WorldWideScience

Sample records for stimulated-like gene family

  1. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    International Nuclear Information System (INIS)

    Mizoshiri, N.; Kishida, T.; Yamamoto, K.; Shirai, T.; Terauchi, R.; Tsuchida, S.; Mori, Y.; Ejima, A.; Sato, Y.; Arai, Y.; Fujiwara, H.; Yamamoto, T.; Kanamura, N.; Mazda, O.; Kubo, T.

    2015-01-01

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  2. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Mizoshiri, N. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kishida, T. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, K. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Shirai, T.; Terauchi, R.; Tsuchida, S. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mori, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ejima, A. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Sato, Y. [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Arai, Y.; Fujiwara, H. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan); Yamamoto, T.; Kanamura, N. [Department of Dental Medicine, Kyoto Prefectural University of Medicine, Kyoto (Japan); Mazda, O., E-mail: mazda@koto.kpu-m.ac.jp [Department of Immunology, Kyoto Prefectural University of Medicine, Kyoto (Japan); Kubo, T. [Department of Orthopaedics, Kyoto Prefectural University of Medicine, Kyoto (Japan)

    2015-11-27

    Introduction: Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. Materials and Methods: We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. Results: As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. Discussion: The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. - Highlights: • Introducing L-myc in a combination with either Oct3/4, Oct6 or Oct9 enables the conversion of fibroblasts to osteoblasts. • A combination of L-myc with Oct3/4 or Oct9 can induce the cells to a phenotype closer to normal osteoblasts. • N-myc was considered the most appropriate Myc family gene for induction of osteoblast-like phenotype in fibroblasts. • The combination of Oct9 plus N-myc has the strongest capability of inducing osteoblast-like phenotype.

  3. Transduction of Oct6 or Oct9 gene concomitant with Myc family gene induced osteoblast-like phenotypic conversion in normal human fibroblasts.

    Science.gov (United States)

    Mizoshiri, N; Kishida, T; Yamamoto, K; Shirai, T; Terauchi, R; Tsuchida, S; Mori, Y; Ejima, A; Sato, Y; Arai, Y; Fujiwara, H; Yamamoto, T; Kanamura, N; Mazda, O; Kubo, T

    2015-11-27

    Osteoblasts play essential roles in bone formation and regeneration, while they have low proliferation potential. Recently we established a procedure to directly convert human fibroblasts into osteoblasts (dOBs). Transduction of Runx2 (R), Osterix (X), Oct3/4 (O) and L-myc (L) genes followed by culturing under osteogenic conditions induced normal human fibroblasts to express osteoblast-specific genes and produce calcified bone matrix both in vitro and in vivo Intriguingly, a combination of only two factors, Oct3/4 and L-myc, significantly induced osteoblast-like phenotype in fibroblasts, but the mechanisms underlying the direct conversion remains to be unveiled. We examined which Oct family genes and Myc family genes are capable of inducing osteoblast-like phenotypic conversion. As result Oct3/4, Oct6 and Oct9, among other Oct family members, had the capability, while N-myc was the most effective Myc family gene. The Oct9 plus N-myc was the best combination to induce direct conversion of human fibroblasts into osteoblast-like cells. The present findings may greatly contribute to the elucidation of the roles of the Oct and Myc proteins in osteoblast direct reprogramming. The results may also lead to establishment of novel regenerative therapy for various bone resorption diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  5. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  6. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    Science.gov (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  7. Evolutionary hierarchy of vertebrate-like heterotrimeric G protein families.

    Science.gov (United States)

    Krishnan, Arunkumar; Mustafa, Arshi; Almén, Markus Sällman; Fredriksson, Robert; Williams, Michael J; Schiöth, Helgi B

    2015-10-01

    Heterotrimeric G proteins perform a crucial role as molecular switches controlling various cellular responses mediated by G protein-coupled receptor (GPCR) signaling pathway. Recent data have shown that the vertebrate-like G protein families are found across metazoans and their closest unicellular relatives. However, an overall evolutionary hierarchy of vertebrate-like G proteins, including gene family annotations and in particular mapping individual gene gain/loss events across diverse holozoan lineages is still incomplete. Here, with more expanded invertebrate taxon sampling, we have reconstructed phylogenetic trees for each of the G protein classes/families and provide a robust classification and hierarchy of vertebrate-like heterotrimeric G proteins. Our results further extend the evidence that the common ancestor (CA) of holozoans had at least five ancestral Gα genes corresponding to all major vertebrate Gα classes and contain a total of eight genes including two Gβ and one Gγ. Our results also indicate that the GNAI/O-like gene likely duplicated in the last CA of metazoans to give rise to GNAI- and GNAO-like genes, which are conserved across invertebrates. Moreover, homologs of GNB1-4 paralogon- and GNB5 family-like genes are found in most metazoans and that the unicellular holozoans encode two ancestral Gβ genes. Similarly, most bilaterian invertebrates encode two Gγ genes which include a representative of the GNG gene cluster and a putative homolog of GNG13. Interestingly, our results also revealed key evolutionary events such as the Drosophila melanogaster eye specific Gβ subunit that is found conserved in most arthropods and several previously unidentified species specific expansions within Gαi/o, Gαs, Gαq, Gα12/13 classes and the GNB1-4 paralogon. Also, we provide an overall proposed evolutionary scenario on the expansions of all G protein families in vertebrate tetraploidizations. Our robust classification/hierarchy is essential to further

  8. Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.

    Science.gov (United States)

    Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng

    2014-04-18

    The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  9. In vivo release of calcitonin gene-related peptide-like material from the cervicotrigeminal area in the rat. Effects of electrical and noxious stimulations of the muzzle.

    Science.gov (United States)

    Pohl, M; Collin, E; Bourgoin, S; Clot, A M; Hamon, M; Cesselin, F; Le Bars, D

    1992-10-01

    The continuous perfusion with an artificial cerebrospinal fluid of the cervicotrigeminal area of the spinal cord in halothane-anaesthetized rats allowed the collection of calcitonin gene-related peptide-like material with the same immunological and chromatographic characteristics as authentic rat alpha-calcitonin gene-related peptide. The spinal release of calcitonin gene-related peptide-like material could be significantly increased by the local application of 60 mM K+ (approximately +100%), high-intensity percutaneous electrical stimulation (approximately +200%) and noxious heat (by immersion in water at 52 degrees C; approximately +150%) applied to the muzzle. By contrast, noxious mechanical (pinches) and chemical (subcutaneous formalin injection) stimulations and deep cooling (by immersion in water at 0 degrees C) of the muzzle did not alter the spinal release of calcitonin gene-related peptide-like material. In addition, low-intensity electrical stimulation, recruiting only the A alpha/beta primary afferent fibres, significantly reduced (approximately -30%) the release of calcitonin gene-related peptide-like material from the cervicotrigeminal area. These data suggest that among the various types of natural noxious stimuli, noxious heat may selectively excite calcitonin gene-related peptide-containing A delta and C primary afferent fibres projecting within the dorsal horn of the spinal cord, and that activation of A alpha/beta fibres reduces spontaneous calcitonin gene-related peptide-like material release possibly through an inhibitory presynaptic control of calcitonin gene-related peptide-containing A delta/C fibres.

  10. The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

    Directory of Open Access Journals (Sweden)

    Daniel Menendez

    2011-03-01

    Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

  11. Cloning and characterization of a novel Gladiolus hybridus AFP family gene (GhAFP-like) related to corm dormancy

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Jian; Seng, Shanshan [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Beijing 100193 (China); Carianopol, Carina [Department of Biological Sciences, University of Toronto, Toronto, Ontario (Canada); Sui, Juanjuan [College of Biology, Fuyang Normal College, Fuyang, Anhui (China); Yang, Qiuyan; Zhang, Fengqin; Jiang, Huiru [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Beijing 100193 (China); He, Junna, E-mail: hejunna@cau.edu.cn [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Beijing 100193 (China); Yi, Mingfang, E-mail: ymfang@cau.edu.cn [Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture and Landscape Architecture, China Agricultural University, Beijing 100193 (China)

    2016-02-26

    Abscisic acid (ABA) is an important phytohormone controlling seed dormancy. AFPs (ABA INSENSITIVE FIVE BINDING PROTEINS) are reported to be negative regulators of the ABA signaling pathway. The involvement of AFPs in dormant vegetative organs remains poorly understood. Here, we isolated and characterized a novel AFP family member from Gladiolus dormant cormels, GhAFP-like, containing three conserved domains of the AFP family. Quantitative PCR analysis revealed that GhAFP-like was expressed in dormant organs and its expression was down-regulated along with corm storage. GhAFP-like was verified to be a nuclear-localized protein. Overexpressing GhAFP-like in Arabidopsis thaliana not only showed weaker seed dormancy with insensitivity to ABA, but also changed the expression of some ABA related genes. In addition, a primary root elongation assay showed GhAFP-like may involve in auxin signaling response. The results in this study indicate that GhAFP-like acts as a negative regulator in ABA signaling and is related to dormancy. - Highlights: • GhAFP-like is expessed in dormant corm. • Overexpressing GhAFP-like showed early germination and insensitivity to ABA. • Overexpressing GhAFP-like changed ABI5 downstream genes expression.

  12. Cloning and characterization of a novel Gladiolus hybridus AFP family gene (GhAFP-like) related to corm dormancy

    International Nuclear Information System (INIS)

    Wu, Jian; Seng, Shanshan; Carianopol, Carina; Sui, Juanjuan; Yang, Qiuyan; Zhang, Fengqin; Jiang, Huiru; He, Junna; Yi, Mingfang

    2016-01-01

    Abscisic acid (ABA) is an important phytohormone controlling seed dormancy. AFPs (ABA INSENSITIVE FIVE BINDING PROTEINS) are reported to be negative regulators of the ABA signaling pathway. The involvement of AFPs in dormant vegetative organs remains poorly understood. Here, we isolated and characterized a novel AFP family member from Gladiolus dormant cormels, GhAFP-like, containing three conserved domains of the AFP family. Quantitative PCR analysis revealed that GhAFP-like was expressed in dormant organs and its expression was down-regulated along with corm storage. GhAFP-like was verified to be a nuclear-localized protein. Overexpressing GhAFP-like in Arabidopsis thaliana not only showed weaker seed dormancy with insensitivity to ABA, but also changed the expression of some ABA related genes. In addition, a primary root elongation assay showed GhAFP-like may involve in auxin signaling response. The results in this study indicate that GhAFP-like acts as a negative regulator in ABA signaling and is related to dormancy. - Highlights: • GhAFP-like is expessed in dormant corm. • Overexpressing GhAFP-like showed early germination and insensitivity to ABA. • Overexpressing GhAFP-like changed ABI5 downstream genes expression.

  13. Functional evolution in the plant SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL gene family

    Directory of Open Access Journals (Sweden)

    Jill Christine Preston

    2013-04-01

    Full Text Available The SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL family of transcription factors is functionally diverse, controlling a number of fundamental aspects of plant growth and development, including vegetative phase change, flowering time, branching, and leaf initiation rate. In natural plant populations, variation in flowering time and shoot architecture have major consequences for fitness. Likewise, in crop species, variation in branching and developmental rate impact biomass and yield. Thus, studies aimed at dissecting how the various functions are partitioned among different SPL genes in diverse plant lineages are key to providing insight into the genetic basis of local adaptation and have already garnered attention by crop breeders. Here we use phylogenetic reconstruction to reveal nine major SPL gene lineages, each of which is described in terms of function and diversification. To assess evidence for ancestral and derived functions within each SPL gene lineage, we use ancestral character state reconstructions. Our analyses suggest an emerging pattern of sub-functionalization, neo-functionalization, and possible convergent evolution following both ancient and recent gene duplication. Based on these analyses we suggest future avenues of research that may prove fruitful for elucidating the importance of SPL gene evolution in plant growth and development.

  14. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  15. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

  16. Regulatory patterns of a large family of defensin-like genes expressed in nodules of Medicago truncatula.

    Directory of Open Access Journals (Sweden)

    Sumitha Nallu

    Full Text Available Root nodules are the symbiotic organ of legumes that house nitrogen-fixing bacteria. Many genes are specifically induced in nodules during the interactions between the host plant and symbiotic rhizobia. Information regarding the regulation of expression for most of these genes is lacking. One of the largest gene families expressed in the nodules of the model legume Medicago truncatula is the nodule cysteine-rich (NCR group of defensin-like (DEFL genes. We used a custom Affymetrix microarray to catalog the expression changes of 566 NCRs at different stages of nodule development. Additionally, bacterial mutants were used to understand the importance of the rhizobial partners in induction of NCRs. Expression of early NCRs was detected during the initial infection of rhizobia in nodules and expression continued as nodules became mature. Late NCRs were induced concomitantly with bacteroid development in the nodules. The induction of early and late NCRs was correlated with the number and morphology of rhizobia in the nodule. Conserved 41 to 50 bp motifs identified in the upstream 1,000 bp promoter regions of NCRs were required for promoter activity. These cis-element motifs were found to be unique to the NCR family among all annotated genes in the M. truncatula genome, although they contain sub-regions with clear similarity to known regulatory motifs involved in nodule-specific expression and temporal gene regulation.

  17. Circadian clock gene aryl hydrocarbon receptor nuclear translocator-like polymorphisms are associated with seasonal affective disorder: An Indian family study.

    Science.gov (United States)

    Rajendran, Bhagya; Janakarajan, Veeramahali Natarajan

    2016-01-01

    Polymorphisms in aryl hydrocarbon receptor nuclear translocator-like (ARNTL) gene, the key component of circadian clock manifests circadian rhythm abnormalities. As seasonal affective disorder (SAD) is associated with disrupted circadian rhythms, the main objective of this study was to screen an Indian family with SAD for ARNTL gene polymorphisms. In this study, 30 members of close-knit family with SAD, 30 age- and sex-matched controls of the same caste with no prior history of psychiatric illness and 30 age- and sex-matched controls belonging to 17 different castes with no prior history of psychiatric illness were genotyped for five different single nucleotide polymorphisms (SNPs) in ARNTL gene by TaqMan allele-specific genotyping assay. Statistical significance was assessed by more powerful quasi-likelihood score test-XM. Most of the family members carried the risk alleles and we observed a highly significant SNP rs2279287 (A/G) in ARNTL gene with an allelic frequency of 0.75. Polymorphisms in ARNTL gene disrupt circadian rhythms causing SAD and genetic predisposition becomes more deleterious in the presence of adverse environment.

  18. Genome-wide comparative analysis of papain-like cysteine protease family genes in castor bean and physic nut.

    Science.gov (United States)

    Zou, Zhi; Huang, Qixing; Xie, Guishui; Yang, Lifu

    2018-01-10

    Papain-like cysteine proteases (PLCPs) are a class of proteolytic enzymes involved in many plant processes. Compared with the extensive research in Arabidopsis thaliana, little is known in castor bean (Ricinus communis) and physic nut (Jatropha curcas), two Euphorbiaceous plants without any recent whole-genome duplication. In this study, a total of 26 or 23 PLCP genes were identified from the genomes of castor bean and physic nut respectively, which can be divided into nine subfamilies based on the phylogenetic analysis: RD21, CEP, XCP, XBCP3, THI, SAG12, RD19, ALP and CTB. Although most of them harbor orthologs in Arabidopsis, several members in subfamilies RD21, CEP, XBCP3 and SAG12 form new groups or subgroups as observed in other species, suggesting specific gene loss occurred in Arabidopsis. Recent gene duplicates were also identified in these two species, but they are limited to the SAG12 subfamily and were all derived from local duplication. Expression profiling revealed diverse patterns of different family members over various tissues. Furthermore, the evolution characteristics of PLCP genes were also compared and discussed. Our findings provide a useful reference to characterize PLCP genes and investigate the family evolution in Euphorbiaceae and species beyond.

  19. Genome-wide characterization, evolution, and expression analysis of the leucine-rich repeat receptor-like protein kinase (LRR-RLK) gene family in Rosaceae genomes.

    Science.gov (United States)

    Sun, Jiangmei; Li, Leiting; Wang, Peng; Zhang, Shaoling; Wu, Juyou

    2017-10-10

    Leucine-rich repeat receptor-like protein kinase (LRR-RLK) is the largest gene family of receptor-like protein kinases (RLKs) and actively participates in regulating the growth, development, signal transduction, immunity, and stress responses of plants. However, the patterns of LRR-RLK gene family evolution in the five main Rosaceae species for which genome sequences are available have not yet been reported. In this study, we performed a comprehensive analysis of LRR-RLK genes for five Rosaceae species: Fragaria vesca (strawberry), Malus domestica (apple), Pyrus bretschneideri (Chinese white pear), Prunus mume (mei), and Prunus persica (peach), which contained 201, 244, 427, 267, and 258 LRR-RLK genes, respectively. All LRR-RLK genes were further grouped into 23 subfamilies based on the hidden Markov models approach. RLK-Pelle_LRR-XII-1, RLK-Pelle_LRR-XI-1, and RLK-Pelle_LRR-III were the three largest subfamilies. Synteny analysis indicated that there were 236 tandem duplicated genes in the five Rosaceae species, among which subfamilies XII-1 (82 genes) and XI-1 (80 genes) comprised 68.6%. Our results indicate that tandem duplication made a large contribution to the expansion of the subfamilies. The gene expression, tissue-specific expression, and subcellular localization data revealed that LRR-RLK genes were differentially expressed in various organs and tissues, and the largest subfamily XI-1 was highly expressed in all five Rosaceae species, suggesting that LRR-RLKs play important roles in each stage of plant growth and development. Taken together, our results provide an overview of the LRR-RLK family in Rosaceae genomes and the basis for further functional studies.

  20. Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes

    Science.gov (United States)

    Jarvi, S.I.; Goto, R.M.; Gee, G.F.; Briles, W.E.; Miller, M.M.

    1999-01-01

    We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbgl and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of '-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.

  1. Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes.

    Science.gov (United States)

    Jarvi, S I; Goto, R M; Gee, G F; Briles, W E; Miller, M M

    1999-01-01

    We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbg1 and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of alpha-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.

  2. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Science.gov (United States)

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  3. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  4. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Directory of Open Access Journals (Sweden)

    Naoki Takata

    Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  5. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  6. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  7. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  8. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    Directory of Open Access Journals (Sweden)

    Jan Futas

    Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

  9. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    Science.gov (United States)

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  10. Molecular Characterization of SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL Gene Family in Betula luminifera

    Directory of Open Access Journals (Sweden)

    Xiu-Yun Li

    2018-05-01

    Full Text Available As a major family of plant-specific transcription factors, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL genes play vital regulatory roles in plant growth, development and stress responses. In this study, 18 SPL genes were identified and cloned from Betula luminifera. Two zinc finger-like structures and a nuclear location signal (NLS segments were existed in the SBP domains of all BlSPLs. Phylogenetic analysis showed that these genes were clustered into nine groups (group I-IX. The intron/exon structure and motif composition were highly conserved within the same group. 12 of the 18 BlSPLs were experimentally verified as the targets of miR156, and two cleavage sites were detected in these miR156-targeted BlSPL genes. Many putative cis-elements, associated with light, stresses and phytohormones response, were identified in the promoter regions of BlSPLs, suggesting that BlSPL genes are probably involved in important physiological processes and developmental events. Tissue-specific expression analysis showed that miR156-targeted BlSPLs exhibited a more differential expression pattern, while most miR156-nontargeted BlSPLs tended to be constitutively expressed, suggesting the distinct roles of miR156-targeted and nontargeted BlSPLs in development and growth of B. luminifera. Further expression analysis revealed that miR156-targeted BlSPLs were dramatically up-regulated with age, whereas mature BlmiR156 level was apparently declined with age, indicating that miR156/SPL module plays important roles in vegetative phase change of B. luminifera. Moreover, yeast two-hybrid assay indicated that several miR156-targeted and nontargeted BlSPLs could interact with two DELLA proteins (BlRGA and BlRGL, which suggests that certain BlSPLs take part in the GA regulated processes through protein interaction with DELLA proteins. All these results provide an important basis for further exploring the biological functions of BlSPLs in B. luminifera.

  11. Genome-Wide Identification and Functional Analysis of the Calcineurin B-like Protein and Calcineurin B-like Protein-Interacting Protein Kinase Gene Families in Turnip (Brassica rapa var. rapa

    Directory of Open Access Journals (Sweden)

    Xin Yin

    2017-07-01

    Full Text Available The calcineurin B-like protein (CBL–CBL-interacting protein kinase (CIPK complex has been identified as a primary component in calcium sensors that perceives various stress signals. Turnip (Brassica rapa var. rapa has been widely cultivated in the Qinghai–Tibet Plateau for a century as a food crop of worldwide economic significance. These CBL–CIPK complexes have been demonstrated to play crucial roles in plant response to various environmental stresses. However, no report is available on the genome-wide characterization of these two gene families in turnip. In the present study, 19 and 51 members of the BrrCBL and BrrCIPK genes, respectively, are first identified in turnip and phylogenetically grouped into three and two distinct clusters, respectively. The expansion of these two gene families is mainly attributable to segmental duplication. Moreover, the differences in expression patterns in quantitative real-time PCR, as well as interaction profiles in the yeast two-hybrid assay, suggest the functional divergence of paralog genes during long-term evolution in turnip. Overexpressing and complement lines in Arabidopsis reveal that BrrCBL9.2 improves, but BrrCBL9.1 does not affect, salt tolerance in Arabidopsis. Thus, the expansion of the BrrCBL and BrrCIPK gene families enables the functional differentiation and evolution of some new gene functions of paralog genes. These paralog genes then play prominent roles in turnip's adaptation to the adverse environment of the Qinghai–Tibet Plateau. Overall, the study results contribute to our understanding of the functions of the CBL–CIPK complex and provide basis for selecting appropriate genes for the in-depth functional studies of BrrCBL–BrrCIPK in turnip.

  12. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  13. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  14. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  15. Cancer Research Advance in CKLF-like MARVEL Transmembrane Domain Containing Member Family (Review).

    Science.gov (United States)

    Lu, Jia; Wu, Qian-Qian; Zhou, Ya-Bo; Zhang, Kai-Hua; Pang, Bing-Xin; Li, Liang; Sun, Nan; Wang, Heng-Shu; Zhang, Song; Li, Wen-Jian; Zheng, Wei; Liu, Wei

    2016-01-01

    CKLF-like MARVEL transmembrane domain-containing family (CMTM) is a novel family of genes first reported at international level by Peking University Human Disease Gene Research Center. The gene products are between chemokines and the transmembrane-4 superfamily. Loaceted in several human chromosomes, CMTMs, which are unregulated in kinds of tumors, are potential tumor suppressor genes consisting of CKLF and CMTM1 to CMTM8. CMTMs play important roles in immune, male reproductive and hematopoietic systems. Also, it has been approved that CMTM family has strong connection with diseases of autoimmunity, haematopoietic system and haematopoietic system. The in-depth study in recent years found the close relation between CMTMs and umorigenesis, tumor development and metastasis. CMTM family has a significant clinical value in diagnosis and treatment to the diseases linking to tumor and immune system.

  16. Gene expression results in lipopolysaccharide-stimulated monocytes depend significantly on the choice of reference genes

    Directory of Open Access Journals (Sweden)

    Øvstebø Reidun

    2010-05-01

    Full Text Available Abstract Background Gene expression in lipopolysaccharide (LPS-stimulated monocytes is mainly studied by quantitative real-time reverse transcription PCR (RT-qPCR using GAPDH (glyceraldehyde 3-phosphate dehydrogenase or ACTB (beta-actin as reference gene for normalization. Expression of traditional reference genes has been shown to vary substantially under certain conditions leading to invalid results. To investigate whether traditional reference genes are stably expressed in LPS-stimulated monocytes or if RT-qPCR results are dependent on the choice of reference genes, we have assessed and evaluated gene expression stability of twelve candidate reference genes in this model system. Results Twelve candidate reference genes were quantified by RT-qPCR in LPS-stimulated, human monocytes and evaluated using the programs geNorm, Normfinder and BestKeeper. geNorm ranked PPIB (cyclophilin B, B2M (beta-2-microglobulin and PPIA (cyclophilin A as the best combination for gene expression normalization in LPS-stimulated monocytes. Normfinder suggested TBP (TATA-box binding protein and B2M as the best combination. Compared to these combinations, normalization using GAPDH alone resulted in significantly higher changes of TNF-α (tumor necrosis factor-alpha and IL10 (interleukin 10 expression. Moreover, a significant difference in TNF-α expression between monocytes stimulated with equimolar concentrations of LPS from N. meningitides and E. coli, respectively, was identified when using the suggested combinations of reference genes for normalization, but stayed unrecognized when employing a single reference gene, ACTB or GAPDH. Conclusions Gene expression levels in LPS-stimulated monocytes based on RT-qPCR results differ significantly when normalized to a single gene or a combination of stably expressed reference genes. Proper evaluation of reference gene stabiliy is therefore mandatory before reporting RT-qPCR results in LPS-stimulated monocytes.

  17. Investigation of genes encoding calcineurin B-like protein family in legumes and their expression analyses in chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Meena, Mukesh Kumar; Ghawana, Sanjay; Sardar, Atish; Dwivedi, Vikas; Khandal, Hitaishi; Roy, Riti; Chattopadhyay, Debasis

    2015-01-01

    Calcium ion (Ca2+) is a ubiquitous second messenger that transmits various internal and external signals including stresses and, therefore, is important for plants' response process. Calcineurin B-like proteins (CBLs) are one of the plant calcium sensors, which sense and convey the changes in cytosolic Ca2+-concentration for response process. A search in four leguminous plant (soybean, Medicago truncatula, common bean and chickpea) genomes identified 9 to 15 genes in each species that encode CBL proteins. Sequence analyses of CBL peptides and coding sequences (CDS) suggested that there are nine original CBL genes in these legumes and some of them were multiplied during whole genome or local gene duplication. Coding sequences of chickpea CBL genes (CaCBL) were cloned from their cDNAs and sequenced, and their annotations in the genome assemblies were corrected accordingly. Analyses of protein sequences and gene structures of CBL family in plant kingdom indicated its diverse origin but showed a remarkable conservation in overall protein structure with appearance of complex gene structure in the course of evolution. Expression of CaCBL genes in different tissues and in response to different stress and hormone treatment were studied. Most of the CaCBL genes exhibited high expression in flowers. Expression profile of CaCBL genes in response to different abiotic stresses and hormones related to development and stresses (ABA, auxin, cytokinin, SA and JA) at different time intervals suggests their diverse roles in development and plant defence in addition to abiotic stress tolerance. These data not only contribute to a better understanding of the complex regulation of chickpea CBL gene family, but also provide valuable information for further research in chickpea functional genomics.

  18. Dynamic evolution of toll-like receptor multigene families in echinoderms

    Directory of Open Access Journals (Sweden)

    Katherine M Buckley

    2012-06-01

    Full Text Available The genome of the purple sea urchin, Strongylocentrotus purpuratus, was the first to be sequenced from a long-lived large invertebrate. Analysis of this genome uncovered a surprisingly complex immune system in which the moderately sized sets of pattern recognition receptors that form the core of vertebrate innate immunity are encoded in large multigene families. The sea urchin genome contains 253 Toll-like receptor (TLR genes, more than 200 Nod-like receptors and 1095 scavenger receptor cysteine-rich domains, a ten-fold expansion relative to vertebrates. Given their stereotypic structure and simple intron-exon architecture, the TLRs are the most tractable of these families for more detailed analysis. An immune defense role for these receptors is suggested by their sequence diversity and expression in immunologically active tissues, including phagocytes. This complexity of the sea urchin TLR multigene families largely derives from expansions that are independent of those in vertebrates and protostomes, although a small family of TLRs with structure similar to that of Drosophila Toll likely originated in an ancient eumetazoan ancestor. Several other invertebrate deuterostome genomes have been sequenced, including the cephalochordate, Branchiostoma floridae and the sea urchin Lytechinus variegatus, as well as partial sequences from two other sea urchin species. Here, we present an analysis of the invertebrate deuterostome TLRs with emphasis on the echinoderms. Representatives of most of the S. purpuratus TLR subfamilies and homologs of the protostome-like sequences are found in L. variegatus. The phylogeny of these genes within sea urchins highlights lineage-specific expansions at higher resolution than is evident at the phylum level. These analyses identify quickly evolving TLR subfamilies that are likely to have novel functions and other, more stable, subfamilies that may function similarly to those of vertebrates.

  19. Leptin stimulates hepatic growth hormone receptor and insulin-like growth factor gene expression in a teleost fish, the hybrid striped bass.

    Science.gov (United States)

    Won, Eugene T; Douros, Jonathan D; Hurt, David A; Borski, Russell J

    2016-04-01

    Leptin is an anorexigenic peptide hormone that circulates as an indicator of adiposity in mammals, and functions to maintain energy homeostasis by balancing feeding and energy expenditure. In fish, leptin tends to be predominantly expressed in the liver, another important energy storing tissue, rather than in fat depots as it is in mammals. The liver also produces the majority of circulating insulin-like growth factors (IGFs), which comprise the mitogenic component of the growth hormone (GH)-IGF endocrine growth axis. Based on similar regulatory patterns of leptin and IGFs that we have documented in previous studies on hybrid striped bass (HSB: Morone saxatilis×Morone chrysops), and considering the co-localization of these peptides in the liver, we hypothesized that leptin might regulate the endocrine growth axis in a manner that helps coordinate somatic growth with energy availability. Using a HSB hepatocyte culture system to simulate autocrine or paracrine exposure that might occur within the liver, this study examines the potential for leptin to modulate metabolism and growth through regulation of IGF gene expression directly, or indirectly through the regulation of GH receptors (GHR), which mediate GH-induced IGF expression. First, we verified that GH (50nM) has a classical stimulatory effect on IGF-1 and additionally show it stimulates IGF-2 transcription in hepatocytes. Leptin (5 and/or 50nM) directly stimulated in vitro GHR2 gene expression within 8h of exposure, and both GHR1 and GHR2 as well as IGF-1 and IGF-2 gene expression after 24h. Cells were then co-incubated with submaximal concentrations of leptin and GH (25nM each) to test if they had a synergistic effect on IGF gene expression, possibly through increased GH sensitivity following GHR upregulation by leptin. In combination, however, the treatments only had an additive effect on stimulating IGF-1 mRNA despite their capacity to increase GHR mRNA abundance. This suggests that leptin's stimulatory

  20. Structure and expression of GSL1 and GSL2 genes encoding gibberellin stimulated-like proteins in diploid and highly heterozygous tetraploid potato reveals their highly conserved and essential status.

    Science.gov (United States)

    Meiyalaghan, Sathiyamoorthy; Thomson, Susan J; Fiers, Mark W E J; Barrell, Philippa J; Latimer, Julie M; Mohan, Sara; Jones, E Eirian; Conner, Anthony J; Jacobs, Jeanne M E

    2014-01-02

    GSL1 and GSL2, Gibberellin Stimulated-Like proteins (also known as Snakin-1 and Snakin-2), are cysteine-rich peptides from potato (Solanum tuberosum L.) with antimicrobial properties. Similar peptides in other species have been implicated in diverse biological processes and are hypothesised to play a role in several aspects of plant development, plant responses to biotic or abiotic stress through their participation in hormone crosstalk, and redox homeostasis. To help resolve the biological roles of GSL1 and GSL2 peptides we have undertaken an in depth analysis of the structure and expression of these genes in potato. We have characterised the full length genes for both GSL1 (chromosome 4) and GSL2 (chromosome 1) from diploid and tetraploid potato using the reference genome sequence of potato, coupled with further next generation sequencing of four highly heterozygous tetraploid cultivars. The frequency of SNPs in GSL1 and GSL2 were very low with only one SNP every 67 and 53 nucleotides in exon regions of GSL1 and GSL2, respectively. Analysis of comprehensive RNA-seq data substantiated the role of specific promoter motifs in transcriptional control of gene expression. Expression analysis based on the frequency of next generation sequence reads established that GSL2 was expressed at a higher level than GSL1 in 30 out of 32 tissue and treatment libraries. Furthermore, both the GSL1 and GSL2 genes exhibited constitutive expression that was not up regulated in response to biotic or abiotic stresses, hormone treatments or wounding. Potato transformation with antisense knock-down expression cassettes failed to recover viable plants. The potato GSL1 and GSL2 genes are very highly conserved suggesting they contribute to an important biological function. The known antimicrobial activity of the GSL proteins, coupled with the FPKM analysis from RNA-seq data, implies that both genes contribute to the constitutive defence barriers in potatoes. The lethality of antisense knock

  1. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  2. Rice Snl6, a cinnamoyl-CoA reductase-like gene family member, is required for NH1-mediated immunity to Xanthomonas oryzae pv. oryzae.

    Directory of Open Access Journals (Sweden)

    Rebecca S Bart

    2010-09-01

    Full Text Available Rice NH1 (NPR1 homolog 1 is a key mediator of innate immunity. In both plants and animals, the innate immune response is often accompanied by rapid cell death at the site of pathogen infection. Over-expression of NH1 in rice results in resistance to the bacterial pathogen, Xanthomonas oryzae pv. oryzae (Xoo, constitutive expression of defense related genes and enhanced benzothiadiazole (BTH- mediated cell death. Here we describe a forward genetic screen that identified a suppressor of NH1-mediated lesion formation and resistance, snl6. Comparative genome hybridization and fine mapping rapidly identified the genomic location of the Snl6 gene. Snl6 is a member of the cinnamoyl-CoA reductase (CCR-like gene family. We show that Snl6 is required for NH1-mediated resistance to Xoo. Further, we show that Snl6 is required for pathogenesis-related gene expression. In contrast to previously described CCR family members, disruption of Snl6 does not result in an obvious morphologic phenotype. Snl6 mutants have reduced lignin content and increased sugar extractability, an important trait for the production of cellulosic biofuels. These results suggest the existence of a conserved group of CCR-like genes involved in the defense response, and with the potential to alter lignin content without affecting development.

  3. Investigation of genes encoding calcineurin B-like protein family in legumes and their expression analyses in chickpea (Cicer arietinum L..

    Directory of Open Access Journals (Sweden)

    Mukesh Kumar Meena

    Full Text Available Calcium ion (Ca2+ is a ubiquitous second messenger that transmits various internal and external signals including stresses and, therefore, is important for plants' response process. Calcineurin B-like proteins (CBLs are one of the plant calcium sensors, which sense and convey the changes in cytosolic Ca2+-concentration for response process. A search in four leguminous plant (soybean, Medicago truncatula, common bean and chickpea genomes identified 9 to 15 genes in each species that encode CBL proteins. Sequence analyses of CBL peptides and coding sequences (CDS suggested that there are nine original CBL genes in these legumes and some of them were multiplied during whole genome or local gene duplication. Coding sequences of chickpea CBL genes (CaCBL were cloned from their cDNAs and sequenced, and their annotations in the genome assemblies were corrected accordingly. Analyses of protein sequences and gene structures of CBL family in plant kingdom indicated its diverse origin but showed a remarkable conservation in overall protein structure with appearance of complex gene structure in the course of evolution. Expression of CaCBL genes in different tissues and in response to different stress and hormone treatment were studied. Most of the CaCBL genes exhibited high expression in flowers. Expression profile of CaCBL genes in response to different abiotic stresses and hormones related to development and stresses (ABA, auxin, cytokinin, SA and JA at different time intervals suggests their diverse roles in development and plant defence in addition to abiotic stress tolerance. These data not only contribute to a better understanding of the complex regulation of chickpea CBL gene family, but also provide valuable information for further research in chickpea functional genomics.

  4. Changes in gene expression following growth stimulation of cultured cells

    International Nuclear Information System (INIS)

    Nathans, D.; Lau, L.F.; Lee, S.J.; Linzer, D.I.H.

    1986-01-01

    To identify genes that may be part of a genetic program for the growth of mammalian cells. The authors are characterizing cDNA clones derived from mRNAs that appear at various times after stimulation of resting BALB/c 3T3 cells with serum or growth factors. cDNA libraries were prepared from polyA/sup +/ RNA from cells stimulated with serum for various periods of time, and the libraries were differentially screened with /sup 32/P-cDNA probes made from stimulated or resting cell mRNA. One cDNA library was prepared from cells that were stimulated with serum for 3 hrs in the presence of cycloheximide. The authors purpose in inhibiting protein synthesis was to limit new mRNAs to those that do not require de novo protein synthesis for their accumulation and to amplify mRNAs that are superinduced by serum in the absence of protein synthesis. Of approximately 50,000 recombinant phage plaques screened, 357 clones hybridized to probes derived from stimulated-cell RNA but not to probes from resting-cell RNA. Cross hybridization analysis showed that 4 RNA sequence families accounted for over 95% of the clones; other sequences were found only once

  5. Lipasin, thermoregulated in brown fat, is a novel but atypical member of the angiopoietin-like protein family.

    Science.gov (United States)

    Fu, Zhiyao; Yao, Fayi; Abou-Samra, Abdul B; Zhang, Ren

    2013-01-18

    Hyperlipidemia is a major contributor to cardiovascular diseases. Members of the angiopoietin-like protein family (ANGPTLs) are important determinants of blood lipid levels. Lipasin, a newly identified gene that regulates serum triglycerides, is homologous to ANGPTL3's N-terminal domain, which is sufficient and necessary for blood lipid regulation. Brown fat is critical in mediating energy homeostasis. Thermogenesis is the primary function of brown fat, in which Lipasin and some ANGPTLs are abundant; it is unknown, however, whether these genes are thermoregulated. We therefore comprehensively examined the thermoregulation of Lipasin and ANGPTLs in brown fat. Here we show that Lipasin is a novel but atypical member of the ANGPTL family because it is within the same branch as ANGPTL3 and 4 by phylogenetic analysis. The mRNA levels of Lipasin are dramatically increased in the cold environment (4 °C for 4 h) whereas those of ANGPTL4 and ANGPTL2 are suppressed. Fasting dramatically suppresses Lipasin but increases ANGPTL4. High-fat diet treatment increases Lipasin, but reduces ANGPTL2. The distinct transcriptional regulations of Lipasin, ANGPTL2 and ANGPTL4 in brown fat in response to cold exposure and nutritional stimulation suggest distinct physiological roles for ANGPTL family members in mediating thermogenesis and energy homeostasis. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  7. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  8. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    OpenAIRE

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

  9. Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder

    2017-11-03

    Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

  10. Stimulation of the innate immune system of carp: role of Toll-like receptors

    NARCIS (Netherlands)

    Pietretti, D.

    2013-01-01

    Toll-like receptors (TLRs), named after the Toll gene identified in fruit flies, are a family of evolutionary conserved proteins that play a key role in the innate immune system. TLRs are found inside or on the surface of immune cells of virtually all-living animals and recognize integral parts

  11. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  12. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  13. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  14. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  15. Comparative studies of vertebrate endothelin-converting enzyme-like 1 genes and proteins

    Directory of Open Access Journals (Sweden)

    Holmes RS

    2013-01-01

    Full Text Available Roger S Holmes,1,2 Laura A Cox11Department of Genetics and Southwest National Primate Research Center, Texas Biomedical Research Institute, San Antonio, TX, USA; 2Eskitis Institute for Cell and Molecular Therapies and School of Biomolecular and Physical Sciences, Griffith University, Nathan, Queensland, AustraliaAbstract: Endothelin-converting enzyme-like 1 (ECEL1 is a member of the M13 family of neutral endopeptidases which play an essential role in the neural regulation of vertebrate respiration. Genetic deficiency of this protein results in respiratory failure soon after birth. Comparative ECEL1 amino acid sequences and structures and ECEL1 gene locations were examined using data from several vertebrate genome projects. Vertebrate ECEL1 sequences shared 66%–99% identity as compared with 30%–63% sequence identities with other M13-like family members, ECE1, ECE2, and NEP (neprilysin or MME. Three N-glycosylation sites were conserved among most vertebrate ECEL1 proteins examined. Sequence alignments, conserved key amino acid residues, and predicted secondary and tertiary structures were also studied, including cytoplasmic, transmembrane, and luminal sequences and active site residues. Vertebrate ECEL1 genes usually contained 18 exons and 17 coding exons on the negative strand. Exons 1 and 2 of the human ECEL1 gene contained 5'-untranslated (5'-UTR regions, a large CpG island (CpG256, and several transcription factor binding sites which may contribute to the high levels of gene expression previously reported in neural tissues. Phylogenetic analyses examined the relationships and potential evolutionary origins of the vertebrate ECEL1 gene with six other vertebrate neutral endopeptidase M13 family genes. These suggested that ECEL1 originated in an ancestral vertebrate genome from a duplication event in an ancestral neutral endopeptidase M13-like gene.Keywords: vertebrates, amino acid sequence, ECEL1, ECE1, ECE2, KELL, NEP, NEPL1, PHEX

  16. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  17. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  18. Early Infantile Leigh-like Gene Defects Have a Poor Prognosis: Report and Review

    Directory of Open Access Journals (Sweden)

    Majid Alfadhel

    2017-10-01

    Full Text Available Solute carrier family 19 (thiamine transporter, member 3 ( SCL19A3 gene defect produces an autosomal recessive neurodegenerative disorder associated with different phenotypes and acronyms. One of the common presentations is early infantile lethal Leigh-like syndrome. We report a case of early infantile Leigh-like SLC19A3 gene defects of patients who died at 4 months of age with no response to a high dose of biotin and thiamine. In addition, we report a novel mutation that was not reported previously. Finally, we review the literature regarding early infantile Leigh-like SLC19A3 gene defects and compare the literature with our patient.

  19. Trichomonas vaginalis vast BspA-like gene family: evidence for functional diversity from structural organisation and transcriptomics

    DEFF Research Database (Denmark)

    Sicheritz-Pontén, Thomas; Noel, CJ; Diaz, N

    2010-01-01

    Trichomonas vaginalis is the most common non-viral human sexually transmitted pathogen and importantly, contributes to facilitating the spread of HIV. Yet very little is known about its surface and secreted proteins mediating interactions with, and permitting the invasion and colonisation of...... potential extracellular proteins for the pathogen. A broad range of microorganisms encoding BspA-like proteins was identified and these are mainly known to live on mucosal surfaces, among these T. vaginalis is endowed with the largest gene family. Over 180 TvBspA proteins with inferred transmembrane domains...... were characterized by a considerable structural diversity between their TpLRR and other types of repetitive sequences and two subfamilies possessed distinct classic sorting signal motifs for endocytosis. One TvBspA subfamily also shared a glycine-rich protein domain with proteins from Clostridium...

  20. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  1. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  2. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  3. Activation of the pacidamycin PacL adenylation domain by MbtH-like proteins.

    Science.gov (United States)

    Zhang, Wenjun; Heemstra, John R; Walsh, Christopher T; Imker, Heidi J

    2010-11-23

    Nonribosomal peptide synthetase (NRPS) assembly lines are major avenues for the biosynthesis of a vast array of peptidyl natural products. Several hundred bacterial NRPS gene clusters contain a small (∼70-residue) protein belonging to the MbtH family for which no function has been defined. Here we show that two strictly conserved Trp residues in MbtH-like proteins contribute to stimulation of amino acid adenylation in some NRPS modules. We also demonstrate that adenylation can be stimulated not only by cognate MbtH-like proteins but also by homologues from disparate natural product pathways.

  4. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  5. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  6. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  7. Evolution, functional differentiation, and co-expression of the RLK gene family revealed in Jilin ginseng, Panax ginseng C.A. Meyer.

    Science.gov (United States)

    Lin, Yanping; Wang, Kangyu; Li, Xiangyu; Sun, Chunyu; Yin, Rui; Wang, Yanfang; Wang, Yi; Zhang, Meiping

    2018-02-21

    Most genes in a genome exist in the form of a gene family; therefore, it is necessary to have knowledge of how a gene family functions to comprehensively understand organismal biology. The receptor-like kinase (RLK)-encoding gene family is one of the most important gene families in plants. It plays important roles in biotic and abiotic stress tolerances, and growth and development. However, little is known about the functional differentiation and relationships among the gene members within a gene family in plants. This study has isolated 563 RLK genes (designated as PgRLK genes) expressed in Jilin ginseng (Panax ginseng C.A. Meyer), investigated their evolution, and deciphered their functional diversification and relationships. The PgRLK gene family is highly diverged and formed into eight types. The LRR type is the earliest and most prevalent, while only the Lec type originated after P. ginseng evolved. Furthermore, although the members of the PgRLK gene family all encode receptor-like protein kinases and share conservative domains, they are functionally very diverse, participating in numerous biological processes. The expressions of different members of the PgRLK gene family are extremely variable within a tissue, at a developmental stage and in the same cultivar, but most of the genes tend to express correlatively, forming a co-expression network. These results not only provide a deeper and comprehensive understanding of the evolution, functional differentiation and correlation of a gene family in plants, but also an RLK genic resource useful for enhanced ginseng genetic improvement.

  8. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  9. Rett-like phenotypes: expanding the genetic heterogeneity to the KCNA2 gene and first familial case of CDKL5-related disease.

    Science.gov (United States)

    Allou, L; Julia, S; Amsallem, D; El Chehadeh, S; Lambert, L; Thevenon, J; Duffourd, Y; Saunier, A; Bouquet, P; Pere, S; Moustaïne, A; Ruaud, L; Roth, V; Jonveaux, P; Philippe, C

    2017-03-01

    Several genes have been implicated in Rett syndrome (RTT) in its typical and variant forms. We applied next-generation sequencing (NGS) to evaluate for mutations in known or new candidate genes in patients with variant forms of Rett or Rett-like phenotypes of unknown molecular aetiology. In the first step, we used NGS with a custom panel including MECP2, CDKL5, FOXG1, MEF2C and IQSEC2. In addition to a FOXG1 mutation in a patient with all core features of the congenital variant of RTT, we identified a missense (p.Ser240Thr) in CDKL5 in a patient who appeared to be seizure free. This missense was maternally inherited with opposite allele expression ratios in the proband and her mother. In the asymptomatic mother, the mutated copy of the CDKL5 gene was inactivated in 90% of blood cells. We also identified a premature stop codon (p.Arg926*) in IQSEC2 in a patient with a Rett-like phenotype. Finally, exome sequencing enabled us to characterize a heterozygous de novo missense (p.Val408Ala) in KCNA2 encoding the potassium channel Kv 1.2 in a girl with infantile-onset seizures variant of RTT. Our study expands the genetic heterogeneity of RTT and RTT-like phenotypes. Moreover, we report the first familial case of CDKL5-related disease. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Genome-wide analysis of the SBP-box gene family in Chinese cabbage (Brassica rapa subsp. pekinensis).

    Science.gov (United States)

    Tan, Hua-Wei; Song, Xiao-Ming; Duan, Wei-Ke; Wang, Yan; Hou, Xi-Lin

    2015-11-01

    The SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box gene family contains highly conserved plant-specific transcription factors that play an important role in plant development, especially in flowering. Chinese cabbage (Brassica rapa subsp. pekinensis) is a leafy vegetable grown worldwide and is used as a model crop for research in genome duplication. The present study aimed to characterize the SBP-box transcription factor genes in Chinese cabbage. Twenty-nine SBP-box genes were identified in the Chinese cabbage genome and classified into six groups. We identified 23 orthologous and 5 co-orthologous SBP-box gene pairs between Chinese cabbage and Arabidopsis. An interaction network among these genes was constructed. Sixteen SBP-box genes were expressed more abundantly in flowers than in other tissues, suggesting their involvement in flowering. We show that the MiR156/157 family members may regulate the coding regions or 3'-UTR regions of Chinese cabbage SBP-box genes. As SBP-box genes were found to potentially participate in some plant development pathways, quantitative real-time PCR analysis was performed and showed that Chinese cabbage SBP-box genes were also sensitive to the exogenous hormones methyl jasmonic acid and salicylic acid. The SBP-box genes have undergone gene duplication and loss, evolving a more refined regulation for diverse stimulation in plant tissues. Our comprehensive genome-wide analysis provides insights into the SBP-box gene family of Chinese cabbage.

