WorldWideScience

Sample records for stilbene

  1. Prototype Stilbene Neutron Collar

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, M. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Shumaker, D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Snyderman, N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Verbeke, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wong, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2016-10-26

    A neutron collar using stilbene organic scintillator cells for fast neutron counting is described for the assay of fresh low enriched uranium (LEU) fuel assemblies. The prototype stilbene collar has a form factor similar to standard He-3 based collars and uses an AmLi interrogation neutron source. This report describes the simulation of list mode neutron correlation data on various fuel assemblies including some with neutron absorbers (burnable Gd poisons). Calibration curves (doubles vs 235U linear mass density) are presented for both thermal and fast (with Cd lining) modes of operation. It is shown that the stilbene collar meets or exceeds the current capabilities of He-3 based neutron collars. A self-consistent assay methodology, uniquely suited to the stilbene collar, using triples is described which complements traditional assay based on doubles calibration curves.

  2. Two new stilbene trimers from Cynodon dactylon.

    Science.gov (United States)

    Li, Bi-Jun; Liu, Yao; Gu, Ai-Tong; Zhang, Qing; Chen, Lei; Wang, Shu-Mei; Wang, Feng

    2017-11-01

    Many naturally occurring oligostilbenes have drawn considerable attention because of their intricate structures and diverse bioactivities. Two new stilbene trimers, cystibenetrimerol A (1) and cystibenetrimerol B (2) were isolated from the dried grass of Cynodon dactylon (L.) Pers. The planar structures and stereo configurations of them were elucidated by spectroscopic and spectrometric methods. The isolation and structures elucidation of two new stilbene trimers suggested the ordinary grass belonging to the family Poaceae may be a rich source of stilbene oligomers.

  3. Digital Data Processing of Stilbene

    International Nuclear Information System (INIS)

    AMIRI, Moslem; MATEJ, Zdenek; MRAVEC, Filip; PRENOSIL, Vaclav; CVACHOVEC, Frantisek

    2013-06-01

    Stilbene is a proven spectrometric detector for mixed fields of neutrons and gamma rays. By digital processing of shape output pulses from the detector it is possible to obtain information about the energy of the interacting neutron / photon and distinguish which of these two particles interacts in the detector. Another numerical processing of digital data can finalize the energy spectrum of both components of the mixed field. The quality of the digitized data is highly dependent on the parameters of the hardware used for digitization and on the quality of software processing. Our results also show how the quality of the particle type identification depends on the sampling rate and as well as the method of processing of the sampled data. (authors)

  4. Isomerization Intermediates In Solution Phase Photochemistry Of Stilbenes

    Science.gov (United States)

    Doany, F. E.; Hochstrasser, R. M.; Greene, B. I.

    1985-04-01

    Picosecond and subpicosecond spectroscopic studies have revealed evidence for an isomerization intermediate between cis and trans in the photoinduced isomerism of both stilbene and biindanyledene ("stiff" stilbene). In stiff stilbene, a transient absorption at 351 nm displays time evolution and viscosity dependence consistent with absorption by a twisted intermediate ("phantom" state) with a lOps lifetime. An analagous bottleneck state with a life-time of 4ps is also consistent with the ground state recovery dynamics of t-stilbene following excitation of c-stilbene when monitored with 0.1ps resolution.

  5. Photoinduced gelation by stilbene oxalyl amide compounds.

    Science.gov (United States)

    Miljanić, Snezana; Frkanec, Leo; Meić, Zlatko; Zinić, Mladen

    2005-03-29

    Oxalyl amide derivatives bearing 4-dodecyloxy-stilbene as a cis-trans photoisomerizing unit were synthesized. The trans derivative acted as a versatile gelator of various organic solvents, whereas the corresponding cis derivative showed a poor gelation ability or none at all. In diluted solution (c = 2.0 x10(-5) mol dm(-3), ethanol), the cis isomer was photochemically converted into the trans isomer within 4 min. Depending on the radiation wavelength, the trans isomer was stable or liable to photodecomposition. When exposed to irradiation, a concentrated solution of the cis isomer (c = 2.0 x 10(-2) mol dm(-3), ethanol) turned into a gel. The FT-Raman, FT-IR, and 1H NMR spectra demonstrated that the gelation process occurred because of a rapid cis --> trans photoisomerization followed by a self-assembly of the trans molecules. Apart from the formation of hydrogen bonding between the oxalyl amide parts of the molecules, confirmed by FT-IR spectroscopy, it was assumed that the pi-pi stacking between the trans-stilbene units of the molecule and a lipophilic interaction between long alkyl chains were the interactions responsible for gelation.

  6. Water deficit increases stilbene metabolism in Cabernet Sauvignon berries.

    Science.gov (United States)

    Deluc, Laurent G; Decendit, Alain; Papastamoulis, Yorgos; Mérillon, Jean-Michel; Cushman, John C; Cramer, Grant R

    2011-01-12

    The impact of water deficit on stilbene biosynthesis in wine grape (Vitis vinifera) berries was investigated. Water deficit increased the accumulation of trans-piceid (the glycosylated form of resveratrol) by 5-fold in Cabernet Sauvignon berries but not in Chardonnay. Similarly, water deficit significantly increased the transcript abundance of genes involved in the biosynthesis of stilbene precursors in Cabernet Sauvignon. Increased expression of stilbene synthase, but not that of resveratrol-O-glycosyltransferase, resulted in increased trans-piceid concentrations. In contrast, the transcript abundance of the same genes declined in Chardonnay in response to water deficit. Twelve single nucleotide polymorphisms (SNPs) were identified in the promoters of stilbene synthase genes of Cabernet Sauvignon, Chardonnay, and Pinot Noir. These polymorphisms resulted in eight changes within the predicted cis regulatory elements in Cabernet Sauvignon and Chardonnay. These results suggest that cultivar-specific molecular mechanisms might exist that control resveratrol biosynthesis in grapes.

  7. Characteristics evaluation of stilbene single crystal grown by vertical bridgman technique

    International Nuclear Information System (INIS)

    Jo, Kwang Ho

    2012-02-01

    As the nature of organic scintillator, stilbene single crystal's decay time is only a couple of nano seconds, which makes it suitable for fast neutron detection. However, the entire amount of stilbene single crystal being used relies on import currently. As the necessity of fast neutron detection equipment such as KSTAR and Sodium-cooled Fast Reactor system increases, the goal is to have our own domestic technology through the growth of stilbene single crystal. The emission wavelength of grown stilbene single crystal is confirmed, and the property of grown stilbene single crystal is assessed compared to commercial stilbene (Ukraine ISMA research center) through gamma ray and neutron tests. In this research, we have grown stilbenes through Bridgman technique, and obtained three stilbenes out of two amples. (Two ones of Φ 30 mm x 15 mm, and Φ 40 mm x 17 mm from the first ample, and size of Φ 25 mm x 13 mm from the other) The grown stilbene's emission wavelength and inherent property of stilbene are confirmed. As the result of gamma ray test, we have confirmed linearity of grown stilbene's scintillator, and the relative light yield ratio is proven 101% efficiency to reference stilbene. Neutron detection efficiency of the three stilbenes amounts to 80% of reference stilbene, and FOM of them is 108% efficiency to reference stilbene's one. Although Ukraine ISMA research center still holds a dominant position with world-class efficiency and performance of its stilbene, we expect to produce a better stilbene with our domestic technology development. Through this, fast neutron detection technique can be obtained, which opens up an opportunity to be used not only in neutron monitoring system in nuclear fusion reactor, but also in alternative measurement technique as the unit price of He-3 increases recently

  8. Stilbene dimer radical cations in the radiolyses of stilbenes and 1,2,3,4-tetraphenylcyclobutanes

    International Nuclear Information System (INIS)

    Tojo, Sachiko; Morishima, Kazuhiro; Ishida, Akito; Majima, Tetsuro; Takamuku, Setsuo

    1995-01-01

    The reaction of the stilbene radical cation formed by pulse radiolysis or γ-radiolyses is explained based on neutralization as well as the formation of a π-type stilbene dimer radical cation (π-St 2 +· ), converting to the σ-type St 2 +· (σ-St 2 +· ). The r-1, c-2, t-3, t-4-tetraphenylcyclobutane radical cation generated in a rigid matrix at 77 K which converted to σ-St 2 +· upon warming. Both r-1, c-2, t-3, t-4- and r-1, t-2, c-3, t-4-tetraphenylcyclobutane radical cations underwent photochemical cycloreversion to π-St 2 +· upon irradiation at wavelengths longer than 390 nm at 77 K, and converted to σ-St 2 +· upon warming. It is suggested that π-St 2 +· has overlapping arrangements of π-electrons, while σ-St 2 +· has radical and cation centers on the 1- and 4-positions of the C 4 linkage. (author)

  9. Photoisomerization of Stilbene: The Detailed XMCQDPT2 Treatment.

    Science.gov (United States)

    Ioffe, I N; Granovsky, A A

    2013-11-12

    We report the detailed XMCQDPT2/cc-pVTZ study of trans-cis photoisomerization in one of the core systems of both experimental and computational photochemistry-the stilbene molecule. For the first time, the potential energy surface (PES) of the S1 state has been directly optimized and scanned using a multistate multiconfiguration second-order perturbation theory. We characterize the trans-stilbene, pyramidalized (phantom), and DHP-cis-stilbene geometric domains of the S1 state and describe their stationary points including the transition states between them, as well as S1/S0 intersections. Also reported are the minima and the activation barriers in the ground state. Our calculations correctly predict the kinetic isotope effect due to H/D exchange at ethylenic hydrogens, the dynamic behavior of excited cis-stilbene, and trans-cis branching ratio after relaxation to S0 through a rather unsymmetric conical intersection. In general, the XMCQDPT2 results confirm the qualitative adequacy of the TDDFT (especially SF-TDDFT) picture of the excited stilbene but also reveal quantitative discrepancies that deserve further exploration.

  10. Stilbene crystalline powder in polymer base as a new fast neutron detector

    International Nuclear Information System (INIS)

    Budakovsky, S.V.; Galunov, N.Z.; Grinyov, B.V.; Karavaeva, N.L.; Kyung Kim, Jong; Kim, Yong-Kyun; Pogorelova, N.V.; Tarasenko, O.A.

    2007-01-01

    A new organic scintillation material consisting of stilbene grains in a polymer glue base is presented. The crystalline grains of stilbene are obtained by mechanical grinding of stilbene single crystals. The resulting composite scintillators have been studied as detectors for fast neutrons

  11. Effect of stilbene resveratrol on haematological indices of rats

    Czech Academy of Sciences Publication Activity Database

    Doubek, J.; Volný, T.; Lojek, Antonín; Knotková, Z.; Kotrbáček, V.; Scheer, P.; Holešovská, Z.

    2005-01-01

    Roč. 74, č. 2 (2005), s. 205-208 ISSN 0001-7213 Institutional research plan: CEZ:AV0Z50040507 Keywords : antioxidative capacity * stilbene-resveratrol Subject RIV: BO - Biophysics Impact factor: 0.353, year: 2005

  12. Ultrasound-Assisted Extraction of Stilbenes from Grape Canes

    Directory of Open Access Journals (Sweden)

    Zulema Piñeiro

    2016-06-01

    Full Text Available An analytical ultrasound-assisted extraction (UAE method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying and several extraction variables (solvent, sample-solvent ratio and extraction time between others on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5 for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.

  13. Ultrasound-Assisted Extraction of Stilbenes from Grape Canes.

    Science.gov (United States)

    Piñeiro, Zulema; Marrufo-Curtido, Almudena; Serrano, Maria Jose; Palma, Miguel

    2016-06-16

    An analytical ultrasound-assisted extraction (UAE) method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying) and several extraction variables (solvent, sample-solvent ratio and extraction time between others) on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5) for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.

  14. Screening Analyses of Pinosylvin Stilbenes, Resin Acids and Lignans in Norwegian Conifers

    OpenAIRE

    Anne Fiksdahl; Karin Oyaas; Ingebjorg Leirset; Hanne Hovelstad

    2006-01-01

    The content and distribution of stilbenes and resin acids in Scots pine (Pinus sylvestris) and spruce (Picea abies), sampled in central Norway, have been examined. The contents of pinosylvin stilbenes in pine heartwood/living knots were 0.2-2/2-8 % (w/w). No stilbenes could be detected in spruce (Picea abies). The resin acid contents of pine sapwood/heartwood and knots were 1-4 and 5-10 % (w/w), respectively. Minor amounts of resin acids (

  15. 76 FR 30967 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    Science.gov (United States)

    2011-05-27

    ... Stilbenic Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1... is a reasonable indication that an industry in the United States is materially injured by reason of imports from China and Taiwan of certain stilbenic optical brightening agents, provided for in subheadings...

  16. The Use of Stilbene Scaffold in Medicinal Chemistry and Multi- Target Drug Design.

    Science.gov (United States)

    Giacomini, Elisa; Rupiani, Sebastiano; Guidotti, Laura; Recanatini, Maurizio; Roberti, Marinella

    2016-01-01

    The stilbene scaffold is a basic element for a number of biologically active natural and synthetic compounds, and it is considered as a privileged structure. Stilbenes exemplified by resveratrol, combretastatin A-4 and pterostilbene are of significant interest for drug research and development because of their potential in therapeutic and preventive application. Resveratrol, present in grapes and other food products, plays a role in the prevention of several human pathological processes and has been suggested as an anticancer agent. Moreover, recent evidence has revealed its potential effect on the aging process, diabetes and neurological dysfunction. Combretastatin A-4, from the bark of South African bush willow Combretum caffrum, also shows significant antitumor activity. Pterostilbene is closely related to resveratrol, sharing the same unique therapeutic potential as anti-inflammatory, antineoplastic and antioxidant agent. Therefore, research and development of stilbene-based medicinal chemistry have become rapidly evolving and increasingly active topics covering almost the whole range of therapeutic fields. In the present review, we provide an overview of the role of stilbenes in medicinal chemistry. In this context, we highlight the chemical methodologies adopted for the synthesis of stilbene derivatives, and outline the successful design of novel stilbene based hybrids in the field of cancer, Alzheimer's and other relevant diseases. This information may be useful in further design of stilbene-based molecules as new leads for the development of novel agents with clinical potential or as effective chemical probes to dissect biological processes.

  17. Superior optical nonlinearity of an exceptional fluorescent stilbene dye

    Energy Technology Data Exchange (ETDEWEB)

    He, Tingchao [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Division of Physics and Applied Physics, Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Sreejith, Sivaramapanicker; Zhao, Yanli [Division of Chemistry and Biological Chemistry, School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Gao, Yang; Grimsdale, Andrew C. [School of Materials Science and Engineering, Nanyang Technological University, Singapore, Singapore 639798 (Singapore); Lin, Xiaodong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Sun, Handong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [Division of Physics and Applied Physics, Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore)

    2015-03-16

    Strong multiphoton absorption and harmonic generation in organic fluorescent chromophores are, respectively, significant in many fields of research. However, most of fluorescent chromophores fall short of the full potential due to the absence of the combination of such different nonlinear upconversion behaviors. Here, we demonstrate that an exceptional fluorescent stilbene dye could exhibit efficient two- and three-photon absorption under the excitation of femtosecond pulses in solution phase. Benefiting from its biocompatibility and strong excited state absorption behavior, in vitro two-photon bioimaging and superior optical limiting have been exploited, respectively. Simultaneously, the chromophore could generate efficient three-photon excited fluorescence and third-harmonic generation (THG) when dispersed into PMMA film, circumventing the limitations of classical fluorescent chromophores. Such chromophore may find application in the production of coherent light sources of higher photon energy. Moreover, the combination of three-photon excited fluorescence and THG can be used in tandem to provide complementary information in biomedical studies.

  18. Synthesis of amide isosteres of schweinfurthin-based stilbenes.

    Science.gov (United States)

    Stockdale, David P; Beutler, John A; Wiemer, David F

    2017-10-15

    The schweinfurthins are plant-derived stilbenes with an intriguing profile of anti-cancer activity. To obtain analogues of the schweinfurthins that might preserve the biological activity but have greater water solubility, a formal replacement of the central olefin with an amide has been explored. Two pairs of amides have been prepared, each containing the same hexahydroxanthene "left half" joined through an amide linkage to two different "right halves." In each series, the amide has been inserted in both possible orientations, placing the carbonyl group on the tricyclic ABC ring system and the amine on the D-ring, or placing the amine on the hexahydroxanthene and the carbonyl group on the D-ring. The four new schweinfurthin analogues have been tested in the NCI 60 cell line screen, and in both cases the more active isomer carried the carbonyl group on the C-ring. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Continuous flow photocyclization of stilbenes – scalable synthesis of functionalized phenanthrenes and helicenes

    Directory of Open Access Journals (Sweden)

    Quentin Lefebvre

    2013-09-01

    Full Text Available A continuous flow oxidative photocyclization of stilbene derivatives has been developed which allows the scalable synthesis of backbone functionalized phenanthrenes and helicenes of various sizes in good yields.

  20. HPLC Quantitative Analysis of Main Stilbenes and Flavones in Different Parts of Matteuccia struthiopteris

    Czech Academy of Sciences Publication Activity Database

    Li, S.; Zhang, D.; Yang, L.; Li, Y.; Zhu, X.; Kmoníčková, Eva; Zídek, Zdeněk

    -, č. 452610 (2013), s. 1-6 ISSN 2090-9063 R&D Projects: GA MŠk(CZ) ME10116 Institutional support: RVO:68378041 Keywords : flavones * alternative medicine * stilbenes Subject RIV: FR - Pharmacology ; Medidal Chemistry

  1. Effect of stilbene and chalcone scaffolds incorporation in clofibric acid on PPARα agonistic activity.

    Science.gov (United States)

    Giampietro, Letizia; D'Angelo, Alessandra; Giancristofaro, Antonella; Ammazzalorso, Alessandra; De Filippis, Barbara; Di Matteo, Mauro; Fantacuzzi, Marialuigia; Linciano, Pasquale; Maccallini, Cristina; Amoroso, Rosa

    2014-01-01

    In an effort to develop safe and efficacious compounds for the treatment of metabolic disorders, new compounds based on a combination of clofibric acid, the active metabolite of clofibrate, and trans-stilbene, chalcone, and other lipophilic groups were synthesized. They were evaluated for PPARα transactivation activity; all branched derivatives showed an increase of the transcriptional activity of receptor compared to the linear ones. Noteworthy, stilbene and benzophenone branched derivatives activated the PPARα better than clofibric acid.

  2. Preharvest methyl jasmonate and postharvest UVC treatments: increasing stilbenes in wine.

    Science.gov (United States)

    Fernández-Marín, María Isabel; Puertas, Belén; Guerrero, Raúl F; García-Parrilla, María Carmen; Cantos-Villar, Emma

    2014-03-01

    Stilbene-enriched wine is considered to be an interesting new food product with added value due to its potential health-promoting properties. Stilbene concentration in grape is highly variable and rather scarce. However, it can be increased by stress treatments. For this reason, numerous pre- and postharvest grape treatments, and some combinations of them, have been tested to maximize stilbene content in grapes. In the present manuscript, Syrah grapes were treated with (i) methyl jasmonate (MEJA), (ii) ultraviolet light (UVC), and (iii) methyl jasmonate and ultraviolet light (MEJA-UVC) and compared with untreated grapes. Afterward, winemaking was developed. Wine achieved by combination of both treatments (MEJA-UVC) contained significantly higher stilbene concentration (trans-resveratrol and piceatannol) than its respective control (2.5-fold). Wine quality was improved in color-related parameters (color intensity, L*, a*, b*, ΔE*, anthocyanins, and tannin). Moreover, MEJA-UVC wines obtained the highest score in sensorial analysis. To the best of our knowledge, this is the first time that pre- and postharvest treatments are combined to increase stilbenes in wine. The effect of treatment combination (methyl jasmonate and UVC light) on grape and wine was evaluated. Our results highlight the positive effect of the treatments in stilbene content, color parameters, and sensorial analysis. Moreover, added-value by-products were achieved. © 2014 Institute of Food Technologists®

  3. Synthesis, Biological Evaluation, and Molecular Modeling Studies of New Oxadiazole-Stilbene Hybrids against Phytopathogenic Fungi

    Science.gov (United States)

    Jian, Weilin; He, Daohang; Song, Shaoyun

    2016-08-01

    Natural stilbenes (especially resveratrol) play important roles in plant protection by acting as both constitutive and inducible defenses. However, their exogenous applications on crops as fungicidal agents are challenged by their oxidative degradation and limited availability. In this study, a new class of resveratrol-inspired oxadiazole-stilbene hybrids was synthesized via Wittig-Horner reaction. Bioassay results indicated that some of the compounds exhibited potent fungicidal activity against Botrytis cinerea in vitro. Among these stilbene hybrids, compounds 11 showed promising inhibitory activity with the EC50 value of 144.6 μg/mL, which was superior to that of resveratrol (315.6 μg/mL). Remarkably, the considerably abnormal mycelial morphology was observed in the presence of compound 11. The inhibitory profile was further proposed by homology modeling and molecular docking studies, which showed the possible interaction of resveratrol and oxadiazole-stilbene hybrids with the cytochrome P450-dependent sterol 14α-demethylase from B. cinerea (BcCYP51) for the first time. Taken together, these results would provide new insights into the fungicidal mechanism of stilbenes, as well as an important clue for biology-oriented synthesis of stilbene hybrids with improved bioactivity against plant pathogenic fungi in crop protection.

  4. Pulse radiolysis of solutions of trans-stilbene

    International Nuclear Information System (INIS)

    Langan, J.R.; Salmon, G.A.

    1982-01-01

    On pulse radiolysis of solutions of trans-stilbene (t-St) in THF the radical-anion of t-St is formed by reaction of e - sub(s) with t-St. The transient absorption spectrum observed with lambdasub(max) at 500 and 720 nm is attributed to the unassociated St - . The subsequent decay of the radical-anion is accounted for by reaction with the counter-cation of THF formed on radiolysis and with radiolytically generated radicals; rate constants for these processes are estimated. Addition of sodium tetrahydridoaluminate (NAH) results in the radical-anion being associated with Na + as a contact ion-pair and a shift of lambdasub(max) to 490 nm. In the presence of the lithium salt the absorption spectrum of the radical-anion reverts to 500 nm. On pulse radiolysis of solutions containing NAH the main reaction forming St - is that of (Na + , e - sub(s))ion pairs with t-St. In addition there is a delayed formation of St - over a period of microseconds. The presence of tetrahydridoaluminate salts also greatly enhances the stability of St - and at high doses per pulse little decay was observed over 700 μs. The variation of G(St - ) with [NAH] was studied and was found to attain a plateau value of 2.0 at the higher concentrations. (author)

  5. Photoluminescence in Carborane-Stilbene Triads: A Structural, Spectroscopic, and Computational Study.

    Science.gov (United States)

    Cabrera-González, Justo; Viñas, Clara; Haukka, Matti; Bhattacharyya, Santanu; Gierschner, Johannes; Núñez, Rosario

    2016-09-12

    A set of triads in which o- and m-carborane clusters are bonded to two stilbene units through Ccluster -CH2 bonds was synthesized, and their structures were confirmed by X-ray diffraction. A study on the influence of the o- and m- isomers on the absorption and photoluminescence properties of the stilbene units in solution revealed no charge-transfer contributions in the lowest excited state, as confirmed by (TD)DFT calculations. The presence of one or two B-I groups in m-carborane derivatives does not affect the emission properties of the stilbenes in solution, probably due to the rather large distance between the iodo substituents and the fluorophore. Nevertheless, a significant redshift of the photoluminescence (PL) emission maximum in the solid state (thin films and powder samples) compared to solution was observed; this can be traced back to PL sensitization, most probably due to more densely packed stilbene moieties. Remarkably, the PL absolute quantum yields of powder samples are significantly higher than those in solution, and this was attributed to the restricted environment and the aforementioned sensitization. Thus, the bonding of the carborane clusters to two stilbene units preserves their PL behavior in solution, but produces significant changes in the solid state. Furthermore, iodinated species can be considered to be promising precursors for theranostic agents in which both imaging and therapeutic functions could possibly be combined. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Conformationally constrained farnesoid X receptor (FXR) agonists: alternative replacements of the stilbene.

    Science.gov (United States)

    Akwabi-Ameyaw, Adwoa; Caravella, Justin A; Chen, Lihong; Creech, Katrina L; Deaton, David N; Madauss, Kevin P; Marr, Harry B; Miller, Aaron B; Navas, Frank; Parks, Derek J; Spearing, Paul K; Todd, Dan; Williams, Shawn P; Wisely, G Bruce

    2011-10-15

    To further explore the optimum placement of the acid moiety in conformationally constrained analogs of GW 4064 1a, a series of stilbene replacements were prepared. The benzothiophene 1f and the indole 1g display the optimal orientation of the carboxylate for enhanced FXR agonist potency. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L

    Czech Academy of Sciences Publication Activity Database

    Soural, I.; Vrchotová, Naděžda; Tříska, Jan; Balík, J.; Horník, Štěpán; Cuřínová, Petra; Sýkora, Jan

    2015-01-01

    Roč. 20, č. 4 (2015), s. 6093-6112 ISSN 1420-3049 R&D Projects: GA MŠk(CZ) LD14038 Institutional support: RVO:67179843 ; RVO:67985858 Keywords : Vitis vinifera L * grape cane * stilbenes * accelerated solvent extraction ( ASE ) * microwave-assisted extraction (MAE) * LC-MS Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.465, year: 2015

  8. Effect of Dietary Stilbenes on 5-Lipoxygenase and Cyclooxygenases Activities In Vitro

    Czech Academy of Sciences Publication Activity Database

    Kutil, Zsófia; Kvasnicová, Marie; Temml, V.; Schuster, D.; Maršík, Petr; Cusimamani, E.F.; Lou, J.D.; Vaněk, Tomáš; Landa, Přemysl

    2015-01-01

    Roč. 18, č. 7 (2015), s. 1471-1477 ISSN 1094-2912 R&D Projects: GA MŠk LH12164 Institutional support: RVO:61389030 Keywords : Dietary stilbenes * Cyclooxygenase inhibition * Docking Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.586, year: 2015

  9. Aerobic methylcyclohexane-promoted epoxidation of stilbene over gold nanoparticles supported on Gd-doped titania

    KAUST Repository

    Mendez, Violaine; Guillois, Kevin; Daniè le, Sté phane; Tuel, Alain; Caps, Valerie

    2010-01-01

    Aerobic partial oxidations of alkanes and alkenes are important processes of the petrochemical industry. The radical mechanisms involved can be catalyzed by soluble salts of transition metals (Co, Cu, Mn...). We show here that the model methylcyclohexane/stilbene co-oxidation reaction can be efficiently catalyzed at lower temperature by supported gold nanoparticles. The support has little influence on gold intrinsic activity but more on the apparent reaction rates which are a combination of catalytic activity and diffusion limitations. These are here minimized by using gadolinium-doped titania nanocrystallites as support for gold nanoparticles. This material is obtained by mild hydrolysis of a new Gd4TiO(OiPr)14 bimetallic oxoalkoxide. It leads to enhanced wettability of the < 3 nm gold particles in the tert-butyl hydroperoxide (TBHP)-initiated epoxidation of stilbene in methylcyclohexane; Au/TiO2:Gd3+ is in turn as active as the state-of-the-art hydrophobic Au/SiO2 catalyst. The rate-determining step of this reaction is identified as the gold-catalyzed homolytic decomposition of TBHP generating radicals and initiating the methylcyclohexane-mediated epoxidation of stilbene, yielding a methylcyclohexan-1-ol/trans-stilbene oxide mixture. Methylcyclohexan-1-ol can also be obtained in the absence of the alkene in the gold-catalyzed solvent-free autoxidation of methylcyclohexane, evidencing the catalytic potential of gold nanoparticles for low temperature C-H activation. © 2010 The Royal Society of Chemistry.

  10. Piceatannol and Other Wine Stilbenes: A Pool of Inhibitors against α-Synuclein Aggregation and Cytotoxicity

    Directory of Open Access Journals (Sweden)

    Hamza Temsamani

    2016-06-01

    Full Text Available The aggregation of α-synuclein is one on the key pathogenic events in Parkinson’s disease. In the present study, we investigated the inhibitory capacities of stilbenes against α-synuclein aggregation and toxicity. Thioflavin T fluorescence, transmission electronic microscopy, and SDS-PAGE analysis were performed to investigate the inhibitory effects of three stilbenes against α-synuclein aggregation: piceatannol, ampelopsin A, and isohopeaphenol. Lipid vesicle permeabilization assays were performed to screen stilbenes for protection against membrane damage induced by aggregated α-synuclein. The viability of PC12 cells was examined using an MTT assay to assess the preventive effects of stilbenes against α-synuclein-induced toxicity. Piceatannol inhibited the formation of α synuclein fibrils and was able to destabilize preformed filaments. It seems to induce the formation of small soluble complexes protecting membranes against α-synuclein-induced damage. Finally, piceatannol protected cells against α-synuclein-induced toxicity. The oligomers tested (ampelopsin A and hopeaphenol were less active.

  11. Pulsed electric field treatment enhanced stilbene content in Graciano, Tempranillo and Grenache grape varieties.

    Science.gov (United States)

    López-Alfaro, Isabel; González-Arenzana, Lucía; López, Noelia; Santamaría, Pilar; López, Rosa; Garde-Cerdán, Teresa

    2013-12-15

    The purpose of this paper was to study the effect of pulsed electric fields (PEF) on the stilbene content of three grape varieties. For this purpose, four different PEF treatments were applied using a continuous system over three varieties, Graciano, Tempranillo and Grenache, destemmed and crushed. In addition, the influence of PEF on their physicochemical composition was studied. PEF treatments did not affect the pH or total acidity of Graciano, however, musts from Tempranillo and Grenache had higher pH values and lower total acidity. In the three varieties, all treatments resulted in an increase of potassium content, deeper colour intensity and total polyphenol index and lower tonality, more pronounced in the treatments with higher time and energy. The stilbene content of the must significantly increased with respect to the control. This increase depended on the variety and the treatment applied. Tempranillo increased up 200% the total stilbene concentration, Grenache 60% and Graciano 50%. For the three varieties, the treatment with the highest time and energy was the most effective on the total stilbene extraction. These results indicate that PEF could be a suitable technology for obtaining musts with deeper colour and higher phenolic content, including resveratrol and piceid. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. 76 FR 19383 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    Science.gov (United States)

    2011-04-07

    ... Stilbenic Optical Brightening Agents From China and Taiwan AGENCY: United States International Trade... reasonable indication that an industry in the United States is materially injured or threatened with material injury, or the establishment of an industry in the United States is materially retarded, by reason of...

  13. 77 FR 27079 - Certain Stilbenic Optical Brightening Agents From China and Taiwan

    Science.gov (United States)

    2012-05-08

    ... industry in the United States is materially injured by reason of imports from China and Taiwan of certain... Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1\\ developed... that imports of certain stilbenic optical brightening agents from China and Taiwan were being sold at...

  14. Characterisation of stilbenes in California almonds (Prunus dulcis) by UHPLC-MS.

    Science.gov (United States)

    Xie, Liyang; Bolling, Bradley W

    2014-04-01

    Stilbene polyphenols are present in some fruits and nuts, but their abundance in many foods, such as almonds, is unknown. Therefore, we characterised stilbenes from Nonpareil, Butte and Carmel almond (Prunus dulcis) varieties from California. UHPLC-MS conditions were optimised to resolve cis- and trans-resveratrol, d4-resveratrol, dienestrol, hexestrol, oxyresveratrol, piceatannol, pterostilbene, and resveratrol-3-β-glucoside (polydatin). Stilbenes were isolated from ethanolic almond extracts by solid-phase extraction and identified with UHPLC-MS by comparison of retention times, mass spectra, in-source CID spectra, and enzymatic hydrolysis to authentic standards. Polydatin was identified in almond extracts, with 7.19-8.52 μg/100 g almond. Piceatannol+oxyresveratrol was tentatively identified in almond blanch water, at 0.19-2.55 μg/100 g almond. Polydatin was concentrated in almond skins, which contained 95.6-97.5% of the total almond content. Therefore, almonds contain the stilbene class of polyphenols in addition to the previously identified proanthocyanidin, hydrolysable tannin, flavonoid, and phenolic acid classes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Varietal Distributions of Stilbenes in Grape Cane of Vitis vinifera L.

