed by T.A. Medsger et al. (1970 relying on its clinical picture, laboratory data and instrumental findings, as well as the criteria (including the first introduced exclusion ones elaborated by A. Bohan and J.B. Peter in 1975, which remain fundamental in both clinical practice and researches. The basis for the clinical and serological criteria proposed by Y. Troyanov et al. (2005 for IIM is the identification of myositis-overlap syndromes. The classificational (subtype identification and therapeutic value of the criteria based on clinical and serological characteristics was supported by the Hungarian investigators A. Vancsa et al. (2010 who investigated the relationship between the clinical and therapeutic characteristics of IIM and positivity for myositis-specific and myositis-associated antibodies. The criteria developed by M.C. Dalakas (1991, 2003 are based on the specific immunopathological features of a histological pattern, which allow the differentiation of DM, PM, and inclusion-body myositis from other myopathic syndromes. The 2004 European Neuromuscular Center (ENMC criteria first identify necrotizing autoimmune myopathy and nonspecific myositis as individual subtypes. The serological classification of IIM, which is based onthe assessment of autoantibodies that play an important role in the pathogenesis of the disease, is of indubitable interest. There is an obvious need for the correct and timely diagnosis of both IIM as a whole and its subtypes in particular, which is complicated by

  5. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy.

    Science.gov (United States)

    Mercer, Louise K; Moore, Tonia L; Chinoy, Hector; Murray, Andrea K; Vail, Andy; Cooper, Robert G; Herrick, Ariane L

    2010-09-01

    To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Nailfold video microscopy (x300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width) were quantified. Patients were clinically assessed and disease activity recorded using the Myositis Disease Activity Assessment Tool. Disease severity and physical function were assessed using the myositis damage index and Stanford HAQ, respectively. Findings were analysed using linear and logistic regression, adjusted for age and sex. In a subgroup of 16 patients with IIM and 27 controls, the process was repeated 6-12 months later and the results were analysed using Student's t-test. Capillary density was lower and dimensions were higher in patients with IIM compared with healthy controls (P nailfold capillaroscopy, suggesting that nailfold capillaroscopy may be useful as an outcome measure of microvascular disease in studies of IIM.

  6. Muscle sonography in six patients with hereditary inclusion body myopathy

    International Nuclear Information System (INIS)

    Adler, Ronald S.; Garolfalo, Giovanna; Paget, Stephen; Kagen, Lawrence

    2008-01-01

    To evaluate the morphological changes of muscle with sonography in six patients affected by hereditary inclusion body myopathy (HIBM). We studied a group of six Persian Jews diagnosed with HIBM. All were homozygous for the GNE mutation M712T. Ultrasonographic examinations of the quadriceps femoris and hamstring muscle groups were performed. A follow-up ultrasound examination was performed, after an interval of 3 years, in four of these patients. Muscles were assessed subjectively as to echogenicity, determined by gray-scale assessment, and loss of normal muscle morphology. Power Doppler sonography (PDS) was used to assess vascularity. A sonographic finding of central atrophy and peripheral sparing resulting in a target-like appearance was noted in the hamstring compartment of all six patients. The quadriceps compartment also showed involvement of the rectus femoris of all patients, which, in some cases, was the only muscle involved in the quadriceps. Vascularity was markedly reduced in the affected areas, with blood flow demonstrated in the peripherally spared areas. The severity of atrophy increased with disease duration. In this case series, we describe a new sonographic finding as well as document progression of HIBM disease, which has generally been described as quadriceps sparing. The myopathic target lesion, as well as isolated rectus femoris atrophy, may provide a useful adjunct to disease diagnosis. (orig.)

  7. Myopathy in CRPS-I: disuse or neurogenic?

    Science.gov (United States)

    Hulsman, Natalie M; Geertzen, Jan H B; Dijkstra, Pieter U; van den Dungen, Jan J A M; den Dunnen, Wilfred F A

    2009-08-01

    The diagnosis Complex Regional Pain Syndrome type I (CRPS-I) is based on clinical symptoms, including motor symptoms. Histological changes in muscle tissue may be present in the chronic phase of CRPS-I. Aim of this study was to analyze skeletal muscle tissue from amputated limbs of patients with CRPS-I, in order to gain more insight in factors that may play a role in changes in muscles in CRPS-I. These changes may be helpful in clarifying the pathophysiology of CRPS-I. Fourteen patients with therapy resistant and longstanding CRPS-I, underwent an amputation of the affected limb. In all patients histological analysis showed extensive changes in muscle tissue, such as fatty degeneration, fibre atrophy and nuclear clumping, which was not related to duration of CRPS-I prior to amputation. In all muscles affected, both type 1 and type 2 fibre atrophy was found, without selective type 2 fibre atrophy. In four patients, type grouping was observed, indicating a sequence of denervation and reinnervation of muscle tissue. In two patients even large group atrophy was present, suggesting new denervation after reinnervation. Comparison between subgroups in arms and legs showed no difference in the number of changes in muscle tissue. Intrinsic and extrinsic muscles were affected equally. Our findings show that in the chronic phase of CRPS-I extensive changes can be seen in muscle tissue, not related to duration of CRPS-I symptoms. Signs of neurogenic myopathy were present in five patients.

  8. [Statin associated myopathy in clinical practice. Results of DAMA study].

    Science.gov (United States)

    Millán, Jesús; Pedro-Botet, Juan; Climent, Elisenda; Millán, Joaquín; Rius, Joan

    Muscle symptoms, with or without elevation of creatin kinase are one of the main adverse effects of statin therapy, a fact that sometimes limits their use. The aim of this study was to evaluate the clinical characteristics of patients treated with statins who have complained muscle symptoms and to identify possible predictive factors. A cross-sectional one-visit, non-interventional, national multicenter study including patients of both sexes over 18 years of age referred for past or present muscle symptoms associated with statin therapy was conducted. 3,845 patients were recruited from a one-day record from 2,001 physicians. Myalgia was present in 78.2% of patients included in the study, myositis in 19.3%, and rhabdomyolysis in 2.5%. Patients reported muscle pain in 77.5% of statin-treated individuals, general weakness 42.7%, and cramps 28.1%. Kidney failure, intense physical exercise, alcohol consumption (>30g/d in men and 20g/d in women) and abdominal obesity were the clinical situations associated with statin myopathy. Myalgia followed by myositis are the most frequent statin-related side effects. It should be recommended control environmental factors such as intense exercise and alcohol intake as well as abdominal obesity and renal function of the patient treated with statins. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

  9. Mutation update and genotype-phenotype correlations of novel and previously described mutations in TPM2 and TPM3 causing congenital myopathies

    NARCIS (Netherlands)

    Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina

    2014-01-01

    Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously

  10. Differential effect of the rs4149056 variant in SLCO1B1 on myopathy associated with simvastatin and atorvastatin

    NARCIS (Netherlands)

    Brunham, L. R.; Lansberg, P. J.; Zhang, L.; Miao, F.; Carter, C.; Hovingh, G. K.; Visscher, H.; Jukema, J. W.; Stalenhoef, A. F.; Ross, C. J. D.; Carleton, B. C.; Kastelein, J. J. P.; Hayden, M. R.

    2012-01-01

    Statins reduce cardiovascular morbidity and mortality in appropriately selected patients. However, statin-associated myopathy is a significant risk associated with these agents. Recently, variation in the SLCO1B1 gene was reported to predict simvastatin-associated myopathy. The aim of this study was

  11. Muscle imaging in patients with tubular aggregate myopathy caused by mutations in STIM1

    DEFF Research Database (Denmark)

    Tasca, Giorgio; D'Amico, Adele; Monforte, Mauro

    2015-01-01

    Tubular aggregate myopathy is a genetically heterogeneous disease characterized by tubular aggregates as the hallmark on muscle biopsy. Mutations in STIM1 have recently been identified as one genetic cause in a number of tubular aggregate myopathy cases. To characterize the pattern of muscle...... involvement in this disease, upper and lower girdles and lower limbs were imaged in five patients with mutations in STIM1, and the scans were compared with two patients with tubular aggregate myopathy not caused by mutations in STIM1. A common pattern of involvement was found in STIM1-mutated patients...... of thigh and posterior leg with sparing of gracilis, tibialis anterior and, to a lesser extent, short head of biceps femoris. Mutations in STIM1 are associated with a homogeneous involvement on imaging despite variable clinical features. Muscle imaging can be useful in identifying STIM1-mutated patients...

  12. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone: A case report.

    Science.gov (United States)

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-07-01

    Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Relative hypothyroidism-induced myopathy. Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases.

  13. Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

    Science.gov (United States)

    Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert

    2013-01-01

    Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594

  14. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    Science.gov (United States)

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-01-01

    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-induced myopathy. Interventions: Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. Outcomes: The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Lessons: Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases. PMID:28746208

  15. Identification of methylenecyclopropyl acetic acid in serum of European horses with atypical myopathy.

    Science.gov (United States)

    Votion, D-M; van Galen, G; Sweetman, L; Boemer, F; de Tullio, P; Dopagne, C; Lefère, L; Mouithys-Mickalad, A; Patarin, F; Rouxhet, S; van Loon, G; Serteyn, D; Sponseller, B T; Valberg, S J

    2014-03-01

    It is hypothesised that European atypical myopathy (AM) has a similar basis as seasonal pasture myopathy in North America, which is now known to be caused by ingestion of hypoglycin A contained in seeds from the tree Acer negundo. Serum from horses with seasonal pasture myopathy contained the conjugated toxic metabolite of hypoglycin A, methylenecyclopropyl acetic acid (MCPA). Retrospective study on archived samples. 1) To determine whether MCPA-carnitine was present in serum of European horses confirmed to have AM; 2) to determine whether Acer negundo or related Acer species were present on AM pastures in Europe. Concentrations of MCPA-carnitine were analysed in banked serum samples of 17 AM horses from Europe and 3 diseased controls (tetanus, neoplasia and exertional rhabdomyolysis) using tandem mass spectrometry. Atypical myopathy was diagnosed by characteristic serum acylcarnitine profiles. Pastures of 12 AM farms were visited by experienced botanists and plant species were documented. Methylenecyclopropyl acetic acid-carnitine at high concentrations (20.39 ± 17.24 nmol/l; range 0.95-57.63 nmol/l; reference: <0.01 nmol/l) was identified in serum of AM but not disease controls (0.00 ± 0.00 nmol/l). Acer pseudoplatanus but not Acer negundo was present on all AM farms. Atypical myopathy in Europe, like seasonal pasture myopathy in North America, is highly associated with the toxic metabolite of hypoglycin A, MCPA-carnitine. This finding coupled with the presence of a tree of which seeds are known to also contain hypoglycin A indicates that ingestion of Acer pseudoplatanus is the probable cause of AM. This finding has major implications for the prevention of AM. © 2013 EVJ Ltd.

  16. A study of acute muscle dysfunction with particular reference to dengue myopathy

    Directory of Open Access Journals (Sweden)

    Rajesh Verma

    2017-01-01

    Full Text Available Background: Acute myopathy is a common cause of acute motor quadriparesis which has various etiologies with different courses of illness and prognosis depending on the cause. Understanding this diversity helps us in proper approach toward diagnosis, predicting the prognosis, and possible complications and in improving the treatments that are being provided. This study was planned to study the clinical, electrophysiological, and etiological profile of patients presenting with acute myopathy. We also studied how dengue-related acute myopathy differs from other causes and also difference between myopathy due to myositis and hypokalemia in cases of dengue. Materials and Methods: This was a prospective, observational study involving all clinically suspected cases of acute myopathy of not more than 4 weeks duration with raised serum creatine kinase (CK level. They were subjected to detailed clinical evaluation along with hematological, biochemical, microbiological, and electrophysiological studies and followed-up for outcome at 1 and 3 months. Muscle biopsy and histopathological examination were done in selected patients after taking informed consent. Statistical analysis was performed by appropriate methods using SPSS version 16.0 (Chicago, IL, USA. Results: We evaluated thirty patients of acute myopathy with raised CK level. Seventeen patients had fever, 11 had myalgia, and 5 had skin lesions. All presented with symmetric weakness, 17 (56.7% patients having predominantly proximal weakness, neck or truncal weakness in 6 (20%, hyporeflexia in 12 (40%, with mean Medical Research Council (MRC sum score of 46.67 ± 6.0. Eight (mean modified Barthel index [MBI] at presentation - 15 ± 3.7 patients had poor functional status according to MBI and 15 according to modified Rankin scale (MRS (mean MRS score - 2.5 ± 1.2. Etiology was dengue viral infection in 14 patients; hypokalemia due to various causes other than dengue in 8; pyomyositis in 3

  17. Collagen XII myopathy with rectus femoris atrophy and collagen XII retention in fibroblasts

    DEFF Research Database (Denmark)

    Witting, Nanna; Krag, Thomas; Werlauff, Ulla

    2018-01-01

    INTRODUCTION: Mutation in the collagen XII gene (COL12A1) was recently reported to induce Bethlem myopathy. We describe a family affected by collagen XII-related myopathy in 3 generations. METHODS: Systematic interview, clinical examination, skin biopsies, and MRI of muscle were used. RESULTS...... affection and abnormal collagen XII retention in fibroblasts. MRI disclosed a selective wasting of the rectus femoris muscle. DISCUSSION: COL12A1 mutations should be considered in patients with a mild Bethlem phenotype who present with selective wasting of the rectus femoris, absence of the outside......-in phenomenon on MRI, and abnormal collagen XII retention in fibroblasts. Muscle Nerve, 2018....

  18. Phenotypes, genotypes, and prevalence of congenital myopathies older than 5 years in Denmark

    DEFF Research Database (Denmark)

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2017-01-01

    .3% NEB mutations. Less than 5% had mutations in ACTA1, TPM2/3, MTM1, TTN, SEPN1, or SC4NA. A genetic cause was established in 83% with specific histology (cores/rods/centronuclear myopathy) vs 29% with unspecific histology. The detailed clinical examination found gene-dependent discrepancies...... in the pattern of muscle affection and walking ability. Although walking ability was delayed in patients with ACTA1, TPM2/3, and RYR1 mutations, it was within normal limits in patients with NEB and DNM2 mutations. CONCLUSIONS: We found that overall, genetic and histologic prevalence of congenital myopathy...

  19. Treatment of critical illness polyneuropathy and/or myopathy - a systematic review

    DEFF Research Database (Denmark)

    Ydemann, Mogens; Eddelien, Heidi Shil; Lauritsen, Anne Øberg

    2012-01-01

    The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years.......The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years....

  20. Autophagy, inflammation and innate immunity in inflammatory myopathies.

    Directory of Open Access Journals (Sweden)

    Cristina Cappelletti

    Full Text Available Autophagy has a large range of physiological functions and its dysregulation contributes to several human disorders, including autoinflammatory/autoimmune diseases such as inflammatory myopathies (IIMs. In order to better understand the pathogenetic mechanisms of these muscular disorders, we sought to define the role of autophagic processes and their relation with the innate immune system in the three main subtypes of IIM, specifically sporadic inclusion body myositis (sIBM, polymyositis (PM, dermatomyositis (DM and juvenile dermatomyositis (JDM. We found that although the mRNA transcript levels of the autophagy-related genes BECN1, ATG5 and FBXO32 were similar in IIM and controls, autophagy activation in all IIM subgroups was suggested by immunoblotting results and confirmed by immunofluorescence. TLR4 and TLR3, two potent inducers of autophagy, were highly increased in IIM, with TLR4 transcripts significantly more expressed in PM and DM than in JDM, sIBM and controls, and TLR3 transcripts highly up-regulated in all IIM subgroups compared to controls. Co-localization between autophagic marker, LC3, and TLR4 and TLR3 was observed not only in sIBM but also in PM, DM and JDM muscle tissues. Furthermore, a highly association with the autophagic processes was observed in all IIM subgroups also for some TLR4 ligands, endogenous and bacterial HSP60, other than the high-mobility group box 1 (HMGB1. These findings indicate that autophagic processes are active not only in sIBM but also in PM, DM and JDM, probably in response to an exogenous or endogenous 'danger signal'. However, autophagic activation and regulation, and also interaction with the innate immune system, differ in each type of IIM. Better understanding of these differences may lead to new therapies for the different IIM types.

  1. Energy Storage.

    Science.gov (United States)

    Eaton, William W.

    Described are technological considerations affecting storage of energy, particularly electrical energy. The background and present status of energy storage by batteries, water storage, compressed air storage, flywheels, magnetic storage, hydrogen storage, and thermal storage are discussed followed by a review of development trends. Included are…

  2. High resolution isotope data and ensemble modelling reveal ecohydrological controls on catchment storage-discharge relationships and flux travel time distributions

    Science.gov (United States)

    Soulsby, C.; Kuppel, S.; Smith, A.; Tetzlaff, D.

    2017-12-01

    The dynamics of water storage in a catchment provides a fundamental insight into the interlinkages between input and output fluxes, and how these are affected by environmental change. Such dynamics also mediate, and help us understand, the fundamental difference of the rapid celerity of the rainfall-runoff (minutes to hours) response of catchments and the much slower velocity of water particles (months to decades) as they are transported through catchment systems. In this contribution we report an intensive, long-term (>10year), multi-scale isotope study in the Scottish Highlands that has sought to better understand these issues. We have integrated empirical data collection with diverse modelling approaches to quantify the dynamics and residence times of storage in different compartments of the hydrological system (vegetation canopies, soils, ground waters etc.) and their relationship between the magnitude and travel time distributions of output fluxes (stream flow, transpiration and evaporation). Use of conceptual, physically-based and probabilistic modelling approaches give broadly consistent perspectives on the storage-discharge relationships and the preferential selection of younger waters in runoff, evaporation and transpiration; while older waters predominate in groundwater. The work also highlighted the importance role vegetation plays in regulating fluxes in evaporation and transpiration and how this contributes to the differential ageing of water in mobile and bulk waters in the soil compartment. A separate case study shows how land use change can affect storage distributions in a catchment and radically change travel time distributions in output fluxes.

  3. Novel Variants in Individuals with RYR1-Related Congenital Myopathies: Genetic, Laboratory, and Clinical Findings

    Directory of Open Access Journals (Sweden)

    Joshua J. Todd

    2018-03-01

    Full Text Available The ryanodine receptor 1-related congenital myopathies (RYR1-RM comprise a spectrum of slow, rare neuromuscular diseases. Affected individuals present with a mild-to-severe symptomatology ranging from proximal muscle weakness, hypotonia and joint contractures to scoliosis, ophthalmoplegia, and respiratory involvement. Although there is currently no FDA-approved treatment for RYR1-RM, our group recently conducted the first clinical trial in this patient population (NCT02362425. This study aimed to characterize novel RYR1 variants with regard to genetic, laboratory, muscle magnetic resonance imaging (MRI, and clinical findings. Genetic and histopathology reports were obtained from participant’s medical records. Alamut Visual Software was used to determine if participant’s variants had been previously reported and to assess predicted pathogenicity. Physical exams, pulmonary function tests, T1-weighted muscle MRI scans, and blood measures were completed during the abovementioned clinical trial. Six novel variants (two de novo, three dominant, and one recessive were identified in individuals with RYR1-RM. Consistent with established RYR1-RM histopathology, cores were observed in all biopsies, except Case 6 who exhibited fiber-type disproportion. Muscle atrophy and impaired mobility with Trendelenburg gait were the most common clinical symptoms and were identified in all cases. Muscle MRI revealed substantial inter-individual variation in fatty infiltration corroborating the heterogeneity of the disease. Two individuals with dominant RYR1 variants exhibited respiratory insufficiency: a clinical symptom more commonly associated with recessive RYR1-RM cases. This study demonstrates that a genetics-led approach is suitable for the diagnosis of suspected RYR1-RM which can be corroborated through histopathology, muscle MRI and clinical examination.

  4. Absence of anti-HMG-CoA reductase autoantibodies in severe self-limited statin-related myopathy.

    Science.gov (United States)

    Floyd, James S; Brody, Jennifer A; Tiniakou, Eleni; Psaty, Bruce M; Mammen, Andrew

    2016-06-01

    Patients with self-limited statin-related myopathy improve spontaneously when statins are stopped. In contrast, patients with statin-associated autoimmune myopathy have autoantibodies recognizing 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) and usually require immunosuppressive therapy to control their disease. On initial presentation, it can sometimes be difficult to distinguish between these 2 diseases, as both present with muscle pain, weakness, and elevated serum creatine kinase (CK) levels. The goal of this study was to determine whether patients with severe self-limited statin-related myopathy also make anti-HMGCR autoantibodies. We screened 101 subjects with severe self-limited cerivastatin-related myopathy for anti-HMGCR autoantibodies. No patient with severe self-limited cerivastatin-related myopathy had anti-HMGCR autoantibodies. Anti-HMGCR autoantibody testing can be used to help differentiate whether a patient has self-limited myopathy due to cerivastatin or autoimmune statin-associated myopathy; these findings may apply to other statins as well. Muscle Nerve 54: 142-144, 2016. © 2016 Wiley Periodicals, Inc.

  5. The heart in Becker muscular dystrophy, facioscapulohumeral dystrophy, and Bethlem myopathy

    NARCIS (Netherlands)

    de Visser, M.; de Voogt, W. G.; la Rivière, G. V.

    1992-01-01

    We report a study, assessing involvement of the heart in 33 familial cases of Becker muscular dystrophy (BMD), 31 familiar cases of facioscapulohumeral (FSH) dystrophy, and 27 familial cases of Bethlem myopathy. In the patients with BMD, correlations of myocardial involvement with age and extent of

  6. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    DEFF Research Database (Denmark)

    van Galen Verwilghen, Gaby; Votion, D.-M.

    2013-01-01

    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these cases. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems ...

  7. [External progressive ophthalmoplegia secondary to mitochondrial myopathy. Report of a case and review of the literature].

    Science.gov (United States)

    Calderón-Garcidueñas, A L; Pérez-Loria, O; Alberto-Sagástegui, J; Farías-García, R

    2000-01-01

    Progressive limitation of occular motility, accompanied by ptosis but usually without diplopia, occurs in many pathologic states, including mitochondrial diseases. A case with chronic progressive external ophthalmoplegia with onset during childhood, associated with proximal myopathy and dysphasia is presented. The muscle biopsy showed a myopathic pattern and abnormal subsarcolemmal mitochondrial deposits. Muscle biopsy for important in the correct diagnosis of this entity.

  8. Congenital myotonic myopathy in the miniature schnauzer: an autosomal recessive trait.

    Science.gov (United States)

    Vite, C H; Melniczek, J; Patterson, D; Giger, U

    1999-01-01

    Myotonia is a clinical sign characterized by a delay in skeletal muscle relaxation following electrical or mechanical stimulation. A series of related miniature schnauzer dogs with congenital myotonic myopathy were studied. A composite pedigree of six affected litters and the results of a planned breeding between two affected animals are consistent with an autosomal recessive mode of inheritance.

  9. Atypical myopathy in Denmark confirmed with the aTRAQ assay

    DEFF Research Database (Denmark)

    Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie

    2016-01-01

    Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...

  10. Evaluating the Atrial Myopathy Underlying Atrial Fibrillation: Identifying the Arrhythmogenic and Thrombogenic Substrate

    Science.gov (United States)

    Goldberger, Jeffrey J.; Arora, Rishi; Green, David; Greenland, Philip; Lee, Daniel C.; Lloyd-Jones, Donald M.; Markl, Michael; Ng, Jason; Shah, Sanjiv J.

    2015-01-01

    Atrial disease or myopathy forms the substrate for atrial fibrillation (AF) and underlies the potential for atrial thrombus formation and subsequent stroke. Current diagnostic approaches in patients with AF focus on identifying clinical predictors with evaluation of left atrial size by echocardiography serving as the sole measure specifically evaluating the atrium. Although the atrial substrate underlying AF is likely developing for years prior to the onset of AF, there is no current evaluation to identify the pre-clinical atrial myopathy. Atrial fibrosis is one component of the atrial substrate that has garnered recent attention based on newer MRI techniques that have been applied to visualize atrial fibrosis in humans with prognostic implications regarding success of treatment. Advanced ECG signal processing, echocardiographic techniques, and MRI imaging of fibrosis and flow provide up-to-date approaches to evaluate the atrial myopathy underlying AF. While thromboembolic risk is currently defined by clinical scores, their predictive value is mediocre. Evaluation of stasis via imaging and biomarkers associated with thrombogenesis may provide enhanced approaches to assess risk for stroke in patients with AF. Better delineation of the atrial myopathy that serves as the substrate for AF and thromboembolic complications might improve treatment outcomes. Furthermore, better delineation of the pathophysiologic mechanisms underlying the development of the atrial substrate for AF, particularly in its earlier stages, could help identify blood and imaging biomarkers that could be useful to assess risk for developing new onset AF and suggest specific pathways that could be targeted for prevention. PMID:26216085

  11. Effects of ubiquinone (coenzyme Q10) on myopathy in statin users.

    NARCIS (Netherlands)

    Schaars, C.F.; Stalenhoef, A.F.H.

    2008-01-01

    PURPOSE OF REVIEW: Statins are associated with muscle complaints, including myositis. The mechanism through which statin use causes muscle toxicity is unknown. One of the theories is that statin therapy reduces coenzyme Q10 levels in muscle mitochondria, which leads to muscle injury and myopathy.

  12. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    International Nuclear Information System (INIS)

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman; Maurer, Britta

    2015-01-01

    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  13. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    Energy Technology Data Exchange (ETDEWEB)

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman [University Hospital Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Maurer, Britta [University Hospital Zurich, University of Zurich, Division of Rheumatology, Zurich (Switzerland)

    2015-12-15

    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  14. RYR1-related myopathies: a wide spectrum of phenotypes throughout life

    NARCIS (Netherlands)

    Snoeck, M.; Engelen, B.G.M. van; Kusters, B.; Lammens, M.M.; Meijer, R.; Molenaar, J.P.F.; Raaphorst, J.; Verschuuren-Bemelmans, C.C.; Straathof, C.S.; Sie, L.T.L.; Coo, I.F.M. de; Pol, W.L. van der; Visser, M de; Scheffer, H.; Treves, S.; Jungbluth, H.; Voermans, N.C.; Kamsteeg, E.J.

    2015-01-01

    BACKGROUND AND PURPOSE: Although several recent studies have implicated RYR1 mutations as a common cause of various myopathies and the malignant hyperthermia susceptibility (MHS) trait, many of these studies have been limited to certain age groups, confined geographical regions or specific

  15. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    DEFF Research Database (Denmark)

    van Galen Verwilghen, Gaby; Votion, D.-M.

    2013-01-01

    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these patients. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems...

  16. Hypoglycin A in maple trees in the Netherlands and the risk of equine atypical myopathy

    NARCIS (Netherlands)

    Westermann, C.M.; van Leeuwen, Robbert; Mol, Hans

    2016-01-01

    The Acer (maple) genus of trees comprises over 120 species worldwide. Some of these contain the plant-toxin hypoglycin-A which has been proven to be a cause of the highly fatal condition called atypical myopathy (AM) in horses and ponies. In an earlier study of maple-tree samples (leaves and seeds)

  17. Autosomal dominant distal myopathy due to a novel ACTA1 mutation.

    Science.gov (United States)

    Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita

    2017-08-01

    Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Fatigue in patients with spinal muscular atrophy type II and congenital myopathies

    DEFF Research Database (Denmark)

    Werlauff, Ulla; Højberg, A; Firla-Holme, R

    2014-01-01

    PURPOSE: The aim of this study was to evaluate whether the fatigue severity scale (FSS) is an appropriate instrument to assess fatigue in patients with spinal muscular atrophy type II (SMA II) and congenital myopathies (CM). METHODS: FSS and visual analog scale (VAS) were administered to 33 SMA II...

  19. Triacylglycerol infusion improves exercise endurance in patients with mitochondrial myopathy due to complex I deficiency

    NARCIS (Netherlands)

    Roef, MJ; de Meer, K; Reijngoud, DJ; Straver, HWHC; de Barse, M; Kalhan, SC; Berger, R

    Background: A high-fat diet has been recommended for the treatment of patients with mitochondrial myopathy due to complex I (NADH dehydrogenase) deficiency (CID). Objective: This study evaluated the effects of intravenous infusion of isoenergetic amounts of triacylglycerol or glucose on substrate

  20. Ileocolonic transfer of solid chyme in small intestinal neuropathies and myopathies

    Energy Technology Data Exchange (ETDEWEB)

    Greydanus, M.P.; Camilleri, M.; Colemont, L.J.; Phillips, S.F.; Brown, M.L.; Thomforde, G.M. (Mayo Clinic and Foundation, Rochester, MN (USA))

    1990-07-01

    The aims of this study were to assess gastric emptying, small bowel transit and colonic filling in patients with motility disorders, with particular attention to the patterns of colonic filling. Gastrointestinal transit was assessed using a previously validated radiolabeled mixed meal. Fourteen patients with clinical and manometric features of chronic intestinal pseudoobstruction classified as intestinal neuropathy and 6 as intestinal myopathy, were studied. The results were compared with those from 10 healthy controls studied similarly. Gastric emptying and small bowel transit of solids were significantly slower in both groups of patients than in healthy controls (P less than 0.05). In health, the ileocolonic transit of solid chyme was characterized by intermittent bolus transfers. The mean size of boluses transferred to the colon (expressed as a percentage of ingested radiolabel) was significantly less (P less than 0.05) in patients with intestinal myopathy (10% +/- 4% (SEM)) than in healthy controls (25% +/- 4%) or in patients with intestinal neuropathy (25% +/- 4%). The intervals between bolus transfer of solids (plateaus in the colonic filling curve) were longer (P less than 0.05) in myopathies (212 +/- 89 minutes) than in health (45 +/- 7 minutes) or neuropathies (53 +/- 11 minutes). Thus, gastric emptying and small bowel transit were delayed in small bowel neuropathies and myopathies. Bolus filling of the colon was less frequent and less effective in patients with myopathic intestinal pseudoobstruction, whereas bolus transfer was preserved in patients with neuropathic intestinal pseudoobstruction.

  1. The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy

    Science.gov (United States)

    Chung, Hae R.; Vakil, Mayand; Munroe, Michael; Parikh, Alay; Meador, Benjamin M.; Wu, Pei T.; Jeong, Jin H.; Woods, Jeffrey A.; Wilund, Kenneth R.; Boppart, Marni D.

    2016-01-01

    HMG-CoA reductase inhibitors (statins) are the most effective pharmacological means of reducing cardiovascular disease risk. The most common side effect of statin use is skeletal muscle myopathy, which may be exacerbated by exercise. Hypercholesterolemia and training status are factors that are rarely considered in the progression of myopathy. The purpose of this study was to determine the extent to which acute and chronic exercise can influence statin-induced myopathy in hypercholesterolemic (ApoE-/-) mice. Mice either received daily injections of saline or simvastatin (20 mg/kg) while: 1) remaining sedentary (Sed), 2) engaging in daily exercise for two weeks (novel, Nov), or 3) engaging in daily exercise for two weeks after a brief period of training (accustomed, Acct) (2x3 design, n = 60). Cholesterol, activity, strength, and indices of myofiber damage and atrophy were assessed. Running wheel activity declined in both exercise groups receiving statins (statin x time interaction, pstatin treatment (statin main effect, pstatin x exercise interaction, pstatin treatment. Exercise (Acct and Nov) increased atrogin-1 mRNA in combination with statin treatment, yet enhanced fiber damage or atrophy was not observed. The results from this study suggest that exercise (Nov, Acct) does not exacerbate statin-induced myopathy in ApoE-/- mice, yet statin treatment reduces activity in a manner that prevents muscle from mounting a beneficial adaptive response to training. PMID:27936249

  2. Statin-Associated Autoimmune Myopathy: A Systematic Review of 100 Cases.

    Science.gov (United States)

    Nazir, Salik; Lohani, Saroj; Tachamo, Niranjan; Poudel, Dilliram; Donato, Anthony

    2017-04-01

    Statins are a group of drugs that reduce the levels of triglycerides and cholesterol in blood by inhibiting HMG-CoA reductase, an enzyme involved in rate limiting step in cholesterol synthesis. About 2-20% patients on statins develop toxic myopathies, which usually resolve on discontinuation of statin. More recently, an immune-mediated necrotizing myopathy has been found to be associated with statin use which in most cases requires treatment with immunosuppressants. To perform a systematic review on published case reports and case series of statin-associated autoimmune myopathy. A comprehensive search of PUBMED, EMBASE, Cochrane library and ClinicalTrials.gov databases was performed for relevant articles from inception until March 19, 2016 to identify cases of statin-associated necrotizing myopathy and characterize their symptoms, evaluation and response to treatment. A total of 16 articles describing 100 patients with statin-associated autoimmune myopathy were identified. The mean age of presentation was 64.72 years, and 54.44% were males. The main presenting clinical feature was proximal muscle weakness, which was symmetric in 83.33% of patients. The mean creatine kinase (CK) was 6853 IU/l. Anti-HMG-CoA reductase antibody was positive in all cases tested (n = 57/57, 100%). In patients with no anti-HMG-CoA antibody results, diagnosis was established by findings of necrotizing myopathy on biopsy. Among the 83 cases where muscle biopsy information was available, 81.48% had necrosis, while 18.51% had combination of necrosis and inflammation. Most (83.82%) patients received two or more immunosuppressants to induce remission. Ninety-one percent had resolution of symptoms after treatment. Statin-associated necrotizing myopathy is a symmetric proximal muscle weakness associated with extreme elevations of CK. It is common in males and can occur after months of statin use. It is associated with necrosis on muscle biopsy and the presence of anti-HMG-CoA reductase antibodies

  3. ColVI myopathies: where do we stand, where do we go?

    Directory of Open Access Journals (Sweden)

    Allamand Valérie

    2011-09-01

    Full Text Available Abstract Collagen VI myopathies, caused by mutations in the genes encoding collagen type VI (ColVI, represent a clinical continuum with Ullrich congenital muscular dystrophy (UCMD and Bethlem myopathy (BM at each end of the spectrum, and less well-defined intermediate phenotypes in between. ColVI myopathies also share common features with other disorders associated with prominent muscle contractures, making differential diagnosis difficult. This group of disorders, under-recognized for a long time, has aroused much interest over the past decade, with important advances made in understanding its molecular pathogenesis. Indeed, numerous mutations have now been reported in the COL6A1, COL6A2 and COL6A3 genes, a large proportion of which are de novo and exert dominant-negative effects. Genotype-phenotype correlations have also started to emerge, which reflect the various pathogenic mechanisms at play in these disorders: dominant de novo exon splicing that enables the synthesis and secretion of mutant tetramers and homozygous nonsense mutations that lead to premature termination of translation and complete loss of function are associated with early-onset, severe phenotypes. In this review, we present the current state of diagnosis and research in the field of ColVI myopathies. The past decade has provided significant advances, with the identification of altered cellular functions in animal models of ColVI myopathies and in patient samples. In particular, mitochondrial dysfunction and a defect in the autophagic clearance system of skeletal muscle have recently been reported, thereby opening potential therapeutic avenues.

  4. Elucidation of the mechanism of atorvastatin-induced myopathy in a rat model.

    Science.gov (United States)

    El-Ganainy, Samar O; El-Mallah, Ahmed; Abdallah, Dina; Khattab, Mahmoud M; Mohy El-Din, Mahmoud M; El-Khatib, Aiman S

    2016-06-01

    Myopathy is among the well documented and the most disturbing adverse effects of statins. The underlying mechanism is still unknown. Mitochondrial dysfunction related to coenzyme Q10 decline is one of the proposed theories. The present study aimed to investigate the mechanism of atorvastatin-induced myopathy in rats. In addition, the mechanism of the coenzyme Q10 protection was investigated with special focus of mitochondrial alterations. Sprague-Dawely rats were treated orally either with atorvastatin (100mg/kg) or atorvastatin and coenzyme Q10 (100mg/kg). Myopathy was assessed by measuring serum creatine kinase (CK) and myoglobin levels together with examination of necrosis in type IIB fiber muscles. Mitochondrial dysfunction was evaluated by measuring muscle lactate/pyruvate ratio, ATP level, pAkt as well as mitochondrial ultrastructure examination. Atorvastatin treatment resulted in a rise in both CK (2X) and myoglobin (6X) level with graded degrees of muscle necrosis. Biochemical determinations showed prominent increase in lactate/pyruvate ratio and a decline in both ATP (>80%) and pAkt (>50%) levels. Ultrastructure examination showed mitochondrial swelling with disrupted organelle membrane. Co-treatment with coenzyme Q10 induced reduction in muscle necrosis as well as in CK and myoglobin levels. In addition, coenzyme Q10 improved all mitochondrial dysfunction parameters including mitochondrial swelling and disruption. These results presented a model for atorvastatin-induced myopathy in rats and proved that mitochondrial dysfunction is the main contributor in statin-myopathy pathophysiology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. Muscle-fiber conduction velocity and electromyography as diagnostic tools in patients with suspected inflammatory myopathy: a prospective study.