  11. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  12. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  13. Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.

    Directory of Open Access Journals (Sweden)

    Juergen H Nett

    Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.

  14. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  15. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  16. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  17. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  18. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  19. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  20. A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

    Energy Technology Data Exchange (ETDEWEB)

    Gong, Y.; Li, X.M.; Shapiro, L.J. [UCSF School of Medicine, San Francisco, CA (United States)] [and others

    1994-09-01

    Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand, and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.

  1. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

  2. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  3. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  4. Ultradian hormone stimulation induces glucocorticoid receptor-mediated pulses of gene transcription.

    Science.gov (United States)

    Stavreva, Diana A; Wiench, Malgorzata; John, Sam; Conway-Campbell, Becky L; McKenna, Mervyn A; Pooley, John R; Johnson, Thomas A; Voss, Ty C; Lightman, Stafford L; Hager, Gordon L

    2009-09-01

    Studies on glucocorticoid receptor (GR) action typically assess gene responses by long-term stimulation with synthetic hormones. As corticosteroids are released from adrenal glands in a circadian and high-frequency (ultradian) mode, such treatments may not provide an accurate assessment of physiological hormone action. Here we demonstrate that ultradian hormone stimulation induces cyclic GR-mediated transcriptional regulation, or gene pulsing, both in cultured cells and in animal models. Equilibrium receptor-occupancy of regulatory elements precisely tracks the ligand pulses. Nascent RNA transcripts from GR-regulated genes are released in distinct quanta, demonstrating a profound difference between the transcriptional programs induced by ultradian and constant stimulation. Gene pulsing is driven by rapid GR exchange with response elements and by GR recycling through the chaperone machinery, which promotes GR activation and reactivation in response to the ultradian hormone release, thus coupling promoter activity to the naturally occurring fluctuations in hormone levels. The GR signalling pathway has been optimized for a prompt and timely response to fluctuations in hormone levels, indicating that biologically accurate regulation of gene targets by GR requires an ultradian mode of hormone stimulation.

  5. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Science.gov (United States)

    Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  6. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  7. Nuclear transfer alters placental gene expression and associated histone modifications of the placental-specific imprinted gene pleckstrin homology-like domain, family A, member 2 (PHLDA2) in cattle.

    Science.gov (United States)

    Arnold, Daniel R; Gaspar, Roberta C; da Rocha, Carlos V; Sangalli, Juliano R; de Bem, Tiago H C; Corrêa, Carolina A P; Penteado, João C T; Meirelles, Flavio V; Lopes, Flavia L

    2017-03-01

    Abnormal placental development is frequent in nuclear transfer (NT) pregnancies and is likely to be associated with altered epigenetic reprogramming. In the present study, fetal and placental measurements were taken on Day 60 of gestation in cows with pregnancies produced by AI, IVF and NT. Placentas were collected and subjected to histological evaluation, the expression of genes important in trophoblast differentiation and expression of the placental imprinted gene pleckstrin homology-like domain, family A, member 2 (PHLDA2), as well as chromatin immunoprecipitation (ChIP) for histone marks within the promoter of PHLDA2. Fewer binucleated cells were observed in NT cotyledons, followed by IVF and AI cotyledons (P<0.05). Expression of heart and neural crest derivatives expressed 1 (HAND1), placental lactogen (PL), pregnancy-associated glycoprotein 9 (PAG-9) and PHLDA2 was elevated in NT cotyledons compared with AI cotyledons. Expression of PHLDA2 was higher in IVF than AI samples (P<0.05). ChIP revealed an increase in the permissive mark dimethylation of lysine 4 on histone H3 (H3K4me2), surprisingly associated with the silent allele of PHLDA2, and a decrease in the inhibitory mark H3K9me2 in NT samples. Thus, genes critical for placental development were altered in NT placentas, including an imprinted gene. Allele-specific changes in the permissive histone mark in the PHLDA2 promoter indicate misregulation of imprinting in clones. Abnormal trophoblast differentiation could have resulted in lower numbers of binucleated cells following NT. These results suggest that the altered expression of imprinted genes associated with NT are also caused by changes in histone modifications.

  8. Genome-wide characterization of Toll-like receptor gene family in common carp (Cyprinus carpio) and their involvement in host immune response to Aeromonas hydrophila infection.

    Science.gov (United States)

    Gong, Yiwen; Feng, Shuaisheng; Li, Shangqi; Zhang, Yan; Zhao, Zixia; Hu, Mou; Xu, Peng; Jiang, Yanliang

    2017-12-01

    The Toll-like receptor (TLR) gene family is a class of conserved pattern recognition receptors, which play an essential role in innate immunity providing efficient defense against invading microbial pathogens. Although TLRs have been extensively characterized in both invertebrates and vertebrates, a comprehensive analysis of TLRs in common carp is lacking. In the present study, we have conducted the first genome-wide systematic analysis of common carp (Cyprinus carpio) TLR genes. A set of 27 common carp TLR genes were identified and characterized. Sequence similarity analysis, functional domain prediction and phylogenetic analysis supported their annotation and orthologies. By examining the gene copy number of TLR genes across several vertebrates, gene duplications and losses were observed. The expression patterns of TLR genes were examined during early developmental stages and in various healthy tissues, and the results showed that TLR genes were ubiquitously expressed, indicating a likely role in maintaining homeostasis. Moreover, the differential expression of TLRs was examined after Aeromons hydrophila infection, and showed that most TLR genes were induced, with diverse patterns. TLR1, TLR4-2, TLR4-3, TLR22-2, TLR22-3 were significantly up-regulated at minimum one timepoint, whereas TLR2-1, TLR4-1, TLR7-1 and TLR7-2 were significantly down-regulated. Our results suggested that TLR genes play critical roles in the common carp immune response. Collectively, our findings provide fundamental genomic resources for future studies on fish disease management and disease-resistance selective breeding strategy development. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  10. Identification of Putative Precursor Genes for the Biosynthesis of Cannabinoid-Like Compound in Radula marginata

    Directory of Open Access Journals (Sweden)

    Tajammul Hussain

    2018-05-01

    Full Text Available The liverwort Radula marginata belongs to the bryophyte division of land plants and is a prospective alternate source of cannabinoid-like compounds. However, mechanistic insights into the molecular pathways directing the synthesis of these cannabinoid-like compounds have been hindered due to the lack of genetic information. This prompted us to do deep sequencing, de novo assembly and annotation of R. marginata transcriptome, which resulted in the identification and validation of the genes for cannabinoid biosynthetic pathway. In total, we have identified 11,421 putative genes encoding 1,554 enzymes from 145 biosynthetic pathways. Interestingly, we have identified all the upstream genes of the central precursor of cannabinoid biosynthesis, cannabigerolic acid (CBGA, including its two first intermediates, stilbene acid (SA and geranyl diphosphate (GPP. Expression of all these genes was validated using quantitative real-time PCR. We have characterized the protein structure of stilbene synthase (STS, which is considered as a homolog of olivetolic acid in R. marginata. Moreover, the metabolomics approach enabled us to identify CBGA-analogous compounds using electrospray ionization mass spectrometry (ESI-MS/MS and gas chromatography mass spectrometry (GC-MS. Transcriptomic analysis revealed 1085 transcription factors (TF from 39 families. Comparative analysis showed that six TF families have been uniquely predicted in R. marginata. In addition, the bioinformatics analysis predicted a large number of simple sequence repeats (SSRs and non-coding RNAs (ncRNAs. Our results collectively provide mechanistic insights into the putative precursor genes for the biosynthesis of cannabinoid-like compounds and a novel transcriptomic resource for R. marginata. The large-scale transcriptomic resource generated in this study would further serve as a reference transcriptome to explore the Radulaceae family.

  11. Characterization of the Entire Cystatin Gene Family in Barley and Their Target Cathepsin L-Like Cysteine-Proteases, Partners in the Hordein Mobilization during Seed Germination1[W

    Science.gov (United States)

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-01-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds. PMID:19759340

  12. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  13. Characterization of PPMUCL1/2/3, three members of a new oomycete-specific mucin-like protein family residing in Phytophthora parasitica biofilm.

    Science.gov (United States)

    Larousse, Marie; Govetto, Benjamin; Séassau, Aurélie; Etienne, Catherine; Industri, Benoit; Theodorakopoulos, Nicolas; Deleury, Emeline; Ponchet, Michel; Panabières, Franck; Galiana, Eric

    2014-05-01

    The plant pathogen Phytophthora parasitica forms a biofilm on the host surface. The biofilm transcriptome is characterized by the expression of PPMUCL1/2/3 (PHYTOPHTHORA PARASITICA MUCIN-LIKE) genes, which we report here to be members of a new, large mucin-like gene family restricted to the oomycete lineage. These genes encode secreted proteins organized into two domains. The NH2-terminal domain is highly conserved, but of unknown function. The second domain is a mucin-like domain enriched in threonine and serine residues, with a large number of putative O-glycosylation sites and a repeated motif defining 15 subgroups among the 315 members of the family. The second domain was found to be glycosylated in the recombinant rPPMUCL1 and rPPMUCL2 proteins. An analysis of PPMUCL1/2/3 gene expression indicated that these genes were expressed in a specific and coordinated manner in the biofilm. A novel cis-motif (R) bound to nuclear proteins, suggesting a possible role in PPMUCL1/2/3 gene regulation. Immunohistochemical staining revealed that the PPMUCL1/2 proteins were secreted and accumulated on the surface of the biofilm. Our data demonstrate that PPMUCL1/2/3 belong to a new oomycete-specific family of mucin-like proteins playing a structural role in the biofilm extracellular matrix. Copyright © 2014 Elsevier GmbH. All rights reserved.

  14. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

    Directory of Open Access Journals (Sweden)

    Behzad Davarniya

    Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

  15. The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families

    Science.gov (United States)

    Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein

    2015-01-01

    Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914

  16. Hypercaloric cafeteria-like diet induced UCP3 gene expression in skeletal muscle is impaired by hypothyroidism

    Directory of Open Access Journals (Sweden)

    Christoffolete M.A.

    2004-01-01

    Full Text Available The uncoupling protein UCP3 belongs to a family of mitochondrial carriers located in the inner mitochondrial membrane of certain cell types. It is expressed almost exclusively at high levels in skeletal muscle and its physiological role has not been fully determined in this tissue. In the present study we have addressed the possible interaction between a hypercaloric diet and thyroid hormone (T3, which are strong stimulators of UCP3 gene expression in skeletal muscle. Male Wistar rats weighing 180 ± 20 g were rendered hypothyroid by thyroidectomy and the addition of methimazole (0.05%; w/v to drinking water after surgery. The rats were fed a hypercaloric cafeteria diet (68% carbohydrates, 13% protein and 18% lipids for 10 days and sacrificed by decapitation. Subsequently, the gastrocnemius muscle was dissected, total RNA was isolated with Trizol? and UCP3 gene expression was determined by Northern blotting using a specific probe. Statistical analysis was performed by one-way analysis of variance (ANOVA followed by the Student-Newman-Keuls post-test. Skeletal muscle UCP3 gene expression was decreased by 60% in hypothyroid rats and UCP3 mRNA expression was increased 70% in euthyroid cafeteria-fed rats compared to euthyroid chow-fed animals, confirming previous studies. Interestingly, the cafeteria diet was unable to stimulate UCP3 gene expression in hypothyroid animals (40% lower as compared to euthyroid cafeteria-fed animals. The results show that a hypercaloric diet is a strong stimulator of UCP3 gene expression in skeletal muscle and requires T3 for an adequate action.

  17. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  18. Analysis of the grape (Vitis vinifera L.) thaumatin-like protein (TLP) gene family and demonstration that TLP29 contributes to disease resistance.

    Science.gov (United States)

    Yan, Xiaoxiao; Qiao, Hengbo; Zhang, Xiuming; Guo, Chunlei; Wang, Mengnan; Wang, Yuejin; Wang, Xiping

    2017-06-27

    Thaumatin-like protein (TLP) is present as a large family in plants, and individual members play different roles in various responses to biotic and abiotic stresses. Here we studied the role of 33 putative grape (Vitis vinifera L.) TLP genes (VvTLP) in grape disease resistance. Heat maps analysis compared the expression profiles of 33 genes in disease resistant and susceptible grape species infected with anthracnose (Elsinoe ampelina), powdery mildew (Erysiphe necator) or Botrytis cinerea. Among these 33 genes, the expression level of TLP29 increased following the three pathogens inoculations, and its homolog from the disease resistant Chinese wild grape V. quinquangularis cv. 'Shang-24', was focused for functional studies. Over-expression of TLP29 from grape 'Shang-24' (VqTLP29) in Arabidopsis thaliana enhanced its resistance to powdery mildew and the bacterium Pseudomonas syringae pv. tomato DC3000, but decreased resistance to B. cinerea. Moreover, the stomatal closure immunity response to pathogen associated molecular patterns was strengthened in the transgenic lines. A comparison of the expression profiles of various resistance-related genes after infection with different pathogens indicated that VqTLP29 may be involved in the salicylic acid and jasmonic acid/ethylene signaling pathways.

  19. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  20. Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

    Science.gov (United States)

    Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

    2015-09-01

    In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

  1. Immunoglobulin Heavy Chain Variable Region and Major Histocompatibility Region Genes Are Linked to Induced Graves' Disease in Females From Two Very Large Families of Recombinant Inbred Mice

    Science.gov (United States)

    Aliesky, Holly; Banuelos, Bianca; Magana, Jessica; Williams, Robert W.; Rapoport, Basil

    2014-01-01

    Graves' hyperthyroidism is caused by antibodies to the TSH receptor (TSHR) that mimic thyroid stimulation by TSH. Stimulating TSHR antibodies and hyperthyroidism can be induced by immunizing mice with adenovirus expressing the human TSHR A-subunit. Prior analysis of induced Graves' disease in small families of recombinant inbred (RI) female mice demonstrated strong genetic control but did not resolve trait loci for TSHR antibodies or elevated serum T4. We investigated the genetic basis for induced Graves' disease in female mice of two large RI families and combined data with earlier findings to provide phenotypes for 178 genotypes. TSHR antibodies measured by inhibition of TSH binding to its receptor were highly significantly linked in the BXD set to the major histocompatibility region (chromosome 17), consistent with observations in 3 other RI families. In the LXS family, we detected linkage between T4 levels after TSHR-adenovirus immunization and the Ig heavy chain variable region (Igvh, chromosome 12). This observation is a key finding because components of the antigen binding region of Igs determine antibody specificity and have been previously linked to induced thyroid-stimulating antibodies. Data from the LXS family provide the first evidence in mice of a direct link between induced hyperthyroidism and Igvh genes. A role for major histocompatibility genes has now been established for genetic susceptibility to Graves' disease in both humans and mice. Future studies using arrays incorporating variation in the complex human Ig gene locus will be necessary to determine whether Igvh genes are also linked to Graves' disease in humans. PMID:25051451

  2. The map-1 gene family in root-knot nematodes, Meloidogyne spp.: a set of taxonomically restricted genes specific to clonal species.

    Directory of Open Access Journals (Sweden)

    Iva Tomalova

    Full Text Available Taxonomically restricted genes (TRGs, i.e., genes that are restricted to a limited subset of phylogenetically related organisms, may be important in adaptation. In parasitic organisms, TRG-encoded proteins are possible determinants of the specificity of host-parasite interactions. In the root-knot nematode (RKN Meloidogyne incognita, the map-1 gene family encodes expansin-like proteins that are secreted into plant tissues during parasitism, thought to act as effectors to promote successful root infection. MAP-1 proteins exhibit a modular architecture, with variable number and arrangement of 58 and 13-aa domains in their central part. Here, we address the evolutionary origins of this gene family using a combination of bioinformatics and molecular biology approaches. Map-1 genes were solely identified in one single member of the phylum Nematoda, i.e., the genus Meloidogyne, and not detected in any other nematode, thus indicating that the map-1 gene family is indeed a TRG family. A phylogenetic analysis of the distribution of map-1 genes in RKNs further showed that these genes are specifically present in species that reproduce by mitotic parthenogenesis, with the exception of M. floridensis, and could not be detected in RKNs reproducing by either meiotic parthenogenesis or amphimixis. These results highlight the divergence between mitotic and meiotic RKN species as a critical transition in the evolutionary history of these parasites. Analysis of the sequence conservation and organization of repeated domains in map-1 genes suggests that gene duplication(s together with domain loss/duplication have contributed to the evolution of the map-1 family, and that some strong selection mechanism may be acting upon these genes to maintain their functional role(s in the specificity of the plant-RKN interactions.

  3. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  4. Evolution of the C-Type Lectin-Like Receptor Genes of the DECTIN-1 Cluster in the NK Gene Complex

    Directory of Open Access Journals (Sweden)

    Susanne Sattler

    2012-01-01

    Full Text Available Pattern recognition receptors are crucial in initiating and shaping innate and adaptive immune responses and often belong to families of structurally and evolutionarily related proteins. The human C-type lectin-like receptors encoded in the DECTIN-1 cluster within the NK gene complex contain prominent receptors with pattern recognition function, such as DECTIN-1 and LOX-1. All members of this cluster share significant homology and are considered to have arisen from subsequent gene duplications. Recent developments in sequencing and the availability of comprehensive sequence data comprising many species showed that the receptors of the DECTIN-1 cluster are not only homologous to each other but also highly conserved between species. Even in Caenorhabditis elegans, genes displaying homology to the mammalian C-type lectin-like receptors have been detected. In this paper, we conduct a comprehensive phylogenetic survey and give an up-to-date overview of the currently available data on the evolutionary emergence of the DECTIN-1 cluster genes.

  5. Diversification of CYCLOIDEA-like genes in Dipsacaceae (Dipsacales: implications for the evolution of capitulum inflorescences

    Directory of Open Access Journals (Sweden)

    Carlson Sara E

    2011-11-01

    ray florets. The similarity in CYC-like gene diversification seen in Dipsacaceae and some members of the Asteraceae sets the stage to investigate whether the convergent evolution of capitulum inflorescences in both groups may have been underlain by convergent evolution in the same gene family.

  6. Oral supplementation of Bifidobacterium longum strain BR-108 alters cecal microbiota by stimulating gut immune system in mice irrespectively of viability.

    Science.gov (United States)

    Makioka, Yuko; Tsukahara, Takamitsu; Ijichi, Tetsuo; Inoue, Ryo

    2018-03-20

    Effect on cecal microbiota and gene expression of various cytokines in ileal Peyer's patches and cecal tissues were compared between viable and heat-killed Bifidobacterium longum strain BR-108 (BR-108) using a mouse model. Irrespectively of viability, oral supplementation of BR-108 altered the cecal microbiota and stimulated gene expression of cytokines such as IL-6 and IL-10 in ileal Peyer's patches and cecal tissue of mice. In addition, BR-108 supplementation significantly affected the relative abundance of bacterial genera and family, Oscillospira, Bacteroides and S24-7. The abundance of these bacterial genera and family strongly correlated with gene expression induced by BR-108. This study demonstrated that the effect of heat-killed BR-108 on the mouse cecal microbiota is similar to that of viable BR-108, most likely due to stimulation of the gut immune system by both heat-killed and viable BR-108 is also similar.

  7. Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, andexpression analysis

    Directory of Open Access Journals (Sweden)

    Glen Peter

    2009-12-01

    Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig

  8. Identification of Interferon-Stimulated Gene Proteins That Inhibit Human Parainfluenza Virus Type 3.

    Science.gov (United States)

    Rabbani, M A G; Ribaudo, Michael; Guo, Ju-Tao; Barik, Sailen

    2016-12-15

    A major arm of cellular innate immunity is type I interferon (IFN), represented by IFN-α and IFN-β. Type I IFN transcriptionally induces a large number of cellular genes, collectively known as IFN-stimulated gene (ISG) proteins, which act as antivirals. The IFIT (interferon-induced proteins with tetratricopeptide repeats) family proteins constitute a major subclass of ISG proteins and are characterized by multiple tetratricopeptide repeats (TPRs). In this study, we have interrogated IFIT proteins for the ability to inhibit the growth of human parainfluenza virus type 3 (PIV3), a nonsegmented negative-strand RNA virus of the Paramyxoviridae family and a major cause of respiratory disease in children. We found that IFIT1 significantly inhibited PIV3, whereas IFIT2, IFIT3, and IFIT5 were less effective or not at all. In further screening a set of ISG proteins we discovered that several other such proteins also inhibited PIV3, including IFITM1, IDO (indoleamine 2,3-dioxygenase), PKR (protein kinase, RNA activated), and viperin (virus inhibitory protein, endoplasmic reticulum associated, interferon inducible)/Cig5. The antiviral effect of IDO, the enzyme that catalyzes the first step of tryptophan degradation, could be counteracted by tryptophan. These results advance our knowledge of diverse ISG proteins functioning as antivirals and may provide novel approaches against PIV3. The innate immunity of the host, typified by interferon (IFN), is a major antiviral defense. IFN inhibits virus growth by inducing a large number of IFN-stimulated gene (ISG) proteins, several of which have been shown to have specific antiviral functions. Parainfluenza virus type 3 (PIV3) is major pathogen of children, and no reliable vaccine or specific antiviral against it currently exists. In this article, we report several ISG proteins that strongly inhibit PIV3 growth, the use of which may allow a better antiviral regimen targeting PIV3. Copyright © 2016, American Society for Microbiology

  9. Structure of a Berberine Bridge Enzyme-Like Enzyme with an Active Site Specific to the Plant Family Brassicaceae

    DEFF Research Database (Denmark)

    Daniel, Bastian; Wallner, Silvia; Steiner, Barbara

    2016-01-01

    Berberine bridge enzyme-like (BBE-like) proteins form a multigene family (pfam 08031), which is present in plants, fungi and bacteria. They adopt the vanillyl alcohol-oxidase fold and predominantly show bi-covalent tethering of the FAD cofactor to a cysteine and histidine residue, respectively....... The Arabidopsis thaliana genome was recently shown to contain genes coding for 28 BBE-like proteins, while featuring four distinct active site compositions. We determined the structure of a member of the AtBBE-like protein family (termed AtBBE-like 28), which has an active site composition that has not been...... be exploited for catalysis. The structure also indicates a shift of the position of the isoalloxazine ring in comparison to other members of the BBE-like family. The dioxygen surrogate chloride was found near the C(4a) position of the isoalloxazine ring in the oxygen pocket, pointing to a rapid reoxidation...

  10. Multiple and variable NHEJ-like genes are involved in resistance to DNA damage in Streptomyces ambofaciens

    Directory of Open Access Journals (Sweden)

    Grégory Hoff

    2016-11-01

    Full Text Available Non homologous end-joining (NHEJ is a double strand break (DSB repair pathway which does not require any homologous template and can ligate two DNA ends together. The basic bacterial NHEJ machinery involves two partners: the Ku protein, a DNA end binding protein for DSB recognition and the multifunctional LigD protein composed a ligase, a nuclease and a polymerase domain, for end processing and ligation of the broken ends. In silico analyses performed in the 38 sequenced genomes of Streptomyces species revealed the existence of a large panel of NHEJ-like genes. Indeed, ku genes or ligD domain homologues are scattered throughout the genome in multiple copies and can be distinguished in two categories: the core NHEJ gene set constituted of conserved loci and the variable NHEJ gene set constituted of NHEJ-like genes present in only a part of the species. In Streptomyces ambofaciens ATCC 23877, not only the deletion of core genes but also that of variable genes led to an increased sensitivity to DNA damage induced by electron beam irradiation. Multiple mutants of ku, ligase or polymerase encoding genes showed an aggravated phenotype compared to single mutants. Biochemical assays revealed the ability of Ku-like proteins to protect and to stimulate ligation of DNA ends. RT-qPCR and GFP fusion experiments suggested that ku-like genes show a growth phase dependent expression profile consistent with their involvement in DNA repair during spores formation and/or germination.

  11. Characterization of the Carbohydrate Binding Module 18 gene family in the amphibian pathogen Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Liu, Peng; Stajich, Jason E

    2015-04-01

    Batrachochytrium dendrobatidis (Bd) is the causative agent of chytridiomycosis responsible for worldwide decline in amphibian populations. Previous analysis of the Bd genome revealed a unique expansion of the carbohydrate-binding module family 18 (CBM18) predicted to be a sub-class of chitin recognition domains. CBM expansions have been linked to the evolution of pathogenicity in a variety of fungal species by protecting the fungus from the host. Based on phylogenetic analysis and presence of additional protein domains, the gene family can be classified into 3 classes: Tyrosinase-, Deacetylase-, and Lectin-like. Examination of the mRNA expression levels from sporangia and zoospores of nine of the cbm18 genes found that the Lectin-like genes had the highest expression while the Tyrosinase-like genes showed little expression, especially in zoospores. Heterologous expression of GFP-tagged copies of four CBM18 genes in Saccharomyces cerevisiae demonstrated that two copies containing secretion signal peptides are trafficked to the cell boundary. The Lectin-like genes cbm18-ll1 and cbm18-ll2 co-localized with the chitinous cell boundaries visualized by staining with calcofluor white. In vitro assays of the full length and single domain copies from CBM18-LL1 demonstrated chitin binding and no binding to cellulose or xylan. Expressed CBM18 domain proteins were demonstrated to protect the fungus, Trichoderma reeseii, in vitro against hydrolysis from exogenously added chitinase, likely by binding and limiting exposure of fungal chitin. These results demonstrate that cbm18 genes can play a role in fungal defense and expansion of their copy number may be an important pathogenicity factor of this emerging infectious disease of amphibians. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Deciphering the genetic control of gene expression following Mycobacterium leprae antigen stimulation.

    Science.gov (United States)

    Manry, Jérémy; Nédélec, Yohann; Fava, Vinicius M; Cobat, Aurélie; Orlova, Marianna; Thuc, Nguyen Van; Thai, Vu Hong; Laval, Guillaume; Barreiro, Luis B; Schurr, Erwin

    2017-08-01

    Leprosy is a human infectious disease caused by Mycobacterium leprae. A strong host genetic contribution to leprosy susceptibility is well established. However, the modulation of the transcriptional response to infection and the mechanism(s) of disease control are poorly understood. To address this gap in knowledge of leprosy pathogenicity, we conducted a genome-wide search for expression quantitative trait loci (eQTL) that are associated with transcript variation before and after stimulation with M. leprae sonicate in whole blood cells. We show that M. leprae antigen stimulation mainly triggered the upregulation of immune related genes and that a substantial proportion of the differential gene expression is genetically controlled. Indeed, using stringent criteria, we identified 318 genes displaying cis-eQTL at an FDR of 0.01, including 66 genes displaying response-eQTL (reQTL), i.e. cis-eQTL that showed significant evidence for interaction with the M. leprae stimulus. Such reQTL correspond to regulatory variations that affect the interaction between human whole blood cells and M. leprae sonicate and, thus, likely between the human host and M. leprae bacilli. We found that reQTL were significantly enriched among binding sites of transcription factors that are activated in response to infection, and that they were enriched among single nucleotide polymorphisms (SNPs) associated with susceptibility to leprosy per se and Type-I Reaction, and seven of them have been targeted by recent positive selection. Our study suggested that natural selection shaped our genomic diversity to face pathogen exposure including M. leprae infection.

  13. Stimulation of language in the preschool. Role of the family

    Directory of Open Access Journals (Sweden)

    María del Pilar Silva Rodríguez

    2013-03-01

    Full Text Available This article makes reference about the study of the problems related with language and its stimul ation, approaching different focuses offered by those in favor of philosophical, psychological, pedagogic approaches, etc. It a lso stands out the necessity to prepare the family so that it can favor the stimulation of the language, because only with its ac tive conscious participation it is that one can maximize the integral development in the infants.

  14. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  15. [Analysis of gene mutation in a Chinese family with Norrie disease].

    Science.gov (United States)

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  16. DOG1-like genes in cereals: investigation of their function by means of ectopic expression in Arabidopsis.

    Science.gov (United States)

    Ashikawa, Ikuo; Abe, Fumitaka; Nakamura, Shingo

    2013-07-01

    The Arabidopsis gene DOG1 (AtDOG1) functions in seed dormancy and in sugar signaling. Little is known about the structural and functional features of plant genes homologous to AtDOG1, except for one type (clade 1) of Triticeae AtDOG1-like genes, which was previously demonstrated to be functionally orthologous to AtDOG1. Here, through phylogenetic, structural, and functional analyses of cereal AtDOG1-like genes, we characterized their features: these genes exist as a gene family that can be classified into five distinct clades (1-5). Of these, AtDOG1-like genes in clades 1-4 have a similar architecture to AtDOG1: they encode proteins with three conserved regions. In contrast, the clade 5 genes are distinct; their encoded proteins lack these conserved regions, but harbor domains that interact with DNA. Ectopic expression of the cereal AtDOG1-like genes of clades 2-4 in Arabidopsis demonstrated that like the clade 1 genes, they performed the same function as AtDOG1. The correlation between the depth of seed dormancy and the efficiency of sugar signaling in transgenic Arabidopsis conferred by genes in clades 1-4 suggests a close link in the underlying mechanisms between the seed dormancy and sugar signaling functions of AtDOG1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  17. Screening for germline phosphatase and tensin homolog-mutations in suspected Cowden syndrome and Cowden syndrome-like families among uterine cancer patients

    Science.gov (United States)

    TZORTZATOS, GERASIMOS; ARAVIDIS, CHRISTOS; LINDBLOM, ANNIKA; MINTS, MIRIAM; THAM, EMMA

    2015-01-01

    Cowden syndrome (CS) is an autosomal dominant disorder characterized by multiple hamartomas in the breast, thyroid and endometrium, with a prevalence of 1 per 250,000. Females with CS have a 21–28% lifetime risk of developing uterine cancer. Germline mutations in the phosphatase and tensin homolog (PTEN) gene, a tumor suppressor gene, are responsible for 30–80% of CS cases. PTEN is a nine-exon gene, located on chromosome 10q23.3, which encodes the 403 amino acid PTEN protein. It negatively regulates the phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin pathway, affecting various cellular processes and signaling pathways. The present study examined whether PTEN mutations are present in CS-like families with uterine cancer (UC). UC patients underwent surgery at Karolinska University Hospital, Stockholm, Sweden (2008–2012). Pedigrees were analyzed and 54 unrelated CS-like families were identified. CS-like families were defined as having at least one occurrence of uterine cancer and one of breast cancer, as well as at least one additional Cowden-associated tumor (uterine, breast, thyroid, colon or kidney cancer) in the same individual or in first-degree relatives. Genomic DNA was amplified using polymerase chain reaction, and DNA sequencing analysis of all nine exons of the PTEN gene was conducted. No germline PTEN mutations or polymorphisms were identified. Germline PTEN mutations are rare in CS-like families with uterine cancer, therefore, genetic screening must be restricted to patients that meet the strict National Comprehensive Cancer Network criteria. Gynecologists must be aware of the CS criteria and identify potential cases of CS in females where uterine cancer is the sentinel cancer. PMID:25789042

  18. Differential gene expression in human granulosa cells from recombinant FSH versus human menopausal gonadotropin ovarian stimulation protocols

    Directory of Open Access Journals (Sweden)

    Bietz Mandi G

    2010-03-01

    Full Text Available Abstract Background The study was designed to test the hypothesis that granulosa cell (GC gene expression response differs between recombinant FSH and human menopausal gonadotropin (hMG stimulation regimens. Methods Females Results After exclusions, 1736 genes exhibited differential expression between groups. Over 400 were categorized as signal transduction genes, ~180 as transcriptional regulators, and ~175 as enzymes/metabolic genes. Expression of selected genes was confirmed by RT-PCR. Differentially expressed genes included A kinase anchor protein 11 (AKAP11, bone morphogenetic protein receptor II (BMPR2, epidermal growth factor (EGF, insulin-like growth factor binding protein (IGFBP-4, IGFBP-5, and hypoxia-inducible factor (HIF-1 alpha. Conclusions Results suggest that major differences exist in the mechanism by which pure FSH alone versus FSH/LH regulate gene expression in preovulatory GC that could impact oocyte maturity and developmental competence.

  19. Molecular evolutionary analysis of the Alfin-like protein family in Arabidopsis lyrata, Arabidopsis thaliana, and Thellungiella halophila.

    Directory of Open Access Journals (Sweden)

    Yu Song

    Full Text Available In previous studies, the Alfin1 gene, a transcription factor, enhanced salt tolerance in alfalfa, primarily through altering gene expression levels in the root. Here, we examined the molecular evolution of the Alfin-like (AL proteins in two Arabidopsis species (A. lyrata and A. thaliana and a salt-tolerant close relative Thellungiella halophila. These AL-like proteins could be divided into four groups and the two known DUF3594 and PHD-finger domains had co-evolved within each group of genes, irrespective of species, due to gene duplication events in the common ancestor of all three species while gene loss was observed only in T. halophila. To detect whether natural selection acted in the evolution of AL genes, we calculated synonymous substitution ratios (dn/ds and codon usage statistics, finding positive selection operated on four branches and significant differences in biased codon usage in the AL family between T. halophila and A. lyrata or A. thaliana. Distinctively, only the AL7 branch was under positive selection on the PHD-finger domain and the three members on the branch showed the smallest difference when codon bias was evaluated among the seven clusters. Functional analysis based on transgenic overexpression lines and T-DNA insertion mutants indicated that salt-stress-induced AtAL7 could play a negative role in salt tolerance of A. thaliana, suggesting that adaptive evolution occurred in the members of AL gene family.

  20. Molecular characterisation of two novel maize LRR receptor-like kinases, which belong to the SERK gene family

    NARCIS (Netherlands)

    Baudino, S.; Hansen, S.; Brettschneider, R.; Hecht, V.F.G.; Dresselhaus, T.; Lörz, H.; Dumas, C.; Rogowsky, P.M.

    2001-01-01

    Genes encoding two novel members of the leucine-rich repeat receptor-like kinase (LRR-RLK) superfamily have been isolated from maize (Zea mays L.). These genes have been named ZmSERK1 and ZmSERK2 since features such as a putative leucine zipper (ZIP) and five leucine rich repeats in the

  1. Spatial and temporal expression of the Grainyhead-like transcription factor family during murine development.

    Science.gov (United States)

    Auden, Alana; Caddy, Jacinta; Wilanowski, Tomasz; Ting, Stephen B; Cunningham, John M; Jane, Stephen M

    2006-10-01

    The Drosophila transcription factor Grainyhead (grh) is expressed in ectoderm-derived tissues where it regulates several key developmental events including cuticle formation, tracheal elongation and dorsal closure. Our laboratory has recently identified three novel mammalian homologues of the grh gene, Grainyhead-like 1, -2 and -3 (Grhl1-3) that rewrite the phylogeny of this family. Using gene targeting in mice, we have shown that Grhl3 is essential for neural tube closure, skin barrier formation and wound healing. Despite their extensive sequence homology, Grhl1 and Grhl2 are unable to compensate for loss of Grhl3 in these developmental processes. To explore this lack of redundancy, and to gain further insights into the functions of this gene family in mammalian development we have performed an extensive in situ hybridisation analysis. We demonstrate that, although all three Grhl genes are highly expressed in the developing epidermis, they display subtle differences in the timing and level of expression. Surprisingly, we also demonstrate differential expression patterns in non-ectoderm-derived tissues, including the heart, the lung, and the metanephric kidney. These findings expand our understanding of the unique role of Grhl3 in neurulation and epidermal morphogenesis, and provide a focus for further functional analysis of the Grhl genes during mouse embryogenesis.

  2. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  3. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  4. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    . Jiandong Wu, Xiaolei Jing, Yang Zhao, Qing Dong, Haiyang Jiang and Qing Ma. J. Genet. 95, 53–62. Table 1. Information about DEFL genes in B. distachyon, O. sativa, S. bicolor and Z. mays. Species. Gene name. Gene identifer. ORF (aa).

  5. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  6. Effects of Transcranial Direct Current Stimulation on Expression of Immediate Early Genes (IEG’s)

    Science.gov (United States)

    2015-12-01

    TRANSCRANIAL DIRECT CURRENT STIMULATION OF EXPRESSION OF IMMEDIATE EARLY GENES (IEG’S) Jessica...AND SUBTITLE Effects of Transcranial Direct Current Stimulation on Expression of Immediate Early Genes (IEG’s) 5a. CONTRACT NUMBER In-House 5b...community in better understanding what is occurring biologically during tDCS. 15. SUBJECT TERMS Transcranial direct current stimulation

  7. Asymptotic Properties of the Number of Matching Coalescent Histories for Caterpillar-Like Families of Species Trees.

    Science.gov (United States)

    Disanto, Filippo; Rosenberg, Noah A

    2016-01-01

    Coalescent histories provide lists of species tree branches on which gene tree coalescences can take place, and their enumerative properties assist in understanding the computational complexity of calculations central in the study of gene trees and species trees. Here, we solve an enumerative problem left open by Rosenberg (IEEE/ACM Transactions on Computational Biology and Bioinformatics 10: 1253-1262, 2013) concerning the number of coalescent histories for gene trees and species trees with a matching labeled topology that belongs to a generic caterpillar-like family. By bringing a generating function approach to the study of coalescent histories, we prove that for any caterpillar-like family with seed tree t , the sequence (h n ) n ≥ 0 describing the number of matching coalescent histories of the n th tree of the family grows asymptotically as a constant multiple of the Catalan numbers. Thus, h n  ∼ β t c n , where the asymptotic constant β t > 0 depends on the shape of the seed tree t. The result extends a claim demonstrated only for seed trees with at most eight taxa to arbitrary seed trees, expanding the set of cases for which detailed enumerative properties of coalescent histories can be determined. We introduce a procedure that computes from t the constant β t as well as the algebraic expression for the generating function of the sequence (h n ) n ≥ 0 .

  8. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  9. The Role of the S40 Gene Family in Leaf Senescence

    Directory of Open Access Journals (Sweden)

    Muhammad Jehanzeb

    2017-10-01

    Full Text Available Senescence affect different traits of plants, such as the ripening of fruit, number, quality and timing of seed maturation. While senescence is induced by age, growth hormones and different environmental stresses, a highly organized genetic mechanism related to substantial changes in gene expression regulates the process. Only a few genes associated to senescence have been identified in crop plants despite the vital significance of senescence for crop yield. The S40 gene family has been shown to play a role in leaf senescence. The barley HvS40 gene is one of the senescence marker genes which shows expression during age-dependent as well as dark-induced senescence. Like barley HvS40, the Arabidopsis AtS40-3 gene is also induced during natural senescence as well as in response to treatment with abscisic acid, salicylic acid, darkness and pathogen attack. It is speculated that rice OsS40 has a similar function in the leaf senescence of rice.

  10. Molecular characterization and expression analysis of WRKY family genes in Dendrobium officinale.

    Science.gov (United States)

    Wang, Tao; Song, Zheng; Wei, Li; Li, Lubin

    2018-03-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators, and the members regulate multiple biological processes. However, there is limited information on WRKYs in Dendrobium officinale. In this study, 52 WRKY family genes of D. officinale were surveyed for the first time. Conserved domain, phylogenetic, exon-intron construction, and expression analyses were performed for the DoWRKY genes. Two major types of intron splicing (PR and VQR introns) were found, and the intron insertion position was observed to be relatively conserved in the conserved DoWRKY domains. The expression profiles of nine DoWRKYs were analyzed in cold- and methyl jasmonate (MeJA)-treated D. officinale seedlings; the DoWRKYs showed significant expression changes at different levels, which suggested their vital roles in stress tolerance. Moreover, the expression trends of most of the DoWRKYs after the simultaneous cold stress and MeJA treatment were the opposite of those of DoWRKYs after the individual cold stress and MeJA treatments, suggesting that the two stresses might have antagonistic effects and affect the adaptive capacity of the plants to stresses. Twelve DoWRKY genes were differentially expressed between symbiotic and asymbiotic germinated seeds; all were upregulated in the symbiotic germinated seeds except DoWRKY16. These differences in expression of DoWRKYs might be involved in promoting in vitro symbiotic germination of seeds with Tulasnella-like fungi. Our findings will be useful for further studies on the WRKY family genes in orchids.

  11. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  12. Slight changes in the mechanical stimulation affects osteoblast- and osteoclast-like cells in co-culture.

    Science.gov (United States)

    Kadow-Romacker, Anke; Duda, Georg N; Bormann, Nicole; Schmidmaier, Gerhard; Wildemann, Britt

    2013-12-01

    Osteoblast- and osteoclast-like cells are responsible for coordinated bone maintenance, illustrated by a balanced formation and resorption. Both parameters appear to be influenced by mechanical constrains acting on each of these cell types individually. We hypothesized that the interactions between both cell types are also influenced by mechanical stimulation. Co-cultures of osteoblast- and osteoclast-like cells were stimulated with 1,100 µstrain, 0.1 or 0.3 Hz for 1-5 min/day over 5 days. Two different setups depending on the differentiation of the osteoclast-like cells were used: i) differentiation assay for the fusion of pre-osteoclasts to osteoclasts, ii) resorption assay to determine the activity level of osteoclast-like cells. In the differentiation assay (co-culture of osteoblasts with unfused osteoclast precursor cells) the mechanical stimulation resulted in a significant decrease of collagen-1 and osteocalcin produced by osteoblast-like cells. Significantly more TRAP-iso5b was measured after stimulation for 3 min with 0.1 Hz, indicating enhanced osteoclastogenesis. In the resorption assay (co-culture of osteoblasts with fused osteoclasts) the stimulation for 3 min with 0.3 Hz significantly increased the resorption activity of osteoclasts measured by the pit formation and the collagen resorption. The same mechanical stimulation resulted in an increased collagen-1 production by the osteoblast-like cells. The ratio of RANKL/OPG was not different between the groups. These findings demonstrate that already small changes in duration or frequency of mechanical stimulation had significant consequences for the behavior of osteoblast- and osteoclast-like cells in co-culture, which partially depend on the differentiation status of the osteoclast-like cells.

  13. Clinical features and growth hormone receptor gene mutations of patients with Laron syndrome from a Chinese family.

    Science.gov (United States)

    Ying, Yan-Qin; Wei, Hong; Cao, Li-Zhi; Lu, Juan-Juan; Luo, Xiao-Ping

    2007-08-01

    Laron syndrome is an autosomal recessive disorder caused by defects of growth hormone receptor (GHR) gene. It is characterized by severe postnatal growth retardation and characteristic facial features as well as high circulating levels of growth hormone (GH) and low levels of insulin-like growth factor I (IGF-I) and insulin-like growth factor binding protein-3 (IGFBP-3). This report described the clinical features and GHR gene mutations in 2 siblings with Laron syndrome in a Chinese family. Their heights and weights were in the normal range at birth, but the growth was retarded after birth. When they presented to the clinic, the heights of the boy (8 years old) and his sister (11 years old) were 80.0 cm (-8.2 SDS) and 96.6 cm (-6.8 SDS) respectively. They had typical appearance features of Laron syndrome such as short stature and obesity, with protruding forehead, saddle nose, large eyes, sparse and thin silky hair and high-pitched voice. They had higher basal serum GH levels and lower serum levels of IGF-I, IGFBP-3 and growth hormone binding protein (GHBP) than normal controls. The peak serum GH level after colonidine and insulin stimulations in the boy was over 350 ng/mL. After one-year rhGH treatment, the boy's height increased from 80.0 cm to 83.3 cm. The gene mutation analysis revealed that two patients had same homozygous mutation of S65H (TCA -->CCA) in exon 4, which is a novel gene mutation. It was concluded that a definite diagnosis of Laron syndrome can be made based on characteristic appearance features and serum levels of GH, IGF-I, IGFBP-3 and GHBP. The S65H mutation might be the cause of Laron syndrome in the two patients.

  14. Muscle fiber type specific induction of slow myosin heavy chain 2 gene expression by electrical stimulation

    International Nuclear Information System (INIS)

    Crew, Jennifer R.; Falzari, Kanakeshwari; DiMario, Joseph X.

    2010-01-01

    Vertebrate skeletal muscle fiber types are defined by a broad array of differentially expressed contractile and metabolic protein genes. The mechanisms that establish and maintain these different fiber types vary throughout development and with changing functional demand. Chicken skeletal muscle fibers can be generally categorized as fast and fast/slow based on expression of the slow myosin heavy chain 2 (MyHC2) gene in fast/slow muscle fibers. To investigate the cellular and molecular mechanisms that control fiber type formation in secondary or fetal muscle fibers, myoblasts from the fast pectoralis major (PM) and fast/slow medial adductor (MA) muscles were isolated, allowed to differentiate in vitro, and electrically stimulated. MA muscle fibers were induced to express the slow MyHC2 gene by electrical stimulation, whereas PM muscle fibers did not express the slow MyHC2 gene under identical stimulation conditions. However, PM muscle fibers did express the slow MyHC2 gene when electrical stimulation was combined with inhibition of inositol triphosphate receptor (IP3R) activity. Electrical stimulation was sufficient to increase nuclear localization of expressed nuclear-factor-of-activated-T-cells (NFAT), NFAT-mediated transcription, and slow MyHC2 promoter activity in MA muscle fibers. In contrast, both electrical stimulation and inhibitors of IP3R activity were required for these effects in PM muscle fibers. Electrical stimulation also increased levels of peroxisome-proliferator-activated receptor-γ co-activator-1 (PGC-1α) protein in PM and MA muscle fibers. These results indicate that MA muscle fibers can be induced by electrical stimulation to express the slow MyHC2 gene and that fast PM muscle fibers are refractory to stimulation-induced slow MyHC2 gene expression due to fast PM muscle fiber specific cellular mechanisms involving IP3R activity.

  15. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Evolutionary maintenance of filovirus-like genes in bat genomes

    Directory of Open Access Journals (Sweden)

    Taylor Derek J

    2011-11-01

    Full Text Available Abstract Background Little is known of the biological significance and evolutionary maintenance of integrated non-retroviral RNA virus genes in eukaryotic host genomes. Here, we isolated novel filovirus-like genes from bat genomes and tested for evolutionary maintenance. We also estimated the age of filovirus VP35-like gene integrations and tested the phylogenetic hypotheses that there is a eutherian mammal clade and a marsupial/ebolavirus/Marburgvirus dichotomy for filoviruses. Results We detected homologous copies of VP35-like and NP-like gene integrations in both Old World and New World species of Myotis (bats. We also detected previously unknown VP35-like genes in rodents that are positionally homologous. Comprehensive phylogenetic estimates for filovirus NP-like and VP35-like loci support two main clades with a marsupial and a rodent grouping within the ebolavirus/Lloviu virus/Marburgvirus clade. The concordance of VP35-like, NP-like and mitochondrial gene trees with the expected species tree supports the notion that the copies we examined are orthologs that predate the global spread and radiation of the genus Myotis. Parametric simulations were consistent with selective maintenance for the open reading frame (ORF of VP35-like genes in Myotis. The ORF of the filovirus-like VP35 gene has been maintained in bat genomes for an estimated 13. 4 MY. ORFs were disrupted for the NP-like genes in Myotis. Likelihood ratio tests revealed that a model that accommodates positive selection is a significantly better fit to the data than a model that does not allow for positive selection for VP35-like sequences. Moreover, site-by-site analysis of selection using two methods indicated at least 25 sites in the VP35-like alignment are under positive selection in Myotis. Conclusions Our results indicate that filovirus-like elements have significance beyond genomic imprints of prior infection. That is, there appears to be, or have been, functionally maintained

  17. IGF-I, IGF-II, and Insulin Stimulate Different Gene Expression Responses through Binding to the IGF-I Receptor

    DEFF Research Database (Denmark)

    Versteyhe, Soetkin; Klaproth, Birgit; Borup, Rehannah

    2013-01-01

    Insulin and the insulin-like growth factors (IGF)-I and -II are closely related peptides important for regulation of metabolism, growth, differentiation, and development. The IGFs exert their main effects through the IGF-I receptor. Although the insulin receptor is the main physiological receptor...... for insulin, this peptide hormone can also bind at higher concentrations to the IGF-I receptor and exert effects through it. We used microarray gene expression profiling to investigate the gene expression regulated by IGF-I, IGF-II, and insulin after stimulation of the IGF-I receptor. Fibroblasts from mice......, knockout for IGF-II and the IGF-II/cation-independent mannose-6-phosphate receptor, and expressing functional IGF-I but no insulin receptors, were stimulated for 4 h with equipotent saturating concentrations of insulin, IGF-I, and IGF-II. Each ligand specifically regulated a group of transcripts...