    Czech Academy of Sciences Publication Activity Database

    Soural, I.; Balík, J.; Vrchotová, Naděžda; Tříska, Jan

    2017-01-01

    Roč. 20, č. 1 (2017), s. 11-14 ISSN 1335-2563 R&D Projects: GA MŠk(CZ) LO1415; GA MŠk(CZ) LD14038 Institutional support: RVO:86652079 Keywords : Vitis vinifera L. * varieties * grape canes * stilbenes * distribution Subject RIV: EH - Ecology, Behaviour OBOR OECD: Environmental sciences (social aspects to be 5.7)

  16. Somatic mutations in stilbene estrogen-induced Syrian hamster kidney tumors identified by DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    Roy Deodutta

    2004-01-01

    Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental

  17. Merocyanines: polyene-polymethine transition in donor-acceptor-substituted stilbenes and polyenes

    International Nuclear Information System (INIS)

    Rettig, Wolfgang; Dekhtyar, Marina

    2003-01-01

    Three series of donor-acceptor-substituted conjugated compounds, namely, stilbenes, the open-chain polyenes of equivalent length, and the species of intermediate structure (polyenes terminated with only one phenyl ring) have been studied by the AM1 and HMO methods to elucidate and compare the structural prerequisites of the ideal polymethinic state ('cyanine limit'). The transition from polyenic to polymethinic properties has been traced in terms of bond-length (bond-order) alternation using the variation of terminal donor and acceptor substituents. Stilbenes manifest themselves as notably 'retarded' polyenes since a larger electronic asymmetry is necessary for them to reach the same degree of polymethinic character. The ground and the excited state have been shown to differ much more strongly for stilbenes than for polyenes with respect to the position of the bond equalization point on the scale of donor-acceptor difference. For the compounds containing one phenyl ring, the features revealed are intermediate between stilbenes and polyenes. The large S 0 -S 1 discrepancy in terms of bond alternation is a general property of aromatic ring-terminated chains (stilbenes) and is related to the influence of the aromatic character which can be quantified in this way. In this context, the most relevant definition for the cyanine limit (based on the bond invariance upon excitation) was selected from the existing definitions. The major trends revealed in the polyenic/polymethinic behaviour of the molecules can be interpreted on a topological basis within HMO or even simpler models with some additional influence due to the interelectronic repulsion which is taken into account in the AM1 treatment

  18. Comparative study of neutron and gamma-ray pulse shape discrimination of anthracene, stilbene, and p-terphenyl

    International Nuclear Information System (INIS)

    Yanagida, Takayuki; Watanabe, Kenichi; Fujimoto, Yutaka

    2015-01-01

    Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under 137 Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators

  19. Comparative study of neutron and gamma-ray pulse shape discrimination of anthracene, stilbene, and p-terphenyl

    Energy Technology Data Exchange (ETDEWEB)

    Yanagida, Takayuki, E-mail: yanagida@lsse.kyutech.ac.jp [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan); Watanabe, Kenichi [Nagoya University, Furocho, Chikusa, Nagoya 464-8603 (Japan); Fujimoto, Yutaka [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan)

    2015-06-01

    Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under {sup 137}Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators.

  20. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents - BIOSTIMUL

    Energy Technology Data Exchange (ETDEWEB)

    Wright, A. von (Univ. of Eastern Finland, Kuopio (Finland). Dept. of Biosciences.), Email: atte.vonWright@uef.fi

    2010-10-15

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)

  1. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents - BIOSTIMUL

    Energy Technology Data Exchange (ETDEWEB)

    Wright, A. von (Univ. of Kuopio, Dept. of Biosciences (Finland)), email: atte.vonWright@uku.fi

    2009-10-15

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type 2 diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type 2 diabetes) highlighting results. (orig.)

  2. Bioactive and wood-associated stilbenes as multifunctional antimicrobial and health promoting agents (BIOSTIMUL)

    Energy Technology Data Exchange (ETDEWEB)

    Wright, A. von (Kuopio Univ., Department of Biosciences (Finland))

    2008-07-01

    Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and as derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)

  3. Factors influencing the production of stilbenes by the knotweed, Reynoutria × bohemica

    Czech Academy of Sciences Publication Activity Database

    Kovářová, Marcela; Bartůňková, Kristýna; Frantík, Tomáš; Koblihová, Helena; Prchalová, K.; Vosátka, Miroslav

    2010-01-01

    Roč. 10, č. 19 (2010), s. 1-16 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : japanese knotweed * Reynoutria * stilbenes Subject RIV: EF - Botanics Impact factor: 4.085, year: 2010 http://www.biomedcentral.com/1471-2229/10/19

  4. Target molecular weights for red cell band 3 stilbene and mercurial binding sites

    International Nuclear Information System (INIS)

    Verkman, A.S.; Skorecki, K.L.; Jung, C.Y.; Ausiello, D.A.

    1986-01-01

    Radiation inactivation was used to measure the target sizes for binding of disulfonic stilbene anion transport inhibitor 4,4'-dibenzamido-2,2'-disulfonic stilbene (DBDS) and mercurial water transport inhibitor p-chloromercuribenzene sulfonate (pCMBS) to human erythrocytes. The measured target size for erythrocyte ghost acetylcholinesterase was 78 +/- 3 kDa. DBDS binding to ghost membranes was measured by a fluorescence enhancement technique. Radiation (0-26 Mrad) had no effect on total membrane protein and DBDS binding affinity, whereas DBDS binding stoichiometry decreased exponentially with radiation dose, giving a target size of 59 +/- 4 kDa. H2-4,4'-diisothiocyano-2,2'-disulfonic stilbene (H2-DIDS, 5 microM) blocked greater than 95% of DBDS binding at all radiation doses. pCMBS binding was measured from the time course of tryptophan fluorescence quenching in ghosts treated with the sulfhydryl reagent N-ethylmaleimide (NEM). Radiation did not affect the kinetics of tryptophan quenching, whereas the total amplitude of the fluorescence signal inactivated with radiation with a target size of 31 +/- 6 kDa. These results support the notion that DBDS and pCMBS bind to the transmembrane domain of erythrocyte band 3 in NEM-treated ghosts and demonstrate that radiation inactivation may probe a target significantly smaller than a covalently linked protein subunit. The small target size for the band 3 stilbene binding site may correspond to the intramembrane domain of the band 3 monomer (52 kDa), which is physically distinct from the cytoplasmic domain (42 kDa)

  5. Carborane-stilbene dyads: the influence of substituents and cluster isomers on photoluminescence properties.

    Science.gov (United States)

    Ferrer-Ugalde, A; Cabrera-González, J; Juárez-Pérez, E J; Teixidor, F; Pérez-Inestrosa, E; Montenegro, J M; Sillanpää, R; Haukka, M; Núñez, R

    2017-02-14

    Two novel styrene-containing meta-carborane derivatives substituted at the second carbon cluster atom (C c ) with either a methyl (Me) or a phenyl (Ph) group are introduced herein along with a new set of stilbene-containing ortho- (o-) and meta- (m-) carborane dyads. The latter set of compounds have been prepared from styrene-containing carborane derivatives via a Heck coupling reaction. High regioselectivity has been achieved for these compounds by using a combination of palladium complexes [Pd 2 (dba) 3 ]/[Pd(t-Bu 3 P) 2 ] as a catalytic system, yielding exclusively E isomers. All compounds have been fully characterised and the crystal structures of seven of them were analysed by X-ray diffraction. The absorption spectra of these compounds are similar to those of their respective fluorophore groups (styrene or stilbene), showing a very small influence of the substituent (Me or Ph) linked to the second C c atom or the cluster isomer (o- or m-). On the other hand, fluorescence spectroscopy revealed high emission intensities for Me-o-carborane derivatives, whereas their Ph-o-carborane analogues evidenced an almost total lack of fluorescence, confirming the significant role of the substituent bound to the adjacent C c in o-carboranes. In contrast, all the m-carborane derivatives display similar photoluminescence (PL) behavior regardless of the substituent attached to the second C c , demonstrating its small influence on emission properties. Additionally, m-carborane derivatives are significantly more fluorescent than their o-counterparts, reaching quantum yield values as high as 30.2%. Regarding solid state emission, only stilbene-containing Ph-o-carborane derivatives, which showed very low fluorescence in solution, exhibited notable PL emission in films attributed to aggregation-induced emission. DFT calculations were performed to successfully complement the photoluminescence studies, supporting the experimentally observed photophysical behavior of the styrene and

  6. Holographic recording of surface relief gratings in stilbene azobenzene derivatives at 633 nm

    International Nuclear Information System (INIS)

    Ozols, A; Saharov, D; Kokars, V; Kampars, V; Maleckis, A; Mezinskis, G; Pludons, A

    2010-01-01

    Holographic recording in stilbene azobenzene derivatives by He-Ne 633 nm laser light has been experimentally studied. It was found that surface relief gratings (SRG) can be recorded by red light. Usually shorter wavelengths are used to induce the trans-cis photo-isomerization in organic materials. SRG with 2 μm period and an amplitude of 130 nm have been recorded with 0.88 W/cm 2 light in about 20 minutes in amorphous films of 3-(4-(bis(2-(trityloxy)ethyl)amino)phenyl)-2-(4-(2-bromo-4-nitrophenyl) diazenyl)phenyl)acrylonitrile spin-coated on glass substrates. Self-diffraction efficiency up to 17.4% and specific recording energy down to 114 J/(cm 2 %) were measured. The recorded SRG were stable as proved by subsequent AFM measurements. The photo-induced changes in absorption spectra did not reveal noticeable signs of trans-cis transformations. Rather, spectrally uniform bleaching of the films took place. We conclude that a photothermally stimulated photo-destruction of chromophores is responsible for the SRG recording. The recording of stable SRG in the stilbene azobenzene derivatives we studied is accompanied by the recording of relaxing volume-phase gratings due to the photo-orientation of chromophores by the linearly polarized recording light. It should also be noted that holographic recording efficiency in stilbene azobenzene derivatives exhibit an unusual non-monotonic sample storage-time dependence presumably caused by the peculiarities of structural relaxation of the films.

  7. New organic photorefractive material composed of a charge-transporting dendrimer and a stilbene chromophore

    Science.gov (United States)

    Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.

    1999-10-01

    In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.

  8. A radioimmunoassay for the detection of diethylstilboestrol and related stilbenes in biological fluids

    International Nuclear Information System (INIS)

    Hallahan, Cornelius; McGarry, Yvonne; Collins, J.D.

    1985-01-01

    A radioimmunoassay for the measurement of the synthetic anabolic agent diethylstilboestrol (DES) is described. It is based on a commercially available antiserum and a tritiated derivative of DES. The method can detect low concentrations of residues (less than 0.5 ng/ml) in small samples (0.05 to 0.2 ml) of biological fluids. DES was measured in plasma, bile and urine obtained from a calf slaughtered 22 days after subcutaneous implantation of 24 mg DES. The assay described is suitable as a rapid screening procedure for identifying animals treated with stilbene substances. (author)

  9. Identification and quantification of stilbenes in some Tunisian red wines using UPLC-MS and HPLC-DAD

    Directory of Open Access Journals (Sweden)

    Kamel Arraki

    2017-06-01

    Full Text Available Seven Tunisian red wines mainly from the Mornag appellation were analyzed for resveratrol and analogues. The wines of each variety were evaporated, concentrated, and then subjected to fractionation and purification using XAD16 and DOWEX column chromatography. In addition to resveratrol, seven stilbenes were identified by UPLC-MS. The stilbenes derived were shown to be piceatannol, piceid, a-viniferin, e-viniferin, hopeaphenol and isohopeaphenol. From the point of view of the presence of resveratrol derivatives, one wine, Sidi Zahia, was the richest qualitatively.

  10. Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L.

    Directory of Open Access Journals (Sweden)

    Ivo Soural

    2015-04-01

    Full Text Available Grape cane, leaves and grape marc are waste products from viticulture, which can be used to obtain secondary stilbene derivatives with high antioxidant value. The presented work compares several extraction methods: maceration at laboratory temperature, extraction at elevated temperature, fluidized-bed extraction, Soxhlet extraction, microwave-assisted extraction, and accelerated solvent extraction. To obtain trans-resveratrol, trans-ε-viniferin and r2-viniferin from grape cane of the V. vinifera variety Cabernet Moravia, various conditions were studied: different solvents, using powdered versus cut cane material, different extraction times, and one-step or multiple extractions. The largest concentrations found were 6030 ± 680 µg/g dry weight (d.w. for trans-resveratrol, 2260 ± 90 µg/g d.w. for trans-ε-viniferin, and 510 ± 40 µg/g d.w. for r2-viniferin. The highest amounts of stilbenes (8500 ± 1100 µg/g d.w. were obtained using accelerated solvent extraction in methanol.

  11. Digital pile-up rejection for plutonium experiments with solution-grown stilbene

    Energy Technology Data Exchange (ETDEWEB)

    Bourne, M.M., E-mail: mmbourne@umich.edu; Clarke, S.D., E-mail: clarkesd@umich.edu; Paff, M., E-mail: mpaff@umich.edu; DiFulvio, A., E-mail: difulvio@umich.edu; Norsworthy, M., E-mail: marknors@umich.edu; Pozzi, S.A., E-mail: pozzisa@umich.edu

    2017-01-11

    A solution-grown stilbene detector was used in several experiments with plutonium samples including plutonium oxide, mixed oxide, and plutonium metal samples. Neutrons from different reactions and plutonium isotopes are accompanied by numerous gamma rays especially by the 59-keV gamma ray of {sup 241}Am. Identifying neutrons correctly is important for nuclear nonproliferation applications and makes neutron/gamma discrimination and pile-up rejection necessary. Each experimental dataset is presented with and without pile-up filtering using a previously developed algorithm. The experiments were simulated using MCNPX-PoliMi, a Monte Carlo code designed to accurately model scintillation detector response. Collision output from MCNPX-PoliMi was processed using the specialized MPPost post-processing code to convert neutron energy depositions event-by-event into light pulses. The model was compared to experimental data after pulse-shape discrimination identified waveforms as gamma ray or neutron interactions. We show that the use of the digital pile-up rejection algorithm allows for accurate neutron counting with stilbene to within 2% even when not using lead shielding.

  12. Effect of clone selection, nitrogen supply, leaf damage and mycorrhizal fungi on stilbene and emodin production in knotweed

    Czech Academy of Sciences Publication Activity Database

    Kovářová, Marcela; Frantík, Tomáš; Koblihová, Helena; Bartůňková, Kristýna; Nývltová, Z.; Vosátka, Miroslav

    2011-01-01

    Roč. 11, č. 98 (2011), s. 1-14 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : knotweed * stilbenes * leaf damage Subject RIV: EF - Botanics Impact factor: 3.447, year: 2011

  13. Perpendicular State of an Electronically Excited Stilbene: Observation by Femtosecond-Stimulated Raman Spectroscopy.

    Science.gov (United States)

    Quick, Martin; Dobryakov, Alexander L; Ioffe, Ilya N; Granovsky, Alex A; Kovalenko, Sergey A; Ernsting, Nikolaus P

    2016-10-20

    In the photoisomerization path of stilbene, a perpendicular state P on the S 1 potential energy surface is expected just before internal conversion through a conical intersection S 1 /S 0 . For decades the observation of P was thwarted by a short lifetime τ P in combination with slow population flow over a barrier. But these limitations can be overcome by ethylenic substitution. Following optical excitation of trans-1,1'-dicyanostilbene, P is populated significantly (τ P = 27 ps in n-hexane) and monitored by an exited-state absorption band at 370 nm. Here we report stimulated Raman lines of P. The strongest, at 1558 cm -1 , is attributed to stretching vibrations of the phenyl rings. Transient electronic states, resonance conditions, and corresponding Raman signals are discussed.

  14. Synthesis and anticancer activity of N-substituted 2-arylquinazolinones bearing trans-stilbene scaffold.

    Science.gov (United States)

    Mahdavi, Mohammad; Pedrood, Keyvan; Safavi, Maliheh; Saeedi, Mina; Pordeli, Mahboobeh; Ardestani, Sussan Kabudanian; Emami, Saeed; Adib, Mehdi; Foroumadi, Alireza; Shafiee, Abbas

    2015-05-05

    A novel series of 2-arylquinazolinones 7a-o bearing trans-stilbene moiety were designed, synthesized, and evaluated against human breast cancer cell lines including human breast adenocarcinoma (MCF-7 and MDA-MB-231) and human ductal breast epithelial tumor (T-47D). Among the tested compounds, the sec-butyl derivative 7h showed the best profile of activity (IC50 < 5 μM) against all cell lines, being 2-fold more potent than standard drug, etoposide. Our investigation revealed that the cytotoxic activity was significantly affected by N3-alkyl substituents. Furthermore, the morphological analysis by acridine orange/ethidium bromide double staining test and flow cytometry analysis indicated that the prototype compound 7h can induce apoptosis in MCF-7 and MDA-MB-231 cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  15. Design, Synthesis and Cytotoxic Evaluation of o-Carboxamido Stilbene Analogues

    Directory of Open Access Journals (Sweden)

    Mohamad Nurul Azmi

    2013-11-01

    Full Text Available Resveratrol, a natural stilbene found in grapes and wines exhibits a wide range of pharmacological properties. Resveratrol is also known as a good chemopreventive agent for inhibiting carcinogenesis processes that target kinases, cyclooxygenases, ribonucleotide reductase and DNA polymerases. A total of 19 analogues with an amide moiety were synthesized and the cytotoxic effects of the analogues on a series of human cancer cell lines are reported. Three compounds 6d, 6i and 6n showed potent cytotoxicity against prostate cancer DU-145 (IC50 = 16.68 µM, colon cancer HT-29 (IC50 = 7.51 µM and breast cancer MCF-7 (IC50 = 21.24 µM, respectively, which are comparable with vinblastine. The resveratrol analogues were synthesized using the Heck method.

  16. Synthesis of stilbene derivatives via visible-light-induced cross-coupling of aryl diazonium salts with nitroalkenes using -NO2 as a leaving group.

    Science.gov (United States)

    Zhang, Na; Quan, Zheng-Jun; Zhang, Zhang; Da, Yu-Xia; Wang, Xi-Cun

    2016-12-06

    The straightforward visible-light-induced synthesis of stilbene compounds via the cross-coupling of nitroalkenes and diazonium tetrafluoroborates under transition-metal-free conditions is described. The protocol uses green LEDs as light sources and eosin Y as an organophotoredox catalyst. Broad substrate scope and exclusive selectivity for the (E)-configuration of stilbenes are observed. This protocol proceeds via a radical pathway, with nitroalkenes serving as the radical acceptor, and the nitro group is cleaved during the process.

  17. Polyphenol Stilbenes from Fenugreek (Trigonella foenum-graecum L. Seeds Improve Insulin Sensitivity and Mitochondrial Function in 3T3-L1 Adipocytes

    Directory of Open Access Journals (Sweden)

    Gang Li

    2018-01-01

    Full Text Available Fenugreek (Trigonella foenum-graecum L. is a well-known annual plant that is widely distributed worldwide and has possessed obvious hypoglycemic and hypercholesterolemia characteristics. In our previous study, three polyphenol stilbenes were separated from fenugreek seeds. Here, we investigated the effect of polyphenol stilbenes on adipogenesis and insulin resistance in 3T3-L1 adipocytes. Oil Red O staining and triglyceride assays showed that polyphenol stilbenes differently reduced lipid accumulation by suppressing the expression of adipocyte-specific proteins. In addition, polyphenol stilbenes improved the uptake of 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-ylamino-2-deoxyglucose (2-NBDG by promoting the phosphorylation of protein kinase B (AKT and AMP-activated protein kinase (AMPK. In present studies, it was found that polyphenol stilbenes had the ability to scavenge reactive oxygen species (ROS. Results from adenosine triphosphate (ATP production and mitochondrial membrane potentials suggested that mitochondria play a critical role in insulin resistance and related signaling activation, such as AKT and AMPK. Rhaponticin, one of the stilbenes from fenugreek, had the strongest activity among the three compounds in vitro. Future studies will focus on mitochondrial biogenesis and function.

  18. A comparison of two methods of pulse-shape discrimination for alpha-gamma separation with trans-stilbene

    International Nuclear Information System (INIS)

    Shani, G.; Cojocaru, M.

    1977-01-01

    A method for measurement of low level alpha particles in high level gamma background is investigated. Because of its pulse-shape-discrimination properties and being a solid scintillator, trans-stilbene seems to be the proper scintillator, for this purpose. The investigation was done by measuring the effect of different gamma background level (from very low to very high) on constant alpha count rate. Two different pulse-shape-discrimination systems were used and compared. The Ortec system measures the pulse fall time and supplies a corresponding pulse height and the Elscint system checks whether the pulse is what is expected to be the gamma pulse, or is a longer pulse. Both systems yielded good results and were found to be adequate for alpha-gamma separation with trans-stilbene. (Auth.)

  19. Stilbenes from Deguelia rufescens var. urucu (Ducke) A. M. G. Azevedo leaves: effects on seed germination and plant growth

    Energy Technology Data Exchange (ETDEWEB)

    Lobo, Livia T.; Silva, Geilson A. da; Freitas, Manolo C.C. de; Silva, Milton N. da; Arruda, Alberto C.; Guilhon, Giselle M.S.P.; Santos, Lourivaldo S.; Santos, Alberdan S.; Arruda, Mara S.P., E-mail: mspa@ufpa.b [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Inst. de Ciencias Exatas e Naturais. Programa de Pos-Graduacao em Quimica; Souza Filho, Antonio Pedro S. [Centro de Pesquisa Agroflorestal da Amazonia Oriental (CPATU), Belem, PA (Brazil)

    2010-07-01

    The Amazon biodiversity may provide plants whose chemical substances are capable of controlling weeds. In this study we report the isolation and identification of five stilbenes from the leaves of 'timbo vermelho' (Deguelia rufescens var. urucu): 4-methoxylonchocarpene (1); 3,5-dimethoxy-4'-hydroxy-3'-prenyl-trans-stilbene (2), lonchocarpene (3), 3,5-dimethoxy-4'-Oprenyl- trans-stilbene (4) and pterostilbene (5). Compounds 2 and 4 are new natural products although 2 has been previously cited as synthesis product. Potential allelopathic activity for 1, 2 and 4 was evaluated over seed germination and plant growth of Mimosa pudica weed. The observed effects on seed germination did not vary significantly (p > 0.05) when the analysis of phytotoxicity was performed with the substances alone, the maximum inhibition did not exceed 20%. The most intense inhibitions on radicle and hypocotyl development were found for compound 4 (p < 0.05). When tested in pairs, showed antagonism for seed germination and synergism for radicle and hypocotyl development. (author)

  20. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  1. Mesoporous stilbene-based lanthanide metal organic frameworks: synthesis, photoluminescence and radioluminescence characteristics.

    Science.gov (United States)

    Mathis Ii, Stephan R; Golafale, Saki T; Bacsa, John; Steiner, Alexander; Ingram, Conrad W; Doty, F Patrick; Auden, Elizabeth; Hattar, Khalid

    2017-01-03

    Ultra large pore isostructural metal organic frameworks (MOFs) which exhibit both photoluminescence and scintillation properties, were synthesized from trans-4,4'-stilbenedicarboxylic acid (H 2 L) and trivalent lanthanide (Ln) metal salts under solvothermal conditions (Ln = Er 3+ (1) and Tm 3+ (2)). This new class of mesoporous materials is a non-interpenetrating network that features ultra-large diamond shaped pores of dimensions with approximate cross-sectional dimensions of 28 Å × 12 Å. The fully deprotonated ligand, L, is isolated and rigidified as it serves as the organic linker component of the MOF structure. Its low density unit cells possess asymmetric units with two crystallographically independent Ln 3+ ions in seven coordinate arrangements. A distinct feature of the structure is the bis-bidentate carboxylate groups. They serve as a ligand that coordinates two Ln(iii) ions while each L connects four Ln(iii) ions yielding an exceptionally large diamond-shaped rectangular network. The structure exhibits ligand-based photoluminescence with increased lifetime compared to free stilbene molecules on exposure to UV radiation, and also exhibits strong scintillation characteristics, comprising of both prompt and delayed radioluminescence features, on exposure to ionizing radiation.

  2. Synergistic action of fatty acids, sulphides and stilbene against acaricide-resistant Rhipicephalus microplus ticks.

    Science.gov (United States)

    Arceo-Medina, G N; Rosado-Aguilar, J A; Rodríguez-Vivas, R I; Borges-Argaez, R

    2016-09-15

    Six compounds in a methanolic extract of Petiveria alliacea stem (cis-stilbene; benzyl disulphide; benzyl trisulphide; and methyl esters of hexadecanoic acid, octadecadienoic acid and octadecenoic acid) are known to exercise acaricide activity against cattle tick Rhipicephalus microplus larvae and adults. The synergistic effect of 57 combinations of these six compounds on acaricide activity against R. microplus was evaluated. Larvae immersion tests produced the lethal concentrations needed to kill 50% (LC 50 ) and 99% (LC 99 ) of the population. Adult immersion tests produced rates (%) for mortality, oviposition inhibition and eclosion inhibition. Individually, none of the compounds (1% concentration) exhibited acaricide activity (mortality ≤2.3%). When combined, however, nine mixtures exhibited a synergistic increase in activity, with high mortality rates (≥92%) in larvae. Values for LC 50 ranged from 0.07 to 0.51% and those for LC 99 from 0.66 to 5.16%. Thirty six compound mixtures had no significant activity (mortality ≤30%) against larvae. Two mixtures exhibited synergism against adults, with high rates (≥92%) of oviposition inhibition. The mixtures based on the benzyl disulphide+benzyl trisulphide pairing produced a synergistic effect against acaricide-resistant R. microplus larva and adults, and are therefore the most promising combination for controlling this ubiquitous ectoparasite. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. An Immunosensing System Using Stilbene Glycoside as a Fluorogenic Substrate for an Enzymatic Reaction Model

    Directory of Open Access Journals (Sweden)

    Ya-Fei Tan

    2008-09-01

    Full Text Available A natural product, stilbene glycoside (2,3,5,4’-tetrahydroxydiphenylethylene-2-O-glucoside, TBG, has been evaluated for the first time as a potential substrate for horseradish peroxidase (HRP-catalyzed fluorogenic reactions. The properties of TBG as a fluorogenic substrate for HRP and its application in a fluorometric enzyme-linked immunosensing system were compared with commercially available substrates such as p-hydroxyphenylpropionic acid (pHPPA, chavicol and Amplex red using Brucella melitensis antibody (BrAb as a model analyte. The immunosensing body based on HRP-BrAb was constructed by dispersing graphite, BrAg and paraffin wax at room temperature. In a competitive immunoassay procedure, the BrAb competed with HRP-BrAb to react with the immobilized BrAg. In the enzymatic reaction, the binding HRP-BrAb on the sensing body surface can catalyze the polymerization reaction of TBG by H2O2 forming fluorescent dimers and causing an increase in fluorescence intensity. TBG showed comparable ability for HRP detection and its enzyme-linked immunosensing reaction system, in a linear detection ranging of 3.5´10-8~7.6´10-6g/L and with a detection limit of 1.7´10-9 g/L. The immobilized biocomposite surface could be regenerated with excellent reproducibility (RSD=3.8% by simply polishing with an alumina paper. The proposed immunosensing system has been used to determine the BrAb in rabbit serum samples with satisfactory results.

  4. Evidence for excited state intramolecular charge transfer in benzazole-based pseudo-stilbenes.

    Science.gov (United States)

    Santos, Fabiano da Silveira; Descalzo, Rodrigo Roceti; Gonçalves, Paulo Fernando Bruno; Benvenutti, Edilson Valmir; Rodembusch, Fabiano Severo

    2012-08-21

    Two azo compounds were obtained through the diazotization reaction of aminobenzazole derivatives and N,N-dimethylaniline using clay montmorillonite KSF as catalyst. The synthesized dyes were characterized using elemental analysis, Fourier transform infrared spectroscopy, and (13)C and (1)H NMR spectroscopy in solution. Their photophysical behavior was studied using UV-vis and steady-state fluorescence in solution. These dyes present intense absorption in the blue region. The spectral features of the azo compounds can be related to the pseudo-stilbene type as well as the E isomer of the dyes. Excitation at the absorption maxima does not produce emissive species in the excited state. However, excitation around 350 nm allowed dual emission of fluorescence, from both a locally excited (LE, short wavelength) and an intramolecular charge transfer (ICT, long wavelength) state, which was corroborated by a linear relation of the fluorescence maximum (ν(max)) versus the solvent polarity function (Δf) from the Lippert-Mataga correlation. Evidence of TICT in these dyes was discussed from the viscosity dependence of the fluorescence intensity in the ICT emission band. Theoretical calculations were also performed in order to study the geometry and charge distribution of the dyes in their ground and excited electronic states. Using DFT methods at the theoretical levels BLYP/Aug-cc-pVDZ, for geometry optimizations and frequency calculations, and B3LYP/6-311+G(2d), for single-point energy evaluations, the calculations revealed that the least energetic and most intense photon absorption leads to a very polar excited state that relaxes non-radioactively, which can be associated with photochemical isomerization.

  5. Identification of isomers in the gas phase and as adsorbates by near-edge X-ray absorption fine structure spectroscopy: Cis- and trans-stilbene

    International Nuclear Information System (INIS)

    Püttner, Ralph; Schmidt-Weber, Philipp; Kampen, Thorsten; Kolczewski, Christine; Hermann, Klaus; Horn, Karsten

    2017-01-01

    Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.

  6. Identification of isomers in the gas phase and as adsorbates by near-edge X-ray absorption fine structure spectroscopy: Cis- and trans-stilbene

    Energy Technology Data Exchange (ETDEWEB)

    Püttner, Ralph [Department of Physics, Freie Universität Berlin, 14195 Berlin (Germany); Schmidt-Weber, Philipp [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Kampen, Thorsten [SPECS Surface Nano Analysis GmbH, 13355 Berlin (Germany); Kolczewski, Christine [Deutsches Museum München, 80538 Munich (Germany); Hermann, Klaus [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Horn, Karsten, E-mail: horn@fhi-berlin.mpg.de [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany)

    2017-02-15

    Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.

  7. Thiophene-free diphenyl-amino-stilbene-diketo-pyrrolo-pyrrole derivatives as donors for organic bulk heterojunction solar cell

    Czech Academy of Sciences Publication Activity Database

    Honová, J.; Luňák, S.; Vala, M.; Stříteský, S.; Fekete, Ladislav; Weiter, M.; Kovalenko, A.