    NARCIS (Netherlands)

    Blijham, P.J.; Hengstman, G.J.D.; Laak, H.J. ter; Engelen, B.G.M. van; Zwarts, M.J.

    2004-01-01

    Combinations of different techniques can increase the diagnostic yield from neurophysiological examination of muscle. In 25 patients with suspected inflammatory myopathy, we prospectively performed needle electromyography (EMG) and measured muscle-fiber conduction velocity (MFCV) in a single muscle,

  6. Noninvasive evaluation of adult onset myopathy from carnitine palmitoyl transferase II deficiency using proton magnetic resonance spectroscopy.

    Science.gov (United States)

    Videen, J S; Haseler, L J; Karpinski, N C; Terkeltaub, R A

    1999-08-01

    The adult onset metabolic myopathy of carnitine palmitoyl transferase II (CPT II) deficiency is under-recognized, in part due to variable degrees of enzyme deficiency and symptomatology, as well as limitations in means for noninvasive evaluation. We describe a proton magnetic resonance spectroscopy (MRS) technique, using a standard clinical magnetic resonance imaging scanner, to diagnose and help monitor the response to therapy in adult CPT II deficiency. A 53-year-old woman presented with a long standing history of diffuse aching and fatigue provoked by high fat intake, fasting, or prolonged exertion. Muscle biopsy revealed myopathic features and a deficiency (33% of control) of CPT II activity with elevated palmitoyl carnitine. Proton MRS of the soleus muscle was performed using a 1.5 Tesla scanner before and during dietary therapy. Proton MRS revealed shortening of the transverse relaxation time (T2), consistent with increased acetylation of the carnitine pool. The symptoms resolved completely by treatment with frequent feedings of a high carbohydrate diet low in long chain fatty acids supplemented with medium chain triglycerides and L-carnitine. Recovery of normal muscle MRS and carnitine T2 relaxation was documented by the third month of therapy. Proton MRS is a novel, potentially useful, and readily available adjunct in the diagnosis and therapeutic monitoring of muscle CPT II deficiency.

  7. Acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia: acute onset and complete recovery.

    Science.gov (United States)

    Tu, Guo-Wei; Song, Jie-Qiong; Ting, Simon Kang Seng; Ju, Min-Jie; He, Hong-Yu; Dong, Ji-Hong; Luo, Zhe

    2015-02-03

    Critical illness polyneuropathy and myopathy are multifaceted complications that follow severe illnesses involving the sensorimotor axons and proximal skeletal muscles. These syndromes have rarely been reported among renal transplant recipients. In this paper, we report a case of acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia. The muscle strength in the patient's extremities improved gradually after four weeks of comprehensive treatment, and his daily life activities were normal a year after being discharged.

  8. Precursory deformation and depths of magma storage revealed by regional InSAR time series surveys: example of the Indonesian and Mexican volcanic arcs

    Science.gov (United States)

    Chaussard, E.; Amelung, F.; Aoki, Y.

    2012-12-01

    -3 km depth below the average regional elevation. We compare the deformation-activity relationship observed in the west-Sunda arc with results from the Mexican arc. We also compare the depths of magma storage estimated in each arc and use a global data-set of reservoir depths at arc volcanoes to try to explain the observed regional trends in magma storage depths.

  9. Experimental and computational analysis of a large protein network that controls fat storage reveals the design principles of a signaling network.

    Directory of Open Access Journals (Sweden)

    Bader Al-Anzi

    2015-05-01

    Full Text Available An approach combining genetic, proteomic, computational, and physiological analysis was used to define a protein network that regulates fat storage in budding yeast (Saccharomyces cerevisiae. A computational analysis of this network shows that it is not scale-free, and is best approximated by the Watts-Strogatz model, which generates "small-world" networks with high clustering and short path lengths. The network is also modular, containing energy level sensing proteins that connect to four output processes: autophagy, fatty acid synthesis, mRNA processing, and MAP kinase signaling. The importance of each protein to network function is dependent on its Katz centrality score, which is related both to the protein's position within a module and to the module's relationship to the network as a whole. The network is also divisible into subnetworks that span modular boundaries and regulate different aspects of fat metabolism. We used a combination of genetics and pharmacology to simultaneously block output from multiple network nodes. The phenotypic results of this blockage define patterns of communication among distant network nodes, and these patterns are consistent with the Watts-Strogatz model.

  10. Experimental and computational analysis of a large protein network that controls fat storage reveals the design principles of a signaling network.

    Science.gov (United States)

    Al-Anzi, Bader; Arpp, Patrick; Gerges, Sherif; Ormerod, Christopher; Olsman, Noah; Zinn, Kai

    2015-05-01

    An approach combining genetic, proteomic, computational, and physiological analysis was used to define a protein network that regulates fat storage in budding yeast (Saccharomyces cerevisiae). A computational analysis of this network shows that it is not scale-free, and is best approximated by the Watts-Strogatz model, which generates "small-world" networks with high clustering and short path lengths. The network is also modular, containing energy level sensing proteins that connect to four output processes: autophagy, fatty acid synthesis, mRNA processing, and MAP kinase signaling. The importance of each protein to network function is dependent on its Katz centrality score, which is related both to the protein's position within a module and to the module's relationship to the network as a whole. The network is also divisible into subnetworks that span modular boundaries and regulate different aspects of fat metabolism. We used a combination of genetics and pharmacology to simultaneously block output from multiple network nodes. The phenotypic results of this blockage define patterns of communication among distant network nodes, and these patterns are consistent with the Watts-Strogatz model.

  11. Role of Exercise Therapy in Prevention of Decline in Aging Muscle Function: Glucocorticoid Myopathy and Unloading

    Directory of Open Access Journals (Sweden)

    Teet Seene

    2012-01-01

    Full Text Available Changes in skeletal muscle quantity and quality lead to disability in the aging population. Physiological changes in aging skeletal muscle are associated with a decline in mass, strength, and inability to maintain balance. Glucocorticoids, which are in wide exploitation in various clinical scenarios, lead to the loss of the myofibrillar apparatus, changes in the extracellular matrix, and a decrease in muscle strength and motor activity, particularly in the elderly. Exercise therapy has shown to be a useful tool for the prevention of different diseases, including glucocorticoid myopathy and muscle unloading in the elderly. The purpose of the paper is to discuss the possibilities of using exercise therapy in the prevention of glucocorticoid caused myopathy and unloading in the elderly and to describe relationships between the muscle contractile apparatus and the extracellular matrix in different types of aging muscles.

  12. Free radicals in alcoholic myopathy: indices of damage and preventive studies.

    Science.gov (United States)

    Preedy, Victor R; Adachi, Junko; Asano, Migiwa; Koll, Michael; Mantle, David; Niemela, Onni; Parkkila, Seppo; Paice, Alistair G; Peters, Timothy; Rajendram, Rajkumar; Seitz, Helmut; Ueno, Yasuhiro; Worrall, Simon

    2002-04-15

    Chronic alcoholic myopathy affects up to two-thirds of all alcohol misusers and is characterized by selective atrophy of Type II (glycolytic, fast-twitch, anaerobic) fibers. In contrast, the Type I fibers (oxidative, slow-twitch, aerobic) are relatively protected. Alcohol increases the concentration of cholesterol hydroperoxides and malondialdehyde-protein adducts, though protein-carbonyl concentration levels do not appear to be overtly increased and may actually decrease in some studies. In alcoholics, plasma concentrations of alpha-tocopherol may be reduced in myopathic patients. However, alpha-tocopherol supplementation has failed to prevent either the loss of skeletal muscle protein or the reductions in protein synthesis in alcohol-dosed animals. The evidence for increased oxidative stress in alcohol-exposed skeletal muscle is thus inconsistent. Further work into the role of ROS in alcoholic myopathy is clearly warranted.

  13. Fatal hepatic hemorrhage by peliosis hepatis in X-linked myotubular myopathy: a case report.

    Science.gov (United States)

    Motoki, T; Fukuda, M; Nakano, T; Matsukage, S; Fukui, A; Akiyoshi, S; Hayashi, Y K; Ishii, E; Nishino, I

    2013-11-01

    We report a 5-year-old boy with X-linked myotubular myopathy complicated by peliosis hepatis. At birth, he was affected with marked generalized muscle hypotonia and weakness, which required permanent ventilatory support, and was bedridden for life. He died of acute fatal hepatic hemorrhage after using a mechanical in-exsufflator. Peliosis hepatis, defined as multiple, variable-sized, cystic blood-filled spaces through the liver parenchyma, was confirmed by autopsy. To avoid fatal hepatic hemorrhage by peliosis hepatis, routine hepatic function tests and abdominal imaging tests should be performed for patients with X-linked myotubular myopathy, especially at the time of using artificial respiration. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Computed tomographical findings of skeletal muscles in rimmed vacuole type distal myopathy

    International Nuclear Information System (INIS)

    Kunimoto, Masanari; Kawai, Mitsuru; Goto, Jun; Nakano, Imaharu

    1987-01-01

    Skeletal muscle CT scans of three patients with biopsy-proven rimmed vacuole type distal myopathy(RVDM) from two unrelated families showed unique involvement pattern of the lower extremities. Parents of the patients in both families are first cousins. T.Y. is a 36-year-old woman who noticed mild difficulty in walking at 34 years of age. Now she shows waddling but still indpendent gait. Manual muscle test (MMT) revealed the following results: fair (3+/5) for hip flexion, 3 for hip extension, 3 for knee flexion, normal (5/5) for knee extension, poor (2/5) for ankle dorsi-flexion, good (4/5) for ankle plantar flexion. T.M., a 34-year-old younger sister of T.Y., started dragging her feet on gait at age 27. She could walk neither on toes nor heels. At present, she can walk only with support. MMT showed the following: 3- and trace (1/5) for hip flexion and extension, 3- and 4 for knee flexion and extension, 1 for ankle plantar- and dorsiflexion. K.W., a 33-year-old woman, began to drag her foot tips in walk and became unable to walk on toes at age 21. The leg weakness progressed into the wheelchair-ridden state at age 30. MMT gave the following results: 1 for hip flexion and extension, 2 and 4 for knee flexion and extension, zero for plantar- and dorsi-flexion. The most impressive CT findings common to these three patients are prominent contrast between the quadriceps muscles and the adductor- and hamstring-group: the former is markedly well preserved even in the most advanced patient (K.W.) while the latter are diffusely and severely affected even in the least affected patient (T.Y.). This finding well coincides with the results of MMT: the knee extensor (quadriceps muscles) fairly well keeps its strength even in the most advanced patient but the knee flexors (adductors and hamstrings) are definitely affected in the early stage of the condition. (J.P.N.)

  15. Computed tomographical findings of skeletal muscles in rimmed vacuole type distal myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Kunimoto, Masanari; Kawai, Mitsuru; Goto, Jun; Nakano, Imaharu

    1987-03-01

    Skeletal muscle CT scans of three patients with biopsy-proven rimmed vacuole type distal myopathy(RVDM) from two unrelated families showed unique involvement pattern of the lower extremities. Parents of the patients in both families are first cousins. T.Y. is a 36-year-old woman who noticed mild difficulty in walking at 34 years of age. Now she shows waddling but still indpendent gait. Manual muscle test (MMT) revealed the following results: fair (3+/5) for hip flexion, 3 for hip extension, 3 for knee flexion, normal (5/5) for knee extension, poor (2/5) for ankle dorsi-flexion, good (4/5) for ankle plantar flexion. T.M., a 34-year-old younger sister of T.Y., started dragging her feet on gait at age 27. She could walk neither on toes nor heels. At present, she can walk only with support. MMT showed the following: 3- and trace (1/5) for hip flexion and extension, 3- and 4 for knee flexion and extension, 1 for ankle plantar- and dorsiflexion. K.W., a 33-year-old woman, began to drag her foot tips in walk and became unable to walk on toes at age 21. The leg weakness progressed into the wheelchair-ridden state at age 30. MMT gave the following results: 1 for hip flexion and extension, 2 and 4 for knee flexion and extension, zero for plantar- and dorsi-flexion. The most impressive CT findings common to these three patients are prominent contrast between the quadriceps muscles and the adductor- and hamstring-group: the former is markedly well preserved even in the most advanced patient (K.W.) while the latter are diffusely and severely affected even in the least affected patient (T.Y.). This finding well coincides with the results of MMT: the knee extensor (quadriceps muscles) fairly well keeps its strength even in the most advanced patient but the knee flexors (adductors and hamstrings) are definitely affected in the early stage of the condition. (J.P.N.).

  16. Homozygous LIPE Mutation in Siblings with Multiple Symmetric Lipomatosis, Partial Lipodystrophy, and Myopathy

    OpenAIRE

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2016-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli–Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causingmutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutan...

  17. Cardiac abnormalities assessed by non-invasive techniques in patients with newly diagnosed idiopathic inflammatory myopathies

    DEFF Research Database (Denmark)

    Diederichsen, Louise Pyndt; Simonsen, Jane Angel; Diederichsen, Axel Cosmus Pyndt

    2015-01-01

    inflammatory myopathies (IIM) by means of non-invasive techniques. METHODS: Fourteen patients with IIM (8 polymyositis, 4 dermatomyositis, 2 cancer-associated dermatomyositis) and 14 gender- and age- matched healthy control subjects were investigated. Participant assessments included a cardiac questionnaire...... in 8 (57%) of the patients compared to none of the controls (pgroup (p=0.01). Two patients had systolic dysfunction, and one diastolic dysfunction...

  18. Case Report: Elevated CPK, an indicator of idiopathic inflammatory myopathy? [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Hina N. Khan

    2016-02-01

    Full Text Available Polymyositis is a rare disease with incidence rates at about 1 per 100,000 people annually. In this case report we will review a case of proximal muscle weakness with an elevated creatine phosphokinase that was initially misdiagnosed twice as rhabdomyolysis. Therefore, emphasizing that idiopathic inflammatory myopathy is a potential cause of myasthenia that must be considered in the differential. The case will also describe the current treatment and treatment response in polymyositis.

  19. Toxic myopathy in a dog associated with the presence of monensin in dry food.

    Science.gov (United States)

    Wilson, J S

    1980-01-01

    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  20. Toxic Myopathy in a Dog Associated with the Presence of Monensin in Dry Food

    OpenAIRE

    Wilson, J. S.

    1980-01-01

    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  1. Whole-body MRI for full assessment and characterization of diffuse inflammatory myopathy

    Directory of Open Access Journals (Sweden)

    Saleh Saleh Elessawy

    2016-09-01

    Full Text Available Background Conventional magnetic resonance imaging (MRI is a highly valuable tool for full assessment of the extent of bilateral symmetrical diffuse inflammatory myopathy, owing to its high sensitivity in the detection of edema which correlates with, and sometimes precedes, clinical findings. Purpose To evaluate the use of whole-body (WB-MRI in characterization and full assessment of the extent and distribution of diffuse inflammatory myopathy. Material and Methods A prospective study on 15 patients presenting with clinical evidence of inflammatory myopathy. It included 4 boys/men and 11 girls/women (age range, 6–44 years; mean age, 25.5 years. 1.5 T WB-MRI was performed and the distribution and extent of disease severity was assessed according to muscle edema on STIR images. Results Four cases of dermatomyositis showed lower limb disease predilection with edema in gluteal, thigh, and calf muscles. The same finding was seen in one case with recurrent polymyositis and three cases with overlap myositis with systemic lupus erythematosus (SLE. Bilateral upper and lower limb myositis was demonstrated in three cases of polymyositis and one case of overlap myositis with scleroderma. Bilateral edema involving all scanned muscle groups was detected in three cases of polymyositis with paraneoplastic syndrome, SLE, and severe active dermatomyositis (including the neck muscles. Conclusion WB-MRI is the diagnostic modality of choice for cases of inflammatory myopathy. It accurately detects the most severely affected muscles candidate for biopsy and provides a reliable baseline study for follow-up of disease progression as well as response to treatment.

  2. Apparent diffusion coefficient (ADC) does not correlate with different serological parameters in myositis and myopathy.

    Science.gov (United States)

    Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey

    2018-06-01

    Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3  mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3  mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3  mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.

  3. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    OpenAIRE

    Stenzel, W; Preusse, C; Allenbach, Y; Pehl, D; Junckerstorff, R; Heppner, F L; Nolte, K; Aronica, E; Kana, V; Rushing, E; Schneider, U; Claeys, K G; Benveniste, O; Weis, J; Goebel, H H

    2015-01-01

    Objective: To analyze antisynthetase syndrome–associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Methods: Skeletal muscle biopsies from antisynthetase syndrome–associated myositis and other IIMs from different institutions worldwide were analyzed by histopathology, quantitative PCR, and electron microscopy. Results: Myonuclear actin filament inclusions were identified as a unique morphologic hallmark of a...

  4. Unfolded protein response and activated degradative pathways regulation in GNE myopathy.

    Directory of Open Access Journals (Sweden)

    Honghao Li

    Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.

  5. Computed tomography and angiography in MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes)

    International Nuclear Information System (INIS)

    Hasuo, K.; Tamura, S.; Yasumori, K.; Uchino, A.; Masuda, K.; Goda, S.; Ishimoto, S.; Kamikaseda, K.; Wakuta, Y.; Kishi, M.

    1987-01-01

    Among mitochondrial encephalomyopathies, MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes, Pavlakis et al., 1983) is recognized as a distinct syndrome characterized by generalized convulsions and recurrrent stroke-like episodes. The neuroradiological findings of three patients with MELAS are reported here. Retrospective review shows that MELAS should be included in the differential diagnosis of infarct-like lesions of the cerebrum. (orig.)

  6. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    OpenAIRE

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-01-01

    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-i...

  7. Insulin resistance and increased muscle cytokine levels in patients with mitochondrial myopathy.

    Science.gov (United States)

    Rue, Nana; Vissing, John; Galbo, Henrik

    2014-10-01

    Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. This was an experimental, controlled study in outpatients. Eight overnight-fasted patients (P) with various inherited mitochondrial myopathies and eight healthy subjects (C) matched for sex, age, weight, height, and physical activity participated in the study. The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. Glucose infusion rate during 90-120 minutes of insulin infusion was measured. Cytokine concentrations in dialysate were also measured. Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P fatty acids and glycerol at 120 minutes were higher in P vs C (2P myopathies, insulin sensitivity of muscle, adipose tissue, and pancreatic A cells is reduced, supporting that mitochondrial function influences insulin action. Furthermore, a local, low-grade inflammation of potential clinical importance exists in the muscle of these patients.

  8. Rapid diagnosis of hypoglycin A intoxication in atypical myopathy of horses.

    Science.gov (United States)

    Sander, Johannes; Cavalleri, Jessika-M V; Terhardt, Michael; Bochnia, Mandy; Zeyner, Annette; Zuraw, Aleksandra; Sander, Stefanie; Peter, Michael; Janzen, Nils

    2016-03-01

    Hypoglycin A (2-amino-3-(2-methylidenecyclopropyl)propanoic acid) is the plant toxin shown to cause atypical myopathy in horses. It is converted in vivo to methylenecyclopropyl acetic acid, which is transformed to a coenzyme A ester that subsequently blocks beta oxidation of fatty acids. Methylenecyclopropyl acetic acid is also conjugated with carnitine and glycine. Acute atypical myopathy may be diagnosed by quantifying the conjugates of methylenecyclopropyl acetic acid plus a selection of acyl conjugates in urine and serum. We describe a new mass spectrometric method for sample volumes of acid in urine, the coefficients of variation for intraday quantification were 2.9% and 3.0%, respectively. The respective values for interday were 9.3% and 8.0%. Methylenecyclopropyl acetyl carnitine was detected as high as 1.18 µmol/L in serum (median: 0.46 µmol/L) and 1.98 mmol/mol creatinine in urine (median: 0.79 mmol/mol creatinine) of diseased horses, while the glycine derivative accumulated up to 1.97 mmol/mol creatinine in urine but was undetectable in most serum samples. In serum samples from horses with atypical myopathy, the intraday coefficients of variation for C4-C8 carnitines and glycines were ≤4.5%. Measured concentrations exceeded those in healthy horses by ~10 to 1,400 times. © 2015 The Author(s).

  9. The genetic basis of pectoralis major myopathies in modern broiler chicken lines.

    Science.gov (United States)

    Bailey, Richard A; Watson, Kellie A; Bilgili, S F; Avendano, Santiago

    2015-12-01

    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories) and wooden breast (WB; 3 categories). Data from two purebred commercial broiler lines (A and B) were utilized providing greater than 40,000 meat quality records per line. The difference in selection history between these two lines has resulted in contrasting breast yield (BY): 29% for Line A and 21% for Line B. Data were analyzed to estimate genetic parameters using a multivariate animal model including six traits: body weight (BW), processing body weight (PW), BY, DPM, WB, and WS, in addition to the appropriate fixed effects and permanent environmental effect of the dam. Results indicate similar patterns of heritability and genetic correlations for the two lines. Heritabilities (h2) of BW, PW and BY ranged from 0.271-0.418; for DPM and WB h2white striping of breast muscle and more than 90% of the variance of the incidence of wooden breast and deep pectoral myopathy in broiler chickens. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.

  10. [Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].

    Science.gov (United States)

    Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra

    2017-11-01

    We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.

  11. Genetic factors affecting statin concentrations and subsequent myopathy: a HuGENet systematic review

    Science.gov (United States)

    Canestaro, William J.; Austin, Melissa A.; Thummel, Kenneth E.

    2015-01-01

    Statins, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitors, have proven efficacy in both lowering low-density-lipoprotein levels and preventing major coronary events, making them one of the most commonly prescribed drugs in the United States. Statins exhibit a class-wide side effect of muscle toxicity and weakness, which has led regulators to impose both dosage limitations and a recall. This review focuses on the best-characterized genetic factors associated with increased statin muscle concentrations, including the genes encoding cytochrome P450 enzymes (CYP2D6, CYP3A4, and CYP3A5), a mitochondrial enzyme (GATM), an influx transporter (SLCO1B1), and efflux transporters (ABCB1 and ABCG2). A systematic literature review was conducted to identify relevant research evaluating the significance of genetic variants predictive of altered statin concentrations and subsequent statin-related myopathy. Studies eligible for inclusion must have incorporated genotype information and must have associated it with some measure of myopathy, either creatine kinase levels or self-reported muscle aches and pains. After an initial review, focus was placed on seven genes that were adequately characterized to provide a substantive review: CYP2D6, CYP3A4, CYP3A5, GATM, SLCO1B1, ABCB1, and ABCG2. All statins were included in this review. Among the genetic factors evaluated, statin-related myopathy appears to be most strongly associated with variants in SLCO1B1. PMID:24810685

  12. Tc-99m ECD brain SPECT in MELAS syndrome and mitochondrial myopathy: comparison with MR findings

    International Nuclear Information System (INIS)

    Park, Sang Joon; Ryu, Young Hoon; Jeon, Tae Joo; Kim, Jai Keun; Nam, Ji Eun; Yoon, Pyeong Ho; Yoon, Choon Sik; Lee, Jong Doo

    1998-01-01

    We evaluated brain perfusion SPECT findings of MELAS syndrome and mitochondrial myopathy in correlation with MR imaging in search of specific imaging features. Subjects were five patients (four females and one male; age range, 1 to 25 year) who presented with repeated stroke like episodes, seizures or developmental delay or asymptomatic but had elevated lactic acid in CSF and serum. Conventional non-contrast MR imaging and Tc-99m-ethyl cysteinate dimer (ECD) brain perfusion SPECT were performed and imaging features were analyzed. MRI demonstrated increased T2 signal intensities in the affected areas of gray and white matters mainly in the parietal (4/5) and occipital lobes (4/5) and in the basal ganglia (1/5), which were not restricted to a specific vascular territory. SPECT demonstrated decreased perfusion in the corresponding regions of MRI lesions. In addition, there were perfusion defects in parietal (1 patient), temporal (2), and frontal (1) lobes and basal ganglia (1) and thalami (2). In a patient with mitochondrial myopathy who had normal MRI, decreased perfusion was noted in left parietal area and bilateral thalami. Tc-99m ECD SPECT imaging in patients with MELAS syndrome and mitochondrial myopathy showed hypoperfusion of parieto-occipital cortex, basal ganglia, thalamus and temporal cortex, which were not restricted to a specific vascular territory. There were no specific imaging features on SPECT. The significance of abnormal perfusion on SPECT without corresponding MR abnormalities needs to be evaluated further in larger number of patients

  13. [Value of MRI in the treatment of Grave's disease orbital myopathy].

    Science.gov (United States)

    Oğuz, V; Yolar, M; Yetik, H; Cakirer, D; Uysal, O; Pazarli, H

    2001-10-01

    In order to evaluate the predictability of the results in the treatment of myopathy in cases with the clinical signs of muscle involvement, 177 extraocular muscles of 27 cases whose oedematous status was detected by MRI and who were given antiinflammatory treatment according to the data of this method, were studied. The nature of involvement was detected in respect with the signal intensity and thickness of each rectus muscle prior to the treatment and at the end of the sixth month following a three months' application of combined treatment of steroids and irradiation of 2000 rads. When the initial and final results were compared, the signal intensities of four involved recti showed significant decrease at the end of the treatment, as they were evaluated separately or together. Besides the thicknesses of these groups of involved recti which were evaluated separately showed significant decrease. The evaluation of the signal intensities by MRI is a way that enables noninvasive detection of the edema and prediction of the anti-inflammatory treatment's results of dysthyroid myopathy. Therefore a systematic follow up by MRI is recommended for the treatment choice in dysthyroid myopathy.

  14. Actin Nemaline Myopathy Mouse Reproduces Disease, Suggests Other Actin Disease Phenotypes and Provides Cautionary Note on Muscle Transgene Expression

    Science.gov (United States)

    Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.

    2011-01-01

    Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871

  15. Genetic Basis of Variation in Rice Seed Storage Protein (Albumin, Globulin, Prolamin, and Glutelin) Content Revealed by Genome-Wide Association Analysis.

    Science.gov (United States)

    Chen, Pingli; Shen, Zhikang; Ming, Luchang; Li, Yibo; Dan, Wenhan; Lou, Guangming; Peng, Bo; Wu, Bian; Li, Yanhua; Zhao, Da; Gao, Guanjun; Zhang, Qinglu; Xiao, Jinghua; Li, Xianghua; Wang, Gongwei; He, Yuqing

    2018-01-01

    Rice seed storage protein (SSP) is an important source of nutrition and energy. Understanding the genetic basis of SSP content and mining favorable alleles that control it will be helpful for breeding new improved cultivars. An association analysis for SSP content was performed to identify underlying genes using 527 diverse Oryza sativa accessions grown in two environments. We identified more than 107 associations for five different traits, including the contents of albumin (Alb), globulin (Glo), prolamin (Pro), glutelin (Glu), and total SSP (Total). A total of 28 associations were located at previously reported QTLs or intervals. A lead SNP sf0709447538, associated for Glu content in the indica subpopulation in 2015, was further validated in near isogenic lines NIL(Zhenshan97) and NIL(Delong208), and the Glu phenotype had significantly difference between two NILs. The association region could be target for map-based cloning of the candidate genes. There were 13 associations in regions close to grain-quality-related genes; five lead single nucleotide polymorphisms (SNPs) were located less than 20 kb upstream from grain-quality-related genes ( PG5a , Wx , AGPS2a , RP6 , and, RM1 ). Several starch-metabolism-related genes ( AGPS2a , OsACS6 , PUL , GBSSII , and ISA2 ) were also associated with SSP content. We identified favorable alleles of functional candidate genes, such as RP6 , RM1 , Wx , and other four candidate genes by haplotype analysis and expression pattern. Genotypes of RP6 and RM1 with higher Pro were not identified in japonica and exhibited much higher expression levels in indica group. The lead SNP sf0601764762, repeatedly detected for Alb content in 2 years in the whole association population, was located in the Wx locus that controls the synthesis of amylose. And Alb content was significantly and negatively correlated with amylose content and the level of 2.3 kb Wx pre-mRNA examined in this study. The associations or candidate genes identified would

  16. Genetic Basis of Variation in Rice Seed Storage Protein (Albumin, Globulin, Prolamin, and Glutelin Content Revealed by Genome-Wide Association Analysis

    Directory of Open Access Journals (Sweden)

    Pingli Chen

    2018-05-01

    Full Text Available Rice seed storage protein (SSP is an important source of nutrition and energy. Understanding the genetic basis of SSP content and mining favorable alleles that control it will be helpful for breeding new improved cultivars. An association analysis for SSP content was performed to identify underlying genes using 527 diverse Oryza sativa accessions grown in two environments. We identified more than 107 associations for five different traits, including the contents of albumin (Alb, globulin (Glo, prolamin (Pro, glutelin (Glu, and total SSP (Total. A total of 28 associations were located at previously reported QTLs or intervals. A lead SNP sf0709447538, associated for Glu content in the indica subpopulation in 2015, was further validated in near isogenic lines NIL(Zhenshan97 and NIL(Delong208, and the Glu phenotype had significantly difference between two NILs. The association region could be target for map-based cloning of the candidate genes. There were 13 associations in regions close to grain-quality-related genes; five lead single nucleotide polymorphisms (SNPs were located less than 20 kb upstream from grain-quality-related genes (PG5a, Wx, AGPS2a, RP6, and, RM1. Several starch-metabolism-related genes (AGPS2a, OsACS6, PUL, GBSSII, and ISA2 were also associated with SSP content. We identified favorable alleles of functional candidate genes, such as RP6, RM1, Wx, and other four candidate genes by haplotype analysis and expression pattern. Genotypes of RP6 and RM1 with higher Pro were not identified in japonica and exhibited much higher expression levels in indica group. The lead SNP sf0601764762, repeatedly detected for Alb content in 2 years in the whole association population, was located in the Wx locus that controls the synthesis of amylose. And Alb content was significantly and negatively correlated with amylose content and the level of 2.3 kb Wx pre-mRNA examined in this study. The associations or candidate genes identified would provide

  17. Tritium storage

    International Nuclear Information System (INIS)

    Hircq, B.

    1990-01-01

    This document represents a synthesis relative to tritium storage. After indicating the main storage particularities as regards tritium, storages under gaseous and solid form are after examined before establishing choices as a function of the main criteria. Finally, tritium storage is discussed regarding tritium devices associated to Fusion Reactors and regarding smaller devices [fr

  18. Gas-Chromatography Mass-Spectrometry (GC-MS Based Metabolite Profiling Reveals Mannitol as a Major Storage Carbohydrate in the Coccolithophorid Alga Emiliania huxleyi

    Directory of Open Access Journals (Sweden)

    Alisdair R. Fernie

    2013-03-01

    Full Text Available Algae are divergent organisms having a wide variety of evolutional histories. Although most of them share photosynthetic activity, their pathways of primary carbon metabolism are rather diverse among species. Here we developed a method for gas chromatography-mass spectroscopy (GC-MS based metabolite profiling for the coccolithophorid alga Emiliania huxleyi, which is one of the most abundant microalgae in the ocean, in order to gain an overview of the pathway of primary metabolism within this alga. Following method optimization, twenty-six metabolites could be detected by this method. Whilst most proteogenic amino acids were detected, no peaks corresponding to malate and fumarate were found. The metabolite profile of E. huxleyi was, however, characterized by a prominent accumulation of mannitol reaching in excess of 14 nmol 106 cells−1. Similarly, the accumulation of the 13C label during short term H13CO3− feeding revealed a massive redistribution of label into mannitol as well as rapid but saturating label accumulation into glucose and several amino acids including aspartate, glycine and serine. These results provide support to previous work suggesting that this species adopts C3 photosynthesis and that mannitol functions as a carbon store in E. huxleyi.

  19. Statin myopathy: the fly in the ointment for the prevention of cardiovascular disease in the 21st century?

    Science.gov (United States)

    Keen, Helen I; Krishnarajah, Janakan; Bates, Timothy R; Watts, Gerald F

    2014-09-01

    Cardiovascular disease (CVD) remains the leading cause of death in industrialized nations. Despite clear evidence of CVD risk reduction with HMG-CoA reductase inhibitors (statins), the side effects of these medications, particularly myopathy, limit their effectiveness. Studies into the mechanisms, aetiology and management of statin myopathy are limited by lack of an internationally agreed clinical definition and tools for assessing outcomes. Currently there is a paucity of evidence to guide the management of patients affected by statin myopathy; with the exception of dose reduction, there is little evidence that other strategies can improve statin tolerance, and even less evidence to suggest these alternate dosing strategies reduce cardiovascular risk. This review will cover current definitions, clinical presentations, risk factors, pathogenesis and management. PubMed was searched (English language, to 2014) for key articles pertaining to statin myopathy. This review then briefly describes our experience of managing this condition in a tertiary lipid disorders clinic, in the setting of limited guiding evidence. Knowledge gaps in the field of statin myopathy are identified and future research directions are suggested. We urge the need for international attention to address this important, but largely neglected clinical problem, that if unresolved will remain an impediment to the effective prevention and treatment of CVD.

  20. Skeletal muscle-specific HMG-CoA reductase knockout mice exhibit rhabdomyolysis: A model for statin-induced myopathy.

    Science.gov (United States)

    Osaki, Yoshinori; Nakagawa, Yoshimi; Miyahara, Shoko; Iwasaki, Hitoshi; Ishii, Akiko; Matsuzaka, Takashi; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Sone, Hirohito; Ohashi, Ken; Ishibashi, Shun; Yamada, Nobuhiro; Shimano, Hitoshi

    2015-10-23

    HMG-CoA reductase (HMGCR) catalyzes the conversion of HMG-CoA to mevalonic acid (MVA); this is the rate-limiting enzyme of the mevalonate pathway that synthesizes cholesterol. Statins, HMGCR inhibitors, are widely used as cholesterol-reducing drugs. However, statin-induced myopathy is the most adverse side effect of statins. To eludicate the mechanisms underlying statin the myotoxicity and HMGCR function in the skeletal muscle, we developed the skeletal muscle-specific HMGCR knockout mice. Knockout mice exhibited postnatal myopathy with elevated serum creatine kinase levels and necrosis. Myopathy in knockout mice was completely rescued by the oral administration of MVA. These results suggest that skeletal muscle toxicity caused by statins is dependent on the deficiencies of HMGCR enzyme activity and downstream metabolites of the mevalonate pathway in skeletal muscles rather than the liver or other organs. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Expanding the clinical spectrum of hereditary fibrosing poikiloderma with tendon contractures, myopathy and pulmonary fibrosis due to FAM111B mutations.