  18. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  19. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  20. Genome-wide identification and expression analysis of SBP-like transcription factor genes in Moso Bamboo (Phyllostachys edulis).

    Science.gov (United States)

    Pan, Feng; Wang, Yue; Liu, Huanglong; Wu, Min; Chu, Wenyuan; Chen, Danmei; Xiang, Yan

    2017-06-27

    The SQUAMOSA promoter binding protein-like (SPL) proteins are plant-specific transcription factors (TFs) that function in a variety of developmental processes including growth, flower development, and signal transduction. SPL proteins are encoded by a gene family, and these genes have been characterized in two model grass species, Zea mays and Oryza sativa. The SPL gene family has not been well studied in moso bamboo (Phyllostachys edulis), a woody grass species. We identified 32 putative PeSPL genes in the P. edulis genome. Phylogenetic analysis arranged the PeSPL protein sequences in eight groups. Similarly, phylogenetic analysis of the SBP-like and SBP proteins from rice and maize clustered them into eight groups analogous to those from P. edulis. Furthermore, the deduced PeSPL proteins in each group contained very similar conserved sequence motifs. Our analyses indicate that the PeSPL genes experienced a large-scale duplication event ~15 million years ago (MYA), and that divergence between the PeSPL and OsSPL genes occurred 34 MYA. The stress-response expression profiles and tissue-specificity of the putative PeSPL gene promoter regions showed that SPL genes in moso bamboo have potential biological functions in stress resistance as well as in growth and development. We therefore examined PeSPL gene expression in response to different plant hormone and drought (polyethylene glycol-6000; PEG) treatments to mimic biotic and abiotic stresses. Expression of three (PeSPL10, -12, -17), six (PeSPL1, -10, -12, -17, -20, -31), and nine (PeSPL5, -8, -9, -14, -15, -19, -20, -31, -32) genes remained relatively stable after treating with salicylic acid (SA), gibberellic acid (GA), and PEG, respectively, while the expression patterns of other genes changed. In addition, analysis of tissue-specific expression of the moso bamboo SPL genes during development showed differences in their spatiotemporal expression patterns, and many were expressed at high levels in flowers and

  1. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  2. Insights into the Evolution of a Snake Venom Multi-Gene Family from the Genomic Organization of Echis ocellatus SVMP Genes

    Directory of Open Access Journals (Sweden)

    Libia Sanz

    2016-07-01

    Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.

  3. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  4. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  5. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  6. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    revealed that sugar transporter gene families in this woody plant are strongly comparable to those of herbaceous species. Dedicated macroarrays have provided a Vitis sugar transporter genes expression profiling, which will likely contribute to understand their physiological functions in plant and berry development. The present results might also have a significant impact on our knowledge on plant sugar transporters.

  7. Transcription factor 7-like 2 gene links increased in vivo insulin synthesis to type 2 diabetes

    NARCIS (Netherlands)

    S. Jainandunsing (Sjaam); Koole, H.R. (H. Rita); van Miert, J.N.I. (Joram N.I.); T. Rietveld (Trinet); J.L.D. Wattimena (Josias); E.J.G. Sijbrands (Eric); F.W.M. de Rooij (Felix)

    2018-01-01

    textabstractTranscription factor 7-like 2 (TCF7L2) is the main susceptibility gene for type 2 diabetes, primarily through impairing the insulin secretion by pancreatic β cells. However, the exact in vivo mechanisms remain poorly understood. We performed a family study and determined if the T risk

  8. Repeat-associated plasticity in the Helicobacter pylori RD gene family.

    Science.gov (United States)

    Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

    2009-11-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

  9. Boosting the LTP-like plasticity effect of intermittent theta-burst stimulation using gamma transcranial alternating current stimulation.

    Science.gov (United States)

    Guerra, Andrea; Suppa, Antonio; Bologna, Matteo; D'Onofrio, Valentina; Bianchini, Edoardo; Brown, Peter; Di Lazzaro, Vincenzo; Berardelli, Alfredo

    2018-03-24

    Transcranial Alternating Current Stimulation (tACS) consists in delivering electric current to the brain using an oscillatory pattern that may entrain the rhythmic activity of cortical neurons. When delivered at gamma frequency, tACS modulates motor performance and GABA-A-ergic interneuron activity. Since interneuronal discharges play a crucial role in brain plasticity phenomena, here we co-stimulated the primary motor cortex (M1) in healthy subjects by means of tACS during intermittent theta-burst stimulation (iTBS), a transcranial magnetic stimulation paradigm known to induce long-term potentiation (LTP)-like plasticity. We measured and compared motor evoked potentials before and after gamma, beta and sham tACS-iTBS. While we delivered gamma-tACS, we also measured short-interval intracortical inhibition (SICI) to detect any changes in GABA-A-ergic neurotransmission. Gamma, but not beta and sham tACS, significantly boosted and prolonged the iTBS-induced after-effects. Interestingly, the extent of the gamma tACS-iTBS after-effects correlated directly with SICI changes. Overall, our findings point to a link between gamma oscillations, interneuronal GABA-A-ergic activity and LTP-like plasticity in the human M1. Gamma tACS-iTBS co-stimulation might represent a new strategy to enhance and prolong responses to plasticity-inducing protocols, thereby lending itself to future applications in the neurorehabilitation setting. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

    Science.gov (United States)

    Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

    2007-11-01

    Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

  11. Structure and function of the human metallothionein gene family: Final technical report

    International Nuclear Information System (INIS)

    Karin, M.

    1986-01-01

    The full nucleotide sequence of two additional human metallothionein (hMT) genes has been determined. These genes, hMT-I/sub B/ and hMT-I/sub F/, are located within the MT-I gene cluster we have described originally. The hMT-I/sub F/ gene is the first hMT-I gene whose amino acid sequence is in complete agreement with the published sequence of the human MT-I proteins. Therefore it is likely to be an active gene encoding a functional protein. However, since we have just completed the sequence analysis, we have not characterized this gene further yet. The hMT-I/sub B/ gene is closely linked to the hMT-I/sub A/ gene, and two pseudogenes, hMT-I/sub C/ and hMT-I/sub D/ separate the two. From its nucleotide sequence hMT-I/sub B/ seems to be an active gene, encoding a functional protein even though it differs in four positions from the published sequence of human MT-I proteins. This gene is expressed in a human hepatoma cell line, HepG2, and its expression is stimulated by Cd ++ . Using gene fusions to the viral thymidine-kinase gene we find that hMT-I/sub B/, like the hMT-I/sub A/ and hMT-II/sub A/ genes, contains a heavy metal responsive promoterregulatory element within its 5' flanking region. We analyzed the level of hMT-I/sub B/ mRNA in a variety of human cell lines by the S1 nuclease technique, and compared it to the expression of the hMT-II/sub A/ gene. While the hMT-II/sub A/ gene was expressed in all of the cell lines analyzed, the hMT-I/sub B/ gene was expressed in liver and kidney derived cell lines cells. This suggest that the expression of the hMT-I/sub B/ gene is controlled in a tissue specific manner. 13 refs

  12. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  13. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  14. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  15. Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

    Science.gov (United States)

    Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

    2017-11-07

    The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

  16. The FMRFamide-like peptide family in nematodes

    Directory of Open Access Journals (Sweden)

    Katleen ePeymen

    2014-06-01

    Full Text Available In the three decades since the FMRFamide peptide was isolated from the mollusk Macrocallista nimbosa, structurally similar peptides sharing a C-terminal RFamide motif have been identified across the animal kingdom. FMRFamide-like peptides (FLPs represent the largest known family of neuropeptides in invertebrates. In the phylum Nematoda, at least 32 flp genes are classified, making the FLP system of nematodes unusually complex. The diversity of the nematode FLP complement is most extensively mapped in Caenorhabditis elegans, where over 70 FLPs have been predicted. FLPs have shown to be expressed in the majority of the 302 C. elegans neurons including interneurons, sensory and motor neurons. The vast expression of FLPs is reflected in the broad functional repertoire of nematode FLP signaling, including neuroendocrine and neuromodulatory effects on locomotory activity, reproduction, feeding, and behavior. In contrast to the many identified nematode FLPs, only few peptides have been assigned a receptor and there is the need to clarify the pathway components and working mechanisms of the FLP signaling network. Here, we review the diversity, distribution, and functions of FLPs in nematodes.

  17. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  18. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  19. Knock-down of transcript abundance of a family of Kunitz proteinase inhibitor genes in white clover (Trifolium repens) reveals a redundancy and diversity of gene function.

    Science.gov (United States)

    Islam, Afsana; Leung, Susanna; Burgess, Elisabeth P J; Laing, William A; Richardson, Kim A; Hofmann, Rainer W; Dijkwel, Paul P; McManus, Michael T

    2015-12-01

    The transcriptional regulation of four phylogenetically distinct members of a family of Kunitz proteinase inhibitor (KPI) genes isolated from white clover (Trifolium repens; designated Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5) has been investigated to determine their wider functional role. The four genes displayed differential transcription during seed germination, and in different tissues of the mature plant, and transcription was also ontogenetically regulated. Heterologous over-expression of Tr-KPI1, Tr-KPI2, Tr-KPI4 and Tr-KPI5 in Nicotiana tabacum retarded larval growth of the herbivore Spodoptera litura, and an increase in the transcription of the pathogenesis-related genes PR1 and PR4 was observed in the Tr-KPI1 and Tr-KPI4 over-expressing lines. RNA interference (RNAi) knock-down lines in white clover displayed significantly altered vegetative growth phenotypes with inhibition of shoot growth and a stimulation of root growth, while knock-down of Tr-KPI1, Tr-KPI2 and Tr-KPI5 transcript abundance also retarded larval growth of S. litura. Examination of these RNAi lines revealed constitutive stress-associated phenotypes as well as altered transcription of cellular signalling genes. These results reveal a functional redundancy across members of the KPI gene family. Further, the regulation of transcription of at least one member of the family, Tr-KPI2, may occupy a central role in the maintenance of a cellular homeostasis. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  20. Differential roles of TGIF family genes in mammalian reproduction

    Directory of Open Access Journals (Sweden)

    Renfree Marilyn B

    2011-09-01

    Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by

  1. Genome-wide identification and characterization of stress-associated protein (SAP gene family encoding A20/AN1 zinc-finger proteins in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Zhou Yong

    2018-01-01

    Full Text Available Stress associated proteins (SAPs play important roles in developmental processes, responses to various stresses and hormone stimulation in plants. However, little is known about the SAP gene family in Medicago truncatula. In this study, a total of 17 MtSAP genes encoding A20/AN1 zinc-finger proteins were characterized. Out of these 17 genes, 15 were distributed over all 8 chromosomes at different densities, and two segmental duplication events were detected. The phylogenetic analysis of these proteins and their orthologs from Arabidopsis and rice suggested that they could be classified into five out of the seven groups of SAP family genes, with genes in the same group showing similar structures and conserved domains. The cis-elements of the MtSAP promoters were studied, and many cis-elements related to stress and plant hormone responses were identified. We also investigated the stress-responsive expression patterns of the MtSAP genes under various stresses, including drought, exposure to NaCl and cold. The qRT-PCR results showed that numerous MtSAP genes exhibited transcriptional responses to multiple abiotic stresses. These results lay the foundation for further functional characterization of SAP genes. To the best of our knowledge, this is the first report of a genome-wide analysis of the SAP gene family in M. truncatula.

  2. Co-ordinate regulation of cytokinin gene family members during flag leaf and reproductive development in wheat.

    Science.gov (United States)

    Song, Jiancheng; Jiang, Lijun; Jameson, Paula Elizabeth

    2012-06-06

    As the global population continues to expand, increasing yield in bread wheat is of critical importance as 20% of the world's food supply is sourced from this cereal. Several recent studies of the molecular basis of grain yield indicate that the cytokinins are a key factor in determining grain yield. In this study, cytokinin gene family members in bread wheat were isolated from four multigene families which regulate cytokinin synthesis and metabolism, the isopentenyl transferases (IPT), cytokinin oxidases (CKX), zeatin O-glucosyltransferases (ZOG), and β-glucosidases (GLU). As bread wheat is hexaploid, each gene family is also likely to be represented on the A, B and D genomes. By using a novel strategy of qRT-PCR with locus-specific primers shared among the three homoeologues of each family member, detailed expression profiles are provided of family members of these multigene families expressed during leaf, spike and seed development. The expression patterns of individual members of the IPT, CKX, ZOG, and GLU multigene families in wheat are shown to be tissue- and developmentally-specific. For instance, TaIPT2 and TaCKX1 were the most highly expressed family members during early seed development, with relative expression levels of up to 90- and 900-fold higher, respectively, than those in the lowest expressed samples. The expression of two cis-ZOG genes was sharply increased in older leaves, while an extremely high mRNA level of TaGLU1-1 was detected in young leaves. Key genes with tissue- and developmentally-specific expression have been identified which would be prime targets for genetic manipulation towards yield improvement in bread wheat breeding programmes, utilising TILLING and MAS strategies.

  3. A family of neuromuscular stimulators with optical transcutaneous control.

    Science.gov (United States)

    Jarvis, J C; Salmons, S

    1991-01-01

    A family of miniature implantable neuromuscular stimulators has been developed using surface-mounted Philips 4000-series integrated circuits. The electronic components are mounted by hand on printed circuits (platinum/gold on alumina) and the electrical connections are made by reflow soldering. The plastic integrated-circuit packages, ceramic resistors and metal interconnections are protected from the body fluids by a coating of biocompatible silicone rubber. This simple technology provides reliable function for at least 4 months under implanted conditions. The circuits have in common a single lithium cell power-supply (3.2 V) and an optical sensor which can be used to detect light flashes through the skin after the device has been implanted. This information channel may be used to switch the output of a device on or off, or to cycle through a series of pre-set programs. The devices are currently finding application in studies which provide an experimental basis for the clinical exploitation of electrically stimulated skeletal muscle in cardiac assistance, sphincter reconstruction or functional electrical stimulation of paralysed limbs.

  4. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  5. A specific type of cyclin-like F-box domain gene is involved in the cryogenic autolysis of Volvariella volvacea.

    Science.gov (United States)

    Gong, Ming; Chen, Mingjie; Wang, Hong; Zhu, Qiuming; Tan, Qi

    2015-01-01

    Cryogenic autolysis is a typical phenomenon of abnormal metabolism in Volvariella volvacea. Recent studies have identified 20 significantly up-regulated genes via high-throughput sequencing of the mRNAs expressed in the mycelia of V. volvacea after cold exposure. Among these significantly up-regulated genes, 15 annotated genes were used for functional annotation cluster analysis. Our results showed that the cyclin-like F-box domain (FBDC) formed the functional cluster with the lowest P-value. We also observed a significant expansion of FBDC families in V. volvacea. Among these, the FBDC3 family displayed the maximal gene expansion in V. volvacea. Gene expression profiling analysis revealed only one FBDC gene in V. volvacea (FBDV1) that was significantly up-regulated, which is located in the FBDC3 family. Comparative genomics analysis revealed the homologous sequences of FBDV1 with high similarity were clustered on the same scaffold. However, FBDV1 was located far from these clusters, indicating the divergence of duplicated genes. Relative time estimation and rate test provided evidence for the divergence of FBDV1 after recent duplications. Real-time RT-PCR analysis confirmed that the expression of the FBDV1 was significantly up-regulated (P autolysis of V. volvacea. © 2015 by The Mycological Society of America.

  6. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  7. STIMULATION OF RESISTANCE OF BEE FAMILIES DURING WINTERING

    Directory of Open Access Journals (Sweden)

    nicolae eremia

    2013-10-01

    Full Text Available Honey bees use as food nectar, honey, pollen and bee bread. They collect nectar and pollen on flowers, that process in food - honey and bee bread. Food provides the bees body with energy due to carbohydrates, proteins, enzymes, lipids, vitamins, minerals. The goal of the studies was to stimulate the bees’ resistance during wintering against nesemosa disease in bee families’ survival after winter time and productivity increasing. There was established that the optimal dose of feed additive Pramix Bionorm P (symbiotic complex, in reserves supplementing of food of bee families during autumn is 150 mg of sugar syrup. There was revealed that using of the feed additive Pramix Bionorm P (symbiotic complex, in bees feeding for reserves supplementing of bees food ensures a stimulating of resistance at wintering of bees, decreases the quantity of used honey during wintering at one space between honey combs populated with bees, as well increases the productivity.

  8. Evolution and diversification of the CYC/TB1 gene family in Asteraceae--a comparative study in Gerbera (Mutisieae) and sunflower (Heliantheae).

    Science.gov (United States)

    Tähtiharju, Sari; Rijpkema, Anneke S; Vetterli, Adrien; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula

    2012-04-01

    Plant-specific TCP domain transcription factors have been shown to regulate morphological novelties during plant evolution, including the complex architecture of the Asteraceae inflorescence that involves different types of flowers. We conducted comparative analysis of the CYCLOIDEA/TEOSINTE BRANCHED1 (CYC/TB1) gene family in Gerbera hybrida (gerbera) and Helianthus annuus (sunflower), two species that represent distant tribes within Asteraceae. Our data confirm that the CYC/TB1 gene family has expanded in Asteraceae, a condition that appears to be connected with the increased developmental complexity and evolutionary success of this large plant family. Phylogenetic analysis of the CYC/TB1 gene family revealed both shared and lineage-specific duplications in gerbera and sunflower, corresponding to the three gene lineages previously identified as specific to core eudicots: CYC1, CYC2, and CYC3. Expression analyses of early stages of flower primordia development indicated that especially within the CYC2 clade, with the greatest number of secondary gene duplications, gene expression patterns are conserved between the species and associated with flower and inflorescence development. All sunflower and gerbera CYC2 clade genes showed differential expression between developing flower types, being upregulated in marginal ray (and trans) flowers. One gene in gerbera (GhCYC3) and two in sunflower (HaCYC2d and HaCYC2c) were indicated to be strong candidates as regulators of ray flower identity, a function that is specific for Asteraceae. Our data further showed that other CYC2 clade genes are likely to have more specialized functions at the level of single flowers, including the late functions in floral reproductive organs that may be more conserved across plant families. The expression patterns of CYC1 and CYC3 clade genes showed more differences between the two species but still pointed to possible conserved functions during vegetative plant development. Pairwise protein

  9. Gene Structures, Evolution, Classification and Expression Profiles of the Aquaporin Gene Family in Castor Bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Zhi Zou

    Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.

  10. Modern acupuncture-like stimulation methods: a literature review

    Directory of Open Access Journals (Sweden)

    Min-Ho Jun

    2015-12-01

    Full Text Available Acupuncture therapy has been proved to be effective for diverse diseases, symptoms, and conditions in numerous clinical trials. The growing popularity of acupuncture therapy has triggered the development of modern acupuncture-like stimulation devices (ASDs, which are equivalent or superior to manual acupuncture with respect to safety, decreased risk of infection, and facilitation of clinical trials. Here, we aim to summarize the research on modern ASDs, with a focus on featured devices undergoing active research and their effectiveness and target symptoms, along with annual publication rates. We searched the popular electronic databases Medline, PubMed, the Cochrane Library, and Web of Science, and analyzed English-language studies on humans. Thereby, a total of 728 studies were identified, of which 195 studies met our inclusion criteria. Electrical stimulators were found to be the earliest and most widely studied devices (133 articles, followed by laser (44 articles, magnetic (16 articles, and ultrasound (2 articles stimulators. A total of 114 studies used randomized controlled trials, and 109 studies reported therapeutic benefits. The majority of the studies (32% focused on analgesia and pain-relief effects, followed by effects on brain activity (16%. All types of the reviewed ASDs were associated with increasing annual publication trends; specifically, the annual growth in publications regarding noninvasive stimulation methods was more rapid than that regarding invasive methods. Based on this observation, we anticipate that the noninvasive or minimally invasive ASDs will become more popular in acupuncture therapy.

  11. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  12. Genome-wide analysis and heavy metal-induced expression profiling of the HMA gene family in Populus trichocarpa

    Directory of Open Access Journals (Sweden)

    Dandan eLi

    2015-12-01

    Full Text Available The heavy metal ATPase (HMA family plays an important role in transition metal transport in plants. However, this gene family has not been extensively studied in Populus trichocarpa. We identified 17 HMA genes in P. trichocarpa (PtHMAs, of which PtHMA1–PtHMA4 belonged to the zinc (Zn/cobalt (Co/cadmium (Cd/lead (Pb subgroup, and PtHMA5–PtHMA8 were members of the copper (Cu/silver (Ag subgroup. Most of the genes were localized to chromosomes I and III. Gene structure, gene chromosomal location, and synteny analyses of PtHMAs indicated that tandem and segmental duplications likely contributed to the expansion and evolution of the PtHMAs. Most of the HMA genes contained abiotic stress-related cis-elements. Tissue-specific expression of PtHMA genes showed that PtHMA1 and PtHMA4 had relatively high expression levels in the leaves, whereas Cu/Ag subgroup (PtHMA5.1- PtHMA8 genes were upregulated in the roots. High concentrations of Cu, Ag, Zn, Cd, Co, Pb and Mn differentially regulated the expression of PtHMAs in various tissues. The preliminary results of the present study generated basic information on the HMA family of Populus that may serve as foundation for future functional studies.

  13. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  14. Outgroup, alignment and modelling improvements indicate that two TNFSF13-like genes existed in the vertebrate ancestor.

    Science.gov (United States)

    Redmond, Anthony K; Pettinello, Rita; Dooley, Helen

    2017-03-01

    The molecular machinery required for lymphocyte development and differentiation appears to have emerged concomitantly with distinct B- and T-like lymphocyte subsets in the ancestor of all vertebrates. The TNFSF superfamily (TNFSF) members BAFF (TNFSF13/Blys) and APRIL (TNFSF13) are key regulators of B cell development survival, and activation in mammals, but the temporal emergence of these molecules, and their precise relationship to the newly identified TNFSF gene BALM (BAFF and APRIL-like molecule), have not yet been elucidated. Here, to resolve the early evolutionary history of this family, we improved outgroup sampling and alignment quality, and applied better fitting substitution models compared to past studies. Our analyses reveal that BALM is a definitive TNFSF13 family member, which split from BAFF in the gnathostome (jawed vertebrate) ancestor. Most importantly, however, we show that both the APRIL and BAFF lineages existed in the ancestors of all extant vertebrates. This implies that APRIL has been lost, or is yet to be found, in cyclostomes (jawless vertebrates). Our results suggest that lineage-specific gene duplication and loss events have caused lymphocyte regulation, despite shared origins, to become secondarily distinct between gnathostomes and cyclostomes. Finally, the structure of lamprey BAFF-like, and its phylogenetic placement as sister to BAFF and BALM, but not the more slowly evolving APRIL, indicates that the primordial lymphocyte regulator was more APRIL-like than BAFF-like.

  15. Guinea pig ID-like families of SINEs.

    Science.gov (United States)

    Kass, David H; Schaetz, Brian A; Beitler, Lindsey; Bonney, Kevin M; Jamison, Nicole; Wiesner, Cathy

    2009-05-01

    Previous studies have indicated a paucity of SINEs within the genomes of the guinea pig and nutria, representatives of the Hystricognathi suborder of rodents. More recent work has shown that the guinea pig genome contains a large number of B1 elements, expanding to various levels among different rodents. In this work we utilized A-B PCR and screened GenBank with sequences from isolated clones to identify potentially uncharacterized SINEs within the guinea pig genome, and identified numerous sequences with a high degree of similarity (>92%) specific to the guinea pig. The presence of A-tails and flanking direct repeats associated with these sequences supported the identification of a full-length SINE, with a consensus sequence notably distinct from other rodent SINEs. Although most similar to the ID SINE, it clearly was not derived from the known ID master gene (BC1), hence we refer to this element as guinea pig ID-like (GPIDL). Using the consensus to screen the guinea pig genomic database (Assembly CavPor2) with Ensembl BlastView, we estimated at least 100,000 copies, which contrasts markedly to just over 100 copies of ID elements. Additionally we provided evidence of recent integrations of GPIDL as two of seven analyzed conserved GPIDL-containing loci demonstrated presence/absence variants in Cavia porcellus and C. aperea. Using intra-IDL PCR and sequence analyses we also provide evidence that GPIDL is derived from a hystricognath-specific SINE family. These results demonstrate that this SINE family continues to contribute to the dynamics of genomes of hystricognath rodents.

  16. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  17. Genome-wide identification and analysis of the SBP-box family genes in apple (Malus × domestica Borkh.).

    Science.gov (United States)

    Li, Jun; Hou, Hongmin; Li, Xiaoqin; Xiang, Jiang; Yin, Xiangjing; Gao, Hua; Zheng, Yi; Bassett, Carole L; Wang, Xiping

    2013-09-01

    SQUAMOSA promoter binding protein (SBP)-box genes encode a family of plant-specific transcription factors and play many crucial roles in plant development. In this study, 27 SBP-box gene family members were identified in the apple (Malus × domestica Borkh.) genome, 15 of which were suggested to be putative targets of MdmiR156. Plant SBPs were classified into eight groups according to the phylogenetic analysis of SBP-domain proteins. Gene structure, gene chromosomal location and synteny analyses of MdSBP genes within the apple genome demonstrated that tandem and segmental duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of the SBP-box gene family in apple. Additionally, synteny analysis between apple and Arabidopsis indicated that several paired homologs of MdSBP and AtSPL genes were located in syntenic genomic regions. Tissue-specific expression analysis of MdSBP genes in apple demonstrated their diversified spatiotemporal expression patterns. Most MdmiR156-targeted MdSBP genes, which had relatively high transcript levels in stems, leaves, apical buds and some floral organs, exhibited a more differential expression pattern than most MdmiR156-nontargeted MdSBP genes. Finally, expression analysis of MdSBP genes in leaves upon various plant hormone treatments showed that many MdSBP genes were responsive to different plant hormones, indicating that MdSBP genes may be involved in responses to hormone signaling during stress or in apple development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  18. Nuclear topography of beta-like globin gene cluster in IL-3-stimulated human leukemic K-562 cells

    Czech Academy of Sciences Publication Activity Database

    Galiová-Šustáčková, Gabriela; Bártová, Eva; Kozubek, Stanislav

    2004-01-01

    Roč. 33, č. 1 (2004), s. 4-14 ISSN 1079-9796 R&D Projects: GA ČR GA301/01/0186; GA AV ČR KSK5052113; GA AV ČR IAA5004306; GA ČR GA202/04/0907; GA MŠk ME 565 Institutional research plan: CEZ:AV0Z5004920 Keywords : beta-like globin gene cluster * K-562 cells * nuclear topography Subject RIV: BO - Biophysics Impact factor: 2.549, year: 2004

  19. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  20. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  1. Coevolution of aah: A dps-Like Gene with the Host Bacterium Revealed by Comparative Genomic Analysis

    Directory of Open Access Journals (Sweden)

    Liyan Ping

    2012-01-01

    Full Text Available A protein named AAH was isolated from the bacterium Microbacterium arborescens SE14, a gut commensal of the lepidopteran larvae. It showed not only a high sequence similarity to Dps-like proteins (DNA-binding proteins from starved cell but also reversible hydrolase activity. A comparative genomic analysis was performed to gain more insights into its evolution. The GC profile of the aah gene indicated that it was evolved from a low GC ancestor. Its stop codon usage was also different from the general pattern of Actinobacterial genomes. The phylogeny of dps-like proteins showed strong correlation with the phylogeny of host bacteria. A conserved genomic synteny was identified in some taxonomically related Actinobacteria, suggesting that the ancestor genes had incorporated into the genome before the divergence of Micrococcineae from other families. The aah gene had evolved new function but still retained the typical dodecameric structure.

  2. Phylogenetic Analysis, Lineage-Specific Expansion and Functional Divergence of seed dormancy 4-Like Genes in Plants.

    Directory of Open Access Journals (Sweden)

    Saminathan Subburaj

    Full Text Available The rice gene seed dormancy 4 (OsSdr4 functions in seed dormancy and is a major factor associated with pre-harvest sprouting (PHS. Although previous studies of this protein family were reported for rice and other species, knowledge of the evolution of genes homologous to OsSdr4 in plants remains inadequate. Fifty four Sdr4-like (hereafter designated Sdr4L genes were identified in nine plant lineages including 36 species. Phylogenetic analysis placed these genes in eight subfamilies (I-VIII. Genes from the same lineage clustered together, supported by analysis of conserved motifs and exon-intron patterns. Segmental duplications were present in both dicot and monocot clusters, while tandemly duplicated genes occurred only in monocot clusters indicating that both tandem and segmental duplications contributed to expansion of the grass I and II subfamilies. Estimation of the approximate ages of the duplication events indicated that ancestral Sdr4 genes evolved from a common angiosperm ancestor, about 160 million years ago (MYA. Moreover, diversification of Sdr4L genes in mono and dicot plants was mainly associated with genome-wide duplication and speciation events. Functional divergence was observed in all subfamily pairs, except IV/VIIIa. Further analysis indicated that functional constraints between subfamily pairs I/II, I/VIIIb, II/VI, II/VIIIb, II/IV, and VI/VIIIb were statistically significant. Site and branch-site model analyses of positive selection suggested that these genes were under strong adaptive selection pressure. Critical amino acids detected for both functional divergence and positive selection were mostly located in the loops, pointing to functional importance of these regions in this protein family. In addition, differential expression studies by transcriptome atlas of 11 Sdr4L genes showed that the duplicated genes may have undergone divergence in expression between plant species. Our findings showed that Sdr4L genes are

  3. The patatin-like lipase family in Gallus gallus

    Directory of Open Access Journals (Sweden)

    Nimpf Johannes

    2008-06-01

    Full Text Available Abstract Background In oviparous species, genes encoding proteins with functions in lipid remodeling, such as specialized lipases, may have evolved to facilitate the assembly and utilization of yolk lipids by the embryo. The mammalian gene family of patatin-like phospholipases (PNPLAs has received significant attention, but studies in other vertebrates are lacking; thus, we have begun investigations of PNPLA genes in the chicken (Gallus gallus. Results We scanned the draft chicken genome using human PNPLA sequences, and performed PCR to amplify and sequence orthologous cDNAs. Full-length cDNA sequences of galline PNPLA2/ATGL, PNPLA4, -7, -8, -9, and the activator protein CGI-58, as well as partial cDNA sequences of avian PNPLA1, -3, and -6 were obtained. The high degree of sequence identities (~50 to 80% between the avian and human orthologs suggests conservation of important enzymatic functions. Quantitation by qPCR of the transcript levels of PNPLAs and CGI-58 in 21 tissues indicates that expression patterns and levels diverge greatly between species. A particularly interesting tissue in which certain PNPLAs may contribute to physiological specialization is the extraembryonic yolk sac. Conclusion Knowledge about the exact in-vivo functions of PNPLAs in any system is still sparse. Thus, studies about the temporal expression patterns and functions of the enzymes identified here, and of other already known extracellular lipases and co-factors, in the yolk sac and embryonic tissues during embryogenesis are called for. Based on the information obtained, further studies are anticipated to provide important insights of the roles of PNPLAs in the yolk sac and embryo development.

  4. Salix purpurea Stimulates the Expression of Specific Bacterial Xenobiotic Degradation Genes in a Soil Contaminated with Hydrocarbons.

    Directory of Open Access Journals (Sweden)

    Antoine P Pagé

    Full Text Available The objectives of this study were to uncover Salix purpurea-microbe xenobiotic degradation systems that could be harnessed in rhizoremediation, and to identify microorganisms that are likely involved in these partnerships. To do so, we tested S. purpurea's ability to stimulate the expression of 10 marker microbial oxygenase genes in a soil contaminated with hydrocarbons. In what appeared to be a detoxification rhizosphere effect, transcripts encoding for alkane 1-monooxygenases, cytochrome P450 monooxygenases, laccase/polyphenol oxidases, and biphenyl 2,3-dioxygenase small subunits were significantly more abundant in the vicinity of the plant's roots than in bulk soil. This gene expression induction is consistent with willows' known rhizoremediation capabilities, and suggests the existence of S. purpurea-microbe systems that target many organic contaminants of interest (i.e. C4-C16 alkanes, fluoranthene, anthracene, benzo(apyrene, biphenyl, polychlorinated biphenyls. An enhanced expression of the 4 genes was also observed within the bacterial orders Actinomycetales, Rhodospirillales, Burkholderiales, Alteromonadales, Solirubrobacterales, Caulobacterales, and Rhizobiales, which suggest that members of these taxa are active participants in the exposed partnerships. Although the expression of the other 6 marker genes did not appear to be stimulated by the plant at the community level, signs of additional systems that rest on their expression by members of the orders Solirubrobacterales, Sphingomonadales, Actinomycetales, and Sphingobacteriales were observed. Our study presents the first transcriptomics-based identification of microbes whose xenobiotic degradation activity in soil appears stimulated by a plant. It paints a portrait that contrasts with the current views on these consortia's composition, and opens the door for the development of laboratory test models geared towards the identification of root exudate characteristics that limit the

  5. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

    2007-01-01

    from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

  6. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  7. Mitogen activated protein kinases selectively regulate palytoxin-stimulated gene expression in mouse keratinocytes

    International Nuclear Information System (INIS)

    Zeliadt, Nicholette A.; Warmka, Janel K.; Wattenberg, Elizabeth V.

    2003-01-01

    We have been investigating how the novel skin tumor promoter palytoxin transmits signals through mitogen activated protein kinases (MAPKs). Palytoxin activates three major MAPKs, extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), and p38, in a keratinocyte cell line derived from initiated mouse skin (308). We previously showed that palytoxin requires ERK to increase matrix metalloproteinase-13 (MMP-13) gene expression, an enzyme implicated in carcinogenesis. Diverse stimuli require JNK and p38 to increase MMP-13 gene expression, however. We therefore used the JNK and p38 inhibitors SP 600125 and SB 202190, respectively, to investigate the role of these MAPKs in palytoxin-induced MMP-13 gene expression. Surprisingly, palytoxin does not require JNK and p38 to increase MMP-13 gene expression. Accordingly, ERK activation, independent of palytoxin and in the absence of JNK and p38 activation, is sufficient to induce MMP-13 gene expression in 308 keratinocytes. Dexamethasone, a synthetic glucocorticoid that inhibits activator protein-1 (AP-1), blocked palytoxin-stimulated MMP-13 gene expression. Therefore, the AP-1 site present in the promoter of the MMP-13 gene appears to be functional and to play a key role in palytoxin-stimulated gene expression. Previous studies showed that palytoxin simulates an ERK-dependent selective increase in the c-Fos content of AP-1 complexes that bind to the promoter of the MMP-13 gene. JNK and p38 can also modulate c-Fos. Palytoxin does not require JNK or p38 to increase c-Fos binding, however. Altogether, these studies indicate that ERK plays a distinctly essential role in transmitting palytoxin-stimulated signals to specific nuclear targets in keratinocytes derived from initiated mouse skin

  8. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  9. Receptor-like protein-tyrosine phosphatase alpha specifically inhibits insulin-increased prolactin gene expression

    DEFF Research Database (Denmark)

    Jacob, K K; Sap, J; Stanley, F M

    1998-01-01

    A physiologically relevant response to insulin, stimulation of prolactin promoter activity in GH4 pituitary cells, was used as an assay to study the specificity of protein-tyrosine phosphatase function. Receptor-like protein-tyrosine phosphatase alpha (RPTPalpha) blocks the effect of insulin...... is specific by two criteria. A number of potential RPTPalpha targets were ruled out by finding (a) that they are not affected or (b) that they are not on the pathway to insulin-increased prolactin-CAT activity. The negative effect of RPTPalpha on insulin activation of the prolactin promoter is not due...... to reduced phosphorylation or kinase activity of the insulin receptor or to reduced phosphorylation of insulin receptor substrate-1 or Shc. Inhibitor studies suggest that insulin-increased prolactin gene expression is mediated by a Ras-like GTPase but is not mitogen-activated protein kinase dependent...

  10. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  11. Unique nonstructural proteins of Pneumonia Virus of Mice (PVM) promote degradation of interferon (IFN) pathway components and IFN-stimulated gene proteins.

    Science.gov (United States)

    Dhar, Jayeeta; Barik, Sailen

    2016-12-01

    Pneumonia Virus of Mice (PVM) is the only virus that shares the Pneumovirus genus of the Paramyxoviridae family with Respiratory Syncytial Virus (RSV). A deadly mouse pathogen, PVM has the potential to serve as a robust animal model of RSV infection, since human RSV does not fully replicate the human pathology in mice. Like RSV, PVM also encodes two nonstructural proteins that have been implicated to suppress the IFN pathway, but surprisingly, they exhibit no sequence similarity with their RSV equivalents. The molecular mechanism of PVM NS function, therefore, remains unknown. Here, we show that recombinant PVM NS proteins degrade the mouse counterparts of the IFN pathway components. Proteasomal degradation appears to be mediated by ubiquitination promoted by PVM NS proteins. Interestingly, NS proteins of PVM lowered the levels of several ISG (IFN-stimulated gene) proteins as well. These results provide a molecular foundation for the mechanisms by which PVM efficiently subverts the IFN response of the murine cell. They also reveal that in spite of their high sequence dissimilarity, the two pneumoviral NS proteins are functionally and mechanistically similar.

  12. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

  13. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  14. Microevolution of Virulence-Related Genes in Helicobacter pylori Familial Infection.

    Directory of Open Access Journals (Sweden)

    Yoshikazu Furuta

    Full Text Available Helicobacter pylori, a bacterial pathogen that can infect human stomach causing gastritis, ulcers and cancer, is known to have a high degree of genome/epigenome diversity as the result of mutation and recombination. The bacteria often infect in childhood and persist for the life of the host. One of the reasons of the rapid evolution of H. pylori is that it changes its genome drastically for adaptation to a new host. To investigate microevolution and adaptation of the H. pylori genome, we undertook whole genome sequencing of the same or very similar sequence type in multi-locus sequence typing (MLST with seven genes in members of the same family consisting of parents and children in Japan. Detection of nucleotide substitutions revealed likely transmission pathways involving children. Nonsynonymous (amino acid changing mutations were found in virulence-related genes (cag genes, vacA, hcpDX, tnfα, ggt, htrA and the collagenase gene, outer membrane protein (OMP genes and other cell surface-related protein genes, signal transduction genes and restriction-modification genes. We reconstructed various pathways by which H. pylori can adapt to a new human host, and our results raised the possibility that the mutational changes in virulence-related genes have a role in adaptation to a child host. Changes in restriction-modification genes might remodel the methylome and transcriptome to help adaptation. This study has provided insights into H. pylori transmission and virulence and has implications for basic research as well as clinical practice.

  15. Genomic and expression analysis of the flax (Linum usitatissimum) family of glycosyl hydrolase 35 genes.

    Science.gov (United States)

    Hobson, Neil; Deyholos, Michael K

    2013-05-23

    Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require

  16. Influence of EARLI1-like genes on flowering time and lignin synthesis of Arabidopsis thaliana.

    Science.gov (United States)

    Shi, Y; Zhang, X; Xu, Z-Y; Li, L; Zhang, C; Schläppi, M; Xu, Z-Q

    2011-09-01

    EARLI1 encodes a 14.7 kDa protein in the cell wall, is a member of the PRP (proline-rich protein) family and has multiple functions, including resistance to low temperature and fungal infection. RNA gel blot analyses in the present work indicated that expression of EARLI1-like genes, EARLI1, At4G12470 and At4G12490, was down-regulated in Col-FRI-Sf2 RNAi plants derived from transformation with Agrobacterium strain ABI, which contains a construct encoding a double-strand RNA targeting 8CM of EARLI1. Phenotype analyses revealed that Col-FRI-Sf2 RNAi plants of EARLI1 flowered earlier than Col-FRI-Sf2 wild-type plants. The average bolting time of Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants was 39.7 and 19.4 days, respectively, under a long-day photoperiod. In addition, there were significant differences in main stem length, internode number and rosette leaf number between Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants. RT-PCR showed that EARLI1-like genes might delay flowering time through the autonomous and long-day photoperiod pathways by maintaining the abundance of FLC transcripts. In Col-FRI-Sf2 RNAi plants, transcription of FLC was repressed, while expression of SOC1 and FT was activated. Microscopy observations showed that EARLI1-like genes were also associated with morphogenesis of leaf cells in Arabidopsis. Using histochemical staining, EARLI1-like genes were found to be involved in regulation of lignin synthesis in inflorescence stems, and Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants had 9.67% and 8.76% dry weight lignin, respectively. Expression analysis revealed that cinnamoyl-CoA reductase, a key enzyme in lignin synthesis, was influenced by EARLI1-like genes. These data all suggest that EARLI1-like genes could control the flowering process and lignin synthesis in Arabidopsis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

  17. Topology of transmembrane channel-like gene 1 protein.

    Science.gov (United States)

    Labay, Valentina; Weichert, Rachel M; Makishima, Tomoko; Griffith, Andrew J

    2010-10-05

    Mutations of transmembrane channel-like gene 1 (TMC1) cause hearing loss in humans and mice. TMC1 is the founding member of a family of genes encoding proteins of unknown function that are predicted to contain multiple transmembrane domains. The goal of our study was to define the topology of mouse TMC1 expressed heterologously in tissue culture cells. TMC1 was retained in the endoplasmic reticulum (ER) membrane of five tissue culture cell lines that we tested. We used anti-TMC1 and anti-HA antibodies to probe the topologic orientation of three native epitopes and seven HA epitope tags along full-length TMC1 after selective or complete permeabilization of transfected cells with digitonin or Triton X-100, respectively. TMC1 was present within the ER as an integral membrane protein containing six transmembrane domains and cytosolic N- and C-termini. There is a large cytoplasmic loop, between the fourth and fifth transmembrane domains, with two highly conserved hydrophobic regions that might associate with or penetrate, but do not span, the plasma membrane. Our study is the first to demonstrate that TMC1 is a transmembrane protein. The topologic organization revealed by this study shares some features with that of the shaker-TRP superfamily of ion channels.

  18. Glucocorticoid stimulates expression of corticotropin-releasing hormone gene in human placenta

    International Nuclear Information System (INIS)

    Robinson, B.G.; Emanuel, R.L.; Frim, D.M.; Majzoub, J.A.

    1988-01-01

    Primary cultures of purified human cytotrophoblasts have been used to examine the expression of the corticotropin-releasing hormone (CRH) gene in placenta. The authors report here that glucocorticoids stimulate placental CRH synthesis and secretion in primary cultures of human placenta. This stimulation is in contrast to the glucocorticoid suppression of CRH expression in hypothalamus. The positive regulation of CRH by glucocorticoids suggests that the rise in CRH preceding parturition could result from the previously described rise in fetal glucocorticoids. Furthermore, this increase in placental CRH could stimulate, via adrenocorticotropic hormone, a further rise in fetal glucocorticoids, completing a positive feedback loop that would be terminated by delivery

  19. Inherited STING-activating mutation underlies a familial inflammatory syndrome with lupus-like manifestations.

    Science.gov (United States)

    Jeremiah, Nadia; Neven, Bénédicte; Gentili, Matteo; Callebaut, Isabelle; Maschalidi, Sophia; Stolzenberg, Marie-Claude; Goudin, Nicolas; Frémond, Marie-Louis; Nitschke, Patrick; Molina, Thierry J; Blanche, Stéphane; Picard, Capucine; Rice, Gillian I; Crow, Yanick J; Manel, Nicolas; Fischer, Alain; Bader-Meunier, Brigitte; Rieux-Laucat, Frédéric

    2014-12-01

    Innate immunity to viral infection involves induction of the type I IFN response; however, dysfunctional regulation of this pathway leads to inappropriate inflammation. Here, we evaluated a nonconsanguineous family of mixed European descent, with 4 members affected by systemic inflammatory and autoimmune conditions, including lupus, with variable clinical expression. We identified a germline dominant gain-of-function mutation in TMEM173, which encodes stimulator of type I IFN gene (STING), in the affected individuals. STING is a key signaling molecule in cytosolic DNA-sensing pathways, and STING activation normally requires dimerization, which is induced by 2'3' cyclic GMP-AMP (cGAMP) produced by the cGAMP synthase in response to cytosolic DNA. Structural modeling supported constitutive activation of the mutant STING protein based on stabilized dimerization. In agreement with the model predictions, we found that the STING mutant spontaneously localizes in the Golgi of patient fibroblasts and is constitutively active in the absence of exogenous 2'3'-cGAMP in vitro. Accordingly, we observed elevated serum IFN activity and a type I IFN signature in peripheral blood from affected family members. These findings highlight the key role of STING in activating both the innate and adaptive immune responses and implicate aberrant STING activation in features of human lupus.

  20. A cryptochrome-like protein is involved in the regulation of photosynthesis genes in Rhodobacter sphaeroides.

    Science.gov (United States)

    Hendrischk, Anne-Kathrin; Frühwirth, Sebastian Walter; Moldt, Julia; Pokorny, Richard; Metz, Sebastian; Kaiser, Gebhard; Jäger, Andreas; Batschauer, Alfred; Klug, Gabriele

    2009-11-01

    Blue light receptors belonging to the cryptochrome/photolyase family are found in all kingdoms of life. The functions of photolyases in repair of UV-damaged DNA as well as of cryptochromes in the light-dependent regulation of photomorphogenetic processes and in the circadian clock in plants and animals are well analysed. In prokaryotes, the only role of members of this protein family that could be demonstrated is DNA repair. Recently, we identified a gene for a cryptochrome-like protein (CryB) in the alpha-proteobacterium Rhodobacter sphaeroides. The protein lacks the typical C-terminal extension of cryptochromes, and is not related to the Cry DASH family. Here we demonstrate that CryB binds flavin adenine dinucleotide that can be photoreduced by blue light. CryB binds single-stranded DNA with very high affinity (K(d) approximately 10(-8) M) but double-stranded DNA and single-stranded RNA with far lower affinity (K(d) approximately 10(-6) M). Despite of that, no in vitro repair activity for pyrimidine dimers in single-stranded DNA could be detected. However, we show that CryB clearly affects the expression of genes for pigment-binding proteins and consequently the amount of photosynthetic complexes in R. sphaeroides. Thus, for the first time a role of a bacterial cryptochrome in gene regulation together with a biological function is demonstrated.

  1. Kaempferol stimulates gene expression of low-density lipoprotein receptor through activation of Sp1 in cultured hepatocytes

    Science.gov (United States)

    Ochiai, Ayasa; Miyata, Shingo; Iwase, Masamori; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2016-01-01

    A high level of plasma low-density lipoprotein (LDL) cholesterol is considered a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) is essential for clearing plasma LDL cholesterol, activation of LDLR is a promising therapeutic target for patients with atherosclerotic disease. Here we demonstrated how the flavonoid kaempferol stimulated the gene expression and activity of LDLR in HepG2 cells. The kaempferol-mediated stimulation of LDLR gene expression was completely inhibited by knockdown of Sp1 gene expression. Treatment of HepG2 cells with kaempferol stimulated the recruitment of Sp1 to the promoter region of the LDLR gene, as well as the phosphorylation of Sp1 on Thr-453 and Thr-739. Moreover, these kaempferol-mediated processes were inhibited in the presence of U0126, an ERK pathway inhibitor. These results suggest that kaempferol may increase the activity of Sp1 through stimulation of Sp1 phosphorylation by ERK1/2 and subsequent induction of LDLR expression and activity. PMID:27109240

  2. Heat Stress and Lipopolysaccharide Stimulation of Chicken Macrophage-Like Cell Line Activates Expression of Distinct Sets of Genes.