    2016-01-01

    Roč. 70, č. 10 (2016), s. 1416-1424 ISSN 0366-6352 R&D Projects: GA MŠk LO1409; GA ČR(CZ) GA15-05095S; GA MŠk LM2015088 Institutional support: RVO:68378271 Keywords : organic solar cell * thiophene-free * diphenyl-amino-stilbene * hole mobility * molecular structure Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.258, year: 2016

  8. Stilbene induced inhibition of androgen receptor dimerization: implications for AR and ARΔLBD-signalling in human prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Wolfgang Streicher

    Full Text Available BACKGROUND: Advanced castration resistant prostate cancer (CRPC is often characterized by an increase of C-terminally truncated, constitutively active androgen receptor (AR variants. Due to the absence of a ligand binding domain located in the AR-C-terminus, these receptor variants (also termed ARΔLBD are unable to respond to all classical forms of endocrine treatments like surgical/chemical castration and/or application of anti-androgens. METHODOLOGY: In this study we tested the effects of the naturally occurring stilbene resveratrol (RSV and (E-4-(2, 6-Difluorostyryl-N, N-dimethylaniline, a fluorinated dialkylaminostilbene (FIDAS on AR- and ARΔLBD in prostate cancer cells. The ability of the compounds to modulate transcriptional activity of AR and the ARΔLBD-variant Q640X was shown by reporter gene assays. Expression of endogenous AR and ARΔLBD mRNA and protein levels were determined by qRT-PCR and Western Blot. Nuclear translocation of AR-molecules was analyzed by fluorescence microscopy. AR and ARΔLBD/Q640X homo-/heterodimer formation was assessed by mammalian two hybrid assays. Biological activity of both compounds in vivo was demonstrated using a chick chorioallantoic membrane xenograft assay. RESULTS: The stilbenes RSV and FIDAS were able to significantly diminish AR and Q640X-signalling. Successful inhibition of the Q640X suggests that RSV and FIDAS are not interfering with the AR-ligand binding domain like all currently available anti-hormonal drugs. Repression of AR and Q640X-signalling by RSV and FIDAS in prostate cancer cells was caused by an inhibition of the AR and/or Q640X-dimerization. Although systemic bioavailability of both stilbenes is very low, both compounds were also able to downregulate tumor growth and AR-signalling in vivo. CONCLUSION: RSV and FIDAS are able to inhibit the dimerization of AR and ARΔLBD molecules suggesting that stilbenes might serve as lead compounds for a novel generation of AR-inhibitors.

  9. Tuning Stilbene Photochemistry by Fluorination: State Reordering Leads to Sudden Polarization near the Franck-Condon Region.

    Science.gov (United States)

    Ioffe, Ilya N; Quick, Martin; Quick, Michael T; Dobryakov, Alexander L; Richter, Celin; Granovsky, Alex A; Berndt, Falko; Mahrwald, Rainer; Ernsting, Nikolaus P; Kovalenko, Sergey A

    2017-10-25

    Spontaneous polarization of a nonpolar molecule upon photoexcitation (the sudden polarization effect) earlier discussed for 90°-twisted alkenes is observed and calculated for planar ring-fluorinated stilbenes, trans-2,3,5,6,2',3',5',6'-octofluorostilbene (tF2356) and trans-2,3,4,5,6,2',3',4',5',6'-decafluorostilbene (tF23456). Due to the fluorination, Franck-Condon states S 1 FC and S 2 FC are dominated by the quasi-degenerate HOMO-1 → LUMO and HOMO-2 → LUMO excitations, while their interaction gives rise to a symmetry-broken zwitterionic S 1 state. After optical excitation of tF2356, one observes an ultrafast (∼0.06 ps) evolution that reflects relaxation from initial nonpolar S 3 FC to long-lived (1.3 ns in n-hexane and 3.4 ns in acetonitrile) polar S 1 . The polarity of S 1 is evidenced by a solvatochromic shift of its fluorescence band. The experimental results provide a sensitive test for quantum-chemical calculations. In particular, our calculations agree with the experiment, and raise concerns about the applicability of the common TDDFT approach to relatively simple stilbenic systems.

  10. Relative light yield and temporal response of a stilbene-doped bibenzyl organic scintillator for neutron detection

    Energy Technology Data Exchange (ETDEWEB)

    Brown, J. A.; Goldblum, B. L., E-mail: bethany@nuc.berkeley.edu; Brickner, N. M.; Daub, B. H.; Kaufman, G. S.; Bibber, K. van; Vujic, J. [Department of Nuclear Engineering, University of California, Berkeley, California 94720 (United States); Bernstein, L. A.; Bleuel, D. L.; Caggiano, J. A.; Hatarik, R.; Phillips, T. W.; Zaitseva, N. P. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Wender, S. A. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)

    2014-05-21

    The neutron time-of-flight (nTOF) diagnostics used to characterize implosions at the National Ignition Facility (NIF) has necessitated the development of novel scintillators that exhibit a rapid temporal response and high light yield. One such material, a bibenzyl-stilbene mixed single-crystal organic scintillator grown in a 99.5:0.5 ratio in solution, has become the standard scintillator used for nTOF diagnostics at NIF. The prompt fluorescence lifetime and relative light yield as a function of proton energy were determined to calibrate this material as a neutron detector. The temporal evolution of the intensity of the prompt fluorescent response was modeled using first-order reaction kinetics and the prompt fluorescence decay constant was determined to be 2.46 ± 0.01 (fit) ± 0.13 (systematic) ns. The relative response of the bibenzyl-stilbene mixed crystal generated by recoiling protons was measured, and results were analyzed using Birks' relation to quantify the non-radiative quenching of excitation energy in the scintillator.

  11. Structural and kinetic analysis of the unnatural fusion protein 4-coumaroyl-CoA ligase::stilbene synthase

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yechun; Yi, Hankuil; Wang, Melissa; Yu, Oliver; Jez, Joseph M. (WU); (Danforth)

    2012-10-24

    To increase the biochemical efficiency of biosynthetic systems, metabolic engineers have explored different approaches for organizing enzymes, including the generation of unnatural fusion proteins. Previous work aimed at improving the biosynthesis of resveratrol, a stilbene associated a range of health-promoting activities, in yeast used an unnatural engineered fusion protein of Arabidopsis thaliana (thale cress) 4-coumaroyl-CoA ligase (At4CL1) and Vitis vinifera (grape) stilbene synthase (VvSTS) to increase resveratrol levels 15-fold relative to yeast expressing the individual enzymes. Here we present the crystallographic and biochemical analysis of the 4CL::STS fusion protein. Determination of the X-ray crystal structure of 4CL::STS provides the first molecular view of an artificial didomain adenylation/ketosynthase fusion protein. Comparison of the steady-state kinetic properties of At4CL1, VvSTS, and 4CL::STS demonstrates that the fusion protein improves catalytic efficiency of either reaction less than 3-fold. Structural and kinetic analysis suggests that colocalization of the two enzyme active sites within 70 {angstrom} of each other provides the basis for enhanced in vivo synthesis of resveratrol.

  12. Fast collimated neutron flux measurement using stilbene scintillator and flashy analog-to-digital converter in JT-60U

    International Nuclear Information System (INIS)

    Ishikawa, M.; Itoga, T.; Okuji, T.; Nakhostin, M.; Shinohara, K.; Hayashi, T.; Sukegawa, A.; Baba, M.; Nishitani, T.

    2006-01-01

    A line-integrated neutron emission profile is routinely measured using the radial neutron collimator system in JT-60U tokamak. Stilbene neuron detectors (SNDs), which combine a stilbene organic crystal scintillation detector (SD) with an analog neutron-gamma pulse shape discrimination (PSD) circuit, have been used to measure collimated neutron flux. Although the SND has many advantages as a neutron detector, the maximum count rate is limited up to ∼1x10 5 counts/s due to the analog PSD circuit. To overcome this issue, a digital signal processing system (DSPS) using a flash analog-to-digital converter (Acqiris DC252, 8 GHz, 10 bits) has been developed at Cyclotron and Radioisotope Center in Tohoku University. In this system anode signals from photomultiplier of the SD are directory stored and digitized. Then, the PSD between neutrons and gamma rays is performed using software. The DSPS has been installed in the vertical neutron collimator system in JT-60U and applied to deuterium experiments. It is confirmed that the PSD is sufficiently performed and collimated neutron flux is successfully measured with count rate up to ∼5x10 5 counts/s without the effect of pileup of detected pulses. The performance of the DSPS as a neutron detector, which supersedes the SND, is demonstrated

  13. Scope and limitations of the Heck-Matsuda-coupling of phenol diazonium salts and styrenes: a protecting-group economic synthesis of phenolic stilbenes.

    Science.gov (United States)

    Schmidt, Bernd; Elizarov, Nelli; Berger, René; Hölter, Frank

    2013-06-14

    4-Phenol diazonium salts undergo Pd-catalyzed Heck reactions with various styrenes to 4'-hydroxy stilbenes. In almost all cases higher yields and fewer side products were observed, compared to the analogous 4-methoxy benzene diazonium salts. In contrast, the reaction fails completely with 2- and 3-phenol diazonium salts. For these substitution patterns the methoxy-substituted derivatives are superior.

  14. Insights on the stilbenes in Raboso Piave grape (Vitis vinifera L.) as a consequence of postharvest vs on-vine dehydration.

    Science.gov (United States)

    Brillante, Luca; De Rosso, Mirko; Dalla Vedova, Antonio; Maoz, Itay; Flamini, Riccardo; Tomasi, Diego

    2018-03-01

    Grape withering is a process used to produce reinforced wines and raisins. Dehydration is usually carried out postharvest by keeping ripe grapes in special warehouses in controlled conditions of temperature, relative humidity (RH) and air flow. Alternatively, grape clusters can be left on the vines after the canes have been pruned. In general, dehydration increases stilbenes in grape, but there are few studies on the effects of on-vine withering. The stilbene profiles of Raboso Piave grape during postharvest and on-vine dehydration were studied here. High-resolution mass spectrometry (MS) was used to identify 19 stilbenes, including resveratrol monomers, dimers (viniferins), oligomers and glucoside derivatives. The two dehydration methods generally had different effects on the above nutraceuticals in grape. The samples kept in warehouses revealed significant increases in Z-ω-viniferin, E-ϵ-viniferin, δ-viniferin and another resveratrol dimer which were not observed in the plants. Trans-Resveratrol increased significantly only in samples dehydrated in the warehouse at 21 °C and 60-70% RH. The findings increase knowledge of stilbene composition in grapes subjected to withering on-vine. The choice of dehydration method affects the contents of these nutraceuticals in the grape and consequently in wines. Reasonably, it could also affect other secondary metabolites important for wine quality. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  15. On interaction of α,β-dibromo-derivatives of 1,2-diphenyl ethane and stilbene with potassium and cesium fluorides

    International Nuclear Information System (INIS)

    Kremlev, M.M.; Fialkov, Yu.A.

    1976-01-01

    The interaction is studied of trans-α, β-dibromostilbene and meso -1, 2 - dibromo -1, 2 - diphenylethane with potassium and cesium fluorides in dimethyl sulphoxide and N - methyl pyrrolidone. It has been found that in this interaction there takes place debromination of vicinal dibromides resulting in the formation of tolan and trans-stilbene, respectively, with a quantitative yield

  16. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part I: Design of a reference catalyst

    KAUST Repository

    Guillois, Kevin

    2012-02-01

    The kinetics of the heterogeneous gold-catalyzed aerobic epoxidation of stilbene in the liquid phase has been shown to be hindered by diffusion limitations, due to the use of supports which are unsuitable to apolar reaction media. The choice of these supports is generally dictated by the ability of standard methods of preparation to stabilize highly dispersed gold nanoparticles on them. Hence, new methods need to be designed in order to produce catalytically active gold nanoparticles on hydrophobic supports in general and on passivated silicas in particular. By investigating Tsukuda\\'s method to produce colloidal solutions of gold nanoparticles upon reduction of the triphenylphosphine gold chloride complex in solution, we found that direct reduction of AuPPh3Cl in the presence of a commercially available silica support functionalized with dimethylsiloxane, Aerosil R972, leads, in a highly reproducible and potentially scalable way, to the best catalyst ever reported for this reaction. (C) 2011 Elsevier BM. All rights reserved.

  17. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part I: Design of a reference catalyst

    KAUST Repository

    Guillois, Kevin; Burel, Laurence; Tuel, Alain; Caps, Valerie

    2012-01-01

    The kinetics of the heterogeneous gold-catalyzed aerobic epoxidation of stilbene in the liquid phase has been shown to be hindered by diffusion limitations, due to the use of supports which are unsuitable to apolar reaction media. The choice of these supports is generally dictated by the ability of standard methods of preparation to stabilize highly dispersed gold nanoparticles on them. Hence, new methods need to be designed in order to produce catalytically active gold nanoparticles on hydrophobic supports in general and on passivated silicas in particular. By investigating Tsukuda's method to produce colloidal solutions of gold nanoparticles upon reduction of the triphenylphosphine gold chloride complex in solution, we found that direct reduction of AuPPh3Cl in the presence of a commercially available silica support functionalized with dimethylsiloxane, Aerosil R972, leads, in a highly reproducible and potentially scalable way, to the best catalyst ever reported for this reaction. (C) 2011 Elsevier BM. All rights reserved.

  18. Relocation of the disulfonic stilbene sites of AE1 (band 3) on the basis of fluorescence energy transfer measurements.

    Science.gov (United States)

    Knauf, Philip A; Law, Foon-Yee; Leung, Tze-Wah Vivian; Atherton, Stephen J

    2004-09-28

    Previous fluorescence resonance energy transfer (FRET) measurements, using BIDS (4-benzamido-4'-isothiocyanostilbene-2,2'-disulfonate) as a label for the disulfonic stilbene site and FM (fluorescein-5-maleimide) as a label for the cytoplasmic SH groups on band 3 (AE1), combined with data showing that the cytoplasmic SH groups lie about 40 A from the cytoplasmic surface of the lipid bilayer, would place the BIDS sites very near the membrane's inner surface, a location that seems to be inconsistent with current models of AE1 structure and mechanism. We reinvestigated the BIDS-FM distance, using laser single photon counting techniques as well as steady-state fluorescence of AE1, in its native membrane environment. Both techniques agree that there is very little energy transfer from BIDS to FM. The mean energy transfer (E), based on three-exponential fits to the fluorescence decay data, is 2.5 +/- 0.7% (SEM, N = 12). Steady-state fluorescence measurements also indicate BIDS to FM. These data indicate that the BIDS sites are probably over 63 A from the cytoplasmic SH groups, placing them near the middle or the external half of the lipid bilayer. This relocation of the BIDS sites fits with other evidence that the disulfonic stilbene sites are located farther toward the external membrane surface than Glu-681, a residue near the inner membrane surface whose modification affects the pH dependence and anion selectivity of band 3. The involvement of two relatively distant parts of the AE1 protein in transport function suggests that the transport mechanism requires coordinated large-scale conformational changes in the band 3 protein.

  19. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part II: Identification and quantification of a key reaction intermediate

    KAUST Repository

    Guillois, Kevin

    2013-03-01

    The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.

  20. Gold-catalyzed aerobic epoxidation of trans-stilbene in methylcyclohexane. Part II: Identification and quantification of a key reaction intermediate

    KAUST Repository

    Guillois, Kevin; Mangematin, Sté phane; Tuel, Alain; Caps, Valerie

    2013-01-01

    The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.

  1. Preparative isolation and purification of three stilbene glycosides from the tibetan medicinal plant Rheum tanguticum maxim. Ex Balf. by high-speed counter-current chromatography.

    Science.gov (United States)

    Zhao, Xiao-Hui; Han, Fa; Li, Yu-Lin; Yue, Hui-Lan

    2013-02-01

    Stilbene glycosides are the primary constituents of Rheum tanguticum Maxim. ex Balf., to which different bioactivities has been attributed, including: anti-HIV, anti-oxidant, anti-tumour, anti-malarial, and anti-allergy activity. However, effective methods for the isolation and purification of stilbene glycosides, such as trans-rhapontin, cis-rhapontin and trans-desoxyrhaponticin, from this herb are not currently available. To develop an efficient method for the preparative isolation and purification of three stilbene glycosides from Rheum tanguticum Maxim. ex Balf. via high-speed counter-current chromatography (HSCCC). A solvent system composed of chloroform:n-butanol:methanol:water (4:1:3:2, v/v/v/v) was developed for the separation. The upper phase was used as the stationary phase, and the lower phase was used as the mobile phase. The flow rate was 1.8 mL/min. The apparatus was controlled at 800 rpm and 25 °C, and the effluent was monitored at 280 nm. Chemical constituents were analysed by high-performance liquid chromatography (HPLC), and their structures were identified by ¹H- and ¹³C-NMR. Under the optimised conditions, 25.5 mg trans-rhapontin, 16.0 mg cis-rhapontin and 20.5 mg trans-desoxyrhaponticin were separated from 80 mg crude sample; the isolates had purities of 99.6, 97.2 and 99.2%, respectively. A simple and efficient HSCCC method has been optimised for the preparative separation of stilbene glycosides from Rheum tanguticum Maxim. ex Balf. Copyright © 2012 John Wiley & Sons, Ltd.

  2. Simultaneous determination of five characteristic stilbene glycosides in root bark of Morus albus L. (Cortex Mori) using high-performance liquid chromatography.

    Science.gov (United States)

    Piao, Shu-juan; Chen, Li-xia; Kang, Ning; Qiu, Feng

    2011-01-01

    Cortex Mori, one of the well-known traditional Chinese herbal medicines, is derived from the root bark of Morus alba L. according to the China Pharmacopeia. Stilbene glycosides are the main components isolated from aqueous extracts of Morus alba and their content varies depending on where Cortex Mori was collected. We have established a qualitative and quantitative method based on the bioactive stilbene glycosides for control of the quality of Cortex Mori from different sources. To develop a high-performance liquid chromatography coupled with ultraviolet absorption detection for simultaneous quantitative determination of five major characteristic stilbene glycosides in 34 samples of the root bark of Morus alba L. (Cortex Mori) from different sources. The analysis was performed on an ODS column using methanol-water-acetic acid (18: 82: 0.1, v/v/v) as the mobile phase and the peaks were monitored at 320 nm. All calibration curves showed good linearity (r ≥ 0.9991) within test ranges. This method showed good repeatability for the quantification of these five components in Cortex Mori with intra- and inter-day standard deviations less than 2.19% and 1.45%, respectively. The validated method was successfully applied to quantify the five investigated components, including a pair of cis-trans-isomers 1 and 2 and a pair of isomers 4 and 5 in 34 samples of Cortex Mori from different sources. Copyright © 2010 John Wiley & Sons, Ltd.

  3. Genome-wide analysis of the grapevine stilbene synthase multigenic family: genomic organization and expression profiles upon biotic and abiotic stresses

    Directory of Open Access Journals (Sweden)

    Vannozzi Alessandro

    2012-08-01

    Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be

  4. Antiviral Stilbene 1,2-Diamines Prevent Initiation of Hepatitis C Virus RNA Replication at the Outset of Infection▿

    Science.gov (United States)

    Gastaminza, Pablo; Pitram, Suresh M.; Dreux, Marlene; Krasnova, Larissa B.; Whitten-Bauer, Christina; Dong, Jiajia; Chung, Josan; Fokin, Valery V.; Sharpless, K. Barry; Chisari, Francis V.

    2011-01-01

    The recent development of a cell culture model of hepatitis C virus (HCV) infection based on the JFH-1 molecular clone has enabled discovery of new antiviral agents. Using a cell-based colorimetric screening assay to interrogate a 1,200-compound chemical library for anti-HCV activity, we identified a family of 1,2-diamines derived from trans-stilbene oxide that prevent HCV infection at nontoxic, low micromolar concentrations in cell culture. Structure-activity relationship analysis of ∼300 derivatives synthesized using click chemistry yielded compounds with greatly enhanced low nanomolar potency and a >1,000:1 therapeutic ratio. Using surrogate models of HCV infection, we showed that the compounds selectively block the initiation of replication of incoming HCV RNA but have no impact on viral entry, primary translation, or ongoing HCV RNA replication, nor do they suppress persistent HCV infection. Selection of an escape variant revealed that NS5A is directly or indirectly targeted by this compound. In summary, we have identified a family of HCV inhibitors that target a critical step in the establishment of HCV infection in which NS5A translated de novo from an incoming genomic HCV RNA template is required to initiate the replication of this important human pathogen. PMID:21430055

  5. Carbon-11 labeled stilbene derivatives from natural products for the imaging of Aβ plaques in the brain

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Mengchao; Tang, Ruikun; Li, Zijing; Jia, Hongmei; Liu, Boli [Beijing Normal Univ. (China). Key Laboratory of Radiopharmaceuticals; Zhang, Jinming; Zhang, Xiaojun [Chinese PLA General Hospital, Beijing (China). Dept. of Nuclear Medicine

    2014-04-01

    Four stilbene derivatives from natural products were screened as novel β-amyloid (Aβ) imaging ligands. In vitro binding assay showed that the methylated ligand, (E)-1-methoxy-4-styrylbenzene (8) displayed high binding affinity to Aβ{sub 1-42} aggregates (K{sub i} = 19.5 nM). Moreover, the {sup 11}C-labeled ligand, [{sup 11}C]8 was prepared through an O-methylation reaction using [{sup 11}C]CH{sub 3}OTf. In vitro autoradiography with sections of transgenic mouse brain also confirmed the high and specific binding of [{sup 11}C]8 to Aβ plaques. In vivo biodistribution experiments in normal mice indicated that [{sup 11}C]8 displayed high initial uptake (9.41 ± 0.51% ID/g at 5 min post-injection) into and rapid washout from the brain, with a brain{sub 5} {sub min}/brain{sub 30} {sub min} ratio of 6.63. These preliminary results suggest that [{sup 11}C]8 may be served as a novel Aβ imaging probe for PET. (orig.)

  6. Effects of trans-stilbene and terphenyl compounds on different strains of Leishmania and on cytokines production from infected macrophages.

    Science.gov (United States)

    Bruno, Federica; Castelli, Germano; Vitale, Fabrizio; Giacomini, Elisa; Roberti, Marinella; Colomba, Claudia; Cascio, Antonio; Tolomeo, Manlio

    2018-01-01

    Most of the antileishmanial modern therapies are not satisfactory due to high toxicity or emergence of resistance and high cost of treatment. Previously, we observed that two compounds of a small library of trans-stilbene and terphenyl derivatives, ST18 and TR4, presented the best activity and safety profiles against Leishmania infantum promastigotes and amastigotes. In the present study we evaluated the effects of ST18 and the TR4 in 6 different species of Leishmania and the modifications induced by these two compounds in the production of 8 different cytokines from infected macrophages. We observed that TR4 was potently active in all Leishmania species tested in the study showing a leishmanicidal activity higher than that of ST18 and meglumine antimoniate in the most of the species. Moreover, TR4 was able to decrease the levels of IL-10, a cytokine able to render the host macrophage inactive allowing the persistence of parasites inside its phagolysosome, and increase the levels of IL-1β, a cytokine important for host resistance to Leishmania infection by inducible iNOS-mediated production of NO, and IL-18, a cytokine implicated in the development of Th1-type immune response. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Multiomics in Grape Berry Skin Revealed Specific Induction of the Stilbene Synthetic Pathway by Ultraviolet-C Irradiation1

    Science.gov (United States)

    Suzuki, Mami; Nakabayashi, Ryo; Ogata, Yoshiyuki; Sakurai, Nozomu; Tokimatsu, Toshiaki; Goto, Susumu; Suzuki, Makoto; Jasinski, Michal; Martinoia, Enrico; Otagaki, Shungo; Matsumoto, Shogo; Saito, Kazuki; Shiratake, Katsuhiro

    2015-01-01

    Grape (Vitis vinifera) accumulates various polyphenolic compounds, which protect against environmental stresses, including ultraviolet-C (UV-C) light and pathogens. In this study, we looked at the transcriptome and metabolome in grape berry skin after UV-C irradiation, which demonstrated the effectiveness of omics approaches to clarify important traits of grape. We performed transcriptome analysis using a genome-wide microarray, which revealed 238 genes up-regulated more than 5-fold by UV-C light. Enrichment analysis of Gene Ontology terms showed that genes encoding stilbene synthase, a key enzyme for resveratrol synthesis, were enriched in the up-regulated genes. We performed metabolome analysis using liquid chromatography-quadrupole time-of-flight mass spectrometry, and 2,012 metabolite peaks, including unidentified peaks, were detected. Principal component analysis using the peaks showed that only one metabolite peak, identified as resveratrol, was highly induced by UV-C light. We updated the metabolic pathway map of grape in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database and in the KaPPA-View 4 KEGG system, then projected the transcriptome and metabolome data on a metabolic pathway map. The map showed specific induction of the resveratrol synthetic pathway by UV-C light. Our results showed that multiomics is a powerful tool to elucidate the accumulation mechanisms of secondary metabolites, and updated systems, such as KEGG and KaPPA-View 4 KEGG for grape, can support such studies. PMID:25761715

  8. Study of sampling rate influence on neutron-gamma discrimination with stilbene coupled to a silicon photomultiplier.

    Science.gov (United States)

    Zhang, Jinglong; Moore, Michael E; Wang, Zhonghai; Rong, Zhou; Yang, Chaowen; Hayward, Jason P

    2017-10-01

    Choosing a digitizer with an appropriate sampling rate is often a trade-off between performance and economy. The influence of sampling rates on the neutron-gamma Pulse Shape Discrimination (PSD) with a solid stilbene scintillator coupled to a Silicon Photomultiplier was investigated in this work. Sampling rates from 125MSPS to 2GSPS from a 10-bit digitizer were used to collect detector pulses produced by the interactions of a Cf-252 source. Due to the decreased signal-to-noise ratio (SNR), the PSD performance degraded with reduced sampling rates. The reason of PSD performance degradation was discussed. Then, an efficient combination of filtering and digital signal processing (DSP) was then applied to suppress the timing noise and electronic background noise. The results demonstrate an improved PSD performance especially at low sampling rates, down to 125MSPS. Using filtering and DSP, the ascribed Figure of Merit (FOM) at 125keV ee (± 10keV ee ) increased from 0.95 to 1.02 at 125MSPS. At 300keV ee and above, all the FOMs are better than 2.00. Our study suggests that 250MSPS is a good enough sampling rate for neutron-gamma discrimination in this system in order to be sensitive to neutrons at and above ~ 125keV ee . Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  10. A stilbene synthase allele from a Chinese wild grapevine confers resistance to powdery mildew by recruiting salicylic acid signalling for efficient defence.

    Science.gov (United States)

    Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter

    2016-10-01

    Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  11. Stilbene Glucoside, a Putative Sleep Promoting Constituent from Polygonum multiflorum Affects Sleep Homeostasis by Affecting the Activities of Lactate Dehydrogenase and Salivary Alpha Amylase.

    Science.gov (United States)

    Wei, Qian; Ta, Guang; He, Wenjing; Wang, Wei; Wu, Qiucheng

    2017-01-01

    Chinese herbal medicine (CHM) has been used for treating insomnia for centuries. The most used CHM for insomnia was Polygonum multiflorum. However, the molecular mechanism for CHM preventing insomnia is unknown. Stilbene glucoside (THSG), an important active component of P. multiflorum, may play an important role for treating insomnia. To test the hypothesis, Kunming mice were treated with different dosages of THSG. To examine the sleep duration, a computer-controlled sleep-wake detection system was implemented. Electroencephalogram (EEG) and electromyogram (EMG) electrodes were implanted to determine sleep-wake state. RT-PCR and Western blot was used to measure the levels of lactate dehydrogenase (LDH) and saliva alpha amylase. Spearman's rank correlation coefficient was used to identify the strength of correlation between the variables. The results showed that THSG significantly prolonged the sleep time of the mice (palpha amylase (palpha amylase (pamylase were negatively associated with sleep duration (palpha amylase.

  12. A single source precursor route to group 13 homo- and heterometallic oxides as highly active supports for gold-catalyzed aerobic epoxidation of trans-stilbene

    KAUST Repository

    Mishra, Shashank K.; Mendez, Violaine; Jeanneau, Erwann; Caps, Valerie; Daniè le, Sté phane

    2012-01-01

    A new Mitsubishi-type of star-shaped homoleptic derivative of indium(III), In4(mdea)6 (2, mdeaH2 = N-methyldiethanolamine) , was synthesized by the chloro-aminoalkoxo exchange reaction of a heteroleptic complex In6Cl6(mdea)6 (1) and used as a facile single source molecular precursor for the sol-gel preparation of high surface area indium oxide. Successful deposition of gold nanoparticles (1 wt.-%) of average size 3.3 nm on the above metal oxide by using HAuCl4· 3H2O afforded a highly efficient Au/In2O3 catalyst for the aerobic epoxidation of trans-stilbene at low temperature. The above single source precursor approach was further extended to obtain other group 13 homo- and heterometallic oxides, namely, α-Ga2O 3, β-Ga2O3 and Al4Ga 2O9, as highly active supports for gold catalysts. The obtained Au/M2O3 (M = Ga, In) and Au/Al4Ga 2O9 catalysts were thoroughly characterized by using several physicochemical techniques such as XRD, high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray (EDX) spectroscopy, and X-ray photoelectron spectroscopy (XPS). A comparative study of the above catalysts for the model aerobic oxidation of stilbene in methylcyclohexane was undertaken. Highly efficient catalysts for aerobic oxidation reactions were obtained by depositing gold nanoparticles on group 13 mono- or mixed metal oxides prepared from the hydrolysis of well-characterized homo- and heterometallic N-methyldiethanolaminate derivatives. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. A single source precursor route to group 13 homo- and heterometallic oxides as highly active supports for gold-catalyzed aerobic epoxidation of trans-stilbene

    KAUST Repository

    Mishra, Shashank K.

    2012-12-14

    A new Mitsubishi-type of star-shaped homoleptic derivative of indium(III), In4(mdea)6 (2, mdeaH2 = N-methyldiethanolamine) , was synthesized by the chloro-aminoalkoxo exchange reaction of a heteroleptic complex In6Cl6(mdea)6 (1) and used as a facile single source molecular precursor for the sol-gel preparation of high surface area indium oxide. Successful deposition of gold nanoparticles (1 wt.-%) of average size 3.3 nm on the above metal oxide by using HAuCl4· 3H2O afforded a highly efficient Au/In2O3 catalyst for the aerobic epoxidation of trans-stilbene at low temperature. The above single source precursor approach was further extended to obtain other group 13 homo- and heterometallic oxides, namely, α-Ga2O 3, β-Ga2O3 and Al4Ga 2O9, as highly active supports for gold catalysts. The obtained Au/M2O3 (M = Ga, In) and Au/Al4Ga 2O9 catalysts were thoroughly characterized by using several physicochemical techniques such as XRD, high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray (EDX) spectroscopy, and X-ray photoelectron spectroscopy (XPS). A comparative study of the above catalysts for the model aerobic oxidation of stilbene in methylcyclohexane was undertaken. Highly efficient catalysts for aerobic oxidation reactions were obtained by depositing gold nanoparticles on group 13 mono- or mixed metal oxides prepared from the hydrolysis of well-characterized homo- and heterometallic N-methyldiethanolaminate derivatives. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Postharvest stilbenes and flavonoids enrichment of table grape cv Redglobe (Vitis vinifera L.) as affected by interactive UV-C exposure and storage conditions.

    Science.gov (United States)

    Crupi, Pasquale; Pichierri, Arianna; Basile, Teodora; Antonacci, Donato

    2013-11-15

    Flavonoids and stilbenes are secondary metabolites produced in plants that can play an important health-promoting role. The biosynthesis of these compounds generally increases as a response to biotic or abiotic stress; therefore, in order to achieve as high phenolic accumulation as possible, the interactive effects of storage conditions (temperature and time) and UV-C radiation on polyphenols content in postharvest Redglobe table grape variety were investigated. During a storage time longer than 48h, both cold storage (4°C) and UV-C exposure of almost 3min (2.4kJm(-2)) positively enhanced the content of cis- and trans-piceid (34 and 90μgg(-1) of skin, respectively) together with quercetin-3-O-galactoside and quercetin-3-O-glucoside (15 and 140μgg(-1) of skin, respectively) up to three fold respect to control grape samples. Conversely, catechin was not significantly affected by irradiation and storage treatments. With regard anthocyanins, the highest concentrations of cyanidin-3-O-glucoside and peonidin-3-Oglucoside were observed in Redglobe, stored at both room temperature and 4°C, after 5min (4.1kJm(-2)) of UV-C treatment and 24h of storage. Gathered findings showed that combined postharvest treatments can lead to possible "functional" grapes, within normal conditions of market commercialization, responding to the rising consumers demand to have foods that support and promote health. Copyright © 2013. Published by Elsevier Ltd.

  15. Photoinduced Ultrafast Intramolecular Excited-State Energy Transfer in the Silylene-Bridged Biphenyl and Stilbene (SBS) System: A Nonadiabatic Dynamics Point of View.