    Science.gov (United States)

    Mercier, Sandra; Küry, Sébastien; Salort-Campana, Emmanuelle; Magot, Armelle; Agbim, Uchenna; Besnard, Thomas; Bodak, Nathalie; Bou-Hanna, Chantal; Bréhéret, Flora; Brunelle, Perrine; Caillon, Florence; Chabrol, Brigitte; Cormier-Daire, Valérie; David, Albert; Eymard, Bruno; Faivre, Laurence; Figarella-Branger, Dominique; Fleurence, Emmanuelle; Ganapathi, Mythily; Gherardi, Romain; Goldenberg, Alice; Hamel, Antoine; Igual, Jeanine; Irvine, Alan D; Israël-Biet, Dominique; Kannengiesser, Caroline; Laboisse, Christian; Le Caignec, Cédric; Mahé, Jean-Yves; Mallet, Stéphanie; MacGowan, Stuart; McAleer, Maeve A; McLean, Irwin; Méni, Cécile; Munnich, Arnold; Mussini, Jean-Marie; Nagy, Peter L; Odel, Jeffrey; O'Regan, Grainne M; Péréon, Yann; Perrier, Julie; Piard, Juliette; Puzenat, Eve; Sampson, Jacinda B; Smith, Frances; Soufir, Nadem; Tanji, Kurenai; Thauvin, Christel; Ulane, Christina; Watson, Rosemarie M; Khumalo, Nonhlanhla P; Mayosi, Bongani M; Barbarot, Sébastien; Bézieau, Stéphane

    2015-10-15

    Hereditary Fibrosing Poikiloderma (HFP) with tendon contractures, myopathy and pulmonary fibrosis (POIKTMP [MIM 615704]) is a very recently described entity of syndromic inherited poikiloderma. Previously by using whole exome sequencing in five families, we identified the causative gene, FAM111B (NM_198947.3), the function of which is still unknown. Our objective in this study was to better define the specific features of POIKTMP through a larger series of patients. Clinical and molecular data of two families and eight independent sporadic cases, including six new cases, were collected. Key features consist of: (i) early-onset poikiloderma, hypotrichosis and hypohidrosis; (ii) multiple contractures, in particular triceps surae muscle contractures; (iii) diffuse progressive muscular weakness; (iv) pulmonary fibrosis in adulthood and (v) other features including exocrine pancreatic insufficiency, liver impairment and growth retardation. Muscle magnetic resonance imaging was informative and showed muscle atrophy and fatty infiltration. Histological examination of skeletal muscle revealed extensive fibroadipose tissue infiltration. Microscopy of the skin showed a scleroderma-like aspect with fibrosis and alterations of the elastic network. FAM111B gene analysis identified five different missense variants (two recurrent mutations were found respectively in three and four independent families). All the mutations were predicted to localize in the trypsin-like cysteine/serine peptidase domain of the protein. We suggest gain-of-function or dominant-negative mutations resulting in FAM111B enzymatic activity changes. HFP with tendon contractures, myopathy and pulmonary fibrosis, is a multisystemic disorder due to autosomal dominant FAM111B mutations. Future functional studies will help in understanding the specific pathological process of this fibrosing disorder.

  2. Energy storage

    Science.gov (United States)

    Kaier, U.

    1981-04-01

    Developments in the area of energy storage are characterized, with respect to theory and laboratory, by an emergence of novel concepts and technologies for storing electric energy and heat. However, there are no new commercial devices on the market. New storage batteries as basis for a wider introduction of electric cars, and latent heat storage devices, as an aid for solar technology applications, with satisfactory performance standards are not yet commercially available. Devices for the intermediate storage of electric energy for solar electric-energy systems, and for satisfying peak-load current demands in the case of public utility companies are considered. In spite of many promising novel developments, there is yet no practical alternative to the lead-acid storage battery. Attention is given to central heat storage for systems transporting heat energy, small-scale heat storage installations, and large-scale technical energy-storage systems.

  3. Evaluation of inflammatory biomarkers associated with oxidative stress and histological assessment of magnetic therapy on experimental myopathy in rats.

    Science.gov (United States)

    Vignola, María Belén; Dávila, Soledad; Cremonezzi, David; Simes, Juan C; Palma, José A; Campana, Vilma R

    2012-12-01

    The effect of pulsed electromagnetic field (PEMF) therapy, also called magnetic therapy, upon inflammatory biomarkers associated with oxidative stress plasma fibrinogen, nitric oxide (NO), L-citrulline, carbonyl groups, and superoxide dismutase (SOD) was evaluated through histological assessment, in rats with experimental myopathy. The groups studied were: (A) control (intact rats that received PEMF sham exposures); (B) rats with myopathy and sacrificed 24 h later; (C) rats with myopathy; (D) rats with myopathy and treated with PEMF; and (E) intact rats treated with PEMF. Groups A, C, D, and E were sacrificed 8 days later. Myopathy was induced by injecting 50 μl of 1% carrageenan λ (type IV) once sub-plantar. Treatment was carried out with PEMF emitting equipment with two flat solenoid disks for 8 consecutive days in groups D and E, at 20 mT and 50 Hz for 30 min/day/rat. The biomarkers were determined by spectrophotometry. The muscles (5/8) were stained with Hematoxylin-Eosin and examined by optic microscopy. Quantitative variables were statistically analyzed by the Fisher test, and categorical applying Pearson's Chi Squared test at p < 0.05 for all cases. In Groups B and C, the biomarkers were significantly increased compared to A, D, and E groups: fibrinogen (p < 0.001); NO, L-citrulline and carbonyl groups (p < 0.05); SOD (p < 0.01) as well as the percentage of area with inflammatory infiltration (p < 0.001). PEMF caused decreased levels of fibrinogen, L-citrulline, NO, SOD, and carbonyl groups and significant muscle recovery in rats with experimental myopathies.

  4. Subclinical myopathy in patients with colorectal cancer: clinical-pathological characterization and search for tissue markers

    Directory of Open Access Journals (Sweden)

    Massimo Vecchiato

    2012-03-01

    Full Text Available Skeletal muscle in patients with cancer undergoes many morphological changes due to immuno-inflammatory factors of tumor origin or treatment.T he latest event of these changes is cancer cachexia. Aim of the study is to identify myopathic features in skeletal muscle biopsies from weight stable patients with colorectal cancer and without cachexia or asthenia / weakness, that could possibly provide new diagnostic and prognostic cancer biomarkers. Morphometric analyses and immunohistochemical studies were performed on intraoperative muscle biopsies from patients with colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. A rectus abdominis biopsy was taken in all patients and controls.A correlation between histopathologic findings and clinical characteristics, circulating inflammatory biomarkers and markers of muscle necrosis,surgery data and cancer phenotype were investigated.. Forty four patients (21male/23 female and 17 controls (6 male/11 female (p=NS were studied. In cancer patients’biopsies we observed asubclinical myopathy characterized by an abnormal distribution of myonuclei, which are localized inside the myofiber rather than at the periphery, and by the presence of regenerating muscle fibers. The percentage of myofibers with internalized nuclei is significantly higher in patients (median= 9%, IQR= 3.7-18.8 than in controls (median= 2.7%, IQR= 1.7-3.2 ( p=0.0002. In patients we observed an inverse correlation between the number of centronucleated fibers and the presence of node metastasis (N+(ρ=-0.64 (p=0.002. Patients affected with colorectal cancer display early sign of a myopathy, characterized by centronucleated and regenerating myofibers. This myopathy appears to be associated with an early stage of neoplasia and it could be an adaptive response of muscle to cancer. We hope a future application of these findings as a possible early diagnostic and prognostic biomarker of

  5. Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.

    Science.gov (United States)

    Brown, Bradley D; Rais, Theodore

    2015-01-01

    The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).

  6. Toxic myopathies: muscle biopsy features Miopatia tóxica: biópsia muscular

    Directory of Open Access Journals (Sweden)

    Rosana Herminia Scola

    2007-03-01

    Full Text Available Several drugs and toxic substances can cause muscular abnormalities and are frequent causes of acquired myopathies. We present a series of 32 patients, predominance of young adult patients, diagnosed with toxic myopathy. The most common substances inducing myopathy were corticosteroids (56.2% followed by the propoxyphene, neuroleptics, zidovudine and drug-induced hypokalemia. The investigation showed normal serum creatine kinase levels in 65.4%, myopathic pattern of the needle electromyography in 40% and the more frequent histological diagnosis of the muscle biopsy was type 2 fiber atrophy (59.3%. Clinical features, etiology, course of the disease, serum levels of muscular enzymes, electromyographic features and, especially, muscle biopsy features are discussed.Diversos medicamentos e substâncias tóxicas podem causar alterações musculares e são causas freqüentes de miopatia adquirida. Apresentamos uma série de 32 pacientes, predomínio de pacientes adulto jovens, com miopatia tóxica. As substâncias mais relacionadas com a miopatia foram os corticosteróides (56,2% seguidos pelo propoxifeno, neurolépticos, zidovudina e drogas indutoras de hipocalemia. A investigação mostrou níveis normais de creatino quinase sérica em 65,4%, eletromiografia de agulha com padrão miopático em 40% e o mais freqüente diagnóstico histológico da biópsia muscular foi atrofia de fibras do tipo 2 (59,3%. As manifestações clínicas, etiologia, tempo de evolução, nível sérico das enzimas musculares, alterações da eletroneuromiografia e, especialmente, da biópsia muscular são discutidos.

  7. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    OpenAIRE

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-01-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...

  8. Serum and tissue markers of myopathy in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Nicoletta Adami

    2012-09-01

    Full Text Available Skeletal muscles in patients with cancer undergo many changes due to immuno-inflammatory factors of tumor origin, or to chemotherapy and irradiation. Aim of the present study is to identify serological biomarkers and early myopathic features in skeletal muscle biopsies from weight stable patients bearing colorectal cancer at the onset of disease. Morphometric analyses by histochemistry and immunohistochemistry were performed on intraoperative muscle biopsies from patients with early colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. Serological analyses for testing markers of inflammation (C Reactive Protein, CRP, muscle enzymes, (Creatin Kinase, CK, soluble isoforms of adhesion molecules (Neural Cell Adhesion Molecule, NCAM, and a marker of protein turnover (prealbumin, a typical indicator of caloric and protein malnutrition were also performed. Fifty oncologic patients (28 male/22 female and 25 non oncologic patients (18 male/7 female (p=N.S. were studied. In muscles from cancer patients we observed a subclinical myopathy characterized by an abnormal distribution of myonuclei. The percentage of myofibers with internalized nuclei was significantly higher in oncologic (median= 13.1%, IQR= 6.0-20.3 than in non oncologic patients (median= 3%, IQR= 2.5-6.1 (p<0.0001. The frequency of these internally nucleated myofibers is even higher in a subgroup of oncologic patients taking myotoxic drugs. In cancer patients, we observed an inverse correlation between the number of internally nucleated fibers and the presence of node metastasis (N+ (ρ=-0.30 (p=0.03. Moreover, in patients with colorectal cancer, low serum levels of preoperative prealbumin (median= 167,7 mg/L, normal range 200-400 mg/L, were detected. The link between the observed early myopathy and long-term cachexia is supported also by the altered expression of sarcolemma associated proteins, in particular laminin and dystrophin

  9. Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report

    Directory of Open Access Journals (Sweden)

    Rosana Hermínia Scola

    2005-06-01

    Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.

  10. Optical storage networking

    Science.gov (United States)

    Mohr, Ulrich

    2001-11-01

    For efficient business continuance and backup of mission- critical data an inter-site storage network is required. Where traditional telecommunications costs are prohibitive for all but the largest organizations, there is an opportunity for regional carries to deliver an innovative storage service. This session reveals how a combination of optical networking and protocol-aware SAN gateways can provide an extended storage networking platform with the lowest cost of ownership and the highest possible degree of reliability, security and availability. Companies of every size, with mainframe and open-systems environments, can afford to use this integrated service. Three mayor applications are explained; channel extension, Network Attached Storage (NAS), Storage Area Networks (SAN) and how optical networks address the specific requirements. One advantage of DWDM is the ability for protocols such as ESCON, Fibre Channel, ATM and Gigabit Ethernet, to be transported natively and simultaneously across a single fiber pair, and the ability to multiplex many individual fiber pairs over a single pair, thereby reducing fiber cost and recovering fiber pairs already in use. An optical storage network enables a new class of service providers, Storage Service Providers (SSP) aiming to deliver value to the enterprise by managing storage, backup, replication and restoration as an outsourced service.

  11. [Dropped head syndrome as first manifestation of primary hyperparathyroid myopathy].

    Science.gov (United States)

    Ota, Kiyobumi; Koseki, Sayo; Ikegami, Kenji; Onishi, Iichiroh; Tomimitsu, Hiyoryuki; Shintani, Shuzo

    2018-03-28

    75 years old woman presented with 6-month history of progressive dropped head syndrome. Neurological examination revealed moderate weakness of flexor and extensor of neck and mild weakness of proximal appendicular muscles with normal deep tendon reflexes. The needle electromyography showed short duration and low amplitude motor unit potential. No fibrillation potentials or positive sharp waves were seen. Biopsy of deltoid muscle was normal. Laboratory studies showed elevated levels of serum calcium (11.8 mg/dl, upper limit of normal 10.1) and intact parathyroid hormone (104 pg/ml, upper limit of normal 65), and decreased level of serum phosphorus (2.3 mg/dl, lower limit of normal 2.7). Ultrasonography and enhanced computed tomography revealed a parathyroid tumor. The tumor was removed surgically. Pathological examination proved tumor to be parathyroid adenoma. Dropped head and weakness of muscles were dramatically improved within a week after the operation. Although hyperparathyroidism is a rare cause of dropped head syndrome, neurologists must recognize hyperparathyroidism as a treatable cause of dropped head syndrome.

  12. Hoffman's syndrome: pseudohypertrophic myopathy as initial manifestation of hypothyroidism. Case report Síndrome de Hoffman: miopatia pseudohipertrófica como manifestação inicial de hipotireoidismo. Relato de caso

    Directory of Open Access Journals (Sweden)

    Luiz Felipe Rocha Vasconcellos

    2003-09-01

    Full Text Available The frequency of myopathy in hypothyroidism ranges from 30 to 80%. The major symptoms related are weakness, muscular cramps and myalgia. The pseudohyperthrophic form is called Hoffman's syndrome. The electrophysiological study reveals myopathy, neuropathy or mixed pattern. Laboratorial investigation generally shows increased levels of muscle enzymes and low serum thyroid hormones, with thyrotrophic-stimulating hormone (TSH elevated. The treatment consists in hormone replacement and the prognosis is good in most of the cases. We report an adult male who developed muscular cramps, myalgia, weakness, pseudohyperthrophy, associated with facial edema and alteration of his voice. The muscle enzymes were increased and T4 was undetectable with a raised level of TSH. The myopathy was the initial manifestation of hypothyroidism in this case.A frequência de miopatia no hipotireoidismo varia de 30% a 80%. Os sintomas relacionados ao acometimento muscular são fraqueza, cãimbras e mialgias. A forma pseudo-hipertrófica é denominada síndrome de Hoffman. O estudo eletrofisiológico pode revelar padrão miopático, neuropático ou misto. A investigação laboratorial em geral mostra aumento das enzimas musculares e redução dos níveis de hormônio tireoidiano com TSH elevado. O tratamento consiste na reposição oral de hormônio e o prognóstico é bom na maioria dos casos. Relatamos o caso de um adulto que apresentou cãimbras, mialgia, fraqueza com pseudohipertrofia muscular associados a edema facial e alteração da voz. As enzimas musculares estavam elevadas e o nível de T4 foi indetectável com aumento de TSH. A miopatia foi manifestação inicial de hipotireoidismo neste caso.

  13. Energy storage

    International Nuclear Information System (INIS)

    2012-01-01

    After having outlined the importance of energy storage in the present context, this document outlines that it is an answer to economic, environmental and technological issues. It proposes a brief overview of the various techniques of energy storage: under the form of chemical energy (hydrocarbons, biomass, hydrogen production), thermal energy (sensitive or latent heat storage), mechanical energy (potential energy by hydraulic or compressed air storage, kinetic energy with flywheels), electrochemical energy (in batteries), electric energy (super-capacitors, superconductor magnetic energy storage). Perspectives are briefly evoked

  14. Deletion of the Ste20-like kinase SLK in skeletal muscle results in a progressive myopathy and muscle weakness.

    Science.gov (United States)

    Pryce, Benjamin R; Al-Zahrani, Khalid N; Dufresne, Sébastien; Belkina, Natalya; Labrèche, Cédrik; Patino-Lopez, Genaro; Frenette, Jérôme; Shaw, Stephen; Sabourin, Luc A

    2017-02-02

    The Ste20-like kinase, SLK, plays an important role in cell proliferation and cytoskeletal remodeling. In fibroblasts, SLK has been shown to respond to FAK/Src signaling and regulate focal adhesion turnover through Paxillin phosphorylation. Full-length SLK has also been shown to be essential for embryonic development. In myoblasts, the overexpression of a dominant negative SLK is sufficient to block myoblast fusion. In this study, we crossed the Myf5-Cre mouse model with our conditional SLK knockout model to delete SLK in skeletal muscle. A thorough analysis of skeletal muscle tissue was undertaken in order to identify defects in muscle development caused by the lack of SLK. Isometric force analysis was performed on adult knockout mice and compared to age-matched wild-type mice. Furthermore, cardiotoxin injections were performed followed by immunohistochemistry for myogenic markers to assess the efficiency muscle regeneration following SLK deletion. We show here that early deletion of SLK from the myogenic lineage does not markedly impair skeletal muscle development but delays the regenerative process. Interestingly, adult mice (~6 months) display an increase in the proportion of central nuclei and increased p38 activation. Furthermore, mice as young as 3 months old present with decreased force generation, suggesting that the loss of SLK impairs myofiber stability and function. Assessment of structural components revealed aberrant localization of focal adhesion proteins, such as FAK and paxillin. Our data show that the loss of SLK results in unstable myofibers resulting in a progressive myopathy. Additionally, the loss of SLK resulted in a delay in muscle regeneration following cardiotoxin injections. Our results show that SLK is dispensable for muscle development and regeneration but is required for myofiber stability and optimal force generation.

  15. Zebrafish models of BAG3 myofibrillar myopathy suggest a toxic gain of function leading to BAG3 insufficiency.

    Science.gov (United States)

    Ruparelia, Avnika A; Oorschot, Viola; Vaz, Raquel; Ramm, Georg; Bryson-Richardson, Robert J

    2014-12-01

    Mutations in the co-chaperone Bcl2-associated athanogene 3 (BAG3) can cause myofibrillar myopathy (MFM), a childhood-onset progressive muscle disease, characterized by the formation of protein aggregates and myofibrillar disintegration. In contrast to other MFM-causing proteins, BAG3 has no direct structural role, but regulates autophagy and the degradation of misfolded proteins. To investigate the mechanism of disease in BAG3-related MFM, we expressed wild-type BAG3 or the dominant MFM-causing BAG3 (BAG3(P209L)) in zebrafish. Expression of the mutant protein results in the formation of aggregates that contain wild-type BAG3. Through the stimulation and inhibition of autophagy, we tested the prevailing hypothesis that impaired autophagic function is responsible for the formation of protein aggregates. Contrary to the existing theory, our studies reveal that inhibition of autophagy is not sufficient to induce protein aggregation. Expression of the mutant protein, however, did not induce myofibrillar disintegration and we therefore examined the effect of knocking down Bag3 function. Loss of Bag3 resulted in myofibrillar disintegration, but not in the formation of protein aggregates. Remarkably, BAG3(P209L) is able to rescue the myofibrillar disintegration phenotype, further demonstrating that its function is not impaired. Together, our knockdown and overexpression experiments identify a mechanism whereby BAG3(P209L) aggregates form, gradually reducing the pool of available BAG3, which eventually results in BAG3 insufficiency and myofibrillar disintegration. This mechanism is consistent with the childhood onset and progressive nature of MFM and suggests that reducing aggregation through enhanced degradation or inhibition of nucleation would be an effective therapy for this disease.

  16. The Effect of the Wooden Breast Myopathy on Sarcomere Structure and Organization.

    Science.gov (United States)

    Velleman, Sandra G; Clark, Daniel L; Tonniges, Jeffrey R

    2018-03-01

    The wooden breast (WB) has been classically identified by the phenotypic presence of a wood-like pectoralis major (p. major) muscle. The WB-affected p. major muscle is characterized by necrotic muscle fibers and the replacement of muscle with connective tissue, water, and fat. The objective of the current study was to determine the effect of the WB myopathy on sarcomere organization by transmission electron microscopy. Sarcomere structure and organization were examined in two broiler lines with a high incidence of WB (Lines A and B) and another broiler line without WB (Line C). Affected muscle had an increase in smaller myofibers with diameters of 20 μm or less. Sarcomere organization decreased with fiber diameter in both Lines A and B. The structure and organization of sarcomeres in Line C were similar to WB-unaffected muscle in Lines A and B. Taken together, these data demonstrate that the WB myopathy detrimentally affects sarcomere organization in a broiler line-specific manner. Disorganization of sarcomere structure will affect the function of the p. major muscle as well as meat quality.

  17. Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy.

    Science.gov (United States)

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2017-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  18. Inflammatory myopathies in childhood: correlation between nailfold capillaroscopy findings and clinical and laboratory data.

    Science.gov (United States)

    Nascif, Ana K S; Terreri, Maria T R A; Len, Cláudio A; Andrade, Luis E C; Hilário, Maria O E

    2006-01-01

    Nailfold capillaroscopy is an important tool for the diagnosis and follow-up of patients with rheumatic diseases, in particular dermatomyositis and scleroderma. A relationship has been observed in adults between improved capillaroscopic findings and reduced disease activity. Our aim was to correlate disease activity (clinical and laboratory data) and nailfold capillaroscopy findings in 18 patients with inflammatory myopathies. This prospective study included 13 juvenile dermatomyositis patients (Bohan and Peter criteria) (mean age of 8.8 years) and five patients with overlap syndrome (mean age of 15.7 years). We evaluated disease activity (skin abnormalities and muscle weakness, muscle enzymes and acute phase reactants) and its correlation with nailfold capillaroscopy findings (dilatation of isolated loops, dropout of surrounding vessels and giant capillary loops). We used a microscope with special light and magnification of 10 to 16X. Eighteen patients underwent a total of 26 capillaroscopic examinations, seven of them on two or more occasions (13 were performed during the active disease phase and 13 during remission). Twelve of the 13 examinations performed during the active phase exhibited scleroderma pattern and 8 of the 13 examinations performed during remission were normal. Therefore, in 20 of the 26 examinations clinical and laboratory data and nailfold capillaroscopy findings correlated (p = 0.01). Nailfold capillaroscopy is a non-invasive examination that offers satisfactory correlation with disease activity and could be a useful tool for the diagnosis and follow-up of inflammatory myopathies.

  19. Hypothyroid myopathy: A peculiar clinical presentation of thyroid failure. Review of the literature.

    Science.gov (United States)

    Sindoni, Alessandro; Rodolico, Carmelo; Pappalardo, Maria Angela; Portaro, Simona; Benvenga, Salvatore

    2016-12-01

    Abnormalities in thyroid function are common endocrine disorders that affect 5-10 % of the general population, with hypothyroidism occurring more frequently than hyperthyroidism. Clinical symptoms and signs are often nonspecific, particularly in hypothyroidism. Muscular symptoms (stiffness, myalgias, cramps, easy fatigability) are mentioned by the majority of patients with frank hypothyroidism. Often underestimated is the fact that muscle symptoms may represent the predominant or the only clinical manifestation of hypothyroidism, raising the issue of a differential diagnosis with other causes of myopathy, which sometimes can be difficult. Elevated serum creatine kinase, which not necessarily correlates with the severity of the myopathic symptoms, is certainly suggestive of muscle impairment, though it does not explain the cause. Rare muscular manifestations, associated with hypothyroidism, are rhabdomyolysis, acute compartment syndrome, Hoffman's syndrome and Kocher-Debré-Sémélaigne syndrome. Though the pathogenesis of hypothyroid myopathy is not entirely known, proposed mechanisms include altered glycogenolytic and oxidative metabolism, altered expression of contractile proteins, and neuro-mediated damage. Correlation studies of haplotype, muscle gene expression and protein characterization, could help understanding the pathophysiological mechanisms of this myopathic presentation of hypothyroidism.

  20. MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2015-01-01

    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  1. Anaesthetic management of a paediatric patient with congenital fibre type disproportion myopathy.

    Science.gov (United States)

    Buisán, F; de la Varga, O; Flores, M; Sánchez-Ruano, J

    2018-04-23

    Congenital fibre type disproportion (CFTD) is a rare type of myopathy that is characterised by muscle weakness and hypotonia during childhood. Clinical features include motor delay, feeding difficulties, limb weakness, joint contractures, and scoliosis. A report is presented of the anaesthetic management of a 3-year-old girl with CFTD myopathy associated with a mutation of the TPM3 gene, scheduled for adenotonsillectomy because of obstructive sleep apnoea hypopnoea syndrome (OSAHS). The main concerns were the possible susceptibility to malignant hyperthermia, the risk of anaesthesia-induced rhabdomyolysis, a greater sensitivity to non-depolarising muscle relaxants, and the presence of OSAHS. Total intravenous anaesthesia with propofol and the use of rocuronium/sugammadex appear to be safe options. Given the high risk of respiratory compromise and other complications, patients should be closely monitored in the post-operative period. Copyright © 2018 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  2. Uremic myopathy: Is oxidative stress implicated in muscle dysfunction in uremia?

    Directory of Open Access Journals (Sweden)

    Antonia eKaltsatou

    2015-03-01

    Full Text Available Renal failure is accompanied by progressive muscle weakness and premature fatigue, in part linked to hypokinesis and in part to uremic toxicity. These changes are associated with various detrimental biochemical and morphological alterations. All of these pathological parameters are collectively termed ureamic myopathy. Various interventions while helpful can’t fully remedy the pathological phenotype. Complex mechanisms that stimulate muscle dysfunction in uremia have been proposed, and oxidative stress could be implicated. Skeletal muscles continuously produce reactive oxygen species (ROS and reactive nitrogen species (RNS at rest and more so during contraction. The aim of this mini review is to provide an update on recent advances in our understanding of how ROS and RNS generation might contribute to muscle dysfunction in uremia. Thus a systematic review was conducted searching PubMed and Scopus by using the Cochrane and PRISMA guidelines. While few studies met our criteria their findings are discussed making reference to other available literature data. Oxidative stress can direct muscle cells into a catabolic state and chronic exposure to it leads to wasting. Moreover, redox disturbances can significantly affect force production per se. We conclude that oxidative stress can be in part responsible for some aspects of uremic myopathy. Further research is needed to discern clear mechanisms and to help efforts to counteract muscle weakness and exercise intolerance in uremic patients.

  3. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation. A newly identified condition.

    Science.gov (United States)

    Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M

    1991-03-01

    A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.

  4. MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2015-09-01

    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  5. Idiopathic Inflammatory Myopathies; Association with Overlap Myositis and Syndromes: Classification, Clinical Characteristics, and Associated Autoantibodies

    Directory of Open Access Journals (Sweden)

    Pari Basharat

    2016-07-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are traditionally identified as a group of disorders that target skeletal muscle due to autoimmune dysfunction. The IIM can be divided into subtypes based on certain clinical characteristics, and several classification schemes have been proposed. The predominant diagnostic criteria for IIM is the Bohan and Peter criteria, which subdivides IIM into primary polymyositis (PM, primary dermatomyositis (DM, myositis with another connective tissue disease, and myositis associated with cancer. However, this measure has been criticised for several reasons including lack of specific criteria to help distinguish between muscle biopsy findings of PM, DM, and immune-mediated necrotising myopathy, as well as the lack of identification of cases of overlap myositis (OM. Because of this issue, other classification criteria for IIM have been proposed, which include utilising myositis-associated antibodies and myositis-specific antibodies, as well as overlap features such as Raynaud’s phenomenon, polyarthritis, oesophageal abnormalities, interstitial lung disease, small bowel abnormalities such as hypomotility and malabsorption, and renal crises, amongst others. Indeed, the identification of autoantibodies associated with certain clinical phenotypes of myositis, in particular connective tissue disease-myositis overlap, has further helped divide IIM into distinct clinical subsets, which include OM and overlap syndromes (OS. This paper reviews the concepts of OM and OS as they pertain to IIM, including definitions in the literature, clinical characteristics, and overlap autoantibodies.

  6. Nutritional status evaluation in patients affected by bethlem myopathy and ullrich congenital muscular dystrophy.

    Science.gov (United States)

    Toni, Silvia; Morandi, Riccardo; Busacchi, Marcello; Tardini, Lucia; Merlini, Luciano; Battistini, Nino Carlo; Pellegrini, Massimo

    2014-01-01

    Collagen VI mutations lead to disabling myopathies like Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD). We have investigated the nutritional and metabolic status of one UCMD and seven BM patients (five female, three male, mean age 31 ± 9 years) in order to find a potential metabolic target for nutritional intervention. For this study, we used standard anthropometric tools, such as BMI evaluation and body circumference measurements. All results were compared to dual-energy X-ray absorptiometry (DXA), considered the "gold standard" method. Energy intake of each patient was evaluated through longitudinal methods (7-day food diary) while resting energy expenditure (REE) was predicted using specific equations and measured by indirect calorimetry. Clinical evaluation included general and nutritional blood and urine laboratory analyses and quantitative muscle strength measurement by hand-held dynamometry. BM and UCMD patients showed an altered body composition, characterized by low free fat mass (FFM) and high fat mass (FM), allowing us to classify them as sarcopenic, and all but one as sarcopenic-obese. Another main result was the negative correlation between REE/FFM ratio (basal energy expenditure per kilograms of fat-free mass) and the severity of the disease, as defined by the muscle megascore (correlation coefficient -0.955, P-value nutritional intervention in these patients.

  7. Treatment options for mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome.

    Science.gov (United States)

    Santa, Kristin M

    2010-11-01

    Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare neurodegenerative disease caused by the decreased ability of cells to produce sufficient energy in the form of adenosine 5'-triphosphate. Although it is one of the most common maternally inherited mitochondrial disorders, its exact incidence is unknown. Caused most frequently by an A-to-G point mutation at the 3243 position in the mitochondrial DNA, MELAS syndrome has a broad range of clinical manifestations and a highly variable course. The classic neurologic characteristics include encephalopathy, seizures, and stroke-like episodes. In addition to its neurologic manifestations, MELAS syndrome exhibits multisystem effects including cardiac conduction defects, diabetes mellitus, short stature, myopathy, and gastrointestinal disturbances. Unfortunately, no consensus guidelines outlining standard drug regimens exist for this syndrome. Many of the accepted therapies used in treating MELAS syndrome have been identified through a small number of clinical trials or isolated case reports. Currently, the drugs most often used include antioxidants and various vitamins aimed at minimizing the demands on the mitochondria and supporting and maximizing their function. Some of the most frequently prescribed agents include coenzyme Q(10), l-arginine, B vitamins, and levocarnitine. Although articles describing MELAS syndrome are available, few specifically target education for clinical pharmacists. This article will provide pharmacists with a practical resource to enhance their understanding of MELAS syndrome in order to provide safe and effective pharmaceutical care.

  8. Effects of aerobic training on exercise-related oxidative stress in mitochondrial myopathies.

    Science.gov (United States)

    Siciliano, Gabriele; Simoncini, Costanza; Lo Gerfo, Annalisa; Orsucci, Daniele; Ricci, Giulia; Mancuso, Michelangelo

    2012-12-01

    In mitochondrial myopathies with respiratory chain deficiency impairment of energy cell production may lead to in excess reactive oxygen species generation with consequent oxidative stress and cell damage. Aerobic training has been showed to increase muscle performance in patients with mitochondrial myopathies. Aim of this study has been to evaluate, in 7 patients (6 F e 1M, mean age 44.9 ± 12.1 years) affected by mitochondrial disease, concomitantly to lactate exercise curve, the occurrence of oxidative stress, as indicated by circulating levels of lipoperoxides, in rest condition and as effect of exercise, and also, to verify if an aerobic training program is able to modify, in these patients, ox-redox balance efficiency. At rest and before training blood level of lipoperoxides was 382.4 ± 37.8 AU, compared to controls (318.7 ± 63.8; Pstress degree according to the adopted scale. During incremental exercise blood level of lipoperoxides did not increase, but maintained significantly higher compared to controls. After an aerobic training of 10 weeks the blood level of lipoperoxides decreased by 13.7% at rest (Pexercise test (P=0.06). These data indicate that, in mitochondrial patients, oxidative stress occurs and that an aerobic training is useful in partially reverting this condition. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Muscle spindles exhibit core lesions and extensive degeneration of intrafusal fibers in the Ryr1I4895T/wt mouse model of core myopathy

    International Nuclear Information System (INIS)

    Zvaritch, Elena; MacLennan, David H.

    2015-01-01

    Muscle spindles from the hind limb muscles of adult Ryr1 I4895T/wt (IT/+) mice exhibit severe structural abnormalities. Up to 85% of the spindles are separated from skeletal muscle fascicles by a thick layer of connective tissue. Many intrafusal fibers exhibit degeneration, with Z-line streaming, compaction and collapse of myofibrillar bundles, mitochondrial clumping, nuclear shrinkage and pyknosis. The lesions resemble cores observed in the extrafusal myofibers of this animal model and of core myopathy patients. Spindle abnormalities precede those in extrafusal fibers, indicating that they are a primary pathological feature in this murine Ryr1-related core myopathy. Muscle spindle involvement, if confirmed for human core myopathy patients, would provide an explanation for an array of devastating clinical features characteristic of these diseases and provide novel insights into the pathology of RYR1-related myopathies. - Highlights: • Muscle spindles exhibit structural abnormalities in a mouse model of core myopathy. • Myofibrillar collapse and mitochondrial clumping is observed in intrafusal fibers. • Myofibrillar degeneration follows a pattern similar to core formation in extrafusal myofibers. • Muscle spindle abnormalities are a part of the pathological phenotype in the mouse model of core myopathy. • Direct involvement of muscle spindles in the pathology of human RYR1-related myopathies is proposed

  10. Property of lysosomal storage disease associated with midbrain pathology in the central nervous system of Lamp-2-deficient mice.

    Science.gov (United States)

    Furuta, Akiko; Kikuchi, Hisae; Fujita, Hiromi; Yamada, Daisuke; Fujiwara, Yuuki; Kabuta, Tomohiro; Nishino, Ichizo; Wada, Keiji; Uchiyama, Yasuo

    2015-06-01

    Lysosome-associated membrane protein-2 (LAMP-2) is the gene responsible for Danon disease, which is characterized by cardiomyopathy, autophagic vacuolar myopathy, and variable mental retardation. To elucidate the function of LAMP-2 in the central nervous system, we investigated the neuropathological changes in Lamp-2-deficient mice. Immunohistochemical observations revealed that Lamp-1 and cathepsin D-positive lysosomal structures increased in the large neurons of the mouse brain. Ubiquitin-immunoreactive aggregates and concanavalin A-positive materials were detected in these neurons. By means of ultrastructural studies, we found various-shaped accumulations, including lipofuscin, glycolipid-like materials, and membranous structures, in the neurons and glial cells of Lamp-2-deficient brains. In deficient mice, glycogen granules accumulated in hepatocyte lysosomes but were not observed in neurons. These pathological features indicate lysosomal storage disease; however, the findings are unlikely a consequence of deficiency of a single lysosomal enzyme. Although previous study results have shown a large amount of autophagic vacuoles in parenchymal cells of the visceral organs, these findings were rarely detected in the brain tissue except for some axons in the substantia nigra, in which abundant activated microglial cells with increased lipid peroxidation were observed. Thus, LAMP-2 in the central nervous system has a possible role in the degradation of the various macromolecules in lysosomes and an additional function concerning protection from oxidative stress, especially in the substantia nigra. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  11. EULAR/ACR classification criteria for adult and juvenile idiopathic inflammatory myopathies and their major subgroups: a methodology report

    NARCIS (Netherlands)

    Bottai, Matteo; Tjärnlund, Anna; Santoni, Giola; Werth, Victoria P.; Pilkington, Clarissa; de Visser, Marianne; Alfredsson, Lars; Amato, Anthony A.; Barohn, Richard J.; Liang, Matthew H.; Singh, Jasvinder A.; Aggarwal, Rohit; Arnardottir, Snjolaug; Chinoy, Hector; Cooper, Robert G.; Danko, Katalin; Dimachkie, Mazen M.; Feldman, Brian M.; García-de la Torre, Ignacio; Gordon, Patrick; Hayashi, Taichi; Katz, James D.; Kohsaka, Hitoshi; Lachenbruch, Peter A.; Lang, Bianca A.; Li, Yuhui; Oddis, Chester V.; Olesinka, Marzena; Reed, Ann M.; Rutkowska-Sak, Lidia; Sanner, Helga; Selva-O'Callaghan, Albert; Wook Song, Yeong; Vencovsky, Jiri; Ytterberg, Steven R.; Miller, Frederick W.; Rider, Lisa G.; Lundberg, Ingrid E.; Amoruso, Maria; Andersson, Helena; Bayat, Nastaran; Bhansing, Kavish J.; Bucher, Sara; Champbell, Richard; Charles-Schoeman, Christina; Chaudhry, Vinay; Christopher-Stine, Lisa; Chung, Lorinda; Cronin, Mary; Curry, Theresa; Dahlbom, Kathe; Distler, Oliver; Efthimiou, Petros; van Engelen, Baziel G. M.; Faiq, Abdullah; Farhadi, Payam Noroozi; Fiorentino, David; Hengstman, Gerald; Hoogendijk, Jessica; Huber, Adam; Kataoka, Hiroshi; Katsumata, Yasuhiro; Kim, Susan; Kong-Rosario, Michelle; Kontzias, Apostolos; Krol, Petra; Kurita, Takashi; Li, Zhan-Guo; Lindvall, Björn; Linklater, Helen; Maillard, Sue; Mamyrova, Gulnara; Mantegazza, Renato; Marder, Galina S.; Nagahashi Marie, Suely Kazue; Mathiesen, Pernille; Mavragani, Clio P.; McHugh, Neil J.; Michaels, Mimi; Mohammed, Reem; Morgan, Gabrielle; Moser, David W.; Moutsopoulos, Haralampos M.