    Directory of Open Access Journals (Sweden)

    Anna Slawinska

    Full Text Available Acute heat stress requires immediate adjustment of the stressed individual to sudden changes of ambient temperatures. Chickens are particularly sensitive to heat stress due to development of insufficient physiological mechanisms to mitigate its effects. One of the symptoms of heat stress is endotoxemia that results from release of the lipopolysaccharide (LPS from the guts. Heat-related cytotoxicity is mitigated by the innate immune system, which is comprised mostly of phagocytic cells such as monocytes and macrophages. The objective of this study was to analyze the molecular responses of the chicken macrophage-like HD11 cell line to combined heat stress and lipopolysaccharide treatment in vitro. The cells were heat-stressed and then allowed a temperature-recovery period, during which the gene expression was investigated. LPS was added to the cells to mimic the heat-stress-related endotoxemia. Semi high-throughput gene expression analysis was used to study a gene panel comprised of heat shock proteins, stress-related genes, signaling molecules and immune response genes. HD11 cell line responded to heat stress with increased mRNA abundance of the HSP25, HSPA2 and HSPH1 chaperones as well as DNAJA4 and DNAJB6 co-chaperones. The anti-apoptotic gene BAG3 was also highly up-regulated, providing evidence that the cells expressed pro-survival processes. The immune response of the HD11 cell line to LPS in the heat stress environment (up-regulation of CCL4, CCL5, IL1B, IL8 and iNOS was higher than in thermoneutral conditions. However, the peak in the transcriptional regulation of the immune genes was after two hours of temperature-recovery. Therefore, we propose the potential influence of the extracellular heat shock proteins not only in mitigating effects of abiotic stress but also in triggering the higher level of the immune responses. Finally, use of correlation networks for the data analysis aided in discovering subtle differences in the gene

  3. AIM2-Like Receptors Positively and Negatively Regulate the Interferon Response Induced by Cytosolic DNA

    Directory of Open Access Journals (Sweden)

    Yuki Nakaya

    2017-07-01

    Full Text Available Cytosolic DNAs derived from retrotransposons serve as pathogen-associated molecular patterns for pattern recognition receptors (PRRs that stimulate the induction of interferons (IFNs and other cytokines, leading to autoimmune disease. Cyclic GMP-AMP synthase is one PRR that senses retrotransposon DNA, activating type I IFN responses through the stimulator of IFN genes (STING. Absent in melanoma 2 (AIM2-like receptors (ALRs have also been implicated in these pathways. Here we show that the mouse ALR IFI205 senses cytosolic retrotransposon DNA independently of cyclic GMP-AMP production. AIM2 antagonizes IFI205-mediated IFN induction activity by sequestering it from STING. We also found that the complement of genes located in the ALR locus in C57BL/6 and AIM2 knockout mice are different and unique, which has implications for interpretation of the sensing of pathogens in different mouse strains. Our data suggest that members of the ALR family are critical to the host IFN response to endogenous DNA.

  4. A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

    Directory of Open Access Journals (Sweden)

    Hewitt Jane E

    2010-11-01

    Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

  5. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  6. Lysophosphatidic acid stimulates thrombomodulin lectin-like domain shedding in human endothelial cells

    International Nuclear Information System (INIS)

    Wu Hualin; Lin ChiIou; Huang Yuanli; Chen, Pin-Shern; Kuo, Cheng-Hsiang; Chen, Mei-Shing; Wu, G.C.-C.; Shi, G.-Y.; Yang, H.-Y.; Lee Hsinyu

    2008-01-01

    Thrombomodulin (TM) is an anticoagulant glycoprotein highly expressed on endothelial cell surfaces. Increased levels of soluble TM in circulation have been widely accepted as an indicator of endothelial damage or dysfunction. Previous studies indicated that various proinflammatory factors stimulate TM shedding in various cell types such as smooth muscle cells and epithelial cells. Lysophosphatidic acid (LPA) is a bioactive lipid mediator present in biological fluids during endothelial damage or injury. In the present study, we first observed that LPA triggered TM shedding in human umbilical vein endothelial cells (HUVECs). By Cyflow analysis, we showed that the LPA-induced accessibility of antibodies to the endothelial growth factor (EGF)-like domain of TM is independent of matrix metalloproteinases (MMPs), while LPA-induced TM lectin-like domain shedding is MMP-dependent. Furthermore, a stable cell line expressing TM without its lectin-like domain exhibited a higher cell proliferation rate than a stable cell line expressing full-length TM. These results imply that LPA induces TM lectin-like domain shedding, which might contribute to the exposure of its EGF-like domain for EGF receptor (EGFR) binding, thereby stimulating subsequent cell proliferation. Based on our findings, we propose a novel mechanism for the exposure of TM EGF-like domain, which possibly mediates LPA-induced EGFR transactivation

  7. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  8. Characterization of cytokinin signaling and homeostasis gene families in two hardwood tree species: Populus trichocarpa and Prunus persica.

    Science.gov (United States)

    Immanen, Juha; Nieminen, Kaisa; Duchens Silva, Héctor; Rodríguez Rojas, Fernanda; Meisel, Lee A; Silva, Herman; Albert, Victor A; Hvidsten, Torgeir R; Helariutta, Ykä

    2013-12-16

    Through the diversity of cytokinin regulated processes, this phytohormone has a profound impact on plant growth and development. Cytokinin signaling is involved in the control of apical and lateral meristem activity, branching pattern of the shoot, and leaf senescence. These processes influence several traits, including the stem diameter, shoot architecture, and perennial life cycle, which define the development of woody plants. To facilitate research about the role of cytokinin in regulation of woody plant development, we have identified genes associated with cytokinin signaling and homeostasis pathways from two hardwood tree species. Taking advantage of the sequenced black cottonwood (Populus trichocarpa) and peach (Prunus persica) genomes, we have compiled a comprehensive list of genes involved in these pathways. We identified genes belonging to the six families of cytokinin oxidases (CKXs), isopentenyl transferases (IPTs), LONELY GUY genes (LOGs), two-component receptors, histidine containing phosphotransmitters (HPts), and response regulators (RRs). All together 85 Populus and 45 Prunus genes were identified, and compared to their Arabidopsis orthologs through phylogenetic analyses. In general, when compared to Arabidopsis, differences in gene family structure were often seen in only one of the two tree species. However, one class of genes associated with cytokinin signal transduction, the CKI1-like family of two-component histidine kinases, was larger in both Populus and Prunus than in Arabidopsis.

  9. Type III Bartter-like syndrome in an infant boy with Gitelman syndrome and autosomal dominant familial neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Brugnara, Milena; Gaudino, Rossella; Tedeschi, Silvana; Syrèn, Marie-Louise; Perrotta, Silverio; Maines, Evelina; Zaffanello, Marco

    2014-09-01

    We report the case of an infant boy with polyuria and a familial history of central diabetes insipidus. Laboratory blood tests disclosed hypokalemia, metabolic alkalosis, hyperreninemia, and hyperaldosteronism. Plasma magnesium concentration was slightly low. Urine analysis showed hypercalciuria, hyposthenuria, and high excretion of potassium. Such findings oriented toward type III Bartter syndrome (BSIII). Direct sequencing of the CLCNKB gene revealed no disease-causing mutations. The water deprivation test was positive. Magnetic resonance imaging showed a lack of posterior pituitary hyperintensity. Finally, direct sequencing of the AVP-NPII gene showed a point mutation (c.1884G>A) in a heterozygous state, confirming an autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI). This condition did not explain the patient's phenotype; thus, we investigated for Gitelman syndrome (GS). A direct sequencing of the SLC12A3 gene showed c.269A>C and c.1205C>A new mutations. In conclusion, the patient had a genetic combination of GS and adFNDI with a BSIII-like phenotype.

  10. Genome-wide identification of Jatropha curcas aquaporin genes and the comparative analysis provides insights into the gene family expansion and evolution in Hevea brasiliensis

    Directory of Open Access Journals (Sweden)

    Zhi eZou

    2016-03-01

    Full Text Available Aquaporins (AQPs are channel-forming integral membrane proteins that transport water and other small solutes across biological membranes. Despite the vital role of AQPs, to date, little is known in physic nut (Jatropha curcas L., Euphorbiaceae, an important non-edible oilseed crop with great potential for the production of biodiesel. In this study, 32 AQP genes were identified from the physic nut genome and the family number is relatively small in comparison to 51 in another Euphorbiaceae plant, rubber tree (Hevea brasiliensis Muell. Arg.. Based on the phylogenetic analysis, the JcAQPs were assigned to five subfamilies, i.e., 9 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 2 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs. Like rubber tree and other plant species, functional prediction based on the aromatic/arginine selectivity filter, Froger’s positions and specificity-determining positions showed a remarkable difference in substrate specificity among subfamilies of JcAQPs. Genome-wide comparative analysis revealed the specific expansion of PIP and TIP subfamilies in rubber tree and the specific gene loss of the XIP subfamily in physic nut. Furthermore, by analyzing deep transcriptome sequencing data, the expression evolution especially the expression divergence of duplicated HbAQP genes was also investigated and discussed. Results obtained from this study not only provide valuable information for future functional analysis and utilization of Jc/HbAQP genes, but also provide a useful reference to survey the gene family expansion and evolution in Euphorbiaceae plants and other plant species.

  11. Identification and isolation of stimulator of interferon genes (STING): an innate immune sensory and adaptor gene from camelids.

    Science.gov (United States)

    Premraj, A; Aleyas, A G; Nautiyal, B; Rasool, T J

    2013-10-01

    The mechanism by which type I interferon-mediated antiviral response is mounted by hosts against invading pathogen is an intriguing one. Of late, an endoplasmic reticulum transmembrane protein encoded by a gene called stimulator of interferon genes (STING) is implicated in the innate signalling pathways and has been identified and cloned in few mammalian species including human, mouse and pig. In this article, we report the identification of STING from three different species of a highly conserved family of mammals - the camelids. cDNAs encoding the STING of Old World camels - dromedary camel (Camelus dromedarius) and bactrian camel (Camelus bactrianus) and a New World camel - llama (Llama glama) were amplified using conserved primers and RACE. The complete STING cDNA of dromedary camel is 2171 bp long with a 706-bp 5' untranslated regions (UTR), an 1137-bp open reading frame (ORF) and a 328-bp 3' UTR. Sequence and phylogenetic analysis of the ORF of STING from these three camelids indicate high level of similarity among camelids and conservation of critical amino acid residues across different species. Quantitative real-time PCR analysis revealed high levels of STING mRNA expression in blood, spleen, lymph node and lung. The identification of camelid STING will help in better understanding of the role of this molecule in the innate immunity of the camelids and other mammals. © 2013 John Wiley & Sons Ltd.

  12. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  13. Cell type-specific suppression of mechanosensitive genes by audible sound stimulation.

    Science.gov (United States)

    Kumeta, Masahiro; Takahashi, Daiji; Takeyasu, Kunio; Yoshimura, Shige H

    2018-01-01

    Audible sound is a ubiquitous environmental factor in nature that transmits oscillatory compressional pressure through the substances. To investigate the property of the sound as a mechanical stimulus for cells, an experimental system was set up using 94.0 dB sound which transmits approximately 10 mPa pressure to the cultured cells. Based on research on mechanotransduction and ultrasound effects on cells, gene responses to the audible sound stimulation were analyzed by varying several sound parameters: frequency, wave form, composition, and exposure time. Real-time quantitative PCR analyses revealed a distinct suppressive effect for several mechanosensitive and ultrasound-sensitive genes that were triggered by sounds. The effect was clearly observed in a wave form- and pressure level-specific manner, rather than the frequency, and persisted for several hours. At least two mechanisms are likely to be involved in this sound response: transcriptional control and RNA degradation. ST2 stromal cells and C2C12 myoblasts exhibited a robust response, whereas NIH3T3 cells were partially and NB2a neuroblastoma cells were completely insensitive, suggesting a cell type-specific response to sound. These findings reveal a cell-level systematic response to audible sound and uncover novel relationships between life and sound.

  14. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  15. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  16. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  17. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  18. Molecular analysis of the NDP gene in two families with Norrie disease.

    Science.gov (United States)

    Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

    2005-04-01

    To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

  19. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  20. Expansion, retention and loss in the Acyl-CoA synthetase "Bubblegum" (Acsbg) gene family in vertebrate history.

    Science.gov (United States)

    Lopes-Marques, Mónica; Machado, André M; Ruivo, Raquel; Fonseca, Elza; Carvalho, Estela; Castro, L Filipe C

    2018-07-20

    Fatty acids (FAs) constitute a considerable fraction of all lipid molecules with a fundamental role in numerous physiological processes. In animals, the majority of complex lipid molecules are derived from the transformation of FAs through several biochemical pathways. Yet, for FAs to enroll in these pathways they require an activation step. FA activation is catalyzed by the rate limiting action of Acyl-CoA synthases. Several Acyl-CoA enzyme families have been previously described and classified according to the chain length of FAs they process. Here, we address the evolutionary history of the ACSBG gene family which activates, FAs with >16 carbons. Currently, two different ACSBG gene families, ACSBG1 and ACSBG2, are recognized in vertebrates. We provide evidence that a wider and unequal ACSBG gene repertoire is present in vertebrate lineages. We identify a novel ACSBG-like gene lineage which occurs specifically in amphibians, ray finned fishes, coelacanths and cartilaginous fishes named ACSBG3. Also, we show that the ACSBG2 gene lineage duplicated in the Theria ancestor. Our findings, thus offer a far richer understanding on FA activation in vertebrates and provide key insights into the relevance of comparative and functional analysis to perceive physiological differences, namely those related with lipid metabolic pathways. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Gene family expansions and contractions are associated with host range in plant pathogens of the genus Colletotrichum.

    Science.gov (United States)

    Baroncelli, Riccardo; Amby, Daniel Buchvaldt; Zapparata, Antonio; Sarrocco, Sabrina; Vannacci, Giovanni; Le Floch, Gaétan; Harrison, Richard J; Holub, Eric; Sukno, Serenella A; Sreenivasaprasad, Surapareddy; Thon, Michael R

    2016-08-05

    Many species belonging to the genus Colletotrichum cause anthracnose disease on a wide range of plant species. In addition to their economic impact, the genus Colletotrichum is a useful model for the study of the evolution of host specificity, speciation and reproductive behaviors. Genome projects of Colletotrichum species have already opened a new era for studying the evolution of pathogenesis in fungi. We sequenced and annotated the genomes of four strains in the Colletotrichum acutatum species complex (CAsc), a clade of broad host range pathogens within the genus. The four CAsc proteomes and secretomes along with those representing an additional 13 species (six Colletotrichum spp. and seven other Sordariomycetes) were classified into protein families using a variety of tools. Hierarchical clustering of gene family and functional domain assignments, and phylogenetic analyses revealed lineage specific losses of carbohydrate-active enzymes (CAZymes) and proteases encoding genes in Colletotrichum species that have narrow host range as well as duplications of these families in the CAsc. We also found a lineage specific expansion of necrosis and ethylene-inducing peptide 1 (Nep1)-like protein (NLPs) families within the CAsc. This study illustrates the plasticity of Colletotrichum genomes, and shows that major changes in host range are associated with relatively recent changes in gene content.

  2. Family group conferencing in Dutch child welfare : Which families are most likely to organize a family group conference?

    NARCIS (Netherlands)

    Dijkstra, S.; Creemers, H.E.; Asscher, J.J.; Deković, M.; Stams, G.J.J.M.

    2017-01-01

    Aim of the present study was to identify which families involved in child welfare are willing to organize a Family Group conference (FGc; phase 1) and which are most likely to complete a conference (phase 2). Data were used of a Dutch randomized controlled trial (N =229). First, the proportion of

  3. Family group conferencing in Dutch child welfare : Which families are most likely to organize a family group conference?

    NARCIS (Netherlands)

    Dijkstra, Sharon; Creemers, Hanneke E.; Asscher, Jessica J.; Dekovic, Maja; Stams, Geert Jan J. M.

    2017-01-01

    Aim of the present study was to identify which families involved in child welfare are willing to organize a Family Group conference (FGc; phase 1) and which are most likely to complete a conference (phase 2). Data were used of a Dutch randomized controlled trial (N = 229). First, the proportion of

  4. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  5. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  6. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  7. Purification of cold-shock-like proteins from Stigmatella aurantiaca - molecular cloning and characterization of the cspA gene.

    Science.gov (United States)

    Stamm, I; Leclerque, A; Plaga, W

    1999-09-01

    Prominent low-molecular-weight proteins were isolated from vegetative cells of the myxobacterium Stigmatella aurantiaca and were found to be members of the cold-shock protein family. A first gene of this family (cspA) was cloned and sequenced. It encodes a protein of 68 amino acid residues that displays up to 71% sequence identity with other bacterial cold-shock(-like) proteins. A cysteine residue within the RNP-2 motif is a peculiarity of Stigmatella CspA. A cspA::(Deltatrp-lacZ) fusion gene construct was introduced into Stigmatella by electroporation, a method that has not been used previously for this strain. Analysis of the resultant transformants revealed that cspA transcription occurs at high levels during vegetative growth at 20 and 32 degrees C, and during fruiting body formation.

  8. Epigenetic modulation of the miR-200 family is associated with transition to a breast cancer stem-cell-like state.

    Science.gov (United States)

    Lim, Yat-Yuen; Wright, Josephine A; Attema, Joanne L; Gregory, Philip A; Bert, Andrew G; Smith, Eric; Thomas, Daniel; Lopez, Angel F; Drew, Paul A; Khew-Goodall, Yeesim; Goodall, Gregory J

    2013-05-15

    The miR-200 family is a key regulator of the epithelial-mesenchymal transition, however, its role in controlling the transition between cancer stem-cell-like and non-stem-cell-like phenotypes is not well understood. We utilized immortalized human mammary epithelial (HMLE) cells to investigate the regulation of the miR-200 family during their conversion to a stem-like phenotype. HMLE cells were found to be capable of spontaneous conversion from a non-stem to a stem-like phenotype and this conversion was accompanied by the loss of miR-200 expression. Stem-like cell fractions isolated from metastatic breast cancers also displayed loss of miR-200 indicating similar molecular changes may occur during breast cancer progression. The phenotypic change observed in HMLE cells was directly controlled by miR-200 because restoration of its expression decreased stem-like properties while promoting a transition to an epithelial phenotype. Investigation of the mechanisms controlling miR-200 expression revealed both DNA methylation and histone modifications were significantly altered in the stem-like and non-stem phenotypes. In particular, in the stem-like phenotype, the miR-200b-200a-429 cluster was silenced primarily through polycomb group-mediated histone modifications whereas the miR-200c-141 cluster was repressed by DNA methylation. These results indicate that the miR-200 family plays a crucial role in the transition between stem-like and non-stem phenotypes and that distinct epigenetic-based mechanisms regulate each miR-200 gene in this process. Therapy targeted against miR-200 family members and epigenetic modifications might therefore be applicable to breast cancer.

  9. [Identification of new conserved and variable regions in the 16S rRNA gene of acetic acid bacteria and acetobacteraceae family].

    Science.gov (United States)

    Chakravorty, S; Sarkar, S; Gachhui, R

    2015-01-01

    The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well.

  10. Area-Specific Cell Stimulation via Surface-Mediated Gene Transfer Using Apatite-Based Composite Layers

    Directory of Open Access Journals (Sweden)

    Yushin Yazaki

    2015-04-01

    Full Text Available Surface-mediated gene transfer systems using biocompatible calcium phosphate (CaP-based composite layers have attracted attention as a tool for controlling cell behaviors. In the present study we aimed to demonstrate the potential of CaP-based composite layers to mediate area-specific dual gene transfer and to stimulate cells on an area-by-area basis in the same well. For this purpose we prepared two pairs of DNA–fibronectin–apatite composite (DF-Ap layers using a pair of reporter genes and pair of differentiation factor genes. The results of the area-specific dual gene transfer successfully demonstrated that the cells cultured on a pair of DF-Ap layers that were adjacently placed in the same well showed specific gene expression patterns depending on the gene that was immobilized in theunderlying layer. Moreover, preliminary real-time PCR results indicated that multipotential C3H10T1/2 cells may have a potential to change into different types of cells depending on the differentiation factor gene that was immobilized in the underlying layer, even in the same well. Because DF-Ap layers have a potential to mediate area-specific cell stimulation on their surfaces, they could be useful in tissue engineering applications.

  11. Rotationally invariant family of Levy-like random matrix ensembles

    International Nuclear Information System (INIS)

    Choi, Jinmyung; Muttalib, K A

    2009-01-01

    We introduce a family of rotationally invariant random matrix ensembles characterized by a parameter λ. While λ = 1 corresponds to well-known critical ensembles, we show that λ ≠ 1 describes 'Levy-like' ensembles, characterized by power-law eigenvalue densities. For λ > 1 the density is bounded, as in Gaussian ensembles, but λ < 1 describes ensembles characterized by densities with long tails. In particular, the model allows us to evaluate, in terms of a novel family of orthogonal polynomials, the eigenvalue correlations for Levy-like ensembles. These correlations differ qualitatively from those in either the Gaussian or the critical ensembles. (fast track communication)

  12. A CHROMATIN MODIFYING ENZYME, SDG8, IS REQUIRED FOR MORPHOLOGICAL, GENE EXPRESSION, AND EPIGENETIC RESPONSES TO MECHANICAL STIMULATION

    Directory of Open Access Journals (Sweden)

    Christopher Ian Cazzonelli

    2014-10-01

    Full Text Available Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3, which encodes a calmodulin-like protein (CML12. The gene neighbouring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.

  13. A chromatin modifying enzyme, SDG8, is involved in morphological, gene expression, and epigenetic responses to mechanical stimulation.

    Science.gov (United States)

    Cazzonelli, Christopher I; Nisar, Nazia; Roberts, Andrea C; Murray, Kevin D; Borevitz, Justin O; Pogson, Barry J

    2014-01-01

    Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3), which encodes a calmodulin-like protein (CML12). The gene neighboring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.

  14. A Mini Zinc-Finger Protein (MIF from Gerbera hybrida Activates the GASA Protein Family Gene, GEG, to Inhibit Ray Petal Elongation

    Directory of Open Access Journals (Sweden)

    Meixiang Han

    2017-09-01

    Full Text Available Petal appearance is an important horticultural trail that is generally used to evaluate the ornamental value of plants. However, knowledge of the molecular regulation of petal growth is mostly derived from analyses of Arabidopsis thaliana, and relatively little is known about this process in ornamental plants. Previously, GEG (Gerbera hybrida homolog of the gibberellin [GA]–stimulated transcript 1 [GAST1] from tomato, a gene from the GA stimulated Arabidopsis (GASA family, was reported to be an inhibitor of ray petal growth in the ornamental species, G. hybrida. To explore the molecular regulatory mechanism of GEG in petal growth inhibition, a mini zinc-finger protein (MIF was identified using yeast one-hybrid (Y1H screen. The direct binding of GhMIF to the GEG promoter was verified by using an electrophoretic mobility shift assay and a dual-luciferase assay. A yeast two-hybrid (Y2H revealed that GhMIF acts as a transcriptional activator. Transient transformation assay indicated that GhMIF is involved in inhibiting ray petal elongation by activating the expression of GEG. Spatiotemporal expression analyses and hormone treatment assay showed that the expression of GhMIF and GEG is coordinated during petal development. Taken together, these results suggest that GhMIF acts as a direct transcriptional activator of GEG, a gene from the GASA protein family to regulate the petal elongation.

  15. Analysis of four families with the Stickler syndrome by linkage studies. Identification of a new premature stop codon in the COL2A1 gene in a family

    Energy Technology Data Exchange (ETDEWEB)

    Bonaventure, J.; Lasselin, C. [Hopital Necker, Paris (France); Toutain, A. [CHU Bretonneau, Tours (France)] [and others

    1994-09-01

    The Stickler syndrome is an arthro-ophthalmopathy which associates progressive myopia with vitreal degeneration and retinal detachment. Cleft palate, cranio-facial abnormalities, deafness and osteoarthritis are often associated symptoms. Genetic heterogeneity of this autosomal dominant disease was consistent with its large clinical variability. Linkage studies have provided evidence for cosegregation of the disease with COL2A1, the gene coding for type II collagen, in about 50% of the families. Four additional families are reported here. Linkage analyses by using a VNTR located in the 3{prime} region of the gene were achieved. In three families, positive lod scores were obtained with a cumulative maximal value of 3.5 at a recombination fraction of 0. In one of these families, single strand conformation analysis of 25 exons disclosed a new mutation in exon 42. Codon for glutamic acid at position a1-803 was converted into a stop codon. The mutation was detected in DNA samples from all the affected members of the family but not in the unaffected. This result confirms that most of the Stickler syndromes linked to COL2A1 are due to premature stop codons. In a second family, an abnormal SSCP pattern of exon 34 was detected in all the affected individuals. The mutation is likely to correspond to a splicing defect in the acceptor site of intron 33. In one family the disease did not segregate with the COL2A1 locus. Further linkage studies with intragenic dimorphic sites in the COL10A1 gene and highly polymorphic markers close to the COL9A1 locus indicated that this disorder did not result from defects in these two genes.

  16. Stimulation of phagocytosis by sulforaphane

    International Nuclear Information System (INIS)

    Suganuma, Hiroyuki; Fahey, Jed W.; Bryan, Kelley E.; Healy, Zachary R.; Talalay, Paul

    2011-01-01

    Research highlights: → Sulforaphane stimulates the phagocytosis of RAW 264.7 macrophages under conditions of serum deprivation. → This effect does not require Nrf2-dependent induction of phase 2 genes. → Inactivation of macrophage migration inhibitory factor (MIF) by sulforaphane may be involved in stimulation of phagocytosis by sulforaphane. -- Abstract: Sulforaphane, a major isothiocyanate derived from cruciferous vegetables, protects living systems against electrophile toxicity, oxidative stress, inflammation, and radiation. A major protective mechanism is the induction of a network of endogenous cytoprotective (phase 2) genes that are regulated by transcription factor Nrf2. To obtain a more detailed understanding of the anti-inflammatory and immunomodulatory effects of sulforaphane, we evaluated its effect on the phagocytosis activity of RAW 264.7 murine macrophage-like cells by measuring the uptake of 2-μm diameter polystyrene beads. Sulforaphane raised the phagocytosis activity of RAW 264.7 cells but only in the absence or presence of low concentrations (1%) of fetal bovine serum. Higher serum concentrations depressed phagocytosis and abolished its stimulation by sulforaphane. This stimulation did not depend on the induction of Nrf2-regulated genes since it occurred in peritoneal macrophages of nrf2 -/- mice. Moreover, a potent triterpenoid inducer of Nrf2-dependent genes did not stimulate phagocytosis, whereas sulforaphane and another isothiocyanate (benzyl isothiocyanate) had comparable inducer potencies. It has been shown recently that sulforaphane is a potent and direct inactivator of macrophage migration inhibitory factor (MIF), an inflammatory cytokine. Moreover, the addition of recombinant MIF to RAW 264.7 cells attenuated phagocytosis, but sulforaphane-inactivated MIF did not affect phagocytosis. The inactivation of MIF may therefore be involved in the phagocytosis-enhancing activity of sulforaphane.

  17. Stimulation of phagocytosis by sulforaphane

    Energy Technology Data Exchange (ETDEWEB)

    Suganuma, Hiroyuki, E-mail: hsuganu1@jhmi.edu [Lewis B. and Dorothy Cullman Cancer Chemoprotection Center, Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, 725 N. Wolfe Street, Baltimore, MD 21205 (United States); Fahey, Jed W., E-mail: jfahey@jhmi.edu [Lewis B. and Dorothy Cullman Cancer Chemoprotection Center, Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, 725 N. Wolfe Street, Baltimore, MD 21205 (United States); Bryan, Kelley E., E-mail: kbryanm1@jhmi.edu [Lewis B. and Dorothy Cullman Cancer Chemoprotection Center, Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, 725 N. Wolfe Street, Baltimore, MD 21205 (United States); Healy, Zachary R., E-mail: zhealy1@jhmi.edu [Lewis B. and Dorothy Cullman Cancer Chemoprotection Center, Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, 725 N. Wolfe Street, Baltimore, MD 21205 (United States); Talalay, Paul, E-mail: ptalalay@jhmi.edu [Lewis B. and Dorothy Cullman Cancer Chemoprotection Center, Department of Pharmacology and Molecular Sciences, Johns Hopkins University School of Medicine, 725 N. Wolfe Street, Baltimore, MD 21205 (United States)

    2011-02-04

    Research highlights: {yields} Sulforaphane stimulates the phagocytosis of RAW 264.7 macrophages under conditions of serum deprivation. {yields} This effect does not require Nrf2-dependent induction of phase 2 genes. {yields} Inactivation of macrophage migration inhibitory factor (MIF) by sulforaphane may be involved in stimulation of phagocytosis by sulforaphane. -- Abstract: Sulforaphane, a major isothiocyanate derived from cruciferous vegetables, protects living systems against electrophile toxicity, oxidative stress, inflammation, and radiation. A major protective mechanism is the induction of a network of endogenous cytoprotective (phase 2) genes that are regulated by transcription factor Nrf2. To obtain a more detailed understanding of the anti-inflammatory and immunomodulatory effects of sulforaphane, we evaluated its effect on the phagocytosis activity of RAW 264.7 murine macrophage-like cells by measuring the uptake of 2-{mu}m diameter polystyrene beads. Sulforaphane raised the phagocytosis activity of RAW 264.7 cells but only in the absence or presence of low concentrations (1%) of fetal bovine serum. Higher serum concentrations depressed phagocytosis and abolished its stimulation by sulforaphane. This stimulation did not depend on the induction of Nrf2-regulated genes since it occurred in peritoneal macrophages of nrf2{sup -/-} mice. Moreover, a potent triterpenoid inducer of Nrf2-dependent genes did not stimulate phagocytosis, whereas sulforaphane and another isothiocyanate (benzyl isothiocyanate) had comparable inducer potencies. It has been shown recently that sulforaphane is a potent and direct inactivator of macrophage migration inhibitory factor (MIF), an inflammatory cytokine. Moreover, the addition of recombinant MIF to RAW 264.7 cells attenuated phagocytosis, but sulforaphane-inactivated MIF did not affect phagocytosis. The inactivation of MIF may therefore be involved in the phagocytosis-enhancing activity of sulforaphane.

  18. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Evolution of the vertebrate claudin gene family: insights from a basal vertebrate, the sea lamprey.

    Science.gov (United States)

    Mukendi, Christian; Dean, Nicholas; Lala, Rushil; Smith, Jeramiah; Bronner, Marianne E; Nikitina, Natalya V

    2016-01-01

    Claudins are major constituents of tight junctions, contributing both to their intercellular sealing and selective permeability properties. While claudins and claudin-like molecules are present in some invertebrates, the association of claudins with tight junctions has been conclusively documented only in vertebrates. Here we report the sequencing, phylogenetic analysis and comprehensive spatiotemporal expression analysis of the entire claudin gene family in the basal extant vertebrate, the sea lamprey. Our results demonstrate that clear orthologues to about half of all mammalian claudins are present in the lamprey, suggesting that at least one round of whole genome duplication contributed to the diversification of this gene family. Expression analysis revealed that claudins are expressed in discrete and specific domains, many of which represent vertebrate-specific innovations, such as in cranial ectodermal placodes and the neural crest; whereas others represent structures characteristic of chordates, e.g. pronephros, notochord, somites, endostyle and pharyngeal arches. By comparing the embryonic expression of claudins in the lamprey to that of other vertebrates, we found that ancestral expression patterns were often preserved in higher vertebrates. Morpholino mediated loss of Cldn3b demonstrated a functional role for this protein in placode and pharyngeal arch morphogenesis. Taken together, our data provide novel insights into the origins and evolution of the claudin gene family and the significance of claudin proteins in the evolution of vertebrates.

  20. AIM2-Like Receptors Positively and Negatively Regulate the Interferon Response Induced by Cytosolic DNA.

    Science.gov (United States)

    Nakaya, Yuki; Lilue, Jingtao; Stavrou, Spyridon; Moran, Eileen A; Ross, Susan R

    2017-07-05

    Cytosolic DNAs derived from retrotransposons serve as pathogen-associated molecular patterns for pattern recognition receptors (PRRs) that stimulate the induction of interferons (IFNs) and other cytokines, leading to autoimmune disease. Cyclic GMP-AMP synthase is one PRR that senses retrotransposon DNA, activating type I IFN responses through the stimulator of IFN genes (STING). Absent in melanoma 2 (AIM2)-like receptors (ALRs) have also been implicated in these pathways. Here we show that the mouse ALR IFI205 senses cytosolic retrotransposon DNA independently of cyclic GMP-AMP production. AIM2 antagonizes IFI205-mediated IFN induction activity by sequestering it from STING. We also found that the complement of genes located in the ALR locus in C57BL/6 and AIM2 knockout mice are different and unique, which has implications for interpretation of the sensing of pathogens in different mouse strains. Our data suggest that members of the ALR family are critical to the host IFN response to endogenous DNA. IMPORTANCE Autoimmune diseases like Aicardi-Goutières syndrome and lupus erythematosus arise when cells of the immune system become activated and attack host cells and tissues. We found that DNA generated by endogenous retroviruses and retroelements in inbred mice and mouse cells is recognized by several host proteins found in macrophages that are members of the ALR family and that these proteins both suppress and activate the pathways leading to the generation of cytokines and IFNs. We also show that there is great genetic diversity between different inbred mouse strains in the ALR genes, which might contribute to differential susceptibility to autoimmunity. Understanding how immune cells become activated is important to the control of disease. Copyright © 2017 Nakaya et al.

  1. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  2. Expression of an isoflavone reductase-like gene enhanced by pollen tube growth in pistils of Solanum tuberosum.

    Science.gov (United States)

    van Eldik, G J; Ruiter, R K; Colla, P H; van Herpen, M M; Schrauwen, J A; Wullems, G J

    1997-03-01

    Successful sexual reproduction relies on gene products delivered by the pistil to create an environment suitable for pollen tube growth. These compounds are either produced before pollination or formed during the interactions between pistil and pollen tubes. Here we describe the pollination-enhanced expression of the cp100 gene in pistils of Solanum tuberosum. Temporal analysis of gene expression revealed an enhanced expression already one hour after pollination and lasts more than 72 h. Increase in expression also occurred after touching the stigma and was not restricted to the site of touch but spread into the style. The predicted CP100 protein shows similarity to leguminous isoflavone reductases (IFRs), but belongs to a family of IFR-like NAD(P)H-dependent oxidoreductases present in various plant species.

  3. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    Science.gov (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  5. Epigenetic control of the basal-like gene expression profile via Interleukin-6 in breast cancer cells

    Directory of Open Access Journals (Sweden)

    Mitrugno Valentina

    2010-11-01

    Full Text Available Abstract Background Basal-like carcinoma are aggressive breast cancers that frequently carry p53 inactivating mutations, lack estrogen receptor-α (ERα and express the cancer stem cell markers CD133 and CD44. These tumors also over-express Interleukin 6 (IL-6, a pro-inflammatory cytokine that stimulates the growth of breast cancer stem/progenitor cells. Results Here we show that p53 deficiency in breast cancer cells induces a loss of methylation at IL-6 proximal promoter region, which is maintained by an IL-6 autocrine loop. IL-6 also elicits the loss of methylation at the CD133 promoter region 1 and of CD44 proximal promoter, enhancing CD133 and CD44 gene transcription. In parallel, IL-6 induces the methylation of estrogen receptor (ERα promoter and the loss of ERα mRNA expression. Finally, IL-6 induces the methylation of IL-6 distal promoter and of CD133 promoter region 2, which harbour putative repressor regions. Conclusion We conclude that IL-6, whose methylation-dependent autocrine loop is triggered by the inactivation of p53, induces an epigenetic reprogramming that drives breast carcinoma cells towards a basal-like/stem cell-like gene expression profile.

  6. Identification of gene expression modifications in myostatin-stimulated myoblasts

    International Nuclear Information System (INIS)

    Yang Wei; Zhang Yong; Ma Guoda; Zhao Xinyi; Chen Yan; Zhu Dahai

    2005-01-01

    Myostatin belongs to the transforming growth factor beta superfamily and has been shown to function as an inhibitor of skeletal muscle proliferation and differentiation. To gain insight into the molecular mechanisms of myostatin function during myogenesis, differential display reverse transcription PCR was employed to identify altered gene expressions associated with myostatin inhibitory function in chicken fetal myoblasts (CFMs). In this work, we have identified seven up-regulated and 12 down-regulated genes in myostatin stimulated CFMs. Those genes are involved in myogenic differentiation, cell architecture, energy metabolism, signal transduction, and apoptosis. The down-regulation of muscle creatine kinase B, troponin C, and myosin regulatory light chain is in agreement with the myostatin negative role in myocyte differentiation. In addition, the expression alteration of skeletal muscle-specific cardiac ankyrin repeat protein and the bcl-2 related anti-apoptotic protein Nr-13 suggests possible unique roles for myostatin in regulating myogenesis by controlling cofactors participated transcriptional regulation and apoptosis

  7. Structure, evolution and functional inference on the Mildew Locus O (MLO) gene family in three cultivated Cucurbitaceae spp.

    Science.gov (United States)

    Iovieno, Paolo; Andolfo, Giuseppe; Schiavulli, Adalgisa; Catalano, Domenico; Ricciardi, Luigi; Frusciante, Luigi; Ercolano, Maria Raffaella; Pavan, Stefano

    2015-12-29

    The powdery mildew disease affects thousands of plant species and arguably represents the major fungal threat for many Cucurbitaceae crops, including melon (Cucumis melo L.), watermelon (Citrullus lanatus L.) and zucchini (Cucurbita pepo L.). Several studies revealed that specific members of the Mildew Locus O (MLO) gene family act as powdery mildew susceptibility factors. Indeed, their inactivation, as the result of gene knock-out or knock-down, is associated with a peculiar form of resistance, referred to as mlo resistance. We exploited recently available genomic information to provide a comprehensive overview of the MLO gene family in Cucurbitaceae. We report the identification of 16 MLO homologs in C. melo, 14 in C. lanatus and 18 in C. pepo genomes. Bioinformatic treatment of data allowed phylogenetic inference and the prediction of several ortholog pairs and groups. Comparison with functionally characterized MLO genes and, in C. lanatus, gene expression analysis, resulted in the detection of candidate powdery mildew susceptibility factors. We identified a series of conserved amino acid residues and motifs that are likely to play a major role for the function of MLO proteins. Finally, we performed a codon-based evolutionary analysis indicating a general high level of purifying selection in the three Cucurbitaceae MLO gene families, and the occurrence of regions under diversifying selection in candidate susceptibility factors. Results of this study may help to address further biological questions concerning the evolution and function of MLO genes. Moreover, data reported here could be conveniently used by breeding research, aiming to select powdery mildew resistant cultivars in Cucurbitaceae.

  8. Maternal tissue is involved in stimulant reception by seeds of the parasitic plant Orobanche.

    Science.gov (United States)

    Plakhine, Dina; Tadmor, Yaakov; Ziadne, Hammam; Joel, Daniel M

    2012-04-01

    A fundamental element in the evolution of obligate root-parasitic angiosperms is their ability to germinate only in response to chemical stimulation by roots, to ensure contact with a nearby nourishing host. The aim of this study was to explore inheritance of the unique germination control in this group of plants. Analysis was made of the segregation of spontaneous (non-induced) germination that appeared in hybrid progenies derived from crosses between Orobanche cernua and O. cumana, which, like all other Orobanche species, are totally dependent on chemical stimulation for the onset of germination, and show negligible spontaneous germination in their natural seed populations. F(1) and F(2) seeds did not germinate in the absence of chemical stimulation, but significant spontaneous germination was found in some F(3) seed families. This indicates that the prevention of non-induced germination in Orobanche seeds, i.e. dependence on an external chemical stimulation for seed germination, is genetically controlled, that this genetic control is expressed in a seed tissue with maternal origin (presumably the perisperm that originates from the nucellus) and that genetic variation for this trait exists in Orobanche species. Similar segregation results were obtained in reciprocal crosses, suggesting that stimulated germination is controlled by nuclear genes.

  9. Identification of ALK as the Major Familial Neuroblastoma Predisposition Gene

    Science.gov (United States)

    Mossë, Yalë P; Laudenslager, Marci; Longo, Luca; Cole, Kristina A; Wood, Andrew; Attiyeh, Edward F; Laquaglia, Michael J; Sennett, Rachel; Lynch, Jill E; Perri, Patrizia; Laureys, Geneviève; Speleman, Frank; Hakonarson, Hakon; Torkamani, Ali; Schork, Nicholas J; Brodeur, Garrett M; Tonini, Gian Paolo; Rappaport, Eric; Devoto, Marcella; Maris, John M

    2009-01-01

    SUMMARY Survival rates for the childhood cancer neuroblastoma have not substantively improved despite dramatic escalation in chemotherapy intensity. Like most human cancers, this embryonal malignancy can be inherited, but the genetic etiology of familial and sporadically occurring neuroblastoma was largely unknown. Here we show that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas, and that activating mutations can also be somatically acquired. We first identified a significant linkage signal at the short arm of chromosome 2 (maximum nonparametric LOD=4.23 at rs1344063) using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate missense mutations in the tyrosine kinase domain of ALK (G1128A, R1192P and R1275Q) that segregated with the disease in eight separate families. Examination of 491 sporadically occurring human neuroblastoma samples showed that the ALK locus was gained in 22.8%, and highly amplified in an additional 3.3%, and that these aberrations were highly associated with death from disease (P=0.0003). Resequencing of 194 high-risk neuroblastoma samples showed somatically acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation consistent with activation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of 4 of 4 cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. Our results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy. PMID:18724359

  10. Genome-wide identification, phylogeny and expression analyses of SCARECROW-LIKE(SCL) genes in millet (Setaria italica).

    Science.gov (United States)

    Liu, Hongyun; Qin, Jiajia; Fan, Hui; Cheng, Jinjin; Li, Lin; Liu, Zheng

    2017-07-01

    As a member of the GRAS gene family, SCARECROW - LIKE ( SCL ) genes encode transcriptional regulators that are involved in plant information transmission and signal transduction. In this study, 44 SCL genes including two SCARECROW genes in millet were identified to be distributed on eight chromosomes, except chromosome 6. All the millet genes contain motifs 6-8, indicating that these motifs are conserved during the evolution. SCL genes of millet were divided into eight groups based on the phylogenetic relationship and classification of Arabidopsis SCL genes. Several putative millet orthologous genes in Arabidopsis , maize and rice were identified. High throughput RNA sequencing revealed that the expressions of millet SCL genes in root, stem, leaf, spica, and along leaf gradient varied greatly. Analyses combining the gene expression patterns, gene structures, motif compositions, promoter cis -elements identification, alternative splicing of transcripts and phylogenetic relationship of SCL genes indicate that the these genes may play diverse functions. Functionally characterized SCL genes in maize, rice and Arabidopsis would provide us some clues for future characterization of their homologues in millet. To the best of our knowledge, this is the first study of millet SCL genes at the genome wide level. Our work provides a useful platform for functional analysis of SCL genes in millet, a model crop for C 4 photosynthesis and bioenergy studies.

  11. Different clinical phenotypes in familial severe congenital neutropenia cases with same mutation of the ELANE gene.

    Science.gov (United States)

    Cho, Hye-Kyung; Jeon, In Sang

    2014-03-01

    Severe congenital neutropenia (SCN) is a heterogeneous group of disorders with a defect in granulopoiesis causing marked neutropenia and severe bacterial infections. A 17-month-old girl (patient 1) was admitted due to cervical lymphadenitis caused by methicillin-resistant Staphylococcus aureus, with neutropenia. She had Pseudomonas aeruginosa sepsis and peritonitis with perforated appendicitis at 8-month of age. Her sister, a 37-month-old girl (patient 2), had recurrent stomatitis with profound neutropenia, and her mother, a 32-yr-old woman (patient 3), had had recurrent stomatitis until her early 20s with neutropenia. We found an ELANE gene mutation (c.597+1G > A) from them in direct DNA sequencing analysis. Patients 1 and 2 did not respond to granulocyte colony stimulating factor and patient 1 was treated with prolonged antibiotics and excision. We demonstrated inherited SCN cases showing different severity even with the same mutation of the ELANE gene in a family.

  12. Genome-wide cloning and sequence analysis of leucine-rich repeat receptor-like protein kinase genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Yuan Tong

    2010-01-01

    Full Text Available Abstract Background Transmembrane receptor kinases play critical roles in both animal and plant signaling pathways regulating growth, development, differentiation, cell death, and pathogenic defense responses. In Arabidopsis thaliana, there are at least 223 Leucine-rich repeat receptor-like kinases (LRR-RLKs, representing one of the largest protein families. Although functional roles for a handful of LRR-RLKs have been revealed, the functions of the majority of members in this protein family have not been elucidated. Results As a resource for the in-depth analysis of this important protein family, the complementary DNA sequences (cDNAs of 194 LRR-RLKs were cloned into the GatewayR donor vector pDONR/ZeoR and analyzed by DNA sequencing. Among them, 157 clones showed sequences identical to the predictions in the Arabidopsis sequence resource, TAIR8. The other 37 cDNAs showed gene structures distinct from the predictions of TAIR8, which was mainly caused by alternative splicing of pre-mRNA. Most of the genes have been further cloned into GatewayR destination vectors with GFP or FLAG epitope tags and have been transformed into Arabidopsis for in planta functional analysis. All clones from this study have been submitted to the Arabidopsis Biological Resource Center (ABRC at Ohio State University for full accessibility by the Arabidopsis research community. Conclusions Most of the Arabidopsis LRR-RLK genes have been isolated and the sequence analysis showed a number of alternatively spliced variants. The generated resources, including cDNA entry clones, expression constructs and transgenic plants, will facilitate further functional analysis of the members of this important gene family.

  13. Dynamic Network Reconstruction from Gene Expression Data Describing the Effect of LiCl Stimulation on Hepatocytes

    Directory of Open Access Journals (Sweden)

    Zellmer Sebastian

    2005-12-01

    Full Text Available Wnt/β-catenin signalling plays an important role in zonation of liver parenchyma and in patterning of hepatocyte heterogeneity. A characteristic marker of this heterogeneity is glutamine synthetase, which is expressed only in a subset of pericentrally located hepatocytes. To investigate, whether and how the Wnt/β-catenin signalling pathway is involved a culture of hepatocytes was stimulated by LiCl. This resulted in an increase in the specific GS activity, indicating that the Wnt/β-catenin pathway may participate in regulating GS levels. Affymetrix GeneChip oligonucleotide arrays were used to monitor the gene expression changes during a period from 2 to 24 hours after stimulation by LiCl. Samples from a cultivation without stimulation were used as controls. Based on the gene expression profiles a hypothetic signal transduction network was constructed by a reverse engineering algorithm. The network robustness was tested and the most stable structure was identified.

  14. Characterization of CgHIFα-Like, a Novel bHLH-PAS Transcription Factor Family Member, and Its Role under Hypoxia Stress in the Pacific Oyster Crassostrea gigas.