    Science.gov (United States)

    Wang, Jun; Huang, Jing; Du, Likai; Lan, Zhenggang

    2015-07-09

    The photoinduced intramolecular excited-state energy-transfer (EET) process in conjugated polymers has received a great deal of research interest because of its important role in the light harvesting and energy transport of organic photovoltaic materials in photoelectric devices. In this work, the silylene-bridged biphenyl and stilbene (SBS) system was chosen as a simplified model system to obtain physical insight into the photoinduced intramolecular energy transfer between the different building units of the SBS copolymer. In the SBS system, the vinylbiphenyl and vinylstilbene moieties serve as the donor (D) unit and the acceptor (A) unit, respectively. The ultrafast excited-state dynamics of the SBS system was investigated from the point of view of nonadiabatic dynamics with the surface-hopping method at the TDDFT level. The first two excited states (S1 and S2) are characterized by local excitations at the acceptor (vinylstilbene) and donor (vinylbiphenyl) units, respectively. Ultrafast S2-S1 decay is responsible for the intramolecular D-A excitonic energy transfer. The geometric distortion of the D moiety play an essential role in this EET process, whereas the A moiety remains unchanged during the nonadiabatic dynamics simulation. The present work provides a direct dynamical approach to understand the ultrafast intramolecular energy-transfer dynamics in SBS copolymers and other similar organic photovoltaic copolymers.

  16. Ab initio Investigation to Model Stilbene Photo-Physical Properties by Combining CC2 Topological Investigation and CASPT2 Energy Corrections

    International Nuclear Information System (INIS)

    Tomasello, Gaia; Altoe, Piero; Garavelli, Marco; Orlandi, Giorgio

    2007-01-01

    Stilbene photoexcitation and consequent decay to the ground state has been investigated by mapping the Minimum Energy Path (MEP) from S 1 spectroscopic state triggering an almost barrierless reaction pathway to an S 1 /S 0 degenerate region. The particular influence of the σ-π excitation on the S 1 wave function, dominated by a π→π* character, reveals how the non-dynamical correlation energy was important to correctly describe the excited state behaviour and the topological aspect of its potential energy surface. Several strategies of calculations, by using CASSCF//CASPT2 methods, were performed trying to improve the photochemical description nowadays known. Both symmetry and non symmetry preserving computations were performed; systematically was concluded that, because of the limit of CASSCF description enables only to introduce the correlation effect such as the ones due to σ-π excitations, CASSCF and CASPT2 topologies are probably often not in agreement. Thus CC2 methodology was adopted o optimize the S 1 geometries and obtain reasonable structures for the minima. Two S 1 /S 0 accessible conical intersections featured by pyramidalized carbons were located on the first excited state explaining the ultrafast radiationless decay to the ground state and the photoproducts observed within the timescale of ps

  17. Synthesis and structural and photoswitchable properties of novel chiral host molecules: axis chiral 2,2'-dihydroxy-1,1'-binaphthyl-appended stiff-stilbene.

    Science.gov (United States)

    Shimasaki, Toshiaki; Kato, Shin-ichiro; Ideta, Keiko; Goto, Kenta; Shinmyozu, Teruo

    2007-02-16

    Novel photoswitchable chiral hosts having an axis chiral 2,2'-dihydroxy-1,1'-binaphthyl (BINOL)-appended stiff-stilbene, trans-(R,R)- and -(S,S)-1, were synthesized by palladium-catalyzed Suzuki-Miyaura coupling and low-valence titanium-catalyzed McMurry coupling as key steps, and they were fully characterized by various NMR spectral techniques. The enantiomers of trans-1 showed almost complete mirror images in the CD spectra, where two split Cotton effects (exciton coupling) were observed in the beta-transitions of the naphthyl chromophore at 222 and 235 nm, but no Cotton effect was observed in the stiff-stilbene chromophore at 365 nm. The structures of (R)-10 and trans-(R,R)-1 were confirmed by X-ray structural analysis. The optimized structure of cis-1 by MO calculations has a wide chiral cavity of 7-8 A in diameter, whereas trans-1 cannot form an intramolecular cavity based on the X-ray data. Irradiation of (R,R)-trans-1 with black light (lambda = 365 nm) in CH3CN or benzene at 23 degrees C led to the conversion to the corresponding cis-isomer, as was monitored by 1H NMR, UV-vis, and CD spectra. At the photostationary state, the cis-1/trans-1 ratio was 86/14 in benzene or 75/25 in CH3CN. On the other hand, irradiation of the cis-1/trans-1 (75/25) mixture in CH3CN with an ultra-high-pressure Hg lamp at 23 degrees C (lambda = 410 nm) led to the photostationary state, where the cis-1/trans-1 ratio was estimated to be 9/91 on the basis of the 1H NMR spectra. The cis-trans and trans-cis interconversions could be repeated 10 times without decomposition of the C=C double bond. Thus, a new type of photoswitchable molecule has been developed, and trans-1 and cis-1 were quite durable under irradiation conditions. The guest binding properties of the BINOL moieties of trans- and cis-(R,R)-1 with F-, Cl-, and H2PO4- were examined by 1H NMR titration in CDCl3. Similar interaction with F- and Cl- was observed in trans-1 (host/guest = 1/1, Kassoc = (1.0 +/- 0.13) x 103 for F

  18. Multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts: differential role of hydroxycinnamic acids, flavonols and stilbenes on endothelial inflammatory gene expression.

    Science.gov (United States)

    Calabriso, Nadia; Scoditti, Egeria; Massaro, Marika; Pellegrino, Mariangela; Storelli, Carlo; Ingrosso, Ilaria; Giovinazzo, Giovanna; Carluccio, Maria Annunziata

    2016-03-01

    The aim of the study was to evaluate the vascular anti-inflammatory effects of polyphenolic extracts from two typical South Italy red wines, the specific contribution of individual polyphenols and the underlying mechanisms of action. Human endothelial cells were incubated with increasing concentrations (1-50 μg/mL) of Primitivo and Negroamaro polyphenolic extracts (PWPE and NWPE, respectively) or pure polyphenols (1-25 μmol/L), including hydroxycinnamic acids (p-coumaric, caffeic and caftaric acids), flavonols (kaempferol, quercetin, myricetin) or stilbenes (trans-resveratrol, trans-piceid) before stimulation with lipopolysaccharide. Through multiple assays, we analyzed the endothelial-monocyte adhesion, the endothelial expression of adhesion molecules (ICAM-1, VCAM-1 and E-Selectin), monocyte chemoattractant protein-1 (MCP-1) and macrophage colony-stimulating factor (M-CSF), as well as ROS intracellular levels and the activation of NF-κB and AP-1. Both PWPE and NWPE, already at 1 μg/mL, inhibited monocyte adhesion to stimulated endothelial cells, a key event in triggering vascular inflammation. They down-regulated the expression of adhesion molecules, ICAM-1, VCAM-1, E-Selectin, as well as MCP-1 and M-CSF, at mRNA and protein levels. All polyphenols reduced intracellular ROS, and everything, except caftaric acid, inhibited the endothelial expression of adhesion molecules and MCP-1, although with different potency. Flavonols and resveratrol significantly reduced also the endothelial expression and release of M-CSF. The decrease in endothelial inflammatory gene expression was related to the inhibition of NF-κB and AP-1 activation but not to intracellular oxidative stress. This study showed multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts and indentified specific bioactive polyphenols which could counteract inflammatory diseases including atherosclerosis.

  19. Efficient {pi} electrons delocalization in prospective push-pull non-linear optical chromophore 4-[N,N-dimethylamino]-4'-nitro stilbene (DANS): A vibrational spectroscopic study

    Energy Technology Data Exchange (ETDEWEB)

    Vijayakumar, T.; Hubert Joe, I. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India); Reghunadhan Nair, C.P. [Polymers and Special Chemicals Division, Vikram Sarabhai Space Centre, Thiruvananthapuram 695 022, Kerala (India); Jayakumar, V.S. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India)], E-mail: vsjk@vsnl.net

    2008-01-22

    A comprehensive investigation on the intramolecular charge transfer (ICT) of an efficient {pi}-conjugated potential push-pull NLO chromophore, 4-[N,N-dimethylamino]-4'-nitro stilbene (DANS), from a strong electron-donor group (dimethylamino-N(CH{sub 3}){sub 2}) to a strong electron-acceptor group (nitro-NO{sub 2}) through the {pi}-conjugated bridge (trans-stilbene) has been carried out from their vibrational spectra. The NIR FT-Raman and FT-IR spectra supported by the density functional theory (DFT) quantum chemical computations have been employed to analyze the effects of intramolecular charge transfer on the geometries and the vibrational modes contributing to the linear electro-optic effect of the organic NLO material. It has been observed that the changes in the endocyclic and exocyclic angles result from the charge-transfer interaction of the phenyl ring and the amino group in the electron-donor side of the NLO chromophore. The strongest vibrational modes contributing to the electro-optic effect have been identified and examined from the concurrent IR and Raman activation of {nu}(C=C/C-C) mode, ring C=C stretching modes, in-plane deformation modes, nitro modes and the umbrella mode of methyl groups. Furthermore, the splitting of the vinyl stretching modes and the electronic effects such as hyperconjugation and backdonation on the methyl hydrogen atoms causing the decrease of stretching frequencies and infrared intensities have also been analyzed in detail. The effect of frontier orbitals transition of electron density transfer and the influence of planarity between the phenyl rings of the stilbene moiety on the first hyperpolarizability have also been discussed.

  20. Poly[bis(N,N-dimethylformamidetris(μ4-trans-stilbene-4,4′-dicarboxylatotricadmium(II]: a two-dimensional network with an unusual 36 topology

    Directory of Open Access Journals (Sweden)

    Gyungse Park

    2008-07-01

    Full Text Available In the title compound, [Cd3(C16H10O43(C3H7NO2]n or [Cd3(SDA3(DMF2]n (H2SDA is trans-stilbene-4,4′-dicarboxylic acid and DMF is dimethylformamide, the linear dicarboxylate ligand forms a two-dimensionally layered metal–organic network with the relatively uncommon 36 topology. The structure reveals trinuclear secondary building units and has an octahedral geometry at a central metal ion (occupying a overline{3} symmetry site and tetrahedral geometries at two surrounding symmetrically equivalent metal ions lying on a threefold axis. The six-connected planar trinuclear CdII centers, Cd3(O2CR6, play a role as potential nodes in generation of the relatively uncommon 36 topology. The coordinated DMF unit is disordered around the threefold axis.

  1. Synthesis, structure, and properties of supramolecular charge-transfer complexes between bis(18-crown-6)stilbene and ammonioalkyl derivatives of 4,4'-bipyridine and 2,7-diazapyrene.

    Science.gov (United States)

    Vedernikov, Artem I; Ushakov, Evgeny N; Efremova, Asya A; Kuz'mina, Lyudmila G; Moiseeva, Anna A; Lobova, Natalia A; Churakov, Andrei V; Strelenko, Yuri A; Alfimov, Michael V; Howard, Judith A K; Gromov, Sergey P

    2011-08-19

    4,4'-Bipyridine and 2,7-diazapyrene derivatives (A) having two ammonioalkyl N-substituents were synthesized. The complex formation of these compounds with bis(18-crown-6)stilbene (D) was studied by spectrophotometry, cyclic voltammetry, (1)H NMR spectroscopy, and X-ray diffraction analysis. In MeCN, π-donor D and π-acceptors A form supramolecular 1:1 (D·A) and 2:1 (D·A·D) charge-transfer complexes. The D·A complexes have a pseudocyclic structure as a result of ditopic binding of the ammonium groups to the crown-ether fragments. The better the geometric matching between the components, the higher the stability of the D·A complexes (log K up to 9.39). A key driving force of the D·A·D complex formation is the excessive steric strain in the precursor D·A complexes. The pseudocyclic D·A complexes involving the ammoniopropyl derivative of 4,4'-bipyridine were obtained as single crystals. Crystallization of the related ammonioethyl derivative was accompanied by transition of the D·A complexes to a structure of the (D·A)(m) coordination polymer type.

  2. cis-Stilbene and (1 alpha,2 beta,3 alpha)-(2-ethenyl-3-methoxycyclopropyl)benzene as mechanistic probes in the Mn(III)(salen)-catalyzed epoxidation: influence of the oxygen source and the counterion on the diastereoselectivity of the competitive concerted and radical-type oxygen transfer.

    Science.gov (United States)

    Adam, Waldemar; Roschmann, Konrad J; Saha-Möller, Chantu R; Seebach, Dieter

    2002-05-08

    cis-Stilbene (1) has been epoxidized by a set of diverse oxygen donors [OxD], catalyzed by the Mn(III)(salen)X complexes 3 (X = Cl, PF(6)), to afford a mixture of cis- and trans-epoxides 2. The cis/trans ratios range from 29:71 (extensive isomerization) to 92:8, which depends both on the oxygen source [OxD] and on the counterion X of the catalyst. When (1 alpha,2 beta,3 alpha)-(2-ethenyl-3-methoxycyclopropyl)-benzene (4) is used as substrate, a mechanistic probe which differentiates between radical and cationic intermediates, no cationic ring-opening products are found in this epoxidation reaction; thus, isomerized epoxide product arises from intermediary radicals. The dependence of the diastereoselectivity on the oxygen source is rationalized in terms of a bifurcation step in the catalytic cycle, in which concerted Lewis-acid-activated oxygen transfer competes with stepwise epoxidation by the established Mn(V)(oxo) species. The experimental counterion effect is attributed to the computationally assessed ligand-dependent reaction profiles and stereoselectivities of the singlet, triplet, and quintet spin states available to the manganese species.

  3. Production of medically valuable stilbenes and emodin in knotweed

    Czech Academy of Sciences Publication Activity Database

    Frantík, Tomáš; Kovářová, M.; Koblihová, Helena; Bartůňková, Kristýna; Nývltová, Z.; Vosátka, Miroslav

    2013-01-01

    Roč. 50, oct.2013 (2013), s. 237-243 ISSN 0926-6690 R&D Projects: GA MŠk 1M0571 Institutional support: RVO:67985939 Keywords : knokweed * resveratrol * emodin Subject RIV: EF - Botanics Impact factor: 3.208, year: 2013

  4. [Homoisoflavanones and stilbenes from fresh bulb of Scilla scilloides].

    Science.gov (United States)

    Wang, Yan-Min; Fan, Meng-Yang; Li, Juan; Wang, Zhi-Min; Gao, Hui-Min

    2014-10-01

    Mian-Zao-Er was collected from the bulbs of Scilla scilloides (Lindl. ) Druce, belonging to the Hyacinthaceae family. 17 compounds were obtained using various column chromatographies on macroporus resin (HPD100), silica gel, Sephadex LH-20 and ODS, as well as semi-preparative HPLC. Their structures were elucidated on the basis of physicochemical properties and spectral data as 2-hydroxy-7-methoxyscillascillin (1), scillascillin (2), 5,7-dihydroxy-3',4'-dimethoxyspiro 2H-1-benzopyran-7'-bicyclo[4.2.0 ] octa [1,3,5 ] -trien } -4-one (3), socialinone (4), 4-methylresveratrol (5), (E)-resveratrol (6), scillavoneA (7), 3,9-di- hydroeucomnalin (8), 3-(3-hydroxy-4-methoxybenzyl) -5,7-dihydroxychroman-4-one (9), (3R)-5,7,3'-trihydroxy-4'-methoxyspiro (2H-1-benzopyran-7'-bicyclo[4, 2, 0] octa [1, 3, 5]-trien} -4-one (10), scillabene A (11), 2-hydroxyscillascillin (12), 3-(4-hydroxybenzyl) -5,7-dihydroxychroman-4-one (13), 3-( 4-hydroxybenzylidene) -5, 7-dihydroxychroman-4-one (14), 3-( 4-hydroxybenzyl) -5-hydroxy-7,8-dimethoxychroman-4-one (15), 3-(4-hydroxybenzyl) -5-hydroxy-6, 7-dimethoxychroman-4-one (16), and 3-(4-hydroxybenzyl)-5,8-hydroxy-7-methoxychroman-4-one (17). Among them, compounds 3, 4, 6, 9, 13 and 15-17 were isolated from this plant for the first time.

  5. 76 FR 23554 - Certain Stilbenic Optical Brightening Agents From the People's Republic of China and Taiwan...

    Science.gov (United States)

    2011-04-27

    ... (ii) determine industry support using a statistically valid sampling method if there is a large number.... Although the HTSUS subheadings are provided for convenience and customs purposes, the written description...

  6. Different effect of two synthetic coumarin-stilbene hybrid compounds on phagocyte activity

    Czech Academy of Sciences Publication Activity Database

    Drábiková, K.; Perečko, T.; Nosál, R.; Račková, L.; Ambrožová, Gabriela; Lojek, Antonín; Šmidrkal, J.; Harmatha, Juraj; Jančinová, V.

    2010-01-01

    Roč. 31, č. 2 (2010), s. 73-78 ISSN 0172-780X R&D Projects: GA MŠk(CZ) MEB0810013 Grant - others:GA ČR(CZ) GA203/07/1227 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : reactive species * phagocytosis * coumarin Subject RIV: BO - Biophysics Impact factor: 1.621, year: 2010

  7. 77 FR 17436 - Certain Stilbenic Optical Brightening Agents From the People's Republic of China: Final...

    Science.gov (United States)

    2012-03-26

    ... Brightening Agents From the People's Republic of China: Final Determination of Sales at Less Than Fair Value...'') published its preliminary determination of sales at less than fair value (``LTFV'') in the antidumping... People's Republic of China: Preliminary Determination of Sales at Less Than Fair Value and Postponement...

  8. 77 FR 27423 - Certain Stilbenic Optical Brightening Agents From the People's Republic of China: Amended Final...

    Science.gov (United States)

    2012-05-10

    ... Department published the final determination of sales at less than fair value in the antidumping duty... Brightening Agents from the People's Republic of China: Final Determination of Sales at Less Than Fair Value... Determination of Sales at Less Than Fair Value and Postponement of Final Determination, 76 FR 68148 (November 3...

  9. 76 FR 49443 - Certain Stilbenic Optical Brightening Agents From the People's Republic of China, and Taiwan...

    Science.gov (United States)

    2011-08-10

    ... Optical Brightening Agents From the People's Republic of China, and Taiwan: Postponement of Preliminary... 5; Maisha Cryor at (202) 482-5831 or Shaun Higgins at (202) 482-0679 (People's Republic of China.... Department of Commerce, 14th Street and Constitution Avenue, NW., Washington, DC 20230. SUPPLEMENTARY...

  10. 77 FR 17027 - Certain Stilbenic Optical Brightening Agents From Taiwan: Final Determination of Sales at Less...

    Science.gov (United States)

    2012-03-23

    ... provided for convenience and customs purposes, the written description of the merchandise is dispositive... comparison market, in the Preliminary Determination we determined selling expenses and profit under section... to derive the constructed value profit. We have also excluded movement expenses and direct-selling...

  11. Oxyresveratrol, a Stilbene Compound from Morus alba L. Twig Extract Active Against Trichophyton rubrum.

    Science.gov (United States)

    Lu, Hai-Peng; Jia, Ya-Nan; Peng, Ya-Lin; Yu, Yan; Sun, Si-Long; Yue, Meng-Ting; Pan, Min-Hui; Zeng, Ling-Shu; Xu, Li

    2017-12-01

    Morus alba L. (mulberry) twig is known to have an inhibitory effect on pathogens in traditional Chinese medicine. In the present study, the dermophytic fungus, Trichophyton rubrum, was used to evaluate the inhibitory effect of total M. alba twig extract and extracts obtained using solvents with different polarities by the method of 96-well MTT colorimetry. The main active substance was isolated and identified by tracking its activity. In addition, the inhibitory effects of active extracts and a single active substance were investigated in combination with miconazole nitrate. Our data indicated that ethyl acetate extracts of mulberry twig (TEE) exhibited a desired inhibitory activity on T. rubrum with the minimum inhibitory concentration (MIC) of 1.000 mg/mL. With activity tracking, the main substance showing antimicrobial activity was oxyresveratrol (OXY), which was isolated from TEE. Its MIC for inhibiting the growth of T. rubrum was 0.500 mg/mL. The combined use of miconazole nitrate and OXY showed a synergistic inhibitory effect, as shown by a significant decrease in the MIC of both components. Based on the OXY content in TEE, the contribution rate of OXY to the inhibitory effect of TEE on T. rubrum was 80.52%, so it was determined to be the main antimicrobial substance in M. alba twig. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  12. 77 FR 27419 - Certain Stilbenic Optical Brightening Agents From Taiwan: Amended Final Determination of Sales at...

    Science.gov (United States)

    2012-05-10

    ... are materially injuring a U.S. industry, all unliquidated entries of such merchandise from Taiwan... Brightening Agents From Taiwan: Amended Final Determination of Sales at Less Than Fair Value and Antidumping... Taiwan. In addition, the Department is amending its final determination to correct a ministerial error...

  13. 76 FR 68148 - Certain Stilbenic Optical Brightening Agents From the People's Republic of China: Preliminary...

    Science.gov (United States)

    2011-11-03

    ...\\ \\58\\ See id. We valued international freight using data obtained from the Descartes Carrier Rate Retrieval Database (``Descartes''), which can be accessed via http://descartes.com/ .\\59\\ The Descartes..., the Descartes data reflect rates for multiple carriers, report rates on a daily basis, the price data...

  14. 76 FR 68154 - Certain Stilbenic Optical Brightening Agents From Taiwan: Preliminary Determination of Sales at...

    Science.gov (United States)

    2011-11-03

    ... Retail Carrier Bags From Taiwan: Preliminary Determination of Sales at Less Than Fair Value and... did not appear to experience significant changes in the cost of manufacturing during the period of... by exporters or producers ``in connection with the sale, for consumption in the foreign country, of...

  15. Photo-isomerization induced rapid photo-degradation of optical nonlinearity in cyano substituted stilbene derivative doped poled polymer

    International Nuclear Information System (INIS)

    Yan Jieyun; Liu Liying; Ji Liyong; Ye Mingxin; Xu Lei; Wang Wencheng

    2004-01-01

    We found that, although alpha'-cyano-4'-nitro-4-N, N-dimethylaminostilbene has larger hyperpolarizability than that of conventional 4'-N, N-dimethylamino-nitrostilbene, the addition of the cyano group makes it much more easy to photo-isomerize, thus destroying the molecular ordering in poled chromophore doped polymers. Experimental evidence was obtained by monitoring the second-harmonic generation intensity, UV-Vis absorption spectrum, and FTIR spectrum. The photo-isomerization reaction process was monitored by optical pump induced absorption anisotropy measurement. Comparisons with the behaviour of a azobenzene dye are also made

  16. Pilot trials with a fluorescent whitening agent of the bis(triazoly) stilbene-disulfonic acid type in golden orfes.

    Science.gov (United States)

    Hamburger, B; Maul, W; Patzschke, K; Theidel, H; Wegner, L A

    1975-01-01

    Golden orfes were examined for uptake, distribution, and elimination of radioactivity administered in the form of a 14C-labelled fluorescent whitening agent (FWA) of the bis(triazolyl)stilbenedisulfonic acid type. Results of these studies are given below. Pilot trials using FWA concentrations of 10 and 100 ppb and a population density of 1 fish per liter show that an equilibrium between uptake and elimination of the FWA develops in the animals within a period of one week; i.e., the incorporated traces of the FWA are not irreversibly bound. The radioactivity is mainly located in the gall bladder and in the intestinal contents, as well as in the liver, throat, and gills. The muscular system (filet) is virtually free from activity. Approximately 1-2% of the FWA amount administered per animal (corresponding to the concentration factors of 7-14) can be temporarily detected in the fish. Radioactivity is eliminated comparatively quickly. Two days following the transfer of the fish into water free from FWA a concentration factor as low as 1 is reached, i.e. from this time the FWA concentration in the animals decreases to less than 10 resp. 100 ppb.

  17. Induced changes in phenolic acids and stilbenes in embryogenic cell cultures of Norway spruce by culture filtrate of Ascocalyx abietina

    Czech Academy of Sciences Publication Activity Database

    Cvikrová, Milena; Malá, J.; Hrubcová, Marie; Eder, Josef; Foretová, Soňa

    2008-01-01

    Roč. 115, č. 2 (2008), s. 57-62 ISSN 1861-3829 R&D Projects: GA ČR GA206/04/0999 Institutional research plan: CEZ:AV0Z50380511 Keywords : astringin * isorhapontin * Picea abies Subject RIV: GK - Forestry Impact factor: 0.566, year: 2008 www.jpdp-online.com/QUlEPTYwMjI0NSZNSUQ9NTE4MDImVElYPTAmQVJPT1Q9NjUwMjMmVEVNUF9NQUlOPUpQRFBfUG9ydHJhaXQuaHRt.html?UID=466CB39FC0B29D76D720FE29DE06FB0322678558FE1AD824

  18. 76 FR 72719 - Certain Stilbenic Optical Brightening Agents From China and Taiwan; Scheduling of the Final Phase...

    Science.gov (United States)

    2011-11-25

    ... Optical Brightening Agents From China and Taiwan; Scheduling of the Final Phase of Antidumping... whether an industry in the United States is materially injured or threatened with material injury, or the establishment of an industry in the United States is materially retarded, by reason of less-than-fair-value...

  19. Epoxide hydrolase-catalyzed enantioselective conversion of trans-stilbene oxide: Insights into the reaction mechanism from steady-state and pre-steady-state enzyme kinetics

    Czech Academy of Sciences Publication Activity Database

    Archelas, A.; Zhao, W.; Faure, B.; Iacazio, G.; Kotík, Michael

    2016-01-01

    Roč. 591, FEB 2016 (2016), s. 66-75 ISSN 0003-9861 Institutional support: RVO:61388971 Keywords : Catalytic mechanism * Epoxide hydrolase * Electrophilic catalysis Subject RIV: CE - Biochemistry Impact factor: 3.165, year: 2016

  20. Changes in phenolic acids and stilbenes induced in embryogenic cell cultures of Norway spruce by two fractions of Sirococcus strobilinus mycelia

    Czech Academy of Sciences Publication Activity Database

    Malá, J.; Hrubcová, Marie; Máchová, P.; Cvrčková, H.; Martincová, Olga; Cvikrová, Milena

    2011-01-01

    Roč. 57, č. 1 (2011), s. 1-7 ISSN 1212-4834 R&D Projects: GA MZe QH82303 Institutional research plan: CEZ:AV0Z50380511 Keywords : defence response * Norway spruce * phenylpropanoids Subject RIV: GK - Forestry http://www.agriculturejournals.cz/publicFiles/33920.pdf

  1. Binuclear new complexes of dioxouranium (VI) and thorium (IV) with some Schiff bases derived from 4,4'-diamino stilbene-2,2'-disulphonic acid-vanillin and O-vanillin

    International Nuclear Information System (INIS)

    Pujar, M.A.; Siddappa, K.

    1992-01-01

    Dioxouranium (VI) and thorium (IV) form 1:1 (metal:ligand) complexes with some Schiff bases. The complexes have been characterized through elemental analyses, conductance, UV-Visible, IR, NMR, TG data and magnetic susceptibility measurements. They are found to be dimeric with hexa or octa-coordinated arrangement around metal ion moiety. The Fsub(U-O) (mdyn A o ) and the length R UO (A o ) of U-O bond are calculated from the IR data. (author). 8 refs., 1 tab

  2. Aerobic Epoxidation of Olefins Catalyzed by the Cobalt‐Based Metal–Organic Framework STA‐12(Co)

    DEFF Research Database (Denmark)

    Beier, Matthias Josef; Kleist, Wolfgang; Wharmby, Michael T.

    2012-01-01

    , (E)‐stilbene was converted with high selectivities between 80 and 90 %. Leaching of Co was low and the reaction was found to proceed mainly heterogeneously. The catalyst was reusable with only a small loss of activity. The catalytic epoxidation of stilbene with the MOF featured an induction period...

  3. Safeguards Technology Development Program 1st Quarter FY 2018 Report

    Energy Technology Data Exchange (ETDEWEB)

    Prasad, Manoj K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2018-01-10

    LLNL will evaluate the performance of a stilbene-based scintillation detector array for IAEA neutron multiplicity counting (NMC) applications. This effort will combine newly developed modeling methodologies and recently acquired high-efficiency stilbene detector units to quantitatively compare the prototype system performance with the conventional He-3 counters and liquid scintillator alternatives.

  4. FXR agonist activity of conformationally constrained analogs of GW 4064.

    Science.gov (United States)

    Akwabi-Ameyaw, Adwoa; Bass, Jonathan Y; Caldwell, Richard D; Caravella, Justin A; Chen, Lihong; Creech, Katrina L; Deaton, David N; Madauss, Kevin P; Marr, Harry B; McFadyen, Robert B; Miller, Aaron B; Navas, Frank; Parks, Derek J; Spearing, Paul K; Todd, Dan; Williams, Shawn P; Bruce Wisely, G

    2009-08-15

    Two series of conformationally constrained analogs of the FXR agonist GW 4064 1 were prepared. Replacement of the metabolically labile stilbene with either benzothiophene or naphthalene rings led to the identification of potent full agonists 2a and 2g.

  5. Tree nut phytochemicals: composition, antioxidant capacity, bioactivity, impact factors. A systematic review of almonds, Brazils, cashews, hazelnuts, macadamias, pecans, pine nuts, pistachios and walnuts

    Science.gov (United States)

    Tree nuts contain an array of phytochemicals including carotenoids, phenolic acids, phytosterols and polyphenolic compounds such as flavonoids, proanthocyanidins (PAC) and stilbenes, all of which are included in nutrient databases, as well as phytates, sphingolipids, alkylphenols and lignans, which ...

  6. Estrogenic activity of constituents from the rhizomes of Rheum undulatum Linné.

    Science.gov (United States)

    Park, SeonJu; Kim, Yun Na; Kwak, Hee Jae; Jeong, Eun Ju; Kim, Seung Hyun

    2018-02-15

    Stilbenes have been reported to be phytoestrogen compounds owing to its structural similarity to the estrogenic agent diethylstilbestrol. To find new stilbene-derivative phytoestrogens, isolation of stilbene-rich R. undulatum was performed and led to identify six new compounds (1-5 and 28), one newly determined absolute configurations compound (27) together with 21 previously reported compounds (6-26). The structures of compounds were determined on the basis of extensive spectroscopic methods including 1D and 2D NMR and CD spectra data. All the isolated compounds were tested for their estrogenic activities in HepG2 cells transiently transfected with ERα, ERβ and ERE-reporter plasmid. Among them, stilbene-derivatives, piceatannol 3'-O-β-d-xylopyranoside (12), cis-rhaponticin (16) and rhapontigenin 3'-O-β-d-glucopyranoside (17), showed the more potent binding affinity for estrogen receptors than 17β-estrodiol. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Biosynthesis of the major tetrahydroxystilbenes in spruce, astringin and isorhapontin, proceeds via resveratrol and is enhanced by fungal infection.

    Science.gov (United States)

    Hammerbacher, Almuth; Ralph, Steven G; Bohlmann, Joerg; Fenning, Trevor M; Gershenzon, Jonathan; Schmidt, Axel

    2011-10-01

    Stilbenes are dibenzyl polyphenolic compounds produced in several unrelated plant families that appear to protect against various biotic and abiotic stresses. Stilbene biosynthesis has been well described in economically important plants, such as grape (Vitis vinifera), peanut (Arachis hypogaea), and pine (Pinus species). However, very little is known about the biosynthesis and ecological role of stilbenes in spruce (Picea), an important gymnosperm tree genus in temperate and boreal forests. To investigate the biosynthesis of stilbenes in spruce, we identified two similar stilbene synthase (STS) genes in Norway spruce (Picea abies), PaSTS1 and PaSTS2, which had orthologs with high sequence identity in sitka (Picea sitchensis) and white (Picea glauca) spruce. Despite the conservation of STS sequences in these three spruce species, they differed substantially from angiosperm STSs. Several types of in vitro and in vivo assays revealed that the P. abies STSs catalyze the condensation of p-coumaroyl-coenzyme A and three molecules of malonyl-coenzyme A to yield the trihydroxystilbene resveratrol but do not directly form the dominant spruce stilbenes, which are tetrahydroxylated. However, in transgenic Norway spruce overexpressing PaSTS1, significantly higher amounts of the tetrahydroxystilbene glycosides, astringin and isorhapontin, were produced. This result suggests that the first step of stilbene biosynthesis in spruce is the formation of resveratrol, which is further modified by hydroxylation, O-methylation, and O-glucosylation to yield astringin and isorhapontin. Inoculating spruce with fungal mycelium increased STS transcript abundance and tetrahydroxystilbene glycoside production. Extracts from STS-overexpressing lines significantly inhibited fungal growth in vitro compared with extracts from control lines, suggesting that spruce stilbenes have a role in antifungal defense.