    2017-01-01

    To describe the methodology used to develop new classification criteria for adult and juvenile idiopathic inflammatory myopathies (IIMs) and their major subgroups. An international, multidisciplinary group of myositis experts produced a set of 93 potentially relevant variables to be tested for

  12. Implications of compound heterozygous insulin receptor mutations in congenital muscle fibre type disproportion myopathy for the receptor kinase activation

    DEFF Research Database (Denmark)

    Klein, H H; Müller, R; Vestergaard, H

    1999-01-01

    We studied insulin receptor kinase activation in two brothers with congenital muscle fibre type disproportion myopathy and compound heterozygous mutations of the insulin receptor gene, their parents, and their unaffected brother. In the father who has a heterozygote Arg1174-->Gln mutation, in sit...

  13. Characterization of DLK1+ cells emerging during skeletal muscle remodeling in response to myositis, myopathies, and acute injury

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Petersson, Stine J; Jørgensen, Louise H

    2009-01-01

    , DLK1 was upregulated in all human myopathies analyzed, including Duchenne- and Becker muscular dystrophies. Substantial numbers of DLK1(+) satellite cells were observed in normal neonatal and Duchenne muscle, and furthermore, myogenic DLK1(+) cells were identified during muscle regeneration in animal...

  14. Characterization of sarcoplasmic reticulum Ca(2+) ATPase pumps in muscle of patients with myotonic dystrophy and with hypothyroid myopathy.

    Science.gov (United States)

    Guglielmi, V; Oosterhof, A; Voermans, N C; Cardani, R; Molenaar, J P; van Kuppevelt, T H; Meola, G; van Engelen, B G; Tomelleri, G; Vattemi, G

    2016-06-01

    Sarcoplasmic/endoplasmic reticulum Ca(2+) ATPase (SERCA) pumps play the major role in lowering cytoplasmic calcium concentration in skeletal muscle by catalyzing the ATP-dependent transport of Ca(2+) from the cytosol to the lumen of the sarcoplasmic reticulum (SR). Although SERCA abnormalities have been hypothesized to contribute to the dysregulation of intracellular Ca(2+) homeostasis and signaling in muscle of patients with myotonic dystrophy (DM) and hypothyroid myopathy, the characterization of SERCA pumps remains elusive and their impairment is still unclear. We assessed the activity of SR Ca(2+)-ATPase, expression levels and fiber distribution of SERCA1 and SERCA2, and oligomerization of SERCA1 protein in muscle of patients with DM type 1 and 2, and with hypothyroid myopathy. Our data provide evidence that SR Ca(2+) ATPase activity, protein levels and muscle fiber distribution of total SERCA1 and SERCA2, and SERCA1 oligomerization pattern are similar in patients with both DM1 and DM2, hypothyroid myopathy and in control subjects. We prove that SERCA1b, the neonatal isoform of SERCA1, is expressed at protein level in muscle of patients with DM2 and, in lower amount, of patients with DM1. Our present study demonstrates that SERCA function is not altered in muscle of patients with DM and with hypothyroid myopathy. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Loss-of-function mutations in SCN4A> cause severe foetal hypokinesia or 'classical' congenital myopathy

    DEFF Research Database (Denmark)

    Zaharieva, Irina T; Thor, Michael G; Oates, Emily C

    2016-01-01

    Congenital myopathies are a clinically and genetically heterogeneous group of muscle disorders characterized by congenital or early-onset hypotonia and muscle weakness, and specific pathological features on muscle biopsy. The phenotype ranges from foetal akinesia resulting in in utero or neonatal...

  16. Lactate disposal via gluconeogenesis is increased during exercise in patients with mitochondrial myopathy due to complex I deficiency

    NARCIS (Netherlands)

    Roef, MJ; Kalhan, SC; Reijngoud, DJ; De Meer, K; Berger, Ruud

    This study evaluated lactate disposal via gluconeogenesis as well as effects of FFA availability on gluconeogenesis via pyruvate (GNG(PYR)) in patients with mitochondrial myopathy due to complex I deficiency (CID). The rates of GNG(PYR) were measured in three CID patients and six healthy controls at

  17. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation: further clinical and histological characterization in a patient.

    Science.gov (United States)

    König, P; Ambrose, N S; Scott, N

    2000-01-01

    Hereditary internal anal sphincter myopathy is a very rare condition, only three families have so far been described in the literature. In this case report further clinical and histological findings of one affected member of one of the above families are presented.

  18. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

    NARCIS (Netherlands)

    Westermann, C.M.; Van Leeuwen, Robbert; Van Raamsdonk, L.W.D.; Mol, H.G.J.

    BACKGROUND: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. HYPOTHESIS/OBJECTIVES: To measure

  19. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses

    NARCIS (Netherlands)

    Westermann, C.M.; Leeuwen, van R.; Raamsdonk, van L.W.D.; Mol, H.G.J.

    2016-01-01

    Background: Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. Hypothesis/Objectives: To

  20. Mutation spectrum in the large GTPase dynamin 2, and genotype-phenotype correlation in autosomal dominant centronuclear myopathy

    DEFF Research Database (Denmark)

    Böhm, Johann; Biancalana, Valérie; Dechene, Elizabeth T

    2012-01-01

    Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzym...

  1. Morphology of the mitochondria in heat shock protein 60 deficient fibroblasts from mitochondrial myopathy patients : Effects of stress conditions

    NARCIS (Netherlands)

    Huckriede, A; Heikema, A; Sjollema, K; Briones, P; Agsteribbe, E

    1995-01-01

    We have described two mitochondrial (mt) myopathy patients with reduced activities of various mt enzymes associated with significantly decreased amounts of heat shock protein 60 (hsp60). Experimental evidence suggested that the lack of hsp60 was the primary defect. Since hsp60 is essential for the

  2. Dietary nitrate does not reduce oxygen cost of exercise or improve muscle mitochondrial function in patients with mitochondrial myopathy

    NARCIS (Netherlands)

    Nabben, M.; Schmitz, J.P.J.; Ciapaite, J.; le Clercq, C.M.P.; van Riel, N.A.; Haak, H.R.; Nicolay, K.; de Coo, I.F.M.; Smeets, H.; Praet, S.F.; van Loon, L.J.; Prompers, J.J.

    2017-01-01

    Muscle weakness and exercise intol erance negatively affect the quality of life of patients with mitochondrial myopathy. Short-term dietary nitrate supplementation has been shown to improve exercise performance and reduce oxygen cost of exercise in healthy humans and trained athletes. We

  3. Neutron storage

    International Nuclear Information System (INIS)

    Strelkov, A.V.

    2004-01-01

    The report is devoted to neutron storage (NS) and describes the history of experiments on the NS development. Great attention is paid to ultracold neutron (UCN) storage. The experiments on the UCN generation, transport, spectroscopy, storage and detection are described. Experiments on searching the UCN electric-dipole moment and electric charge are continued. Possible using of UCN for studying the nanoparticles is discussed [ru

  4. Energy storage

    International Nuclear Information System (INIS)

    Odru, P.

    2010-01-01

    This book proposes a broad overview of the technologies developed in the domains of on-board electricity storage (batteries, super-capacitors, flywheels), stationary storage (hydraulic dams, compressed air, batteries and hydrogen), and heat storage (sensible, latent and sorption) together with their relative efficiency, their expected developments and what advantages they can offer. Eminent specialists of this domain have participated to the redaction of this book, all being members of the Tuck's Foundation 'IDees' think tank. (J.S.)

  5. Energy storage

    CERN Document Server

    Brunet, Yves

    2013-01-01

    Energy storage examines different applications such as electric power generation, transmission and distribution systems, pulsed systems, transportation, buildings and mobile applications. For each of these applications, proper energy storage technologies are foreseen, with their advantages, disadvantages and limits. As electricity cannot be stored cheaply in large quantities, energy has to be stored in another form (chemical, thermal, electromagnetic, mechanical) and then converted back into electric power and/or energy using conversion systems. Most of the storage technologies are examined: b

  6. Tritium storage

    International Nuclear Information System (INIS)

    Hircq, B.

    1989-01-01

    A general synthesis about tritium storage is achieved in this paper and a particular attention is given to practical application in the Fusion Technology Program. Tritium, storage under gaseous form and solid form are discussed (characteristics, advantages, disadvantages and equipments). The way of tritium storage is then discussed and a choice established as a function of a logic which takes into account the main working parameters

  7. Probe Storage

    NARCIS (Netherlands)

    Gemelli, Marcellino; Abelmann, Leon; Engelen, Johannes Bernardus Charles; Khatib, M.G.; Koelmans, W.W.; Zaboronski, Olog; Campardo, Giovanni; Tiziani, Federico; Laculo, Massimo

    2011-01-01

    This chapter gives an overview of probe-based data storage research over the last three decades, encompassing all aspects of a probe recording system. Following the division found in all mechanically addressed storage systems, the different subsystems (media, read/write heads, positioning, data

  8. Elevated Cardiac Troponin T in Patients With Skeletal Myopathies.

    Science.gov (United States)

    Schmid, Johannes; Liesinger, Laura; Birner-Gruenberger, Ruth; Stojakovic, Tatjana; Scharnagl, Hubert; Dieplinger, Benjamin; Asslaber, Martin; Radl, Roman; Beer, Meinrad; Polacin, Malgorzata; Mair, Johannes; Szolar, Dieter; Berghold, Andrea; Quasthoff, Stefan; Binder, Josepha S; Rainer, Peter P

    2018-04-10

    Cardiac troponins are often elevated in patients with skeletal muscle disease who have no evidence of cardiac disease. The goal of this study was to characterize cardiac troponin concentrations in patients with myopathies and derive insights regarding the source of elevated troponin T measurements. Cardiac troponin T (cTnT) and cardiac troponin I (cTnI) concentrations were determined by using high sensitivity assays in 74 patients with hereditary and acquired skeletal myopathies. Patients underwent comprehensive cardiac evaluation, including 12-lead electrocardiogram, 24-h electrocardiogram, cardiac magnetic resonance imaging, and coronary artery computed tomography. cTnT and cTnI protein expression was determined in skeletal muscle samples of 9 patients and in control tissues derived from autopsy using antibodies that are used in commercial assays. Relevant Western blot bands were subjected to liquid chromatography tandem mass spectrometry for protein identification. Levels of cTnT (median: 24 ng/l; interquartile range: 11 to 54 ng/l) were elevated (>14 ng/l) in 68.9% of patients; cTnI was elevated (>26 ng/l) in 4.1% of patients. Serum cTnT levels significantly correlated with creatine kinase and myoglobin (r = 0.679 and 0.786, respectively; both p < 0.001). Based on cTnT serial testing, 30.1% would have fulfilled current rule-in criteria for myocardial infarction. Noncoronary cardiac disease was present in 23%. Using cTnT antibodies, positive bands were found in both diseased and healthy skeletal muscle at molecular weights approximately 5 kDa below cTnT. Liquid chromatography tandem mass spectrometry identified the presence of skeletal troponin T isoforms in these bands. Measured cTnT concentrations were chronically elevated in the majority of patients with skeletal myopathies, whereas cTnI elevation was rare. Our data indicate that cross-reaction of the cTnT immunoassay with skeletal muscle troponin isoforms was the likely cause. Copyright © 2018 The

  9. A Comprehensive Overview on Myositis-Specific Antibodies: New and Old Biomarkers in Idiopathic Inflammatory Myopathy

    Science.gov (United States)

    Satoh, Minoru; Tanaka, Shin; Ceribelli, Angela; Calise, S. John; Chan, Edward K. L.

    2018-01-01

    Autoantibodies specific for idiopathic inflammatory myopathy (myositis-specific autoantibodies (MSAs)) are clinically useful biomarkers to help the diagnosis of polymyositis/dermatomyositis (PM/DM). Many of these are also associated with a unique clinical subset of PM/DM, making them useful in predicting and monitoring certain clinical manifestations. Classic MSAs known for over 30 years include antibodies to Jo-1 (histidyl transfer RNA (tRNA) synthetase) and other aminoacyl tRNA synthetases (ARS), anti-Mi-2, and anti-signal recognition particle (SRP). Anti-Jo-1 is the first autoantibodies to ARS detected in 15–25 % of patients. In addition to anti-Jo-1, antibodies to seven other aminoacyl tRNA synthetases (ARS) have been reported with prevalence, usually 1–5 % or lower. Patients with any antiARS antibodies are associated with anti-synthetase syndrome characterized by myositis, interstitial lung disease (ILD), arthritis, Raynaud’s phenomenon, and others. Several recent studies suggested heterogeneity in clinical features among different anti-ARS antibody-positive patients and anti-ARS may also be found in idiopathic ILD without myositis. Anti-Mi-2 is a classic marker for DM and associated with good response to steroid treatment and good prognosis. Anti-SRP is specific for PM and associated with treatment-resistant myopathy histologically characterized as necrotizing myopathy. In addition to classic MSAs, several new autoantibodies with strong clinical significance have been described in DM. Antibodies to transcription intermediary factor 1γ/α (TIF1γ/α, p155/140) are frequently found in DM associated with malignancy while anti-melanoma differentiation-associated gene 5 (MDA5; CADM140) are associated with clinically amyopathic DM (CADM) complicated by rapidly progressive ILD. Also, anti-MJ/nuclear matrix protein 2 (NXP-2) and anti-small ubiquitin-like modifier-1 (SUMO-1) activating enzyme (SAE) are recognized as new DM-specific autoantibodies. Addition of

  10. Neurogenic myopathies and imaging of muscle denervation; Neurogene Myopathien und Bildgebung der Muskeldenervation

    Energy Technology Data Exchange (ETDEWEB)

    Wolf, M. [Universitaetsklinikum Heidelberg, Abteilung fuer Neuroradiologie, Heidelberg (Germany); Wolf, C. [Reha-Zentrum Gernsbach, Neurologie, Gernsbach (Germany); Weber, M.A. [Universitaetsklinikum Heidelberg, Abteilung fuer Diagnostische und Interventionelle Radiologie, Heidelberg (Germany)

    2017-12-15

    Neurogenic myopathies are primary diseases of the nervous system, which secondarily result in denervation of the target musculature. The spectrum of potential causes is manifold ranging from acute traumatic injuries and chronic compression to neurodegenerative, inflammatory, metabolic and neoplastic processes. The medical history, clinical neurological examination, and electrophysiological tests including electromyography and nerve conduction studies are crucial in diagnosing neuropathic myopathies. Electromyography is the gold standard for diagnosing muscle denervation. Additional imaging methods and magnetic resonance imaging (MRI) in particular, are capable of contributing valuable information. The MRI examination of denervated musculature shows edema, an increase in the apparent diffusion coefficient (ADC) and hyperperfusion. Chronic denervation results in fatty degeneration and atrophy of affected muscles, which are also detectable by MRI. Although the MRI findings in muscle denervation are relatively unspecific, they show a high sensitivity, comparable to electromyography. Dedicated MR neurography may often visualize the underlying lesion(s) of the innervating nerve(s). Besides high sensitivity, comparable to electromyography, MRI is capable of evaluating muscles which are inaccessible for needle electromyography. Due to its non-invasive character, MRI is ideal for follow-up examinations. The use of MRI is often a meaningful addition to the diagnostics of neurogenic myopathies. The extent and distribution pattern of muscular alterations often provide information on the localization of the causative nerve damage. A correct diagnosis or at least a narrowing down of possible differential diagnoses can often be achieved using MRI. (orig.) [German] Neurogene Myopathien sind Erkrankungen des Nervensystems, die sekundaer zur Denervierung der Zielmuskulatur fuehren. Das Spektrum potenzieller Ursachen ist vielfaeltig und umfasst akute traumatische Verletzungen

  11. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    Science.gov (United States)

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

    2014-10-18

    To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

  12. Are Peripheral Blood Mononuclear Cells Derived from Patients with Certain Myopathies Suitable for Personalized Drug Screening?

    Directory of Open Access Journals (Sweden)

    Andriy V. Shatillo

    2014-12-01

    Full Text Available Background: Limb girdle muscular dystrophies (LGMDs and several other disorders which share their specific phenotype are rare, predominantly hereditary conditions with no curative treatment. Differential diagnosis of these myopathies is quite challenging and expensive in many cases. Therefore, a significant proportion of patients remains undiagnosed and untreated for a long time. At the same time there is a huge amount of drugs and supplements potentially able to modify the course of some of these muscular dystrophies. That is why a simple empirical approach able to define a patient’s reaction to a specific compound seems rational. Because most common basic pathogenetic mechanisms for these quite different disorders increase the vulnerability of muscle cells (or decrease ability for reparation during mechanical stress, we propose a simple, noninvasive and inexpensive approach for individualized drug screening based on the drug’s influence on the mechanical vulnerability of peripheral blood mononuclear cells (PBMC. Methods: PBMC derived from 8 patients with Duchenne muscular dystrophy (DMD, 2 patients with LGMD2A, 1 patient with LGMD2B, 1 with MERRF syndrome, 1 with facioscapulohumeral muscular dystrophy (FSHD and 13 matched control subjects were irradiated by ultrasound in the presence of several compounds (lisinopril, vitamin D3, prednisolon, tocopherol, topiramate, glutargin, α-lipoic acid, essentiale, and physiological solution. Then viability indexes of the samples were detected by citotoxic assays based on vital dye (neutral red and resazurin metabolism. Results: In cytotoxicity tests with active transport of neutral red into PBMC derived from DMD patients, the cells showed signs of destruction at 1.06±0.52 minutes of ultrasounding compared to 1.75±0.6 minutes in control. PBMCs from patients with other myopathies have either normal or decreased resistance to ultrasound. The addition of tocopherol significantly changes the PBMC

  13. Validation and clinical significance of the childhood myositis assessment scale for assessment of muscle function in the juvenile idiopathic inflammatory myopathies

    NARCIS (Netherlands)

    Huber, AM; Feldman, BM; Rennebohm, RM; Hicks, JE; Lindsley, CB; Perez, MD; Zemel, LS; Wallace, CA; Ballinger, SH; Passo, MH; Reed, AM; Summers, RM; Katona, IM; Miller, FW; Lachenbruch, PA; Rider, LG; White, P.H.

    Objective. To examine the measurement characteristics of the Childhood Myositis Assessment Scale (CMAS) in children with juvenile idiopathic inflammatory myopathy (juvenile IIM), and to obtain preliminary data on the clinical significance of CMAS scores. Methods. One hundred eight children with

  14. Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

    Science.gov (United States)

    Momma, Kazunari; Noguchi, Satoru; Malicdan, May Christine V; Hayashi, Yukiko K; Minami, Narihiro; Kamakura, Keiko; Nonaka, Ikuya; Nishino, Ichizo

    2012-01-01

    Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

  15. Rimmed vacuoles in Becker muscular dystrophy have similar features with inclusion myopathies.

    Directory of Open Access Journals (Sweden)

    Kazunari Momma

    Full Text Available Rimmed vacuoles in myofibers are thought to be due to the accumulation of autophagic vacuoles, and can be characteristic in certain myopathies with protein inclusions in myofibers. In this study, we performed a detailed clinical, molecular, and pathological characterization of Becker muscular dystrophy patients who have rimmed vacuoles in muscles. Among 65 Becker muscular dystrophy patients, we identified 12 patients who have rimmed vacuoles and 11 patients who have deletions in exons 45-48 in DMD gene. All patients having rimmed vacuoles showed milder clinical features compared to those without rimmed vacuoles. Interestingly, the rimmed vacuoles in Becker muscular dystrophy muscles seem to represent autophagic vacuoles and are also associated with polyubiquitinated protein aggregates. These findings support the notion that rimmed vacuoles can appear in Becker muscular dystrophy, and may be related to the chronic changes in muscle pathology induced by certain mutations in the DMD gene.

  16. Insulin Resistance and Increased Muscle Cytokine Levels in Patients With Mitochondrial Myopathy

    DEFF Research Database (Denmark)

    Rue, Nana; Vissing, John; Galbo, Henrik

    2014-01-01

    CONTEXT: Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. OBJECTIVE: The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. DESIGN......: The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. MAIN OUTCOME MEASURES: Glucose infusion rate during 90-120 minutes of insulin infusion...... was measured. Cytokine concentrations in dialysate were also measured. RESULTS: Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P insulin, C-peptide, and glucagon were higher...

  17. Exertional myopathy in a grizzly bear (Ursus arctos) captured by leghold snare.

    Science.gov (United States)

    Cattet, Marc; Stenhouse, Gordon; Bollinger, Trent

    2008-10-01

    We diagnosed exertional myopathy (EM) in a grizzly bear (Ursus arctos) that died approximately 10 days after capture by leghold snare in west-central Alberta, Canada, in June 2003. The diagnosis was based on history, post-capture movement data, gross necropsy, histopathology, and serum enzyme levels. We were unable to determine whether EM was the primary cause of death because autolysis precluded accurate evaluation of all tissues. Nevertheless, comparison of serum aspartate aminotransferase and creatine kinase concentrations and survival between the affected bear and other grizzly bears captured by leghold snare in the same research project suggests EM also occurred in other bears, but that it is not generally a cause of mortality. We propose, however, occurrence of nonfatal EM in grizzly bears after capture by leghold snare has potential implications for use of this capture method, including negative effects on wildlife welfare and research data.

  18. X-linked Myotubular Myopathy with a Novel MTM1 Mutation in a Taiwanese Child

    Directory of Open Access Journals (Sweden)

    Chia-Ying Chang

    2008-12-01

    Full Text Available We report a male, preterm newborn infant with X-linked myotubular myopathy, the most severe type of the disease. He presented at birth with generalized hypotonia, difficulty in swallowing, and respiratory distress with frequent episodes of atelectasis. The infant had a long thin face, generalized hypotonia, and arachnodactyly. Diagnosis was based on fetal history, muscle histopathology, electron microscopy and a genetic study. A base pair change was detected in exon 11 of the MTM1 gene: c.1160C > A, which caused an amino acid change, p.S387Y. The father's gene was normal but the mother had the same mutation as her son and was thus a carrier.

  19. Adult-onset nemaline myopathy in a dog presenting with persistent atrial standstill and primary hypothyroidism.

    Science.gov (United States)

    Nakamura, R K; Russell, N J; Shelton, G D

    2012-06-01

    A nine-year-old neutered female mixed breed dog presented for evaluation following a five-day history of lethargy, inappetence, weakness, abdominal distension and generalised muscle atrophy. Persistent vatrial standstill with a junctional rhythm was identified on electrocardiogram. Echocardiogram identified moderate dilation of all cardiac chambers and mild thickening of the mitral and tricuspid valves. Serology was negative for Neospora caninum and Toxoplasma gondii. Permanent pacemaker implantation was performed in addition to endomyocardial and skeletal muscle biopsies. Cryosections from the biceps femoris muscle showed numerous nemaline rod bodies while endomyocardial biopsies were possibly consistent with end-stage myocarditis. Rod bodies have rarely been reported in the veterinary literature. To the authors' knowledge, this is the first report of adult-onset nemaline rod myopathy and hypothyroidism with concurrent cardiac disease in a dog. © 2012 British Small Animal Veterinary Association.

  20. Myopathy Associated with Acute Hypothyroidism following Radioiodine Therapy for Graves Disease in an Adolescent

    Directory of Open Access Journals (Sweden)

    Rivkees ScottA

    2010-08-01

    Full Text Available We describe acute myopathy following I-131 treatment for hyperthyroidism due to Graves Disease (GD in an adolescent. A 15 year-old diagnosed with GD required treatment with radioactive iodine (I-131 therapy. Six weeks post I-131, he developed generalized muscle cramps. The CK was 19.800 U/L, the total thyroxine was 2.3 mcg/dL (29.6 nmol/L SI and the estimated free thyroxine (EFT was 0.5 ng/dL (6.4 pmol/L SI. The ALT was 112 U/L and AST was 364 U/L (normal

  1. Two families with MYH7 distal myopathy associated with cardiomyopathy and core formations.

    Science.gov (United States)

    Naddaf, Elie; Waclawik, Andrew J

    2015-03-01

    Laing distal myopathy is caused by MYH7 gene mutations. Multiple families have been reported with varying patterns of skeletal and cardiac involvement as well as histopathological findings. We report 2 families with p.Glu1508del mutation with detailed electrophysiological and muscle pathology findings. All patients displayed the classic phenotype with weakness starting in the anterior compartment of the legs with a "hanging great toe." It was followed by finger extensors involvement, relatively sparing the extensor indicis proprius, giving the appearance of a "pointing index" finger. All the affected individuals had a dilated cardiomyopathy and core formations on muscle biopsy. Unexpectedly, neurogenic changes were also observed in some individuals. Both families were initially misdiagnosed with either central core disease or hereditary neuropathy. Recognizing the classic phenotype, screening for cardiac involvement that may be clinically silent, and determining the mode of inheritance help with selecting the appropriate genetic test.

  2. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    Science.gov (United States)

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-05-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable to sublocalise the XLMTM locus further within the Xq28 region. This evidence for an Xq28 localisation may allow us to carry out useful genetic counselling within such families.

  3. When should MELAS (Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes) be the diagnosis?

    Science.gov (United States)

    Lorenzoni, Paulo José; Werneck, Lineu Cesar; Kay, Cláudia Suemi Kamoi; Silvado, Carlos Eduardo Soares; Scola, Rosana Herminia

    2015-11-01

    Mitochondrial myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like episodes (MELAS) is a rare mitochondrial disorder. Diagnostic criteria for MELAS include typical manifestations of the disease: stroke-like episodes, encephalopathy, evidence of mitochondrial dysfunction (laboratorial or histological) and known mitochondrial DNA gene mutations. Clinical features of MELAS are not necessarily uniform in the early stages of the disease, and correlations between clinical manifestations and physiopathology have not been fully elucidated. It is estimated that point mutations in the tRNALeu(UUR) gene of the DNAmt, mainly A3243G, are responsible for more of 80% of MELAS cases. Morphological changes seen upon muscle biopsy in MELAS include a substantive proportion of ragged red fibers (RRF) and the presence of vessels with a strong reaction for succinate dehydrogenase. In this review, we discuss mainly diagnostic criterion, clinical and laboratory manifestations, brain images, histology and molecular findings as well as some differential diagnoses and current treatments.

  4. Energy storage

    Energy Technology Data Exchange (ETDEWEB)

    1962-07-01

    The papers on energy storage problems, given to the United Nations Conference on New Sources of Energy, Rome, 1961, are reviewed. Many aspects of the subject are discussed: comparisons between the costs of storing energy in batteries and in fuel cells; the use, efficiency and expected improvement of fuel cells; the principles involved in the chemical conversion of solar energy to chemical energy; the use of metal hydride fuel cells; the chemical conversion and storage of concentrated solar energy for which the solar furnace is used for photochemical reactions. Finally, the general costs of storing energy in any form and delivering it are analyzed with particular reference to storage batteries and fuel cells.

  5. Role of Myofibrillar Protein Catabolism in Development of Glucocorticoid Myopathy: Aging and Functional Activity Aspects

    Directory of Open Access Journals (Sweden)

    Teet Seene

    2016-05-01

    Full Text Available Muscle weakness in corticosteroid myopathy is mainly the result of the destruction and atrophy of the myofibrillar compartment of fast-twitch muscle fibers. Decrease of titin and myosin, and the ratio of nebulin and MyHC in myopathic muscle, shows that these changes of contractile and elastic proteins are the result of increased catabolism of the abovementioned proteins in skeletal muscle. Slow regeneration of skeletal muscle is in good correlation with a decreased number of satellite cells under the basal lamina of muscle fibers. Aging causes a reduction of AMP-activated protein kinase (AMPK activity as the result of the reduced function of the mitochondrial compartment. AMPK activity increases as a result of increased functional activity. Resistance exercise causes anabolic and anticatabolic effects in skeletal muscle: muscle fibers experience hypertrophy while higher myofibrillar proteins turn over. These changes are leading to the qualitative remodeling of muscle fibers. As a result of these changes, possible maximal muscle strength is increasing. Endurance exercise improves capillary blood supply, increases mitochondrial biogenesis and muscle oxidative capacity, and causes a faster turnover rate of sarcoplasmic proteins as well as qualitative remodeling of type I and IIA muscle fibers. The combination of resistance and endurance exercise may be the fastest way to prevent or decelerate muscle atrophy due to the anabolic and anticatabolic effects of exercise combined with an increase in oxidative capacity. The aim of the present short review is to assess the role of myofibrillar protein catabolism in the development of glucocorticoid-caused myopathy from aging and physical activity aspects.

  6. Masseter muscle myofibrillar protein synthesis and degradation in an experimental critical illness myopathy model.

    Directory of Open Access Journals (Sweden)

    Hazem Akkad

    Full Text Available Critical illness myopathy (CIM is a debilitating common consequence of modern intensive care, characterized by severe muscle wasting, weakness and a decreased myosin/actin (M/A ratio. Limb/trunk muscles are primarily affected by this myopathy while cranial nerve innervated muscles are spared or less affected, but the mechanisms underlying these muscle-specific differences remain unknown. In this time-resolved study, the cranial nerve innervated masseter muscle was studied in a unique experimental rat intensive care unit (ICU model, where animals were exposed to sedation, neuromuscular blockade (NMB, mechanical ventilation, and immobilization for durations varying between 6 h and 14d. Gel electrophoresis, immunoblotting, RT-PCR and morphological staining techniques were used to analyze M/A ratios, myofiber size, synthesis and degradation of myofibrillar proteins, and levels of heat shock proteins (HSPs. Results obtained in the masseter muscle were compared with previous observations in experimental and clinical studies of limb muscles. Significant muscle-specific differences were observed, i.e., in the masseter, the decline in M/A ratio and muscle fiber size was small and delayed. Furthermore, transcriptional regulation of myosin and actin synthesis was maintained, and Akt phosphorylation was only briefly reduced. In studied degradation pathways, only mRNA, but not protein levels of MuRF1, atrogin-1 and the autophagy marker LC3b were activated by the ICU condition. The matrix metalloproteinase MMP-2 was inhibited and protective HSPs were up-regulated early. These results confirm that the cranial nerve innervated masticatory muscles is less affected by the ICU-stress response than limb muscles, in accordance with clinical observation in ICU patients with CIM, supporting the model' credibility as a valid CIM model.

  7. Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

    Science.gov (United States)

    Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

    2014-05-01

    Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

  8. Metabolic Myopathies

    Science.gov (United States)

    ... OII) Timed Up & Go (TUG) Western Ontario & McMaster Universities Osteoarthritis Index (WOMAC) Young Investigators Resources for Doctoral Students/Post-Doctoral Fellows Evidence-Based Practice for Academic Researchers Responsible Data Management in Research Career Planning Treatments Patient ...

  9. Mitochondrial Myopathy

    Science.gov (United States)

    ... these disorders and to find ways to effectively treat, prevent, or potentially cure them. Information from the National Library of Medicine’s MedlinePlus ... neuromuscular diseases caused by damage to the mitochondria—small, energy-producing structures that serve as the cells' "power plants." Nerve cells in the brain and muscles ...

  10. Inflammatory Myopathies

    Science.gov (United States)

    ... National Institutes of Health, the leading supporter of biomedical research in the world. The NINDS, along with other ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research

  11. Mitochondrial Myopathy

    Science.gov (United States)

    ... Institutes of Health (NIH), the leading supporter of biomedical research in the world. In conjunction with other NIH ... Testimony Legislative Updates Impact NINDS Contributions to Approved Therapies ... Director, Division of Intramural Research

  12. Mitochondrial Myopathies

    Science.gov (United States)

    ... noting “soft signs” in unaffected relatives. These include deaf- ness, short stature, migraine headaches and PEO. Muscle ... mitochondrial defects and provide valuable information for family planning. Perhaps most important, knowing the genetic defects that ...

  13. Thyrotoxic Myopathy

    Science.gov (United States)

    ... potassium levels (known as periodic paralysis). View Full Definition Treatment Treatment involves restoring normal levels of thyroid hormone and may include thyroid drugs, radioactive iodine, and sometimes partial or complete surgical ...

  14. Modelling reveals endogenous osmotic adaptation of storage tissue water potential as an important driver determining different stem diameter variation patterns in the mangrove species Avicennia marina and Rhizophora stylosa.

    Science.gov (United States)

    Vandegehuchte, Maurits W; Guyot, Adrien; Hubeau, Michiel; De Swaef, Tom; Lockington, David A; Steppe, Kathy

    2014-09-01

    Stem diameter variations are mainly determined by the radial water transport between xylem and storage tissues. This radial transport results from the water potential difference between these tissues, which is influenced by both hydraulic and carbon related processes. Measurements have shown that when subjected to the same environmental conditions, the co-occurring mangrove species Avicennia marina and Rhizophora stylosa unexpectedly show a totally different pattern in daily stem diameter variation. Using in situ measurements of stem diameter variation, stem water potential and sap flow, a mechanistic flow and storage model based on the cohesion-tension theory was applied to assess the differences in osmotic storage water potential between Avicennia marina and Rhizophora stylosa. Both species, subjected to the same environmental conditions, showed a resembling daily pattern in simulated osmotic storage water potential. However, the osmotic storage water potential of R. stylosa started to decrease slightly after that of A. marina in the morning and increased again slightly later in the evening. This small shift in osmotic storage water potential likely underlaid the marked differences in daily stem diameter variation pattern between the two species. The results show that in addition to environmental dynamics, endogenous changes in the osmotic storage water potential must be taken into account in order to accurately predict stem diameter variations, and hence growth.

  15. Fat and Sugar Metabolism During Exercise in Patients With Metabolic Myopathy

    Science.gov (United States)

    2017-08-31

    Metabolism, Inborn Errors; Lipid Metabolism, Inborn Errors; Carbohydrate Metabolism, Inborn Errors; Long-Chain 3-Hydroxyacyl-CoA Dehydrogenase Deficiency; Glycogenin-1 Deficiency (Glycogen Storage Disease Type XV); Carnitine Palmitoyl Transferase 2 Deficiency; VLCAD Deficiency; Medium-chain Acyl-CoA Dehydrogenase Deficiency; Multiple Acyl-CoA Dehydrogenase Deficiency; Carnitine Transporter Deficiency; Neutral Lipid Storage Disease; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Muscle Phosphofructokinase Deficiency; Phosphoglucomutase 1 Deficiency; Phosphoglycerate Mutase Deficiency; Phosphoglycerate Kinase Deficiency; Phosphorylase Kinase Deficiency; Beta Enolase Deficiency; Lactate Dehydrogenase Deficiency; Glycogen Synthase Deficiency

  16. Mutation in TWINKLE in a Large Iranian Family with Progressive External Ophthalmoplegia, Myopathy, Dysphagia and Dysphonia, and Behavior Change.

    Science.gov (United States)

    Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana

    2016-02-01

    TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.

  17. Mild trifunctional protein deficiency is associated with progressive neuropathy and myopathy and suggests a novel genotype-phenotype correlation.