    Directory of Open Access Journals (Sweden)

    Ting Wang

    Full Text Available Hypoxia-inducible factor (HIF, a critical member of the basic-helix-loop-helix (bHLH-containing Per-Arnt-Sim (PAS protein family, is a master transcription factor involved in maintaining oxygen homeostasis. In the present study, we isolated and characterized a novel bHLH-PAS family member, CgHIFα-like gene, from the Pacific oyster Crassostrea gigas, and determined its importance during hypoxia stress. The 3020-bp CgHIFα-like cDNA encoded a protein of 888 amino acids. The predicted CgHIFα-like amino acid sequence was conserved in the N-terminal bHLH, PAS, and PAC domains (but not in the C-terminal domain and was most closely related to the HIF family in the bHLH-PAS protein phylogenic tree. Similar to the mammalian HIF-1α, CgHIFα-like could be expressed as four mRNA isoforms containing alternative 5'-untranslated regions and different translation initiation codons. At the mRNA level, these isoforms were expressed in a tissue-specific manner and showed increased transcription to varying degrees under hypoxic conditions. Additionally, the western blot analysis demonstrated that CgHIFα-like was induced by hypoxia. Electrophoretic mobility shift assay indicated that CgHIFα-like could bind to the hypoxia responsive element (HRE, whereas dual-luciferase reporter analysis demonstrated that CgHIFα-like could transactivate the reporter gene containing the HREs. In addition to CgHIFα-like, we identified CgARNT from the C. gigas, analyzed its expression pattern, and confirmed its interaction with CgHIFα-like using a yeast two-hybrid assay. In conclusion, this is the first report on the cloning and characterization of a novel hypoxia transcription factor in mollusks, which could accumulate under hypoxia and regulate hypoxia related gene expression by binding to HRE and dimerizing with CgARNT. As only one member of HIF has been identified in invertebrates to date, our results provide new insights into the unique mechanisms of hypoxia tolerance in

  15. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  16. Targeted next generation sequencing identifies functionally deleterious germline mutations in novel genes in early-onset/familial prostate cancer.

    Directory of Open Access Journals (Sweden)

    Paula Paulo

    2018-04-01

    Full Text Available Considering that mutations in known prostate cancer (PrCa predisposition genes, including those responsible for hereditary breast/ovarian cancer and Lynch syndromes, explain less than 5% of early-onset/familial PrCa, we have sequenced 94 genes associated with cancer predisposition using next generation sequencing (NGS in a series of 121 PrCa patients. We found monoallelic truncating/functionally deleterious mutations in seven genes, including ATM and CHEK2, which have previously been associated with PrCa predisposition, and five new candidate PrCa associated genes involved in cancer predisposing recessive disorders, namely RAD51C, FANCD2, FANCI, CEP57 and RECQL4. Furthermore, using in silico pathogenicity prediction of missense variants among 18 genes associated with breast/ovarian cancer and/or Lynch syndrome, followed by KASP genotyping in 710 healthy controls, we identified "likely pathogenic" missense variants in ATM, BRIP1, CHEK2 and TP53. In conclusion, this study has identified putative PrCa predisposing germline mutations in 14.9% of early-onset/familial PrCa patients. Further data will be necessary to confirm the genetic heterogeneity of inherited PrCa predisposition hinted in this study.

  17. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  18. An Alfin-like gene from Atriplex hortensis enhances salt and drought tolerance and abscisic acid response in transgenic Arabidopsis.

    Science.gov (United States)

    Tao, Jian-Jun; Wei, Wei; Pan, Wen-Jia; Lu, Long; Li, Qing-Tian; Ma, Jin-Biao; Zhang, Wan-Ke; Ma, Biao; Chen, Shou-Yi; Zhang, Jin-Song

    2018-02-09

    Alfin-like (AL) is a small plant-specific gene family with prominent roles in root growth and abiotic stress response. Here, we aimed to identify novel stress tolerance AL genes from the stress-tolerant species Atriplex hortensis. Totally, we isolated four AhAL genes, all encoding nuclear-localized proteins with cis-element-binding and transrepression activities. Constitutive expression of AhAL1 in Arabidopsis facilitated plants to survive under saline condition, while expressing anyone of the other three AhAL genes led to salt-hypersensitive response, indicating functional divergence of AhAL family. AhAL1 also conferred enhanced drought tolerance, as judged from enhanced survival, improved growth, decreased malonaldehyde (MDA) content and reduced water loss in AhAL1-expressing plants compared to WT. In addition, abscisic acid (ABA)-mediated stomatal closure and inhibition of seed germination and primary root elongation were enhanced in AhAL1-transgenic plants. Further analysis demonstrated that AhAL1 could bind to promoter regions of GRF7, DREB1C and several group-A PP2C genes and repress their expression. Correspondingly, the expression levels of positive stress regulator genes DREB1A, DREB2A and three ABFs were all increased in AhAL1-expressing plants. Based on these results, AhAL1 was identified as a novel candidate gene for improving abiotic stress tolerance of crop plants.

  19. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  20. KIR And HLA Haplotype Analysis in a Family Lacking The KIR 2DL1-2DP1 Genes

    Directory of Open Access Journals (Sweden)

    Vojvodić Svetlana

    2015-06-01

    Full Text Available The killer cell immunoglobulin-like receptor (KIR gene cluster exhibits extensive allelic and haplotypic diversity that is observed as presence/absence of genes, resulting in expansion and contraction of KIR haplotypes and by allelic variation of individual KIR genes. We report a case of KIR pseudogene 2DP1 and 2DL1 gene absence in members of one family with the children suffering from acute myelogenous leukemia (AML. Killer cell immunoglo-bulin-like receptor low resolution genotyping was performed by the polymerase chain reaction (PCR-sequencespecific primers (SSP/sequence-specific oligonucleotide (SSO method and haplotype assignment was done by gene content analysis. Both parents and the maternal grandfather, shared the same Cen-B2 KIR haplotype, containing KIR 3DL3, -2DS2, -2DL2 and -3DP1 genes. The second haplotype in the KIR genotype of the mother and grandfather was Tel-A1 with KIR 2DL4 (normal and deleted variant, -3DL1, -22 bp deletion variant of the 2DS4 gene and -3DL2, while the second haplotype in the KIR genotype of the father was Tel-B1 with 2DL4 (normal variant, -3DS1, -2DL5, -2DS5, -2DS1 and 3DL2 genes. Haplotype analysis in all three offsprings revealed that the children inherited the Cen-B2 haplotype with the same gene content but two of the children inherited a deleted variant of the 2DL4 gene, while the third child inherited a normal one. The second haplotype of all three offspring contained KIR 2DL4, -2DL5, -2DS1, -2DS4 (del 22bp variant, -2DS5, -3DL1 and -3DL2 genes, which was the basis of the assumption that there is a hybrid haplotype and that the present 3DL1 gene is a variant of the 3DS1 gene. Due to consanguinity among the ancestors, the results of KIR segregation analysis showed the existence of a very rare KIR genotype in the offspring. The family who is the subject of this case is even more interesting because the father was 10/10 human leukocyte antigen (HLA-matched to his daughter, all members of the family have

  1. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  2. Stimulants of Toll-like receptor (TLR)-2 and TLR-4 are abundant in certain minimally-processed vegetables.

    Science.gov (United States)

    Erridge, Clett

    2011-06-01

    Stimulants of the innate immune receptors Toll-like receptor (TLR)-2 and TLR4 have been shown to promote insulin resistance and atherosclerosis in animal models of these diseases. As minimally processed vegetables (MPV) can contain a relatively large bacterial load compared to other foodstuffs, we aimed to quantify the abundance of stimulants of TLR2 and TLR4 in MPV using a transfection-based bioassay calibrated with Escherichia coli LPS and the synthetic lipopeptide Pam(3)CSK(4). Of 5 classes of MPV and 3 classes of related vegetable products considered to be likely to contain a high microbial load, diced onion and bean sprouts contained the highest levels of stimulants of TLR2 (up to 18.5 μg Pam(3)CSK(4)-equivalents per g) and TLR4 (up to 11.4 μg LPS-equivalents per g). By contrast, the majority of fresh whole vegetables examined reproducibly contained minimal or undetectable levels of TLR2- or TLR4-stimulants. The accumulation of TLR-stimulants in MPVs correlated well with growth of enterobacterial spoilage organisms. In conclusion, the modern trend towards eating minimally processed vegetables rather than whole foods is likely to be associated with increased oral exposure to stimulants of TLR2 and TLR4. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  4. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  5. Molecular cloning and characterization of recA-like gene from Schizosaccharomyces pombe

    International Nuclear Information System (INIS)

    Lee, J.S.; Kang, J.K.; Yoon, S.M.; Park, Y.; Yang, Y.K.; Kim, S.W.; Park, J.K.; Park, J.G.; Hong, S.H.; Park, S.D.

    1996-01-01

    We have previously purified and characterized a RecA-like protein from Schizosaccharomyces pombe (S. pombe). In the present study, we have cloned a gene encoding the RecA-like protein. The S. pombe recA-like gene was isolated by immunological screening of the expression library of S. pombe using anti-Escherichia coli (E. coli) RecA antibody as a probe. From 10(6) plaques screened, 6 putative clones were finally isolated. Five of the clones screened contained the same kinds of DNA inserts, as determined by crosshybridization analysis. Among the clones, TC-2 was selected for further studies. The pGEM3Zf(-)Delta 17 vector harboring the 4.3 kb DNA insert of TC-2 clone was capable of producing abeta-gal/RecA-like fusion protein, suggesting that the cloned gene encodes the RecA-like protein of S. pombe. It was also revealed by Southern hybridization analysis that the same DNA sequence as the cloned recA-like gene is located within the S. pombe chromosomal DNA. In addition, the cloned recA-like gene was transcribed into a 3.0 kb RNA transcript, as judged by Northern blot analysis. The level of the RNA transcript of recA-like gene was increased approximately 1.6 to 2.4-fold upon treatment with DNA damaging agents such as ultraviolet (UV)-light, methyl methanesulfonate (MMS), and mitomycin-C (MMC). This data suggests that the cloned S. pombe recA-like gene is slightly inducible to DNAdamage as in E. coli recA gene. These results suggest that an inducible repair mechanism analogous to that of E. coli may exist in fission yeast S. pombe

  6. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  7. Comprehensive analysis of the soybean (Glycine max GmLAX auxin transporter gene family

    Directory of Open Access Journals (Sweden)

    Chenglin eChai

    2016-03-01

    Full Text Available The phytohormone auxin plays a critical role in regulation of plant growth and development as well as plant responses to abiotic stresses. This is mainly achieved through its uneven distribution in plants via a polar auxin transport process. Auxin transporters are major players in polar auxin transport. The AUXIN RESISTANT 1 ⁄ LIKE AUX1 (AUX⁄LAX auxin influx carriers belong to the amino acid permease family of proton-driven transporters and function in the uptake of indole-3-acetic acid (IAA. In this study, genome-wide comprehensive analysis of the soybean AUX⁄LAX (GmLAX gene family, including phylogenic relationships, chromosome localization, and gene structure, were carried out. A total of 15 GmLAX genes, including seven duplicated gene pairs, were identified in the soybean genome. They were distributed on 10 chromosomes. Despite their higher percentage identities at the protein level, GmLAXs exhibited versatile tissue-specific expression patterns, indicating coordinated functioning during plant growth and development. Most GmLAXs were responsive to drought and dehydration stresses and auxin and abscisic acid (ABA stimuli, in a tissue- and/or time point- sensitive mode. Several GmLAX members were involved in responding to salt stress. Sequence analysis revealed that promoters of GmLAXs contained different combinations of stress-related cis-regulatory elements. These studies suggest that the soybean GmLAXs were under control of a very complex regulatory network, responding to various internal and external signals. This study helps to identity candidate GmLAXs for further analysis of their roles in soybean development and adaption to adverse environments.

  8. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  9. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  10. A novel mutation in ABCA1 gene causing Tangier Disease in an Italian family with uncommon neurological presentation

    Directory of Open Access Journals (Sweden)

    Marco Ceccanti

    2016-11-01

    Full Text Available Tangier disease is an autosomal recessive disorder characterized by severe reduction in HDL-cholesterol and peripheral lipid storage. We describe a family with c.5094C>A p.Tyr16980* mutation in the ABCA1 gene, clinically characterized by syringomyelic-like anesthesia, demyelinating multineuropathy and reduction in intraepidermal small fibers innervation. In the proband patient, cardiac involvement determined a myocardial infarction; lipid storage was demonstrated in gut, cornea and aortic wall. The reported ABCA1 mutation has never been described before in a Tangier family.

  11. Domain combination of the vertebrate-like TLR gene family ...

    Indian Academy of Sciences (India)

    2Framingham Heart Study, National Heart, Lung, and Blood Institute, Framingham 01702, USA ... with the acquired immune responses (Pasare and Medzhitov ... There are two structural types of TLRs: the vertebrate-like ... The evolutionary positions of all ..... rules, that might be selective pressure exerted by pathogens.

  12. Genome-wide analysis of the Solanum tuberosum (potato) trehalose-6-phosphate synthase (TPS) gene family: evolution and differential expression during development and stress.

    Science.gov (United States)

    Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang

    2017-12-01

    Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.

  13. A Novel Missense Mutation of the NSD1 Gene Associated with Overgrowth in Three Generations of an Italian Family: Case Report, Differential Diagnosis, and Review of Mutations of NSD1 Gene in Familial Sotos Syndrome

    Directory of Open Access Journals (Sweden)

    Gianluigi Laccetta

    2017-11-01

    Full Text Available Sotos syndrome (SoS is characterized by overgrowth of prenatal onset, learning disability, and characteristic facial appearance; it is usually due to haploinsufficiency of NSD1 gene at chromosome 5q35. An Italian child was born at 37 weeks of gestation (weight 2,910 g, 25th–50th centiles; length 50 cm, 75th centile; head circumference 36 cm, 97th centile showing cryptorchidism on the right side, hypertelorism, dolichocephaly, broad and prominent forehead, and narrow jaw; the pregnancy was worsened by maternal preeclampsia and gestational diabetes, and his mother had a previous history of four early miscarriages. The patient showed neonatal jaundice, hypotonia, feeding difficulties, frequent vomiting, and gastroesophageal reflux. After the age of 6 months, his weight, length, and head circumference were above the 97th centile; psychomotor development was delayed. At the age of 9 years, the patient showed also joint laxity and scoliosis. DNA sequence analysis of NSD1 gene detected a novel heterozygous mutation (c.521T>A, p.Val174Asp in exon 2. The same mutant allele was also found in the mother and in the maternal grandfather of the proband; both the mother and the maternal grandfather of the proband showed isolated overgrowth with height above the 97th centile in absence of other features of SoS. At present 23 familial cases of SoS have been described (two cases with mutation in exon 2 of NSD1 gene; no familial cases of SoS with mutation of NSD1 gene and isolated overgrowth have been reported. Probably, point mutations of NSD1 gene, and particularly mutations between exon 20 and exon 23, are not likely to affect reproductive fitness. Epigenetic mechanisms and intrauterine environment may influence phenotypes, therefore genetic tests are not useful to predict the phenotype but they are indispensable for the diagnosis of SoS. This is the first Italian familial case of SoS with genetic confirmation and the third report in which a

  14. The amyloid precursor-like protein (APLP) gene maps to the long arm of human chromosome 19

    Energy Technology Data Exchange (ETDEWEB)

    Wasco, W.; Tanzi, R.E. (Harvard Medical School, Boston, MA (United States)); Brook, J.D. (Center for Medical Genetics, Nottingham (United Kingdom))

    1993-01-01

    We have recently isolated a cDNA from a mouse brain library that encodes a protein whose predicted amino acid sequence is 42% identical and 64% similar to that of the amyloid [beta] protein precursor (APP; 16). This 653-amino-acid amyloid precursor-like protein (APLP) is similar to APP in overall structure as well as amino acid sequence. The amino acid homologies are particularly strong in three distinct regions of the proteins where the identities are 47, 54, and 56% (16). All three of these regions are also conserved in the Drosophila APP-like gene, APPL (11). Notably, 12 cysteine residues and a N -glyco-sylation site are conserved in the extracellular portion of APLP and APP, and a clathrin-binding domain is conserved in the cytoplasmic domain. The cytoplasmic domain is also conserved in a partial CDNA reported to encode an APP-like gene in rat testes (17), These data suggest that APLP and APP are members of a highly conserved gene family. A panel of DNAs from 31 human-rodent somatic cell lines of known karyotype was digested with EcoR1. These DNAs were then probed with the human APLP cDNA clone and the hybridization pattern was consistent with the assignment of the APLP locus to chromosome 19. 17 refs., 1 fig.

  15. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  16. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in sea lamprey and Japanese lamprey.

    Science.gov (United States)

    Ren, Jianfeng; Chung-Davidson, Yu-Wen; Yeh, Chu-Yin; Scott, Camille; Brown, Titus; Li, Weiming

    2015-06-06

    Lampreys are extant representatives of the jawless vertebrate lineage that diverged from jawed vertebrates around 500 million years ago. Lamprey genomes contain information crucial for understanding the evolution of gene families in vertebrates. The ATP-binding cassette (ABC) gene family is found from prokaryotes to eukaryotes. The recent availability of two lamprey draft genomes from sea lamprey Petromyzon marinus and Japanese lamprey Lethenteron japonicum presents an opportunity to infer early evolutionary events of ABC genes in vertebrates. We conducted a genome-wide survey of the ABC gene family in two lamprey draft genomes. A total of 37 ABC transporters were identified and classified into seven subfamilies; namely seven ABCA genes, 10 ABCB genes, 10 ABCC genes, three ABCD genes, one ABCE gene, three ABCF genes, and three ABCG genes. The ABCA subfamily has expanded from three genes in sea squirts, seven and nine in lampreys and zebrafish, to 13 and 16 in human and mouse. Conversely, the multiple copies of ABCB1-, ABCG1-, and ABCG2-like genes found in sea squirts have contracted in the other species examined. ABCB2 and ABCB3 seem to be new additions in gnathostomes (not in sea squirts or lampreys), which coincides with the emergence of the gnathostome-specific adaptive immune system. All the genes in the ABCD, ABCE and ABCF subfamilies were conserved and had undergone limited duplication and loss events. In the sea lamprey transcriptomes, the ABCE and ABCF gene subfamilies were ubiquitously and highly expressed in all tissues while the members in other gene subfamilies were differentially expressed. Thirteen more lamprey ABC transporter genes were identified in this study compared with a previous study. By concatenating the same gene sequences from the two lampreys, more full length sequences were obtained, which significantly improved both the assignment of gene names and the phylogenetic trees compared with a previous analysis using partial sequences. The ABC

  17. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  18. Expression of avian β-defensins and Toll-like receptor genes in the rooster epididymis during growth and Salmonella infection.

    Science.gov (United States)

    Anastasiadou, M; Avdi, M; Michailidis, G

    2013-08-01

    The epididymis is an organ involved in the maturation, transport, and storage of sperm prior to ejaculation. As epididymis is exposed to a constant risk of inflammatory conditions that may lead to transient or permanent sterility, protection of this organ from pathogens is an essential aspect of reproductive physiology. The families of antimicrobial peptides β-defensins and the pattern-recognition receptors Toll-like (TLR) mediate innate immunity in various vertebrates including avian species. As rooster infertility is a major concern in the poultry industry, the objectives of this study were to determine the expression profile of the entire family of the avian β-defensins (AvBD) and TLR genes in the rooster epididymis, to investigate whether sexual maturation affects their epididymidal mRNA abundance and to determine the changes in their expression levels in response to Salmonella enteritidis (SE) infection in the epididymis of sexually mature roosters. RNA was extracted from the epididymis of healthy pubertal, sexually mature and aged birds, and from sexually mature SE infected birds. RT-PCR analysis revealed that 10 members of the AvBD and nine members of the TLR gene families were expressed in the epididymis. Quantitative real-time PCR analysis revealed that the epididymidal mRNA abundance of certain AvBD and TLR genes was developmentally regulated with respect to sexual maturation. SE infection resulted in a significant induction of AvBD 1, 9, 10, 12 and 14, as well as TLR 1-2, 2-1, 2-2, 4, 5 and 7 genes, in the epididymis of sexually mature roosters, compared to healthy birds of the same age. These findings provide strong evidence to suggest that the rooster epididymis is capable of initiating an inflammatory response to Salmonella, through activation of certain members of the AvBD and TLR gene families. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. The YABBY Genes of Leaf and Leaf-Like Organ Polarity in Leafless Plant Monotropa hypopitys

    Directory of Open Access Journals (Sweden)

    Anna V. Shchennikova

    2018-01-01

    Full Text Available Monotropa hypopitys is a mycoheterotrophic, nonphotosynthetic plant acquiring nutrients from the roots of autotrophic trees through mycorrhizal symbiosis, and, similar to other extant plants, forming asymmetrical lateral organs during development. The members of the YABBY family of transcription factors are important players in the establishment of leaf and leaf-like organ polarity in plants. This is the first report on the identification of YABBY genes in a mycoheterotrophic plant devoid of aboveground vegetative organs. Seven M. hypopitys YABBY members were identified and classified into four clades. By structural analysis of putative encoded proteins, we confirmed the presence of YABBY-defining conserved domains and identified novel clade-specific motifs. Transcriptomic and qRT-PCR analyses of different tissues revealed MhyYABBY transcriptional patterns, which were similar to those of orthologous YABBY genes from other angiosperms. These data should contribute to the understanding of the role of the YABBY genes in the regulation of developmental and physiological processes in achlorophyllous leafless plants.

  20. Genetic testing of the FBN1 gene in Chinese patients with Marfan/Marfan-like syndrome.

    Science.gov (United States)

    Yang, Hang; Luo, Mingyao; Chen, Qianlong; Fu, Yuanyuan; Zhang, Jing; Qian, Xiangyang; Sun, Xiaogang; Fan, Yuxin; Zhou, Zhou; Chang, Qian

    2016-08-01

    Marfan syndrome (MFS) is an autosomal dominant connective tissue disorder typically involving the ocular, skeletal and cardiovascular systems, and aortic aneurysms/dissection mainly contributes to its mortality. Here, we performed genetic testing of the FBN1 gene in 39 Chinese probands with Marfan/Marfan-like syndrome and their related family members by Sanger sequencing. In total, 29 pathogenic/likely pathogenic FBN1 mutations, including 17 novel ones, were identified. In addition, most MFS patients with aortic disease (62%) had a truncating or splicing mutation. These results expand the FBN1 mutation spectrum and enrich our knowledge of genotype-phenotype correlations. Genetic testing for MFS and its related aortic diseases is increasingly important for early intervention and treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Interferon γ-inducible protein (IFI) 16 transcriptionally regulates type i interferons and other interferon-stimulated genes and controls the interferon response to both DNA and RNA viruses.

    Science.gov (United States)

    Thompson, Mikayla R; Sharma, Shruti; Atianand, Maninjay; Jensen, Søren B; Carpenter, Susan; Knipe, David M; Fitzgerald, Katherine A; Kurt-Jones, Evelyn A

    2014-08-22

    The interferon γ-inducible protein 16 (IFI16) has recently been linked to the detection of nuclear and cytosolic DNA during infection with herpes simplex virus-1 and HIV. IFI16 binds dsDNA via HIN200 domains and activates stimulator of interferon genes (STING), leading to TANK (TRAF family member-associated NF-κB activator)-binding kinase-1 (TBK1)-dependent phosphorylation of interferon regulatory factor (IRF) 3 and transcription of type I interferons (IFNs) and related genes. To better understand the role of IFI16 in coordinating type I IFN gene regulation, we generated cell lines with stable knockdown of IFI16 and examined responses to DNA and RNA viruses as well as cyclic dinucleotides. As expected, stable knockdown of IFI16 led to a severely attenuated type I IFN response to DNA ligands and viruses. In contrast, expression of the NF-κB-regulated cytokines IL-6 and IL-1β was unaffected in IFI16 knockdown cells, suggesting that the role of IFI16 in sensing these triggers was unique to the type I IFN pathway. Surprisingly, we also found that knockdown of IFI16 led to a severe attenuation of IFN-α and the IFN-stimulated gene retinoic acid-inducible gene I (RIG-I) in response to cyclic GMP-AMP, a second messenger produced by cyclic GMP-AMP synthase (cGAS) as well as RNA ligands and viruses. Analysis of IFI16 knockdown cells revealed compromised occupancy of RNA polymerase II on the IFN-α promoter in these cells, suggesting that transcription of IFN-stimulated genes is dependent on IFI16. These results indicate a broader role for IFI16 in the regulation of the type I IFN response to RNA and DNA viruses in antiviral immunity. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Prelimbic Stimulation Ameliorates Depressive-Like Behaviors and Increases Regional BDNF Expression in a Novel Drug-Resistant Animal Model of Depression.

    Science.gov (United States)

    Moshe, Hagar; Gal, Ram; Barnea-Ygael, Noam; Gulevsky, Tatiana; Alyagon, Uri; Zangen, Abraham

    2016-01-01

    Approximately one third of all major depression patients fail to respond to conventional pharmacological antidepressants, and brain stimulation methods pose a promising alternative for this population. Recently, based on repeated multifactorial selective inbreeding of rats for depressive-like behaviors, we introduced a novel animal model for MDD. Rats from this Depressive Rat Line (DRL) exhibit inherent depressive-like behaviors, which are correlated with lower levels of brain-derived neurotrophic factor (BDNF) in specific brain regions. In addition, DRL rats do not respond to antidepressant medication but respond to electroconvulsive treatment, and they can thus be utilized to test the effectiveness of brain stimulation on hereditary, medication-resistant depressive-like behaviors. To test the effect of sub-convulsive electrical stimulation (SCES) of the prelimbic cortex, using TMS-like temporal pattern of stimulation, on depressive-like behaviors and regional BDNF levels in DRL rats. SCES sessions were administered daily for 10 days through chronically implanted electrodes. Temporal stimulation parameters were similar to those used in TMS for major depression in human patients. Depressive-like behaviors were assayed after treatment, followed by brain extraction and regional BDNF measurements. SCES normalized both the depressive-like behaviors and the reduced BDNF levels observed in DRL rats. Correlation analyses suggest that changes in specific behaviors are mediated, at least in part, by BDNF expression in reward-related brain regions. Brain stimulation is effective in a drug-resistant, inherited animal model for depression. BDNF alterations in specific regions may mediate different antidepressant effects. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Stimulation of the synthesis of bacteriophage T4 gene 32 protein by ultraviolet light irradiation

    International Nuclear Information System (INIS)

    Krisch, H.M.; Van Houwe, G.

    1976-01-01

    The synthesis of bacteriophage T4 gene 32 product, P32, has been followed by gel electrophoresis of lysates of infected cells which have been irradiated with ultraviolet light. In wild-type infections irradiation after the commencement of late gene expression results in a rapid stimulation of the rate of P32 synthesis. Within four minutes after irradiation P32 is synthesized at 11 times the rate of the unirradiated control infection. P32 seems to be the only T4 protein which exhibits such u.v. inducibility. This inducibility is dependent on the function of genes 46 and 47 and to a lesser extent on several other T4 genes thought to be involved in repair (P43, w and y). An infection defective in both P43 and P46 shows essentially no stimulation of the rate of P32 synthesis after irradiation. In the absence of DNA replication the parental DNA is degraded after irradiation in a dose-dependent manner. The extent of P32 induction in such an infection is also proportional to the dose. It is suggested that the production of gaps during repair of u.v.-irradiated DNA is responsible for the stimulation of P32 synthesis. A model is proposed in which such regions of single-stranded DNA compete for P32 by binding it nonspecifically, thus reducing the amount of P32 free to block the expression of gene 32. Because the expression of gene 32 is self-regulatory this would result in increased P32 synthesis. The possible role of P32 in the repair of u.v.-damaged DNA is discussed. (author)

  4. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    Science.gov (United States)

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  5. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  6. Functional analysis of the cathepsin-like cysteine protease genes in adult Brugia malayi using RNA interference.

    Directory of Open Access Journals (Sweden)

    Louise Ford

    Full Text Available Cathepsin-like enzymes have been identified as potential targets for drug or vaccine development in many parasites, as their functions appear to be essential in a variety of important biological processes within the host, such as molting, cuticle remodeling, embryogenesis, feeding and immune evasion. Functional analysis of Caenorhabditis elegans cathepsin L (Ce-cpl-1 and cathepsin Z (Ce-cpz-1 has established that both genes are required for early embryogenesis, with Ce-cpl-1 having a role in regulating in part the processing of yolk proteins. Ce-cpz-1 also has an important role during molting.RNA interference assays have allowed us to verify whether the functions of the orthologous filarial genes in Brugia malayi adult female worms are similar. Treatment of B. malayi adult female worms with Bm-cpl-1, Bm-cpl-5, which belong to group Ia of the filarial cpl gene family, or Bm-cpz-1 dsRNA resulted in decreased numbers of secreted microfilariae in vitro. In addition, analysis of the intrauterine progeny of the Bm-cpl-5 or Bm-cpl Pro dsRNA- and siRNA-treated worms revealed a clear disruption in the process of embryogenesis resulting in structural abnormalities in embryos and a varied differential development of embryonic stages.Our studies suggest that these filarial cathepsin-like cysteine proteases are likely to be functional orthologs of the C. elegans genes. This functional conservation may thus allow for a more thorough investigation of their distinct functions and their development as potential drug targets.

  7. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  8. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  9. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  10. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  11. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  12. Comprehensive evaluation of gene expression signatures in response to electroacupuncture stimulation at Zusanli (ST36) acupoint by transcriptomic analysis.

    Science.gov (United States)

    Wu, Jing-Shan; Lo, Hsin-Yi; Li, Chia-Cheng; Chen, Feng-Yuan; Hsiang, Chien-Yun; Ho, Tin-Yun

    2017-08-15

    Electroacupuncture (EA) has been applied to treat and prevent diseases for years. However, molecular events happened in both the acupunctured site and the internal organs after EA stimulation have not been clarified. Here we applied transcriptomic analysis to explore the gene expression signatures after EA stimulation. Mice were applied EA stimulation at ST36 for 15 min and nine tissues were collected three hours later for microarray analysis. We found that EA affected the expression of genes not only in the acupunctured site but also in the internal organs. EA commonly affected biological networks involved in cytoskeleton and cell adhesion, and also regulated unique process networks in specific organs, such as γ-aminobutyric acid-ergic neurotransmission in brain and inflammation process in lung. In addition, EA affected the expression of genes related to various diseases, such as neurodegenerative diseases in brain and obstructive pulmonary diseases in lung. This report applied, for the first time, a global comprehensive genome-wide approach to analyze the gene expression profiling of acupunctured site and internal organs after EA stimulation. The connection between gene expression signatures, biological processes, and diseases might provide a basis for prediction and explanation on the therapeutic potentials of acupuncture in organs.

  13. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.

    Science.gov (United States)

    He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan

    2012-07-01

    WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.

  14. Lack of segregation of a Marfan-like phenotype associating marfanoie habitus and mitral valve disease with fibrillin gene on chromosome 15

    Energy Technology Data Exchange (ETDEWEB)

    VanMaldergen, L.; Hilbert, P.; Gillerot, Y. [Institut de Morphologie Pathologique, Loverval (Belgium)] [and others

    1994-09-01

    Apart from typical Marfan syndrome (MS), several Marfan-like conditions are known. One of those is the MASS syndrome (Mitral involvement, Aortic dilatation, Skin and Skeletal abnormalities) defined by Pyeritz et al. Among these, a dominantly inherited mitral valve prolapse with marfanoid habitus have also been reported. Until now, except for a Marfan-like condition described by Boileau et al., all Marfan families are linked to fib 15. A large Belgian pedigree with 25 affected patients among 62 at risk subjects spanning four generations is described. A syndrome including marfanoid skeletal dysplasia (tall stature, dolichostenomelia, arachnodactyly, pectus carinatum joint dislocation), prolapse and/or myxomatous degeneration of the mitral valve, but without aortic dilatation of eye involvement was observed. Although the phenotype fulfills Berlin diagnostic criteria for MS, it closely resembles MASS syndrome. Preliminary linkage results show discordance aggregation insertion in the fib 15 gene, as evaluated by intragenic microsatellite fib 15. Since Dietz et al. described a similar patient with fib 15 gene, we suggest that this variant of Marfan syndrome is genetically heterogeneous and caused by mutations, some of which are allelic to classical Marfan syndrome plus a subtype, some of which are not. Linkage studies are under way to further characterize the gene involved in the present family.

  15. Genomic assessment of the evolution of the prion protein gene family in vertebrates.

    Science.gov (United States)

    Harrison, Paul M; Khachane, Amit; Kumar, Manish

    2010-05-01

    Prion diseases are devastating neurological disorders caused by the propagation of particles containing an alternative beta-sheet-rich form of the prion protein (PrP). Genes paralogous to PrP, called Doppel and Shadoo, have been identified, that also have neuropathological relevance. To aid in the further functional characterization of PrP and its relatives, we annotated completely the PrP gene family (PrP-GF), in the genomes of 42 vertebrates, through combined strategic application of gene prediction programs and advanced remote homology detection techniques (such as HMMs, PSI-TBLASTN and pGenThreader). We have uncovered several previously undescribed paralogous genes and pseudogenes. We find that current high-quality genomic evidence indicates that the PrP relative Doppel, was likely present in the last common ancestor of present-day Tetrapoda, but was lost in the bird lineage, since its divergence from reptiles. Using the new gene annotations, we have defined the consensus of structural features that are characteristic of the PrP and Doppel structures, across diverse Tetrapoda clades. Furthermore, we describe in detail a transcribed pseudogene derived from Shadoo that is conserved across primates, and that overlaps the meiosis gene, SYCE1, thus possibly regulating its expression. In addition, we analysed the locus of PRNP/PRND for significant conservation across the genomic DNA of eleven mammals, and determined the phylogenetic penetration of non-coding exons. The genomic evidence indicates that the second PRNP non-coding exon found in even-toed ungulates and rodents, is conserved in all high-coverage genome assemblies of primates (human, chimp, orang utan and macaque), and is, at least, likely to have fallen out of use during primate speciation. Furthermore, we have demonstrated that the PRNT gene (at the PRNP human locus) is conserved across at least sixteen mammals, and evolves like a long non-coding RNA, fashioned from fragments of ancient, long

  16. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium

    KAUST Repository

    Rao, Pavitra N.

    2016-06-14

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also present earlier in the Alveolata in the free-living, non-parasitophorous, photosynthetic chromerids, Chromera and Vitrella. In P. falciparum and P. berghei blood stage parasites the transcripts of all nine cpw-wpc genes have been detected in gametocytes. RNA immunoprecipitation followed by reverse transcriptase-PCR reveals all P. berghei cpw-wpc transcripts to be bound by the translational repressors DOZI and CITH, and thus are likely under translational control prior to transmission from the rodent host to the mosquito vector in P. berghei. The GFP tagging of two endogenous P. berghei genes confirmed translational silencing in the gametocyte and translation in ookinetes. Establishing a luciferase transgene assay we show that the 3′ untranslated region of PF3D7_1331400 controls protein expression of this reporter in P. falciparum gametocytes. Our analyses suggest that cpw-wpc genes are translationally silenced in gametocytes across Plasmodium spp. and activated during ookinete formation and thus may have a role in transmission to the mosquito.

  17. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium

    KAUST Repository

    Rao, Pavitra N.; Santos, Jorge M.; Pain, Arnab; Templeton, Thomas J.; Mair, Gunnar R.

    2016-01-01

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also present earlier in the Alveolata in the free-living, non-parasitophorous, photosynthetic chromerids, Chromera and Vitrella. In P. falciparum and P. berghei blood stage parasites the transcripts of all nine cpw-wpc genes have been detected in gametocytes. RNA immunoprecipitation followed by reverse transcriptase-PCR reveals all P. berghei cpw-wpc transcripts to be bound by the translational repressors DOZI and CITH, and thus are likely under translational control prior to transmission from the rodent host to the mosquito vector in P. berghei. The GFP tagging of two endogenous P. berghei genes confirmed translational silencing in the gametocyte and translation in ookinetes. Establishing a luciferase transgene assay we show that the 3′ untranslated region of PF3D7_1331400 controls protein expression of this reporter in P. falciparum gametocytes. Our analyses suggest that cpw-wpc genes are translationally silenced in gametocytes across Plasmodium spp. and activated during ookinete formation and thus may have a role in transmission to the mosquito.

  18. Comprehensive Analysis of the COBRA-Like (COBL) Gene Family in Gossypium Identifies Two COBLs Potentially Associated with Fiber Quality

    Science.gov (United States)

    Niu, Erli; Shang, Xiaoguang; Cheng, Chaoze; Bao, Jianghao; Zeng, Yanda; Cai, Caiping; Du, Xiongming; Guo, Wangzhen

    2015-01-01

    COBRA-Like (COBL) genes, which encode a plant-specific glycosylphosphatidylinositol (GPI) anchored protein, have been proven to be key regulators in the orientation of cell expansion and cellulose crystallinity status. Genome-wide analysis has been performed in A. thaliana, O. sativa, Z. mays and S. lycopersicum, but little in Gossypium. Here we identified 19, 18 and 33 candidate COBL genes from three sequenced cotton species, diploid cotton G. raimondii, G. arboreum and tetraploid cotton G. hirsutum acc. TM-1, respectively. These COBL members were anchored onto 10 chromosomes in G. raimondii and could be divided into two subgroups. Expression patterns of COBL genes showed highly developmental and spatial regulation in G. hirsutum acc. TM-1. Of them, GhCOBL9 and GhCOBL13 were preferentially expressed at the secondary cell wall stage of fiber development and had significantly co-upregulated expression with cellulose synthase genes GhCESA4, GhCESA7 and GhCESA8. Besides, GhCOBL9 Dt and GhCOBL13 Dt were co-localized with previously reported cotton fiber quality quantitative trait loci (QTLs) and the favorable allele types of GhCOBL9 Dt had significantly positive correlations with fiber quality traits, indicating that these two genes might play an important role in fiber development. PMID:26710066

  19. A novel mutation in the WFS1 gene identified in a Taiwanese family with low-frequency hearing impairment

    Directory of Open Access Journals (Sweden)

    Chung Shing-Fang

    2007-05-01

    Full Text Available Abstract Background Wolfram syndrome gene 1 (WFS1 accounts for most of the familial nonsyndromic low-frequency sensorineural hearing loss (LFSNHL which is characterized by sensorineural hearing losses equal to and below 2000 Hz. The current study aimed to contribute to our understanding of the molecular basis of LFSNHL in an affected Taiwanese family. Methods The Taiwanese family with LFSNHL was phenotypically characterized using audiologic examination and pedigree analysis. Genetic characterization was performed by direct sequencing of WFS1 and mutation analysis. Results Pure tone audiometry confirmed that the family members affected with LFSNHL had a bilateral sensorineural hearing loss equal to or below 2000 Hz. The hearing loss threshold of the affected members showed no progression, a characteristic that was consistent with a mutation in the WFS1 gene located in the DFNA6/14/38 locus. Pedigree analysis showed a hereditarily autosomal dominant pattern characterized by a full penetrance. Among several polymorphisms, a missense mutation Y669H (2005T>C in exon 8 of WFS1 was identified in members of a Taiwanese family diagnosed with LFSNHL but not in any of the control subjects. Conclusion We discovered a novel heterozygous missense mutation in exon 8 of WFS1 (i.e., Y669H which is likely responsible for the LFSNHL phenotype in this particular Taiwanese family.

  20. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  1. Resveratrol stimulates c-Fos gene transcription via activation of ERK1/2 involving multiple genetic elements.

    Science.gov (United States)

    Thiel, Gerald; Rössler, Oliver G

    2018-06-05

    The polyphenol resveratrol is found in many plant and fruits and is a constituent of our diet. Resveratrol has been proposed to have chemopreventive and anti-inflammatory activities. On the cellular level, resveratrol activates stimulus-regulated transcription factors. To identify resveratrol-responsive elements within a natural gene promoter, the molecular pathway leading to c-Fos gene expression by resveratrol was dissected. The c-Fos gene encodes a basic region leucine zipper transcription factor and is a prototype of an immediate-early gene that is regulated by a wide range of signaling molecules. We analyzed chromatin-integrated c-Fos promoter-luciferase reporter genes where transcription factor binding sites were destroyed by point mutations or deletion mutagenesis. The results show that mutation of the binding sites for serum response factor (SRF), activator protein-1 (AP-1) and cAMP response element binding protein (CREB) significantly reduced reporter gene transcription following stimulation of the cells with resveratrol. Inactivation of the binding sites for signal transducer and activator of transcription (STAT) or ternary complex factors did not influence resveratrol-regulated c-Fos promoter activity. Thus, the c-Fos promoter contains three resveratrol-responsive elements, the cAMP response element (CRE), and the binding sites for SRF and AP-1. Moreover, we show that the transcriptional activation potential of the c-Fos protein is increased in resveratrol-stimulated cells, indicating that the biological activity of c-Fos is elevated by resveratrol stimulation. Pharmacological and genetic experiments revealed that the protein kinase ERK1/2 is the signal transducer that connects resveratrol treatment with the c-Fos gene. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  3. Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

    Science.gov (United States)

    Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

    2014-02-01

    Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.

    Science.gov (United States)

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng

    2015-01-01

    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  5. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

    Science.gov (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

    2014-05-01

    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  6. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  7. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  8. WD-repeat instability and diversification of the Podospora anserina hnwd non-self recognition gene family.

    Science.gov (United States)

    Chevanne, Damien; Saupe, Sven J; Clavé, Corinne; Paoletti, Mathieu

    2010-05-06

    Genes involved in non-self recognition and host defence are typically capable of rapid diversification and exploit specialized genetic mechanism to that end. Fungi display a non-self recognition phenomenon termed heterokaryon incompatibility that operates when cells of unlike genotype fuse and leads to the cell death of the fusion cell. In the fungus Podospora anserina, three genes controlling this allorecognition process het-d, het-e and het-r are paralogs belonging to the same hnwd gene family. HNWD proteins are STAND proteins (signal transduction NTPase with multiple domains) that display a WD-repeat domain controlling recognition specificity. Based on genomic sequence analysis of different P. anserina isolates, it was established that repeat regions of all members of the gene family are extremely polymorphic and undergoing concerted evolution arguing for frequent recombination within and between family members. Herein, we directly analyzed the genetic instability and diversification of this allorecognition gene family. We have constituted a collection of 143 spontaneous mutants of the het-R (HNWD2) and het-E (hnwd5) genes with altered recognition specificities. The vast majority of the mutants present rearrangements in the repeat arrays with deletions, duplications and other modifications as well as creation of novel repeat unit variants. We investigate the extreme genetic instability of these genes and provide a direct illustration of the diversification strategy of this eukaryotic allorecognition gene family.

  9. Molecular Evolution and Genetic Variation of G2-Like Transcription Factor Genes in Maize.

    Directory of Open Access Journals (Sweden)

    Fang Liu

    Full Text Available The productivity of maize (Zea mays L. depends on the development of chloroplasts, and G2-like transcription factors play a central role in regulating chloroplast development. In this study, we identified 59 G2-like genes in the B73 maize genome and systematically analyzed these genes at the molecular and evolutionary levels. Based on gene structure character, motif compositions and phylogenetic analysis, maize G2-like genes (ZmG1- ZmG59 were divided into seven groups (I-VII. By synteny analysis, 18 collinear gene pairs and strongly conserved microsyntny among regions hosting G2-like genes across maize and sorghum were found. Here, we showed that the vast majority of ZmG gene duplications resulted from whole genome duplication events rather than tandem duplications. After gene duplication events, some ZmG genes were silenced. The functions of G2-like genes were multifarious and most genes that are expressed in green tissues may relate to maize photosynthesis. The qRT-PCR showed that the expression of these genes was sensitive to low temperature and drought. Furthermore, we analyzed differences of ZmGs specific to cultivars in temperate and tropical regions at the population level. Interestingly, the single nucleotide polymorphism (SNP analysis revealed that nucleotide polymorphism associated with different temperature zones. Above all, G2-like genes were highly conserved during evolution, but polymorphism could be caused due to a different geographical location. Moreover, G2-like genes might be related to cold and drought stresses.

  10. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Directory of Open Access Journals (Sweden)

    Yan Liangzhen

    2012-11-01

    Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

  11. The Medicago truncatula lysine motif-receptor-like kinase gene family includes NFP and new nodule-expressed genes

    NARCIS (Netherlands)

    Arrighi, J.F.; Barre, A.; Amor, Ben B.; Bersoult, A.; Campos Soriano, L.; Mirabella, R.; Carvalho-Niebel, de F.; Journet, E.P.; Ghérardi, M.; Huguet, T.; Geurts, R.; Dénarié, J.; Rougé, P.; Gough, C.

    2006-01-01

    Rhizobial Nod factors are key symbiotic signals responsible for starting the nodulation process in host legume plants. Of the six Medicago truncatula genes controlling a Nod factor signaling pathway, Nod Factor Perception (NFP) was reported as a candidate Nod factor receptor gene. Here, we provide

  12. Evolutionary genomics and adaptive evolution of the Hedgehog gene family (Shh, Ihh and Dhh in vertebrates.

    Directory of Open Access Journals (Sweden)

    Joana Pereira

    Full Text Available The Hedgehog (Hh gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh, each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.

  13. Evolutionary genomics and adaptive evolution of the Hedgehog gene family (Shh, Ihh and Dhh) in vertebrates.

    Science.gov (United States)

    Pereira, Joana; Johnson, Warren E; O'Brien, Stephen J; Jarvis, Erich D; Zhang, Guojie; Gilbert, M Thomas P; Vasconcelos, Vitor; Antunes, Agostinho

    2014-01-01

    The Hedgehog (Hh) gene family codes for a class of secreted proteins composed of two active domains that act as signalling molecules during embryo development, namely for the development of the nervous and skeletal systems and the formation of the testis cord. While only one Hh gene is found typically in invertebrate genomes, most vertebrates species have three (Sonic hedgehog--Shh; Indian hedgehog--Ihh; and Desert hedgehog--Dhh), each with different expression patterns and functions, which likely helped promote the increasing complexity of vertebrates and their successful diversification. In this study, we used comparative genomic and adaptive evolutionary analyses to characterize the evolution of the Hh genes in vertebrates following the two major whole genome duplication (WGD) events. To overcome the lack of Hh-coding sequences on avian publicly available databases, we used an extensive dataset of 45 avian and three non-avian reptilian genomes to show that birds have all three Hh paralogs. We find suggestions that following the WGD events, vertebrate Hh paralogous genes evolved independently within similar linkage groups and under different evolutionary rates, especially within the catalytic domain. The structural regions around the ion-binding site were identified to be under positive selection in the signaling domain. These findings contrast with those observed in invertebrates, where different lineages that experienced gene duplication retained similar selective constraints in the Hh orthologs. Our results provide new insights on the evolutionary history of the Hh gene family, the functional roles of these paralogs in vertebrate species, and on the location of mutational hotspots.

  14. Expression of Arabidopsis FCS-Like Zinc finger genes is differentially regulated by sugars, cellular energy level, and abiotic stress

    Directory of Open Access Journals (Sweden)

    Muhammed eJamsheer K

    2015-09-01

    Full Text Available Cellular energy status is an important regulator of plant growth, development, and stress mitigation. Environmental stresses ultimately lead to energy deficit in the cell which activates the SNF1-RELATED KINASE 1 (SnRK1 signaling cascade which eventually triggering a massive reprogramming of transcription to enable the plant to survive under low-energy conditions. The role of Arabidopsis thaliana FCS-Like Zinc finger (FLZ gene family in energy and stress signaling is recently come to highlight after their interaction with kinase subunits of SnRK1 were identified. In a detailed expression analysis in different sugars, energy starvation, and replenishment series, we identified that the expression of most of the FLZ genes is differentially modulated by cellular energy level. It was found that FLZ gene family contains genes which are both positively and negatively regulated by energy deficit as well as energy-rich conditions. Genetic and pharmacological studies identified the role of HEXOKINASE 1- dependent and energy signaling pathways in the sugar-induced expression of FLZ genes. Further, these genes were also found to be highly responsive to different stresses as well as abscisic acid. In over-expression of kinase subunit of SnRK1, FLZ genes were found to be differentially regulated in accordance with their response towards energy fluctuation suggesting that these genes may work downstream to the established SnRK1 signaling under low-energy stress. Taken together, the present study provides a conceptual framework for further studies related to SnRK1-FLZ interaction in relation to sugar and energy signaling and stress response.