  8. Variability in the Content of Trans-Resveratrol, Trans-ε-Viniferin and R2-Viniferin in Grape Cane of Seven Vitis vinifera L. Varieties during a Three-Year Study.

    Science.gov (United States)

    Tříska, Jan; Vrchotová, Naděžda; Balík, Josef; Soural, Ivo; Sotolář, Radek

    2017-06-03

    Grape canes are a waste product from viticulture that show potential as an industrially extractable source of stilbenes, which are valuable for medical and other purposes. In this work, grape canes collected in three consecutive years (2014-2016) at six different places in South Moravia, Czech Republic were extracted, and the contents of trans -resveratrol, trans -ε-viniferin, and r2-viniferin were determined by high-performance liquid chromatography. The study included three blue grape varieties of Vitis vinifera L. (Cabernet Moravia, Blaufränkisch, and Piwi variety Laurot) and four white grape varieties (Chardonnay, Green Veltliner, Piwi variety Hibernal, and Piwi variety Malverina). From the viewpoint of producing extracts with high stilbenes content, the Hibernal variety is clearly the best. The mean amounts of the stilbenes for this variety at all localities and for all three years were 4.99 g/kg for trans -resveratrol, 3.24 g/kg for trans -ε-viniferin, and 1.73 g/kg for r2-viniferin. The influence of vintage, locality, and variety on the amounts of stilbenes was studied using PCA analysis. In contrast to expectations, there was no strong impact of locality on stilbenes content. The differences were varietal for most varieties, regardless of the area of cultivation. Laurot and Hibernal varieties did differ significantly in that respect, however, as they exhibited clear dependence on location.

  9. The O-methyltransferase PMT2 mediates methylation of pinosylvin in Scots pine.

    Science.gov (United States)

    Paasela, Tanja; Lim, Kean-Jin; Pietiäinen, Milla; Teeri, Teemu H

    2017-06-01

    Heartwood extractives are important determinants of the natural durability of pine heartwood. The most important phenolic compounds affecting durability are the stilbenes pinosylvin and its monomethylether, which in addition have important functions as phytoalexins in active defense. A substantial portion of the synthesized pinosylvin is 3-methoxylated but the O-methyltransferase responsible for this modification has not been correctly identified. We studied the expression of the stilbene pathway during heartwood development as well as in response to wounding of xylem and UV-C treatment of needles. We isolated and enzymatically characterized a novel O-methyltransferase, PMT2. The methylated product was verified as pinosylvin monomethylether using ultra performance liquid chromatography-tandem mass spectrometry and high performance liquid chromatography analyses. The PMT2 enzyme was highly specific for stilbenes as substrate, in contrast to caffeoyl-CoA O-methyltransferase (CCoAOMT) and PMT1 that were multifunctional. Expression profile and multifunctional activity of CCoAOMT suggest that it might have additional roles outside lignin biosynthesis. PMT1 is not involved in the stilbene pathway and its biological function remains an open question. We isolated a new specific O-methyltransferase responsible for 3-methoxylation of pinosylvin. Expression of PMT2 closely follows stilbene biosynthesis during developmental and stress induction. We propose that PMT2 is responsible for pinosylvin methylation in Scots pine (Pinus sylvestris), instead of the previously characterized methyltransferase, PMT1. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  10. The use of dendrimers as high-performance shells for round-trip energy transfer: efficient trans-cis photoisomerization from an excited triplet state produced within a dendrimer shell.

    Science.gov (United States)

    Miura, Yousuke; Momotake, Atsuya; Takeuchi, Keiichirou; Arai, Tatsuo

    2011-01-01

    A series of stilbene-cored poly(benzyl ether) dendrimers with benzophenone peripheries were synthesized and their photophysical and photochemical properties were studied. Fluorescence studies revealed that singlet-singlet energy transfer (SSET) from the stilbene core to the benzophenone units took place efficiently in dendrimers of all generations. Similarly, phosphorescence and time-resolved spectroscopic measurements indicated efficient triplet-triplet energy transfer (TTET) from the benzophenone periphery to the stilbene core. Upon excitation at 310 nm, the stilbene core isomerizes via an energy round trip within the dendrimer shell. The quantum yields for the energy round trip (Φ(ERT)), defined as the product of the quantum yields of SSET, intersystem crossing, and TTET (Φ(ERT) = Φ(SS)Φ(isc)Φ(TT)), were extremely high for all generations--99%, 95% and 94% for G1, G2, and G3, respectively--which means that the excitation energy of the dendrimer core was transferred to the dendrimer periphery and back to the core almost quantitatively. The quantum yield for photoisomerization of G1-G3 via an energy round trip was higher than for other stilbene-cored dendrimers, which mainly isomerize from the excited singlet state. Photostability in the dendrimers was also demonstrated and discussed.

  11. Synthesis and characterization of tunable coumarin- linked glasses as new class of organic/inorganic phosphors

    Energy Technology Data Exchange (ETDEWEB)

    Luridiana, Alberto; Pretta, Gianluca; Secci, Francesco; Frongia, Angelo [Dipartimento di Scienze Chimiche e Geologiche, Università degli Studi di Cagliari, Complesso universitario di Monserrato, SS 554, bivio per Sestu, Monserrato (Canada) (Italy); Chiriu, Daniele; Carbonaro, Carlo Maria; Corpino, Riccardo [Dipartimento di Fisica, Università degli Studi di Cagliari, Complesso universitario di Monserrato, SS 554, bivio per Sestu, Monserrato (Canada) (Italy); Ricci, Pier Carlo, E-mail: carlo.ricci@dsf.unica.it [Dipartimento di Fisica, Universitá degli Studi di Cagliari, S.P. Monserrato-Sestu Km 0,700, 09042 Monserrato (Canada) (Italy)

    2014-10-21

    It is well known that stilbene with a trans conformation is highly fluorescent. From the viewpoint of molecular structure, coumarins bear a carbon-carbon double bond which is fixed as trans conformation as in trans-stilbene through a lactone structure. This can help to avoid the trans-cis transformation of the double bond under ultraviolet (UV) irradiation as observed in stilbene compounds and results in strong fluorescence and high fluorescence quantum yield and photostability in most of coumarin derivatives. Herein we report some preliminary results about the synthesis and spectroscopic characterization of tunable coumarins and the development of a new linkage protocol for the obtainment of monolayer coumarin-covalently linked glasses. The resulting organic/inorganic coumarin/silica based Self-Assembled Monolayer (SMA) film is proposed as new phosphors for the substituting of critical raw materials, like rare earths, in photonics applications.

  12. Neutron spectrometry with organic scintillation detector; Espectrometria de nuetrones con cristales de centelleo organicos

    Energy Technology Data Exchange (ETDEWEB)

    Butragueno Casdo, J L

    1972-07-01

    This work describes a fast neutron spectrometer using a stilbene crystal as head detector with pulse shape discrimination (P.S.D.) to reject gamma background. Tre experimental procedure involves the P.S.D., the measurements to calibrate the spectrometer and the corrections for several factors, mainly the non-linear response of the stilbene. Results of the measurements with the reaction D{sup 2}(d,n)He{sup 3}, and with an Am-Be neutron source are presented. It is also presented the measurement of the spectrum of the fast reactor CCRAl-1. (Author) 17 refs.

  13. Fast neutron spectrometer with pulse shape discrimination

    International Nuclear Information System (INIS)

    Verbitsky, S.S.

    1978-01-01

    A fast neutron spectrometer with a stilbene single crystal designed to operate at high pulsed count rate has been described. Making use of identification and rejection of events, accompanied by pile-up, allowed to increase permissible count rates by an order of magnitude. The results of energy dependence of signal amplitude and shape relative anisotropy in stilbene in the range 4-10 and 2-8 MeV respectively have been presented. Taking into account anisotropy of the detector-scintillation properties allowed to improve particle discrimination. (Auth.)

  14. Graphene oxide catalyzed cis-trans isomerization of azobenzene

    Directory of Open Access Journals (Sweden)

    Dongha Shin

    2014-09-01

    Full Text Available We report the fast cis-trans isomerization of an amine-substituted azobenzene catalyzed by graphene oxide (GO, where the amine functionality facilitates the charge transfer from azobenzene to graphene oxide in contrast to non-substituted azobenzene. This catalytic effect was not observed in stilbene analogues, which strongly supports the existence of different isomerization pathways between azobenzene and stilbene. The graphene oxide catalyzed isomerization is expected to be useful as a new photoisomerization based sensing platform complementary to GO-based fluorescence quenching methods.

  15. Neutron spectrometry with organic scintillation detector

    International Nuclear Information System (INIS)

    Butragueno Casado, J. L.

    1972-01-01

    This work describes a fast neutron spectrometer using a stilbene crystal as head detector with pulse shape discrimination (P.S.D.) to reject gamma background. Tre experimental procedure involves the P.S.D., the measurements to calibrate the spectrometer and the corrections for several factors, mainly the non-linear response of the stilbene. Results of the measurements with the reaction D 2 (d,n)He 3 , and with an Am-Be neutron source are presented. It is also presented the measurement of the spectrum of the fast reactor CCRAl-1. (Author) 17 refs

  16. Measurements of angular and energy distributions of gamma-rays resulting from neutron interactions in shielding barriers

    International Nuclear Information System (INIS)

    Makarious, A.S.; Maayouf, R.M.A.; Megahid, R.

    1978-01-01

    Measurements of both angular and energy distributions of secondary gamma resulting from interactions of neutrons emerging from one of the ET-RR-1 reactor beam holes, in barriers from iron, lead and water are reported. The measurements were carried out, both with a bare neutron beam and with the beam being transmitted through a B4C. Filter, using a stilbene crystal gamma spectrometer. The spectrometer applies discrimination between neutrons and gammas according to the difference in decay times of the scintillations produced by them in stilbene. The described angular distributions resulted from measurements made at different angles of neutron incidence and with three different thicknesses of each sample

  17. A versatile route to benzodiazocine and spiropyran derivatives ...

    Indian Academy of Sciences (India)

    The photolytic reaction with trans-stilbene resulted in the exclusive formation of spiro{2 ,5 ,6 -triphenyl-2H-pyran-. 4 ,3}-benzo[b]thiophene-2-one derivatives. Theoretical calculations have been performed to study the mecha- nism and stereoselectivity of products. Good yield and broad scope of usable substrates of industrial ...

  18. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    The photolytic reaction with trans-stilbene resulted in the exclusive formation of spiro{2',5',6'-triphenyl-2H-pyran-4',3}-benzo[b]thiophene-2-one derivatives. Theoretical calculations have been performed to study the mechanism and stereoselectivity of products. Good yield and broad scope of usable substrates of industrial ...

  19. Effects of diterpene acids on components of a conifer bark beetle-fungal interaction : tolerance by Ips pini and sensitivity by its associate Ophiostoma ips

    Science.gov (United States)

    Brian J. Kopper; Barbara L. Illman; Philip J. Kersten; Kier D. Klepzig; Kenneth F. Raffa

    2005-01-01

    Conifer resin and phloem tissue contain several phytochemical groups, composed primarily of monoterpenes, diterpene acids, and stilbene phenolics. The effects of monoterpenes and phenolics on stem-colonizing bark beetles and their associated microorganisms have been studied to some extent, but the roles of diterpene acids are largely unknown. Diterpene acids are known...

  20. Effects of diterpene acids on components of a conifer bark beetle–fungal interaction: tolerance by Ips pini and sensitivity by its associate Ophiostoma ips

    Science.gov (United States)

    Brian J. Kopper; Barbara L. Illman; Philip J. Kersten; Kier D. Klepzig; Kenneth F. Raffa

    2005-01-01

    Conifer resin and phloem tissue contain several phytochemical groups,composed primarily of monoterpenes,diterpene acids, and stilbene phenolics. The effects of monoterpenes and phenolics on stem-colonizing bark beetles and their associated microorganisms have been studied to some extent, but the roles of diterpene acids are largely unknown. Diterpene acids are known to...

  1. Partitioning of resveratrol between pentane and DMSO

    DEFF Research Database (Denmark)

    Shen, Chen; Stein, Paul C.; Klösgen-Buchkremer, Beate Maria

    2015-01-01

    Partitioning of trans-3,5,4′-trihydroxy-stilbene (resveratrol) between n-pentane and DMSO was investigated as a contribution to understand the interaction between resveratrol and biomembranes. In order to determine the partition coefficient P* of resveratrol between pentane and DMSO, resveratrol ...

  2. Uji Aktivitas Antioksidan Ekstrak Air dan Ekstrak Etanol Daun Kelor (Moringa Oleifera LAM)

    OpenAIRE

    Rizkayanti, Rizkayanti; Diah, Anang Wahid M; Jura, Minarni Rama

    2017-01-01

    Moringa (moringa oleifera Lam) leaves contains many molecules as inhibitors for free radicals such as phenolic compounds (phenolic acids, flavonoids, quinones, coumarins, lignans, stilbenes, tannins), nitrogen compounds (alkaloids, amines, betalain), vitamins, terpenoids (including carotenoids), and several other endogenous metabolites as antioxidants. This study aimed to determine the antioxidant potency of water and ethanol extracts of moringa (moringa oleifera Lam) leave obtained by macera...

  3. Resveratrol and pterostilbene epigenetically restore PTEN expression by targeting OncomiRs of the miR-17 family in prostate cancer

    Science.gov (United States)

    In recent years, not only has the role of miRNAs in cancer become increasingly clear but also their utilization as potential biomarkers and therapeutic targets has also gained ground. Although the importance of dietary stilbenes such as resveratrol and pterostilbene as anti-cancer agents is well rec...

  4. Antimicrobial Activity of Resveratrol Analogues

    Directory of Open Access Journals (Sweden)

    Malik Chalal

    2014-06-01

    Full Text Available Stilbenes, especially resveratrol and its derivatives, have become famous for their positive effects on a wide range of medical disorders, as indicated by a huge number of published studies. A less investigated area of research is their antimicrobial properties. A series of 13 trans-resveratrol analogues was synthesized via Wittig or Heck reactions, and their antimicrobial activity assessed on two different grapevine pathogens responsible for severe diseases in the vineyard. The entire series, together with resveratrol, was first evaluated on the zoospore mobility and sporulation level of Plasmopara viticola (the oomycete responsible for downy mildew. Stilbenes displayed a spectrum of activity ranging from low to high. Six of them, including the most active ones, were subsequently tested on the development of Botrytis cinerea (fungus responsible for grey mold. The results obtained allowed us to identify the most active stilbenes against both grapevine pathogens, to compare the antimicrobial activity of the evaluated series of stilbenes, and to discuss the relationship between their chemical structure (number and position of methoxy and hydroxy groups and antimicrobial activity.

  5. Conformationally constrained farnesoid X receptor (FXR) agonists: Naphthoic acid-based analogs of GW 4064.

    Science.gov (United States)

    Akwabi-Ameyaw, Adwoa; Bass, Jonathan Y; Caldwell, Richard D; Caravella, Justin A; Chen, Lihong; Creech, Katrina L; Deaton, David N; Jones, Stacey A; Kaldor, Istvan; Liu, Yaping; Madauss, Kevin P; Marr, Harry B; McFadyen, Robert B; Miller, Aaron B; Navas, Frank; Parks, Derek J; Spearing, Paul K; Todd, Dan; Williams, Shawn P; Wisely, G Bruce

    2008-08-01

    Starting from the known FXR agonist GW 4064 1a, a series of stilbene replacements were prepared. The 6-substituted 1-naphthoic acid 1b was an equipotent FXR agonist with improved developability parameters relative to 1a. Analog 1b also reduced the severity of cholestasis in the ANIT acute cholestatic rat model.

  6. Mississippi CaP HBCU Undergraduate Research Training Program

    Science.gov (United States)

    2015-09-01

    risk for African-Americans, obesity and medical distrust contribute to high rates of PCa in Mississippi. The scarcity of minority physicians and...Blue Fighting Prostate Cancer in the Mississippi Delta”. Anait S. Levenson, M.D., Ph.D., UMMC-CI, “Novel epigenetic mechanisms of dietary stilbenes

  7. RAMBAs for Breast Cancer Prevention and Treatment

    Science.gov (United States)

    2009-01-01

    have shown promise for this indication. Recently, the flavonoid kaempferol (Fig. 10a) was shown to inhibit agonist binding to AhR, as well as agonist...that have been identified as potent inhibitors come from diverse chem- ical families including synthetic aromatics, coumarins, flavonoids , and stilbenes

  8. The Oxygenase CAO-1 of Neurospora crassa Is a Resveratrol Cleavage Enzyme

    KAUST Repository

    Diaz-Sanchez, V.; F. Estrada, A.; Limon, M. C.; Al-Babili, Salim; Avalos, J.

    2013-01-01

    The genome of the ascomycete Neurospora crassa encodes CAO-1 and CAO-2, two members of the carotenoid cleavage oxygenase family that target double bonds in different substrates. Previous studies demonstrated the role of CAO-2 in cleaving the C40 carotene torulene, a key step in the synthesis of the C35 apocarotenoid pigment neurosporaxanthin. In this work, we investigated the activity of CAO-1, assuming that it may provide retinal, the chromophore of the NOP-1 rhodopsin, by cleaving β-carotene. For this purpose, we tested CAO-1 activity with carotenoid substrates that were, however, not converted. In contrast and consistent with its sequence similarity to family members that act on stilbenes, CAO-1 cleaved the interphenyl Cα-Cβ double bond of resveratrol and its derivative piceatannol. CAO-1 did not convert five other similar stilbenes, indicating a requirement for a minimal number of unmodified hydroxyl groups in the stilbene background. Confirming its biological function in converting stilbenes, adding resveratrol led to a pronounced increase in cao-1 mRNA levels, while light, a key regulator of carotenoid metabolism, did not alter them. Targeted Δcao-1 mutants were not impaired by the presence of resveratrol, a phytoalexin active against different fungi, which did not significantly affect the growth and development of wild-type Neurospora. However, under partial sorbose toxicity, the Δcao-1 colonies exhibited faster radial growth than control strains in the presence of resveratrol, suggesting a moderate toxic effect of resveratrol cleavage products.

  9. Anti-inflammatory activity of natural stilbenoids: A review

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Marcela; Landa, Přemysl

    2017-01-01

    Roč. 124, OCT (2017), s. 126-145 ISSN 1043-6618 R&D Projects: GA ČR(CZ) GA16-07193S Institutional support: RVO:61389030 Keywords : Bioavailability * Encapsulation * Inflammation * Metabolites * Multi-targeted therapy * Natural stilbenes Subject RIV: GM - Food Processing OBOR OECD: Biochemistry and molecular biology Impact factor: 4.480, year: 2016

  10. High-performance liquid chromatography separation of unsaturated organic compounds by a monolithic silica column embedded with silver nanoparticles.

    Science.gov (United States)

    Zhu, Yang; Morisato, Kei; Hasegawa, George; Moitra, Nirmalya; Kiyomura, Tsutomu; Kurata, Hiroki; Kanamori, Kazuyoshi; Nakanishi, Kazuki

    2015-08-01

    The optimization of a porous structure to ensure good separation performances is always a significant issue in high-performance liquid chromatography column design. Recently we reported the homogeneous embedment of Ag nanoparticles in periodic mesoporous silica monolith and the application of such Ag nanoparticles embedded silica monolith for the high-performance liquid chromatography separation of polyaromatic hydrocarbons. However, the separation performance remains to be improved and the retention mechanism as compared with the Ag ion high-performance liquid chromatography technique still needs to be clarified. In this research, Ag nanoparticles were introduced into a macro/mesoporous silica monolith with optimized pore parameters for high-performance liquid chromatography separations. Baseline separation of benzene, naphthalene, anthracene, and pyrene was achieved with the theoretical plate number for analyte naphthalene as 36,000 m(-1). Its separation function was further extended to cis/trans isomers of aromatic compounds where cis/trans stilbenes were chosen as a benchmark. Good separation of cis/trans-stilbene with separation factor as 7 and theoretical plate number as 76,000 m(-1) for cis-stilbene was obtained. The trans isomer, however, is retained more strongly, which contradicts the long- established retention rule of Ag ion chromatography. Such behavior of Ag nanoparticles embedded in a silica column can be attributed to the differences in the molecular geometric configuration of cis/trans stilbenes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Influence of UV and Ozonised Water Treatment on Trans-resveratrol Content in Berry Skins and Juices of Franc and Green Veltliner Grapes

    Czech Academy of Sciences Publication Activity Database

    Landfeld, A.; Tříska, Jan; Balík, J.; Strohalm, J.; Novotná, P.; Vrchotová, Naděžda; Totušek, J.; Lefnerová, D.; Híc, P.; Tománková, E.; Halama, R.; Houška, M.

    2015-01-01

    Roč. 33, č. 3 (2015), s. 267-276 ISSN 1212-1800 R&D Projects: GA MZe QI91B094 Institutional support: RVO:67179843 Keywords : grape juices * stilbens content * UV irradiation * ozonisation Subject RIV: GM - Food Processing Impact factor: 0.728, year: 2015

  12. Selenium-mediated synthesis of biaryls through rearrangement.

    Science.gov (United States)

    Shahzad, Sohail A; Vivant, Clotilde; Wirth, Thomas

    2010-03-19

    A new cyclization of beta-keto ester substituted stilbene derivatives using selenium electrophiles in the presence of Lewis acids is described. Substituted naphthols are obtained through cyclization and subsequent 1,2-rearrangement of aryl groups under very mild reaction conditions.

  13. Antileishmanial activity of piceatannol isolated from Euphorbia lagascae seeds

    NARCIS (Netherlands)

    Duarte, Noelia; Kayser, Oliver; Abreu, Pedro; Ferreira, Maria-Jose U.

    In the search for biologically active compounds from Euphorbia lagascae Spreng, an herbaceous plant native to southeast of Iberic Peninsula, a stilbene, two coumarins and two 1-2-deoxyphorbol diterpene esters were isolated by chromatographic methods, from the methanol extracts of its defatted seeds.

  14. Synthesis of 10-(/sup 3/H)-5H-dibenz(b,f) azepine-5-carboxamide ((/sup 3/H)-carbamazepine)

    Energy Technology Data Exchange (ETDEWEB)

    Brundish, D.E. (Ciba Lab., Horsham (UK))

    1985-01-01

    The title compound has been prepared from bromo derivative at a specific activity of 27 Ci mmol/sup -1/ with radiochemical purity of 98.4% by a selective catalytic reduction with tritium gas. Bromine was replaced without reduction of the stilbene double bond using a poisoned, deactivated catalyst.

  15. The Oxygenase CAO-1 of Neurospora crassa Is a Resveratrol Cleavage Enzyme

    KAUST Repository

    Diaz-Sanchez, V.

    2013-07-26

    The genome of the ascomycete Neurospora crassa encodes CAO-1 and CAO-2, two members of the carotenoid cleavage oxygenase family that target double bonds in different substrates. Previous studies demonstrated the role of CAO-2 in cleaving the C40 carotene torulene, a key step in the synthesis of the C35 apocarotenoid pigment neurosporaxanthin. In this work, we investigated the activity of CAO-1, assuming that it may provide retinal, the chromophore of the NOP-1 rhodopsin, by cleaving β-carotene. For this purpose, we tested CAO-1 activity with carotenoid substrates that were, however, not converted. In contrast and consistent with its sequence similarity to family members that act on stilbenes, CAO-1 cleaved the interphenyl Cα-Cβ double bond of resveratrol and its derivative piceatannol. CAO-1 did not convert five other similar stilbenes, indicating a requirement for a minimal number of unmodified hydroxyl groups in the stilbene background. Confirming its biological function in converting stilbenes, adding resveratrol led to a pronounced increase in cao-1 mRNA levels, while light, a key regulator of carotenoid metabolism, did not alter them. Targeted Δcao-1 mutants were not impaired by the presence of resveratrol, a phytoalexin active against different fungi, which did not significantly affect the growth and development of wild-type Neurospora. However, under partial sorbose toxicity, the Δcao-1 colonies exhibited faster radial growth than control strains in the presence of resveratrol, suggesting a moderate toxic effect of resveratrol cleavage products.

  16. Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.

    Science.gov (United States)

    Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S

    2014-11-01

    A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.

  17. Botanical Extracts as Medical Countermeasures for Radiation Induced DNA Damage

    Science.gov (United States)

    2012-03-01

    20 Figure 9: CYP3A4 inhibition HPLC assay for GSE4 and LT ..................................................... 21...the final stages of this project, Dr. John Arnason at the University of Ottawa for preliminary botanicals information and HPLC data, Aimee Jones for...flavanols, flavonols, stilbenes (resveratrol) and phenolic acids (31, 32). Previous studies have shown that proanthocyanidin (oligomer chain of flavonoid

  18. Synthesis of pterostilbene by Julie Olefination

    Science.gov (United States)

    A simple, stereoselective route for the synthesis of the biologically active compounds trans-pterostilbene and tetramethoxy stilbene from the readily available starting materials 3,5-dimethoxy benzyl alcohol and 4-hydroxy benzaldehyde was developed using Julia olefination as a key reaction....

  19. E-Combretastatin and E-Resveratrol Structural Modifications: Antimicrobial and Cancer Cell Growth Inhibitory Beta-E-Nitrostyrenes

    Science.gov (United States)

    As part of a broad-based SAR investigation of E-resveratrol (strong sirtuin activator and antineoplastic) and the anticancer vascular-targeting combretastatin-type stilbenes, a series of twenty-three beta-E-nitrostyrenes was synthesized in order to evaluate potential antineoplastic, antitubulin poly...

  20. Resveratrol anti-ultraviolet-induced guinea pig skin injury

    International Nuclear Information System (INIS)

    Li Wenxing; Zhao Ying

    2014-01-01

    Objective: To Estimate on the protection effect of Stilbene on skin damage induced by ultraviolet radiation. Methods: After the normal skin in guinea pig under the intervene of Resveratrol was irradiated with over- dose of ultraviolet rays (UVB and UVA), the samples in every group were matched and compared. Results: The skin tissue in the Resveratrol intervene group irradiated by ultraviolet rays didn't change obviously as compared with that in the self-control group. But, the damage skin tissue in the control group irradiated by ultraviolet did change significantly as compared with that in the Stilbene intervene group. Conclusion: Resveratrol is a good material to protect the skin from damage effect by ultraviolet radiation. (authors)

  1. A Derivative Method with Free Radical Oxidation to Predict Resveratrol Metabolites by Tandem Mass Spectrometry.

    Science.gov (United States)

    Liu, Wangta; Shiue, Yow-Ling; Lin, Yi-Reng; Lin, Hugo You-Hsien; Liang, Shih-Shin

    2015-10-01

    In this study, we demonstrated an oxidative method with free radical to generate 3,5,4'-trihydroxy- trans -stilbene ( trans -resveratrol) metabolites and detect sequentially by an autosampler coupling with liquid chromatography electrospray ionization tandem mass spectrometer (LC-ESI-MS/MS). In this oxidative method, the free radical initiator, ammonium persulfate (APS), was placed in a sample bottle containing resveratrol to produce oxidative derivatives, and the reaction progress was tracked by autosampler sequencing. Resveratrol, a natural product with purported cancer preventative qualities, produces metabolites including dihydroresveratrol, 3,4'-dihydroxy- trans -stilbene, lunularin, resveratrol monosulfate, and dihydroresveratrol monosulfate by free radical oxidation. Using APS free radical, the concentrations of resveratrol derivatives differ as a function of time. Besides simple, convenient and time- and labor saving, the advantages of free radical oxidative method of its in situ generation of oxidative derivatives followed by LC-ESI-MS/MS can be utilized to evaluate different metabolites in various conditions.

  2. Resveratrol in peanuts.

    Science.gov (United States)

    Sales, Jocelyn M; Resurreccion, Anna V A

    2014-01-01

    Peanuts are important dietary food source of resveratrol with potent antioxidant properties implicated in reducing risk of cancer, cardiovascular and Alzheimer's disease, and delaying aging. Resveratrol is a naturally occurring stilbene phytoalexin phenolic compound produced in response to a variety of biotic and abiotic stresses. This paper is a review of trans-resveratrol and related stilbenes from peanuts--their chemical structures, mechanisms for their biosynthesis, and concentrations in comparison with other major food sources. It will also discuss trans-resveratrol's absorption, bioavailability, and major health benefits; processes to enhance their biosynthesis in peanuts by biotic and abiotic stresses; process optimization for enhanced levels in peanuts and their potential food applications; and methods used for its extraction and analysis.

  3. Excited state dynamics & optical control of molecular motors

    Science.gov (United States)

    Wiley, Ted; Sension, Roseanne

    2014-03-01

    Chiral overcrowded alkenes are likely candidates for light driven rotary molecular motors. At their core, these molecular motors are based on the chromophore stilbene, undergoing ultrafast cis/trans photoisomerization about their central double bond. Unlike stilbene, the photochemistry of molecular motors proceeds in one direction only. This unidirectional rotation is a result of helicity in the molecule induced by steric hindrance. However, the steric hindrance which ensures unidirectional excited state rotation, has the unfortunate consequence of producing large ground state barriers which dramatically decrease the overall rate of rotation. These molecular scale ultrafast motors have only recently been studied by ultrafast spectroscopy. Our lab has studied the photochemistry and photophysics of a ``first generation'' molecular motor with UV-visible transient absorption spectroscopy. We hope to use optical pulse shaping to enhance the efficiency and turnover rate of these molecular motors.

  4. Pterostilbene Is a Potential Candidate for Control of Blackleg in Canola.

    Directory of Open Access Journals (Sweden)

    Joshua C O Koh

    Full Text Available Two stilbenes, resveratrol and pterostilbene, exhibit antifungal activity against Leptosphaeria maculans, the fungal pathogen responsible for blackleg (stem canker in canola (Brassica napus. In vitro studies on the effect of these stilbenes on L. maculans mycelial growth and conidia germination showed that pterostilbene is a potent fungicide and sporicide, but resveratrol only exerted minor inhibition on L. maculans. Cell viability of hyphae cultures was markedly reduced by pterostilbene and SYTOX green staining showed that cell membrane integrity was compromised. We demonstrate that pterostilbene exerts fungicidal activity across 10 different L. maculans isolates and the compound confers protection to the blackleg-susceptible canola cv. Westar seedlings. The potential of pterostilbene as a control agent against blackleg in canola is discussed.

  5. Targeting Mycobacterium tuberculosis nucleoid-associated protein HU with structure-based inhibitors

    Science.gov (United States)

    Bhowmick, Tuhin; Ghosh, Soumitra; Dixit, Karuna; Ganesan, Varsha; Ramagopal, Udupi A.; Dey, Debayan; Sarma, Siddhartha P.; Ramakumar, Suryanarayanarao; Nagaraja, Valakunja

    2014-06-01

    The nucleoid-associated protein HU plays an important role in maintenance of chromosomal architecture and in global regulation of DNA transactions in bacteria. Although HU is essential for growth in Mycobacterium tuberculosis (Mtb), there have been no reported attempts to perturb HU function with small molecules. Here we report the crystal structure of the N-terminal domain of HU from Mtb. We identify a core region within the HU-DNA interface that can be targeted using stilbene derivatives. These small molecules specifically inhibit HU-DNA binding, disrupt nucleoid architecture and reduce Mtb growth. The stilbene inhibitors induce gene expression changes in Mtb that resemble those induced by HU deficiency. Our results indicate that HU is a potential target for the development of therapies against tuberculosis.