    OpenAIRE

    Ibdah, J A; Tein, I; Dionisi-Vici, C; Bennett, M J; IJlst, L; Gibson, B; Wanders, R J; Strauss, A W

    1998-01-01

    Human mitochondrial trifunctional protein (TFP) is a heterooctamer of four alpha- and four beta-subunits that catalyzes three steps in the beta-oxidation spiral of long-chain fatty acids. TFP deficiency causes a Reye-like syndrome, cardiomyopathy, or sudden, unexpected death. We delineated the molecular basis for TFP deficiency in two patients with a unique phenotype characterized by chronic progressive polyneuropathy and myopathy without hepatic or cardiac involvement. Single-stranded confor...

  18. Performance, meat quality, and pectoral myopathies of broilers fed either corn or sorghum based diets supplemented with guanidinoacetic acid.

    Science.gov (United States)

    Córdova-Noboa, H A; Oviedo-Rondón, E O; Sarsour, A H; Barnes, J; Ferzola, P; Rademacher-Heilshorn, M; Braun, U

    2018-04-13

    One experiment was conducted to evaluate the effects of guanidinoacetic acid (GAA) supplementation in broilers fed corn or sorghum-based diets on live performance, carcass and cut up yields, meat quality, and pectoral myopathies. The treatments consisted of corn or sorghum-based diets with or without the addition of GAA (600 g/ton). A total of 800 one-d-old male Ross 708 broiler chicks were randomly placed in 40 floor pens with 10 replicates (20 birds per pen) per each of the four treatments. At hatch, 14, 35, and 50 d, BW and feed intake were recorded. BW gain and FCR were calculated at the end of each phase. Four broilers per pen were selected and slaughtered at 51d and 55d of age to determine carcass and cut up yields, meat quality and myopathies (spaghetti muscle, white striping, and wooden breast) severity in the Pectoralis major. Data were analyzed as a randomized complete block design in a 2 × 2 factorial arrangement with grain type and GAA supplementation as main effects. At 50 d, diets containing GAA improved (P broilers fed corn diets with GAA had higher breast meat yield (P 0.05) by GAA supplementation at any slaughter ages. However, GAA decreased (P broilers supplemented with GAA had double (P broilers fed non-supplemented diets, therefore reducing the severity of this myopathy. In conclusion, GAA supplementation improved broiler live performance in broilers raised up to 50 d independently of grain source, increased breast meat yield in corn-based diets and reduced the severity of wooden breast myopathy.

  19. [Molecular and clinical characterization of Colombian patients suffering from type III glycogen storage disease].

    Science.gov (United States)

    Mantilla, Carolina; Toro, Mónica; Sepúlveda, María Elsy; Insuasty, Margarita; Di Filippo, Diana; López, Juan Álvaro; Baquero, Carolina; Navas, María Cristina; Arias, Andrés Augusto

    2018-05-01

    Type III glycogen storage disease (GSD III) is an autosomal recessive disorder in which a mutation in the AGL gene causes deficiency of the glycogen debranching enzyme. The disease is characterized by fasting hypoglycemia, hepatomegaly and progressive myopathy. Molecular analyses of AGL have indicated heterogeneity depending on ethnic groups. The full spectrum of AGL mutations in Colombia remains unclear. To describe the clinical and molecular characteristics of ten Colombian patients diagnosed with GSD III. We recruited ten Colombian children with a clinical and biochemical diagnosis of GSD III to undergo genetic testing. The full coding exons and the relevant exon-intron boundaries of the AGL underwent Sanger sequencing to identify mutation. All patients had the classic phenotype of the GSD III. Genetic analysis revealed a mutation p.Arg910X in two patients. One patient had the mutation p.Glu1072AspfsX36, and one case showed a compound heterozygosity with p.Arg910X and p.Glu1072AspfsX36 mutations. We also detected the deletion of AGL gene 3, 4, 5, and 6 exons in three patients. The in silico studies predicted that these defects are pathogenic. No mutations were detected in the amplified regions in three patients. We found mutations and deletions that explain the clinical phenotype of GSD III patients. This is the first report with a description of the clinical phenotype and the spectrum of AGL mutations in Colombian patients. This is important to provide appropriate prognosis and genetic counseling to the patient and their relatives.

  20. [Fenofibrate--induced myopathy in a patient with undiagnosed hypothyroidism--case report and a review of the literature].

    Science.gov (United States)

    Lukjanowicz, Małgorzata; Trzcińska-Butkiewicz, Beata; Brzosko, Marek

    2006-01-01

    Hypothyroidism is one of the common causes of the secondary hypercholesterolemia. The prevalence of hypothyroidism in the general population is estimated to be as high as about 1.5%. Frequency of the hypothyroidism in patients with hyperlipidemia is high, and can be observed in 4.2-10% in different populations. Most commonly, there is no need to treat the hypothyroid patients with the hypolipidemic drugs. Substitution treatment with the thyroid hormones usually results in either normalization or significant decreasing of the lipid levels. Hypothyroidism with symptoms of involvement of skeletal muscles is referred as to hypothyroid myopathy in English literature, and can be present in 30-80% patients with deficiency of the thyroid hormones. Hypothyroidism is a risk factor of developing of toxic injury of muscles, what is thought to be related to hypolipidemic drug intake. We report a case of a patient with undiagnosed hypothyroidism with muscle involvement manifestation, who was treated with fenofibrate due to accidentally diagnosed hypercholesterolemia. Hypolipidemic management resulted in rapid exacerbation of previously moderate myopathy. High concentrations of muscle enzymes and moderate increasing of creatinine concentration were detected. Improvement was observed after discontinuation of fenofibrate administration, but muscle symptoms and elevation of muscle enzymes and creatinine persisted. After administration of levothyroxin, muscle weakness and laboratory abnormalities were observed no longer. After several months of follow-up we believe that treatment with fenofibrate in our patient was complicated with muscle tissue damage and exacerbated symptoms of myopathy originally related to decompensated hypothyroidism.

  1. Nemaline myopathy and heart failure: role of ivabradine; a case report.

    Science.gov (United States)

    Sarullo, Filippo M; Vitale, Giuseppe; Di Franco, Antonino; Sarullo, Silvia; Salerno, Ylenia; Vassallo, Laura; Baviera, Emanuela Petrona; Marazia, Stefania; Mandalà, Giorgio; Lanza, Gaetano A

    2015-01-19

    Nemaline myopathy (NM) is a rare congenital myopathy characterized by muscle weakness, hypotonia and the presence in muscle fibers of inclusions known as nemaline bodies and a wide spectrum of clinical phenotypes, ranging from severe forms with neonatal onset to asymptomatic forms. The adult-onset form is heterogeneous in terms of clinical presentation and disease progression. Cardiac involvement occurs in the minority of cases and little is known about medical management in this subgroup of NM patients. We report a rare case of heart failure (HF) in a patient with adult-onset NM in whom ivabradine proved to be able to dramatically improve the clinical picture. We report a case of a 37-year-old man with adult-onset NM, presenting with weakness and hypotonia of the proximal limb muscles and shoulder girdle, severely limiting daily activities. He developed progressive HF over a period of 6 months while attending a rehabilitation program, with reduced left ventricular ejection fraction (LVEF = 20%), manifested by dyspnea and signs of systemic congestion. The patient was started HF therapy with enalapril, carvedilol, spironolactone and loop diuretics. Target HF doses of these drugs (including carvedilol) were not reached because of symptomatic hypotension causing a high resting heart rate (HR) ≥70 beats per minute (bpm). Further deterioration of the clinical picture occurred with several life-threatening arrhythmic episodes requiring external defibrillation. An implantable cardioverter defibrillator (ICD) was then implanted. Persistent high resting HR was successfully treated with ivabradine with HR lowering from 90 bpm to 55 bpm at 1 month follow up, LVEF rising to 50% at 3 month follow up and to 54% at 2,5 year follow up. To date no more hospitalizations for heart failure occurred. A single hospitalization due to aspiration pneumonia required insertion of a tracheostomy tube to protect airways from further aspiration. At present, the patient is attending

  2. Energy Storage

    CSIR Research Space (South Africa)

    Bladergroen, B

    2015-10-01

    Full Text Available In commercial arena, the most recent developments in EES are in electrochemical storage, singling out Li-ion batteries and Vanadium Redox flow batteries, while power-to-gas/-fuels (electrolysis of water into hydrogen and subsequent methanisation...

  3. Liver Storage

    African Journals Online (AJOL)

    1971-10-23

    Oct 23, 1971 ... The need for whole-organ preservation has become in- cre.asingly important ... ideally fulfil the same purpose as the circulation of blood through the body, ... Hepatic hypothermia produced by the introduction of cold electrolyte ... Recently, we reported successful hypothermic immersion storage for up to 8 ...

  4. Dry storage

    International Nuclear Information System (INIS)

    Arnott, Don.

    1985-01-01

    The environmental movement has consistently argued against disposal of nuclear waste. Reasons include its irretrievability in the event of leakage, the implication that reprocessing will continue and the legitimacy attached to an expanding nuclear programme. But there is an alternative. The author here sets out the background and a possible future direction of a campaign based on a call for dry storage. (author)

  5. Storage Rings

    International Nuclear Information System (INIS)

    Fischer, W.

    2010-01-01

    Storage rings are circular machines that store particle beams at a constant energy. Beams are stored in rings without acceleration for a number of reasons (Tab. 1). Storage rings are used in high-energy, nuclear, atomic, and molecular physics, as well as for experiments in chemistry, material and life sciences. Parameters for storage rings such as particle species, energy, beam intensity, beam size, and store time vary widely depending on the application. The beam must be injected into a storage ring but may not be extracted (Fig. 1). Accelerator rings such as synchrotrons are used as storage rings before and after acceleration. Particles stored in rings include electrons and positrons; muons; protons and anti-protons; neutrons; light and heavy, positive and negative, atomic ions of various charge states; molecular and cluster ions, and neutral polar molecules. Spin polarized beams of electrons, positrons, and protons were stored. The kinetic energy of the stored particles ranges from 10 -6 eV to 3.5 x 10 12 eV (LHC, 7 x 10 12 eV planned), the number of stored particles from one (ESR) to 1015 (ISR). To store beam in rings requires bending (dipoles) and transverse focusing (quadrupoles). Higher order multipoles are used to correct chromatic aberrations, to suppress instabilities, and to compensate for nonlinear field errors of dipoles and quadrupoles. Magnetic multipole functions can be combined in magnets. Beams are stored bunched with radio frequency systems, and unbunched. The magnetic lattice and radio frequency system are designed to ensure the stability of transverse and longitudinal motion. New technologies allow for better storage rings. With strong focusing the beam pipe dimensions became much smaller than previously possible. For a given circumference superconducting magnets make higher energies possible, and superconducting radio frequency systems allow for efficient replenishment of synchrotron radiation losses of large current electron or positron beams

  6. Flex Sensor Based Biofeedback Monitoring for Post-Stroke Fingers Myopathy Patients

    Science.gov (United States)

    Garda, Y. R.; Caesarendra, W.; Tjahjowidodo, T.; Turnip, A.; Wahyudati, S.; Nurhasanah, L.; Sutopo, D.

    2018-04-01

    Hands are one of the crucial parts of the human body in carrying out daily activities. Accidents on the hands decreasing in motor skills of the hand so that therapy is necessary to restore motor function of the hand. In addition to accidents, hand disabilities can be caused by certain diseases, e.g. stroke. Stroke is a partial destruction of the brain. It occurs if the arteries that drain blood to the brain are blocked, or if torn or leak. The purpose of this study to make biofeedback monitoring equipment for post-stroke hands myopathy patients. Biofeedback is an alternative method of treatment that involves measuring body functions measured subjects such as skin temperature, sweat activity, blood pressure, heart rate and hand paralysis due to stroke. In this study, the sensor used for biofeedback monitoring tool is flex sensor. Flex sensor is a passive resistive device that changes its resistance as the sensor is bent. Flex sensor converts the magnitude of the bend into electrical resistance, the greater the bend the greater the resistance value. The monitoring used in this biofeedback monitoring tool uses Graphical User Interface (GUI) in C# programming language. The motivation of the study is to monitor and record the progressive improvement of the hand therapy. Patients who experienced post-stroke can see the therapy progress quantitatively.

  7. Role of TGF-β signaling in inherited and acquired myopathies

    Directory of Open Access Journals (Sweden)

    Burks Tyesha N

    2011-05-01

    Full Text Available Abstract The transforming growth factor-beta (TGF-β superfamily consists of a variety of cytokines expressed in many different cell types including skeletal muscle. Members of this superfamily that are of particular importance in skeletal muscle are TGF-β1, mitogen-activated protein kinases (MAPKs, and myostatin. These signaling molecules play important roles in skeletal muscle homeostasis and in a variety of inherited and acquired neuromuscular disorders. Expression of these molecules is linked to normal processes in skeletal muscle such as growth, differentiation, regeneration, and stress response. However, chronic elevation of TGF-β1, MAPKs, and myostatin is linked to various features of muscle pathology, including impaired regeneration and atrophy. In this review, we focus on the aberrant signaling of TGF-β in various disorders such as Marfan syndrome, muscular dystrophies, sarcopenia, and critical illness myopathy. We also discuss how the inhibition of several members of the TGF-β signaling pathway has been implicated in ameliorating disease phenotypes, opening up novel therapeutic avenues for a large group of neuromuscular disorders.

  8. Impaired Insulin/IGF Signaling in Experimental Alcohol-Related Myopathy

    Directory of Open Access Journals (Sweden)

    Elizabeth Silbermann

    2012-08-01

    Full Text Available Alcohol-related myopathy (Alc-M is highly prevalent among heavy drinkers, although its pathogenesis is not well understood. We hypothesize that Alc-M is mediated by combined effects of insulin/IGF resistance and oxidative stress, similar to the effects of ethanol on liver and brain. We tested this hypothesis using an established model in which adult rats were pair-fed for 8 weeks with isocaloric diets containing 0% (N = 8 or 35.5% (N = 13 ethanol by caloric content. Gastrocnemius muscles were examined by histology, morphometrics, qRT-PCR analysis, and ELISAs. Chronic ethanol feeding reduced myofiber size and mRNA expression of IGF-1 polypeptide, insulin, IGF-1, and IGF-2 receptors, IRS-1, and IRS-2. Multiplex ELISAs demonstrated ethanol-associated inhibition of insulin, IRS-1, Akt, and p70S6K signaling, and increased activation of GSK-3β. In addition, ethanol-exposed muscles had increased 4-hydroxy-2-nonenal immunoreactivity, reflecting lipid peroxidation, and reduced levels of mitochondrial Complex IV, Complex V, and acetylcholinesterase. These results demonstrate that experimental Alc-M is associated with inhibition of insulin/IGF/IRS and downstream signaling that mediates metabolism and cell survival, similar to findings in alcoholic liver and brain degeneration. Moreover, the increased oxidative stress, which could be mediated by mitochondrial dysfunction, may have led to inhibition of acetylcholinesterase, which itself is sufficient to cause myofiber atrophy and degeneration.

  9. Clinical significance of magnetic resonance imaging of skeletal muscles in idiopathic inflammatory myopathies of adults

    Energy Technology Data Exchange (ETDEWEB)

    Nishikai, Masahiko; Akiya, Kumiko [National Tokyo Medical Center (Japan)

    2000-12-01

    The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)

  10. Rare myositis-specific autoantibody associations among Hungarian patients with idiopathic inflammatory myopathy.

    Science.gov (United States)

    Bodoki, L; Nagy-Vincze, M; Griger, Z; Betteridge, Z; Szöllősi, L; Jobanputra, R; Dankó, K

    2015-01-01

    Idiopathic inflammatory myopathies are systemic, chronic autoimmune diseases characterized by symmetrical, proximal muscle weakness. Homogeneous groups present with similar symptoms. The response to therapy and prognosis could be facilitated by myositis-specific autoantibodies, and in this way, give rise to immunoserological classification. The myositis-specific autoantibodies are directed against specific proteins found in the cytoplasm or in the nucleus of the cells. To date, literature suggests the rarity of the co-existence of two myositis-specific autoantibodies. In this study the authors highlight rare associations of myositis-specific autoantibodies. Three hundred and thirty-seven Hungarian patients with polymyositis or dermatomyositis were studied. Their clinical findings were noted retrospectively. Specific blood tests identified six patients with the rare co-existence of myositis-specific autoantibodies, anti-Jo-1 and anti-SRP, anti-Jo-1 and anti-Mi-2, anti-Mi-2 and anti-PL-12, anti-Mi-2 and anti-SRP, and anti-SRP and anti-PL-7, respectively. This case review aims to identify the clinical importance of these rare associations and their place within the immunoserological classification.

  11. Clinical significance of magnetic resonance imaging of skeletal muscles in idiopathic inflammatory myopathies of adults

    International Nuclear Information System (INIS)

    Nishikai, Masahiko; Akiya, Kumiko

    2000-01-01

    The purpose of this study was to evaluate the clinical significance of magnetic resonance imaging (MRI) of skeletal muscles in Japanese patients with idiopathic inflammatory myopathies (IIM). MRI was performed in 23 adult patients with IIM, including 10 with polymyositis, 12 with dermatomyositis, and 1 with focal myositis. Seven (73%) of 11 patients with active IIM and 2 (17%) of 12 patients with inactive IIM showed hyperintensity of T2-weighted images and normal intensity of T1-weighted images, indicating 'edema-like abnormalities' (MRI findings for active myositis). Muscle lipomatosis and fibrosis were demonstrated in four patients and 1 patient, respectively. Considerable selectivity of muscles in developing inflammatory disorders was found. In quadriceps muscles, for example, vastus muscles seemed to be more often affected in DM patients, whereas adductors were more often affected in PM patients. Serial examination of muscle MRIs was carried out in 4 patients and the findings paralleled the disease activities. The muscle MRI findings did not necessarily correlate with other findings, such as the presence of muscle weakness, elevated serum creatine kinase levels, myogenic electromyogram, or muscle biopsy findings. The muscle MRI was considered to be an additional useful tool for the diagnosis, evaluation of disease activity, and planning treatment of IIM. (author)

  12. Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

    Directory of Open Access Journals (Sweden)

    Jakub Piotr Fichna

    Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

  13. Diabetic Myopathy: Impact of Diabetes Mellitus on Skeletal Muscle Progenitor Cells

    Directory of Open Access Journals (Sweden)

    Donna M D'Souza

    2013-12-01

    Full Text Available Diabetes mellitus is defined as a group of metabolic diseases that are associated with the presence of a hyperglycemic state due to impairments in insulin function. While the development of each form of diabetes (Type 1 or Type 2 drastically differs, resultant pathologies often overlap. In each diabetic condition a failure to maintain healthy muscle is often observed, and is termed diabetic myopathy. This significant, but often overlooked, complication is believed to contribute to the progression of additional diabetic pathologies due to the vital importance of skeletal muscle for our physical and metabolic well-being. While studies have investigated the link between changes to skeletal muscle metabolic health following diabetes mellitus onset (particularly Type 2 diabetes mellitus, few have examined the negative impact of diabetes mellitus on the growth and reparative capacities of skeletal muscle that often coincides with disease development. Importantly, evidence is accumulating that the muscle progenitor cell population (particularly the muscle satellite cell population is also negatively affected by the diabetic environment, and as such, likely contributes to the declining skeletal muscle health observed in diabetes mellitus. In this review, we summarize the current knowledge surrounding the influence of diabetes mellitus on skeletal muscle growth and repair, with a particular emphasis on the impact of diabetes mellitus on the progenitor cell population of skeletal muscle.

  14. MiR-320a as a Potential Novel Circulating Biomarker of Arrhythmogenic CardioMyopathy.

    Science.gov (United States)

    Sommariva, Elena; D'Alessandra, Yuri; Farina, Floriana Maria; Casella, Michela; Cattaneo, Fabio; Catto, Valentina; Chiesa, Mattia; Stadiotti, Ilaria; Brambilla, Silvia; Dello Russo, Antonio; Carbucicchio, Corrado; Vettor, Giulia; Riggio, Daniela; Sandri, Maria Teresa; Barbuti, Andrea; Vernillo, Gianluca; Muratori, Manuela; Dal Ferro, Matteo; Sinagra, Gianfranco; Moimas, Silvia; Giacca, Mauro; Colombo, Gualtiero Ivanoe; Pompilio, Giulio; Tondo, Claudio

    2017-07-06

    Diagnosis of Arrhythmogenic CardioMyopathy (ACM) is challenging and often late after disease onset. No circulating biomarkers are available to date. Given their involvement in several cardiovascular diseases, plasma microRNAs warranted investigation as potential non-invasive diagnostic tools in ACM. We sought to identify circulating microRNAs differentially expressed in ACM with respect to Healthy Controls (HC) and Idiopathic Ventricular Tachycardia patients (IVT), often in differential diagnosis. ACM and HC subjects were screened for plasmatic expression of 377 microRNAs and validation was performed in 36 ACM, 53 HC, 21 IVT. Variable importance in data partition was estimated through Random Forest analysis and accuracy by Receiver Operating Curves. Plasmatic miR-320a showed 0.53 ± 0.04 fold expression difference in ACM vs. HC (p ACM (n = 13) and HC (n = 17) with athletic lifestyle, a ACM precipitating factor. Importantly, ACM patients miR-320a showed 0.78 ± 0.05 fold expression change vs. IVT (p = 0.03). When compared to non-invasive ACM diagnostic parameters, miR-320a ranked highly in discriminating ACM vs. IVT and it increased their accuracy. Finally, miR-320a expression did not correlate with ACM severity. Our data suggest that miR-320a may be considered a novel potential biomarker of ACM, specifically useful in ACM vs. IVT differentiation.

  15. Neuropatia na miopatia miotubular ou centronuclear Neuropathy in myotubular or centronuclear myopathy

    Directory of Open Access Journals (Sweden)

    Roberto E. P. Sica

    1975-06-01

    Full Text Available Un estudio electrofisiológico detallado fué hecho en los músculos extensor corto de los dedos, de la eminencia tenar, de la eminencia hipotenar y soleo en un paciente con el diagnóstico de miopatía miotubular o centronuclear. El hallazgo principal fué una notoria reducción en el número de unidades motoras activas en todos los músculos investigados, en tanto que las unidades remanentes mostraron tamaño conservado. Las observaciones hechas se han interpretado como favoreciéndo la génesis neurógena en el desarrollo de este proceso.A detailed electrophysiological study has been made of the extensor digitorum brevis, thenar, hypothenar and soleus muscles in one patient with myotubular or centronuclear myopathy. The main finding was a noticeable reduction in the population of active motor units in all the investigated muscles. The remainer units showed normal sizes. The experimental observations have been interpreted in terms of a neuropathic process.

  16. The spectrum of myopathies in the city of São Paulo

    Directory of Open Access Journals (Sweden)

    José A. Levy

    1976-12-01

    Full Text Available A review of all myopathic patients treated at the Neurologic Clinic of the Medical School of the University of São Paulo during the past 15 years is reported. A total of 466 cases were examined and distributed as follows: 56% of progressive muscular dystrophy; 31% of myasthenia gravis; 6% of polymyositis; 4% of myotonic dystrophy; and the remainder of several different diseases (central core disease, Kearns-syndrome, myotonia congenita, adynamia episodica hereditaria, diabetic myopathy and Eaton-Lambert syndrome. Enzymatic dosages, electromyography, muscle biopsy, electrocardiography and genetic counselling are also reported.Os autores fazem uma revisão de todos os casos de miopatias tratados na Clínica Neurológica da F.M.U.S.P. durante os últimos 15 anos. Foram examinados 466 casos, assim distribuídos: 56% de distrofia muscular progressiva; 31% de miastenia grave; 6% de polimiosite; 4% de distrofia miotônica e, o restante, de várias outras moléstias (Central core disease, síndrome de Kearns, miotonia congênita, adinamia episódica hereditária, miopatia diabética e síndrome de Eaton-Lambert. São relatadas também as dosagens enzimáticas, eletromiografia, biópsia muscular, eletrocardiografia e aconselhamento genético.

  17. Mechanisms of Hyperhomocysteinemia Induced Skeletal Muscle Myopathy after Ischemia in the CBS−/+ Mouse Model

    Directory of Open Access Journals (Sweden)

    Sudhakar Veeranki

    2015-01-01

    Full Text Available Although hyperhomocysteinemia (HHcy elicits lower than normal body weights and skeletal muscle weakness, the mechanisms remain unclear. Despite the fact that HHcy-mediated enhancement in ROS and consequent damage to regulators of different cellular processes is relatively well established in other organs, the nature of such events is unknown in skeletal muscles. Previously, we reported that HHcy attenuation of PGC-1α and HIF-1α levels enhanced the likelihood of muscle atrophy and declined function after ischemia. In the current study, we examined muscle levels of homocysteine (Hcy metabolizing enzymes, anti-oxidant capacity and focused on protein modifications that might compromise PGC-1α function during ischemic angiogenesis. Although skeletal muscles express the key enzyme (MTHFR that participates in re-methylation of Hcy into methionine, lack of trans-sulfuration enzymes (CBS and CSE make skeletal muscles more susceptible to the HHcy-induced myopathy. Our study indicates that elevated Hcy levels in the CBS−/+ mouse skeletal muscles caused diminished anti-oxidant capacity and contributed to enhanced total protein as well as PGC-1α specific nitrotyrosylation after ischemia. Furthermore, in the presence of NO donor SNP, either homocysteine (Hcy or its cyclized version, Hcy thiolactone, not only increased PGC-1α specific protein nitrotyrosylation but also reduced its association with PPARγ in C2C12 cells. Altogether these results suggest that HHcy exerts its myopathic effects via reduction of the PGC-1/PPARγ axis after ischemia.

  18. Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

    Science.gov (United States)

    Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

    2014-01-01

    Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

  19. Underground Storage Tanks - Storage Tank Locations

    Data.gov (United States)

    NSGIC Education | GIS Inventory — A Storage Tank Location is a DEP primary facility type, and its sole sub-facility is the storage tank itself. Storage tanks are aboveground or underground, and are...

  20. A novel Ile1455Thr variant in the skeletal muscle sodium channel alpha-subunit in a patient with a severe adult-onset proximal myopathy with electrical myotonia and a patient with mild paramyotonia phenotype

    NARCIS (Netherlands)

    Bednarz, M.; Stunnenberg, B.C.; Kusters, B.; Kamsteeg, E.J.; Saris, C.G.J.; Groome, J.; Winston, V.; Meola, G.; Jurkat-Rott, K.; Voermans, N.C.

    2017-01-01

    In sodium channelopathies, a severe fixed myopathy caused by a dominant mutation is rare. We describe two unrelated patients with a novel variant, p.Ile1455Thr, with phenotypes of paramyotonia in one case and fixed proximal myopathy with latent myotonia in another. In-vitro whole cell patch-clamp

  1. A case report: a heterozygous deletion (2791_2805 del) in exon 18 of the filamin C gene causing filamin C-related myofibrillar myopathies in a Chinese family.

    Science.gov (United States)

    Miao, Jing; Su, Fei-Fei; Liu, Xue-Mei; Wei, Xiao-Jing; Yuan, Yun; Yu, Xue-Fan

    2018-06-04

    Filamin C-related myofibrillar myopathies (MFM) are progressive skeletal myopathies with an autosomal dominant inheritance pattern. The conditions are caused by mutations of the filamin C gene (FLNC) located in the chromosome 7q32-q35 region. Genetic variations in the FLNC gene result in various clinical phenotypes. We describe a 43-year-old woman who suffered filamin C-related MFM, with symptoms first presenting in the proximal muscles of the lower limbs and eventually spreading to the upper limbs and distal muscles. The patient's serum level of creatine kinase was mildly increased. Mildy myopathic changes in the electromyographic exam and moderate lipomatous alterations in lower limb MRI were found. Histopathological examination revealed increased muscle fiber size variability, disturbances in oxidative enzyme activity, and the presence of abnormal protein aggregates and vacuoles in some muscle fibers. Ultrastructural analysis showed inclusions composed of thin filaments and interspersed granular densities. DNA sequencing analysis detected a novel 15-nucleotide deletion (c.2791_2805del, p.931_935del) in the FLNC gene. The patient's father, sister, brother, three paternal aunts, one paternal uncle, and the uncle's son also had slowly progressive muscle weakness, and thus, we detected an autosomal dominant inheritance pattern of the disorder. A novel heterogeneous 15-nucleotide deletion (c.2791_2805del, p.931_935del) in the Ig-like domain 7 of the FLNC gene was found to cause filamin C-related MFM. This deletion in the FLNC gene causes protein aggregation, abnormalities in muscle structure, and impairment in muscle fiber function, which leads to muscle weakness.

  2. Two novel MYH7 proline substitutions cause Laing Distal Myopathy-like phenotypes with variable expressivity and neck extensor contracture.

    Science.gov (United States)

    Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S

    2016-08-12

    Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.

  3. Fuel storage

    International Nuclear Information System (INIS)

    Palacios, C.; Alvarez-Miranda, A.

    2009-01-01

    ENSA is a well known manufacturer of multi-system primary components for the nuclear industry and is totally prepared to satisfy future market requirements in this industry. At the same time that ENSA has been gaining a reputation world wider for the supply of primary components, has been strengthening its commitment and experience in supplying spent fuel components, either pool racks or storage and transportation casks, and offers not only fabrication but also design capabilities for its products. ENSA has supplied Spent Fuel Pool Racks, in spain, Finland, Taiwan, Korea, China, and currently it is in the process of licensing its own rack design in the United States of America for the ESBWR along with Ge-Hitachi. ENSA has supplied racks for 20 pools and 22 different reactors and it has also manufactured racks under all available technologies and developed a design known as Interlock Cell Matrix whose main features are outlined in this article. Another ENSA achievement in rack technology is the use of remote control for re-racking activities instead of using divers, which improves the ALARA requirements. Regarding casks for storage and transportation, ENSA also has al leading worldwide position, with exports prevailing over the Spanish market where ENSA has supplied 16 storage and transportation casks to the Spanish nuclear power Trillo. In some cases, ENSA acts as subcontractor for other clients. Foreign markets are still a major challenge for ENSA. ENSA-is well known for its manufacturing capabilities in the nuclear industry, but has been always involved in design activities through its engineering division, which carries out different tasks: components Design; Tooling Design; Engineering and Documentation; Project Engineering; Calculations, Design and Development Engineering. (Author)

  4. Underground storage

    Energy Technology Data Exchange (ETDEWEB)

    1965-06-10

    A procedure is described for making an underground storage cavity in a soluble formation. Two holes are drilled, and fluid is pumped into the first hole. This fluid is a non-solute for the formation material. Then pressure is applied to the fluid until the formation is fractured in the direction of the second hole. More non-solute fluid is injected to complete the fracture between the 2 holes. A solute fluid is then circulated between the 2 holes, which results in removal of that part of the formation next to the fracture and the forming of a chamber.

  5. Pumped storage

    International Nuclear Information System (INIS)

    Strauss, P.L.

    1991-01-01

    The privately financed 1,000 MW Rocky Point Pumped Storage Project located in central Colorado, USA, will be one of the world's highest head, 2,350 feet reversible pump/turbine projects. The project will offer an economical supply of peaking power and spinning reserve power to Colorado and other southwestern states. This paper describes how the project will be made compatible with the environmental conditions in the project area and the type of terrestrial mitigation measures that are being proposed for those situations where the project impacts the environment, either temporarily or permanently

  6. A highly prevalent equine glycogen storage disease is explained by constitutive activation of a mutant glycogen synthase

    DEFF Research Database (Denmark)

    Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K

    2017-01-01

    BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...

  7. mtDNA depletion myopathy: elucidation of the tissue specificity in the mitochondrial thymidine kinase (TK2) deficiency.

    Science.gov (United States)

    Saada, Ann; Shaag, Avraham; Elpeleg, Orly

    2003-05-01

    Decreased mitochondrial thymidine kinase (TK2) activity is associated with mitochondrial DNA (mtDNA) depletion and respiratory chain dysfunction and is manifested by isolated, fatal skeletal myopathy. Other tissues such as liver, brain, heart, and skin remain unaffected throughout the patients' life. In order to elucidate the mechanism of tissue specificity in the disease we have investigated the expression of the mitochondrial deoxynucleotide carrier, the mtDNA content and the activity of TK2 in mitochondria of various tissues. Our results suggest that low basal TK2 activity combined with a high requirement for mitochondrial encoded proteins in muscle predispose this tissue to the devastating effect of TK2 deficiency.

  8. The occurrence of deep pectoral myopathy in broilers and associated changes in breast meat quality.

    Science.gov (United States)

    Yalcin, S; Ozkan, S; Acar, M Comert; Meral, O

    2018-02-01

    1. Two experiments were conducted to determine the effect of slaughter weight on the incidence and intensity of deep pectoral myopathy (DPM) of M. pectoralis minor (p. minor muscle) in commercial conditions in Turkey and to evaluate the impact of DPM on meat quality traits of pectoralis major (p. major) muscle in broilers. 2. In Experiment 1, a total of 116 250 carcasses from 59 Ross-308 broiler flocks, classified according to slaughter weight as 2.0-2.2, 2.2-2.4, 2.4-2.6 and >2.6 kg, were evaluated for occurrence of DPM. In Experiment 2, p. major samples from unaffected broilers and each DPM stage were evaluated for meat quality, oxidant and antioxidant properties, nutritional value and fatty acid profile. DPM was characterised as 1: muscles with coagulative necrosis, 2: muscles with fibrous tissue texture and pink to plumb and 3: muscles with green necrotic area. 3. The average incidence of DPM was found to be 0.73% in Experiment 1 and independent of slaughter weight. 4. In Experiment 2, p. major muscle of broilers with DPM 1 and 2 had higher pH values with higher redness and drip loss. All DPM stages resulted in an increase in lipid content and malondialdehyde activity and lowered ash content of p. major muscle compared with unaffected birds. DPM 2 increased superoxide dismutase and glutathione peroxidase activities in M. p. major. The p. major of broilers with DPM had lower content of C18:2 conjugated linoleic and C20:3n-6 fatty acids than those of unaffected broilers. Lower Δ6 desaturase and thiosterase activities and 18:2n-6 to 18:3n-3 ratio were observed for all DPM stages compared to unaffected. 5. It was concluded that these changes obtained in p. major muscle of broilers with DPM might indicate biochemical characteristics of muscle degenerations.