  15. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  17. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  18. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Science.gov (United States)

    Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine

    2014-01-01

    Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  19. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Directory of Open Access Journals (Sweden)

    Florian Jabbour

    Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  20. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    International Nuclear Information System (INIS)

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

    1988-01-01

    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

  1. Induction of interferon-stimulated genes by IRF3 promotes replication of Toxoplasma gondii.

    Science.gov (United States)

    Majumdar, Tanmay; Chattopadhyay, Saurabh; Ozhegov, Evgeny; Dhar, Jayeeta; Goswami, Ramansu; Sen, Ganes C; Barik, Sailen

    2015-03-01

    Innate immunity is the first line of defense against microbial insult. The transcription factor, IRF3, is needed by mammalian cells to mount innate immune responses against many microbes, especially viruses. IRF3 remains inactive in the cytoplasm of uninfected cells; upon virus infection, it gets phosphorylated and then translocates to the nucleus, where it binds to the promoters of antiviral genes and induces their expression. Such genes include type I interferons (IFNs) as well as Interferon Stimulated Genes (ISGs). IRF3-/- cells support enhanced replication of many viruses and therefore, the corresponding mice are highly susceptible to viral pathogenesis. Here, we provide evidence for an unexpected pro-microbial role of IRF3: the replication of the protozoan parasite, Toxoplasma gondii, was significantly impaired in IRF3-/- cells. In exploring whether the transcriptional activity of IRF3 was important for its pro-parasitic function, we found that ISGs induced by parasite-activated IRF3 were indeed essential, whereas type I interferons were not important. To delineate the signaling pathway that activates IRF3 in response to parasite infection, we used genetically modified human and mouse cells. The pro-parasitic signaling pathway, which we termed PISA (Parasite-IRF3 Signaling Activation), activated IRF3 without any involvement of the Toll-like receptor or RIG-I-like receptor pathways, thereby ruling out a role of parasite-derived RNA species in activating PISA. Instead, PISA needed the presence of cGAS, STING, TBK1 and IRF3, indicating the necessity of DNA-triggered signaling. To evaluate the physiological significance of our in vitro findings, IRF3-/- mice were challenged with parasite infection and their morbidity and mortality were measured. Unlike WT mice, the IRF3-/- mice did not support replication of the parasite and were resistant to pathogenesis caused by it. Our results revealed a new paradigm in which the antiviral host factor, IRF3, plays a cell

  2. Serum amyloid A stimulates macrophage foam cell formation via lectin-like oxidized low-density lipoprotein receptor 1 upregulation

    International Nuclear Information System (INIS)

    Lee, Ha Young; Kim, Sang Doo; Baek, Suk-Hwan; Choi, Joon Hyuk; Cho, Kyung-Hyun; Zabel, Brian A.; Bae, Yoe-Sik

    2013-01-01

    Highlights: ► SAA induced macrophage foam cell formation. ► SAA stimulated upregulation of lectin-like oxidized low-density lipoprotein receptor 1 (LOX1). ► SAA-induced LOX1 expression and foam cell formation is mediated by JNK/NF-κB signaling. ► HDL-conjugated SAA also stimulates foam cell formation via LOX1 upregulation. ► The finding reveals a novel mechanism of action of SAA in the pathogenesis of atherosclerosis. -- Abstract: Elevated levels of serum amyloid A (SAA) is a risk factor for cardiovascular diseases, however, the role of SAA in the pathophysiology of atherosclerosis remains unclear. Here we show that SAA induced macrophage foam cell formation. SAA-stimulated foam cell formation was mediated by c-jun N-terminal kinase (JNK) signaling. Moreover, both SAA and SAA-conjugated high density lipoprotein stimulated the expression of the important scavenger receptor lectin-like oxidized low-density lipoprotein receptor 1 (LOX1) via nuclear factor-κB (NF-κB). A LOX1 antagonist carrageenan significantly blocked SAA-induced foam cell formation, indicating that SAA promotes foam cell formation via LOX1 expression. Our findings therefore suggest that SAA stimulates foam cell formation via LOX1 induction, and thus likely contributes to atherogenesis

  3. Serum amyloid A stimulates macrophage foam cell formation via lectin-like oxidized low-density lipoprotein receptor 1 upregulation

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ha Young, E-mail: hayoung@skku.edu [Department of Biological Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Mitochondria Hub Regulation Center, Dong-A University, Busan 602-714 (Korea, Republic of); Kim, Sang Doo [Department of Biological Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Baek, Suk-Hwan [Department of Biochemistry and Molecular Biology, College of Medicine, Yeungnam University, Daegu 705-717 (Korea, Republic of); Choi, Joon Hyuk [Department of Pathology, College of Medicine, Yeungnam University, Daegu 705-717 (Korea, Republic of); Cho, Kyung-Hyun [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Zabel, Brian A. [Palo Alto Institute for Research and Education, Veterans Affairs Hospital, Palo Alto, CA 94304 (United States); Bae, Yoe-Sik, E-mail: yoesik@skku.edu [Department of Biological Science, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Mitochondria Hub Regulation Center, Dong-A University, Busan 602-714 (Korea, Republic of); Samsung Advanced Institute for Health Sciences and Technology, Sungkyunkwan University, Seoul 135-710 (Korea, Republic of)

    2013-03-29

    Highlights: ► SAA induced macrophage foam cell formation. ► SAA stimulated upregulation of lectin-like oxidized low-density lipoprotein receptor 1 (LOX1). ► SAA-induced LOX1 expression and foam cell formation is mediated by JNK/NF-κB signaling. ► HDL-conjugated SAA also stimulates foam cell formation via LOX1 upregulation. ► The finding reveals a novel mechanism of action of SAA in the pathogenesis of atherosclerosis. -- Abstract: Elevated levels of serum amyloid A (SAA) is a risk factor for cardiovascular diseases, however, the role of SAA in the pathophysiology of atherosclerosis remains unclear. Here we show that SAA induced macrophage foam cell formation. SAA-stimulated foam cell formation was mediated by c-jun N-terminal kinase (JNK) signaling. Moreover, both SAA and SAA-conjugated high density lipoprotein stimulated the expression of the important scavenger receptor lectin-like oxidized low-density lipoprotein receptor 1 (LOX1) via nuclear factor-κB (NF-κB). A LOX1 antagonist carrageenan significantly blocked SAA-induced foam cell formation, indicating that SAA promotes foam cell formation via LOX1 expression. Our findings therefore suggest that SAA stimulates foam cell formation via LOX1 induction, and thus likely contributes to atherogenesis.

  4. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  5. Phylogenetic analysis and protein structure modelling identifies distinct Ca(2+)/Cation antiporters and conservation of gene family structure within Arabidopsis and rice species.

    Science.gov (United States)

    Pittman, Jon K; Hirschi, Kendal D

    2016-12-01

    The Ca(2+)/Cation Antiporter (CaCA) superfamily is an ancient and widespread family of ion-coupled cation transporters found in nearly all kingdoms of life. In animals, K(+)-dependent and K(+)-indendent Na(+)/Ca(2+) exchangers (NCKX and NCX) are important CaCA members. Recently it was proposed that all rice and Arabidopsis CaCA proteins should be classified as NCX proteins. Here we performed phylogenetic analysis of CaCA genes and protein structure homology modelling to further characterise members of this transporter superfamily. Phylogenetic analysis of rice and Arabidopsis CaCAs in comparison with selected CaCA members from non-plant species demonstrated that these genes form clearly distinct families, with the H(+)/Cation exchanger (CAX) and cation/Ca(2+) exchanger (CCX) families dominant in higher plants but the NCKX and NCX families absent. NCX-related Mg(2+)/H(+) exchanger (MHX) and CAX-related Na(+)/Ca(2+) exchanger-like (NCL) proteins are instead present. Analysis of genomes of ten closely-related rice species and four Arabidopsis-related species found that CaCA gene family structures are highly conserved within related plants, apart from minor variation. Protein structures were modelled for OsCAX1a and OsMHX1. Despite exhibiting broad structural conservation, there are clear structural differences observed between the different CaCA types. Members of the CaCA superfamily form clearly distinct families with different phylogenetic, structural and functional characteristics, and therefore should not be simply classified as NCX proteins, which should remain as a separate gene family.

  6. Gene structure, transcripts and calciotropic effects of the PTH family of peptides in Xenopus and chicken

    Directory of Open Access Journals (Sweden)

    Power Deborah M

    2010-12-01

    Full Text Available Abstract Background Parathyroid hormone (PTH and PTH-related peptide (PTHrP belong to a family of endocrine factors that share a highly conserved N-terminal region (amino acids 1-34 and play key roles in calcium homeostasis, bone formation and skeletal development. Recently, PTH-like peptide (PTH-L was identified in teleost fish raising questions about the evolution of these proteins. Although PTH and PTHrP have been intensively studied in mammals their function in other vertebrates is poorly documented. Amphibians and birds occupy unique phylogenetic positions, the former at the transition of aquatic to terrestrial life and the latter at the transition to homeothermy. Moreover, both organisms have characteristics indicative of a complex system in calcium regulation. This study investigated PTH family evolution in vertebrates with special emphasis on Xenopus and chicken. Results The PTH-L gene is present throughout the vertebrates with the exception of placental mammals. Gene structure of PTH and PTH-L seems to be conserved in vertebrates while PTHrP gene structure is divergent and has acquired new exons and alternative promoters. Splice variants of PTHrP and PTH-L are common in Xenopus and chicken and transcripts of the former have a widespread tissue distribution, although PTH-L is more restricted. PTH is widely expressed in fish tissue but from Xenopus to mammals becomes largely restricted to the parathyroid gland. The N-terminal (1-34 region of PTH, PTHrP and PTH-L in Xenopus and chicken share high sequence conservation and the capacity to modify calcium fluxes across epithelia suggesting a conserved role in calcium metabolism possibly via similar receptors. Conclusions The parathyroid hormone family contains 3 principal members, PTH, PTHrP and the recently identified PTH-L. In teleosts there are 5 genes which encode PTHrP (2, PTH (2 and PTH-L and in tetrapods there are 3 genes (PTHrP, PTH and PTH-L, the exception is placental mammals which

  7. Identification of haplotype tag single nucleotide polymorphisms within the nuclear factor-κB family genes and their clinical relevance in patients with major trauma.

    Science.gov (United States)

    Pan, Wei; Zhang, An Qiang; Gu, Wei; Gao, Jun Wei; Du, Ding Yuan; Zhang, Lian Yang; Zeng, Ling; Du, Juan; Wang, Hai Yan; Jiang, Jian Xin

    2015-03-20

    Nuclear factor-κB (NF-κB) family plays an important role in the development of sepsis in critically ill patients. Although several single nucleotide polymorphisms (SNPs) have been identified in the NF-κB family genes, only a few SNPs have been studied. A total of 753 patients with major blunt trauma were included in this study. Tag SNPs (tSNPs) were selected from the NF-κB family genes (NFKB1, NFKB2, RELA, RELB and REL) through construction of haplotype blocks. The SNPs selected from genes within the canonical NF-κB pathway (including NFKB1, RELA and REL), which played a critical role in innate immune responses were genotyped using pyrosequencing method and analyzed in relation to the risk of development of sepsis and multiple organ dysfunction (MOD) syndrome. Moreover, the rs842647 polymorphism was analyzed in relation to tumor necrosis factor α (TNF-α) production by peripheral blood leukocytes in response to bacterial lipoprotein stimulation. Eight SNPs (rs28362491, rs3774932, rs4648068, rs7119750, rs4803789, rs12609547, rs1560725 and rs842647) were selected from the NF-κB family genes. All of them were shown to be high-frequency SNPs in this study cohort. Four SNPs (rs28362491, rs4648068, rs7119750 and rs842647) within the canonical NF-κB pathway were genotyped, and rs842647 was associated with sepsis morbidity rate and MOD scores. An association was also observed between the rs842647 A allele and lower TNF-α production. rs842647 polymorphism might be used as relevant risk estimate for the development of sepsis and MOD syndrome in patients with major trauma.

  8. SEP-class genes in Prunus mume and their likely role in floral organ development.

    Science.gov (United States)

    Zhou, Yuzhen; Xu, Zongda; Yong, Xue; Ahmad, Sagheer; Yang, Weiru; Cheng, Tangren; Wang, Jia; Zhang, Qixiang

    2017-01-13

    Flower phylogenetics and genetically controlled development have been revolutionised during the last two decades. However, some of these evolutionary aspects are still debatable. MADS-box genes are known to play essential role in specifying the floral organogenesis and differentiation in numerous model plants like Petunia hybrida, Arabidopsis thaliana and Antirrhinum majus. SEPALLATA (SEP) genes, belonging to the MADS-box gene family, are members of the ABCDE and quartet models of floral organ development and play a vital role in flower development. However, few studies of the genes in Prunus mume have yet been conducted. In this study, we cloned four PmSEPs and investigated their phylogenetic relationship with other species. Expression pattern analyses and yeast two-hybrid assays of these four genes indicated their involvement in the floral organogenesis with PmSEP4 specifically related to specification of the prolificated flowers in P. mume. It was observed that the flower meristem was specified by PmSEP1 and PmSEP4, the sepal by PmSEP1 and PmSEP4, petals by PmSEP2 and PmSEP3, stamens by PmSEP2 and PmSEP3 and pistils by PmSEP2 and PmSEP3. With the above in mind, flower development in P. mume might be due to an expression of SEP genes. Our findings can provide a foundation for further investigations of the transcriptional factors governing flower development, their molecular mechanisms and genetic basis.

  9. Combining cell transplants or gene therapy with deep brain stimulation for Parkinson's disease.

    Science.gov (United States)

    Rowland, Nathan C; Starr, Philip A; Larson, Paul S; Ostrem, Jill L; Marks, William J; Lim, Daniel A

    2015-02-01

    Cell transplantation and gene therapy each show promise to enhance the treatment of Parkinson's disease (PD). However, because cell transplantation and gene therapy generally require direct delivery to the central nervous system, clinical trial design involves unique scientific, ethical, and financial concerns related to the invasive nature of the procedure. Typically, such biologics have been tested in PD patients who have not received any neurosurgical intervention. Here, we suggest that PD patients undergoing deep brain stimulation (DBS) device implantation are an ideal patient population for the clinical evaluation of cell transplantation and gene therapy. Randomizing subjects to an experimental group that receives the biologic concurrently with the DBS implantation-or to a control group that receives the DBS treatment alone-has several compelling advantages. First, this study design enables the participation of patients likely to benefit from DBS, many of whom simultaneously meet the inclusion criteria of biologic studies. Second, the need for a sham neurosurgical procedure is eliminated, which may reduce ethical concerns, promote patient recruitment, and enhance the blinding of surgical trials. Third, testing the biologic by "piggybacking" onto an established, reimbursable procedure should reduce the cost of clinical trials, which may allow a greater number of biologics to reach this critical stage of research translation. Finally, this clinical trial design may lead to combinatorial treatment strategies that provide PD patients with more durable control over disabling motor symptoms. By combining neuromodulation with biologics, we may also reveal important treatment paradigms relevant to other diseases of the brain. © 2014 International Parkinson and Movement Disorder Society.

  10. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  11. Overlapping protective roles for glutathione transferase gene family members in chemical and oxidative stress response in Agrobacterium tumefaciens.

    Science.gov (United States)

    Skopelitou, Katholiki; Muleta, Abdi W; Pavli, Ourania; Skaracis, Georgios N; Flemetakis, Emmanouil; Papageorgiou, Anastassios C; Labrou, Nikolaos E

    2012-03-01

    In the present work, we describe the characterisation of the glutathione transferase (GST) gene family from Agrobacterium tumefaciens C58. A genome survey revealed the presence of eight GST-like proteins in A. tumefaciens (AtuGSTs). Comparison by multiple sequence alignment generated a dendrogram revealing the phylogenetic relationships of AtuGSTs-like proteins. The beta and theta classes identified in other bacterial species are represented by five members in A. tumefaciens C58. In addition, there are three "orphan" sequences that do not fit into any previously recognised GST classes. The eight GST-like genes were cloned, expressed in Escherichia coli and their substrate specificity was determined towards 17 different substrates. The results showed that AtuGSTs catalyse a broad range of reactions, with different members of the family exhibiting quite varied substrate specificity. The 3D structures of AtuGSTs were predicted using molecular modelling. The use of comparative sequence and structural analysis of the AtuGST isoenzymes allowed us to identify local sequence and structural characteristics between different GST isoenzymes and classes. Gene expression profiling was conducted under normal culture conditions as well as under abiotic stress conditions (addition of xenobiotics, osmotic stress and cold and heat shock) to induce and monitor early stress-response mechanisms. The results reveal the constitutive expression of GSTs in A. tumefaciens and a modulation of GST activity after treatments, indicating that AtuGSTs presumably participate in a wide range of functions, many of which are important in counteracting stress conditions. These functions may be relevant to maintaining cellular homeostasis as well as in the direct detoxification of toxic compounds.

  12. Chitinase family GH18: evolutionary insights from the genomic history of a diverse protein family

    Directory of Open Access Journals (Sweden)

    Aronson Nathan N

    2007-06-01

    Full Text Available Abstract Background Chitinases (EC.3.2.1.14 hydrolyze the β-1,4-linkages in chitin, an abundant N-acetyl-β-D-glucosamine polysaccharide that is a structural component of protective biological matrices such as insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 (GH18 family of chitinases is an ancient gene family widely expressed in archea, prokaryotes and eukaryotes. Mammals are not known to synthesize chitin or metabolize it as a nutrient, yet the human genome encodes eight GH18 family members. Some GH18 proteins lack an essential catalytic glutamic acid and are likely to act as lectins rather than as enzymes. This study used comparative genomic analysis to address the evolutionary history of the GH18 multiprotein family, from early eukaryotes to mammals, in an effort to understand the forces that shaped the human genome content of chitinase related proteins. Results Gene duplication and loss according to a birth-and-death model of evolution is a feature of the evolutionary history of the GH18 family. The current human family likely originated from ancient genes present at the time of the bilaterian expansion (approx. 550 mya. The family expanded in the chitinous protostomes C. elegans and D. melanogaster, declined in early deuterostomes as chitin synthesis disappeared, and expanded again in late deuterostomes with a significant increase in gene number after the avian/mammalian split. Conclusion This comprehensive genomic study of animal GH18 proteins reveals three major phylogenetic groups in the family: chitobiases, chitinases/chitolectins, and stabilin-1 interacting chitolectins. Only the chitinase/chitolectin group is associated with expansion in late deuterostomes. Finding that the human GH18 gene family is closely linked to the human major histocompatibility complex paralogon on chromosome 1, together with the recent association of GH18 chitinase activity with Th2 cell inflammation, suggests that its late expansion

  13. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  14. Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Orozco, Rebecca; Hileman, Lena C

    2016-02-01

    Duplicated petunia clade-VI SPL genes differentially promote the timing of inflorescence and flower development, and leaf initiation rate. The timing of plant reproduction relative to favorable environmental conditions is a critical component of plant fitness, and is often associated with variation in plant architecture and habit. Recent studies have shown that overexpression of the microRNA miR156 in distantly related annual species results in plants with perennial characteristics, including late flowering, weak apical dominance, and abundant leaf production. These phenotypes are largely mediated through the negative regulation of a subset of genes belonging to the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) family of transcription factors. In order to determine how and to what extent paralogous SPL genes have partitioned their roles in plant growth and development, we functionally characterized petunia clade-VI SPL genes under different environmental conditions. Our results demonstrate that PhSBP1and PhSBP2 differentially promote discrete stages of the reproductive transition, and that PhSBP1, and possibly PhCNR, accelerates leaf initiation rate. In contrast to the closest homologs in annual Arabidopsis thaliana and Mimulus guttatus, PhSBP1 and PhSBP2 transcription is not mediated by the gibberellic acid pathway, but is positively correlated with photoperiod and developmental age. The developmental functions of clade-VI SPL genes have, thus, evolved following both gene duplication and speciation within the core eudicots, likely through differential regulation and incomplete sub-functionalization.

  15. A paralogue of the phosphomutase-like gene family in Candida glabrata, CgPmu2, gained broad-range phosphatase activity due to a small number of clustered substitutions.

    Science.gov (United States)

    Orlando, Kelly A; Iosue, Christine L; Leone, Sarah G; Davies, Danielle L; Wykoff, Dennis D

    2015-10-15

    Inorganic phosphate is required for a range of cellular processes, such as DNA/RNA synthesis and intracellular signalling. The phosphate starvation-inducible phosphatase activity of Candida glabrata is encoded by the gene CgPMU2 (C. glabrata phosphomutase-like protein). CgPMU2 is part of a three-gene family (∼75% identical) created through gene duplication in the C. glabrata clade; only CgPmu2 is a PHO-regulated broad range acid phosphatase. We identified amino acids that confer broad range phosphatase activity on CgPmu2 by creating fusions of sections of CgPMU2 with CgPMU1, a paralogue with little broad range phosphatase activity. We used site-directed mutagenesis on various fusions to sequentially convert CgPmu1 to CgPmu2. Based on molecular modelling of the Pmu proteins on to a histidine phosphatase crystal structure, clusters of amino acids were found in two distinct regions that were able to confer phosphatase activity. Substitutions in these two regions together conferred broad phosphatase activity on CgPmu1. Interestingly, one change is a histidine adjacent to the active site histidine of CgPmu2 and it exhibits a novel ability to partially replace the conserved active site histidine in CgPmu2. Additionally, a second amino acid change was able to confer nt phosphatase activity to CgPmu1, suggesting single amino acid changes neofunctionalize CgPmu2. © 2015 Authors; published by Portland Press Limited.

  16. COBRA-LIKE2, a member of the glycosylphosphatidylinositol-anchored COBRA-LIKE family, plays a role in cellulose deposition in arabidopsis seed coat mucilage secretory cells.

    Science.gov (United States)

    Ben-Tov, Daniela; Abraham, Yael; Stav, Shira; Thompson, Kevin; Loraine, Ann; Elbaum, Rivka; de Souza, Amancio; Pauly, Markus; Kieber, Joseph J; Harpaz-Saad, Smadar

    2015-03-01

    Differentiation of the maternally derived seed coat epidermal cells into mucilage secretory cells is a common adaptation in angiosperms. Recent studies identified cellulose as an important component of seed mucilage in various species. Cellulose is deposited as a set of rays that radiate from the seed upon mucilage extrusion, serving to anchor the pectic component of seed mucilage to the seed surface. Using transcriptome data encompassing the course of seed development, we identified COBRA-LIKE2 (COBL2), a member of the glycosylphosphatidylinositol-anchored COBRA-LIKE gene family in Arabidopsis (Arabidopsis thaliana), as coexpressed with other genes involved in cellulose deposition in mucilage secretory cells. Disruption of the COBL2 gene results in substantial reduction in the rays of cellulose present in seed mucilage, along with an increased solubility of the pectic component of the mucilage. Light birefringence demonstrates a substantial decrease in crystalline cellulose deposition into the cellulosic rays of the cobl2 mutants. Moreover, crystalline cellulose deposition into the radial cell walls and the columella appears substantially compromised, as demonstrated by scanning electron microscopy and in situ quantification of light birefringence. Overall, the cobl2 mutants display about 40% reduction in whole-seed crystalline cellulose content compared with the wild type. These data establish that COBL2 plays a role in the deposition of crystalline cellulose into various secondary cell wall structures during seed coat epidermal cell differentiation. © 2015 American Society of Plant Biologists. All Rights Reserved.

  17. The effect of sensory stimulation provided by family on arterial blood oxygen saturation in critical care patients.

    Science.gov (United States)

    Yousefi, Hojatollah; Naderi, Mojgan; Daryabeigi, Reza

    2015-01-01

    Stressors in the intensive care unit (ICU) impair patients' comfort, excite the stress response, and increase oxygen consumption in their body. Non-medical interventions are recommended by several studies as a treatment to improve comfort in the ICU patients. Sensory stimulation is one of the most important interventions. Since arterial blood oxygen saturation is an important index of patients' clinical and respiratory condition, this study aimed to investigate the effect of sensory stimulation provided by family on arterial blood oxygen saturation in critical care patients. This study is a clinical trial conducted on 64 patients hospitalized in the ICU wards of Al-Zahra and Kashani hospitals in Isfahan, Iran in 2012 and 2013. The patients were selected by simple sampling method and were randomly assigned to two groups (study and control). Patients' arterial blood oxygen saturations were measured 10 min before, immediately after, 10 min and 30 min after sensory stimulation in the study group, and simultaneously in the control group without any intervention. Repeated measures analysis of variance (ANOVA) showed a significant difference in the mean of arterial blood oxygen saturation levels 10 min before, immediately after, 10 min and 30 min after sensory stimulation in the study group (P 0.18). Application of sensory stimulations as a nursing and non-medical intervention by the family members improves comfort and increases the level of blood oxygen saturation in critical care patients.

  18. The Plasmodium PHIST and RESA-Like Protein Families of Human and Rodent Malaria Parasites

    Science.gov (United States)

    Moreira, Cristina K.; Naissant, Bernina; Coppi, Alida; Bennett, Brandy L.; Aime, Elena; Franke-Fayard, Blandine; Janse, Chris J.; Coppens, Isabelle; Sinnis, Photini; Templeton, Thomas J.

    2016-01-01

    The phist gene family has members identified across the Plasmodium genus, defined by the presence of a domain of roughly 150 amino acids having conserved aromatic residues and an all alpha-helical structure. The family is highly amplified in P. falciparum, with 65 predicted genes in the genome of the 3D7 isolate. In contrast, in the rodent malaria parasite P. berghei 3 genes are identified, one of which is an apparent pseudogene. Transcripts of the P. berghei phist genes are predominant in schizonts, whereas in P. falciparum transcript profiles span different asexual blood stages and gametocytes. We pursued targeted disruption of P. berghei phist genes in order to characterize a simplistic model for the expanded phist gene repertoire in P. falciparum. Unsuccessful attempts to disrupt P. berghei PBANKA_114540 suggest that this phist gene is essential, while knockout of phist PBANKA_122900 shows an apparent normal progression and non-essential function throughout the life cycle. Epitope-tagging of P. falciparum and P. berghei phist genes confirmed protein export to the erythrocyte cytoplasm and localization with a punctate pattern. Three P. berghei PEXEL/HT-positive exported proteins exhibit at least partial co-localization, in support of a common vesicular compartment in the cytoplasm of erythrocytes infected with rodent malaria parasites. PMID:27022937

  19. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  20. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  1. Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

    Science.gov (United States)

    Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

    2005-05-13

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

  2. Transcriptional dissection of melanoma identifies a high-risk subtype underlying TP53 family genes and epigenome deregulation

    Science.gov (United States)

    Badal, Brateil; Solovyov, Alexander; Di Cecilia, Serena; Chan, Joseph Minhow; Chang, Li-Wei; Iqbal, Ramiz; Aydin, Iraz T.; Rajan, Geena S.; Chen, Chen; Abbate, Franco; Arora, Kshitij S.; Tanne, Antoine; Gruber, Stephen B.; Johnson, Timothy M.; Fullen, Douglas R.; Phelps, Robert; Bhardwaj, Nina; Bernstein, Emily; Ting, David T.; Brunner, Georg; Schadt, Eric E.; Greenbaum, Benjamin D.; Celebi, Julide Tok

    2017-01-01

    BACKGROUND. Melanoma is a heterogeneous malignancy. We set out to identify the molecular underpinnings of high-risk melanomas, those that are likely to progress rapidly, metastasize, and result in poor outcomes. METHODS. We examined transcriptome changes from benign states to early-, intermediate-, and late-stage tumors using a set of 78 treatment-naive melanocytic tumors consisting of primary melanomas of the skin and benign melanocytic lesions. We utilized a next-generation sequencing platform that enabled a comprehensive analysis of protein-coding and -noncoding RNA transcripts. RESULTS. Gene expression changes unequivocally discriminated between benign and malignant states, and a dual epigenetic and immune signature emerged defining this transition. To our knowledge, we discovered previously unrecognized melanoma subtypes. A high-risk primary melanoma subset was distinguished by a 122-epigenetic gene signature (“epigenetic” cluster) and TP53 family gene deregulation (TP53, TP63, and TP73). This subtype associated with poor overall survival and showed enrichment of cell cycle genes. Noncoding repetitive element transcripts (LINEs, SINEs, and ERVs) that can result in immunostimulatory signals recapitulating a state of “viral mimicry” were significantly repressed. The high-risk subtype and its poor predictive characteristics were validated in several independent cohorts. Additionally, primary melanomas distinguished by specific immune signatures (“immune” clusters) were identified. CONCLUSION. The TP53 family of genes and genes regulating the epigenetic machinery demonstrate strong prognostic and biological relevance during progression of early disease. Gene expression profiling of protein-coding and -noncoding RNA transcripts may be a better predictor for disease course in melanoma. This study outlines the transcriptional interplay of the cancer cell’s epigenome with the immune milieu with potential for future therapeutic targeting. FUNDING

  3. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  4. Characterization of a gene family encoding SEA (sea-urchin sperm protein, enterokinase and agrin-domain proteins with lectin-like and heme-binding properties from Schistosoma japonicum.

    Directory of Open Access Journals (Sweden)

    Evaristus Chibunna Mbanefo

    Full Text Available BACKGROUND: We previously identified a novel gene family dispersed in the genome of Schistosoma japonicum by retrotransposon-mediated gene duplication mechanism. Although many transcripts were identified, no homolog was readily identifiable from sequence information. METHODOLOGY/PRINCIPAL FINDINGS: Here, we utilized structural homology modeling and biochemical methods to identify remote homologs, and characterized the gene products as SEA (sea-urchin sperm protein, enterokinase and agrin-domain containing proteins. A common extracellular domain in this family was structurally similar to SEA-domain. SEA-domain is primarily a structural domain, known to assist or regulate binding to glycans. Recombinant proteins from three members of this gene family specifically interacted with glycosaminoglycans with high affinity, with potential implication in ligand acquisition and immune evasion. Similar approach was used to identify a heme-binding site on the SEA-domain. The heme-binding mode showed heme molecule inserted into a hydrophobic pocket, with heme iron putatively coordinated to two histidine axial ligands. Heme-binding properties were confirmed using biochemical assays and UV-visible absorption spectroscopy, which showed high affinity heme-binding (K D = 1.605×10(-6 M and cognate spectroscopic attributes of hexa-coordinated heme iron. The native proteins were oligomers, antigenic, and are localized on adult worm teguments and gastrodermis; major host-parasite interfaces and site for heme detoxification and acquisition. CONCLUSIONS: The results suggest potential role, at least in the nucleation step of heme crystallization (hemozoin formation, and as receptors for heme uptake. Survival strategies exploited by parasites, including heme homeostasis mechanism in hemoparasites, are paramount for successful parasitism. Thus, assessing prospects for application in disease intervention is warranted.

  5. Characterization of a Gene Family Encoding SEA (Sea-urchin Sperm Protein, Enterokinase and Agrin)-Domain Proteins with Lectin-Like and Heme-Binding Properties from Schistosoma japonicum

    Science.gov (United States)

    Mbanefo, Evaristus Chibunna; Kikuchi, Mihoko; Huy, Nguyen Tien; Shuaibu, Mohammed Nasir; Cherif, Mahamoud Sama; Yu, Chuanxin; Wakao, Masahiro; Suda, Yasuo; Hirayama, Kenji

    2014-01-01

    Background We previously identified a novel gene family dispersed in the genome of Schistosoma japonicum by retrotransposon-mediated gene duplication mechanism. Although many transcripts were identified, no homolog was readily identifiable from sequence information. Methodology/Principal Findings Here, we utilized structural homology modeling and biochemical methods to identify remote homologs, and characterized the gene products as SEA (sea-urchin sperm protein, enterokinase and agrin)-domain containing proteins. A common extracellular domain in this family was structurally similar to SEA-domain. SEA-domain is primarily a structural domain, known to assist or regulate binding to glycans. Recombinant proteins from three members of this gene family specifically interacted with glycosaminoglycans with high affinity, with potential implication in ligand acquisition and immune evasion. Similar approach was used to identify a heme-binding site on the SEA-domain. The heme-binding mode showed heme molecule inserted into a hydrophobic pocket, with heme iron putatively coordinated to two histidine axial ligands. Heme-binding properties were confirmed using biochemical assays and UV-visible absorption spectroscopy, which showed high affinity heme-binding (K D = 1.605×10−6 M) and cognate spectroscopic attributes of hexa-coordinated heme iron. The native proteins were oligomers, antigenic, and are localized on adult worm teguments and gastrodermis; major host-parasite interfaces and site for heme detoxification and acquisition. Conclusions The results suggest potential role, at least in the nucleation step of heme crystallization (hemozoin formation), and as receptors for heme uptake. Survival strategies exploited by parasites, including heme homeostasis mechanism in hemoparasites, are paramount for successful parasitism. Thus, assessing prospects for application in disease intervention is warranted. PMID:24416467

  6. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  7. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  8. Dynamic Changes in Host Gene Expression following In Vitro Viral Mimic Stimulation in Crocodile Cells

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    2017-11-01

    Full Text Available The initial control of viral infection in a host is dominated by a very well orchestrated early innate immune system; however, very little is known about the ability of a host to control viral infection outside of mammals. The reptiles offer an evolutionary bridge between the fish and mammals, with the crocodile having evolved from the archosauria clade that included the dinosaurs, and being the largest living reptile species. Using an RNA-seq approach, we have defined the dynamic changes of a passaged primary crocodile cell line to stimulation with both RNA and DNA viral mimics. Cells displayed a marked upregulation of many genes known to be involved in the mammalian response to viral infection, including viperin, Mx1, IRF7, IRF1, and RIG-I with approximately 10% of the genes being uncharacterized transcripts. Both pathway and genome analysis suggested that the crocodile may utilize the main known mammalian TLR and cytosolic antiviral RNA signaling pathways, with the pathways being responsible for sensing DNA viruses less clear. Viral mimic stimulation upregulated the type I interferon, IFN-Omega, with many known antiviral interferon-stimulated genes also being upregulated. This work demonstrates for the first time that reptiles show functional regulation of many known and unknown antiviral pathways and effector genes. An enhanced knowledge of these ancient antiviral pathways will not only add to our understanding of the host antiviral innate response in non-mammalian species, but is critical to fully comprehend the complexity of the mammalian innate immune response to viral infection.

  9. Perfluorooctanoic acid stimulated mitochondrial biogenesis and gene transcription in rats

    International Nuclear Information System (INIS)

    Walters, M.W.; Bjork, J.A.; Wallace, K.B.

    2009-01-01

    Perfluorooctanoic acid (PFOA), used in the production of non-stick surface compounds, exhibits a worldwide distribution in the serum of humans and wildlife. In rodents PFOA transactivates PPARα and PPARγ nuclear receptors and increases mitochondrial DNA (mtDNA) copy number, which may be critical to the altered metabolic state of affected animals. A key regulator of mitochondrial biogenesis and transcription of mitochondrial genes is the PPARγ coactivator-1α (Pgc-1α) protein. The purpose of this study was to determine if Pgc-1α is implicated in the stimulation of mitochondrial biogenesis that occurs following the treatment of rats with PFOA. Livers from adult male Sprague-Dawley rats that received a 30 mg/kg daily oral dose of PFOA for 28 days were used for all experiments. Analysis of mitochondrial replication and transcription was performed by real time PCR, and proteins were detected using western blotting. PFOA treatment caused a transcriptional activation of the mitochondrial biogenesis pathway leading to a doubling of mtDNA copy number. Further, transcription of OXPHOS genes encoded by mtDNA was 3-4 times greater than that of nuclear encoded genes, suggestive of a preferential induction of mtDNA transcription. Western blot analysis revealed an increase in Pgc-1α, unchanged Tfam and decreased Cox II and Cox IV subunit protein expression. We conclude that PFOA treatment in rats induces mitochondrial biogenesis at the transcriptional level with a preferential stimulation of mtDNA transcription and that this occurs by way of activation of the Pgc-1α pathway. Implication of the Pgc-1α pathway is consistent with PPARγ transactivation by PFOA and reveals new understanding and possibly new critical targets for assessing or averting the associated metabolic disease.

  10. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  11. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  12. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  13. Genome-wide analysis of the GRAS gene family in Prunus mume.

    Science.gov (United States)

    Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

    2015-02-01

    Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

  14. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  15. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion

    Science.gov (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith

    2016-01-01

    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  16. LMI1-like genes involved in leaf margin development of Brassica napus.

    Science.gov (United States)

    Ni, Xiyuan; Liu, Han; Huang, Jixiang; Zhao, Jianyi

    2017-06-01

    In rapeseed (Brassica napus L.), leaf margins are variable and can be entire, serrate, or lobed. In our previous study, the lobed-leaf gene (LOBED-LEAF 1, BnLL1) was mapped to a 32.1 kb section of B. napus A10. Two LMI1-like genes, BnaA10g26320D and BnaA10g26330D, were considered the potential genes that controlled the lobed-leaf trait in rapeseed. In the present study, these two genes and another homologous gene (BnaC04g00850D) were transformed into Arabidopsis thaliana (L.) Heynh. plants to identify their functions. All three LMI1-like genes of B. napus produced serrate leaf margins. The expression analysis indicated that the expression level of BnaA10g26320D determined the difference between lobed- and entire-leaved lines in rapeseed. Therefore, it is likely that BnaA10g26320D corresponds to BnLL1.

  17. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  18. Mouse mammary tumor virus-like gene sequences are present in lung patient specimens

    Directory of Open Access Journals (Sweden)

    Rodríguez-Padilla Cristina

    2011-09-01

    Full Text Available Abstract Background Previous studies have reported on the presence of Murine Mammary Tumor Virus (MMTV-like gene sequences in human cancer tissue specimens. Here, we search for MMTV-like gene sequences in lung diseases including carcinomas specimens from a Mexican population. This study was based on our previous study reporting that the INER51 lung cancer cell line, from a pleural effusion of a Mexican patient, contains MMTV-like env gene sequences. Results The MMTV-like env gene sequences have been detected in three out of 18 specimens studied, by PCR using a specific set of MMTV-like primers. The three identified MMTV-like gene sequences, which were assigned as INER6, HZ101, and HZ14, were 99%, 98%, and 97% homologous, respectively, as compared to GenBank sequence accession number AY161347. The INER6 and HZ-101 samples were isolated from lung cancer specimens, and the HZ-14 was isolated from an acute inflammatory lung infiltrate sample. Two of the env sequences exhibited disruption of the reading frame due to mutations. Conclusion In summary, we identified the presence of MMTV-like gene sequences in 2 out of 11 (18% of the lung carcinomas and 1 out of 7 (14% of acute inflamatory lung infiltrate specimens studied of a Mexican Population.

  19. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  20. Evolution and Expression Patterns of CYC/TB1 Genes in Anacyclus: Phylogenetic Insights for Floral Symmetry Genes in Asteraceae

    Science.gov (United States)

    Bello, María A.; Cubas, Pilar; Álvarez, Inés; Sanjuanbenito, Guillermo; Fuertes-Aguilar, Javier

    2017-01-01

    Homologs of the CYC/TB1 gene family have been independently recruited many times across the eudicots to control aspects of floral symmetry The family Asteraceae exhibits the largest known diversification in this gene paralog family accompanied by a parallel morphological floral richness in its specialized head-like inflorescence. In Asteraceae, whether or not CYC/TB1 gene floral symmetry function is preserved along organismic and gene lineages is unknown. In this study, we used phylogenetic, structural and expression analyses focused on the highly derived genus Anacyclus (tribe Anthemidae) to address this question. Phylogenetic reconstruction recovered eight main gene lineages present in Asteraceae: two from CYC1, four from CYC2 and two from CYC3-like genes. The species phylogeny was recovered in most of the gene lineages, allowing the delimitation of orthologous sets of CYC/TB1 genes in Asteraceae. Quantitative real-time PCR analysis indicated that in Anacyclus three of the four isolated CYC2 genes are more highly expressed in ray flowers. The expression of the four AcCYC2 genes overlaps in several organs including the ligule of ray flowers, as well as in anthers and ovules throughout development. PMID:28487706

  1. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  2. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  3. Chitinase-like (CTL) and cellulose synthase (CESA) gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L.) bast fibers.

    Science.gov (United States)

    Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K

    2014-01-01

    Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.

  4. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

  5. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  6. Functional identification of the promoter of SLC4A5, a gene associated with cardiovascular and metabolic phenotypes in the HERITAGE Family Study.

    Science.gov (United States)

    Stütz, Adrian M; Teran-Garcia, Margarita; Rao, D C; Rice, Treva; Bouchard, Claude; Rankinen, Tuomo

    2009-11-01

    The sodium bicarbonate cotransporter gene SLC4A5, associated earlier with cardiovascular phenotypes, was tested for associations in the HERITAGE Family Study, and possible mechanisms were investigated. Twelve tag-single nucleotide polymorphisms (SNPs) covering the SLC4A5 gene were analyzed in 276 Black and 503 White healthy, sedentary subjects. Associations were tested using a variance components-based (QTDT) method with data adjusted for age, sex and body size. In Whites, rs6731545 and rs7571842 were significantly associated with resting and submaximal exercise pulse pressure (PP) (0.0004 HERITAGE Family Study are likely due to neither variation in the promoter nor known coding SNPs of SLC4A5.

  7. Stimulation of albumin gene transcription by insulin in primary cultures of rat hepatocytes

    International Nuclear Information System (INIS)

    Lloyd, C.E.; Kalinyak, J.E.; Hutson, S.M.; Jefferson, L.S.

    1987-01-01

    The first goal of the work reported here was to prepare single-stranded DNA sequences for use in studies on the regulation of albumin gene expression. A double-stranded rat albumin cDNA clone was subcloned into the bacteriophage vector M13mp7. Single-stranded recombinant clones were screened for albumin sequences containing either the mRNA strand or the complementary strand. Two clones were selected that contained the 1200 nucleotide long 3' end of the albumin sequence. DNA from the clone containing the mRNA strand was used as a template for DNA polymerase I to prepare a radiolabeled, single-stranded cDNA to albumin mRNA. This radiolabeled cDNA probe was used to quantitate the relative abundance of albumin mRNA in samples of total cellular RNA. DNA from the clone containing the complementary strand was used to measure relative rates of albumin gene transcription in isolated nuclei. The second goal was to use the single-stranded DNA probes to investigate the mechanism of the insulin-mediated stimulation of albumin synthesis in primary cultures of rat hepatocytes. Addition of insulin to hepatocytes maintained in a chemically defined, serum-free medium for 40 h in the absence of any hormones resulted in a specific 1.5- to 2.5-fold stimulation of albumin gene transcription that was maximal at 3 h and was maintained above control values for at least 24 h. The rate of albumin gene transcription in nuclei isolated from livers of diabetic rats was reduced to 50% of the value recorded in control nuclei. Taken together, these findings demonstrate that insulin regulates synthesis of albumin at the level of gene transcription

  8. Gene structure and functional characterization of growth hormone in dogfish, Squalus acanthias.

    Science.gov (United States)

    Moriyama, Shunsuke; Oda, Mayumi; Yamazaki, Tomohide; Yamaguchi, Kiyoko; Amiya, Noriko; Takahashi, Akiyoshi; Amano, Masafumi; Goto, Tomoaki; Nozaki, Masumi; Meguro, Hiroshi; Kawauchi, Hiroshi

    2008-06-01

    Dogfish (Squalus acanthias) growth hormone (GH) was identified by cDNA cloning and protein purification from the pituitary gland. Dogfish GH cDNA encoded a prehormone of 210 amino acids (aa). Sequence analysis of purified GH revealed that the prehormone is composed of a signal peptide of 27 aa and a mature protein of 183 aa. Dogfish GH showed 94% sequence identity with blue shark GH, and also showed 37-66%, 26%, and 48-67% sequence identity with GH from osteichtyes, an agnathan, and tetrapods. The site of production was identified through immunocytochemistry to be cells of the proximal pars distalis of the pituitary gland. Dogfish GH stimulates both insulin-like growth factor-I and II mRNA levels in dogfish liver in vitro. The dogfish GH gene consisted of five exons and four introns, the same as in lamprey, teleosts such as cypriniforms and siluriforms, and tetrapods. The 5'-flanking region within 1082 bp of the transcription start site contained consensus sequences for the TATA box, Pit-1/GHF-1, CRE, TRE, and ERE. These results show that the endocrine mechanism for growth stimulation by the GH-IGF axis was established at an early stage of vertebrate evolution, and that the 5-exon-type gene organization might reflect the structure of the ancestral gene for the GH gene family.

  9. Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato.

    Science.gov (United States)

    Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther

    2013-04-01

    Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.

  10. Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

    Science.gov (United States)

    Shastry, B S; Trese, M T

    2000-01-01

    Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

  11. Bioinformatic analysis reveals high diversity of bacterial genes for laccase-like enzymes.

    Directory of Open Access Journals (Sweden)

    Luka Ausec

    Full Text Available Fungal laccases have been used in various fields ranging from processes in wood and paper industries to environmental applications. Although a few bacterial laccases have been characterized in recent years, prokaryotes have largely been neglected as a source of novel enzymes, in part due to the lack of knowledge about the diversity and distribution of laccases within Bacteria. In this work genes for laccase-like enzymes were searched for in over 2,200 complete and draft bacterial genomes and four metagenomic datasets, using the custom profile Hidden Markov Models for two- and three-domain laccases. More than 1,200 putative genes for laccase-like enzymes were retrieved from chromosomes and plasmids of diverse bacteria. In 76% of the genes, signal peptides were predicted, indicating that these bacterial laccases may be exported from the cytoplasm, which contrasts with the current belief. Moreover, several examples of putatively horizontally transferred bacterial laccase genes were described. Many metagenomic sequences encoding fragments of laccase-like enzymes could not be phylogenetically assigned, indicating considerable novelty. Laccase-like genes were also found in anaerobic bacteria, autotrophs and alkaliphiles, thus opening new hypotheses regarding their ecological functions. Bacteria identified as carrying laccase genes represent potential sources for future biotechnological applications.

  12. The NAC transcription factor family in maritime pine (Pinus Pinaster): molecular regulation of two genes involved in stress responses.

    Science.gov (United States)

    Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción

    2015-10-24

    NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.

  13. Boule-like genes regulate male and female gametogenesis in the flatworm Macrostomum lignano

    NARCIS (Netherlands)

    Kuales, G.; De Mulder, K.; Glashauser, J.; Salvenmoser, W.; Takashima, S.; Hartenstein, V.; Berezikov, E.; Salzburger, W.; Ladurner, P.

    2011-01-01

    Members of the DAZ (Deleted in AZoospermia) gene family are important players in the process of gametogenesis and their dysregulation accounts for 10% of human male infertility. Boule, the ancestor of the family, is mainly involved in male meiosis in most organisms. With the exception of Drosophila

  14. TAIL1: an isthmin-like gene, containing type 1 thrombospondin-repeat and AMOP domain, mapped to ARVD1 critical region.

    Science.gov (United States)

    Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio

    2004-06-23

    Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.