  6. Estudo teórico de propriedades ópticas não-lineares de nanotubos de carbono de parede única quimicamente modificados Theoretical analysis of non-linear optical properties for chemically modified single wall carbon nanotubes

    Directory of Open Access Journals (Sweden)

    Antônio M. Da Silva Jr.

    2009-01-01

    Full Text Available Structure and first hyperpolarizability for a series of armchair a(5,5 chemically modified carbon nanotubes (CNT were calculated at semiempirical and density functional levels of theory. The 4,4´-substituted stilbenes were selected as chromophore with substituents at position 4´ set to X=NO2, H, Cl, OH and NH2. The calculated values for static first hyperpolarizability (β were almost linearly dependent on the electronic effect of the group X, increasing from NO2 to NH2. At DFT level the effect of inserting the chromophore in the CNT surface was to enhance the β value up to 70% relative to the free 4,4´-substituted stilbene.

  7. Summary of neutron measurements for the Viking Program

    International Nuclear Information System (INIS)

    Anderson, M.E.

    1975-01-01

    The results of neutron measurements for 238 Pu-fueled, 683-W (thermal) capsules fabricated for the Viking Program (Mars Lander) are presented. These results include, for each capsule, the total neutron emission rate and neutron multiplication and, for one capsule, the neutron energy spectrum. A precision long counter was used for the neutron emission rate measurements and a single stilbene crystal for the neutron spectrum measurement. (U.S.)

  8. Antibacterial Activity of Phenolic Compounds Against the Phytopathogen Xylella fastidiosa

    OpenAIRE

    Maddox, Christina E.; Laur, Lisa M.; Tian, Li

    2010-01-01

    Xylella fastidiosa is a pathogenic bacterium that causes diseases in many crop species, which leads to considerable economic loss. Phenolic compounds (a group of secondary metabolites) are widely distributed in plants and have shown to possess antimicrobial properties. The anti-Xylella activity of 12 phenolic compounds, representing phenolic acid, coumarin, stilbene and flavonoid, was evaluated using an in vitro agar dilution assay. Overall, these phenolic compounds were effective in inhibiti...

  9. Red Wine Polyphenols for Cancer Prevention

    OpenAIRE

    He, Shan; Sun, Cuirong; Pan, Yuanjiang

    2008-01-01

    Conventional cancer therapies, the second leading cause of death worldwide, result in serious side effects and, at best, merely extend the patient's lifespan by a few years. Searching for effective prevention is of high priority in both basic and clinical sciences. In recent decades natural products have been considered to be an important source of cancer chemopreventive agents. Red wine polyphenols, which consisted of various powerful antioxidants such as flavonoids and stilbenes, have been ...

  10. Inhibition of oxidant production in rat adjuvant arthritis with perostilbene

    Czech Academy of Sciences Publication Activity Database

    Perečko, T.; Drábiková, K.; Nosáľ, R.; Harmatha, Juraj; Bauerová, K.; Mihalová, D.; Jančinová, V.

    2010-01-01

    Roč. 3, č. 3 (2010), A73-A74 ISSN 1337-6853. [Toxcon 2010, Borderless Toxicology. 15th Interdisciplinary Toxicological Conference & Advanced Toxicological Course. 06.09.-10.09.2010, Stará Lesná - Hotel Academia] R&D Projects: GA ČR(CZ) GA203/07/1227 Institutional research plan: CEZ:AV0Z40550506 Keywords : stilbene type polyphenols * antiinflammatory * oxidative burst of neutrophils Subject RIV: CC - Organic Chemistry

  11. A Naturally Occurring Antioxidant Complex from Unripe Grapes: The Case of Sangiovese (v. Vitis vinifera)

    OpenAIRE

    Giovanna Fia; Claudio Gori; Ginevra Bucalossi; Francesca Borghini; Bruno Zanoni

    2018-01-01

    The wine industry is well known for its production of a large amount of wastes and by-products. Among them, unripe grapes from thinning operations are an undervalued by-product. Grapes are an interesting source of natural antioxidants such as flavonoids, non-flavonoids and stilbenes. A potential strategy to exploit unripe grapes was investigated in this study. Juice from unripe grapes, v. Sangiovese, was obtained by an innovative technique of solid-liquid extraction without the use of solvent...

  12. Process for purifying lignocellulosic feedstocks

    Science.gov (United States)

    Gray, Matthew; Matthes, Megan; Nelson, Thomas; Held, Andrew

    2018-01-09

    The present invention includes methods for removing mineral acids, mineral salts and contaminants, such as metal impurities, ash, terpenoids, stilbenes, flavonoids, proteins, and other inorganic products, from a lignocellulosic feedstock stream containing organic acids, carbohydrates, starches, polysaccharides, disaccharides, monosaccharides, sugars, sugar alcohols, phenols, cresols, and other oxygenated hydrocarbons, in a manner that maintains a portion of the organic acids and other oxygenated hydrocarbons in the product stream.

  13. Alkenylation of Arenes and Heteroarenes with Alkynes.

    Science.gov (United States)

    Boyarskiy, Vadim P; Ryabukhin, Dmitry S; Bokach, Nadezhda A; Vasilyev, Aleksander V

    2016-05-25

    This review is focused on the analysis of current data on new methods of alkenylation of arenes and heteroarenes with alkynes by transition metal catalyzed reactions, Bronsted/Lewis acid promoted transformations, and others. The synthetic potential, scope, limitations, and mechanistic problems of the alkenylation reactions are discussed. The insertion of an alkenyl group into aromatic and heteroaromatic rings by inter- or intramolecular ways provides a synthetic route to derivatives of styrene, stilbene, chalcone, cinnamic acid, various fused carbo- and heterocycles, etc.

  14. Wide-range scintillation spectrometer of fast neutrons

    International Nuclear Information System (INIS)

    Blinov, M.V.; Gavrilov, B.P.; Ivannikova, L.L.; Kozulin, Eh.M.; Mozhaev, A.N.; Saidgareev, V.M.; Tyurin, G.P.

    1984-01-01

    A spectrometer of fast neutrons developed on the base of stilbene crystas and permitting to detect neutrons simultaneously by time-of-flight and recoil protons with analysis of pulse shape in the 0.5-50 MeV energy range is described. The detecting part is performed in the CAMAC standard. The ''Minsk-32'' computer was used for data storage and preliminary processing

  15. Potential Chemical Systems for Intramolecular Cycloaddition Cures

    Science.gov (United States)

    1979-05-01

    allowed electrocyclic photochemical ring closure of stilbene to dihydrophenanthrene is well known (Reference 12). The presence of an oxidant , e.g...CH (c) R 3 0 00 > 0 I I (42) The keto-diynes 36 follow a uniform reaction pathway with chlorotris- ( triphenylphosphine )rhodium[I] to yield the...Irradiation of 36b similarly gives 49. The mechanism proposed for the photochemical reaction involves an initial formation of the reactive cyclobutadiene by

  16. Variability in the content of trans-resveratrol, trans-ε-viniferin and r2-viniferin in grape cane of seven Vitis vinifera L. varieties during a three-year study

    Czech Academy of Sciences Publication Activity Database

    Tříska, Jan; Vrchotová, Naděžda; Balík, J.; Soural, I.; Sotolář, R.

    2017-01-01

    Roč. 22, č. 6 (2017), č. článku 928. ISSN 1420-3049 R&D Projects: GA MŠk(CZ) LO1415; GA MŠk(CZ) LD14038 Institutional support: RVO:67179843 Keywords : stilbenes * Vitis vinifera L * grape cane * Moravian wine region Subject RIV: EH - Ecology, Behaviour OBOR OECD: Environmental sciences (social aspects to be 5.7) Impact factor: 2.861, year: 2016

  17. Palladium-Catalyzed Decarboxylative γ-Olefination of 2,5-Cyclohexadiene-1-carboxylic Acid Derivatives with Vinyl Halides.

    Science.gov (United States)

    Chang, Chi-Hao; Chou, Chih-Ming

    2018-04-06

    This study explores a Pd-catalyzed decarboxylative Heck-type Csp 3 -Csp 2 coupling reaction of 2,5-cyclohexadiene-1-carboxylic acid derivatives with vinyl halides to provide γ-olefination products. The olefinated 1,3-cyclohexadienes can be further oxidized to produce meta-alkylated stilbene derivatives. Additionally, the conjugated diene products can also undergo a Diels-Alder reaction to produce a bicyclo[2.2.2]octadiene framework.

  18. Synthesis of covalently linked oligo(phenyleneethynylene) wires incorporating dithiafulvene units

    DEFF Research Database (Denmark)

    Jørgensen, Frederik Præstholm; Petersen, Johannes Fabritius; Andersen, Cecilie Lindholm

    2017-01-01

    Controlled alignment and self-assembly of molecular wires is one of the challenges in the field of molecular electronics. Here, we take an approach by which two oligo(phenyleneethynylene)s (OPEs) are linked together through one vinylogous linker. These molecules thus incorporate a central stilben...... from electron-withdrawing CHO groups to electron-donating DTF groups in a conversion also promoted by the phosphite....

  19. Hybrid metal organic scintillator materials system and particle detector

    Science.gov (United States)

    Bauer, Christina A.; Allendorf, Mark D.; Doty, F. Patrick; Simmons, Blake A.

    2011-07-26

    We describe the preparation and characterization of two zinc hybrid luminescent structures based on the flexible and emissive linker molecule, trans-(4-R,4'-R') stilbene, where R and R' are mono- or poly-coordinating groups, which retain their luminescence within these solid materials. For example, reaction of trans-4,4'-stilbenedicarboxylic acid and zinc nitrate in the solvent dimethylformamide (DMF) yielded a dense 2-D network featuring zinc in both octahedral and tetrahedral coordination environments connected by trans-stilbene links. Similar reaction in diethylformamide (DEF) at higher temperatures resulted in a porous, 3-D framework structure consisting of two interpenetrating cubic lattices, each featuring basic to zinc carboxylate vertices joined by trans-stilbene, analogous to the isoreticular MOF (IRMOF) series. We demonstrate that the optical properties of both embodiments correlate directly with the local ligand environments observed in the crystal structures. We further demonstrate that these materials produce high luminescent response to proton radiation and high radiation tolerance relative to prior scintillators. These features can be used to create sophisticated scintillating detection sensors.

  20. Anti-Cancer Activity of Resveratrol and Derivatives Produced by Grapevine Cell Suspensions in a 14 L Stirred Bioreactor

    Directory of Open Access Journals (Sweden)

    Laetitia Nivelle

    2017-03-01

    Full Text Available In the present study, resveratrol and various oligomeric derivatives were obtained from a 14 L bioreactor culture of elicited grapevine cell suspensions (Vitis labrusca L.. The crude ethyl acetate stilbene extract obtained from the culture medium was fractionated by centrifugal partition chromatography (CPC using a gradient elution method and the major stilbenes contained in the fractions were subsequently identified by using a 13C-NMR-based dereplication procedure and further 2D NMR analyses including HSQC, HMBC, and COSY. Beside δ-viniferin (2, leachianol F (4 and G (4′, four stilbenes (resveratrol (1, ε-viniferin (5, pallidol (3 and a newly characterized dimer (6 were recovered as pure compounds in sufficient amounts to allow assessment of their biological activity on the cell growth of three different cell lines, including two human skin malignant melanoma cancer cell lines (HT-144 and SKMEL-28 and a healthy human dermal fibroblast HDF line. Among the dimers obtained in this study, the newly characterized resveratrol dimer (6 has never been described in nature and its biological potential was evaluated here for the first time. ε-viniferin as well as dimer (6 showed IC50 values on the three tested cell lines lower than the ones exerted by resveratrol and pallidol. However, activities of the first two compounds were significantly decreased in the presence of fetal bovine serum although that of resveratrol and pallidol was not. The differential tumor activity exerted by resveratrol on healthy and cancer lines was also discussed.

  1. Study of Leaf Metabolome Modifications Induced by UV-C Radiations in Representative Vitis, Cissus and Cannabis Species by LC-MS Based Metabolomics and Antioxidant Assays

    Directory of Open Access Journals (Sweden)

    Guillaume Marti

    2014-09-01

    Full Text Available UV-C radiation is known to induce metabolic modifications in plants, particularly to secondary metabolite biosynthesis. To assess these modifications from a global and untargeted perspective, the effects of the UV-C radiation of the leaves of three different model plant species, Cissus antarctica Vent. (Vitaceae, Vitis vinifera L. (Vitaceae and Cannabis sativa L. (Cannabaceae, were evaluated by an LC-HRMS-based metabolomic approach. The approach enabled the detection of significant metabolite modifications in the three species studied. For all species, clear modifications of phenylpropanoid metabolism were detected that led to an increased level of stilbene derivatives. Interestingly, resveratrol and piceid levels were strongly induced by the UV-C treatment of C. antarctica leaves. In contrast, both flavonoids and stilbene polymers were upregulated in UV-C-treated Vitis leaves. In Cannabis, important changes in cinnamic acid amides and stilbene-related compounds were also detected. Overall, our results highlighted phytoalexin induction upon UV-C radiation. To evaluate whether UV-C stress radiation could enhance the biosynthesis of bioactive compounds, the antioxidant activity of extracts from control and UV-C-treated leaves was measured. The results showed increased antioxidant activity in UV-C-treated V. vinifera extracts.

  2. Synthesis, anticancer activity, and inhibition of tubulin polymerization by conformationally restricted analogues of lavendustin A.

    Science.gov (United States)

    Mu, Fanrong; Hamel, Ernest; Lee, Debbie J; Pryor, Donald E; Cushman, Mark

    2003-04-24

    Compounds in the lavendustin A series have been shown to inhibit both protein-tyrosine kinases (PTKs) and tubulin polymerization. Since certain lavendustin A derivatives can exist in conformations that resemble both the trans-stilbene structure of the PTK inhibitor piceatannol and the cis-stilbene structure of the tubulin polymerization inhibitor combretastatin A-4, the possibility exists that the ratio of the two types of activities of the lavendustins could be influenced through the synthesis of conformationally restricted analogues. Accordingly, the benzylaniline structure of a series of pharmacologically active lavendustin A fragments was replaced by either their cis- or their trans-stilbene relatives, and effects on both inhibition of tubulin polymerization and cytotoxicity in cancer cell cultures were monitored. Both dihydrostilbene and 1,2-diphenylalkyne congeners were also prepared and evaluated biologically. Surprisingly, conformational restriction of the bridge between the two aromatic rings of the lavendustins had no significant effect on biological activity. On the other hand, conversion of the three phenolic hydroxyl groups of the lavendustin A derivatives to their corresponding methyl ethers consistently abolished their ability to inhibit tubulin polymerization and usually decreased cytotoxicity in cancer cell cultures as well, indicating the importance of at least one of the phenolic hydroxyl groups. Further investigation suggested that the phenolic hydroxyl group in the salicylamide ring was required for activity, while the two phenol moieties in the hydroquinone ring could be methylated with retention of activity. Two of the lavendustin A derivatives displayed IC(50) values of 1.4 microM for inhibition of tubulin polymerization, which ranks them among the most potent of the known tubulin polymerization inhibitors.

  3. Enhanced production of resveratrol derivatives in tobacco plants by improving the metabolic flux of intermediates in the phenylpropanoid pathway.

    Science.gov (United States)

    Jeong, Yu Jeong; An, Chul Han; Woo, Su Gyeong; Park, Ji Hye; Lee, Ki-Won; Lee, Sang-Hoon; Rim, Yeonggil; Jeong, Hyung Jae; Ryu, Young Bae; Kim, Cha Young

    2016-09-01

    The biosynthesis of flavonoids such as anthocyanin and stilbenes has attracted increasing attention because of their potential health benefits. Anthocyanins and stilbenes share common phenylpropanoid precursor pathways. We previously reported that the overexpression of sweetpotato IbMYB1a induced anthocyanin pigmentation in transgenic tobacco (Nicotiana tabacum) plants. In the present study, transgenic tobacco (Nicotiana tabacum SR1) plants (STS-OX and ROST-OX) expressing the RpSTS gene encoding stilbene synthase from rhubarb (Rheum palmatum L. cv. Jangyeop) and the RpSTS and VrROMT genes encoding resveratrol O-methyltransferase from frost grape (Vitis riparia) were generated under the control of 35S promoter. Phenotypic alterations in floral organs, such as a reduction in floral pigments and male sterility, were observed in STS-OX transgenic tobacco plants. However, we failed to obtain STS-OX and ROST-OX plants with high levels of resveratrol compounds. Therefore, to improve the production of resveratrol derivatives in plants, we cross-pollinated flowers of STS-OX or ROST-OX and IbMYB1a-OX transgenic lines (SM and RSM). Phenotypic changes in vegetative and reproductive development of SM and RSM plants were observed. Furthermore, by HPLC and LC-MS analyses, we found enhanced production of resveratrol derivatives such as piceid, piceid methyl ether, resveratrol methyl ether O-hexoside, and 5-methyl resveratrol-3,4'-O-β-D-diglucopyranoside in SM and RSM cross-pollinated lines. Here, total contents of trans- and cis-piceids ranged from approximately 104-240 µg/g fresh weight in SM (F2). Collectively, we suggest that coexpression of RpSTS and IbMYB1a via cross-pollination can induce enhanced production of resveratrol compounds in plants by increasing metabolic flux into stilbenoid biosynthesis.

  4. Copolymers based on N-acryloyl-L-leucine and urea methacrylate with pyridine moieties

    Directory of Open Access Journals (Sweden)

    Buruiana Emil C.

    2016-01-01

    Full Text Available By using free radical polymerization of (N-methacryloyloxyethyl-N′-4-picolyl-urea (MAcPU and N-acryloyl-L-leucine (AcLeu, an optically active copolymer, poly[(N-methacryloyloxyethyl-N′-4-picolyl-urea-co-N-acryloyl-L-leucine], MAcPU-co-AcLeu (1.86:1 molar ratio was prepared and subsequently functionalized at the pyridine-N with (1R/S-(−/+-10-camphorsulfonic acid (R/S-CSA and at carboxyl group with (R-(+-α-ethylbenzylamine (R-EBA or trans-4-stilbene methanol (t-StM. The structures, chemical composition and chiroptical activity of the monomers and the copolymers were characterized by spectral analysis (FTIR, 1H (13C-NMR, 1H,1H-COSY, UV/vis, thermal methods (TGA, DSC, fluorescence spectroscopy, gel permeation chromatography and specific rotation measurements. Influence of the optical activity of monomer and modifier on modified copolymers suggested a good correlation between the experimental data obtained (23[α]589=+12.5° for AcLeu and MAcPU-co-AcLeu, 23[α]589=0°+27.5° for (MAcPU-co-AcLeu-R/S-CSA, 23[α]589=+25° for (MAcPU-co-AcLeu-R-EBA, and 23[α]589 = 0° for (MAcPU-co-AcLeu-St. In addition, the photobehavior of the stilbene copolymer (MAcPU-co-AcLeu-St in film was investigated by UV-vis spectroscopy. The fluorescence quenching of the stilbene species in the presence of aliphatic/aromatic amine in DMF solution was evaluated, more efficiently being 4,4′−dipyridyl (detection limit: 7.2 x 10-6 mol/L.

  5. Neutron and gamma-ray spectra measurement on the model of the KS-150 reactor radial shielding

    International Nuclear Information System (INIS)

    Holman, M.; Hogel, J.; Marik, J.; Kovarik, K.; Franc, L.; Vespalec, R.

    1977-01-01

    A shortened model of the peripheral region of the KS-150 reactor core consisting of two rows of fuel elements and a reflector was constructed from the peripheral fuel elements of the KS-150 reactor core in an experiment on the TR-0 reactor. The mockup of the thermal shield (10 cm of steel), the pressure vessel (15 cm of steel) and the inner wall of the water biological shielding (2 cm of steel) of the KS-150 reactor were erected outside the TR-0 vessel. Fast neutron and gamma spectra were measured with a stilbene crystal scintillation spectrometer. The resonance neutron spectra were measured with 197 Au, 63 Cu and 23 Na resonance activation detectors. Fast neutron spectra inside the reactor were measured with a 10 mm diameter by 10 mm thick stilbene crystal spectrometer, outside the reactor with a 10 mm diameter by 10 mm thick and a 20 mm diameter by 20 mm thick stilbene crystal spectrometer. Neutron spectra in the energy regions of 1 eV to 3 keV and 0.6 MeV to 0.8 MeV were obtained on the core periphery, on the reflector half-thickness and in front of and behind the reactor thermal shield. Gamma spectra were obtained in front of and behind the thermal shield. It was found that the attenuation of neutron fluxes by the reflector and the thermal shield increased with increasing energy while gamma radiation attenuation decreased with increasing energy. It was not possible to obtain the neutron spectrum in the 10 to 600 keV energy range because suitable detection instrumentation was not available. (J.P.)

  6. Modulation of TRP channels by resveratrol and other stilbenoids

    Directory of Open Access Journals (Sweden)

    Yu Lina

    2013-02-01

    Full Text Available Abstract Background Resveratrol (3,5,4’ - trihydroxy-trans-stilbene, a widely distributed natural stilbenoid, was proposed to account for the unique effects of red wine on life span and health. It has been reported to possess various biological and pharmacological activities, such as anti-oxidant, anti-inflammatory, and anti-carcinogenic effects. Here, using whole-cell patch-clamp techniques and behavioral analyses, we investigated whether resveratrol and other stilbenoids can modulate TRP channels in sensory neurons in vitro, and have analgesic effects in vivo. Results We found that resveratrol dose-dependently suppressed the allyl isothiocyanate (AITC-induced currents (IAITC in HEK293 cells that express TRPA1, as well as in rat dorsal root ganglion (DRG neurons. Instead, pinosylvin methyl ether (PME, another derivate of stilbene which has a similar structure to resveratrol, dose-dependently blocked the capsaicin-induced currents (ICAP in HEK293 cells that express TRPV1 as well as in DRG neurons. Interestingly, resveratrol had no inhibitory effect on the ICAP, and PME had no effect on the IAITC. Otherwise, trans-stilbene showed no any effect on IAITC or ICAP. The concentration response curve of AITC showed that resveratrol inhibited the action of TRPA1 not by changing the EC50, but by suppressing the AITC-induced maximum response. By contrast, the inhibition of TRPV1 by PME did not change the capsaicin-induced maximum response but did cause a right shift of the EC50. Moreover, pre-administration of resveratrol suppressed intraplantar injections of AITC-evoked nocifensive behaviors, as well as that PME suppressed capsaicin-evoked one. Conclusions These data suggest that resveratrol and other stilbenoids may have an inhibitory effect on TRP channels. In addition, these stilbenoids modulate TRP channel activity in different ways.

  7. Some organoperoxo complexes of antimony, niobium and tantalum and their oxidation properties

    International Nuclear Information System (INIS)

    Tarafder, M.T.H.

    1999-05-01

    Several novel organoperoxo complexes of Nb(V), Ta(V) and Sb(V) have been synthesized and characterized. The complexes have the compositions [M(O 2 ) 2 L Cl] and [M(O 2 ) 2 L'] [L = monodentate and bidentate, neutral ligand; L' = bidentate, uninegative ligand]. These complexes are very reactive to both organic and inorganic substrates. Niobium and tantalum complexes were found to oxidize phosphines and arsines to their oxides. These also oxidize olefins to epoxides under stoichiometric conditions while under catalytic conditions, ring opening of the epoxides occur producing α-hydroxyketone when the substrate is trans-stilbene. The antimony complexes are decidedly inert towards oxidation. (author)

  8. Biotechnological production of vanillin.

    Science.gov (United States)

    Priefert, H; Rabenhorst, J; Steinbüchel, A

    2001-08-01

    Vanillin is one of the most important aromatic flavor compounds used in foods, beverages, perfumes, and pharmaceuticals and is produced on a scale of more than 10 thousand tons per year by the industry through chemical synthesis. Alternative biotechnology-based approaches for the production are based on bioconversion of lignin, phenolic stilbenes, isoeugenol, eugenol, ferulic acid, or aromatic amino acids, and on de novo biosynthesis, applying fungi, bacteria, plant cells, or genetically engineered microorganisms. Here, the different biosynthesis routes involved in biotechnological vanillin production are discussed.

  9. Optimum filter-based discrimination of neutrons and gamma rays

    International Nuclear Information System (INIS)

    Amiri, Moslem; Prenosil, Vaclav; Cvachovec, Frantisek

    2015-01-01

    An optimum filter-based method for discrimination of neutrons and gamma-rays in a mixed radiation field is presented. The existing filter-based implementations of discriminators require sample pulse responses in advance of the experiment run to build the filter coefficients, which makes them less practical. Our novel technique creates the coefficients during the experiment and improves their quality gradually. Applied to several sets of mixed neutron and photon signals obtained through different digitizers using stilbene scintillator, this approach is analyzed and its discrimination quality is measured. (authors)

  10. Suppression background device in neutron detection by a scintillation detector

    International Nuclear Information System (INIS)

    Degtyarev, A.P.; Kozyr', Yu.E.; Prokopets, G.A.

    1980-01-01

    A pulse shape discriminator for suppression of cosmic and gamma background as well as for suppression of intrinsic noises of a photomultiplier is described. Identification of signals of background and neutrons is performed by means of comparison of relative intensity of fast and slow components of scintillator luminescence. Basic discriminator flowsheet which contains integrating and differential RC circuits and time-to-amplitude converter is given. The discriminator provides minimum energy of detected neutrons equal to 500 keV when using a FEhU-36 neutron detector with a stilbene crystal [ru

  11. Dihydronaflavonols from the leaves of Derris urucu (Leguminosae): structural elucidation and DPPH radical-scavenging activity

    Energy Technology Data Exchange (ETDEWEB)

    Lobo, Livia T.; Silva, Geilson A. da; Ferreira, Malisson; Silva, Milton N. da; Santos, Alberdan S.; Arruda, Alberto C.; Guilhon, Gisele M.S.P.; Santos, Lourivaldo S.; Arruda, Mara Silvia P. [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Inst. de Ciencias Exatas e Naturais. Programa de Pos-Graduacao em Quimica], e-mail: mspa@ufpa.br; Borges, Rosilvaldo dos Santos [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Fac. de Farmacia. Inst. de Ciencias

    2009-07-01

    Derris urucu is an Amazonian plant with insecticide and ichthyotoxic properties. Studies with this species show the presence of flavonoids, mainly rotenoids, as well as stilbenes. The ethanol extract of the leaves of Derris urucu (Leguminosae) afforded three new dihydroflavonols named urucuol A (1), B (2) and C (3), and the dihydroflavonol isotirumalin (4). Their structures were elucidated by extensive analysis of 1D and 2D NMR, UV and IR spectra and MS data and comparison with literature data. The isolated compounds (1-4) were evaluated for DPPH radical scavenging activity and showed a relatively lower antioxidant ability compared to the commercial antioxidant trans-resveratrol. (author)

  12. Synthesis, characterization and oxidative behaviour of dioxoruthenium(VI) complexes

    International Nuclear Information System (INIS)

    Agarwal, D.D.; Rastogi, Rachana

    1995-01-01

    Dioxoruthenium(VI) complexes are found to give low yield of epoxide but good yield of cyclohexanone. The complexes are electro active giving metal centered Ru VI /Ru V couple. Cis-stilbene gives trans epoxide and benzaldehyde. Norbornene gives exo epoxy norbornene. The selectivity for allylic oxidation is high. In the present note the synthesis of dioxoruthenium(VI) complexes and their oxidation behaviour is reported. The dioxoruthenium(VI) complexes have been stoichiometrically found to be good oxidants. (author). 21 refs., 1 tab

  13. Pinus pinaster Knot: A Source of Polyphenols against Plasmopara viticola.

    Science.gov (United States)

    Gabaston, Julien; Richard, Tristan; Cluzet, Stéphanie; Palos Pinto, Antonio; Dufour, Marie-Cécile; Corio-Costet, Marie-France; Mérillon, Jean-Michel

    2017-10-11

    Pine knot extract from Pinus pinaster byproducts was characterized by UHPLC-DAD-MS and NMR. Fourteen polyphenols divided into four classes were identified as follows: lignans (nortrachelogenin, pinoresinol, matairesinol, isolariciresinol, secoisolariciresinol), flavonoids (pinocembrin, pinobanksin, dihydrokaempferol, taxifolin), stilbenes (pinosylvin, pinosylvin monomethyl ether, pterostilbene), and phenolic acids (caffeic acid, ferulic acid). The antifungal potential of pine knot extract, as well as the main compounds, was tested in vitro against Plasmopara viticola. The ethanolic extract showed a strong antimildew activity. In addition, pinosylvins and pinocembrin demonstrated significant inhibition of zoospore mobility and mildew development. These findings strongly suggest that pine knot is a potential biomass that could be used as a natural antifungal product.

  14. Two Palladium-Catalyzed Domino Reactions from One Set of Substrates/Reagents: Efficient Synthesis of Substituted Indenes and cis-Stilbenoid Hydrocarbons from the Same Internal Alkynes and Hindered Grignard Reagents

    Science.gov (United States)

    Dong, Cheng-Guo; Yeung, Pik; Hu, Qiao-Sheng

    2008-01-01

    Two types of domino reactions from the same internal alkynes and hindered Grignard reagents based on carbopalladation, Pd-catalyzed cross-coupling reaction and C-H activation strategy are described. The realization of these domino reactions relied on the control of the use of the ligand and the reaction temperature. Our study provides an efficient access to useful polysubstituted indenes and cis-substituted stilbenes, and may offer new means to the development of tandem/domino reactions in a more efficient way. PMID:17217305

  15. Calculation with MCNP of capture photon flux in VVER-1000 experimental reactor.

    Science.gov (United States)

    Töre, Candan; Ortego, Pedro

    2005-01-01

    The aim of this study is to obtain by Monte Carlo method the high energy photon flux due to neutron capture in the internals and vessel layers of the experimental reactor LR-0 located in REZ, Czech Republic, and loaded with VVER-1000 fuel. The calclated neutron, photon and photon to neutron flux ratio are compared with experimental measurements performed with a multi-parameter stilbene detector. The results show clear underestimation of photon flux in downcomer and some overestimation at vessel surface and 1/4 thickness but a good fitting for deeper points in vessel.

  16. Measurement of scintillation decay curves by a single photon counting technique

    International Nuclear Information System (INIS)

    Noguchi, Tsutomu

    1978-01-01

    An improved apparatus suitable for the measurement of spectroscopic scintillation decay curves has been developed by combination of a single photon counting technique and a delayed coincidence method. The time resolution of the apparatus is improved up to 1.16 nsec (FWHM), which is obtained from the resolution function of the system for very weak Cherenkov light flashes. Systematic measurement of scintillation decay curves is made for liquid and crystal scintillators including PPO-toluene, PBD-xylene, PPO-POPOP-toluene, anthracene and stilbene. (auth.)

  17. Liquid-assisted grinding and ion pairing regulates percentage conversion and diastereoselectivity of the Wittig reaction under mechanochemical conditions.

    Science.gov (United States)

    Denlinger, Kendra Leahy; Ortiz-Trankina, Lianna; Carr, Preston; Benson, Kingsley; Waddell, Daniel C; Mack, James

    2018-01-01

    Mechanochemistry is maturing as a discipline and continuing to grow, so it is important to continue understanding the rules governing the system. In a mechanochemical reaction, the reactants are added into a vessel along with one or more grinding balls and the vessel is shaken at high speeds to facilitate a chemical reaction. The dielectric constant of the solvent used in liquid-assisted grinding (LAG) and properly chosen counter-ion pairing increases the percentage conversion of stilbenes in a mechanochemical Wittig reaction. Utilizing stepwise addition/evaporation of ethanol in liquid-assisted grinding also allows for the tuning of the diastereoselectivity in the Wittig reaction.