  9. Biomechanics, diagnosis, and treatment outcome in inflammatory myopathy presenting as oropharyngeal dysphagia

    Science.gov (United States)

    Williams, R B; Grehan, M J; Hersch, M; Andre, J; Cook, I J

    2003-01-01

    Aims: In patients with inflammatory myopathy and dysphagia, our aims were to determine: (1) the diagnostic utility of clinical and laboratory indicators; (2) the biomechanical properties of the pharyngo-oesophageal segment; (3) the usefulness of pharyngeal videomanometry in distinguishing neuropathic from myopathic dysphagia; and (4) clinical outcome. Methods: Clinical, laboratory, and videomanometric assessment was performed in 13 patients with myositis and dysphagia, in 17 disease controls with dysphagia (due to proven CNS disease), and in 22 healthy age matched controls. The diagnostic accuracy of creatine kinase (CPK), erythrocyte sedimentation rate, antinuclear antibody, and electromyography (EMG) were compared with the gold standard muscle biopsy. The biomechanical properties of the pharyngo-oesophageal segment were assessed by videomanometry. Results: Mean time from dysphagia onset to the diagnosis of myositis was 55 months (range 1–180). One third had no extrapharyngeal muscle weakness; 25% had normal CPK, and EMG was unhelpful in 28%. Compared with neurogenic controls, myositis patients had more prevalent cricopharyngeal restrictive disorders (69% v 14%; p=0.0003), reduced upper oesophageal sphincter (UOS) opening (p=0.01), and elevated hypopharyngeal intrabolus pressures (p=0.001). Videomanometric features favouring a myopathic over a neuropathic aetiology were: preserved pharyngeal swallow response, complete UOS relaxation, and normal swallow coordination. The 12 month mortality was 31%. Conclusions: The notable lack of supportive clinical signs and significant false negative rates for laboratory tests contribute to the marked delay in diagnosis. The myopathic process is strongly associated with restricted sphincter opening suggesting that cricopharyngeal disruption is a useful adjunct to immunosuppressive therapy. The condition has a poor prognosis. PMID:12631653

  10. Intravenous immune globulin in hereditary inclusion body myopathy: a pilot study

    Directory of Open Access Journals (Sweden)

    Dorward Heidi

    2007-01-01

    Full Text Available Abstract Background Hereditary Inclusion Body Myopathy (HIBM is an autosomal recessive, adult onset, non-inflammatory neuromuscular disorder with no effective treatment. The causative gene, GNE, codes for UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase, which catalyzes the first two reactions in the synthesis of sialic acid. Reduced sialylation of muscle glycoproteins, such as α-dystroglycan and neural cell adhesion molecule (NCAM, has been reported in HIBM. Methods We treated 4 HIBM patients with intravenous immune globulin (IVIG, in order to provide sialic acid, because IgG contains 8 μmol of sialic acid/g. IVIG was infused as a loading dose of 1 g/kg on two consecutive days followed by 3 doses of 400 mg/kg at weekly intervals. Results For all four patients, mean quadriceps strength improved from 19.0 kg at baseline to 23.2 kg (+22% directly after IVIG loading to 25.6 kg (+35% at the end of the study. Mean shoulder strength improved from 4.1 kg at baseline to 5.9 kg (+44% directly after IVIG loading to 6.0 kg (+46% at the end of the study. The composite improvement for 8 other muscle groups was 5% after the initial loading and 19% by the end of the study. Esophageal motility and lingual strength improved in the patients with abnormal barium swallows. Objective measures of functional improvement gave variable results, but the patients experienced improvements in daily activities that they considered clinically significant. Immunohistochemical staining and immunoblotting of muscle biopsies for α-dystroglycan and NCAM did not provide consistent evidence for increased sialylation after IVIG treatment. Side effects were limited to transient headaches and vomiting. Conclusion The mild benefits in muscle strength experienced by HIBM patients after IVIG treatment may be related to the provision of sialic acid supplied by IVIG. Other sources of sialic acid are being explored as treatment options for HIBM.

  11. Relationship between work rate and oxygen uptake in mitochondrial myopathy during ramp-incremental exercise

    Directory of Open Access Journals (Sweden)

    A.C. Gimenes

    2011-04-01

    Full Text Available We determined the response characteristics and functional correlates of the dynamic relationship between the rate (Δ of oxygen consumption ( O2 and the applied power output (work rate = WR during ramp-incremental exercise in patients with mitochondrial myopathy (MM. Fourteen patients (7 males, age 35.4 ± 10.8 years with biopsy-proven MM and 10 sedentary controls (6 males, age 29.0 ± 7.8 years took a ramp-incremental cycle ergometer test for the determination of the O2 on-exercise mean response time (MRT and the gas exchange threshold (GET. The ΔO2/ΔWR slope was calculated up to GET (S1, above GET (S2 and over the entire linear portion of the response (S T. Knee muscle endurance was measured by isokinetic dynamometry. As expected, peak O2 and muscle performance were lower in patients than controls (P O2/ΔWR than controls, especially the S2 component (6.8 ± 1.5 vs 10.3 ± 0.6 mL·min-1·W-1, respectively; P O2/ΔWR (S T and muscle endurance, MRT-O2, GET and peak O2 in MM patients (P O2/ΔWR below 8 mL·min-1·W-1 had severely reduced peak O2 values (O2 had lower ΔO2/ΔWR (P O2/ΔWR is typically reduced in patients with MM, being related to increased functional impairment and higher cardiopulmonary stress.

  12. Characteristic cardiac phenotypes are detected by cardiovascular magnetic resonance in patients with different clinical phenotypes and genotypes of mitochondrial myopathy.

    Science.gov (United States)

    Florian, Anca; Ludwig, Anna; Stubbe-Dräger, Bianca; Boentert, Matthias; Young, Peter; Waltenberger, Johannes; Rösch, Sabine; Sechtem, Udo; Yilmaz, Ali

    2015-05-22

    Mitochondrial myopathies (MM) are a heterogeneous group of inherited conditions resulting from a primary defect in the mitochondrial respiratory chain with consecutively impaired cellular energy metabolism. Small sized studies using mainly electrocardiography (ECG) and echocardiography have revealed cardiac abnormalities ranging from conduction abnormalities and arrhythmias to hypertrophic or dilated cardiomyopathy in these patients. Recently, characteristic patterns of cardiac involvement were documented by cardiovascular magnetic resonance (CMR) in patients with chronic progressive external ophthalmoplegia (CPEO)/Kearns-Sayre syndrome (KSS) and with mitochondrial encephalopathy with lactic acidosis and stroke-like episodes (MELAS). The present study aimed to characterize the prevalence and pattern of cardiac abnormalities and to test the additional diagnostic value of CMR in this patient population. The hypothesis that different neuromuscular MM syndromes present with different cardiac disease phenotypes was evaluated. Sixty-four MM patients (50 ± 15 years, 44% male) and 25 matched controls (52 ± 14 years, 36% male) prospectively underwent cardiac evaluations including CMR (comprising cine- and late-gadolinium-enhancement (LGE) imaging). Based on the neuromuscular phenotype and genotype, the patients were grouped: (a) CPEO/KSS (N = 33); (b) MELAS/-like (N = 11); c) myoclonic epilepsy with ragged-red fibers (MERRF) (N = 3) and d) other non-specific MM forms (N = 17). Among the 64 MM patients, 34 (53%) had at least one abnormal CMR finding: 18 (28%) demonstrated an impaired left ventricular ejection-fraction (LV-EF patients showed significantly higher maximal wall thickness (10 ± 3 vs. 8 ± 2 mm, p = 0.005) and concentricity (LV mass to end-diastolic volume: 0.84 ± 0.27 vs. 0.67 ± 0.11, p patients showed the highest frequency of cardiac disease (in 10/11 (91%)), a mostly concentric LV hypertrophy (6/9; 67%) with or

  13. Gas storage materials, including hydrogen storage materials

    Science.gov (United States)

    Mohtadi, Rana F; Wicks, George G; Heung, Leung K; Nakamura, Kenji

    2013-02-19

    A material for the storage and release of gases comprises a plurality of hollow elements, each hollow element comprising a porous wall enclosing an interior cavity, the interior cavity including structures of a solid-state storage material. In particular examples, the storage material is a hydrogen storage material such as a solid state hydride. An improved method for forming such materials includes the solution diffusion of a storage material solution through a porous wall of a hollow element into an interior cavity.

  14. A Drosophila model of dominant inclusion body myopathy type 3 shows diminished myosin kinetics that reduce muscle power and yield myofibrillar defects.

    Science.gov (United States)

    Suggs, Jennifer A; Melkani, Girish C; Glasheen, Bernadette M; Detor, Mia M; Melkani, Anju; Marsan, Nathan P; Swank, Douglas M; Bernstein, Sanford I

    2017-06-01

    Individuals with inclusion body myopathy type 3 (IBM3) display congenital joint contractures with early-onset muscle weakness that becomes more severe in adulthood. The disease arises from an autosomal dominant point mutation causing an E706K substitution in myosin heavy chain type IIa. We have previously expressed the corresponding myosin mutation (E701K) in homozygous Drosophila indirect flight muscles and recapitulated the myofibrillar degeneration and inclusion bodies observed in the human disease. We have also found that purified E701K myosin has dramatically reduced actin-sliding velocity and ATPase levels. Since IBM3 is a dominant condition, we now examine the disease state in heterozygote Drosophila in order to gain a mechanistic understanding of E701K pathogenicity. Myosin ATPase activities in heterozygotes suggest that approximately equimolar levels of myosin accumulate from each allele. In vitro actin sliding velocity rates for myosin isolated from the heterozygotes were lower than the control, but higher than for the pure mutant isoform. Although sarcomeric ultrastructure was nearly wild type in young adults, mechanical analysis of skinned indirect flight muscle fibers revealed a 59% decrease in maximum oscillatory power generation and an approximately 20% reduction in the frequency at which maximum power was produced. Rate constant analyses suggest a decrease in the rate of myosin attachment to actin, with myosin spending decreased time in the strongly bound state. These mechanical alterations result in a one-third decrease in wing beat frequency and marginal flight ability. With aging, muscle ultrastructure and function progressively declined. Aged myofibrils showed Z-line streaming, consistent with the human heterozygote phenotype. Based upon the mechanical studies, we hypothesize that the mutation decreases the probability of the power stroke occurring and/or alters the degree of movement of the myosin lever arm, resulting in decreased in vitro

  15. Spatially Discordant Alternans and Arrhythmias in Tachypacing-Induced Cardiac Myopathy in Transgenic LQT1 Rabbits: The Importance of IKs and Ca2+ Cycling.

    Directory of Open Access Journals (Sweden)

    Emily Lau

    Full Text Available Remodeling of cardiac repolarizing currents, such as the downregulation of slowly activating K+ channels (IKs, could underlie ventricular fibrillation (VF in heart failure (HF. We evaluated the role of Iks remodeling in VF susceptibility using a tachypacing HF model of transgenic rabbits with Long QT Type 1 (LQT1 syndrome.LQT1 and littermate control (LMC rabbits underwent three weeks of tachypacing to induce cardiac myopathy (TICM. In vivo telemetry demonstrated steepening of the QT/RR slope in LQT1 with TICM (LQT1-TICM; pre: 0.26±0.04, post: 0.52±0.01, P<0.05. In vivo electrophysiology showed that LQT1-TICM had higher incidence of VF than LMC-TICM (6 of 11 vs. 3 of 11, respectively. Optical mapping revealed larger APD dispersion (16±4 vs. 38±6 ms, p<0.05 and steep APD restitution in LQT1-TICM compared to LQT1-sham (0.53±0.12 vs. 1.17±0.13, p<0.05. LQT1-TICM developed spatially discordant alternans (DA, which caused conduction block and higher-frequency VF (15±1 Hz in LQT1-TICM vs. 13±1 Hz in LMC-TICM, p<0.05. Ca2+ DA was highly dynamic and preceded voltage DA in LQT1-TICM. Ryanodine abolished DA in 5 out of 8 LQT1-TICM rabbits, demonstrating the importance of Ca2+ in complex DA formation. Computer simulations suggested that HF remodeling caused Ca2+-driven alternans, which was further potentiated in LQT1-TICM due to the lack of IKs.Compared with LMC-TICM, LQT1-TICM rabbits exhibit steepened APD restitution and complex DA modulated by Ca2+. Our results strongly support the contention that the downregulation of IKs in HF increases Ca2+ dependent alternans and thereby the risk of VF.

  16. A Drosophila model of dominant inclusion body myopathy type 3 shows diminished myosin kinetics that reduce muscle power and yield myofibrillar defects

    Directory of Open Access Journals (Sweden)

    Jennifer A. Suggs

    2017-06-01

    Full Text Available Individuals with inclusion body myopathy type 3 (IBM3 display congenital joint contractures with early-onset muscle weakness that becomes more severe in adulthood. The disease arises from an autosomal dominant point mutation causing an E706K substitution in myosin heavy chain type IIa. We have previously expressed the corresponding myosin mutation (E701K in homozygous Drosophila indirect flight muscles and recapitulated the myofibrillar degeneration and inclusion bodies observed in the human disease. We have also found that purified E701K myosin has dramatically reduced actin-sliding velocity and ATPase levels. Since IBM3 is a dominant condition, we now examine the disease state in heterozygote Drosophila in order to gain a mechanistic understanding of E701K pathogenicity. Myosin ATPase activities in heterozygotes suggest that approximately equimolar levels of myosin accumulate from each allele. In vitro actin sliding velocity rates for myosin isolated from the heterozygotes were lower than the control, but higher than for the pure mutant isoform. Although sarcomeric ultrastructure was nearly wild type in young adults, mechanical analysis of skinned indirect flight muscle fibers revealed a 59% decrease in maximum oscillatory power generation and an approximately 20% reduction in the frequency at which maximum power was produced. Rate constant analyses suggest a decrease in the rate of myosin attachment to actin, with myosin spending decreased time in the strongly bound state. These mechanical alterations result in a one-third decrease in wing beat frequency and marginal flight ability. With aging, muscle ultrastructure and function progressively declined. Aged myofibrils showed Z-line streaming, consistent with the human heterozygote phenotype. Based upon the mechanical studies, we hypothesize that the mutation decreases the probability of the power stroke occurring and/or alters the degree of movement of the myosin lever arm, resulting in

  17. Experimental studies on the accumulation of /sup 99m/Tc-MDP in the bupivacaine hydrochloride induced myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Sone, Shinsuke

    1989-02-01

    It has recently been demonstrated that several /sup 99m/Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of /sup 99m/Tc-methylendiphosphonate (/sup 99m/Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of /sup 99m/Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of /sup 99m/Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of /sup 99m/Tc-MDP reflects the early degenerative changes of skeletal muscle.

  18. Experimental studies on the accumulation of 99mTc-MDP in the bupivacaine hydrochloride induced myopathy

    International Nuclear Information System (INIS)

    Sone, Shinsuke

    1989-01-01

    It has recently been demonstrated that several 99m Tc-labeled phosphate compounds accumulate in skeletal muscle in patients with myopathies including Duchenne muscular dystrophy (DMD). However, the mechanism by which these compounds accumulate in skeletal muscles is unknown. In order to analyze the mechanisms of tracer-localization in skeletal muscles of myopathies, the uptake of 99m Tc-methylendiphosphonate ( 99m Tc-MDP) by muscles examined in rats treated by intramuscular injection of a local anesthetic, bupivacaine. At the same time, the histological and biochemical changes of the injured muscles were studied, and findings obtained were correlated with the procedure of 99m Tc-MDP uptake. Intramuscular injection of bupivacaine resulted in markedly increased uptake of 99m Tc-MDP in the injected muscle at 12 and 24 hours after injection. The plasma creatine phosphokinase (CK) concentration increased 2-3 folds during the period from 3 to 24 hours after bupivacaine injection. Four days following injection, the CK isozyme MB activity in muscle increased. Twenty hours after injection of bupivacaine, changes such as hypercontraction and disruptin of myofibrils, Z-band lysis, and swelling of mitochondria occurred. Four days after the injection, myoblasts and myotubes were found in the damaged areas of the muscle. These results show that the increased muscle uptake of 99m Tc-MDP reflects the early degenerative changes of skeletal muscle. (author)

  19. Sporadic late-onset nemaline myopathy with MGUS: long-term follow-up after melphalan and SCT.

    Science.gov (United States)

    Voermans, Nicol C; Benveniste, Olivier; Minnema, Monique C; Lokhorst, Henk; Lammens, Martin; Meersseman, Wouter; Delforge, Michel; Kuntzer, Thierry; Novy, Jan; Pabst, Thomas; Bouhour, Françoise; Romero, Norma; Leblond, Veronique; Bergh, Peter van den; Vekemans, Marie-Christiane; van Engelen, Baziel G; Eymard, Bruno

    2014-12-02

    Sporadic late-onset nemaline myopathy (SLONM) is a rare, late-onset myopathy that progresses subacutely. If associated with a monoclonal gammopathy of unknown significance (MGUS), the outcome is unfavorable: the majority of these patients die within 1 to 5 years of respiratory failure. This study aims to qualitatively assess the long-term treatment effect of high-dose melphalan (HDM) followed by autologous stem cell transplantation (SCT) in a series of 8 patients with SLONM-MGUS. We performed a retrospective case series study (n = 8) on the long-term (1-8 years) treatment effect of HDM followed by autologous SCT (HDM-SCT) on survival, muscle strength, and functional capacities. Seven patients showed a lasting moderate-good clinical response, 2 of them after the second HDM-SCT. All of them had a complete, a very good partial, or a partial hematologic response. One patient showed no clinical or hematologic response and died. This case series shows the positive effect of HDM-SCT in this rare disorder. Factors that may portend an unfavorable outcome are a long disease course before the hematologic treatment and a poor hematologic response. Age at onset, level and type of M protein (κ vs λ), and severity of muscle weakness were not associated with a specific outcome. This study provides Class IV evidence that for patients with SLONM-MGUS, HDM-SCT increases the probability of survival and functional improvement. © 2014 American Academy of Neurology.

  20. Hypoglycin A concentrations in seeds of Acer pseudoplatanus trees growing on atypical myopathy-affected and control pastures.

    Science.gov (United States)

    Unger, L; Nicholson, A; Jewitt, E M; Gerber, V; Hegeman, A; Sweetman, L; Valberg, S

    2014-01-01

    Hypoglycin A, found in seeds of Acer negundo, appears to cause seasonal pasture myopathy (SPM) in North America and is implicated in atypical myopathy (AM) in Europe. Acer negundo is uncommon in Europe. Thus, the potential source of hypoglycin A in Europe is unknown. We hypothesized that seeds of Acer pseudoplatanus were the source of hypoglycin A in Europe. Our objective was to determine the concentration of hypoglycin A in seeds of A. pseudoplatanus trees located in pastures where previous cases of AM had occurred. None. University of Berne records were searched to retrospectively identify 6 farms with 10 AM cases and 11 suspected AM deaths between 2007 and 2011. During October 2012, A. pseudoplatanus seeds were collected from 2 to 6 trees per pasture on 6 AM farms (7 pastures) from trees in or close to 2 pastures on 2 control farms where AM had not been previously reported. Hypoglycin A in seeds was analyzed by GC-MS. Acer pseudoplatanus trees were identified on all AM pastures. Hypoglycin A was detected in all A. pseudoplatanus seeds in highly variable concentrations ranging from 0.04 to 2.81 μg/mg (mean 0.69) on AM farms and 0.10 to 9.12 μg/mg (mean 1.59) on control farms. Preventing horses from grazing pastures containing A. pseudoplatanus seeds during late fall and early spring might be the best means to prevent AM. Copyright © 2014 by the American College of Veterinary Internal Medicine.

  1. Clinical pathological and genetic analysis of 2 cases of mitochondrial myopathy presented as acute motor axonal neuropathy

    Directory of Open Access Journals (Sweden)

    Hou-min YIN

    2014-06-01

    Full Text Available Background The main clinical manifestations of mitochondrial myopathy are chronic limb weakness and muscular soreness. Subclinical peripheral nerve injury is also reported, but acute axonal neuropathy.like syndrome concurrent with lactic acidosis is rare. In this paper the clinical features of 2 patients presenting as acute lactic acidosis and sudden muscle weakness were analyzed. Pathological changes and genetic mutations were detected.  Methods Electromyography (EMG and muscle biopsy were performed. Modified Gomori trichrome (MGT and succinodehydrogenase (SDH staining were used to identify pathological changes. Changes of ultra microstructure of muscular tissue were observed under electron microscope. Mitochondrial DNA (mtDNA full length sequencing was performed using 24 pairs of partially overlapping primers.  Results EMG showed a coexistence of neurogenic and myogenic changes. Dramatic decrease of motor nerve amplitude and moderately reduced sensory nerve amplitude were observed but nerve conduction velocity was normal in both patients. Impressive ragged red fibers were seen on MGT staining. Electron microscope showed dramatic mitochondrial abnormalities in Case 1 and paracrystaline inclusions in Case 2. mtDNA sequencing showed 3243A > G mutation in Case 1 and 8344A > G mutation in Case 2. Conclusions Mitochondrial myopathy can present as metabolic crisis like acute lactic acidosis, dyspnea and acute motor axonal neuropathy.like syndrome. It is a life.threatening phenotype that needs more attention. doi: 10.3969/j.issn.1672-6731.2014.06.007

  2. Deficiency of long-chain 3-hydroxyacyl-CoA dehydrogenase: a cause of lethal myopathy and cardiomyopathy in early childhood

    NARCIS (Netherlands)

    Rocchiccioli, F.; Wanders, R. J.; Aubourg, P.; Vianey-Liaud, C.; IJlst, L.; Fabre, M.; Cartier, N.; Bougneres, P. F.

    1990-01-01

    A child presented in early childhood with episodes of coma and hypoglycemia and a rapidly evolutive myopathy and cardiomyopathy leading to death at 9 mo of age. Ketosis was decreased (blood beta-hydroxybutyrate: 0.07 mmol/L) despite normal plasma levels of fatty acids (0.81 mmol/L). The patient's

  3. Detection of hypoglycin A in the seeds of sycamore (Acer pseudoplatanus) and box elder (A. negundo) in New Zealand; the toxin associated with cases of equine atypical myopathy.

    Science.gov (United States)

    McKenzie, R K; Hill, F I; Habyarimana, J A; Boemer, F; Votion, D M

    2016-05-01

    During April and May 2014 four horses aged between 5 months and 9 years, located in the Canterbury, Marlborough and Southland regions, presented with a variety of clinical signs including recumbency, stiffness, lethargy, dehydration, depression, and myoglobinuria suggestive of acute muscle damage. Two horses were subjected to euthanasia and two recovered. In all cases seeds of sycamore maple (Acer pseudoplatanus) or box elder (A. negundo) were present in the area where the horse had been grazing. The samaras (seeds) of some Acer spp. may contain hypoglycin A, that has been associated with cases of atypical myopathy in Europe and North America. To determine if hypoglycin A is present in the samaras of Acer spp. in New Zealand, samples were collected from trees throughout the country that were associated with historical and/or current cases of atypical myopathy, and analysed for hypoglycin A. Serum samples from the four cases and four unaffected horses were analysed for the presence of hypoglycin A, profiles of acylcarnitines (the definitive diagnosis for atypical myopathy) and activities of creatine kinase and aspartate aminotransferase.Markedly elevated serum activities of creatine kinase and aspartate aminotransferase, and increased concentrations of selected acylcarnitines were found in the case horses. Hypoglycin A was detected in the serum of those horses but not in the healthy controls. Hypoglycin A was detected in 10/15 samples of samaras from sycamore maple and box elder from throughout New Zealand. Cases of atypical myopathy were diagnosed on properties where samaras containing hypoglycin A were also found. Sycamore and box elder trees in New Zealand are a source of hypoglycin A associated with the development of atypical myopathy. If pastured horses present with clinical and biochemical signs of severe muscle damage then the environment should be checked for the presence of these trees. Horses should be prevented from grazing samaras from Acer spp. in the

  4. Biomarker for Glycogen Storage Diseases

    Science.gov (United States)

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  5. NMR-based metabolomics reveals that conjugated double bond content and lipid storage efficiency in HepG2 cells are affected by fatty acid cis/trans configuration and chain length

    DEFF Research Database (Denmark)

    Najbjerg, Heidi; Young, Jette F; Bertram, Hanne Christine S.

    2011-01-01

    from conjugated double bonds (5.65, 5.94, and 6.28 ppm) in cells exposed to vaccenic acid, revealing that vaccenic acid upon uptake by the HepG2 cells is converted into a conjugated fatty acid. Upon exposure of the HepG2 cells to either butyric acid (C4:0), caproic acid (C6:0), lauric acid (C12...

  6. Adherence to drug label recommendations for avoiding drug interactions causing statin-induced myopathy--a nationwide register study.

    Directory of Open Access Journals (Sweden)

    Jennifer Settergren

    Full Text Available To investigate the extent to which clinicians avoid well-established drug-drug interactions that cause statin-induced myopathy. We hypothesised that clinicians would avoid combining erythromycin or verapamil/diltiazem respectively with atorvastatin or simvastatin. In patients with statin-fibrate combination therapy, we hypothesised that gemfibrozil was avoided to the preference of bezafibrate or fenofibrate. When combined with verapamil/diltiazem or fibrates, we hypothesized that the dispensed doses of atorvastatin/simvastatin would be decreased.Cross-sectional analysis of nationwide dispensing data. Odds ratios of interacting erythromycin, verapamil/diltiazem versus respective prevalence of comparator drugs doxycycline, amlodipine/felodipine in patients co-dispensed interacting statins simvastatin/atorvastatin versus patients unexposed (pravastatin/fluvastatin/rosuvastatin was calculated. For fibrates, OR of gemfibrozil versus fenofibrate/bezafibrate in patients co-dispensed any statin was assessed.OR of interacting erythromycin versus comparator doxycycline did not differ between patients on interacting and comparator statins either in patients dispensed high or low statin doses (adjusted OR 0.87; 95% CI 0.60-1.25 and 0.92; 95% CI 0.69-1.23. Interacting statins were less common among patients dispensed verapamil/diltiazem as compared to patients on amlodipine/felodipine (OR high dose 0.62; CI 0.56-0.68 and low dose 0.63; CI 0.58-0.68. Patients on any statin were to a lesser extent dispensed gemfibrozil compared to patients not dispensed a statin (OR high dose 0.65; CI 0.55-0.76 and low dose 0.70; CI 0.63-0.78. Mean DDD (SD for any statin was substantially higher in patients co-dispensed gemfibrozil 178 (149 compared to patients on statin monotherapy 127 (93, (p<0.001.Prescribers may to some extent avoid co-prescription of statins with calcium blockers and fibrates with an increased risk of myopathy. We found no evidence for avoiding co

  7. Mathematics revealed

    CERN Document Server

    Berman, Elizabeth

    1979-01-01

    Mathematics Revealed focuses on the principles, processes, operations, and exercises in mathematics.The book first offers information on whole numbers, fractions, and decimals and percents. Discussions focus on measuring length, percent, decimals, numbers as products, addition and subtraction of fractions, mixed numbers and ratios, division of fractions, addition, subtraction, multiplication, and division. The text then examines positive and negative numbers and powers and computation. Topics include division and averages, multiplication, ratios, and measurements, scientific notation and estim

  8. Dietary Management of the Ketogenic Glycogen Storage Diseases

    Directory of Open Access Journals (Sweden)

    Kaustuv Bhattacharya MBBS, MRCPCH, FRACP, MD

    2016-08-01

    Full Text Available The glycogen storage diseases (GSDs comprise a group of rare inherited disorders of glycogen metabolism. The hepatic glycogenolytic forms of these disorders are typically associated with hypoglycemia and hepatomegaly. For GSD I, secondary metabolic disturbances include fasting hyperlactatemia, hyperuricemia, and hyperlipidemia. Glycogen storage disease III is caused by reduced activity of the debrancher enzyme, GSD VI by phosphorylase, and GSD IX by phosphorylase kinase. It has often been reported that the non-GSD I group of disorders have a benign course. However, myopathy, cardiomyopathy, and cirrhosis have been reported significant clinical morbidities associated with GSD III and IX in particular. There have been a range of reports indicating high-protein diets, high-fat diets, medium chain triglyceride (MCT, modified Atkins diet, and therapeutic ketones as rescuing severe phenotypes of GSD III in particular. The etiology of these severe phenotypes has not been defined. Cases presented in this report indicate potential harm from excessive simple sugar use in GSD IX C. Review of the literature indicates that most interventions have reduced the glycemic load and provide alternate substrates for energy in rescue situations. Prevention of complications is most likely to occur with a mixed balanced low glycemic index diet potentially with relative increases in protein.

  9. The myopathy-causing mutation DNM2-S619L leads to defective tubulation in vitro and in developing zebrafish

    Directory of Open Access Journals (Sweden)

    Elizabeth M. Gibbs

    2014-01-01

    Full Text Available DNM2 is a ubiquitously expressed GTPase that regulates multiple subcellular processes. Mutations in DNM2 are a common cause of centronuclear myopathy, a severe disorder characterized by altered skeletal muscle structure and function. The precise mechanisms underlying disease-associated DNM2 mutations are unresolved. We examined the common DNM2-S619L mutation using both in vitro and in vivo approaches. Expression of DNM2-S619L in zebrafish led to the accumulation of aberrant vesicular structures and to defective excitation-contraction coupling. Expression of DNM2-S619L in COS7 cells resulted in defective BIN1-dependent tubule formation. These data suggest that DNM2-S619L causes disease, in part, by interfering with membrane tubulation.

  10. Economic analysis of using above ground gas storage devices for compressed air energy storage system

    Science.gov (United States)

    Liu, Jinchao; Zhang, Xinjing; Xu, Yujie; Chen, Zongyan; Chen, Haisheng; Tan, Chunqing

    2014-12-01

    Above ground gas storage devices for compressed air energy storage (CAES) have three types: air storage tanks, gas cylinders, and gas storage pipelines. A cost model of these gas storage devices is established on the basis of whole life cycle cost (LCC) analysis. The optimum parameters of the three types are determined by calculating the theoretical metallic raw material consumption of these three devices and considering the difficulties in manufacture and the influence of gas storage device number. The LCCs of the three types are comprehensively analyzed and compared. The result reveal that the cost of the gas storage pipeline type is lower than that of the other two types. This study may serve as a reference for designing large-scale CAES systems.

  11. Progressive Structural Defects in Canine Centronuclear Myopathy Indicate a Role for HACD1 in Maintaining Skeletal Muscle Membrane Systems.

    Science.gov (United States)

    Walmsley, Gemma L; Blot, Stéphane; Venner, Kerrie; Sewry, Caroline; Laporte, Jocelyn; Blondelle, Jordan; Barthélémy, Inès; Maurer, Marie; Blanchard-Gutton, Nicolas; Pilot-Storck, Fanny; Tiret, Laurent; Piercy, Richard J

    2017-02-01

    Mutations in HACD1/PTPLA cause recessive congenital myopathies in humans and dogs. Hydroxyacyl-coA dehydratases are required for elongation of very long chain fatty acids, and HACD1 has a role in early myogenesis, but the functions of this striated muscle-specific enzyme in more differentiated skeletal muscle remain unknown. Canine HACD1 deficiency is histopathologically classified as a centronuclear myopathy (CNM). We investigated the hypothesis that muscle from HACD1-deficient dogs has membrane abnormalities in common with CNMs with different genetic causes. We found progressive changes in tubuloreticular and sarcolemmal membranes and mislocalized triads and mitochondria in skeletal muscle from animals deficient in HACD1. Furthermore, comparable membranous abnormalities in cultured HACD1-deficient myotubes provide additional evidence that these defects are a primary consequence of altered HACD1 expression. Our novel findings, including T-tubule dilatation and disorganization, associated with defects in this additional CNM-associated gene provide a definitive pathophysiologic link with these disorders, confirm that dogs deficient in HACD1 are relevant models, and strengthen the evidence for a unifying pathogenesis in CNMs via defective membrane trafficking and excitation-contraction coupling in muscle. These results build on previous work by determining further functional roles of HACD1 in muscle and provide new insight into the pathology and pathogenetic mechanisms of HACD1 CNM. Consequently, alterations in membrane properties associated with HACD1 mutations should be investigated in humans with related phenotypes. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  12. Idiopathic inflammatory myopathies in adults: A comparative study of Bohan and Peter and European Neuromuscular Center 2004 criteria.

    Science.gov (United States)

    Challa, Sundaram; Jakati, Saumya; Uppin, Megha S; Kannan, Meena A; Liza, Rajasekhar; Murthy Jagarlapudi, M K

    2018-01-01

    Bohan and Peter criteria are widely used for the diagnosis of idiopathic inflammatory myopathies (IIMs). Recently, European Neuromuscular Center (ENMC) formulated criteria to identify subgroups of IIMs. To compare the two diagnostic criteria in adult IIMs. This was a retrospective review of case records of histologically confirmed IIMs in adults between January 2014 and May 2015. Both the Bohan and Peter, and ENMC 2004 criteria were applied in the same group of patients to subgroup the IIMs. Muscle biopsy was evaluated in all the four domains: muscle fiber, inflammatory, connective tissue, and vascular, with the basic panel of histological stains. Sporadic inclusion body myositis (s-IBM) was diagnosed using ENMC IBM diagnostic research criteria 2011. During the study period, 69 patients fulfilled the ENMC criteria for IIMs including 16 patients with s-IBM. The subgrouping as per the ENMC criteria (53) was: dermatomyositis (DM) in 30; polymyositis (PM) in 2; immune-mediated necrotizing myopathy (IMNM) in 9; and nonspecific myositis (NM) in 12 patients, whereas subgrouping by the Bohan and Peter criteria was DM in 9 and PM with and without connective tissue disease (CTD) in 26 patients only. There was underdiagnosis of DM, as perifascicular atrophy is not recognized as a diagnostic histological feature, and overdiagnosis of PM with and without CTD due to poor characterization of histological features in PM by the Bohan and Peter criteria. Systematic evaluation of muscle biopsy according to the ENMC criteria with basic panel of histochemical stains improved the diagnostic yield of IIM significantly when compared to the Bohan and Peter criteria.

  13. Efficient and reproducible myogenic differentiation from human iPS cells: prospects for modeling Miyoshi Myopathy in vitro.

    Directory of Open Access Journals (Sweden)

    Akihito Tanaka

    Full Text Available The establishment of human induced pluripotent stem cells (hiPSCs has enabled the production of in vitro, patient-specific cell models of human disease. In vitro recreation of disease pathology from patient-derived hiPSCs depends on efficient differentiation protocols producing relevant adult cell types. However, myogenic differentiation of hiPSCs has faced obstacles, namely, low efficiency and/or poor reproducibility. Here, we report the rapid, efficient, and reproducible differentiation of hiPSCs into mature myocytes. We demonstrated that inducible expression of myogenic differentiation1 (MYOD1 in immature hiPSCs for at least 5 days drives cells along the myogenic lineage, with efficiencies reaching 70-90%. Myogenic differentiation driven by MYOD1 occurred even in immature, almost completely undifferentiated hiPSCs, without mesodermal transition. Myocytes induced in this manner reach maturity within 2 weeks of differentiation as assessed by marker gene expression and functional properties, including in vitro and in vivo cell fusion and twitching in response to electrical stimulation. Miyoshi Myopathy (MM is a congenital distal myopathy caused by defective muscle membrane repair due to mutations in DYSFERLIN. Using our induced differentiation technique, we successfully recreated the pathological condition of MM in vitro, demonstrating defective membrane repair in hiPSC-derived myotubes from an MM patient and phenotypic rescue by expression of full-length DYSFERLIN (DYSF. These findings not only facilitate the pathological investigation of MM, but could potentially be applied in modeling of other human muscular diseases by using patient-derived hiPSCs.

  14. Efficient and Reproducible Myogenic Differentiation from Human iPS Cells: Prospects for Modeling Miyoshi Myopathy In Vitro

    Science.gov (United States)

    Tanaka, Akihito; Woltjen, Knut; Miyake, Katsuya; Hotta, Akitsu; Ikeya, Makoto; Yamamoto, Takuya; Nishino, Tokiko; Shoji, Emi; Sehara-Fujisawa, Atsuko; Manabe, Yasuko; Fujii, Nobuharu; Hanaoka, Kazunori; Era, Takumi; Yamashita, Satoshi; Isobe, Ken-ichi; Kimura, En; Sakurai, Hidetoshi

    2013-01-01

    The establishment of human induced pluripotent stem cells (hiPSCs) has enabled the production of in vitro, patient-specific cell models of human disease. In vitro recreation of disease pathology from patient-derived hiPSCs depends on efficient differentiation protocols producing relevant adult cell types. However, myogenic differentiation of hiPSCs has faced obstacles, namely, low efficiency and/or poor reproducibility. Here, we report the rapid, efficient, and reproducible differentiation of hiPSCs into mature myocytes. We demonstrated that inducible expression of myogenic differentiation1 (MYOD1) in immature hiPSCs for at least 5 days drives cells along the myogenic lineage, with efficiencies reaching 70–90%. Myogenic differentiation driven by MYOD1 occurred even in immature, almost completely undifferentiated hiPSCs, without mesodermal transition. Myocytes induced in this manner reach maturity within 2 weeks of differentiation as assessed by marker gene expression and functional properties, including in vitro and in vivo cell fusion and twitching in response to electrical stimulation. Miyoshi Myopathy (MM) is a congenital distal myopathy caused by defective muscle membrane repair due to mutations in DYSFERLIN. Using our induced differentiation technique, we successfully recreated the pathological condition of MM in vitro, demonstrating defective membrane repair in hiPSC-derived myotubes from an MM patient and phenotypic rescue by expression of full-length DYSFERLIN (DYSF). These findings not only facilitate the pathological investigation of MM, but could potentially be applied in modeling of other human muscular diseases by using patient-derived hiPSCs. PMID:23626698

  15. Revealing Rembrandt

    Directory of Open Access Journals (Sweden)

    Andrew J Parker

    2014-04-01

    Full Text Available The power and significance of artwork in shaping human cognition is self-evident. The starting point for our empirical investigations is the view that the task of neuroscience is to integrate itself with other forms of knowledge, rather than to seek to supplant them. In our recent work, we examined a particular aspect of the appreciation of artwork using present-day functional magnetic resonance imaging (fMRI. Our results emphasised the continuity between viewing artwork and other human cognitive activities. We also showed that appreciation of a particular aspect of artwork, namely authenticity, depends upon the co-ordinated activity between the brain regions involved in multiple decision making and those responsible for processing visual information. The findings about brain function probably have no specific consequences for understanding how people respond to the art of Rembrandt in comparison with their response to other artworks. However, the use of images of Rembrandt’s portraits, his most intimate and personal works, clearly had a significant impact upon our viewers, even though they have been spatially confined to the interior of an MRI scanner at the time of viewing. Neuroscientific studies of humans viewing artwork have the capacity to reveal the diversity of human cognitive responses that may be induced by external advice or context as people view artwork in a variety of frameworks and settings.