  15. Influence of vascular endothelial growth factor stimulation and serum deprivation on gene activation patterns of human adipose tissue-derived stromal cells

    DEFF Research Database (Denmark)

    Tratwal, Josefine; Mathiasen, Anders Bruun; Juhl, Morten

    2015-01-01

    INTRODUCTION: Stimulation of mesenchymal stromal cells and adipose tissue-derived stromal cells (ASCs) with vascular endothelial growth factor (VEGF) has been used in multiple animal studies and clinical trials for regenerative purposes. VEGF stimulation is believed to promote angiogenesis and VEGF...... stimulation is usually performed under serum deprivation. Potential regenerative molecular mechanisms are numerous and the role of contributing factors is uncertain. The aim of the current study was to investigate the effect of in vitro serum deprivation and VEGF stimulation on gene expression patterns...... of ASCs. METHODS: Gene expressions of ASCs cultured in complete medium, ASCs cultured in serum-deprived medium and ASCs stimulated with VEGF in serum-deprived medium were compared. ASC characteristics according to criteria set by the International Society of Cellular Therapy were confirmed by flow...

  16. Insulin-Like Growth Factor-1 Inscribes a Gene Expression Profile for Angiogenic Factors and Cancer Progression in Breast Epithelial Cells

    Directory of Open Access Journals (Sweden)

    J.S. Oh

    2002-01-01

    Full Text Available Activation of the insulin-like growth factor-1 receptor (IGF-11R by IGF-1 is associated with the risk and progression of many types of cancer, although despite this it remains unclear how activated IGF-1 R contributes to cancer progression. In this study, gene expression changes elicited by IGF-1 were profiled in breast epithelial cells. We noted that many genes are functionally linked to cancer progression and angiogenesis. To validate some of the changes observed, the RNA and/or protein was confirmed for c-fos, cytochrome P4501Al, cytochrome P450 1131, interleukin-1 beta, fas ligand, vascular endothelial growth factor, and urokinase plasminogen activator. Nuclear proteins were also temporally monitored to address how gene expression changes were regulated. We found that IGF-1 stimulated the nuclear translocation of phosphorylated AKT, hypoxic-inducible factor-1 alpha, and phosphorylated cAMP-responsive element-binding protein, which correlated with temporal changes in gene expression. Next, the promoter regions of IGF-1-regulated genes were searched in silico. The promoters of genes that clustered together had similar regulatory regions. In summary, IGF-1 inscribes a gene expression profile relevant to cancer progression, and this study provides insight into the mechanism(s whereby some of these changes occur.

  17. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  18. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  19. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    Science.gov (United States)

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  20. Emergence of switch-like behavior in a large family of simple biochemical networks.

    Directory of Open Access Journals (Sweden)

    Dan Siegal-Gaskins

    2011-05-01

    Full Text Available Bistability plays a central role in the gene regulatory networks (GRNs controlling many essential biological functions, including cellular differentiation and cell cycle control. However, establishing the network topologies that can exhibit bistability remains a challenge, in part due to the exceedingly large variety of GRNs that exist for even a small number of components. We begin to address this problem by employing chemical reaction network theory in a comprehensive in silico survey to determine the capacity for bistability of more than 40,000 simple networks that can be formed by two transcription factor-coding genes and their associated proteins (assuming only the most elementary biochemical processes. We find that there exist reaction rate constants leading to bistability in ∼90% of these GRN models, including several circuits that do not contain any of the TF cooperativity commonly associated with bistable systems, and the majority of which could only be identified as bistable through an original subnetwork-based analysis. A topological sorting of the two-gene family of networks based on the presence or absence of biochemical reactions reveals eleven minimal bistable networks (i.e., bistable networks that do not contain within them a smaller bistable subnetwork. The large number of previously unknown bistable network topologies suggests that the capacity for switch-like behavior in GRNs arises with relative ease and is not easily lost through network evolution. To highlight the relevance of the systematic application of CRNT to bistable network identification in real biological systems, we integrated publicly available protein-protein interaction, protein-DNA interaction, and gene expression data from Saccharomyces cerevisiae, and identified several GRNs predicted to behave in a bistable fashion.

  1. Isolation of MA-ACS Gene Family and Expression Study of MA-ACS1 Gene in Musa acuminata Cultivar Pisang Ambon Lumut

    Directory of Open Access Journals (Sweden)

    LISTYA UTAMI KARMAWAN

    2009-03-01

    Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.

  2. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  3. Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

    Science.gov (United States)

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

    2013-02-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

  4. Gene expression profiling of peripheral blood mononuclear cells (PBMC) from Mycobacterium bovis infected cattle after in vitro antigenic stimulation with purified protein derivative of tuberculin (PPD).

    Science.gov (United States)

    Meade, Kieran G; Gormley, Eamonn; Park, Stephen D E; Fitzsimons, Tara; Rosa, Guilherme J M; Costello, Eamon; Keane, Joseph; Coussens, Paul M; MacHugh, David E

    2006-09-15

    Microarray analysis of messenger RNA (mRNA) abundance was used to investigate the gene expression program of peripheral blood mononuclear cells (PBMC) from cattle infected with Mycobacterium bovis, the causative agent of bovine tuberculosis. An immunospecific bovine microarray platform (BOTL-4) with spot features representing 1336 genes was used for transcriptional profiling of PBMC from six M. bovis-infected cattle stimulated in vitro with bovine purified protein derivative of tuberculin (PPD-bovine). Cells were harvested at four time points (3 h, 6 h, 12 h and 24 h post-stimulation) and a split-plot design with pooled samples was used for the microarray experiment to compare gene expression between PPD-bovine stimulated PBMC and unstimulated controls for each time point. Statistical analyses of these data revealed 224 genes (approximately 17% of transcripts on the array) differentially expressed between stimulated and unstimulated PBMC across the 24 h time course (PPPD-bovine across the 24 h time course. However, perturbation of the PBMC transcriptome was most apparent at time points 3 h and 12 h post-stimulation, with 81 and 84 genes differentially expressed, respectively. In addition, a more stringent statistical threshold (PPPD-bovine-, PPD-avian- and Concanavalin A (ConA) stimulated PBMC, including the interferon-gamma gene (IFNG), which was upregulated in PBMC stimulated with PPD-bovine (40-fold), PPD-avian (10-fold) and ConA (8-fold) after in vitro culture for 12 h. The pattern of expression of these genes in PPD-bovine stimulated PBMC provides the first description of an M. bovis-specific signature of infection that may provide insights into the molecular basis of the host response to infection. Although the present study was carried out with mixed PBMC cell populations, it will guide future studies to dissect immune cell-specific gene expression patterns in response to M. bovis infection.

  5. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Directory of Open Access Journals (Sweden)

    Preeti Arya

    Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  6. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Science.gov (United States)

    Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K

    2014-01-01

    Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  7. Involvement of the MEN1 gene locus in familial isolated hyperparathyroidism

    DEFF Research Database (Denmark)

    Villablanca, Andrea; Wassif, Wassif S; Birket-Smith, Niels Thomas

    2002-01-01

    Familial isolated hyperparathyroidism (FIHP) is a hereditary disorder characterised by uni- or multiglandular parathyroid disease. A subset of families are likely to be genetic variants of other familial tumour syndromes in which PHPT is the main feature, for example multiple endocrine neoplasia ...

  8. The alpha cell expresses glucagon-like peptide-2 receptors and glucagon-like peptide-2 stimulates glucagon secretion from the rat pancreas

    DEFF Research Database (Denmark)

    de Heer, J; Pedersen, J; Orskov, C

    2007-01-01

    AIMS/HYPOTHESIS: Glucagon-like peptide-2 (GLP-2) is a gut hormone regulating intestinal growth and nutrient absorption. Recently, GLP-2 has been reported to stimulate glucagon secretion in healthy humans. We sought to clarify the mechanism and physiological significance of this endocrine effect. ...... of the glucagonotropic action of GLP-2 in humans....

  9. Molecular study of the perforin gene in familial hematological malignancies

    Directory of Open Access Journals (Sweden)

    El Abed Rim

    2011-09-01

    Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

  10. Oestrogen regulates the expression of cathepsin E-A-like gene ...

    Indian Academy of Sciences (India)

    Hang Zheng

    2018-02-28

    Feb 28, 2018 ... 1College of Animal Science and Veterinary Medicine, Henan Agricultural .... evaluated the expression regulation mechanism of the gene ... C with ad libitum water and food. ... embryonic liver following the method previously described .... Cloning and sequence analysis of chicken cathepsin E-A-like gene.

  11. Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

    Science.gov (United States)

    Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

    2010-01-01

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

  12. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  13. The knottin-like Blufensin family regulates genes involved in nuclear import and the secretory pathway in barley-powdery mildew interactions

    Science.gov (United States)

    Xu, Weihui; Meng, Yan; Surana, Priyanka; Fuerst, Greg; Nettleton, Dan; Wise, Roger P.

    2015-01-01

    Plants have evolved complex regulatory mechanisms to control a multi-layered defense response to microbial attack. Both temporal and spatial gene expression are tightly regulated in response to pathogen ingress, modulating both positive and negative control of defense. BLUFENSINs, small knottin-like peptides in barley, wheat, and rice, are highly induced by attack from fungal pathogens, in particular, the obligate biotrophic fungus, Blumeria graminis f. sp. hordei (Bgh), causal agent of barley powdery mildew. Previous research indicated that Blufensin1 (Bln1) functions as a negative regulator of basal defense mechanisms. In the current report, we show that BLN1 and BLN2 can both be secreted to the apoplast and Barley stripe mosaic virus (BSMV)-mediated overexpression of Bln2 increases susceptibility of barley to Bgh. Bimolecular fluorescence complementation (BiFC) assays signify that BLN1 and BLN2 can interact with each other, and with calmodulin. We then used BSMV-induced gene silencing to knock down Bln1, followed by Barley1 GeneChip transcriptome analysis, to identify additional host genes influenced by Bln1. Analysis of differential expression revealed a gene set enriched for those encoding proteins annotated to nuclear import and the secretory pathway, particularly Importin α1-b and Sec61 γ subunits. Further functional analysis of these two affected genes showed that when silenced, they also reduced susceptibility to Bgh. Taken together, we postulate that Bln1 is co-opted by Bgh to facilitate transport of disease-related host proteins or effectors, influencing the establishment of Bgh compatibility on its barley host. PMID:26089830

  14. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  15. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

     768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  16. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  17. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  18. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  19. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  20. Loss of heterozygosity on chromosome 11q13 in two families with acromegaly/gigantism is independent of mutations of the multiple endocrine neoplasia type I gene.

    Science.gov (United States)

    Gadelha, M R; Prezant, T R; Une, K N; Glick, R P; Moskal, S F; Vaisman, M; Melmed, S; Kineman, R D; Frohman, L A

    1999-01-01

    Familial acromegaly/gigantism occurring in the absence of multiple endocrine neoplasia type I (MEN-1) or the Carney complex has been reported in 18 families since the biochemical diagnosis of GH excess became available, and the genetic defect is unknown. In the present study we examined 2 unrelated families with isolated acromegaly/gigantism. In family A, 3 of 4 siblings were affected, with ages at diagnosis of 19, 21, and 23 yr. In family B, 5 of 13 siblings exhibited the phenotype and were diagnosed at 13, 15, 17, 17, and 24 yr of age. All 8 affected patients had elevated basal GH levels associated with high insulin-like growth factor I levels and/or nonsuppressible serum GH levels during an oral glucose tolerance test. GHRH levels were normal in affected members of family A. An invasive macroadenoma was found in 6 subjects, and a microadenoma was found in 1 subject from family B. The sequence of the GHRH receptor complementary DNA in 1 tumor from family A was normal. There was no history of consanguinity in either family, and the past medical history and laboratory results excluded MEN-1 and the Carney complex in all affected and unaffected screened subjects. Five of 8 subjects have undergone pituitary surgery to date, and paraffin-embedded pituitary blocks were available for analysis. Loss of heterozygosity on chromosome 11q13 was studied by comparing microsatellite polymorphisms of leukocyte and tumor DNA using PYGM (centromeric) and D11S527 (telomeric), markers closely linked to the MEN-1 tumor suppressor gene. All tumors exhibited a loss of heterozygosity at both markers. Sequencing of the MEN-1 gene revealed no germline mutations in either family, nor was a somatic mutation found in tumor DNA from one subject in family A. The integrity of the MEN-1 gene in this subject was further supported by demonstration of the presence of MEN-1 messenger ribonucleic acid, as assessed by RT-PCR. These data indicate that loss of heterozygosity in these affected family

  1. [Deep brain stimulation - expectations and doubts. A nationwide questionnaire study of patients with Parkinson's disease and their family members].

    Science.gov (United States)

    Südmeyer, M; Volkmann, J; Wojtecki, L; Deuschl, G; Schnitzler, A; Möller, B

    2012-04-01

    The aim of this questionnaire-based study was to determine the decision-making motives from Parkinson's patients and their family members for deep brain stimulation (DBS), which are crucial for the attitude towards this therapy and which should be considered during the clinical interview. The questionnaire was sent out nationwide to members of the German Parkinson Association. Patient and family specific data as well as information sources, doubts and expectations with respect to DBS were assessed. A total of 582 patients and 476 family members answered the questionnaire, revealing that 96% of the patients and 91% of the family members already possessed information regarding DBS. While a large proportion of interviewees had specific expectations concerning DBS, more than two thirds expressed concerns regarding DBS; the most frequent with respect to intraoperative complications and stimulation-induced worsening of symptoms. The quantity of realistic patients and family expectations significantly correlated with a positive evaluation of DBS and doubts as well as unrealistic expectations of family members correlated with a negative attitude towards the operation. The findings suggest that patients and their relatives organized in support groups indeed possess detailed information regarding DBS. However, for the acceptance of the treatment a timely elucidation about DBS as well as responding to the individual concerns by the consulting physician is essential.

  2. A novel albumin gene mutation (R222I) in familial dysalbuminemic hyperthyroxinemia.

    Science.gov (United States)

    Schoenmakers, Nadia; Moran, Carla; Campi, Irene; Agostini, Maura; Bacon, Olivia; Rajanayagam, Odelia; Schwabe, John; Bradbury, Sonia; Barrett, Timothy; Geoghegan, Frank; Druce, Maralyn; Beck-Peccoz, Paolo; O'Toole, Angela; Clark, Penelope; Bignell, Michelle; Lyons, Greta; Halsall, David; Gurnell, Mark; Chatterjee, Krishna

    2014-07-01

    Familial dysalbuminemic hyperthyroxinemia, characterized by abnormal circulating albumin with increased T4 affinity, causes artefactual elevation of free T4 concentrations in euthyroid individuals. Four unrelated index cases with discordant thyroid function tests in different assay platforms were investigated. Laboratory biochemical assessment, radiolabeled T4 binding studies, and ALB sequencing were undertaken. (125)I-T4 binding to both serum and albumin in affected individuals was markedly increased, comparable with known familial dysalbuminemic hyperthyroxinemia cases. Sequencing showed heterozygosity for a novel ALB mutation (arginine to isoleucine at codon 222, R222I) in all four cases and segregation of the genetic defect with abnormal biochemical phenotype in one family. Molecular modeling indicates that arginine 222 is located within a high-affinity T4 binding site in albumin, with substitution by isoleucine, which has a smaller side chain predicted to reduce steric hindrance, thereby facilitating T4 and rT3 binding. When tested in current immunoassays, serum free T4 values from R222I heterozygotes were more measurably abnormal in one-step vs two-step assay architectures. Total rT3 measurements were also abnormally elevated. A novel mutation (R222I) in the ALB gene mediates dominantly inherited dysalbuminemic hyperthyroxinemia. Susceptibility of current free T4 immunoassays to interference by this mutant albumin suggests likely future identification of individuals with this variant binding protein.

  3. Genome-Wide Study of the Tomato SlMLO Gene Family and Its Functional Characterization in Response to the Powdery Mildew Fungus Oidium neolycopersici.

    Science.gov (United States)

    Zheng, Zheng; Appiano, Michela; Pavan, Stefano; Bracuto, Valentina; Ricciardi, Luigi; Visser, Richard G F; Wolters, Anne-Marie A; Bai, Yuling

    2016-01-01

    The MLO (Mildew Locus O) gene family encodes plant-specific proteins containing seven transmembrane domains and likely acting in signal transduction in a calcium and calmodulin dependent manner. Some members of the MLO family are susceptibility factors toward fungi causing the powdery mildew disease. In tomato, for example, the loss-of-function of the MLO gene SlMLO1 leads to a particular form of powdery mildew resistance, called ol-2, which arrests almost completely fungal penetration. This type of penetration resistance is characterized by the apposition of papillae at the sites of plant-pathogen interaction. Other MLO homologs in Arabidopsis regulate root response to mechanical stimuli (AtMLO4 and AtMLO11) and pollen tube reception by the female gametophyte (AtMLO7). However, the role of most MLO genes remains unknown. In this work, we provide a genome-wide study of the tomato SlMLO gene family. Besides SlMLO1, other 15 SlMLO homologs were identified and characterized with respect to their structure, genomic organization, phylogenetic relationship, and expression profile. In addition, by analysis of transgenic plants, we demonstrated that simultaneous silencing of SlMLO1 and two of its closely related homologs, SlMLO5 and SlMLO8, confer higher level of resistance than the one associated with the ol-2 mutation. The outcome of this study provides evidence for functional redundancy among tomato homolog genes involved in powdery mildew susceptibility. Moreover, we developed a series of transgenic lines silenced for individual SlMLO homologs, which lay the foundation for further investigations aimed at assigning new biological functions to the MLO gene family.

  4. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  5. Diversifying Selection in the Wheat Stem Rust Fungus Acts Predominantly on Pathogen-Associated Gene Families and Reveals Candidate Effectors

    Directory of Open Access Journals (Sweden)

    Jana eSperschneider

    2014-09-01

    Full Text Available Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defence proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialised gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control.

  6. Cloning of a recA-like gene of Proteus mirabilis

    International Nuclear Information System (INIS)

    Eitner, G.; Solonin, A.S.; Tanyashin, V.I.

    1981-01-01

    A gene of Proteus mirabilis that can substitute for functions of the recA gene of Escherichia coli has been cloned into the plasmid pBR322, using shotgun experiments. The recA-like gene (recAsub(P.m.)) has been localized by restriction mapping within a 1.5-Md PstI fragment that is a part of two cloned Hind III fragments of the chromosome of P. mirabilis. The restriction map of the recAsub(P.m.) gene differs from that of the recA gene of E. coli. Funtionally, the recombinant plasmids containing the recAsub(P.m.) gene restore a nearly wild-type level of UV-resistance to several point and deletion mutants in the recA gene of E. coli. (Auth.)

  7. Comprehensive analysis of the mutation spectrum in 301 German ALS families.

    Science.gov (United States)

    Müller, Kathrin; Brenner, David; Weydt, Patrick; Meyer, Thomas; Grehl, Torsten; Petri, Susanne; Grosskreutz, Julian; Schuster, Joachim; Volk, Alexander E; Borck, Guntram; Kubisch, Christian; Klopstock, Thomas; Zeller, Daniel; Jablonka, Sibylle; Sendtner, Michael; Klebe, Stephan; Knehr, Antje; Günther, Kornelia; Weis, Joachim; Claeys, Kristl G; Schrank, Berthold; Sperfeld, Anne-Dorte; Hübers, Annemarie; Otto, Markus; Dorst, Johannes; Meitinger, Thomas; Strom, Tim M; Andersen, Peter M; Ludolph, Albert C; Weishaupt, Jochen H

    2018-04-12

    Recent advances in amyotrophic lateral sclerosis (ALS) genetics have revealed that mutations in any of more than 25 genes can cause ALS, mostly as an autosomal-dominant Mendelian trait. Detailed knowledge about the genetic architecture of ALS in a specific population will be important for genetic counselling but also for genotype-specific therapeutic interventions. Here we combined fragment length analysis, repeat-primed PCR, Southern blotting, Sanger sequencing and whole exome sequencing to obtain a comprehensive profile of genetic variants in ALS disease genes in 301 German pedigrees with familial ALS. We report C9orf72 mutations as well as variants in consensus splice sites and non-synonymous variants in protein-coding regions of ALS genes. We furthermore estimate their pathogenicity by taking into account type and frequency of the respective variant as well as segregation within the families. 49% of our German ALS families carried a likely pathogenic variant in at least one of the earlier identified ALS genes. In 45% of the ALS families, likely pathogenic variants were detected in C9orf72, SOD1, FUS, TARDBP or TBK1 , whereas the relative contribution of the other ALS genes in this familial ALS cohort was 4%. We identified several previously unreported rare variants and demonstrated the absence of likely pathogenic variants in some of the recently described ALS disease genes. We here present a comprehensive genetic characterisation of German familial ALS. The present findings are of importance for genetic counselling in clinical practice, for molecular research and for the design of diagnostic gene panels or genotype-specific therapeutic interventions in Europe. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  8. GDNF gene is associated with tourette syndrome in a family study.

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A; King, Robert A; Heiman, Gary A; Mir, Pablo

    2015-07-01

    Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). The polymorphism rs3096140 in glial cell line-derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10(-4) ). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. © 2015 International Parkinson and Movement Disorder Society.

  9. GDNF Gene Is Associated With Tourette Syndrome in a Family Study

    Science.gov (United States)

    Huertas-Fernández, Ismael; Gómez-Garre, Pilar; Madruga-Garrido, Marcos; Bernal-Bernal, Inmaculada; Bonilla-Toribio, Marta; Martín-Rodríguez, Juan Francisco; Cáceres-Redondo, María Teresa; Vargas-González, Laura; Carrillo, Fátima; Pascual, Alberto; Tischfield, Jay A.; King, Robert A.; Heiman, Gary A.; Mir, Pablo

    2016-01-01

    Background Tourette syndrome is a disorder characterized by persistent motor and vocal tics, and frequently accompanied by the comorbidities attention deficit hyperactivity disorder and obsessive-compulsive disorder. Impaired synaptic neurotransmission has been implicated in its pathogenesis. Our aim was to investigate the association of 28 candidate genes, including genes related to synaptic neurotransmission and neurotrophic factors, with Tourette syndrome. Methods We genotyped 506 polymorphisms in a discovery cohort from the United States composed of 112 families and 47 unrelated singletons with Tourette syndrome (201 cases and 253 controls). Genes containing significant polymorphisms were imputed to fine-map the signal(s) to potential causal variants. Allelic analyses in Tourette syndrome cases were performed to check the role in attention deficit hyperactivity disorder and obsessive-compulsive disorder comorbidities. Target polymorphisms were further studied in a replication cohort from southern Spain composed of 37 families and three unrelated singletons (44 cases and 73 controls). Results The polymorphism rs3096140 in glial cell line–derived neurotrophic factor gene (GDNF) was significant in the discovery cohort after correction (P = 1.5 × 10−4). No linkage disequilibrium was found between rs3096140 and other functional variants in the gene. We selected rs3096140 as target polymorphism, and the association was confirmed in the replication cohort (P = 0.01). No association with any comorbidity was found. Conclusions As a conclusion, a common genetic variant in GDNF is associated with Tourette syndrome. A defect in the production of GDNF could compromise the survival of parvalbumin interneurons, thus altering the excitatory/inhibitory balance in the corticostriatal circuitry. Validation of this variant in other family cohorts is necessary. PMID:26096985

  10. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  11. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  12. Epstein-Barr virus latent gene sequences as geographical markers of viral origin: unique EBNA3 gene signatures identify Japanese viruses as distinct members of the Asian virus family.

    Science.gov (United States)

    Sawada, Akihisa; Croom-Carter, Deborah; Kondo, Osamu; Yasui, Masahiro; Koyama-Sato, Maho; Inoue, Masami; Kawa, Keisei; Rickinson, Alan B; Tierney, Rosemary J

    2011-05-01

    Polymorphisms in Epstein-Barr virus (EBV) latent genes can identify virus strains from different human populations and individual strains within a population. An Asian EBV signature has been defined almost exclusively from Chinese viruses, with little information from other Asian countries. Here we sequenced polymorphic regions of the EBNA1, 2, 3A, 3B, 3C and LMP1 genes of 31 Japanese strains from control donors and EBV-associated T/NK-cell lymphoproliferative disease (T/NK-LPD) patients. Though identical to Chinese strains in their dominant EBNA1 and LMP1 alleles, Japanese viruses were subtly different at other loci. Thus, while Chinese viruses mainly fall into two families with strongly linked 'Wu' or 'Li' alleles at EBNA2 and EBNA3A/B/C, Japanese viruses all have the consensus Wu EBNA2 allele but fall into two families at EBNA3A/B/C. One family has variant Li-like sequences at EBNA3A and 3B and the consensus Li sequence at EBNA3C; the other family has variant Wu-like sequences at EBNA3A, variants of a low frequency Chinese allele 'Sp' at EBNA3B and a consensus Sp sequence at EBNA3C. Thus, EBNA3A/B/C allelotypes clearly distinguish Japanese from Chinese strains. Interestingly, most Japanese viruses also lack those immune-escape mutations in the HLA-A11 epitope-encoding region of EBNA3B that are so characteristic of viruses from the highly A11-positive Chinese population. Control donor-derived and T/NK-LPD-derived strains were similarly distributed across allelotypes and, by using allelic polymorphisms to track virus strains in patients pre- and post-haematopoietic stem-cell transplant, we show that a single strain can induce both T/NK-LPD and B-cell-lymphoproliferative disease in the same patient.

  13. Genome-Wide Identification and Expression Analyses of Aquaporin Gene Family during Development and Abiotic Stress in Banana

    Science.gov (United States)

    Hu, Wei; Hou, Xiaowan; Huang, Chao; Yan, Yan; Tie, Weiwei; Ding, Zehong; Wei, Yunxie; Liu, Juhua; Miao, Hongxia; Lu, Zhiwei; Li, Meiying; Xu, Biyu; Jin, Zhiqiang

    2015-01-01

    Aquaporins (AQPs) function to selectively control the flow of water and other small molecules through biological membranes, playing crucial roles in various biological processes. However, little information is available on the AQP gene family in bananas. In this study, we identified 47 banana AQP genes based on the banana genome sequence. Evolutionary analysis of AQPs from banana, Arabidopsis, poplar, and rice indicated that banana AQPs (MaAQPs) were clustered into four subfamilies. Conserved motif analysis showed that all banana AQPs contained the typical AQP-like or major intrinsic protein (MIP) domain. Gene structure analysis suggested the majority of MaAQPs had two to four introns with a highly specific number and length for each subfamily. Expression analysis of MaAQP genes during fruit development and postharvest ripening showed that some MaAQP genes exhibited high expression levels during these stages, indicating the involvement of MaAQP genes in banana fruit development and ripening. Additionally, some MaAQP genes showed strong induction after stress treatment and therefore, may represent potential candidates for improving banana resistance to abiotic stress. Taken together, this study identified some excellent tissue-specific, fruit development- and ripening-dependent, and abiotic stress-responsive candidate MaAQP genes, which could lay a solid foundation for genetic improvement of banana cultivars. PMID:26307965

  14. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  15. A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

    Science.gov (United States)

    He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

    2017-08-23

    The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

  16. CCAAT/enhancer-binding protein delta activates insulin-like growth factor-I gene transcription in osteoblasts. Identification of a novel cyclic AMP signaling pathway in bone

    Science.gov (United States)

    Umayahara, Y.; Ji, C.; Centrella, M.; Rotwein, P.; McCarthy, T. L.

    1997-01-01

    Insulin-like growth factor-I (IGF-I) plays a key role in skeletal growth by stimulating bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other cAMP-activating agents enhanced IGF-I gene transcription in cultured primary rat osteoblasts through promoter 1, the major IGF-I promoter, and identified a short segment of the promoter, termed HS3D, that was essential for hormonal regulation of IGF-I gene expression. We now demonstrate that CCAAT/enhancer-binding protein (C/EBP) delta is a major component of a PGE2-stimulated DNA-protein complex involving HS3D and find that C/EBPdelta transactivates IGF-I promoter 1 through this site. Competition gel shift studies first indicated that a core C/EBP half-site (GCAAT) was required for binding of a labeled HS3D oligomer to osteoblast nuclear proteins. Southwestern blotting and UV-cross-linking studies showed that the HS3D probe recognized a approximately 35-kDa nuclear protein, and antibody supershift assays indicated that C/EBPdelta comprised most of the PGE2-activated gel-shifted complex. C/EBPdelta was detected by Western immunoblotting in osteoblast nuclear extracts after treatment of cells with PGE2. An HS3D oligonucleotide competed effectively with a high affinity C/EBP site from the rat albumin gene for binding to osteoblast nuclear proteins. Co-transfection of osteoblast cell cultures with a C/EBPdelta expression plasmid enhanced basal and PGE2-activated IGF-I promoter 1-luciferase activity but did not stimulate a reporter gene lacking an HS3D site. By contrast, an expression plasmid for the related protein, C/EBPbeta, did not alter basal IGF-I gene activity but did increase the response to PGE2. In osteoblasts and in COS-7 cells, C/EBPdelta, but not C/EBPbeta, transactivated a reporter gene containing four tandem copies of HS3D fused to a minimal promoter; neither transcription factor stimulated a gene with four copies of an HS3D mutant that was unable to bind osteoblast

  17. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  18. Comparative genomic analysis of the Lipase3 gene family in five plant species reveals distinct evolutionary origins.

    Science.gov (United States)

    Wang, Dan; Zhang, Lin; Hu, JunFeng; Gao, Dianshuai; Liu, Xin; Sha, Yan

    2018-04-01

    Lipases are physiologically important and ubiquitous enzymes that share a conserved domain and are classified into eight different families based on their amino acid sequences and fundamental biological properties. The Lipase3 family of lipases was reported to possess a canonical fold typical of α/β hydrolases and a typical catalytic triad, suggesting a distinct evolutionary origin for this family. Genes in the Lipase3 family do not have the same functions, but maintain the conserved Lipase3 domain. There have been extensive studies of Lipase3 structures and functions, but little is known about their evolutionary histories. In this study, all lipases within five plant species were identified, and their phylogenetic relationships and genetic properties were analyzed and used to group them into distinct evolutionary families. Each identified lipase family contained at least one dicot and monocot Lipase3 protein, indicating that the gene family was established before the split of dicots and monocots. Similar intron/exon numbers and predicted protein sequence lengths were found within individual groups. Twenty-four tandem Lipase3 gene duplications were identified, implying that the distinctive function of Lipase3 genes appears to be a consequence of translocation and neofunctionalization after gene duplication. The functional genes EDS1, PAD4, and SAG101 that are reportedly involved in pathogen response were all located in the same group. The nucleotide diversity (Dxy) and the ratio of nonsynonymous to synonymous nucleotide substitutions rates (Ka/Ks) of the three genes were significantly greater than the average across the genomes. We further observed evidence for selection maintaining diversity on three genes in the Toll-Interleukin-1 receptor type of nucleotide binding/leucine-rich repeat immune receptor (TIR-NBS LRR) immunity-response signaling pathway, indicating that they could be vulnerable to pathogen effectors.

  19. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  20. Effects of a Sensory Stimulation by Nurses and Families on Level of Cognitive Function, and Basic Cognitive Sensory Recovery of Comatose Patients With Severe Traumatic Brain Injury: A Randomized Control Trial.

    Science.gov (United States)

    Moattari, Marzieh; Alizadeh Shirazi, Fatemeh; Sharifi, Nasrin; Zareh, Najaf

    2016-09-01

    Several lines of evidence suggest that early sensory stimulation and regular family visiting programs are potential nursing interventions to improve the outcomes of head injured comatose patients. However, little is known about the impacts of family involvement in providing sensory stimulation. To determine the effects of a sensory stimulation program conducted by nurses and families on the consciousness, level of cognitive function, and basic cognitive sensory recovery of head injury comatose patients. This was a randomized clinical trial performed at the Shiraz level I trauma center including 60 head injured comatose patients with an initial Glasgow coma score (GCS) of less than 8. Patients were randomly assigned to receive sensory stimulation by a qualified nurse (nurse group; n = 20), by the family (family group; n = 20), or usual care (control group; n = 20). The sensory stimulation program involving the nurses and patients' families was conducted, twice daily, in the morning and evening for 7 days. The level of consciousness, level of cognitive function, and basic cognitive sensory recovery of the patients were evaluated and monitored using the GCS, Rancho Los Amigos (RLA), and Western Neuro-Sensory stimulation profile (WNSSP). Data were analyzed by chi square, Kruskal-Wallis, and repeated-measures tests using SPSS. All the patients were comparable regarding their baseline characteristics, level of consciousness, level of cognitive function, and basic cognitive sensory recovery determined by GCS, RLA, and WNSSP. Although the two intervention groups of the study improved, those who received the sensory stimulation program from their families had significantly higher GCS (P = 0.001), RLA (P = 0.001), and WNSSP (P = 0.001) scores after 7 days when compared to the two other groups. The application of sensory stimulation by families led to significant increases in the consciousness, level of cognitive function, and basic cognitive sensory recovery of comatose

  1. Comparative and evolutionary studies of vertebrate ALDH1A-like genes and proteins.

    Science.gov (United States)

    Holmes, Roger S

    2015-06-05

    Vertebrate ALDH1A-like genes encode cytosolic enzymes capable of metabolizing all-trans-retinaldehyde to retinoic acid which is a molecular 'signal' guiding vertebrate development and adipogenesis. Bioinformatic analyses of vertebrate and invertebrate genomes were undertaken using known ALDH1A1, ALDH1A2 and ALDH1A3 amino acid sequences. Comparative analyses of the corresponding human genes provided evidence for distinct modes of gene regulation and expression with putative transcription factor binding sites (TFBS), CpG islands and micro-RNA binding sites identified for the human genes. ALDH1A-like sequences were identified for all mammalian, bird, lizard and frog genomes examined, whereas fish genomes displayed a more restricted distribution pattern for ALDH1A1 and ALDH1A3 genes. The ALDH1A1 gene was absent in many bony fish genomes examined, with the ALDH1A3 gene also absent in the medaka and tilapia genomes. Multiple ALDH1A1-like genes were identified in mouse, rat and marsupial genomes. Vertebrate ALDH1A1, ALDH1A2 and ALDH1A3 subunit sequences were highly conserved throughout vertebrate evolution. Comparative amino acid substitution rates showed that mammalian ALDH1A2 sequences were more highly conserved than for the ALDH1A1 and ALDH1A3 sequences. Phylogenetic studies supported an hypothesis for ALDH1A2 as a likely primordial gene originating in invertebrate genomes and undergoing sequential gene duplication to generate two additional genes, ALDH1A1 and ALDH1A3, in most vertebrate genomes. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  2. NR4A1 (Nur77 mediates thyrotropin-releasing hormone-induced stimulation of transcription of the thyrotropin β gene: analysis of TRH knockout mice.

    Directory of Open Access Journals (Sweden)

    Yasuyo Nakajima

    Full Text Available Thyrotropin-releasing hormone (TRH is a major stimulator of thyrotropin-stimulating hormone (TSH synthesis in the anterior pituitary, though precisely how TRH stimulates the TSHβ gene remains unclear. Analysis of TRH-deficient mice differing in thyroid hormone status demonstrated that TRH was critical for the basal activity and responsiveness to thyroid hormone of the TSHβ gene. cDNA microarray and K-means cluster analyses with pituitaries from wild-type mice, TRH-deficient mice and TRH-deficient mice with thyroid hormone replacement revealed that the largest and most consistent decrease in expression in the absence of TRH and on supplementation with thyroid hormone was shown by the TSHβ gene, and the NR4A1 gene belonged to the same cluster as and showed a similar expression profile to the TSHβ gene. Immunohistochemical analysis demonstrated that NR4A1 was expressed not only in ACTH- and FSH- producing cells but also in thyrotrophs and the expression was remarkably reduced in TRH-deficient pituitary. Furthermore, experiments in vitro demonstrated that incubation with TRH in GH4C1 cells increased the endogenous NR4A1 mRNA level by approximately 50-fold within one hour, and this stimulation was inhibited by inhibitors for PKC and ERK1/2. Western blot analysis confirmed that TRH increased NR4A1 expression within 2 h. A series of deletions of the promoter demonstrated that the region between bp -138 and +37 of the TSHβ gene was responsible for the TRH-induced stimulation, and Chip analysis revealed that NR4A1 was recruited to this region. Conversely, knockdown of NR4A1 by siRNA led to a significant reduction in TRH-induced TSHβ promoter activity. Furthermore, TRH stimulated NR4A1 promoter activity through the TRH receptor. These findings demonstrated that 1 TRH is a highly specific regulator of the TSHβ gene, and 2 TRH mediated induction of the TSHβ gene, at least in part by sequential stimulation of the NR4A1-TSHβ genes through a PKC and

  3. Application of Various Statistical Models to Explore Gene-Gene Interactions in Folate, Xenobiotic, Toll-Like Receptor and STAT4 Pathways that Modulate Susceptibility to Systemic Lupus Erythematosus.

    Science.gov (United States)

    Rupasree, Yedluri; Naushad, Shaik Mohammad; Varshaa, Ravi; Mahalakshmi, Govindaraj Swathika; Kumaraswami, Konda; Rajasekhar, Liza; Kutala, Vijay Kumar

    2016-02-01

    In view of our previous studies showing an independent association of genetic polymorphisms in folate, xenobiotic, and toll-like receptor (TLR) pathways with the risk for systemic lupus erythematosus (SLE), we have developed three statistical models to delineate complex gene-gene interactions between folate, xenobiotic, TLR, and signal transducer and activator of transcription 4 (STAT4) signaling pathways in association with the molecular pathophysiology of SLE. We developed additive, multifactor dimensionality reduction (MDR), and artificial neural network (ANN) models. The additive model, although the simplest, suggested a moderate predictability of 30 polymorphisms of these four pathways (area under the curve [AUC] 0.66). MDR analysis revealed significant gene-gene interactions among glutathione-S-transferase (GST)T1 and STAT4 (rs3821236 and rs7574865) polymorphisms, which account for moderate predictability of SLE. The MDR model for specific auto-antibodies revealed the importance of gene-gene interactions among cytochrome P450, family1, subfamily A, polypeptide 1 (CYP1A1) m1, catechol-O-methyltransferase (COMT) H108L, solute carrier family 19 (folate transporter), member 1 (SLC19A1) G80A, estrogen receptor 1 (ESR1), TLR5, 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), thymidylate synthase (TYMS). and STAT4 polymorphisms. The ANN model for disease prediction showed reasonably good predictability of SLE risk with 30 polymorphisms (AUC 0.76). These polymorphisms contribute towards the production of SSB and anti-dsDNA antibodies to the extent of 48 and 40%, respectively, while their contribution for the production of antiRNP, SSA, and anti-cardiolipin antibodies varies between 20 and 30%. The current study highlighted the importance of genetic polymorphisms in folate, xenobiotic, TLR, and STAT4 signaling pathways as moderate predictors of SLE risk and delineates the molecular pathophysiology associated with these single nucleotide

  4. Candida albicans Agglutinin-Like Sequence (Als) Family Vignettes: A Review of Als Protein Structure and Function

    Science.gov (United States)

    Hoyer, Lois L.; Cota, Ernesto

    2016-01-01

    Approximately two decades have passed since the description of the first gene in the Candida albicans ALS (agglutinin-like sequence) family. Since that time, much has been learned about the composition of the family and the function of its encoded cell-surface glycoproteins. Solution of the structure of the Als adhesive domain provides the opportunity to evaluate the molecular basis for protein function. This review article is formatted as a series of fundamental questions and explores the diversity of the Als proteins, as well as their role in ligand binding, aggregative effects, and attachment to abiotic surfaces. Interaction of Als proteins with each other, their functional equivalence, and the effects of protein abundance on phenotypic conclusions are also examined. Structural features of Als proteins that may facilitate invasive function are considered. Conclusions that are firmly supported by the literature are presented while highlighting areas that require additional investigation to reveal basic features of the Als proteins, their relatedness to each other, and their roles in C. albicans biology. PMID:27014205

  5. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Peng, Fred Y; Yang, Rong-Cai

    2017-06-20

    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  6. Mutation analysis of the cathepsin C gene in Indian families with Papillon-Lefèvre syndrome

    Directory of Open Access Journals (Sweden)

    Srivastava Satish

    2003-07-01

    Full Text Available Abstract Background PLS is a rare autosomal recessive disorder characterized by early onset periodontopathia and palmar plantar keratosis. PLS is caused by mutations in the cathepsin C (CTSC gene. Dipeptidyl-peptidase I encoded by the CTSC gene removes dipeptides from the amino-terminus of protein substrates and mainly plays an immune and inflammatory role. Several mutations have been reported in this gene in patients from several ethnic groups. We report here mutation analysis of the CTSC gene in three Indian families with PLS. Methods Peripheral blood samples were obtained from individuals belonging to three Indian families with PLS for genomic DNA isolation. Exon-specific intronic primers were used to amplify DNA samples from individuals. PCR products were subsequently sequenced to detect mutations. PCR-SCCP and ASOH analyses were used to determine if mutations were present in normal control individuals. Results All patients from three families had a classic PLS phenotype, which included palmoplantar keratosis and early-onset severe periodontitis. Sequence analysis of the CTSC gene showed three novel nonsense mutations (viz., p.Q49X, p.Q69X and p.Y304X in homozygous state in affected individuals from these Indian families. Conclusions This study reported three novel nonsense mutations in three Indian families. These novel nonsense mutations are predicted to produce truncated dipeptidyl-peptidase I causing PLS phenotype in these families. A review of the literature along with three novel mutations reported here showed that the total number of mutations in the CTSC gene described to date is 41 with 17 mutations being located in exon 7.

  7. Influences of AMY1 gene copy number and protein expression on salivary alpha-amylase activity before and after citric acid stimulation in splenic asthenia children.

    Science.gov (United States)

    Yang, Zemin; Lin, Jing; Chen, Longhui; Zhang, Min; Yang, Xiaorong; Chen, Weiwen

    2015-06-01

    To compare the correlations between salivary alpha-amylase (sAA) activity and amylase, alpha 1 (salivary) gene (AMYl) copy number or its gene expression between splenic asthenia and healthy children, and investigate the reasons of attenuated sAA activity ratio before and after citric acid stimulation in splenic asthenia children. Saliva samples from 20 splenic asthenia children and 29 healthy children were collected before and after citric acid stimulation. AMYl copy number, sAA activity, and total sAA and glycosylated sAA contents were determined, and their correlations were analyzed. Although splenic asthenia and healthy children had no differences in AMY1 copy number, splenic asthenia children had positive correlations between AMY1 copy number and sAA activity before or after citric acid stimulation. Splenic asthenia children had a higher sAA glycosylated proportion ratio and glycosylated sAA content ratio, while their total sAA content ratio and sAA activity ratio were lower compared with healthy children. The glycosylated sAA content ratio was higher than the total sAA content ratio in both groups. Splenic asthenia and healthy children had positive correlations between total sAA or glycosylated sAA content and sAA activity. However, the role played by glycosylated sAA content in sAA activity in healthy children increased after citric acid stimulation, while it decreased in splenic asthenia children. Genetic factors like AMY1 copy number variations, and more importantly, sAA glycosylation abnormalities leading to attenuated sAA activity after citric acid stimulation, which were the main reasons of the attenuated sAA activity ratio in splenic asthenia children compared with healthy children.

  8. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  9. Variation at innate immunity Toll-like receptor genes in a bottlenecked population of a New Zealand robin.

    Directory of Open Access Journals (Sweden)

    Catherine E Grueber

    Full Text Available Toll-like receptors (TLRs are an ancient family of genes encoding transmembrane proteins that bind pathogen-specific molecules and initiate both innate and adaptive aspects of the immune response. Our goal was to determine whether these genes show sufficient genetic diversity in a bottlenecked population to be a useful addition or alternative to the more commonly employed major histocompatibility complex (MHC genotyping in a conservation genetics context. We amplified all known avian TLR genes in a severely bottlenecked population of New Zealand's Stewart Island robin (Petroica australis rakiura, for which reduced microsatellite diversity was previously observed. We genotyped 17-24 birds from a reintroduced island population (including the 12 founders for nine genes, seven of which were polymorphic. We observed a total of 24 single-nucleotide polymorphisms overall, 15 of which were non-synonymous, representing up to five amino-acid variants at a locus. One locus (TLR1LB showed evidence of past directional selection. Results also confirmed a passerine duplication of TLR7. The levels of TLR diversity that we observe are sufficient to justify their further use in addressing conservation genetic questions, even in bottlenecked populations.

  10. AHSG gene polymorphisms are associated with bone mineral density in Caucasian nuclear families

    International Nuclear Information System (INIS)

    Yang Yanjun; Wang Yanbo; Lei Shufeng; Long Jirong; Shen Hui; Zhao Lanjuan; Jiang Deke; Xiao Sumei; Chen Xiangding; Chen Yuan; Deng Hongwen

    2007-01-01

    Purpose. To investigate the role of alpha2-HS glycoprotein (AHSG) gene on bone mineral density (BMD) variation. Methods. A total of 665 subjects from 157 Caucasian nuclear families were genotyped at the AHSG NlaIII, SacI sites. The association and linkage between the single SNP markers and haplotypes constructed by two markers in this gene and BMDs at the spine and hip were determined by using quantitative transmission disequilibrium test (QTDT). Results. Significant within-family associations were obtained for spine BMD at both of studied markers (P = 0.036 and 0.005 at the NlaIII and SacI sites, respectively). Significant (P = 0.008 at the NlaIII locus) (P = 0.004 at the SacI locus) total associations at spine BMD were detected. Haplotype analyses confirmed those within-family and total association. Conclusions. These data suggest the polymorphisms in the AHSG gene may have effects on BMD variation in Caucasian population

  11. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    Science.gov (United States)

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  12. Insights into the evolution and diversification of the AT-hook Motif Nuclear Localized gene family in land plants.

    Science.gov (United States)

    Zhao, Jianfei; Favero, David S; Qiu, Jiwen; Roalson, Eric H; Neff, Michael M

    2014-10-14

    Members of the ancient land-plant-specific transcription factor AT-Hook Motif Nuclear Localized (AHL) gene family regulate various biological processes. However, the relationships among the AHL genes, as well as their evolutionary history, still remain unexplored. We analyzed over 500 AHL genes from 19 land plant species, ranging from the early diverging Physcomitrella patens and Selaginella to a variety of monocot and dicot flowering plants. We classified the AHL proteins into three types (Type-I/-II/-III) based on the number and composition of their functional domains, the AT-hook motif(s) and PPC domain. We further inferred their phylogenies via Bayesian inference analysis and predicted gene gain/loss events throughout their diversification. Our analyses suggested that the AHL gene family emerged in embryophytes and further evolved into two distinct clades, with Type-I AHLs forming one clade (Clade-A), and the other two types together diversifying in another (Clade-B). The two AHL clades likely diverged before the separation of Physcomitrella patens from the vascular plant lineage. In angiosperms, Clade-A AHLs expanded into 5 subfamilies; while, the ones in Clade-B expanded into 4 subfamilies. Examination of their expression patterns suggests that the AHLs within each clade share similar expression patterns with each other; however, AHLs in one monophyletic clade exhibit distinct expression patterns from the ones in the other clade. Over-expression of a Glycine max AHL PPC domain in Arabidopsis thaliana recapitulates the phenotype observed when over-expressing its Arabidopsis thaliana counterpart. This result suggests that the AHL genes from different land plant species may share conserved functions in regulating plant growth and development. Our study further suggests that such functional conservation may be due to conserved physical interactions among the PPC domains of AHL proteins. Our analyses reveal a possible evolutionary scenario for the AHL gene family

  13. Comparative genome analysis reveals a conserved family of actin-like proteins in apicomplexan parasites

    Directory of Open Access Journals (Sweden)

    Sibley L David

    2005-12-01

    Full Text Available Abstract Background The phylum Apicomplexa is an early-branching eukaryotic lineage that contains a number of important human and animal pathogens. Their complex life cycles and unique cytoskeletal features distinguish them from other model eukaryotes. Apicomplexans rely on actin-based motility for cell invasion, yet the regulation of this system remains largely unknown. Consequently, we focused our efforts on identifying actin-related proteins in the recently completed genomes of Toxoplasma gondii, Plasmodium spp., Cryptosporidium spp., and Theileria spp. Results Comparative genomic and phylogenetic studies of apicomplexan genomes reveals that most contain only a single conventional actin and yet they each have 8–10 additional actin-related proteins. Among these are a highly conserved Arp1 protein (likely part of a conserved dynactin complex, and Arp4 and Arp6 homologues (subunits of the chromatin-remodeling machinery. In contrast, apicomplexans lack canonical Arp2 or Arp3 proteins, suggesting they lost the Arp2/3 actin polymerization complex on their evolutionary path towards intracellular parasitism. Seven of these actin-like proteins (ALPs are novel to apicomplexans. They show no phylogenetic associations to the known Arp groups and likely serve functions specific to this important group of intracellular parasites. Conclusion The large diversity of actin-like proteins in apicomplexans suggests that the actin protein family has diverged to fulfill various roles in the unique biology of intracellular parasites. Conserved Arps likely participate in vesicular transport and gene expression, while apicomplexan-specific ALPs may control unique biological traits such as actin-based gliding motility.