  18. Discovery of gemfibrozil analogues that activate PPARα and enhance the expression of gene CPT1A involved in fatty acids catabolism.

    Science.gov (United States)

    De Filippis, Barbara; Giancristofaro, Antonella; Ammazzalorso, Alessandra; D'Angelo, Alessandra; Fantacuzzi, Marialuigia; Giampietro, Letizia; Maccallini, Cristina; Petruzzelli, Michele; Amoroso, Rosa

    2011-10-01

    A new series of gemfibrozil analogues conjugated with α-asarone, trans-stilbene, chalcone, and their bioisosteric modifications were synthesized and evaluated to develop PPARα agonists. In this attempt, we have removed the methyls on the phenyl ring of gemfibrozil and introduced the above scaffolds in para position synthesizing two series of derivatives, keeping the dimethylpentanoic skeleton of gemfibrozil unaltered or demethylated. Four compounds exhibited good activation of the PPARα receptor and were also screened for their activity on PPARα-regulated gene CPT1A. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  19. Fast neutron flux analyzer with real-time digital pulse shape discrimination

    Energy Technology Data Exchange (ETDEWEB)

    Ivanova, A.A., E-mail: a.a.ivanova@inp.nsk.su [Budker Institute of Nuclear Physics SB RAS, 630090 Novosibirsk (Russian Federation); Zubarev, P.V. [Budker Institute of Nuclear Physics SB RAS, 630090 Novosibirsk (Russian Federation); Novosibirsk State Technical University, 630092 Novosibirsk (Russian Federation); Ivanenko, S.V. [Budker Institute of Nuclear Physics SB RAS, 630090 Novosibirsk (Russian Federation); Khilchenko, A.D. [Budker Institute of Nuclear Physics SB RAS, 630090 Novosibirsk (Russian Federation); Novosibirsk State Technical University, 630092 Novosibirsk (Russian Federation); Kotelnikov, A.I. [Budker Institute of Nuclear Physics SB RAS, 630090 Novosibirsk (Russian Federation); Polosatkin, S.V. [Budker Institute of Nuclear Physics SB RAS, 630090 Novosibirsk (Russian Federation); Novosibirsk State Technical University, 630092 Novosibirsk (Russian Federation); Novosibirsk State University, 630090 Novosibirsk (Russian Federation); Puryga, E.A.; Shvyrev, V.G. [Budker Institute of Nuclear Physics SB RAS, 630090 Novosibirsk (Russian Federation); Novosibirsk State Technical University, 630092 Novosibirsk (Russian Federation); Sulyaev, Yu.S. [Budker Institute of Nuclear Physics SB RAS, 630090 Novosibirsk (Russian Federation); Novosibirsk State University, 630090 Novosibirsk (Russian Federation)

    2016-08-11

    Investigation of subthermonuclear plasma confinement and heating in magnetic fusion devices such as GOL–3 and GDT at the Budker Institute (Novosibirsk, Russia) requires sophisticated equipment for neutron-, gamma- diagnostics and upgrading data acquisition systems with online data processing. Measurement of fast neutron flux with stilbene scintillation detectors raised the problem of discrimination of the neutrons (n) from background cosmic particles (muons) and neutron-induced gamma rays (γ). This paper describes a fast neutron flux analyzer with real-time digital pulse-shape discrimination (DPSD) algorithm FPGA-implemented for the GOL–3 and GDT devices. This analyzer was tested and calibrated with the help of {sup 137}Cs and {sup 252}Cf radiation sources. The Figures of Merit (FOM) calculated for different energy cuts are presented. - Highlights: • Electronic equipment for measurement of fast neutron flux with stilbene scintillator is presented. • FPGA-implemented digital pulse-shape discrimination algorithm by charge comparison method is shown. • Calibration of analyzer was carried out with {sup 137}Cs and {sup 252}Cf. • Figures of Merit (FOM) values for energy cuts from 1/8 Cs to 2 Cs are from 1.264 to 2.34 respectively.

  20. An organic scintillator neutron spectrometer suitable for in-phantom studies

    International Nuclear Information System (INIS)

    Harrison, K.G.

    1981-07-01

    A transportable organic scintillator spectrometry system based on a 1 cm high x 1 cm dia. cylindrical stilbene scintillator with a 30 cm light-pipe has been developed for neutron spectrometry inside anthropomorphic phantoms in order to improve knowledge of dose and dose-equivalent distributions in the body. Electronic pulse-shape discrimination is used to discriminate between neutron and gamma-ray events in the scintillator. The spectrometer is shown to give excellent results in the range of neutron energies from 1.5 to 7 MeV when used with an unfolding program based on differentiation of the pulse-height distribution. Below 1 MeV problems are experienced with pulse-shape discrimination, and below 2 MeV there are found to be some shortcomings in the differentiation method for this size of scintillator. Above about 9 MeV more sophisticated unfolding methods are shown to be desirable. Problems of stability of the system, difficulties in the measurement and calculation of the response functions, and disadvantages of using stilbene are discussed. (author)

  1. Phytochemical Compounds and Antioxidant Capacity of Tucum-Do-Cerrado (Bactris setosa Mart), Brazil's Native Fruit.

    Science.gov (United States)

    Rosa, Fernanda R; Arruda, Andréa F; Siqueira, Egle M A; Arruda, Sandra F

    2016-02-23

    This study identified major phenolic compounds of the tucum-do-cerrado (Bactris setosa) peel, as well as antioxidant activity and total phytochemical compound concentration of different extracts of the peel and pulp of this fruit. Phenolic compounds of the different extracts of tucum-do-cerrado peel were identified and quantified using a high-performance liquid chromatography system coupled to a diode array detector (DAD). Total phytochemical compound content was determined by spectrophotometric assays and the antioxidant activity by ferric reducing antioxidant power and β-carotene/linoleic assays. Total phenolic, flavanols, total anthocyanins and yellow flavonoids concentration of tucum-do-cerrado were 122-, 14-, 264- and 61-fold higher in the peel than in the pulp, respectively. The aqueous, methanolic and ethanolic extracts of the tucum-do-cerrado peel exhibited higher antioxidant activity compared to its pulp. Flavanols, anthocyanins, flavones, phenolic acids and stilbenes were the main phenolic classes identified in the tucum-do-cerrado peel extracts. Results suggest that the antioxidant capacity and the phytochemical compound content of the tucum-do-cerrado are mainly associated with the peel. Although flavonoids are the main compounds identified in tucum-do-cerrado peel, other phenolics identified in minor amounts, such as phenolic acids and stilbenes, may be responsible for the high antioxidant capacity of the fruit.

  2. Phytochemical Compounds and Antioxidant Capacity of Tucum-Do-Cerrado (Bactris setosa Mart), Brazil’s Native Fruit

    Science.gov (United States)

    Rosa, Fernanda R.; Arruda, Andréa F.; Siqueira, Egle M. A.; Arruda, Sandra F.

    2016-01-01

    This study identified major phenolic compounds of the tucum-do-cerrado (Bactris setosa) peel, as well as antioxidant activity and total phytochemical compound concentration of different extracts of the peel and pulp of this fruit. Phenolic compounds of the different extracts of tucum-do-cerrado peel were identified and quantified using a high-performance liquid chromatography system coupled to a diode array detector (DAD). Total phytochemical compound content was determined by spectrophotometric assays and the antioxidant activity by ferric reducing antioxidant power and β-carotene/linoleic assays. Total phenolic, flavanols, total anthocyanins and yellow flavonoids concentration of tucum-do-cerrado were 122-, 14-, 264- and 61-fold higher in the peel than in the pulp, respectively. The aqueous, methanolic and ethanolic extracts of the tucum-do-cerrado peel exhibited higher antioxidant activity compared to its pulp. Flavanols, anthocyanins, flavones, phenolic acids and stilbenes were the main phenolic classes identified in the tucum-do-cerrado peel extracts. Results suggest that the antioxidant capacity and the phytochemical compound content of the tucum-do-cerrado are mainly associated with the peel. Although flavonoids are the main compounds identified in tucum-do-cerrado peel, other phenolics identified in minor amounts, such as phenolic acids and stilbenes, may be responsible for the high antioxidant capacity of the fruit. PMID:26907338

  3. Temperature-dependent vibrational spectroscopy to study order-disorder transitions in charge transfer complexes

    Directory of Open Access Journals (Sweden)

    Rohan Isaac

    2018-02-01

    Full Text Available Charge-transfer (CT complexes are a promising class of materials for the semiconductor industry because of their versatile properties. This class of compounds shows a variety of phase transitions, which are of interest because of their potential impact on the electronic characteristics. Here temperature-dependent vibrational spectroscopy is used to study structural phase transitions in a set of organic CT complexes. Splitting and broadening of infrared-active phonons in the complex formed between pyrene and pyromellitic dianhydride (PMDA confirm the structural transition is of the order-disorder type and complement previous x-ray diffraction (XRD results. We show that this technique is a powerful tool to characterize transitions, and apply it to a range of binary CT complexes composed of polyaromatic hyrdocarbons (anthracene, perylene, phenanthrene, pyrene, and stilbene and PMDA. We extend the understanding of transitions in perylene-PMDA and pyrene-PMDA, and show that there are no order-disorder transitions present in anthracene-PMDA, stilbene-PMDA and phenanthrene-PMDA in the temperature range investigated here.

  4. Temperature-dependent vibrational spectroscopy to study order-disorder transitions in charge transfer complexes

    Science.gov (United States)

    Isaac, Rohan; Goetz, Katelyn P.; Roberts, Drew; Jurchescu, Oana D.; McNeil, L. E.

    2018-02-01

    Charge-transfer (CT) complexes are a promising class of materials for the semiconductor industry because of their versatile properties. This class of compounds shows a variety of phase transitions, which are of interest because of their potential impact on the electronic characteristics. Here temperature-dependent vibrational spectroscopy is used to study structural phase transitions in a set of organic CT complexes. Splitting and broadening of infrared-active phonons in the complex formed between pyrene and pyromellitic dianhydride (PMDA) confirm the structural transition is of the order-disorder type and complement previous x-ray diffraction (XRD) results. We show that this technique is a powerful tool to characterize transitions, and apply it to a range of binary CT complexes composed of polyaromatic hyrdocarbons (anthracene, perylene, phenanthrene, pyrene, and stilbene) and PMDA. We extend the understanding of transitions in perylene-PMDA and pyrene-PMDA, and show that there are no order-disorder transitions present in anthracene-PMDA, stilbene-PMDA and phenanthrene-PMDA in the temperature range investigated here.

  5. [Polyketone Reaction in Biosynthetic Pathways of 2, 3, 5, 4'-Tetrahydroxy Stilhene-2-O-β-D-glucoside in Polygonum multiflorum by Biocatalysis].

    Science.gov (United States)

    Lei, Lei; Xia, Wan-xia; Shao, Li; Zhao, Shu-jin

    2015-10-01

    2, 3, 5, 4'-Tetrahydroxy stilbene-2-O-β-D-glucoside (THSG), the active ingredient of Polygonum multiflorum, its polyketone reaction in the biosynthesis pathways was studied by biocatalysis method. The substrates 4-coumaroyl-CoA and malonyl-CoA were catalyzed in vitro by the crude enzyme extracted from Polygonum multiflorum callus, then the products were verified by HPLC and LC-MS methods. And the crude enzyme was analyzed by ammonium sulfate precipitation method and SDS-PAGE. HPLC chromatogram showed the same retention time of both the product and resveratrol standards; LC-MS spectra showed that the m/z of product was 227, which was consistent with resveratrol standards under the mode of negative ion; Ammonium sulfate (AS) precipitation method showed AS of 40% - 70% had catalytic activity,and 50% - 60% was the optimum; SDS-PAGE showed protein bands were obviously different among different AS concentration between 20% - 80%, the protein band of 42 kDa was found in AS of 50% - 60%, which had the same molecular weight with stilbene synthase. The product of polyketone reaction in the biosynthesis of THSG is resveratrol rather than THSG, so it is speculated that THSG is the conversion product of resveratrol instead of the direct product of the polyketone reaction.

  6. Kinetics of renal organic acid transport; studies on the counter-transport of p-aminohippuric acid

    International Nuclear Information System (INIS)

    Yang Saeng Park

    1979-04-01

    The experiments have been performed in various conditions using 14 C-PAH as a tracer. The relative ratio of the inhibitor constant (Ki) between Diodrast and probenecid was of the same magnitude as the concentrations of these inhibitors for maximal stimulation of PAH efflux. The author observed that in metabolically inhibited slices there was no PAH uptake against concentration gradient, but the efflux of PAH was greater than that in the normal slice. In these metabolically inhibited slice PAH efflux was also biphasically altered by Diodrast and probenecid added to the medium. When the concentration of sodium was reduced in medium, PAH influx was decreased but PAH efflux facilitated. 0.1mM disulfonic stilbene derivative, SITS (4-acetamido-4'-isothiocyano-2.2' disulfonic stilbene) increased PAH efflux in the normal slice, but decreased the efflux in the metabolically inhibited slice. Analyzing the data presented, the contractor came to the conclusion that the influx and efflux of PAH in the renal slice are mediated by mobile carrier cycling across the peritubular membrane of renal tubular cell. He observed also that the affinity of carrier for organic acids is altered by the energy-linking reaction at the cytoplasmic border of the membrane

  7. Dose-response relationship of rat aryl hydrocarbon hydroxylase and epoxide hydratase induction

    Energy Technology Data Exchange (ETDEWEB)

    Gielen, J.E.; Goujon, F.M.; Sele-Doyen, J.; Van Cantfort, J.

    1980-01-01

    This paper summarizes our recent results supporting the hypothesis that different regulation mechanisms are involved in the control of AHH and EH activity and that the AHH induction in the extrahepatic tissues might also be affected by liver specific inducers. In the rat, lung and kidney AHH is highly sensitive to the inducers present in cigarette smoke and cigarette smoke condensate, the EH activity not being affected by the same agents. Phenobarbital is also able to protentiate the inducing action of low doses of benzo(a)pyrene on the lung AHH activity. In primary rat liver cells in culture, AHH and EH can be selectivly induced. Low doses of benz(a)anthracene preferentially enhance the AHH activity while trans-stilbene oxide an various antioxidants modify only the EH activity. Phenobarbital, which also induces the AHH activity in cell culture, produces a more than additive effect when added to the culture medium in a mixture with benz(a)anthracene. Trans-stilbene oxide prevents the AHH induction by phenobarbital and not by benz(a)anthracene. Our results suggest that, in addition to its own induction capacity, phenobarbital is also able to potentiate the action of chemicals belonging to a different class of inducers.

  8. Chitosan and grape secondary metabolites: A proteomics and metabolomics approach

    Directory of Open Access Journals (Sweden)

    Bavaresco Luigi

    2017-01-01

    Full Text Available Chitosan is a polysaccharide obtained by deacetylation of chitin, and it is involved in defence mechanisms of plants toward diseases. In the present work, V. vinifera L. cv. Ortrugo, grafted on 420A rootstock was grown in pot and treated, at veraison, by 0.03% chitosan solution at cluster level. Just before the treatment (T0 and 24 hours (T1, 48 hours (T2, 72 hours (T3 and 10 days (T4 later, the concentration of stilbenic compounds was detected, and at T1 proteomics and metabolomics analyses were done. Proteomics relies on the analysis of the complete set of proteins existing in a given substrate, while metabolomics relies on the analyses of the complete set of metabolites in a given substrate. The treatment improved the stilbene concentration over the control at T1. Proteomic analysis showed that superoxide dismutase (SOD and phenylalanine ammonia-lyase (PAL were overexpressed in the treated grapes. SOD is known to be an enzyme active against reactive oxygen species (ROS while PAL is a key enzyme in the phenylpropanoids pathway. Metabolomics analysis highlighted the positive role of the treatment in improving the triperpenoid concentration (betulin, erythrodiol, uvaol, oleanolate; these compounds are known to be effective against microbes, insects and fungi.

  9. Determination of Fluorescent Whitening Agents in Paper Materials by Ion-Pair Reversed-Phase High-Performance Liquid Chromatography

    International Nuclear Information System (INIS)

    Kim, Jeong Soo; Kim, Keon; Kim, Do Hwan

    2012-01-01

    A simple method was developed for the analysis of seven stilbene-type fluorescent whitening agents (FWAs) in paper materials by ion-pair reversed-phase high-performance liquid chromatography with fluorescence detection. These stilbene-type FWAs included two disulfonate, two tetrasulfonate, and three hexasulfonate compounds. After optimization of chromatographic conditions, the FWAs were satisfactorily separated using a reversed-phase column (RP-18) with the following isocratic mobile phase: methanol-water (60:40) containing 17.5 mM TBABr and 10 mM citrate buffer (pH = 7.0). The calibration plot was linear in the range from 5 to 500 ng/mL for two disulfo-FWAs and from 1 to 500 ng/mL for the other five FWAs. Precision levels of the calibration curve as indicated by RSD of response factors were 1.2 and 8.1%. Limits of quantitation (LOQ) ranged from 1.2 to 11 ng/mL

  10. Determination of Fluorescent Whitening Agents in Paper Materials by Ion-Pair Reversed-Phase High-Performance Liquid Chromatography

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jeong Soo; Kim, Keon [Korea Univ., Seoul (Korea, Republic of); Kim, Do Hwan [Daegu Univ., Gyeongsan (Korea, Republic of)

    2012-12-15

    A simple method was developed for the analysis of seven stilbene-type fluorescent whitening agents (FWAs) in paper materials by ion-pair reversed-phase high-performance liquid chromatography with fluorescence detection. These stilbene-type FWAs included two disulfonate, two tetrasulfonate, and three hexasulfonate compounds. After optimization of chromatographic conditions, the FWAs were satisfactorily separated using a reversed-phase column (RP-18) with the following isocratic mobile phase: methanol-water (60:40) containing 17.5 mM TBABr and 10 mM citrate buffer (pH = 7.0). The calibration plot was linear in the range from 5 to 500 ng/mL for two disulfo-FWAs and from 1 to 500 ng/mL for the other five FWAs. Precision levels of the calibration curve as indicated by RSD of response factors were 1.2 and 8.1%. Limits of quantitation (LOQ) ranged from 1.2 to 11 ng/mL.

  11. The comparative kinetic analysis of Acetocell and Lignoboost® lignin pyrolysis: the estimation of the distributed reactivity models.

    Science.gov (United States)

    Janković, Bojan

    2011-10-01

    The non-isothermal pyrolysis kinetics of Acetocell (the organosolv) and Lignoboost® (kraft) lignins, in an inert atmosphere, have been studied by thermogravimetric analysis. Using isoconversional analysis, it was concluded that the apparent activation energy for all lignins strongly depends on conversion, showing that the pyrolysis of lignins is not a single chemical process. It was identified that the pyrolysis process of Acetocell and Lignoboost® lignin takes place over three reaction steps, which was confirmed by appearance of the corresponding isokinetic relationships (IKR). It was found that major pyrolysis stage of both lignins is characterized by stilbene pyrolysis reactions, which were subsequently followed by decomposition reactions of products derived from the stilbene pyrolytic process. It was concluded that non-isothermal pyrolysis of Acetocell and Lignoboost® lignins can be best described by n-th (n>1) reaction order kinetics, using the Weibull mixture model (as distributed reactivity model) with alternating shape parameters. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Bioactivation of Phytoestrogens: Intestinal Bacteria and Health.

    Science.gov (United States)

    Landete, J M; Arqués, J; Medina, M; Gaya, P; de Las Rivas, B; Muñoz, R

    2016-08-17

    Phytoestrogens are polyphenols similar to human estrogens found in plants or derived from plant precursors. Phytoestrogens are found in high concentration in soya, flaxseed and other seeds, fruits, vegetables, cereals, tea, chocolate, etc. They comprise several classes of chemical compounds (stilbenes, coumestans, isoflavones, ellagitannins, and lignans) which are structurally similar to endogenous estrogens but which can have both estrogenic and antiestrogenic effects. Although epidemiological and experimental evidence indicates that intake of phytoestrogens in foods may be protective against certain chronic diseases, discrepancies have been observed between in vivo and in vitro experiments. The microbial transformations have not been reported so far in stilbenes and coumestans. However, isoflavones, ellagitanins, and lignans are metabolized by intestinal bacteria to produce equol, urolithins, and enterolignans, respectively. Equol, urolithin, and enterolignans are more bioavailable, and have more estrogenic/antiestrogenic and antioxidant activity than their precursors. Moreover, equol, urolithins and enterolignans have anti-inflammatory effects and induce antiproliferative and apoptosis-inducing activities. The transformation of isoflavones, ellagitanins, and lignans by intestinal microbiota is essential to be protective against certain chronic diseases, as cancer, cardiovascular disease, osteoporosis, and menopausal symptoms. Bioavailability, bioactivity, and health effects of dietary phytoestrogens are strongly determined by the intestinal bacteria of each individual.

  13. Effect of generation on the electronic properties of light-emitting dendrimers

    Science.gov (United States)

    Burn, Paul L.; Halim, Mounir; Pillow, Jonathan N. G.; Samuel, Ifor D. W.

    1999-12-01

    We have compared the optical and electronic properties of a series of porphyrin centered dendrimers containing stilbene dendrons. The first and second generation dendrimers could be spin-coated from solution to form good quality thin films. Incorporation into single layer light-emitting diodes gave red-light emission with maximum external quantum efficiencies of 0.02% and 0.04% for the first and second generation dendrimers respectively. We have determined by photoluminescence studies that energy can be transferred efficiently from the stilbene dendrons to the porphyrin core and that PL emission is from the core. Cyclic voltammetry studies on the dendrimers show that the reductions are porphyrin centered with the dendrons only affecting the rate of heterogeneous electron transfer between the electrode and the dendrimers. This suggests that charge mobility within a dendrimer film in an LED will be affected by the porphyrin edge to porphyrin edge distance. We have studied the hydrodynamic radii of the dendrimers by gel permeation chromatography and found as expected that the average porphyrin edge to dendron edge distance increases with generation. This is consistent with the slowing of heterogeneous electron transfer observed in the cyclic voltammetry on increasing the generation number and suggests that the dendrons are interleaved in the solid state to facilitate charge transport.

  14. Phytochemical Compounds and Antioxidant Capacity of Tucum-Do-Cerrado (Bactris setosa Mart, Brazil’s Native Fruit

    Directory of Open Access Journals (Sweden)

    Fernanda R. Rosa

    2016-02-01

    Full Text Available This study identified major phenolic compounds of the tucum-do-cerrado (Bactris setosa peel, as well as antioxidant activity and total phytochemical compound concentration of different extracts of the peel and pulp of this fruit. Phenolic compounds of the different extracts of tucum-do-cerrado peel were identified and quantified using a high-performance liquid chromatography system coupled to a diode array detector (DAD. Total phytochemical compound content was determined by spectrophotometric assays and the antioxidant activity by ferric reducing antioxidant power and β-carotene/linoleic assays. Total phenolic, flavanols, total anthocyanins and yellow flavonoids concentration of tucum-do-cerrado were 122-, 14-, 264- and 61-fold higher in the peel than in the pulp, respectively. The aqueous, methanolic and ethanolic extracts of the tucum-do-cerrado peel exhibited higher antioxidant activity compared to its pulp. Flavanols, anthocyanins, flavones, phenolic acids and stilbenes were the main phenolic classes identified in the tucum-do-cerrado peel extracts. Results suggest that the antioxidant capacity and the phytochemical compound content of the tucum-do-cerrado are mainly associated with the peel. Although flavonoids are the main compounds identified in tucum-do-cerrado peel, other phenolics identified in minor amounts, such as phenolic acids and stilbenes, may be responsible for the high antioxidant capacity of the fruit.

  15. Chloroquine uptake, altered partitioning and the basis of drug resistance: evidence for chloride-dependent ionic regulation.

    Science.gov (United States)

    Martiney, J A; Ferrer, A S; Cerami, A; Dzekunov, S; Roepe, P

    1999-01-01

    The biochemical mechanism of chloroquine resistance in Plasmodium falciparum remains unknown. We postulated that chloroquine-resistant strains could alter ion fluxes that then indirectly control drug accumulation within the parasite by affecting pH and/or membrane potential ('altered partitioning mechanism'). Two principal intracellular pH-regulating systems in many cell types are the amiloride-sensitive Na+/H+ exchanger (NHE), and the sodium-independent, stilbene-sensitive Cl-/HCO3- antiporter (AE). We report that under physiological conditions (balanced CO2 and HCO3-) chloroquine uptake and susceptibility are not altered by amiloride analogues. We also do not detect a significant difference in NHE activity between chloroquine-sensitive and chloroquine-resistant strains via single cell photometry methods. AE activity is dependent on the intracellular and extracellular concentrations of Cl- and HCO3- ions. Chloroquine-resistant strains differentially respond to experimental modifications in chloride-dependent homeostasis, including growth, cytoplasmic pH and pH regulation. Chloroquine susceptibility is altered by stilbene DIDS only on chloroquine-resistant strains. Our results suggest that a Cl(-)-dependent system (perhaps AE) has a significant effect on the uptake of chloroquine by the infected erythrocyte, and that alterations of this biophysical parameter may be part of the mechanism of chloroquine resistance in P. falciparum.

  16. The effect of metal-buffer bilayer drain/source electrodes on the operational stability of the organic field effect transistors

    International Nuclear Information System (INIS)

    Karimi-Alavijeh, H.R.; Ehsani, A.

    2015-01-01

    In this paper, we have investigated experimentally the effect of different drain/source (D/S) electrodes and charge injection buffer layers on the electrical properties and operational stability of a stilbene organic field effect transistor (OFET). The results show that the organic buffer layer of copper phthalocyanine (CuPc) considerably improves the electrical properties of the transistors, but has a negligible effect on their temporal behavior. On the other hand, inorganic metal-oxide buffer layer of molybdenum oxide (MoO 3 ) drastically changes both the electrical properties and operational stability. The functionalities of this metal-oxide tightly depend on the properties of the D/S metallic electrodes. OFETs with Al/MoO 3 as the bilayer D/S electrodes have the best electrical properties: field effect mobility μ eff = 0.32 cm 2 V −1 s −1 and threshold voltage V TH = − 5 V and the transistors with Ag/MoO 3 have the longest operational stability. It was concluded that the chemical stability of the metal/metal-oxide or metal/organic interfaces of the bilayer D/S electrodes determine the operational stability of the OFETs. - Highlights: • The effect of buffer layers on the performance of the stilbene OFETs has been investigated. • Inorganic buffer layer improved the electrical and temporal behaviors simultaneously. • Organic buffer layer only changes the electrical properties. • Chemical stability of the interfaces determines the operational stability of the transistor

  17. An Overview of Stress-Induced Resveratrol Synthesis in Grapes: Perspectives for Resveratrol-Enriched Grape Products

    Directory of Open Access Journals (Sweden)

    Mohidul Hasan

    2017-02-01

    Full Text Available Resveratrol is the most important stilbene phytoalexin synthesized naturally or induced in plants, as a part of their defense mechanism. Grapes and their derivative products, including juice and wine, are the most important natural sources of resveratrol, consisting of notably higher amounts than other natural sources like peanuts. Consumption of red wine with its presence of resveratrol explained the “French Paradox”. Hence, the demand of resveratrol from grapes is increasing. Moreover, as a natural source of resveratrol, grapes became very important in the nutraceutical industry for their benefits to human health. The accumulation of resveratrol in grape skin, juice, and wine has been found to be induced by the external stimuli: microbial infection, ultrasonication (US treatment, light-emitting diode (LED, ultra violet (UV irradiation, elicitors or signaling compounds, macronutrients, and fungicides. Phenylalanine ammonia lyase, cinnamate-4-hydroxylase, coumaroyl-CoA ligase, and stilbene synthase play a key role in the synthesis of resveratrol. The up-regulation of those genes have the positive relationship with the elicited accumulation of resveratrol. In this review, we encapsulate the effect of different external stimuli (biotic and abiotic stresses or signaling compounds in order to obtain the maximum accumulation of resveratrol in grape skin, leaves, juice, wine, and cell cultures.

  18. Organodioxygen complexes of some group 4B metal ions

    International Nuclear Information System (INIS)

    Tarafder, M.T.H.; Akhter Hossain; Gino Mariotto

    2003-09-01

    Organodioxygen complexes of some group 4B metal ions, viz., zirconium(IV), tin(IV) and lead(II) containing monodentate, bidentate and tridentate ligands were synthesized and characterized. The complexes have the compositions of [Zr(O)(O 2 )2C 5 H 5 N.H 2 O], [Zr(O)(O 2 - ) 2 .2OPPh 3 ], [Sn(O 2 )(C 9 H 6 NO) 2 ], [Sn(0 2 ) 2 .(CH 2 ) 2 (NH 2 ) 2 ], [Pb(O 2 - )(C 5 H 5 N) 2 NO 3 ], [Pb(O 2 )(C 8 H 6 NOH)], [Pb(O 2 - )(det)NO 3 ] and [PbO 2 - ) (C 5 H 4 NCOOH)NO 3 .H 2 O]. Because of apparent linearity of M- O 2 grouping, the V 1 (O-O) stretching modes were only Raman active, giving bands at 810- 841 cm 1 for the peroxo complexes (1, 3, ,4 and 6), while the bands in the superoxo complexes (2, 5, 7 and 8) appeared at 1020- 1100 cm -1 . The peroxo complex of Zr(IV) containing monodentate ligands were found to oxidize trans-stilbene to trans-stilbene oxide under stoichiometric conditions. The organoperoxo complexes of tin and lead were insensitive to oxidative processes. (author)

  19. Phenolic characterisation of red wines from different grape varieties cultivated in Mendoza province (Argentina).

    Science.gov (United States)

    Fanzone, Martín; Zamora, Fernando; Jofré, Viviana; Assof, Mariela; Gómez-Cordovés, Carmen; Peña-Neira, Álvaro

    2012-02-01

    Knowledge of the chemical composition of wine and its association with the grape variety/cultivar is of paramount importance in oenology and a necessary tool for marketing. Phenolic compounds are very important quality parameters of wines because of their impact on colour, taste and health properties. The aim of the present work was to study and describe the non-flavonoid and flavonoid composition of wines from the principal red grape varieties cultivated in Mendoza (Argentina). Sixty phenolic compounds, including phenolic acids/derivatives, stilbenes, anthocyanins, flavanols, flavonols and dihydroflavonols, were identified and quantified using high-performance liquid chromatography with diode array detection coupled with electrospray ionisation mass spectrometry (HPLC-DAD/ESI-MS). Marked quantitative differences could be seen in the phenolic profile among varieties, especially in stilbenes, acylated anthocyanins and other flavonoids. The polyphenolic content of Malbec wines was higher compared with the other red varieties. Dihydroflavonols represent a significant finding from the chemotaxonomic point of view, especially for Malbec variety. This is the first report on the individual phenolic composition of red wines from Mendoza (Argentina) and suggests that anthocyanins, flavanols and phenolic acids exert a great influence on cultivar-based differentiation. Copyright © 2011 Society of Chemical Industry.