  16. Frequency and phenotype of patients carrying TPM2 and TPM3 gene mutations in a cohort of 94 patients with congenital myopathy

    DEFF Research Database (Denmark)

    Citirak, Gülsenay; Witting, Nanna; Duno, Morten

    2014-01-01

    , two related female patients and two sporadic, male patients were found to carry mutations in the tropomyosin 2 (TPM2) and tropomyosin 3 (TPM3) genes, respectively. This indicates a low (4.3%) frequency of TPM2 and TPM3 mutations as a cause of congenital myopathy. Compared to previously described...... patients carrying the same mutations as found in our study (c.503G>A, and c.502C>T in TPM3, and c.415_417delGAG in TPM2), clinical presentation and muscle morphological findings differed in our patients. Differences included variation in distribution of muscle weakness, presence of scoliosis and ptosis...... had nemaline myopathy and fiber size disproportion, while three patients had congenital fiber type disproportion (CFTD) on muscle biopsies. TPM2-related CFTD has only been described in two cases, indicating that mutations in TPM2 are rare causes of CFTD....

  17. High prevalence of impaired glucose homeostasis and myopathy in asymptomatic and oligosymptomatic 3243A>G mitochondrial DNA mutation-positive subjects

    DEFF Research Database (Denmark)

    Frederiksen, A.L.; Jeppesen, T.D.; Vissing, J.

    2009-01-01

    controls were subjected to an oral glucose tolerance test. Twenty-six adult 3243A>G carriers with unknown myopathy status and 17 healthy controls had a maximal cycle test and a muscle biopsy performed. The mutation loads were quantified in blood and muscle biopsies and correlated to the clinical......INTRODUCTION: The point mutation of 3243A>G mtDNA is the most frequent cause of mitochondrial diabetes, often presenting as the syndrome maternally inherited diabetes and deafness (MIDD). The mutation may also cause myopathy, ataxia, strokes, ophthalmoplegia, epilepsy, and cardiomyopathy in various...... combinations. Consequently, it is difficult to predict the "phenotypic risk profile" of 3243A>G mutation-positive subjects. The 3243A>G mutation coexists in cells with wild-type mtDNA, a phenomenon called heteroplasmy. The marked variability in mutation loads in different tissues is the main explanation...

  18. Manual muscle testing and hand-held dynamometry in people with inflammatory myopathy: An intra- and interrater reliability and validity study.

    Science.gov (United States)

    Baschung Pfister, Pierrette; de Bruin, Eling D; Sterkele, Iris; Maurer, Britta; de Bie, Rob A; Knols, Ruud H

    2018-01-01

    Manual muscle testing (MMT) and hand-held dynamometry (HHD) are commonly used in people with inflammatory myopathy (IM), but their clinimetric properties have not yet been sufficiently studied. To evaluate the reliability and validity of MMT and HHD, maximum isometric strength was measured in eight muscle groups across three measurement events. To evaluate reliability of HHD, intra-class correlation coefficients (ICC), the standard error of measurements (SEM) and smallest detectable changes (SDC) were calculated. To measure reliability of MMT linear Cohen`s Kappa was computed for single muscle groups and ICC for total score. Additionally, correlations between MMT8 and HHD were evaluated with Spearman Correlation Coefficients. Fifty people with myositis (56±14 years, 76% female) were included in the study. Intra-and interrater reliability of HHD yielded excellent ICCs (0.75-0.97) for all muscle groups, except for interrater reliability of ankle extension (0.61). The corresponding SEMs% ranged from 8 to 28% and the SDCs% from 23 to 65%. MMT8 total score revealed excellent intra-and interrater reliability (ICC>0.9). Intrarater reliability of single muscle groups was substantial for shoulder and hip abduction, elbow and neck flexion, and hip extension (0.64-0.69); moderate for wrist (0.53) and knee extension (0.49) and fair for ankle extension (0.35). Interrater reliability was moderate for neck flexion (0.54) and hip abduction (0.44); fair for shoulder abduction, elbow flexion, wrist and ankle extension (0.20-0.33); and slight for knee extension (0.08). Correlations between the two tests were low for wrist, knee, ankle, and hip extension; moderate for elbow flexion, neck flexion and hip abduction; and good for shoulder abduction. In conclusion, the MMT8 total score is a reliable assessment to consider general muscle weakness in people with myositis but not for single muscle groups. In contrast, our results confirm that HHD can be recommended to evaluate strength of

  19. APPLIED ASPECTS OF SLCO1B1 PHARMACOGENETIC TESTING FOR PREDICTING OF STATIN-INDUCED MYOPATHY AND PERSONALIZATION OF STATINS THERAPY

    Directory of Open Access Journals (Sweden)

    D. A. Sychev

    2015-09-01

    Full Text Available The clinical significance of the SLCO1B1 gene polymorphism (encoding an organic anion transport polipeptide in the development of statin induced myopathy is considered. Possible tactics of statin dose determination on the basis of pharmacogenetic testing is discussed. Indications for the use of this approach in clinical practice that should increase the efficacy and safety of the statin therapy are also considered.

  20. Melanocytes from patients affected by Ullrich congenital muscular dystrophy and Bethlem myopathy have dysfunctional mitochondria that can be rescued with cyclophilin inhibitors

    Directory of Open Access Journals (Sweden)

    Alessandra eZulian

    2014-11-01

    Full Text Available Ullrich congenital muscular dystrophy and Bethlem myopathy are caused by mutations in collagen VI genes, which encode an extracellular matrix protein; yet mitochondria play a major role in disease pathogenesis through a short circuit caused by inappropriate opening of the permeability transition pore, a high conductance channel which causes a shortage in ATP production. We find that melanocytes do not produce collagen VI yet they bind it at the cell surface, suggesting that this protein may play a trophic role and that its absence may cause lesions similar to those seen in skeletal muscle. We show that mitochondria in melanocytes of Ullrich congenital muscular dystrophy and Bethlem myooathy patients display increased size, reduced matrix density and disrupted cristae, findings that suggest a functional impairment. In keeping with this hypothesis, mitochondria (i underwent anomalous depolarization after inhibition of the F-ATP synthase with oligomycin, and (ii displayed decreased respiratory reserve capacity. The non-immunosuppressive cyclophilin inhibitor NIM811 prevented mitochondrial depolarization in response to oligomycin in melanocytes from both Ullrich congenital muscular dystrophy and Bethlem myopathy patients, and partially restored the respiratory reserve of melanocytes from one Bethlem myopathy patient. These results match our recent findings on melanocytes from patients affected by Duchenne muscular dystrophy (Pellegrini et al., 2013 Melanocytes--a novel tool to study mitochondrial dysfunction in Duchenne muscular dystrophy. J Cell Physiol 228, 1323-1331, and suggest that skin biopsies may represent a minimally invasive tool to investigate mitochondrial dysfunction and to evaluate drug efficacy in collagen VI-related myopathies and possibly in other muscle wasting conditions like aging sarcopenia.

  1. Clinical study on myocardial imaging with. beta. -methyl-p-( sup 123 I)-iodophenyl-pentadecanoic acid in patients with mitochondrial myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa (Kagoshima Univ. (Japan). Faculty of Medicine) (and others)

    1992-04-01

    Myocardial imaging with {beta}-methyl-p-({sup 123}I)-iodophenyl-pentadecanoic acid ({sup 123}I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with {sup 201}Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of {sup 123}I-BMIPP compared to {sup 201}Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of {sup 123}I-BMIPP was higher than that of {sup 201}Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of {sup 123}I-BMIPP was lower than that of {sup 201}Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of {sup 123}I-BMIPP, these results suggest that {sup 123}I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)

  2. Desmin myopathy with severe cardiomyopathy in a Uruguayan family due to a codon deletion in a new location within the desmin 1A rod domain.

    Science.gov (United States)

    Vernengo, Luis; Chourbagi, Oussama; Panuncio, Ana; Lilienbaum, Alain; Batonnet-Pichon, Sabrina; Bruston, Francine; Rodrigues-Lima, Fernando; Mesa, Rosario; Pizzarossa, Carlos; Demay, Laurence; Richard, Pascale; Vicart, Patrick; Rodriguez, Maria-Mirta

    2010-03-01

    Desmin myopathy is a heterogeneous neuromuscular disorder characterized by skeletal myopathy and cardiomyopathy, inherited mostly in an autosomal dominant pattern. We report a five generation Uruguayan family with severe cardiomyopathy and skeletal myopathy. Its most striking features are: atrial dilation, arrhythmia, conduction block and sudden death due to conduction impairment. Affected skeletal muscle shows alteration of mitochondria with paracrystallin inclusions and granulofilamentous material scattered in the muscle fibres. This family carries an unusual deletion p.E114del within the 1A rod domain of desmin. Transfected cells expressing the mutated desmin show punctuated and speckled cytoplasmic aggregates. The mutation causes a local conformational change in heptads a/d residues and charge positions. These findings lead to the hypothesis that coiled-coil interactions may be impaired, resulting in severe alterations in the desmin network. This is the first time that a mutation affecting this domain in the desmin molecule is described in a desminopathy. Copyright 2010. Published by Elsevier B.V.

  3. Clinical study on myocardial imaging with β-methyl-p-(123I)-iodophenyl-pentadecanoic acid in patients with mitochondrial myopathy

    International Nuclear Information System (INIS)

    Kihara, Koichi; Nakajo, Masayuki; Shono, Hirohisa

    1992-01-01

    Myocardial imaging with β-methyl-p-( 123 I)-iodophenyl-pentadecanoic acid ( 123 I-BMIPP), a new radiopharmaceutical designed to evaluate myocardial fatty acid metabolism, was performed in 7 patients with mitochondrial myopathy to detect their myocardial damages in comparison with 201 Tl myocardial imaging. These patients were divided into 4 chronic progressive external ophthalmoplegia (CPEO) cases, 2 mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) cases and 1 myoclonus epilepsy with ragged-red fibers (MERRF). In visual assessment, we observed more myocardial segments with decreased uptake of 123 I-BMIPP compared to 201 Tl in MELAS cases than in CPEO cases. The mean myocardial uptake of 123 I-BMIPP was higher than that of 201 Tl in CPEO cases. On the other hand, in MELAS and MERRF cases, the mean myocardial uptake of 123 I-BMIPP was lower than that of 201 Tl. Abnormal findings suggesting myocardial damages were observed in echocardiogram and/or in electrocardiogram in MELAS and MERRF cases, while no such abnormal findings were observed in CPEO cases. Along with the previously reported experimental result that the impairment of rat myocardial mitochondria decreased myocardial uptake of 123 I-BMIPP, these results suggest that 123 I-BMIPP may be useful to detect myocardial damages in patients with mitochondrial myopathy. (author)

  4. Transcriptomic profiling of TK2 deficient human skeletal muscle suggests a role for the p53 signalling pathway and identifies growth and differentiation factor-15 as a potential novel biomarker for mitochondrial myopathies

    Science.gov (United States)

    2014-01-01

    Background Mutations in the gene encoding thymidine kinase 2 (TK2) result in the myopathic form of mitochondrial DNA depletion syndrome which is a mitochondrial encephalomyopathy presenting in children. In order to unveil some of the mechanisms involved in this pathology and to identify potential biomarkers and therapeutic targets we have investigated the gene expression profile of human skeletal muscle deficient for TK2 using cDNA microarrays. Results We have analysed the whole transcriptome of skeletal muscle from patients with TK2 mutations and compared it to normal muscle and to muscle from patients with other mitochondrial myopathies. We have identified a set of over 700 genes which are differentially expressed in TK2 deficient muscle. Bioinformatics analysis reveals important changes in muscle metabolism, in particular, in glucose and glycogen utilisation, and activation of the starvation response which affects aminoacid and lipid metabolism. We have identified those transcriptional regulators which are likely to be responsible for the observed changes in gene expression. Conclusion Our data point towards the tumor suppressor p53 as the regulator at the centre of a network of genes which are responsible for a coordinated response to TK2 mutations which involves inflammation, activation of muscle cell death by apoptosis and induction of growth and differentiation factor 15 (GDF-15) in muscle and serum. We propose that GDF-15 may represent a potential novel biomarker for mitochondrial dysfunction although further studies are required. PMID:24484525

  5. Skeletal muscle metabolism is impaired during exercise in glycogen storage disease type III

    DEFF Research Database (Denmark)

    Preisler, Nicolai; Laforêt, Pascal; Madsen, Karen Lindhardt

    2015-01-01

    /kg/min (p = 0.024). Fructose ingestion improved exercise tolerance in the patients. CONCLUSION: Similar to patients with McArdle disease, in whom muscle glycogenolysis is also impaired, GSDIIIa is associated with a reduced skeletal muscle oxidation of carbohydrates and a compensatory increase in fatty acid......OBJECTIVE: Glycogen storage disease type IIIa (GSDIIIa) is classically regarded as a glycogenosis with fixed weakness, but we hypothesized that exercise intolerance in GSDIIIa is related to muscle energy failure and that oral fructose ingestion could improve exercise tolerance in this metabolic...... myopathy. METHODS: We challenged metabolism with cycle-ergometer exercise and measured substrate turnover and oxidation rates using stable isotope methodology and indirect calorimetry in 3 patients and 6 age-matched controls on 1 day, and examined the effect of fructose ingestion on exercise tolerance...

  6. Fuel assembly storage pool

    International Nuclear Information System (INIS)

    Hiranuma, Hiroshi.

    1976-01-01

    Object: To remove limitation of the number of storage of fuel assemblies to increase the number of storage thereof so as to relatively reduce the water depth required for shielding radioactive rays. Structure: Fuel assembly storage rack containers for receiving a plurality of spent fuel assembly racks are stacked in multi-layer fashion within a storage pool filled with water for shielding radioactive rays and removing heat. (Furukawa, Y.)

  7. Heat transport and storage

    International Nuclear Information System (INIS)

    Despois, J.

    1977-01-01

    Recalling the close connections existing between heat transport and storage, some general considerations on the problem of heat distribution and transport are presented 'in order to set out the problem' of storage in concrete form. This problem is considered in its overall plane, then studied under the angle of the different technical choices it involves. The two alternatives currently in consideration are described i.e.: storage in a mined cavity and underground storage as captive sheet [fr

  8. Storage in Europe

    International Nuclear Information System (INIS)

    Cabanes, J.M.; Rottenberg, J.; Abiad, A.; Caudron, S.; Girault, Ph.

    2007-01-01

    Storage represents one of the key elements among the different modulation tools. How the problem of storage is put forward in Europe in front of the increasing uncertainty of the gas demand and prices? What are the policies implemented by storage facility operators? To what extend storage can amortize gas prices volatility or allow the market actors to take the best profit of this volatility? These are the questions debated at this workshop by four specialists of this domain. (J.S.)

  9. Effects of coenzyme Q10 on statin-induced myopathy: a meta-analysis of randomized controlled trials.

    Science.gov (United States)

    Banach, Maciej; Serban, Corina; Sahebkar, Amirhossein; Ursoniu, Sorin; Rysz, Jacek; Muntner, Paul; Toth, Peter P; Jones, Steven R; Rizzo, Manfredi; Glasser, Stephen P; Lip, Gregory Y H; Dragan, Simona; Mikhailidis, Dimitri P

    2015-01-01

    To evaluate the efficacy of coenzyme Q10 (CoQ10) supplementation on statin-induced myopathy. We searched the MEDLINE, Cochrane Library, Scopus, and EMBASE databases (November 1, 1987, to May 1, 2014) to identify randomized controlled trials investigating the impact of CoQ10 on muscle pain and plasma creatine kinase (CK) activity as 2 measures of statin-induced myalgia. Two independent reviewers extracted data on study characteristics, methods, and outcomes. We included 6 studies with 302 patients receiving statin therapy: 5 studies with 226 participants evaluated the effect of CoQ10 supplementation on plasma CK activity, and 5 studies (4 used in the CK analysis and 1 other study) with 253 participants were included to assess the effect of CoQ10 supplementation on muscle pain. Compared with the control group, plasma CK activity was increased after CoQ10 supplementation, but this change was not significant (mean difference, 11.69 U/L [to convert to μkat/L, multiply by 0.0167]; 95% CI, -14.25 to 37.63 U/L; P=.38). Likewise, CoQ10 supplementation had no significant effect on muscle pain despite a trend toward a decrease (standardized mean difference, -0.53; 95% CI, -1.33 to 0.28; P=.20). No dose-effect association between changes in plasma CK activity (slope, -0.001; 95% CI, -0.004 to 0.001; P=.33) or in the indices of muscle pain (slope, 0.002; 95% CI, -0.005 to 0.010; P=.67) and administered doses of CoQ10 were observed. The results of this meta-analysis of available randomized controlled trials do not suggest any significant benefit of CoQ10 supplementation in improving statin-induced myopathy. Larger, well-designed trials are necessary to confirm the findings from this meta-analysis. Copyright © 2015 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  10. Pit Water Storage Ottrupgaard

    DEFF Research Database (Denmark)

    Heller, Alfred

    2000-01-01

    The pit water storage, a seasonal thermal storage, was built in 1993 with floating lid and hybrid clay-polymer for pit lining. The storage was leaking severe and solutions were to be found. In the paper solutions for pit lining and floating lids are discussed, cost estimations given and coming...

  11. Wind turbine storage systems

    International Nuclear Information System (INIS)

    Ibrahim, H.; Ilinca, A.; Perron, J.

    2005-01-01

    Electric power is often produced in locations far from the point of utilization which creates a challenge in stabilizing power grids, particularly since electricity cannot be stored. The production of decentralized electricity by renewable energy sources offers a greater security of supply while protecting the environment. Wind power holds the greatest promise in terms of environmental protection, competitiveness and possible applications. It is known that wind energy production is not always in phase with power needs because of the uncertainty of wind. For that reason, energy storage is the key for the widespread integration of wind energy into the power grids. This paper proposed various energy storage methods that can be used in combination with decentralized wind energy production where an imbalance exists between electricity production and consumption. Energy storage can play an essential role in bringing value to wind energy, particularly if electricity is to be delivered during peak hours. Various types of energy storage are already in use or are being developed. This paper identified the main characteristics of various electricity storage techniques and their applications. They include stationary or embarked storage for long or short term applications. A comparison of characteristics made it possible to determine which types of electricity storage are best suited for wind energy. These include gravity energy; thermal energy; compressed air energy; coupled storage with natural gas; coupled storage with liquefied gas; hydrogen storage for fuel cells; chemical energy storage; storage in REDOX batteries; storage by superconductive inductance; storage in supercondensers; and, storage as kinetic energy. 21 refs., 21 figs

  12. Fuel storage tank

    International Nuclear Information System (INIS)

    Peehs, M.; Stehle, H.; Weidinger, H.

    1979-01-01

    The stationary fuel storage tank is immersed below the water level in the spent fuel storage pool. In it there is placed a fuel assembly within a cage. Moreover, the storage tank has got a water filling and a gas buffer. The water in the storage tank is connected with the pool water by means of a filter, a surge tank and a water purification facility, temperature and pressure monitoring being performed. In the buffer compartment there are arranged catalysts a glow plugs for recombination of radiolysis products into water. The supply of water into the storage tank is performed through the gas buffer compartment. (DG) [de

  13. Myopathy in very-long-chain acyl-CoA dehydrogenase deficiency

    DEFF Research Database (Denmark)

    Scholte, H R; Van Coster, R N; de Jonge, P C

    1999-01-01

    was deficient in muscle and fibroblasts, consistent with deficiency of very-long-chain acyl-CoA dehydrogenase (VLCAD). The gene of this enzyme had a homozygous deletion of three base pairs in exon 9, skipping lysine residue 238. Fibroblasts oxidised myristate, palmitate and oleate at a rate of 129, 62 and 38......A 30-year-old man suffered since the age of 13 years from exercise induced episodes of intense generalised muscle pain, weakness and myoglobinuria. Fasting ketogenesis was low, while blood glucose remained normal. Muscle mitochondria failed to oxidise palmitoylcarnitine. Palmitoyl-CoA dehydrogenase......% of controls. In contrast to patients with cardiac VLCAD deficiency, our patient had no lipid storage, a normal heart function, a higher rate of oleate oxidation in fibroblasts and normal free carnitine in plasma and fibroblasts. 31P-nuclear magnetic resonance spectroscopy of muscle showed a normal oxidative...

  14. Assessing storage adequacy

    International Nuclear Information System (INIS)

    Amirault, P.

    2004-01-01

    Government policy encourages the use of natural gas. It is expected that liquefied natural gas (LNG) and Arctic gas will make up 20 to 25 per cent of supply. This presentation provided an outlook of storage value based on a technical analysis by the National Petroleum Counsel (NPC) report. A moderately robust growth is expected in the residential and commercial load which may be partially offset by robust growth in electricity. The net result is an increase in storage requirements. It was concluded that there is a strong case for growth in storage demand but a lack of good sites for additional capacity. This will lead to higher storage values. The NPC sees the need for 1 Tcf more storage use by 2025, of which 700 Bcf will need to come from new storage. In particular, current storage levels may not be sufficient to meet a colder than normal winter, and deliverability is affected by field inventory. Most storage capacity was built before 1985, mostly by regulated entities. It is expected that only 250 to 400 Bcf will be added over the next 25 years in North America. If storage becomes scarce, prices will move to the marginal cost of new additions, and the upper limit on price will be determined by salt cavern storage. An increase of $1.00 in the price of leasing storage would add about $0.11 to the average price of consumed gas. tabs., figs

  15. Spent fuel storage rack

    International Nuclear Information System (INIS)

    Morikawa, Matsuo; Uchiyama, Yuichi.

    1983-01-01

    Purpose: To improve the safety and facilitate the design by limiting the relative displacement in a storage rack. Constitution: The outer wall of a storage rack disposed in water within a fuel pool, the pool wall opposing to the storage rack and the structure between the opposing storages racks are made as a space for confining the pool water or a structure formed with a slight gap, for example, a combination of a recessed structure and a protruded structure. In such a constitution, a space for confirming the pool water is established and the pool water thus confined forms a flow resistance when the storage rack vibrates upon earthquakes, serves as a damper and significantly reduces the responsivity. Furthermore, the relative displacement in the storage rack is limited to inhibit excess earthquake forces to exert on setting bolts and rack clamping bolts of the storage rack. (Sekiya, K.)

  16. GRACE storage-runoff hystereses reveal the dynamics of ...

    Science.gov (United States)

    Watersheds function as integrated systems where climate and geology govern the movement of water. In situ instrumentation can provide local-scale insights into the non-linear relationship between streamflow and water stored in a watershed as snow, soil moisture, and groundwater. However, there is a poor understanding of these processes at the regional scale—primarily because of our inability to measure water stores and fluxes in the subsurface. Now NASA’s Gravity Recovery and Climate Experiment (GRACE) satellites quantify changes in the amount of water stored across and through the Earth, providing measurements of regional hydrologic behavior. Here we apply GRACE data to characterize for the first time how regional watersheds function as simple, dynamic systems through a series of hysteresis loops. While the physical processes underlying the loops are inherently complex, the vertical integration of terrestrial water in the GRACE signal provides process-based insights into the dynamic and non-linear function of regional-scale watersheds. We use this process-based understanding with GRACE data to effectively forecast seasonal runoff (mean R2 of 0.91) and monthly runoff (mean R2 of 0.77) in three regional-scale watersheds (>150,000 km2) of the Columbia River Basin, USA. Data from the Gravity Recovery and Climate Experiment (GRACE) satellites provide a novel dataset for understanding changes in the amount of water stored across and through the surface of the Ear

  17. A defect in the thymidine kinase 2 gene causing isolated mitochondrial myopathy without mtDNA depletion.

    Science.gov (United States)

    Leshinsky-Silver, E; Michelson, M; Cohen, S; Ginsberg, M; Sadeh, M; Barash, V; Lerman-Sagie, T; Lev, D

    2008-07-01

    Isolated mitochondrial myopathies (IMM) are either due to primary defects in mtDNA, in nuclear genes that control mtDNA abundance and structure such as thymidine kinase 2 (TK2), or due to CoQ deficiency. Defects in the TK2 gene have been found to be associated with mtDNA depletion attributed to a depleted mitochondrial dNTP pool in non-dividing cells. We report an unusual case of IMM, homozygous for the H90N mutation in the TK2 gene but unlike other cases with the same mutation, does not demonstrate mtDNA depletion. The patient's clinical course is relatively mild and a muscle biopsy showed ragged red muscle fibers with a mild decrease in complexes I and an increase in complexes IV and II activities. This report extends the phenotypic expression of TK2 defects and suggests that all patients who present with an IMM even with normal quantities of mtDNA should be screened for TK2 mutations.

  18. Effect of Adalimumab on Refractory Arthritis in Juvenile Idiopathic Inflammatory Myopathy with Anti-MDA5 Autoantibody

    Directory of Open Access Journals (Sweden)

    Takako Miyamae

    2018-01-01

    Full Text Available A 10-year-old girl manifested persistent fever, skin rash, leg pain, fatigue, and joint pain. Based on muscle weakness, elevated muscle-derived enzymes, magnetic resonance imaging, and skin biopsy results, the diagnosis was juvenile idiopathic inflammatory myopathies (JIIM. Chest CT was normal; the anti-melanoma differentiation-associated protein-5 (anti-MDA5 autoantibody was positive. Initial manifestations subsided after prednisolone (PSL and methotrexate treatment. After the PSL dosage was decreased, the patient presented with metacarpophalangeal (MCP joint pain and swelling in both index fingers, synovial fluid, and signals on power Doppler ultrasound. The arthritis was refractory to cyclosporine and tacrolimus. Radiography showed progressive MCP joint space narrowing and joint erosion. Adalimumab was initiated 14 months after disease onset. There was a mildly increased matrix metalloproteinase-3 (MMP3 level, an erythrocyte sedimentation ratio (ESR, and a normal CRP level. Adalimumab resulted in decreased MCP joint pain and swelling. PSL was discontinued 10 months after adalimumab initiation; after 9 more months of adalimumab, there were no significant ultrasonography findings. MMP3 and ESR levels normalized during treatment. Radiography after 2 years of adalimumab showed further progressive MCP joint space narrowing restricting dorsiflexion. This report clarified that anti-MDA5-positive JIIM joint manifestations were due to active synovitis and that adalimumab is required for severe cases. Further experience is needed to determine the pathology, severity, and prognosis of this type of arthritis.

  19. Mutation Spectrum in the Large GTPase Dynamin 2, and Genotype–Phenotype Correlation in Autosomal Dominant Centronuclear Myopathy

    Science.gov (United States)

    Böhm, Johann; Biancalana, Valérie; DeChene, Elizabeth T.; Bitoun, Marc; Pierson, Christopher R.; Schaefer, Elise; Karasoy, Hatice; Dempsey, Melissa A.; Klein, Fabrice; Dondaine, Nicolas; Kretz, Christine; Haumesser, Nicolas; Poirson, Claire; Toussaint, Anne; Greenleaf, Rebecca S.; Barger, Melissa A.; Mahoney, Lane J.; Kang, Peter B.; Zanoteli, Edmar; Vissing, John; Witting, Nanna; Echaniz-Laguna, Andoni; Wallgren-Pettersson, Carina; Dowling, James; Merlini, Luciano; Oldfors, Anders; Ousager, Lilian Bomme; Melki, Judith; Krause, Amanda; Jern, Christina; Oliveira, Acary S. B.; Petit, Florence; Jacquette, Aurélia; Chaussenot, Annabelle; Mowat, David; Leheup, Bruno; Cristofano, Michele; Aldea, Juan José Poza; Michel, Fabrice; Furby, Alain; Llona, Jose E. Barcena; Van Coster, Rudy; Bertini, Enrico; Urtizberea, Jon Andoni; Drouin-Garraud, Valérie; Béroud, Christophe; Prudhon, Bernard; Bedford, Melanie; Mathews, Katherine; Erby, Lori A. H.; Smith, Stephen A.; Roggenbuck, Jennifer; Crowe, Carol A.; Spitale, Allison Brennan; Johal, Sheila C.; Amato, Anthony A.; Demmer, Laurie A.; Jonas, Jessica; Darras, Basil T.; Bird, Thomas D.; Laurino, Mercy; Welt, Selman I.; Trotter, Cynthia; Guicheney, Pascale; Das, Soma; Mandel, Jean-Louis; Beggs, Alan H.; Laporte, Jocelyn

    2012-01-01

    Centronuclear myopathy (CNM) is a genetically heterogeneous disorder associated with general skeletal muscle weakness, type I fiber predominance and atrophy, and abnormally centralized nuclei. Autosomal dominant CNM is due to mutations in the large GTPase dynamin 2 (DNM2), a mechanochemical enzyme regulating cytoskeleton and membrane trafficking in cells. To date, 40 families with CNM-related DNM2 mutations have been described, and here we report 60 additional families encompassing a broad genotypic and phenotypic spectrum. In total, 18 different mutations are reported in 100 families and our cohort harbors nine known and four new mutations, including the first splice-site mutation. Genotype–phenotype correlation hypotheses are drawn from the published and new data, and allow an efficient screening strategy for molecular diagnosis. In addition to CNM, dissimilar DNM2 mutations are associated with Charcot–Marie–Tooth (CMT) peripheral neuropathy (CMTD1B and CMT2M), suggesting a tissue-specific impact of the mutations. In this study, we discuss the possible clinical overlap of CNM and CMT, and the biological significance of the respective mutations based on the known functions of dynamin 2 and its protein structure. Defects in membrane trafficking due to DNM2 mutations potentially represent a common pathological mechanism in CNM and CMT. PMID:22396310

  20. Mild myopathy is associated with COMP but not MATN3 mutations in mouse models of genetic skeletal diseases.

    Directory of Open Access Journals (Sweden)

    Katarzyna A Piróg

    Full Text Available Pseudoachondroplasia (PSACH and multiple epiphyseal dysplasia (MED are skeletal disorders resulting from mutations in COMP, matrilin-3 or collagen IX and are characterised by short-limbed dwarfism and premature osteoarthritis. Interestingly, recent reports suggest patients can also manifest with muscle weakness. Here we present a detailed analysis of two mouse models of the PSACH/MED disease spectrum; ΔD469 T3-COMP (PSACH and V194D matrilin-3 (MED. In grip test experiments T3-COMP mice were weaker than wild-type littermates, whereas V194D mice behaved as controls, confirming that short-limbed dwarfism alone does not contribute to PSACH/MED-related muscle weakness. Muscles from T3-COMP mice showed an increase in centronuclear fibers at the myotendinous junction. T3-COMP tendons became more lax in cyclic testing and showed thicker collagen fibers when compared with wild-type tissue; matrilin-3 mutant tissues were indistinguishable from controls. This comprehensive study of the myopathy associated with PSACH/MED mutations enables a better understanding of the disease progression, confirms that it is genotype specific and that the limb weakness originates from muscle and tendon pathology rather than short-limbed dwarfism itself. Since some patients are primarily diagnosed with neuromuscular symptoms, this study will facilitate better awareness of the differential diagnoses that might be associated with the PSACH/MED spectrum and subsequent care of PSACH/MED patients.

  1. Diffusion and Perfusion Characteristics of MELAS (Mitochondrial Myopathy, Encephalopathy, Lactic Acidosis, and Stroke-Like Episode) in Thirteen Patients

    International Nuclear Information System (INIS)

    Kim, Ji Hye; Jeon, Tae Yeon; Eo, Hong; Yoo, So Young; Lim, Myung Kwan; Rha, Jung Ho; Shu, Chang Hae

    2011-01-01

    We analyzed the diffusion and perfusion characteristics of acute MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episode) lesions in a large series to investigate the controversial changes of the apparent diffusion coefficient (ADC) that were reported in prior studies. We analyzed 44 newly appearing lesions during 28 stroke-like episodes in 13 patients with MELAS. We performed a visual assessment of the MR images including the ADC and perfusion maps, comparison of the ADC between the normal and abnormal areas, comparison of % ADC between the 44 MELAS lesions and the 30 acute ischemic infarcts. In addition, the patterns of evolution on follow-up MR images were analyzed. Decreased, increased, and normal ADCs were noted in 16 (36%), 16 (36%), and 12 (27%) lesions, respectively. The mean % ADC was 102 ± 40.9% in the MELAS and 64 ± 17.8% in the acute vascular infarcts (p < 0.001), while perfusion imaging demonstrated hyper-perfusion in six acute MELAS lesions. On follow-up images, resolution, progression, and tissue loss were noted in 10, 4, and 17 lesions, respectively. The cytotoxic edema gradually evolves following an acute stroke-like episode in patients with MELAS, and this may overlap with hyper-perfusion and vasogenic edema. The edematous swelling may be reversible or it may evolve to encephalomalacia, suggesting irreversible damage

  2. Diffusion and Perfusion Characteristics of MELAS (Mitochondrial Myopathy, Encephalopathy, Lactic Acidosis, and Stroke-Like Episode) in Thirteen Patients

    Science.gov (United States)

    Kim, Ji Hye; Jeon, Tae Yeon; Rha, Jung Ho; Eo, Hong; Yoo, So-Young; Shu, Chang Hae

    2011-01-01

    Objective We analyzed the diffusion and perfusion characteristics of acute MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episode) lesions in a large series to investigate the controversial changes of the apparent diffusion coefficient (ADC) that were reported in prior studies. Materials and Methods We analyzed 44 newly appearing lesions during 28 stroke-like episodes in 13 patients with MELAS. We performed a visual assessment of the MR images including the ADC and perfusion maps, comparison of the ADC between the normal and abnormal areas, comparison of % ADC between the 44 MELAS lesions and the 30 acute ischemic infarcts. In addition, the patterns of evolution on follow-up MR images were analyzed. Results Decreased, increased, and normal ADCs were noted in 16 (36%), 16 (36%), and 12 (27%) lesions, respectively. The mean % ADC was 102 ± 40.9% in the MELAS and 64 ± 17.8% in the acute vascular infarcts (p MELAS lesions. On follow-up images, resolution, progression, and tissue loss were noted in 10, 4, and 17 lesions, respectively. Conclusion The cytotoxic edema gradually evolves following an acute stroke-like episode in patients with MELAS, and this may overlap with hyper-perfusion and vasogenic edema. The edematous swelling may be reversible or it may evolve to encephalomalacia, suggesting irreversible damage. PMID:21228936

  3. Enzyme replacement therapy rescues weakness and improves muscle pathology in mice with X-linked myotubular myopathy.

    Science.gov (United States)

    Lawlor, Michael W; Armstrong, Dustin; Viola, Marissa G; Widrick, Jeffrey J; Meng, Hui; Grange, Robert W; Childers, Martin K; Hsu, Cynthia P; O'Callaghan, Michael; Pierson, Christopher R; Buj-Bello, Anna; Beggs, Alan H

    2013-04-15

    No effective treatment exists for patients with X-linked myotubular myopathy (XLMTM), a fatal congenital muscle disease caused by deficiency of the lipid phosphatase, myotubularin. The Mtm1δ4 and Mtm1 p.R69C mice model severely and moderately symptomatic XLMTM, respectively, due to differences in the degree of myotubularin deficiency. Contractile function of intact extensor digitorum longus (EDL) and soleus muscles from Mtm1δ4 mice, which produce no myotubularin, is markedly impaired. Contractile forces generated by chemically skinned single fiber preparations from Mtm1δ4 muscle were largely preserved, indicating that weakness was largely due to impaired excitation contraction coupling. Mtm1 p.R69C mice, which produce small amounts of myotubularin, showed impaired contractile function only in EDL muscles. Short-term replacement of myotubularin with a prototypical targeted protein replacement agent (3E10Fv-MTM1) in Mtm1δ4 mice improved contractile function and muscle pathology. These promising findings suggest that even low levels of myotubularin protein replacement can improve the muscle weakness and reverse the pathology that characterizes XLMTM.