  14. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  15. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  16. Benefits of gene transduction of granulocyte macrophage colony-stimulating factor in cancer vaccine using genetically modified dendritic cells.

    Science.gov (United States)

    Ojima, Toshiyasu; Iwahashi, Makoto; Nakamura, Masaki; Matsuda, Kenji; Nakamori, Mikihito; Ueda, Kentaro; Naka, Teiji; Katsuda, Masahiro; Miyazawa, Motoki; Yamaue, Hiroki

    2007-10-01

    Granulocyte macrophage colony-stimulating factor (GM-CSF) is a key cytokine for the generation and stimulation of dendritic cells (DCs), and it may also play a pivotal role in promoting the survival of DCs. In this study, the feasibility of creating a cancer vaccine using DCs adenovirally transduced with the carcinoembryonic antigen (CEA) gene and the GM-CSF gene was examined. In addition, the effect of the co-transduction of GM-CSF gene on the lifespan of these genetically modified DCs was determined. A cytotoxic assay using peripheral blood mononuclear cell (PBMC)-derived cytotoxic T lymphocytes (CTLs) was performed in a 4-h 51Cr release assay. The apoptosis of DCs was examined by TdT-mediated dUTP-FITC nick end labeling (TUNEL) assay. CEA-specific CTLs were generated from PBMCs stimulated with genetically modified DCs expressing CEA. The cytotoxicity of these CTLs was augmented by co-transduction of DCs with the GM-CSF gene. Co-transduction of the GM-CSF gene into DCs inhibited apoptosis of these DCs themselves via up-regulation of Bcl-x(L) expression, leading to the extension of the lifespan of these DCs. Furthermore, the transduction of the GM-CSF gene into DCs also suppressed the incidence of apoptosis of DCs induced by transforming growth factor-beta1 (TGFbeta-1). Immunotherapy using these genetically modified DCs may therefore be useful with several advantages as follows: i) adenoviral toxicity to DCs can be reduced; ii) the lifespan of vaccinated DCs can be prolonged; and iii) GM-CSF may protect DCs from apoptosis induced by tumor-derived TGFbeta-1 in the regional lymph nodes.

  17. Toll-Like Receptor 2 Stimulation of Osteoblasts Mediates Staphylococcus Aureus Induced Bone Resorption and Osteoclastogenesis through Enhanced RANKL

    Science.gov (United States)

    Kassem, Ali; Lindholm, Catharina; Lerner, Ulf H

    2016-01-01

    Severe Staphylococcus aureus (S. aureus) infections pose an immense threat to population health and constitute a great burden for the health care worldwide. Inter alia, S. aureus septic arthritis is a disease with high mortality and morbidity caused by destruction of the infected joints and systemic bone loss, osteoporosis. Toll-Like receptors (TLRs) are innate immune cell receptors recognizing a variety of microbial molecules and structures. S. aureus recognition via TLR2 initiates a signaling cascade resulting in production of various cytokines, but the mechanisms by which S. aureus causes rapid and excessive bone loss are still unclear. We, therefore, investigated how S. aureus regulates periosteal/endosteal osteoclast formation and bone resorption. S. aureus stimulation of neonatal mouse parietal bone induced ex vivo bone resorption and osteoclastic gene expression. This effect was associated with increased mRNA and protein expression of receptor activator of NF-kB ligand (RANKL) without significant change in osteoprotegerin (OPG) expression. Bone resorption induced by S. aureus was abolished by OPG. S. aureus increased the expression of osteoclastogenic cytokines and prostaglandins in the parietal bones but the stimulatory effect of S. aureus on bone resorption and Tnfsf11 mRNA expression was independent of these cytokines and prostaglandins. Stimulation of isolated periosteal osteoblasts with S. aureus also resulted in increased expression of Tnfsf11 mRNA, an effect lost in osteoblasts from Tlr2 knockout mice. S. aureus stimulated osteoclastogenesis in isolated periosteal cells without affecting RANKL-stimulated resorption. In contrast, S. aureus inhibited RANKL-induced osteoclast formation in bone marrow macrophages. These data show that S. aureus enhances bone resorption and periosteal osteoclast formation by increasing osteoblast RANKL production through TLR2. Our study indicates the importance of using different in vitro approaches for studies of how S

  18. COBRA-LIKE2, a Member of the Glycosylphosphatidylinositol-Anchored COBRA-LIKE Family, Plays a Role in Cellulose Deposition in Arabidopsis Seed Coat Mucilage Secretory Cells1,2[OPEN

    Science.gov (United States)

    Ben-Tov, Daniela; Abraham, Yael; Stav, Shira; Thompson, Kevin; Loraine, Ann; Elbaum, Rivka; de Souza, Amancio; Pauly, Markus; Kieber, Joseph J.; Harpaz-Saad, Smadar

    2015-01-01

    Differentiation of the maternally derived seed coat epidermal cells into mucilage secretory cells is a common adaptation in angiosperms. Recent studies identified cellulose as an important component of seed mucilage in various species. Cellulose is deposited as a set of rays that radiate from the seed upon mucilage extrusion, serving to anchor the pectic component of seed mucilage to the seed surface. Using transcriptome data encompassing the course of seed development, we identified COBRA-LIKE2 (COBL2), a member of the glycosylphosphatidylinositol-anchored COBRA-LIKE gene family in Arabidopsis (Arabidopsis thaliana), as coexpressed with other genes involved in cellulose deposition in mucilage secretory cells. Disruption of the COBL2 gene results in substantial reduction in the rays of cellulose present in seed mucilage, along with an increased solubility of the pectic component of the mucilage. Light birefringence demonstrates a substantial decrease in crystalline cellulose deposition into the cellulosic rays of the cobl2 mutants. Moreover, crystalline cellulose deposition into the radial cell walls and the columella appears substantially compromised, as demonstrated by scanning electron microscopy and in situ quantification of light birefringence. Overall, the cobl2 mutants display about 40% reduction in whole-seed crystalline cellulose content compared with the wild type. These data establish that COBL2 plays a role in the deposition of crystalline cellulose into various secondary cell wall structures during seed coat epidermal cell differentiation. PMID:25583925

  19. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  20. Ixodes scapularis tick serine proteinase inhibitor (serpin gene family; annotation and transcriptional analysis

    Directory of Open Access Journals (Sweden)

    Chalaire Katelyn C

    2009-05-01

    Full Text Available Abstract Background Serine proteinase inhibitors (Serpins are a large superfamily of structurally related, but functionally diverse proteins that control essential proteolytic pathways in most branches of life. Given their importance in the biology of many organisms, the concept that ticks might utilize serpins to evade host defenses and immunizing against or disrupting their functions as targets for tick control is an appealing option. Results A sequence homology search strategy has allowed us to identify at least 45 tick serpin genes in the Ixodes scapularis genome that are structurally segregated into 32 intronless and 13 intron-containing genes. Nine of the intron-containing serpins occur in a cluster of 11 genes that span 170 kb of DNA sequence. Based on consensus amino acid residues in the reactive center loop (RCL and signal peptide scanning, 93% are putatively inhibitory while 82% are putatively extracellular. Among the 11 different amino acid residues that are predicted at the P1 sites, 16 sequences possess basic amino acid (R/K residues. Temporal and spatial expression analyses revealed that 40 of the 45 serpins are differentially expressed in salivary glands (SG and/or midguts (MG of unfed and partially fed ticks. Ten of the 38 serpin genes were expressed from six to 24 hrs of feeding while six and fives genes each are predominantly or exclusively expressed in either MG and SG respectively. Conclusion Given the diversity among tick species, sizes of tick serpin families are likely to be variable. However this study provides insight on the potential sizes of serpin protein families in ticks. Ticks must overcome inflammation, complement activation and blood coagulation to complete feeding. Since these pathways are regulated by serpins that have basic residues at their P1 sites, we speculate that I. scapularis may utilize some of the serpins reported in this study to manipulate host defense. We have discussed our data in the context of

  1. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  2. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  3. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  4. Macrophage colony-stimulating factor, CSF-1, and its proto-oncogene-encoded receptor

    International Nuclear Information System (INIS)

    Sherr, C.J.; Rettenmier, C.W.; Roussel, M.F.

    1988-01-01

    The macrophage colony-stimulating factor, CSF-1, or M-CSF, is one of a family of hematopoietic growth factors that stimulates the proliferation of monocytes, macrophages, and their committed bone marrow progenitors. Unlike pluripotent hemopoietins such as granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-3 (IL-3 or multi-CSF), which affect the growth of myeloid cells of several different hematopoietic lineages, CSF-1 acts only on cells of the mononuclear phagocyte series to stimulate their growth and enhance their survival. Retroviral transduction of the feline c-fms gene in the Susan McDonough and Hardy Zuckerman-5 (HZ-5) strains of feline sarcoma virus (FeSV) led to genetic alterations that endowed the recombined viral oncogene (v-fms) with the ability to transform cells in culture morphologically and to induce firbrosarcomas and hematopoietic neoplasms in susceptible animals. The v-fms oncogene product differs from the normal CSF-1 receptor in certain of its cardinal biochemical properties, most notably in exhibiting constitutively high basal levels of tyrosine kinase activity in the absence of its ligand. Comparative studies of the c-fms and v-fms genes coupled with analyses of engineered mutants and receptor chimeras have begun to pinpoint pertinent genetic alterations in the normal receptor gene that unmask its latent oncogenic potential. In addition, the availability of biologically active c-fms, v-fms, and CSF-1 cDNAs has allowed these genes to be mobilized and expressed in naive cells, thereby facilitating assays for receptor coupling with downstream components of the mitogenic pathway in diverse cell types

  5. A diverse family of serine proteinase genes expressed in cotton boll weevil (Anthonomus grandis): implications for the design of pest-resistant transgenic cotton plants.

    Science.gov (United States)

    Oliveira-Neto, Osmundo B; Batista, João A N; Rigden, Daniel J; Fragoso, Rodrigo R; Silva, Rodrigo O; Gomes, Eliane A; Franco, Octávio L; Dias, Simoni C; Cordeiro, Célia M T; Monnerat, Rose G; Grossi-De-Sá, Maria F

    2004-09-01

    Fourteen different cDNA fragments encoding serine proteinases were isolated by reverse transcription-PCR from cotton boll weevil (Anthonomus grandis) larvae. A large diversity between the sequences was observed, with a mean pairwise identity of 22% in the amino acid sequence. The cDNAs encompassed 11 trypsin-like sequences classifiable into three families and three chymotrypsin-like sequences belonging to a single family. Using a combination of 5' and 3' RACE, the full-length sequence was obtained for five of the cDNAs, named Agser2, Agser5, Agser6, Agser10 and Agser21. The encoded proteins included amino acid sequence motifs of serine proteinase active sites, conserved cysteine residues, and both zymogen activation and signal peptides. Southern blotting analysis suggested that one or two copies of these serine proteinase genes exist in the A. grandis genome. Northern blotting analysis of Agser2 and Agser5 showed that for both genes, expression is induced upon feeding and is concentrated in the gut of larvae and adult insects. Reverse northern analysis of the 14 cDNA fragments showed that only two trypsin-like and two chymotrypsin-like were expressed at detectable levels. Under the effect of the serine proteinase inhibitors soybean Kunitz trypsin inhibitor and black-eyed pea trypsin/chymotrypsin inhibitor, expression of one of the trypsin-like sequences was upregulated while expression of the two chymotrypsin-like sequences was downregulated. Copyright 2004 Elsevier Ltd.

  6. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development

    International Nuclear Information System (INIS)

    Gao, Junpeng; Cao, Xiaoli; Shi, Shandang; Ma, Yuling; Wang, Kai; Liu, Shengjie; Chen, Dan; Chen, Qin; Ma, Haoli

    2016-01-01

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. - Highlights: • A systematic analysis of the potato AUX/IAA gene family were performed. • StIAA genes were related to auxin perception and signal transduction. • Candidate StIAA genes likely related to tuber initiation and expansion were screened.

  7. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Junpeng [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Innovation Experimental College, Northwest A& F University, Yangling, Shaanxi 712100 (China); Cao, Xiaoli; Shi, Shandang [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Ma, Yuling [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Innovation Experimental College, Northwest A& F University, Yangling, Shaanxi 712100 (China); Wang, Kai; Liu, Shengjie [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Chen, Dan [School of Life Sciences and Technology, Xidian University, Xi' an, Shaanxi 710071 (China); Chen, Qin [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Ma, Haoli, E-mail: mahaoli@nwsuaf.edu.cn [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China)

    2016-03-04

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. - Highlights: • A systematic analysis of the potato AUX/IAA gene family were performed. • StIAA genes were related to auxin perception and signal transduction. • Candidate StIAA genes likely related to tuber initiation and expansion were screened.

  8. Molecular genetic characterization of the RD-114 gene family of endogenous feline retroviral sequences.

    Science.gov (United States)

    Reeves, R H; O'Brien, S J

    1984-01-01

    RD-114 is a replication-competent, xenotropic retrovirus which is homologous to a family of moderately repetitive DNA sequences present at ca. 20 copies in the normal cellular genome of domestic cats. To examine the extent and character of genomic divergence of the RD-114 gene family as well as to assess their positional association within the cat genome, we have prepared a series of molecular clones of endogenous RD-114 DNA segments from a genomic library of cat cellular DNA. Their restriction endonuclease maps were compared with each other as well as to that of the prototype-inducible RD-114 which was molecularly cloned from a chronically infected human cell line. The endogenous sequences analyzed were similar to each other in that they were colinear with RD-114 proviral DNA, were bounded by long terminal redundancies, and conserved many restriction sites in the gag and pol regions. However, the env regions of many of the sequences examined were substantially deleted. Several of the endogenous RD-114 genomes contained a novel envelope sequence which was unrelated to the env gene of the prototype RD-114 env gene but which, like RD-114 and endogenous feline leukemia virus provirus, was found only in species of the genus Felis, and not in other closely related Felidae genera. The endogenous RD-114 sequences each had a distinct cellular flank which indicates that these sequences are not tandem but dispersed nonspecifically throughout the genome. Southern analysis of cat cellular DNA confirmed the conclusions about conserved restriction sites in endogenous sequences and indicated that a single locus may be responsible for the production of the major inducible form of RD-114. Images PMID:6090693

  9. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  10. Integrative network analysis highlights biological processes underlying GLP-1 stimulated insulin secretion: A DIRECT study.

    Directory of Open Access Journals (Sweden)

    Valborg Gudmundsdottir

    Full Text Available Glucagon-like peptide 1 (GLP-1 stimulated insulin secretion has a considerable heritable component as estimated from twin studies, yet few genetic variants influencing this phenotype have been identified. We performed the first genome-wide association study (GWAS of GLP-1 stimulated insulin secretion in non-diabetic individuals from the Netherlands Twin register (n = 126. This GWAS was enhanced using a tissue-specific protein-protein interaction network approach. We identified a beta-cell protein-protein interaction module that was significantly enriched for low gene scores based on the GWAS P-values and found support at the network level in an independent cohort from Tübingen, Germany (n = 100. Additionally, a polygenic risk score based on SNPs prioritized from the network was associated (P < 0.05 with glucose-stimulated insulin secretion phenotypes in up to 5,318 individuals in MAGIC cohorts. The network contains both known and novel genes in the context of insulin secretion and is enriched for members of the focal adhesion, extracellular-matrix receptor interaction, actin cytoskeleton regulation, Rap1 and PI3K-Akt signaling pathways. Adipose tissue is, like the beta-cell, one of the target tissues of GLP-1 and we thus hypothesized that similar networks might be functional in both tissues. In order to verify peripheral effects of GLP-1 stimulation, we compared the transcriptome profiling of ob/ob mice treated with liraglutide, a clinically used GLP-1 receptor agonist, versus baseline controls. Some of the upstream regulators of differentially expressed genes in the white adipose tissue of ob/ob mice were also detected in the human beta-cell network of genes associated with GLP-1 stimulated insulin secretion. The findings provide biological insight into the mechanisms through which the effects of GLP-1 may be modulated and highlight a potential role of the beta-cell expressed genes RYR2, GDI2, KIAA0232, COL4A1 and COL4A2 in GLP-1 stimulated

  11. Quinapril treatment increases insulin-stimulated endothelial function and adiponectin gene expression in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Hermann, Thomas S; Li, Weijie; Dominguez, Helena

    2005-01-01

    OBJECTIVE: Angiotensin-converting enzyme inhibitors reduce cardiovascular mortality and improve endothelial function in type 2 diabetic patients. We hypothesized that 2 months of quinapril treatment would improve insulin-stimulated endothelial function and glucose uptake in type 2 diabetic subjects...... and simultaneously increase the expression of genes that are pertinent for endothelial function and metabolism. METHODS: Twenty-four type 2 diabetic subjects were randomized to receive 2 months of quinapril 20 mg daily or no treatment in an open parallel study. Endothelium-dependent and -independent vasodilation...... occlusion plethysmography. Gene expression was measured by real-time PCR. RESULTS: Quinapril treatment increased insulin-stimulated endothelial function in the type 2 diabetic subjects (P = 0.005), whereas forearm glucose uptake was unchanged. Endothelial function was also increased by quinapril (P = 0...

  12. Transcription activator-like effector-mediated regulation of gene expression based on the inducible packaging and delivery via designed extracellular vesicles

    International Nuclear Information System (INIS)

    Lainšček, Duško; Lebar, Tina; Jerala, Roman

    2017-01-01

    Transcription activator-like effector (TALE) proteins present a powerful tool for genome editing and engineering, enabling introduction of site-specific mutations, gene knockouts or regulation of the transcription levels of selected genes. TALE nucleases or TALE-based transcription regulators are introduced into mammalian cells mainly via delivery of the coding genes. Here we report an extracellular vesicle-mediated delivery of TALE transcription regulators and their ability to upregulate the reporter gene in target cells. Designed transcriptional activator TALE-VP16 fused to the appropriate dimerization domain was enriched as a cargo protein within extracellular vesicles produced by mammalian HEK293 cells stimulated by Ca-ionophore and using blue light- or rapamycin-inducible dimerization systems. Blue light illumination or rapamycin increased the amount of the TALE-VP16 activator in extracellular vesicles and their addition to the target cells resulted in an increased expression of the reporter gene upon addition of extracellular vesicles to the target cells. This technology therefore represents an efficient delivery for the TALE-based transcriptional regulators. - Highlights: • Inducible dimerization enriched cargo proteins within extracellular vesicles (EV). • Farnesylation surpassed LAMP-1 fusion proteins for the EV packing. • Extracellular vesicles were able to deliver TALE regulators to mammalian cells. • TALE mediated transcriptional activation was achieved by designed EV.

  13. Aquaporin family genes exhibit developmentally-regulated and host-dependent transcription patterns in the sea louse Caligus rogercresseyi.

    Science.gov (United States)

    Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian

    2016-07-01

    Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Short interspersed nuclear elements (SINEs) are abundant in Solanaceae and have a family-specific impact on gene structure and genome organization.

    Science.gov (United States)

    Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas

    2016-05-01

    Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  15. Mutation analysis of the adenomatous polyposis coli (APC) gene in Danish patients with familial adenomatous polyposis (FAP)

    DEFF Research Database (Denmark)

    Bisgaard, Marie Luise; Ripa, Rasmus S; Bülow, Steffen

    2004-01-01

    Development of one hundred or more adenomas in the colon and rectum is diagnostic for the dominantly inherited, autosomal disease Familial Adenomatous Polyposis (FAP). It is possible to identify a mutation in the Adenomatous Polyposis Coli (APC) gene in approximately 80% of the patients, and almost...... 1,000 different pathogenic mutations have been identified in the APC gene up till now. We report 12 novel and 24' previously described germline APC mutations from 48 unrelated Danish families. Four families with the mutation localized in the 3' region of the gene showed great variance in phenotypic...

  16. Titin is a candidate gene for stroke volume response to endurance training: the HERITAGE Family Study.

    Science.gov (United States)

    Rankinen, Tuomo; Rice, Treva; Boudreau, Anik; Leon, Arthur S; Skinner, James S; Wilmore, Jack H; Rao, D C; Bouchard, Claude

    2003-09-29

    A genome-wide linkage scan for endurance training-induced changes in submaximal exercise stroke volume (DeltaSV50) in the HERITAGE Family Study revealed two chromosomal regions (2q31-q32 and 10p11.2) with at least suggestive evidence of linkage among white families. Here we report a further characterization of the quantitative trait locus (QTL) in chromosome 2q31 and provide evidence that titin (TTN) is likely a candidate gene involved. The original linkage was detected with two markers (D2S335 and D2S1391), and the QTL covered approximately 25 million base pairs (Mb). We added 12 microsatellite markers resulting in an average marker density of one marker per 2.3 Mb. The evidence of linkage increased from P = 0.006 to P = 0.0002 and 0.00002 in the multi- and single-point analyses, respectively. The strongest evidence of linkage was seen with two markers in and near the TTN gene. Transmission/disequilibrium test (TDT) with the same marker set provided evidence for association with one of the TTN markers (D2S385; P = 0.004). TTN is a major contributor to the elasticity of cardiomyocytes and a key regulator of the Frank-Starling mechanism. Since TTN is the largest gene in the human genome, the challenge is to identify the DNA sequence variants contributing to the interindividual differences in cardiac adaptation to endurance training.

  17. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  18. The Human Gene SLC25A29, of Solute Carrier Family 25, Encodes a Mitochondrial Transporter of Basic Amino Acids*

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-01-01

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation. PMID:24652292

  19. The human gene SLC25A29, of solute carrier family 25, encodes a mitochondrial transporter of basic amino acids.

    Science.gov (United States)

    Porcelli, Vito; Fiermonte, Giuseppe; Longo, Antonella; Palmieri, Ferdinando

    2014-05-09

    The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport carboxylates, amino acids, nucleotides, and cofactors across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. In this work, a member of this family, SLC25A29, previously reported to be a mitochondrial carnitine/acylcarnitine- or ornithine-like carrier, has been thoroughly characterized biochemically. The SLC25A29 gene was overexpressed in Escherichia coli, and the gene product was purified and reconstituted in phospholipid vesicles. Its transport properties and kinetic parameters demonstrate that SLC25A29 transports arginine, lysine, homoarginine, methylarginine and, to a much lesser extent, ornithine and histidine. Carnitine and acylcarnitines were not transported by SLC25A29. This carrier catalyzed substantial uniport besides a counter-exchange transport, exhibited a high transport affinity for arginine and lysine, and was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. The main physiological role of SLC25A29 is to import basic amino acids into mitochondria for mitochondrial protein synthesis and amino acid degradation.

  20. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  1. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  2. CLAVATA3-like genes are differentially expressed in grape vine (Vitis vinifera) tissues.

    Science.gov (United States)

    Tominaga-Wada, Rumi; Nukumizu, Yuka; Wada, Takuji; Sawa, Shinichiro; Tetsumura, Takuya

    2013-10-15

    The CLAVATA3 (CLV3)/endosperm surrounding region [(ESR) CLE] peptides function as intercellular signaling molecules that regulate various physiological and developmental processes in diverse plant species. We identified five CLV3-like genes from grape vine (Vitis vinifera var. Pinot Noir): VvCLE 6, VvCLE 25-1, VvCLE 25-2, VvCLE 43 and VvCLE TDIF. These CLV3-like genes encode short proteins containing 43-128 amino acids. Except VvCLE TDIF, grape vine CLV3-like proteins possess a consensus amino acid sequence known as the CLE domain. Phylogenic analysis suggests that the VvCLE 6, VvCLE25-1, VvCLE25-2 and VvCLE43 genes have evolved from a single common ancestor to the Arabidopsis CLV3 gene. Expression analyses showed that the five grape CLV3-like genes are expressed in leaves, stems, roots and axillary buds with significant differences in their levels of expression. For example, while all of them were strongly expressed in axillary buds, VvCLE6 and VvCLE43 expression prevailed in roots, and VvCLE25-1, VvCLE25-2 and VvCLE TDIF expression in stems. The differential expression of the five grape CLV3-like peptides suggests that they play different roles in different organs and developmental stages. Copyright © 2013 Elsevier GmbH. All rights reserved.

  3. Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon

    Directory of Open Access Journals (Sweden)

    Qing XU

    2018-01-01

    Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis

  4. The tubby family proteins

    OpenAIRE

    Mukhopadhyay, Saikat; Jackson, Peter K

    2011-01-01

    The tubby mouse shows a tripartite syndrome characterized by maturity-onset obesity, blindness and deafness. The causative gene Tub is the founding member of a family of related proteins present throughout the animal and plant kingdoms, each characterized by a signature carboxy-terminal tubby domain. This domain consists of a β barrel enclosing a central α helix and binds selectively to specific membrane phosphoinositides. The vertebrate family of tubby-like proteins (TULPs) includes the foun...

  5. Genome-wide identification and characterization of the SBP-box gene family in Petunia.

    Science.gov (United States)

    Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

    2018-03-12

    SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

  6. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  7. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  8. Genome-wide identification, characterisation and expression analysis of the MADS-box gene family in Prunus mume.

    Science.gov (United States)

    Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia

    2014-10-01

    MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.

  9. Expression of human Piwi-like genes is associated with prognosis for soft tissue sarcoma patients

    International Nuclear Information System (INIS)

    Greither, Thomas; Taubert, Helge; Koser, Franziska; Kappler, Matthias; Bache, Matthias; Lautenschläger, Christine; Göbel, Steffen; Holzhausen, Hans-Jürgen; Wach, Sven; Würl, Peter

    2012-01-01

    Argonaute genes are essential for RNA interference, stem cell maintenance and differentiation. The Piwi-like genes, a subclass of the Argonaute genes, are expressed mainly in the germline. These genes may be re-expressed in tumors, and expression of the Piwi-like genes is associated with prognosis in several types of tumors. We measured the expression of Piwi-like mRNAs (Piwi-like 2–4) in 125 soft tissue sarcoma (STS) samples by qPCRs. Statistical tests were applied to study the correlation of expression levels with tumor-specific survival for STS patients. In multivariate Cox’s regression analyses, we showed that low Piwi-like 2 and Piwi-like 4 mRNA expression were significantly associated with a worse prognosis (RR = 1.87; p = 0.032 and RR = 1.82; p = 0.039). Low expression of both genes was associated with a 2.58-fold increased risk of tumor-related death (p = 0.01). Piwi-like 4 and combined Piwi-like 2 and 4 mRNA levels correlated significantly with prognosis (RR = 3.53; p = 0.002 and RR = 5.23; p = 0.004) only for female but not for male patients. However, combined low Piwi-like 2 and 3 transcript levels were associated with worse survival (RR = 5.90; p = 0.02) for male patients. In this study, we identified a significant association between the expression of Piwi-like 2 and 4 mRNAs and the tumor-specific survival of soft tissue sarcoma patients. Furthermore, a connection between sex and the impact of Piwi-like mRNA expressions on STS patients’ prognosis was shown for the first time

  10. Colony stimulating factors and their clinical implication

    International Nuclear Information System (INIS)

    Asano, Shigetaka

    1989-01-01

    Granulocytes and macrophage are dependent for their production and/or functional activation in vitro on the presence of a family of glycoproteins. They are generally called colony-stimulating factors (CSFs) because of their capacity to stimulate colony formation in semi-solid cultures, and are currently classified into four distinct subtypes, that is, Multi-CSF, GM-CSF, G-CSF and M-CSF, according to the cell type of colonies formed under their stimulation or their target cell specificity. All of the murine and human CSF subtypes and the genes for them have become available in a purified form and in a large scale, and now allow us to investigate their interactions, the mechanisms for their actions, the cell-cell interactions leading to their production and secretion, and their actions in vivo. Furthermore, the preclinical and/or clinical studies which were carried out using the purified CSFs strongly indicate that human CSFs will be effective strategies for preventing and treating opportunistic bacterial and fungal infection as a major cause of death in granulocytopenic patients. (author)

  11. Adenovirus gene transfer to amelogenesis imperfecta ameloblast-like cells.

    Directory of Open Access Journals (Sweden)

    Anton V Borovjagin

    Full Text Available To explore gene therapy strategies for amelogenesis imperfecta (AI, a human ameloblast-like cell population was established from third molars of an AI-affected patient. These cells were characterized by expression of cytokeratin 14, major enamel proteins and alkaline phosphatase staining. Suboptimal transduction of the ameloblast-like cells by an adenovirus type 5 (Ad5 vector was consistent with lower levels of the coxsackie-and-adenovirus receptor (CAR on those cells relative to CAR-positive A549 cells. To overcome CAR -deficiency, we evaluated capsid-modified Ad5 vectors with various genetic capsid modifications including "pK7" and/or "RGD" motif-containing short peptides incorporated in the capsid protein fiber as well as fiber chimera with the Ad serotype 3 (Ad3 fiber "knob" domain. All fiber modifications provided an augmented transduction of AI-ameloblasts, revealed following vector dose normalization in A549 cells with a superior effect (up to 404-fold of pK7/RGD double modification. This robust infectivity enhancement occurred through vector binding to both α(vβ3/α(vβ5 integrins and heparan sulfate proteoglycans (HSPGs highly expressed by AI-ameloblasts as revealed by gene transfer blocking experiments. This work thus not only pioneers establishment of human AI ameloblast-like cell population as a model for in vitro studies but also reveals an optimal infectivity-enhancement strategy for a potential Ad5 vector-mediated gene therapy for AI.

  12. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  13. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  14. Dominant control region of the human β- like globin gene cluster

    NARCIS (Netherlands)

    Blom van Assendelft, Margaretha van

    1989-01-01

    The structure and regulation of the human β -like globin gene cluster has been studied extensively. Genetic disorders connected with this gene cluster are responsible for human diseases associated with high levels of morbidity and mortality, such as β-thalassaemia and sickle cell anaemia. The work

  15. Translational control is a major contributor to hypoxia induced gene expression

    International Nuclear Information System (INIS)

    Beucken, Twan van den; Magagnin, Michael G.; Jutten, Barry; Seigneuric, Renaud; Lambin, Philippe; Koritzinsky, Marianne; Wouters, Bradly G.

    2011-01-01

    Background and purpose: Hypoxia is a common feature of solid tumors that is associated with an aggressive phenotype, resistance to therapy and poor prognosis. Major contributors to these adverse effects are the transcriptional program activated by the HIF family of transcription factors as well as the translational response mediated by PERK-dependent phosphorylation of eIF2α and inhibition of mTORC1 activity. In this study we determined the relative contribution of both transcriptional and translational responses to changes in hypoxia induced gene expression. Material and methods: Total and efficiently translated (polysomal) mRNA was isolated from DU145 prostate carcinoma cells that were exposed for up to 24 h of hypoxia ( 2 ). Changes in transcription and translation were assessed using affymetrix microarray technology. Results: Our data reveal an unexpectedly large contribution of translation control on both induced and repressed gene expression at all hypoxic time points, particularly during acute hypoxia (2-4 h). Gene ontology analysis revealed that gene classes like transcription and signal transduction are stimulated by translational control whereas expression of genes involved in cell growth and protein metabolism are repressed during hypoxic conditions by translational control. Conclusions: Our data indicate that translation influences gene expression during hypoxia on a scale comparable to that of transcription.

  16. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  17. Transcriptome-wide survey of mouse CNS-derived cells reveals monoallelic expression within novel gene families.

    Directory of Open Access Journals (Sweden)

    Sierra M Li

    Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.

  18. [Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

    Science.gov (United States)

    Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-05-01

    The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

  19. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    International Nuclear Information System (INIS)

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun

    2006-01-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor γ (PPARγ). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPARγ antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPARγ. Specific PPARγ ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium

  20. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

    Science.gov (United States)

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-11-01

    Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  1. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

    Directory of Open Access Journals (Sweden)

    Xiaoyan Huang

    2017-01-01

    Full Text Available Purpose: Norrie disease (ND is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  2. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  3. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    Madhu Sudhan

    2007-03-29

    Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...

  4. Screening for large genomic rearrangements in the FANCA gene reveals extensive deletion in a Finnish breast cancer family.

    Science.gov (United States)

    Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri

    2011-03-28

    A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  5. The Malus domestica sugar transporter gene family: identifications based on genome and expression profiling related to the accumulation of fruit sugars.

    Science.gov (United States)

    Wei, Xiaoyu; Liu, Fengli; Chen, Cheng; Ma, Fengwang; Li, Mingjun

    2014-01-01

    In plants, sugar transporters are involved not only in long-distance transport, but also in sugar accumulations in sink cells. To identify members of sugar transporter gene families and to analyze their function in fruit sugar accumulation, we conducted a phylogenetic analysis of the Malus domestica genome. Expression profiling was performed with shoot tips, mature leaves, and developed fruit of "Gala" apple. Genes for sugar alcohol [including 17 sorbitol transporters (SOTs)], sucrose, and monosaccharide transporters, plus SWEET genes, were selected as candidates in 31, 9, 50, and 27 loci, respectively, of the genome. The monosaccharide transporter family appears to include five subfamilies (30 MdHTs, 8 MdEDR6s, 5 MdTMTs, 3 MdvGTs, and 4 MdpGLTs). Phylogenetic analysis of the protein sequences indicated that orthologs exist among Malus, Vitis, and Arabidopsis. Investigations of transcripts revealed that 68 candidate transporters are expressed in apple, albeit to different extents. Here, we discuss their possible roles based on the relationship between their levels of expression and sugar concentrations. The high accumulation of fructose in apple fruit is possibly linked to the coordination and cooperation between MdTMT1/2 and MdEDR6. By contrast, these fruits show low MdSWEET4.1 expression and a high flux of fructose produced from sorbitol. Our study provides an exhaustive survey of sugar transporter genes and demonstrates that sugar transporter gene families in M. domestica are comparable to those in other species. Expression profiling of these transporters will likely contribute to improving our understanding of their physiological functions in fruit formation and the development of sweetness properties.

  6. The Malus domestica sugar transporter gene family: identifications based on genome and expression profiling related to the accumulation of fruit sugars

    Directory of Open Access Journals (Sweden)

    Xiaoyu eWei

    2014-11-01

    Full Text Available In plants, sugar transporters are involved not only in long-distance transport, but also in sugar accumulations in sink cells. To identify members of sugar transporter gene families and to analyze their function in fruit sugar accumulation, we conducted a phylogenetic analysis of the Malus domestica genome. Expression profiling was performed with shoot tips, mature leaves, and developed fruit of ‘Gala’ apple. Genes for sugar alcohol (including 17 sorbitol transporters, sucrose, and monosaccharide transporters, plus SWEET genes, were selected as candidates in 31, 9, 50, and 27 loci, respectively, of the genome. The monosaccharide transporter family appears to include five subfamilies (30 MdHTs, 8 MdEDR6s, 5 MdTMTs, 3 MdvGTs, and 4 MdpGLTs. Phylogenetic analysis of the protein sequences indicated that orthologs exist among Malus, Vitis, and Arabidopsis. Investigations of transcripts revealed that 68 candidate transporters are expressed in apple, albeit to different extents. Here, we discuss their possible roles based on the relationship between their levels of expression and sugar concentrations. The high accumulation of fructose in apple fruit is possibly linked to the coordination and cooperation between MdTMT1/2 and MdEDR6. By contrast, these fruits show low MdSWEET4.1 expression and a high flux of fructose produced from sorbitol. Our study provides an exhaustive survey of sugar transporter genes and demonstrates that sugar transporter gene families in M. domestica are comparable to those in other species. Expression profiling of these transporters will likely contribute to improving our understanding of their physiological functions in fruit formation and the development of sweetness properties.

  7. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    International Nuclear Information System (INIS)

    Teodorov, E.; Ferrari, M.F.R.; Fior-Chadi, D.R.; Camarini, R.; Felício, L.F.

    2012-01-01

    The periaqueductal gray (PAG) has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc) or 0.9% saline (up to 1 mL/kg) and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05) because a lower percentage of U69593 group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR). A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05) and lactating female rats (P < 0.01), with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in female

  8. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Teodorov, E. [Centro de Matemática, Computação e Cognição, Universidade Federal do ABC, São Paulo, SP (Brazil); Ferrari, M.F.R. [Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Fior-Chadi, D.R. [Departamento de Fisiologia, Instituto de Biociências, Universidade de São Paulo, São Paulo, SP (Brazil); Camarini, R. [Departamento de Farmacologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, SP (Brazil); Felício, L.F. [Departamento de Patologia, Faculdade de Medicina Veterinária e Zootecnia, Universidade de São Paulo, São Paulo, SP (Brazil)

    2012-06-01

    The periaqueductal gray (PAG) has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc) or 0.9% saline (up to 1 mL/kg) and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05) because a lower percentage of U69593 group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR). A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05) and lactating female rats (P < 0.01), with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in female

  9. Behavioral meaningful opioidergic stimulation activates kappa receptor gene expression

    Directory of Open Access Journals (Sweden)

    E. Teodorov

    2012-10-01

    Full Text Available The periaqueductal gray (PAG has been reported to be a location for opioid regulation of pain and a potential site for behavioral selection in females. Opioid-mediated behavioral and physiological responses differ according to the activity of opioid receptor subtypes. The present study investigated the effects of the peripheral injection of the kappa-opioid receptor agonist U69593 into the dorsal subcutaneous region of animals on maternal behavior and on Oprk1 gene activity in the PAG of female rats. Female Wistar rats weighing 200-250 g at the beginning of the study were randomly divided into 2 groups for maternal behavior and gene expression experiments. On day 5, pups were removed at 7:00 am and placed in another home cage that was distant from their mother. Thirty minutes after removing the pups, the dams were treated with U69593 (0.15 mg/kg, sc or 0.9% saline (up to 1 mL/kg and after 30 min were evaluated in the maternal behavior test. Latencies in seconds for pup retrieval, grouping, crouching, and full maternal behavior were scored. The results showed that U69593 administration inhibited maternal behavior (P < 0.05 because a lower percentage of kappa group dams showed retrieval of first pup, retrieving all pups, grouping, crouching and displaying full maternal behavior compared to the saline group. Opioid gene expression was evaluated using real-time reverse-transcription polymerase chain reaction (RT-PCR. A single injection of U69593 increased Oprk1 PAG expression in both virgin (P < 0.05 and lactating female rats (P < 0.01, with no significant effect on Oprm1 or Oprd1 gene activity. Thus, the expression of kappa-opioid receptors in the PAG may be modulated by single opioid receptor stimulation and behavioral meaningful opioidergic transmission in the adult female might occur simultaneously to specific changes in gene expression of kappa-opioid receptor subtype. This is yet another alert for the complex role of the opioid system in

  10. Neurexin gene family variants as risk factors for autism spectrum disorder.

    Science.gov (United States)

    Wang, Jia; Gong, Jianhua; Li, Li; Chen, Yanlin; Liu, Lingfei; Gu, HuaiTing; Luo, Xiu; Hou, Fang; Zhang, Jiajia; Song, Ranran

    2018-01-01

    Increasing evidence suggests that abnormal synaptic function leads to neuronal developmental disorders and is an important component of the etiology of autism spectrum disorder (ASD). Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals. Thus, neurexins are attractive candidate genes for autism. Since gene families have greater power to reveal genetic association than single genes, we designed this case-control study to investigate six genetic variants in three neurexin genes (NRXN1, NRXN2, and NRXN3) in a Chinese population including 529 ASD patients and 1,923 healthy controls. We found that two SNPs were significantly associated with ASD after false discovery rate (FDR) adjustment for multiple comparisons. The NRXN2 rs12273892 polymorphism T allele and AT genotype were significantly associated with increased risk of ASD (respectively: OR = 1.328, 95% CI = 1.133-1.557, P Autism Res 2018, 11: 37-43. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Autism spectrum disorder (ASD) is a neurodevelopmental disorder that is highly heritable, and studies have found a number of candidate genes that might contribute to ASD. Neurexins are presynaptic cell-adhesion molecules that affect the function of synapses and mediate the conduction of nerve signals, and they play an important role in normal brain development and become candidate genes for autism. The purpose of our study is to explore the association between variants of the neurexins gene family and ASD in a Chinese population through a case-control study. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.

  11. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  12. High-frequency stimulation of the globus pallidus interna nucleus modulates GFRα1 gene expression in the basal ganglia.

    Science.gov (United States)

    Ho, Duncun Xun Kiat; Tan, Yong Chee; Tan, Jiayi; Too, Heng Phon; Ng, Wai Hoe

    2014-04-01

    Deep brain stimulation (DBS) is an established therapy for movement disorders such as Parkinson's disease (PD). Although the efficacy of DBS is clear, its precise molecular mechanism remains unknown. The glial cell line derived factor (GDNF) family of ligands has been shown to confer neuroprotective effects on dopaminergic neurons, and putaminal infusion of GDNF have been investigated in PD patients with promising results. Despite the potential therapeutic role of GDNF in alleviating motor symptoms, there is no data on the effects of electrical stimulation on GDNF-family receptor (GFR) expression in the basal ganglia structures. Here, we report the effects of electrical stimulation on GFRα1 isoforms, particularly GFRα1a and GFRα1b. Wistar rats underwent 2 hours of high frequency stimulation (HFS) at the globus pallidus interna nucleus. A control group was subjected to a similar procedure but without stimulation. The HFS group, sacrificed 24 hours after treatment, had a threefold decrease in mRNA expression level of GFRα1b (p=0.037), but the expression level reverted to normal 72 hours after stimulation. Our preliminary data reveal the acute effects of HFS on splice isoforms of GFRα1, and suggest that HFS may modulate the splice isoforms of GFRα1a and GFRα1b to varying degrees. Going forward, elucidating the interactions between HFS and GFR may shed new insights into the complexity of GDNF signaling in the nervous system and lead to better design of clinical trials using these signaling pathways to halt disease progression in PD and other neurodegenerative diseases. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  14. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  15. Perturbed desmosomal cadherin expression in grainy head-like 1-null mice.

    Science.gov (United States)

    Wilanowski, Tomasz; Caddy, Jacinta; Ting, Stephen B; Hislop, Nikki R; Cerruti, Loretta; Auden, Alana; Zhao, Lin-Lin; Asquith, Stephen; Ellis, Sarah; Sinclair, Rodney; Cunningham, John M; Jane, Stephen M

    2008-03-19

    In Drosophila, the grainy head (grh) gene plays a range of key developmental roles through the regulation of members of the cadherin gene family. We now report that mice lacking the grh homologue grainy head-like 1 (Grhl1) exhibit hair and skin phenotypes consistent with a reduction in expression of the genes encoding the desmosomal cadherin, desmoglein 1 (Dsg1). Grhl1-null mice show an initial delay in coat growth, and older mice exhibit hair loss as a result of poor anchoring of the hair shaft in the follicle. The mice also develop palmoplantar keratoderma, analogous to humans with DSG1 mutations. Sequence analysis, DNA binding, and chromatin immunoprecipitation experiments demonstrate that the human and mouse Dsg1 promoters are direct targets of GRHL1. Ultrastructural analysis reveals reduced numbers of abnormal desmosomes in the interfollicular epidermis. These findings establish GRHL1 as an important regulator of the Dsg1 genes in the context of hair anchorage and epidermal differentiation, and suggest that cadherin family genes are key targets of the grainy head-like genes across 700 million years of evolution.

  16. A survey of the pyrabactin resistance-like abscisic acid receptor gene family in poplar.

    Science.gov (United States)

    Yu, Jingling; Li, Hejuan; Peng, Yajing; Yang, Lei; Zhao, Fugeng; Luan, Sheng; Lan, Wenzhi

    2017-08-03

    The conserved PYR/PYL/RCAR family acts as abscisic acid (ABA) receptors for land plants to adapt to terrestrial environments. Our recent study reported that the exogenous overexpression of poplar PtPYRL1 and PtPYRL5, the PYR/PYL/RCAR orthologs, promoted the sensitivity of transgenic Arabidopsis to ABA responses. Here, we surveyed the PtPYRL family in poplar, and revealed that although the sequence and structure are relatively conserved among these receptors, PtPYRL members have differential expression patterns and the sensitivity to ABA or drought treatment, suggesting that PtPYRLs might be good candidates to a future biotechnological use to enhance poplar resistance to water-stress environments.

  17. The PIN1 family gene PvPIN1 is involved in auxin-dependent root emergence and tillering in switchgrass

    Directory of Open Access Journals (Sweden)

    Kaijie Xu

    2016-03-01

    Full Text Available Abstract Switchgrass (Panicum virgatum L.; family Poaceae is a warm-season C4 perennial grass. Tillering plays an important role in determining the morphology of aboveground parts and the final biomass yield of switchgrass. Auxin distribution in plants can affect a variety of important growth and developmental processes, including the regulation of shoot and root branching, plant resistance and biological yield. Auxin transport and gradients in plants are mediated by influx and efflux carriers. PvPIN1, a switchgrass PIN1-like gene that is involved in regulating polar transport, is a putative auxin efflux carrier. Neighbor-joining analysis using sequences deposited in NCBI databases showed that the PvPIN1gene belongs to the PIN1 family and is evolutionarily closer to the Oryza sativa japonica group. Tiller emergence and development was significantly promoted in plants subjected toPvPIN1 RNA interference (RNAi, which yielded a phenotype similar to that of wild-type plants treated with the auxin transport inhibitor TIBA (2,3,5-triiodobenzoic acid. A transgenic approach that inducedPvPIN1 gene overexpression or suppression altered tiller number and the shoot/root ratio. These data suggest that PvPIN1plays an important role in auxin-dependent adventitious root emergence and tillering.

  18. Blogging Family-like Relations when Visiting Theme and Amusement Parks: The Use of Children in Displays Online

    Directory of Open Access Journals (Sweden)

    Anne-Li Lindgren

    2014-10-01

    Full Text Available This paper combines sociological perspectives on family display, internet studies on family and private photography and a child studies perspective on the display of children. The paper proposes that blogging practices related to visits to theme and amusement parks in Sweden provide a new arena for people to display family-like relationships. In the different displays, adults mainly use pictures of children in the blogs to demonstrate their ability to perform family-like relationships. The paper suggests that this form of child-centred display, a visualized child-centredness, done during the park visit as well as in the blogging, is part of the construction of contemporary childhoods and what it means to be a child today and has not been theorized in earlier research on the display of family-like relations.

  19. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  20. Annotation, Phylogeny and Expression Analysis of the Nuclear Factor Y Gene Families in Common Bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Carolina eRípodas

    2015-01-01

    Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.