  4. Muscle MRI in neutral lipid storage disease (NLSD).

    Science.gov (United States)

    Garibaldi, Matteo; Tasca, Giorgio; Diaz-Manera, Jordi; Ottaviani, Pierfancesco; Laschena, Francesco; Pantoli, Donatella; Gerevini, Simonetta; Fiorillo, Chiara; Maggi, Lorenzo; Tasca, Elisabetta; D'Amico, Adele; Musumeci, Olimpia; Toscano, Antonio; Bruno, Claudio; Massa, Roberto; Angelini, Corrado; Bertini, Enrico; Antonini, Giovanni; Pennisi, Elena Maria

    2017-07-01

    Neutral lipid storage disease (NLSD) is a rare inherited disorder of lipid metabolism resulting in lipid droplets accumulation in different tissues. Skeletal muscle could be affected in both two different form of disease: NLSD with myopathy (NLSD-M) and NLSD with ichthyosis (NLSD-I). We present the muscle imaging data of 12 patients from the Italian Network for NLSD: ten patients presenting NLSD-M and two patients with NLSD-I. In NLSD-M gluteus minimus, semimembranosus, soleus and gastrocnemius medialis in the lower limbs and infraspinatus in the upper limbs were the most affected muscles. Gracilis, sartorius, subscapularis, pectoralis, triceps brachii and sternocleidomastoid were spared. Muscle involvement was not homogenous and characteristic "patchy" replacement was observed in at least one muscle in all the patients. Half of the patients showed one or more STIR positive muscles. In both NLSD-I cases muscle involvement was not observed by T1-TSE sequences, but one of them showed positive STIR images in more than one muscle in the leg. Our data provides evidence that muscle imaging can identify characteristic alterations in NLSD-M, characterized by a specific pattern of muscle involvement with "patchy" areas of fatty replacement. Larger cohorts are needed to assess if a distinct pattern of muscle involvement exists also for NLSD-I.

  5. PC-Cluster based Storage System Architecture for Cloud Storage

    OpenAIRE

    Yee, Tin Tin; Naing, Thinn Thu

    2011-01-01

    Design and architecture of cloud storage system plays a vital role in cloud computing infrastructure in order to improve the storage capacity as well as cost effectiveness. Usually cloud storage system provides users to efficient storage space with elasticity feature. One of the challenges of cloud storage system is difficult to balance the providing huge elastic capacity of storage and investment of expensive cost for it. In order to solve this issue in the cloud storage infrastructure, low ...

  6. Large mass storage facility

    International Nuclear Information System (INIS)

    Peskin, A.M.

    1978-01-01

    The report of a committee to study the questions surrounding possible acquisition of a large mass-storage device is presented. The current computing environment at BNL and justification for an online large mass storage device are briefly discussed. Possible devices to meet the requirements of large mass storage are surveyed, including future devices. The future computing needs of BNL are prognosticated. 2 figures, 4 tables

  7. Burnup credit in a dry storage module

    International Nuclear Information System (INIS)

    Thornton, J.R.

    1989-01-01

    Comparison of spent fuel storage expansion options available to Oconee Nuclear Station revealed that dry storage could be economically competitive with transshipment and rod consolidation. Economic competitiveness, however, mandated large unit capacity while existing cask handling facilities at Oconee severely limited size and weight. The dry storage concept determined to best satisfy these conflicting criteria is a 24 pressurized water reactor (PWR) fuel assembly capacity NUTECH Horizontal Modular Storage (NUHOMS) system. The Oconee version of the NUHOMS system takes advantage of burnup credit in demonstrating criticality safety. The burnup credit criticality analysis was performed by Duke Power Company's Design Engineering Department. This paper was prepared to summarize the criticality control design features employed in the Oconee NUHOMS-24P DSC basket and to describe the incentives for pursuing a burnup credit design. Principal criticality design parameters, criteria, and analysis methodology are also presented

  8. Benchmarking Cloud Storage Systems

    OpenAIRE

    Wang, Xing

    2014-01-01

    With the rise of cloud computing, many cloud storage systems like Dropbox, Google Drive and Mega have been built to provide decentralized and reliable file storage. It is thus of prime importance to know their features, performance, and the best way to make use of them. In this context, we introduce BenchCloud, a tool designed as part of this thesis to conveniently and efficiently benchmark any cloud storage system. First, we provide a study of six commonly-used cloud storage systems to ident...

  9. Anti-HMGCR antibodies as a biomarker for immune-mediated necrotizing myopathies: A history of statins and experience from a large international multi-center study.

    Science.gov (United States)

    Musset, Lucile; Allenbach, Yves; Benveniste, Olivier; Boyer, Olivier; Bossuyt, Xavier; Bentow, Chelsea; Phillips, Joe; Mammen, Andrew; Van Damme, Philip; Westhovens, René; Ghirardello, Anna; Doria, Andrea; Choi, May Y; Fritzler, Marvin J; Schmeling, Heinrike; Muro, Yoshinao; García-De La Torre, Ignacio; Ortiz-Villalvazo, Miguel A; Bizzaro, Nicola; Infantino, Maria; Imbastaro, Tiziana; Peng, Qinglin; Wang, Guochun; Vencovský, Jiří; Klein, Martin; Krystufkova, Olga; Franceschini, Franco; Fredi, Micaela; Hue, Sophie; Belmondo, Thibaut; Danko, Katalin; Mahler, Michael

    2016-10-01

    In an effort to find naturally occurring substances that reduce cholesterol by inhibiting 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGCR), statins were first discovered by Endo in 1972. With the widespread prescription and use of statins to decrease morbidity from myocardial infarction and stroke, it was noted that approximately 5% of all statin users experienced muscle pain and weakness during treatment. In a smaller proportion of patients, the myopathy progressed to severe morbidity marked by proximal weakness and severe muscle wasting. Remarkably, Mammen and colleagues were the first to discover that the molecular target of statins, 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR), is an autoantibody target in patients that develop an immune-mediated necrotizing myopathy (IMNM). These observations have been confirmed in a number of studies but, until today, a multi-center, international study of IMNM, related idiopathic inflammatory myopathies (IIM), other auto-inflammatory conditions and controls has not been published. Accordingly, an international, multi-center study investigated the utility of anti-HMGCR antibodies in the diagnosis of statin-associated IMNM in comparison to different forms of IIM and controls. This study included samples from patients with different forms of IIM (n=1250) and patients with other diseases (n=656) that were collected from twelve sites and tested for anti-HMGCR antibodies by ELISA. This study confirmed that anti-HMGCR autoantibodies, when found in conjunction with statin use, characterize a subset of IIM who are older and have necrosis on muscle biopsy. Taken together, the data to date indicates that testing for anti-HMGCR antibodies is important in the differential diagnosis of IIM and might be considered for future classification criteria. Copyright © 2016. Published by Elsevier B.V.

  10. A new storage-ring light source

    Energy Technology Data Exchange (ETDEWEB)

    Chao, Alex [SLAC National Accelerator Lab., Menlo Park, CA (United States)

    2015-06-01

    A recently proposed technique in storage ring accelerators is applied to provide potential high-power sources of photon radiation. The technique is based on the steady-state microbunching (SSMB) mechanism. As examples of this application, one may consider a high-power DUV photon source for research in atomic and molecular physics or a high-power EUV radiation source for industrial lithography. A less challenging proof-of-principle test to produce IR radiation using an existing storage ring is also considered.

  11. Water Storage: Quo Vadis?

    Science.gov (United States)

    Smakhtin, V.

    2017-12-01

    Humans stored water - in various forms - for ages, coping with water resources variability, and its extremes - floods and droughts. Storage per capita, and other storage-related indicators, have essentially become one way of reflecting the progress of economic development. Massive investments went into large surface water reservoirs that have become the characteristic feature of the earth's landscapes, bringing both benefits and controversy. As water variability progressively increases with changing climate, globally, on one hand, and the idea of sustainable development receives strong traction, on another - it may be worth the while to comprehensively examine current trends and future prospects for water storage development. The task is surely big, to say the least. The presentation will aim to initiate a structured discussion on this multi-facet issue and identify which aspects and trends of water storage development may be most important in the context of Sustainable Development Goals, Sendai Framework for Disaster Risk Reduction, Paris Agreement on Climate Change, and examine how, where and to what extent water storage planning can be improved. It will cover questions like i) aging of large water storage infrastructure, the current extent of this trend in various geographical regions, and possible impacts on water security and security of nations; ii) improved water storage development planning overall in the context of various water development alternatives and storage options themselves and well as their combinations iii) prospects for another "storage revolution" - speed increase in dam numbers, and where, if at all this is most likely iv) recent events in storage development, e.g. is dam decommissioning a trend that picks pace, or whether some developing economies in Asia can do without going through the period of water storage construction, with alternatives, or suggestions for alleviation of negative impacts v) the role of subsurface storage as an

  12. Myopathy associated with pigmentary degeneration of the retina and high protein content of cerebrospinal fluid Miopatia associada a degeneração pigmentar da retina e hiperproteinorraquia

    Directory of Open Access Journals (Sweden)

    José Antonio Levy

    1974-06-01

    Full Text Available The cases of two brothers suffering from a myopathy associated with pigmentary degeneration of the retina and increase of protein content of the cerebrospinal fluid are reported.Foram estudados dois pacientes, filhos de pais não consanguíneos, com quadro miopático, iniciado na segunda década da vida, com predomínio na musculatura das cinturas e da face. Em ambos os casos havia degeneração pigmentar da retina e aumento da taxa protéica no líquido cefalorraqueano.

  13. Selective muscle fiber loss and molecular compensation in mitochondrial myopathy due to TK2 deficiency.

    Science.gov (United States)

    Vilà, Maya R; Villarroya, Joan; García-Arumí, Elena; Castellote, Amparo; Meseguer, Anna; Hirano, Michio; Roig, Manuel

    2008-04-15

    A 12-year-old patient with mitochondrial DNA (mtDNA) depletion syndrome due to TK2 gene mutations has been evaluated serially over the last 10 years. We observed progressive muscle atrophy with selective loss of type 2 muscle fibers and, despite severe depletion of mtDNA, normal activities of respiratory chain (RC) complexes and levels of COX II mitochondrial protein in the remaining muscle fibers. These results indicate that compensatory mechanisms account for the slow progression of the disease. Identification of factors that ameliorate mtDNA depletion may reveal new therapeutic targets for these devastating disorders.

  14. Detection of differentially expressed genes in broiler pectoralis major muscle affected by White Striping - Wooden Breast myopathies.

    Science.gov (United States)

    Zambonelli, Paolo; Zappaterra, Martina; Soglia, Francesca; Petracci, Massimiliano; Sirri, Federico; Cavani, Claudio; Davoli, Roberta

    2016-12-01

    White Striping and Wooden Breast (WS/WB) are abnormalities increasingly occurring in the fillets of high breast yield and growth rate chicken hybrids. These defects lead to consistent economic losses for poultry meat industry, as affected broiler fillets present an impaired visual appearance that negatively affects consumers' acceptability. Previous studies have highlighted in affected fillets a severely damaged muscle, showing profound inflammation, fibrosis, and lipidosis. The present study investigated the differentially expressed genes and pathways linked to the compositional changes observed in WS/WB breast muscles, in order to outline a more complete framework of the gene networks related to the occurrence of this complex pathological picture. The biochemical composition was performed on 20 pectoralis major samples obtained from high breast yield and growth rate broilers (10 affected vs. 10 normal) and 12 out of the 20 samples were used for the microarray gene expression profiling (6 affected vs. 6 normal). The obtained results indicate strong changes in muscle mineral composition, coupled to an increased deposition of fat. In addition, 204 differentially expressed genes (DEG) were found: 102 up-regulated and 102 down-regulated in affected breasts. The gene expression pathways found more altered in WS/WB muscles are those related to muscle development, polysaccharide metabolic processes, proteoglycans synthesis, inflammation, and calcium signaling pathway. On the whole, the findings suggest that a multifactorial and complex etiology is associated with the occurrence of WS/WB muscle abnormalities, contributing to further defining the transcription patterns associated with these myopathies. © 2016 Poultry Science Association Inc.

  15. Mild functional differences of dynamin 2 mutations associated to centronuclear myopathy and Charcot-Marie Tooth peripheral neuropathy.

    Directory of Open Access Journals (Sweden)

    Olga S Koutsopoulos

    Full Text Available The large GTPase dynamin 2 is a key player in membrane and cytoskeletal dynamics mutated in centronuclear myopathy (CNM and Charcot-Marie Tooth (CMT neuropathy, two discrete dominant neuromuscular disorders affecting skeletal muscle and peripheral nerves respectively. The molecular basis for the tissue-specific phenotypes observed and the physiopathological mechanisms linked to dynamin 2 mutations are not well established. In this study, we have analyzed the impact of CNM and CMT implicated dynamin 2 mutants using ectopic expression of four CNM and two CMT mutations, and patient fibroblasts harboring two dynamin 2 CNM mutations in established cellular processes of dynamin 2 action. Wild type and CMT mutants were seen in association with microtubules whereas CNM mutants lacked microtubules association and did not disrupt interphase microtubules dynamics. Most dynamin 2 mutants partially decreased clathrin-mediated endocytosis when ectopically expressed in cultured cells; however, experiments in patient fibroblasts suggested that endocytosis is overall not defective. Furthermore, CNM mutants were seen in association with enlarged clathrin stained structures whereas the CMT mutant constructs were associated with clathrin structures that appeared clustered, similar to the structures observed in Dnm1 and Dnm2 double knock-out cells. Other roles of dynamin 2 including its interaction with BIN1 (amphiphysin 2, and its function in Golgi maintenance and centrosome cohesion were not significantly altered. Taken together, these mild functional defects are suggestive of differences between CMT and CNM disease-causing dynamin 2 mutants and suggest that a slight impairment in clathrin-mediated pathways may accumulate over time to foster the respective human diseases.

  16. Hypoglycin A Concentrations in Maple Tree Species in the Netherlands and the Occurrence of Atypical Myopathy in Horses.

    Science.gov (United States)

    Westermann, C M; van Leeuwen, R; van Raamsdonk, L W D; Mol, H G J

    2016-05-01

    Atypical myopathy (AM) in horses is caused by the plant toxin hypoglycin A, which in Europe typically is found in the sycamore maple tree (Acer pseudoplatanus). Owners are concerned about whether their horses are in danger if they graze near maple trees. To measure hypoglycin A in the most common maple tree species in the Netherlands, and to determine whether concentration of toxin is a predictor of AM in horses. A total of 278 samples of maple tree leaves, sprouts, and seeds were classified by species. Mean concentrations of hypoglycin A were compared for the type of sample, the season and the occurrence of AM in the pasture (non-AM versus AM). Statistical analysis was performed using generalized a linear model (SPPS22). Almost all Acer pseudoplatanus samples contained hypoglycin A, with concentrations differing significantly among sources (P < .001). Concentrations were significantly higher in seeds from the AM group than in seeds from the non-AM group (856 ± 677 and 456 ± 358 mg/kg, respectively; P = .039). In sprouts and leaves this was not the case. Acer platanoides and Acer campestre samples did not contain detectable concentrations of hypoglycin A. Acer platanoides and campestre seem to be safe around paddocks and pastures, whereas almost all Acer pseudoplatanus samples contained hypoglycin A. In all AM cases, Acer pseudoplatanus was found. Despite significantly higher concentration of hypoglycin A in seeds of pastures where AM has occurred, individual prediction of AM cannot be made by measuring these concentrations because of the high standard deviation. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  17. Energy Storage Economics

    Energy Technology Data Exchange (ETDEWEB)

    Elgqvist, Emma M [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-09-07

    This presentation provides an overview on energy storage economics including recent market trends, battery terminology and concepts, value streams, challenges, and an example of how photovoltaics and storage can be used to lower demand charges. It also provides an overview of the REopt Lite web tool inputs and outputs.

  18. System for secure storage

    NARCIS (Netherlands)

    2005-01-01

    A system (100) comprising read means (112) for reading content data and control logic data from a storage medium (101), the control logic data being uniquely linked to the storage medium (101), processing means (113-117), for processing the content data and feeding the processed content data to an

  19. Grain Handling and Storage.

    Science.gov (United States)

    Harris, Troy G.; Minor, John

    This text for a secondary- or postecondary-level course in grain handling and storage contains ten chapters. Chapter titles are (1) Introduction to Grain Handling and Storage, (2) Elevator Safety, (3) Grain Grading and Seed Identification, (4) Moisture Control, (5) Insect and Rodent Control, (6) Grain Inventory Control, (7) Elevator Maintenance,…

  20. Wind-energy storage

    Science.gov (United States)

    Gordon, L. H.

    1980-01-01

    Program SIMWEST can model wind energy storage system using any combination of five types of storage: pumped hydro, battery, thermal, flywheel, and pneumatic. Program is tool to aid design of optional system for given application with realistic simulation for further evaluation and verification.

  1. ERDA's Chemical Energy Storage Program

    Science.gov (United States)

    Swisher, J. H.; Kelley, J. H.

    1977-01-01

    The Chemical Energy Storage Program is described with emphasis on hydrogen storage. Storage techniques considered include pressurized hydrogen gas storage, cryogenic liquid hydrogen storage, storage in hydride compounds, and aromatic-alicyclic hydrogen storage. Some uses of energy storage are suggested. Information on hydrogen production and hydrogen use is also presented. Applications of hydrogen energy systems include storage of hydrogen for utilities load leveling, industrial marketing of hydrogen both as a chemical and as a fuel, natural gas supplementation, vehicular applications, and direct substitution for natural gas.

  2. Effect of different storage temperatures on bacterial spoilage of ...

    African Journals Online (AJOL)

    This study determined the bacterial organisms associated with Oreochromis niloticus spoilage at two storage temperatures (6 and 20°C) and also assessed the ability of the individual bacterial isolates to cause spoilage at the two storage temperatures. Bacteriological analysis revealed the association of five bacteria ...

  3. Electricity Storage. Technology Brief

    Energy Technology Data Exchange (ETDEWEB)

    Simbolotti, G. [Italian National Agency for New Technologies, Energy and Sustainable Economic Development ENEA, Rome (Italy); Kempener, R. [International Renewable Energy Agency IRENA, Bonn (Germany)

    2012-04-15

    Electricity storage is a key technology for electricity systems with a high share of renewables as it allows electricity to be generated when renewable sources (i.e. wind, sunlight) are available and to be consumed on demand. It is expected that the increasing price of fossil fuels and peak-load electricity and the growing share of renewables will result in electricity storage to grow rapidly and become more cost effective. However, electricity storage is technically challenging because electricity can only be stored after conversion into other forms of energy, and this involves expensive equipment and energy losses. At present, the only commercial storage option is pumped hydro power where surplus electricity (e.g. electricity produced overnight by base-load coal or nuclear power) is used to pump water from a lower to an upper reservoir. The stored energy is then used to produce hydropower during daily high-demand periods. Pumped hydro plants are large-scale storage systems with a typical efficiency between 70% and 80%, which means that a quarter of the energy is lost in the process. Other storage technologies with different characteristics (i.e. storage process and capacity, conversion back to electricity and response to power demand, energy losses and costs) are currently in demonstration or pre-commercial stages and discussed in this brief report: Compressed air energy storage (CAES) systems, Flywheels; Electrical batteries; Supercapacitors; Superconducting magnetic storage; and Thermal energy storage. No single electricity storage technology scores high in all dimensions. The technology of choice often depends on the size of the system, the specific service, the electricity sources and the marginal cost of peak electricity. Pumped hydro currently accounts for 95% of the global storage capacity and still offers a considerable expansion potential but does not suit residential or small-size applications. CAES expansion is limited due to the lack of suitable

  4. Plutonium storage criteria

    Energy Technology Data Exchange (ETDEWEB)

    Chung, D. [Scientech, Inc., Germantown, MD (United States); Ascanio, X. [Dept. of Energy, Germantown, MD (United States)

    1996-05-01

    The Department of Energy has issued a technical standard for long-term (>50 years) storage and will soon issue a criteria document for interim (<20 years) storage of plutonium materials. The long-term technical standard, {open_quotes}Criteria for Safe Storage of Plutonium Metals and Oxides,{close_quotes} addresses the requirements for storing metals and oxides with greater than 50 wt % plutonium. It calls for a standardized package that meets both off-site transportation requirements, as well as remote handling requirements from future storage facilities. The interim criteria document, {open_quotes}Criteria for Interim Safe Storage of Plutonium-Bearing Solid Materials{close_quotes}, addresses requirements for storing materials with less than 50 wt% plutonium. The interim criteria document assumes the materials will be stored on existing sites, and existing facilities and equipment will be used for repackaging to improve the margin of safety.

  5. Compact nuclear fuel storage

    International Nuclear Information System (INIS)

    Kiselev, V.V.; Churakov, Yu.A.; Danchenko, Yu.V.; Bylkin, B.K.; Tsvetkov, S.V.

    1983-01-01

    Different constructions of racks for compact storage of spent fuel assemblies (FA) in ''coolin''g pools (CP) of NPPs with the BWR and PWR type reactors are described. Problems concerning nuclear and radiation safety and provision of necessary thermal conditions arising in such rack design are discussed. It is concluded that the problem of prolonged fuel storage at NPPs became Very actual for many countries because of retapdation of the rates of fuel reprocessing centers building. Application of compact storage racks is a promising solution of the problem of intermediate FA storage at NPPs. Such racks of stainless boron steel and with neutron absorbers in the from of boron carbide panels enable to increase the capacity of the present CP 2-2.6 times, and the period of FA storage in them up to 5-10 years

  6. Electricity storage using a thermal storage scheme

    Energy Technology Data Exchange (ETDEWEB)

    White, Alexander, E-mail: ajw36@cam.ac.uk [Hopkinson Laboratory, Cambridge University Engineering Department, Trumpington Street, Cambridge. CB2 1PZ (United Kingdom)

    2015-01-22

    The increasing use of renewable energy technologies for electricity generation, many of which have an unpredictably intermittent nature, will inevitably lead to a greater demand for large-scale electricity storage schemes. For example, the expanding fraction of electricity produced by wind turbines will require either backup or storage capacity to cover extended periods of wind lull. This paper describes a recently proposed storage scheme, referred to here as Pumped Thermal Storage (PTS), and which is based on “sensible heat” storage in large thermal reservoirs. During the charging phase, the system effectively operates as a high temperature-ratio heat pump, extracting heat from a cold reservoir and delivering heat to a hot one. In the discharge phase the processes are reversed and it operates as a heat engine. The round-trip efficiency is limited only by process irreversibilities (as opposed to Second Law limitations on the coefficient of performance and the thermal efficiency of the heat pump and heat engine respectively). PTS is currently being developed in both France and England. In both cases, the schemes operate on the Joule-Brayton (gas turbine) cycle, using argon as the working fluid. However, the French scheme proposes the use of turbomachinery for compression and expansion, whereas for that being developed in England reciprocating devices are proposed. The current paper focuses on the impact of the various process irreversibilities on the thermodynamic round-trip efficiency of the scheme. Consideration is given to compression and expansion losses and pressure losses (in pipe-work, valves and thermal reservoirs); heat transfer related irreversibility in the thermal reservoirs is discussed but not included in the analysis. Results are presented demonstrating how the various loss parameters and operating conditions influence the overall performance.

  7. Ultrafine hydrogen storage powders

    Science.gov (United States)

    Anderson, Iver E.; Ellis, Timothy W.; Pecharsky, Vitalij K.; Ting, Jason; Terpstra, Robert; Bowman, Robert C.; Witham, Charles K.; Fultz, Brent T.; Bugga, Ratnakumar V.

    2000-06-13

    A method of making hydrogen storage powder resistant to fracture in service involves forming a melt having the appropriate composition for the hydrogen storage material, such, for example, LaNi.sub.5 and other AB.sub.5 type materials and AB.sub.5+x materials, where x is from about -2.5 to about +2.5, including x=0, and the melt is gas atomized under conditions of melt temperature and atomizing gas pressure to form generally spherical powder particles. The hydrogen storage powder exhibits improved chemcial homogeneity as a result of rapid solidfication from the melt and small particle size that is more resistant to microcracking during hydrogen absorption/desorption cycling. A hydrogen storage component, such as an electrode for a battery or electrochemical fuel cell, made from the gas atomized hydrogen storage material is resistant to hydrogen degradation upon hydrogen absorption/desorption that occurs for example, during charging/discharging of a battery. Such hydrogen storage components can be made by consolidating and optionally sintering the gas atomized hydrogen storage powder or alternately by shaping the gas atomized powder and a suitable binder to a desired configuration in a mold or die.

  8. Storage of radioactive wastes

    International Nuclear Information System (INIS)

    1992-07-01

    Even if the best waste minimization measures are undertaken throughout radioisotope production or usage, significant radioactive wastes arise to make management measures essential. For developing countries with low isotope usage and little or no generation of nuclear materials, it may be possible to handle the generated waste by simply practicing decay storage for several half-lives of the radionuclides involved, followed by discharge or disposal without further processing. For those countries with much larger facilities, longer lived isotopes are produced and used. In this situation, storage is used not only for decay storage but also for in-process retention steps and for the key stage of interim storage of conditioned wastes pending final disposal. The report will serve as a technical manual providing reference material and direct step-by-step know-how to staff in radioisotope user establishments and research centres in the developing Member States without nuclear power generation. Considerations are limited to the simpler storage facilities. The restricted quantities and low activity associated with the relevant wastes will generally permit contact-handling and avoid the need for shielding requirements in the storage facilities or equipment used for handling. A small quantity of wastes from some radioisotope production cells and from reactor cooling water treatment may contain sufficient short lived activity from activated corrosion products to require some separate decay storage before contact-handling is suitable. 16 refs, 12 figs, 8 tabs

  9. Aflatoxins & Safe Storage

    Directory of Open Access Journals (Sweden)

    Philippe eVillers

    2014-04-01

    Full Text Available The paper examines both field experience and research on the prevention of the exponential growth of aflatoxins during multi-month post harvest storage in hot, humid countries. The approach described is the application of modern safe storage methods using flexible, Ultra Hermetic™ structures that create an unbreatheable atmosphere through insect and microorganism respiration alone, without use of chemicals, fumigants, or pumps. Laboratory and field data are cited and specific examples are given describing the uses of Ultra Hermetic storage to prevent the growth of aflatoxins with their significant public health consequences. Also discussed is the presently limited quantitative information on the relative occurrence of excessive levels of aflatoxin (>20 ppb before versus after multi-month storage of such crops as maize, rice and peanuts when under high humidity, high temperature conditions and, consequently, the need for further research to determine the frequency at which excessive aflatoxin levels are reached in the field versus after months of post-harvest storage. The significant work being done to reduce aflatoxin levels in the field is mentioned, as well as its probable implications on post harvest storage. Also described is why, with some crops such as peanuts, using Ultra Hermetic storage may require injection of carbon dioxide or use of an oxygen absorber as an accelerant. The case of peanuts is discussed and experimental data is described.

  10. c-Kit-positive cardiac stem cells nested in hypoxic niches are activated by stem cell factor reversing the aging myopathy.

    Science.gov (United States)

    Sanada, Fumihiro; Kim, Junghyun; Czarna, Anna; Chan, Noel Yan-Ki; Signore, Sergio; Ogórek, Barbara; Isobe, Kazuya; Wybieralska, Ewa; Borghetti, Giulia; Pesapane, Ada; Sorrentino, Andrea; Mangano, Emily; Cappetta, Donato; Mangiaracina, Chiara; Ricciardi, Mario; Cimini, Maria; Ifedigbo, Emeka; Perrella, Mark A; Goichberg, Polina; Choi, Augustine M; Kajstura, Jan; Hosoda, Toru; Rota, Marcello; Anversa, Piero; Leri, Annarosa

    2014-01-03

    Hypoxia favors stem cell quiescence, whereas normoxia is required for stem cell activation, but whether cardiac stem cell (CSC) function is regulated by the hypoxic/normoxic state of the cell is currently unknown. A balance between hypoxic and normoxic CSCs may be present in the young heart, although this homeostatic control may be disrupted with aging. Defects in tissue oxygenation occur in the old myocardium, and this phenomenon may expand the pool of hypoxic CSCs, which are no longer involved in myocyte renewal. Here, we show that the senescent heart is characterized by an increased number of quiescent CSCs with intact telomeres that cannot re-enter the cell cycle and form a differentiated progeny. Conversely, myocyte replacement is controlled only by frequently dividing CSCs with shortened telomeres; these CSCs generate a myocyte population that is chronologically young but phenotypically old. Telomere dysfunction dictates their actual age and mechanical behavior. However, the residual subset of quiescent young CSCs can be stimulated in situ by stem cell factor reversing the aging myopathy. Our findings support the notion that strategies targeting CSC activation and growth interfere with the manifestations of myocardial aging in an animal model. Although caution has to be exercised in the translation of animal studies to human beings, our data strongly suggest that a pool of functionally competent CSCs persists in the senescent heart and that this stem cell compartment can promote myocyte regeneration effectively, partly correcting the aging myopathy.

  11. Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature

    LENUS (Irish Health Repository)

    Thabit, Hood

    2011-05-13

    Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

  12. Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature

    Directory of Open Access Journals (Sweden)

    Sreenan Seamus

    2011-05-01

    Full Text Available Abstract Introduction Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. Case presentations We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. Conclusion These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

  13. Proximal myopathy in lacto-vegetarian Asian patients responding to Vitamin D and calcium supplement therapy - two case reports and review of the literature.

    LENUS (Irish Health Repository)

    Thabit, Hood

    2012-02-01

    INTRODUCTION: Severe proximal myopathy can occasionally be the first presenting complaint of patients with osteomalacia. This may lead to investigations and misdiagnosis of a neuromuscular disease, rather than a metabolic bone disease. CASE PRESENTATIONS: We present here two cases of severe proximal myopathy in patients who were both of South Asian origin and lacto-vegetarians: a 31-year-old Indian man and a 34-year-old Indian woman. In both cases, their clinical symptoms fully resolved following vitamin D and calcium replacement therapy. These patients were at risk of osteomalacia due to their dietary intake and ethnicity. The role of dietary intake and sunlight exposure in the development of osteomalacia in certain ethnic groups living in Western Europe is reviewed here. CONCLUSION: These two cases emphasize the importance of recognizing osteomalacia in at-risk individuals, as the condition is reversible and easily treated with vitamin D and calcium supplementation. It may also help avoid prolonged and unnecessary investigations of these patients.

  14. Aspects of the storage of radioactive waste

    International Nuclear Information System (INIS)

    Nienhuys, K.

    1978-01-01

    The expansion in the number of nuclear power stations in the netherlands is amongst other things, dependent on an acceptable policy for the storage of the waste from the stations. Consequently the idea has developed for storage in a salt-dome. The sub-committee on radioactive waste substances of the Interdepartmental Committee for Nuclear Energy has therefore given a mandate to initiate further research. For the risk analysis over the definitive storage of nuclear waste the sub-comittee produced a report in 1975, entitled 'Safety analysis for the underground storage of nuclear waste in salt-dome outcrops'. The analysis reveals a number of defective features. This makes especially clear that statements about the definitive storage of nuclear waste in salt domes can only be made with a great deal of uncertainty. There is no guarantee that the nuclear waste generated may be stowed away so that it will never return to the ionosphere. The speed whereby the nuclear waste may return would be dependent on a combination of events which cannot generally be calculated or assessed. The long term consequences of an irreversible radioactive contamination of the biosphere is not acceptable. There is insufficient proof that the storage of radioactive waste in salt domes is feasible. (G.C.)

  15. Pure myopathy with enlarged mitochondria associated to a new mutation in MTND2 gene

    Directory of Open Access Journals (Sweden)

    Alice Zanolini

    2017-03-01

    Full Text Available To date, only few mutations in the mitochondrial DNA (mtDNA-encoded ND2 subunit of Complex I have been reported, usually presenting a severe phenotype characterized by early onset encephalomyopathy and early death. In this report, we describe a new mutation in the MTND2 gene in a 21-year-old man with a mild myopathic phenotype characterized by exercise intolerance and increased plasma lactate at rest. Electromyography and brain NMR were normal, and no cardiac involvement was present. Muscle biopsy showed a massive presence of ragged red – COX-positive fibres, with enlarged mitochondria containing osmiophilic inclusions. Biochemical assays revealed a severe isolated complex I deficiency. We identified a novel, heteroplasmic mutation m.4831G>A in the MTND2 gene, causing the p.Gly121Asp substitution in the ND2 protein. The mutation was present in the 95% of mitochondrial genomes from patient's muscle tissue, at a lower level in cells from the urinary tract and at a lowest level in lymphocytes from patient's blood; the base substitution was absent in fibroblasts and in the tissues from proband's healthy mother and brother. The specific skeletal muscle tissue involvement can explain the childhood-onset and the relatively benign, exclusively myopathic course of the disease.

  16. Spent-fuel-storage alternatives

    International Nuclear Information System (INIS)

    1980-01-01

    The Spent Fuel Storage Alternatives meeting was a technical forum in which 37 experts from 12 states discussed storage alternatives that are available or are under development. The subject matter was divided into the following five areas: techniques for increasing fuel storage density; dry storage of spent fuel; fuel characterization and conditioning; fuel storage operating experience; and storage and transport economics. Nineteen of the 21 papers which were presented at this meeting are included in this Proceedings. These have been abstracted and indexed

  17. Magnox waste storage complex

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    This article looks at the design and construction of British Nuclear Fuel Limited's (BNFL) Magnox waste storage complex by Costain Engineering Limited. Magnox swarf from fuel decanning is stored underwater in specially designed silos. Gas processing capabilities from Costain Engineering Limited and the experience of BNFL combined in this project to provide the necessary problem-solving skills necessary for this waste storage upgrading and extension project. A retrofitted inerting facility was fitted to an existing building and a new storage extension was fitted, both without interrupting reprocessing operations at Sellafield. (UK)

  18. Tiered Storage For LHC

    CERN Multimedia

    CERN. Geneva; Hanushevsky, Andrew

    2012-01-01

    For more than a year, the ATLAS Western Tier 2 (WT2) at SLAC National Accelerator has been successfully operating a two tiered storage system based on Xrootd's flexible cross-cluster data placement framework, the File Residency Manager. The architecture allows WT2 to provide both, high performance storage at the higher tier to ATLAS analysis jobs, as well as large, low cost disk capacity at the lower tier. Data automatically moves between the two storage tiers based on the needs of analysis jobs and is completely transparent to the jobs.

  19. Next generation storage facility

    International Nuclear Information System (INIS)

    Schlesser, J.A.

    1994-01-01

    With diminishing requirements for plutonium, a substantial quantity of this material requires special handling and ultimately, long-term storage. To meet this objective, we at Los Alamos, have been involved in the design of a storage facility with the goal of providing storage capabilities for this and other nuclear materials. This paper presents preliminary basic design data, not for the structure and physical plant, but for the container and arrays which might be configured within the facility, with strong emphasis on criticality safety features

  20. Monitored retrievable storage design

    International Nuclear Information System (INIS)

    Woods, W.D.

    1985-01-01

    The Nuclear Waste Policy Act of 1982 (NWPA) established a national policy for the safe storage and disposal of spent nuclear fuel and high-level radioactive waste. The NWPA requires that DOE... ''submit a proposal to Congress on the need for and feasibility of one or more Monitored Retrievable Storage (MRS) Facilities''... In subsequent evaluations of the commercial nuclear waste management system, DOE has identified important advantages in providing an MRS Facility as an integral part of the total system. The integral MRS Facility serves as an independent, centralized spent nuclear fuel and high-level waste handling and packaging facility with a safe temporary storage capacity