  20. Metabolic Engineering of Yeast and Plants for the Production of the Biologically Active Hydroxystilbene, Resveratrol

    Science.gov (United States)

    Jeandet, Philippe; Delaunois, Bertrand; Aziz, Aziz; Donnez, David; Vasserot, Yann; Cordelier, Sylvain; Courot, Eric

    2012-01-01

    Resveratrol, a stilbenic compound deriving from the phenyalanine/polymalonate route, being stilbene synthase the last and key enzyme of this pathway, recently has become the focus of a number of studies in medicine and plant physiology. Increased demand for this molecule for nutraceutical, cosmetic and possibly pharmaceutic uses, makes its production a necessity. In this context, the use of biotechnology through recombinant microorganisms and plants is particularly promising. Interesting results can indeed arise from the potential of genetically modified microorganisms as an alternative mechanism for producing resveratrol. Strategies used to tailoring yeast as they do not possess the genes that encode for the resveratrol pathway, will be described. On the other hand, most interest has centered in recent years, on STS gene transfer experiments from various origins to the genome of numerous plants. This work also presents a comprehensive review on plant molecular engineering with the STS gene, resulting in disease resistance against microorganisms and the enhancement of the antioxidant activities of several fruits in transgenic lines. PMID:22654481

  1. Traditional usages, botany, phytochemistry, pharmacology and toxicology of Polygonum multiflorum Thunb.: a review.

    Science.gov (United States)

    Lin, Longfei; Ni, Boran; Lin, Hongmei; Zhang, Miao; Li, Xuechun; Yin, Xingbin; Qu, Changhai; Ni, Jian

    2015-01-15

    Polygonum multiflorum Thunb., which is known as Heshouwu ( in Chinese) in China. It is traditionally valued and reported for hair-blacking, liver and kidney-tonifying and anti-aging effects as well as low toxicity. The aim of this review is to provide comprehensive information on the botany, traditional uses, phytochemistry, pharmacological research and toxicology of Polygonum multiflorum, based on the scientific literature. Moreover, trends and perspectives for future investigation of this plant are discussed. It will build up a new foundation for further study on Polygonum multiflorum. A systematic review of the literature on Polygonum multiflorum was performed using several resources, including classic books on Chinese herbal medicine and various scientific databases, such as PubMed, SciFinder, the Web of Science, Science Direct, China Knowledge Resource Integrated (CNKI). Polygonum multiflorum is widely distributed throughout the world and has been used as a traditional medicine for centuries in China. The ethnomedical uses of Polygonum multiflorum have been recorded in many provinces of China and Japan for nine species of adulterants in six families. More than 100 chemical compounds have been isolated from this plant, and the major components have been determined to be stilbenes, quinones, flavonoids and others. Crude extracts and pure compounds of this plant are used as effective agents in pre-clinical and clinical practice due to their anti-aging, anti-hyperlipidaemia, anti-cancer and anti-inflammatory effects and to promote immunomodulation, neuroprotection, and the curing of other diseases. However, these extracts can also lead to hepatotoxicity, nephrotoxicity and embryonic toxicity. Pharmacokinetic studies have demonstrated that the main components of Polygonum multiflorum, such as 2,3,5,4'-tetrahydroxystilbene-2-O-β-d-glucopyranoside and emodin are distributed among many organs and tissues. Therapeutic potential of Polygonum multiflorum has been

  2. Discovery of efficient stimulators for adult hippocampal neurogenesis based on scaffolds in dragon's blood.

    Science.gov (United States)

    Liang, Jian-Hua; Yang, Liang; Wu, Si; Liu, Si-Si; Cushman, Mark; Tian, Jing; Li, Nuo-Min; Yang, Qing-Hu; Zhang, He-Ao; Qiu, Yun-Jie; Xiang, Lin; Ma, Cong-Xuan; Li, Xue-Meng; Qing, Hong

    2017-08-18

    Reduction of hippocampal neurogenesis caused by aging and neurological disorders would impair neural circuits and result in memory loss. A new lead compound (N-trans-3',4'-methylenedioxystilben-4-yl acetamide 27) has been discovered to efficiently stimulate adult rats' neurogenesis. In-depth structure-activity relationship studies proved the necessity of a stilbene scaffold that is absent in highly cytotoxic analogs such as chalcones and heteroaryl rings and inactive analogs such as diphenyl acetylene and diphenyl ethane, and validated the importance of an NH in the carboxamide and a methylenedioxy substituent on the benzene ring. Immunohistochemical staining and biochemical analysis indicate, in contrast to previously reported neuroprotective chemicals, N-stilbenyl carboxamides have extra capacity for neuroproliferation-type neurogenesis, thereby providing a foundation for improving the plasticity of the adult mammalian brain. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  3. Phytochemical review of Juncus L. genus (Fam. Juncaceae

    Directory of Open Access Journals (Sweden)

    Abdelsamed I. El-Shamy

    2015-09-01

    Full Text Available This review surveys the various naturally occurring compounds that have been isolated from different species of Juncus genus. This is the first review published on this topic. The present study furnishes an overview of all naturally isolated compounds, flavonoids, coumarines, terpenes, stilbenes, sterols, phenolic acids, carotenes, phenanthrenes derivatives (monomeric and dimeric and biological activities of these species. These plants have often been used in traditional medicine, and also have therefore been studied for their antitumor, antioxidant, antiviral, anti-algal, antimicrobial, cytotoxic and anti-inflammatory, significant anti-eczematic and hepatoprotective activity. On the basis of 48 references, this review covers the phytochemistry and pharmacology of Juncus species, describing compounds previously reported.

  4. Attenuation of neutrons and gamma-rays in homogeneous and multilayered shields

    International Nuclear Information System (INIS)

    Abdo, A.E.; Megahid, R.M.

    1997-01-01

    Measurements were carried-out to compare the attenuation properties of homogeneous shields and shields of two layers and three layers for fast neutrons and total gamma-rays. These were performed by measuring the fast neutron and total gamma-ray spectra behind homogeneous shields of magnetite-limonite, ilmenite-ilmenite and magnetite-magnetite concretes. The two layers assembly consists of iron and one of the above mentioned concretes, while the three layers shield consists of water, iron and one of the previously mentioned concretes. All measurements were carried-out using a neutron-gamma spectrometer with stilbene scintillator coupled to a fast photo multi player tube. Separation between pulses of recoil protons and recoil electrons was achieved by a pulse shape discrimination technique. 3 tabs., 10 figs., 13 refs

  5. Development and validation of a multi-residue method for the detection of a wide range of hormonal anabolic compounds in hair using gas chromatography-tandem mass spectrometry

    International Nuclear Information System (INIS)

    Rambaud, Lauriane; Monteau, Fabrice; Deceuninck, Yoann; Bichon, Emmanuelle; Andre, Francois; Le Bizec, Bruno

    2007-01-01

    The monitoring of anabolic steroid residues in hair is undoubtedly one of the most efficient strategies to demonstrate the long-term administration of these molecules in meat production animals. A multi-residue sample preparation procedure was developed and validated for 28 steroids. A 100 mg hair sample was grinded into powder and extracted at 50 deg. C with methanol. After acidic hydrolysis and extraction with ethyl acetate, phenolsteroids, such as estrogens, resorcyclic acid lactones and stilbens in one hand, are separated from androgens and progestagens in the other hand. Solid phase extractions were performed before applying a specific derivatisation for each compound sub-group. Detection and identification were achieved using gas chromatography-tandem mass spectrometry with acquisition in the selected reaction monitoring mode after electron ionisation. The method was validated according to the 2002/657/EC guideline. Decision limits (CCα) for main steroids were in the 0.1-10 μg kg -1 range

  6. An organic dye with very large Stokes-shift and broad tunability of fluorescence: Potential two-photon probe for bioimaging and ultra-sensitive solid-state gas sensor

    Energy Technology Data Exchange (ETDEWEB)

    He, Tingchao; Tian, Xiaoqing; Lin, Xiaodong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Wang, Yue; Zhao, Xin; Sun, Handong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [Division of Physics and Applied Physics, and Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Gao, Yang; Grimsdale, Andrew C. [School of Materials Science and Engineering, Nanyang Technological University, Singapore 639798 (Singapore)

    2016-01-04

    Light-emitting nonlinear optical molecules, especially those with large Stokes shifts and broad tunability of their emission wavelength, have attracted considerable attention for various applications including biomedical imaging and fluorescent sensors. However, most fluorescent chromophores have only limited potential for such applications due to small Stokes shifts, narrow tunability of fluorescence emissions, and small optical nonlinearity in highly polar solvents. In this work, we demonstrate that a two-photon absorbing stilbene chromophore exhibits a large two-photon absorption action cross-section (ηδ = 320 GM) in dimethylsulfoxide (DMSO) and shows broad fluorescence tunability (125 nm) by manipulating the polarity of the surrounding medium. Importantly, a very large Stokes shift of up to 227 nm is achieved in DMSO. Thanks to these features, this chromophore can be utilized as a two-photon probe for bioimaging applications and in an ultrasensitive solid-state gas detector.

  7. Definition and determination of the triplet-triplet energy transfer reaction coordinate.

    Science.gov (United States)

    Zapata, Felipe; Marazzi, Marco; Castaño, Obis; Acuña, A Ulises; Frutos, Luis Manuel

    2014-01-21

    A definition of the triplet-triplet energy transfer reaction coordinate within the very weak electronic coupling limit is proposed, and a novel theoretical formalism is developed for its quantitative determination in terms of internal coordinates The present formalism permits (i) the separation of donor and acceptor contributions to the reaction coordinate, (ii) the identification of the intrinsic role of donor and acceptor in the triplet energy transfer process, and (iii) the quantification of the effect of every internal coordinate on the transfer process. This formalism is general and can be applied to classical as well as to nonvertical triplet energy transfer processes. The utility of the novel formalism is demonstrated here by its application to the paradigm of nonvertical triplet-triplet energy transfer involving cis-stilbene as acceptor molecule. In this way the effect of each internal molecular coordinate in promoting the transfer rate, from triplet donors in the low and high-energy limit, could be analyzed in detail.

  8. Differential expression analysis of genic male sterility by cDNA-AFLP in maize

    International Nuclear Information System (INIS)

    Zhang Linbi; Rong Tingzhao; Pan Guangtang; Cao Moju

    2009-01-01

    The differential expression of male sterility induced by space flight with male fertility was studied using cDNA-AFLP technology. Total RNA was isolated from anther of male sterility and male fertility. Nine differential expression cDNA fragments were obtained with 16 primer combinations. The differential cDNA fragments were eluted, cloned and sequenced. Then half-quantitative RT-PCR was used to stuy the differential expressions of 4 development stages between sterility and fertility. Sequencing analysis shown 2 fragments from male sterility might be novel genes. Four fragments from male fertility were homology as chalcone and stilbene synthases, putative acyl CoA dehydrogenase, putative protein kinases and putative glycine decarboxylase. All these proteins might participate in the energy metabolisms, substance metabolisms or signal pollen development, Z8 took on increasing expression during the middle period of pollen development. These results just met the demand of more energy and more substance during the pollen development. (authors)

  9. Functional Foods and Nutraceuticals as Dietary Intervention in Chronic Diseases; Novel Perspectives for Health Promotion and Disease Prevention.

    Science.gov (United States)

    Adefegha, Stephen Adeniyi

    2017-12-27

    Functional foods describe the importance of foods in promoting health and preventing diseases aside their primary role of providing the body with the required amount of essential nutrients such as proteins, carbohydrates, vitamins, fats, and oils needed for its healthy survival. This review explains the interaction of functional food bioactive compounds including polyphenols (phenolic acids [hydroxybenzoic acids and hydroxycinnamic acids], flavonoids [flavonols, flavones, flavanols, flavanones, isoflavones, proanthocyanidins], stilbenes, and lignans), terpenoids, carotenoids, alkaloids, omega-3 and polyunsaturated fatty acids, among others with critical enzymes (α- amylase, α- glucosidase, angiotensin-I converting enzyme [ACE], acetylcholinesterase [AChE], and arginase) linked to some degenerative diseases (type-2 diabetes, cardiovascular diseases [hypertension], neurodegenerative diseases [Alzheimer's disease] and erectile dysfunction). Different functional food bioactive compounds may synergistically/additively confer an overwhelming protection against these degenerative diseases by modulating/altering the activities of these critical enzymes of physiological importance.

  10. Final LDRD report : advanced plastic scintillators for neutron detection.

    Energy Technology Data Exchange (ETDEWEB)

    Vance, Andrew L.; Mascarenhas, Nicholas; O' Bryan, Greg; Mrowka, Stanley

    2010-09-01

    This report summarizes the results of a one-year, feasibility-scale LDRD project that was conducted with the goal of developing new plastic scintillators capable of pulse shape discrimination (PSD) for neutron detection. Copolymers composed of matrix materials such as poly(methyl methacrylate) (PMMA) and blocks containing trans-stilbene (tSB) as the scintillator component were prepared and tested for gamma/neutron response. Block copolymer synthesis utilizing tSBMA proved unsuccessful so random copolymers containing up to 30% tSB were prepared. These copolymers were found to function as scintillators upon exposure to gamma radiation; however, they did not exhibit PSD when exposed to a neutron source. This project, while falling short of its ultimate goal, demonstrated the possible utility of single-component, undoped plastics as scintillators for applications that do not require PSD.

  11. Fast neutron-gamma discrimination on neutron emission profile measurement on JT-60U

    International Nuclear Information System (INIS)

    Ishii, K.; Okamoto, A.; Kitajima, S.; Sasao, M.; Shinohara, K.; Ishikawa, M.; Baba, M.; Isobe, M.

    2010-01-01

    A digital signal processing (DSP) system is applied to stilbene scintillation detectors of the multichannel neutron emission profile monitor in JT-60U. Automatic analysis of the neutron-γ pulse shape discrimination is a key issue to diminish the processing time in the DSP system, and it has been applied using the two-dimensional (2D) map. Linear discriminant function is used to determine the dividing line between neutron events and γ-ray events on a 2D map. In order to verify the validity of the dividing line determination, the pulse shape discrimination quality is evaluated. As a result, the γ-ray contamination in most of the beam heating phase was negligible compared with the statistical error with 10 ms time resolution.

  12. Biotechnological and molecular approaches for vanillin production: a review.

    Science.gov (United States)

    Kaur, Baljinder; Chakraborty, Debkumar

    2013-02-01

    Vanillin is one of the most widely used flavoring agents in the world. As the annual world market demand of vanillin could not be met by natural extraction, chemical synthesis, or tissue culture technology, thus biotechnological approaches may be replacement routes to make production of bio-vanillin economically viable. This review's main focus is to highlight significant aspects of biotechnology with emphasis on the production of vanillin from eugenol, isoeugenol, lignin, ferulic acid, sugars, phenolic stilbenes, vanillic acid, aromatic amino acids, and waste residues by applying fungi, bacteria, and plant cells. Production of biovanillin using GRAS lactic acid bacteria and metabolically engineered microorganisms, genetic organization of vanillin biosynthesis operons/gene cassettes and finally the stability of biovanillin generated through various biotechnological procedures are also critically reviewed in the later sections of the review.

  13. Resveratrol and Health

    DEFF Research Database (Denmark)

    This volume examines the phytoalexin resveratrol and the ongoing studies about its effects on lifespan and health. Resveratrol (3,5,4'-trihydroxy-trans-stilbene), a phytoalexin produced naturally by several plants when under attack by pathogens such as bacteria or fungi, significantly extends...... the lifespan of the yeast Saccharomyces cerevisiae, Caenorhabditis elegans and the fruit fly Drosophila melanogaster. Resveratrol is currently a topic of numerous animal and human studies into its effects. The effects of resveratrol on the lifespan of many model organisms remain controversial. Anti......-cancer, anti-inflammatory, blood-sugar-lowering, and other beneficial cardiovascular effects of resveratrol have been reported in experiments with mouse and rat model systems. However, most of these results have yet to be replicated in humans. Resveratrol is found in the skin of red grapes and is a constituent...

  14. Resveratrol products resulting by free radical attack

    Energy Technology Data Exchange (ETDEWEB)

    Bader, Yvonne; Quint, R.M. [Section Radiation Biology, Department of Nutritional Sciences, Faculty of Life Sciences, University of Vienna, UZAII, Althanstrasse 14, A-1090 Vienna (Austria); Getoff, Nikola [Section Radiation Biology, Department of Nutritional Sciences, Faculty of Life Sciences, University of Vienna, UZAII, Althanstrasse 14, A-1090 Vienna (Austria)], E-mail: nikola.getoff@univie.ac.at

    2008-06-15

    Trans-resveratrol (trans-3,4',5-trihydroxystilbene; RES), which is contained in red wine and many plants, is one of the most relevant and extensively investigated stilbenes with a broad spectrum of biological activities. Among other duties, RES has been reported to have anti-carcinogenetic activities, which could be attributed to its antioxidant properties. The degradation of RES was studied under various conditions. The products (aldehydes, carboxylic acids, etc.) generated from RES by the attack of free radicals were registered as a function of the radical concentration (absorbed radiation dose). Based on the obtained data it appears that the OH radicals are initiating the rather complicated process, which involves of the numerous consecutive reactions. A possible starting reaction mechanism is presented.

  15. Resveratrol Neuroprotection in Stroke and Traumatic CNS injury

    Science.gov (United States)

    Lopez, Mary; Dempsey, Robert J; Vemuganti, Raghu

    2015-01-01

    Resveratrol, a stilbene formed in many plants in response to various stressors, elicits multiple beneficial effects in vertebrates. Particularly, resveratrol was shown to have therapeutic properties in cancer, atherosclerosis and neurodegeneration. Resveratrol-induced benefits are modulated by multiple synergistic pathways that control oxidative stress, inflammation and cell death. Despite the lack of a definitive mechanism, both in vivo and in vitro studies suggest that resveratrol can induce a neuroprotective state when administered acutely or prior to experimental injury to the CNS. In this review, we discuss the neuroprotective potential of resveratrol in stroke, traumatic brain injury and spinal cord injury, with a focus on the molecular pathways responsible for this protection. PMID:26277384

  16. Scintillation response of organic and inorganic scintillators

    CERN Document Server

    Papadopoulos, L M

    1999-01-01

    A method to evaluate the scintillation response of organic and inorganic scintillators to different heavy ionizing particles is suggested. A function describing the rate of the energy consumed as fluorescence emission is derived, i.e., the differential response with respect to time. This function is then integrated for each ion and scintillator (anthracene, stilbene and CsI(Tl)) to determine scintillation response. The resulting scintillation responses are compared to the previously reported measured responses. Agreement to within 2.5% is observed when these data are normalized to each other. In addition, conclusions regarding the quenching parameter kB dependence on the type of the particle and the computed values of kB for certain ions are included. (author)

  17. Research on neutron energy spectrum of the beryllium, iron and polyethylene shells assemblies injected by D-T neutron

    International Nuclear Information System (INIS)

    An, Li; Guo, Haiping; Wang, Xinhua

    2009-04-01

    To test a simulation code, the multi-shell assemblies were established, which were made of beryllium stainless steel and polyethylene from the interior to the outer. The symmetry axes are all in the line of the D + beam. The neutron energy spectra above 1 MeV were obtained in medium by the detector of stilbene crystal of φ18 min x 20 mm. The distance between source and the spherical surface was 30 cm and 50 cm. The measurement channels are in the angle 0 degree and 120 degree relative to D + beam direction. The measurement positions are 0 cm, 9.7 cm, 12.8 cm and 17.3 cm away from the center of the assembly in both directions. The spectrum in different positions of the multi-shell assemblies in medium were compared and analyzed. (authors)

  18. Location effects on the polyphenolic and polysaccharidic profiles and colour of Carignan grape variety wines from the Chilean Maule region.

    Science.gov (United States)

    Cejudo-Bastante, María Jesús; Del Barrio-Galán, Rubén; Heredia, Francisco J; Medel-Marabolí, Marcela; Peña-Neira, Álvaro

    2018-04-01

    This paper reports on a study of chemical characterization and colour parameters of cv. Carignan red wines from six locations and two production years of the Chilean Maule valley. The chemical study was performed on polyphenolic composition (benzoic acids, hydroxycinnamic acid derivatives, stilbenes, flavan-3-ols, flavonols and anthocyanins) and several fractions of proanthocyanidins and polysaccharides. Results revealed that although significantly (p < 0.05) different content of anthocyanins were observed according to the production year, it could be possible to establish fingerprints of the different locations of the Maule valley wines. Thus, wines from zones closer to the Andes Mountains had higher content of procyanidin B3 (Caliboro), polysaccharides and cis-resveratrol-glucoside (Loncomilla and Melozal), whereas the proximity to the Pacific Ocean provoked a unifying effect in chemical and colorimetric terms (Cauquenes, Sauzal and Huerta del Maule). Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Red Wine Polyphenols for Cancer Prevention

    Science.gov (United States)

    He, Shan; Sun, Cuirong; Pan, Yuanjiang

    2008-01-01

    Conventional cancer therapies, the second leading cause of death worldwide, result in serious side effects and, at best, merely extend the patient's lifespan by a few years. Searching for effective prevention is of high priority in both basic and clinical sciences. In recent decades natural products have been considered to be an important source of cancer chemopreventive agents. Red wine polyphenols, which consisted of various powerful antioxidants such as flavonoids and stilbenes, have been implicated in cancer prevention and that promote human health without recognizable side effects. Since resveratrol, a major component of red wine polyphenols, has been studied and reviewed extensively for its chemopreventive activity to interfere with the multi-stage carcinogenesis, this review focuses on recent progress in studies on cancer chemopreventive activities of red wine polyphenol extracts and fractions as well as other red wine polyphenols, like procyanidin B5 analogues and myricetin. PMID:19325788

  20. Red Wine Polyphenols for Cancer Prevention

    Directory of Open Access Journals (Sweden)

    Yuanjiang Pan

    2008-05-01

    Full Text Available Conventional cancer therapies, the second leading cause of death worldwide, result in serious side effects and, at best, merely extend the patient's lifespan by a few years. Searching for effective prevention is of high priority in both basic and clinical sciences. In recent decades natural products have been considered to be an important source of cancer chemopreventive agents. Red wine polyphenols, which consisted of various powerful antioxidants such as flavonoids and stilbenes, have been implicated in cancer prevention and that promote human health without recognizable side effects. Since resveratrol, a major component of red wine polyphenols, has been studied and reviewed extensively for its chemopreventive activity to interfere with the multi-stage carcinogenesis, this review focuses on recent progress in studies on cancer chemopreventive activities of red wine polyphenol extracts and fractions as well as other red wine polyphenols, like procyanidin B5 analogues and myricetin.

  1. Highly pH-responsive sensor based on amplified spontaneous emission coupled to colorimetry.

    Science.gov (United States)

    Zhang, Qi; Castro Smirnov, Jose R; Xia, Ruidong; Pedrosa, Jose M; Rodriguez, Isabel; Cabanillas-Gonzalez, Juan; Huang, Wei

    2017-04-07

    We demonstrated a simple, directly-readable approach for high resolution pH sensing. The method was based on sharp changes in Amplified Spontaneous Emission (ASE) of a Stilbene 420 (ST) laser dye triggered by the pH-dependent absorption of Bromocresol Green (BG). The ASE threshold of BG:ST solution mixtures exhibited a strong dependence on BG absorption, which was drastically changed by the variations of the pH of BG solution. As a result, ASE on-off or off-on was observed with different pH levels achieved by ammonia doping. By changing the concentration of the BG solution and the BG:ST blend ratio, this approach allowed to detect pH changes with a sensitivity down to 0.05 in the 10-11 pH range.

  2. Inhomogeneity of neutron and gamma-ray attenuation in biological shields

    Energy Technology Data Exchange (ETDEWEB)

    El-bakkoush, F A; El-Ghobary, A M; Megahid, R M [Reactor and Neutron physics Department, Nuclear Research Center, A.E.A., Cairo (Egypt)

    1997-12-31

    Measurements have been carried-out to investigate the attenuation properties of some materials which are used as biological shields around nuclear radiation sources. Investigation was performed by measuring the transmitted fast neutron and gamma-spectra through cylindrical samples of magnetite- limonite, steel and cellulose shields. The neutron and gamma spectra were measured by a neutron-gamma spectrometer with stilbene scintillator. Discrimination between neutron and gamma pulses was achieved by a discrimination method. The obtained results are displayed in the form of neutron and gamma spectra and attenuation relations which are used to derive the total macroscopic cross-sections for neutrons and total linear attenuation coefficients for gamma-rays. The values of neutron and gamma relaxation lengths are also derived for the investigated materials. 10 figs., 1 tabs.

  3. Chemical constituents from Swartzia apetala Raddi var. glabra and evaluation of their antifungal activity against Candida spp.

    Directory of Open Access Journals (Sweden)

    Marcelo Francisco de Araujo

    Full Text Available From the hexanic extract of the stem from Swartzia apetala Raddi var. glabra were isolated one stilbene (1, one flavanone (2, one pterocarpan (3, one triterpene (4 and a mixture of three steroids (5 to 7. The crude extract and the compounds isolated were submitted to evaluation of the antifungal activity against nine yeast standard ATCC of the Candida genus. Among the compounds only the triterpene (4 and the mixture of steroids (5 to 7 showed no activity. The structures of the compounds were determined by spectral data analysis of GC/MS and ¹H and 13C NMR (1D and 2D experiments, as well as comparison with literature values.

  4. Neuroprotective effects of Resveratrol in Alzheimer Disease Pathology

    Directory of Open Access Journals (Sweden)

    Shraddha D Rege

    2014-09-01

    Full Text Available Alzheimer’s disease (AD is a chronic neurodegenerative disorder characterized by a progressive loss of cognitive and behavioral abilities. Extracellular senile plaques and intracellular neurofibrillary tangles are hallmarks of AD. Researchers aim to analyze the molecular mechanisms underlying AD pathogenesis; however, the therapeutic options available to treat this disease are inadequate. In the past few years, several studies have reported interesting insights about the neuroprotective properties of the polyphenolic compound resveratrol (3, 5, 4’-trihydroxy-trans-stilbene when used with in vitro and in vivo models of AD. The aim of this review is to focus on the neuroprotective and antioxidant effects of resveratrol on AD and its multiple potential mechanisms of action. In addition, because the naturally occurring forms of resveratrol have a very limited half-life in plasma, a description of potential analogues aimed at increasing bioavailability in plasma is also discussed.

  5. Ring strain and total syntheses of modified macrocycles of the isoplagiochin type

    Directory of Open Access Journals (Sweden)

    Andreas Speicher

    2009-12-01

    Full Text Available Macrocycles of the bisbibenzyl-type are natural products that are found exclusively in bryophytes (liverworts. The molecular framework of the subtype “isoplagiochin” is of substantial structural interest because of the chirality of the entire molecule, which arises from two biaryl axes in combination with two helical two-carbon units in a cyclic arrangement. From a structural as well as a synthetic point of view we report on the total synthesis of compounds which possess more rigid two-carbon biaryl bridges like stilbene (E or Z or even tolane moieties which were introduced starting with a Sonogashira protocol. The McMurry method proved to be a powerful tool for the cyclization to these considerably ring-strained macrocycles.

  6. Characterization of New-Generation Silicon Photomultipliers for Nuclear Security Applications

    Directory of Open Access Journals (Sweden)

    Wonders Marc A.

    2018-01-01

    Full Text Available Silicon photomultipliers have received a great deal of interest recently for use in applications spanning a wide variety of fields, including nuclear safeguards and nonproliferation. For nuclear-related applications, the ability of silicon photomultipliers to discriminate neutrons from gamma rays using pulse shape discrimination when coupled with certain organic scintillators is a characteristic of utmost importance. This work reports on progress characterizing the performance of twenty different silicon photomultipliers from five manufacturers with an emphasis on pulse shape discrimination performance and timing. Results are presented on pulse shape discrimination performance as a function of overvoltage for 6-mm x 6-mm silicon photomultipliers, and the time response to stilbene is characterized for silicon photomultipliers of three different sizes. Finally, comparison with a photomultiplier tube shows that some new-generation silicon photomultipliers can perform as well as photomultiplier tubes in neutron-gamma ray discrimination.

  7. Characterization of New-Generation Silicon Photomultipliers for Nuclear Security Applications

    Science.gov (United States)

    Wonders, Marc A.; Chichester, David L.; Flaska, Marek

    2018-01-01

    Silicon photomultipliers have received a great deal of interest recently for use in applications spanning a wide variety of fields, including nuclear safeguards and nonproliferation. For nuclear-related applications, the ability of silicon photomultipliers to discriminate neutrons from gamma rays using pulse shape discrimination when coupled with certain organic scintillators is a characteristic of utmost importance. This work reports on progress characterizing the performance of twenty different silicon photomultipliers from five manufacturers with an emphasis on pulse shape discrimination performance and timing. Results are presented on pulse shape discrimination performance as a function of overvoltage for 6-mm x 6-mm silicon photomultipliers, and the time response to stilbene is characterized for silicon photomultipliers of three different sizes. Finally, comparison with a photomultiplier tube shows that some new-generation silicon photomultipliers can perform as well as photomultiplier tubes in neutron-gamma ray discrimination.

  8. Fission-neutrons source with fast neutron-emission timing

    Energy Technology Data Exchange (ETDEWEB)

    Rusev, G., E-mail: rusev@lanl.gov; Baramsai, B.; Bond, E.M.; Jandel, M.

    2016-05-01

    A neutron source with fast timing has been built to help with detector-response measurements. The source is based on the neutron emission from the spontaneous fission of {sup 252}Cf. The time is provided by registering the fission fragments in a layer of a thin scintillation film with a signal rise time of 1 ns. The scintillation light output is measured by two silicon photomultipliers with rise time of 0.5 ns. Overall time resolution of the source is 0.3 ns. Design of the source and test measurements using it are described. An example application of the source for determining the neutron/gamma pulse-shape discrimination by a stilbene crystal is given.

  9. High-efficiency organic glass scintillators

    Science.gov (United States)

    Feng, Patrick L.; Carlson, Joseph S.

    2017-12-19

    A new family of neutron/gamma discriminating scintillators is disclosed that comprises stable organic glasses that may be melt-cast into transparent monoliths. These materials have been shown to provide light yields greater than solution-grown trans-stilbene crystals and efficient PSD capabilities when combined with 0.01 to 0.05% by weight of the total composition of a wavelength-shifting fluorophore. Photoluminescence measurements reveal fluorescence quantum yields that are 2 to 5 times greater than conventional plastic or liquid scintillator matrices, which accounts for the superior light yield of these glasses. The unique combination of high scintillation light-yields, efficient neutron/gamma PSD, and straightforward scale-up via melt-casting distinguishes the developed organic glasses from existing scintillators.

  10. Characterization of phenolic and other polar compounds in peel and flesh of pink guava (Psidium guajava L. cv. 'Criolla') by ultra-high performance liquid chromatography with diode array and mass spectrometric detection.

    Science.gov (United States)

    Rojas-Garbanzo, Carolina; Zimmermann, Benno F; Schulze-Kaysers, Nadine; Schieber, Andreas

    2017-10-01

    Pink guava (Psidium guajava L.) is a highly consumed fruit in tropical countries. Despite of interesting research on health effects of this fruit, investigations into the profile of secondary plant metabolites are scarce. In this study, the phenolic compounds in the peel and flesh of pink guava were characterized by ultra-high performance liquid chromatography with diode array and mass spectrometric detection. Sixty phenolic compounds were characterized by MS 2 and classified as ellagitannins, flavones, flavonols, flavanols, proanthocyanidins, dihydrochalcones, and anthocyanidins, and non-flavonoids such as phenolic acid derivatives, stilbenes, acetophenones, and benzophenones. Forty-two polyphenols are reported for the first time in both peel and flesh, and twenty-four compounds were detected for the first time in P. guajava, e.g., phlorizin, nothofagin, astringin, chrysin-C-glucoside, valoneic acid bilactone, cinnamoyl-glucoside, and two dimethoxycinnamoyl-hexosides. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Preparation of aromatic hydrocarbon monocrystals; Preparation de monocristaux d'hydrocarbures aromatiques

    Energy Technology Data Exchange (ETDEWEB)

    Baret, C; Hering, H; Pichat, L; Thommeret, J

    1951-04-01

    This report explains the technique developed and used for the production of organic monocrystals, necessary for the detection of {gamma} radiation. The Bridgman process has been used. A glass bulb containing the substance to be crystallized passes through a vertical thermo-regulated furnace maintained slightly above the fusion point of the substance. The bottom of the bulb has a conical section which ends with a thin capillary in order to obtain a single crystal nucleus. This method has been implemented to several hydrocarbons (naphthalene, anthracene, stilbene, tolan, tetraphenylethylene, tetra-phenyl-butadiene). The report describes successively: the furnaces, the process used for the filling of the bulbs, the degassing of the products, and for each compound, the details of the preparation and purification and the size of the obtained crystals. (J.S.)

  12. Neutron and photon spectrometry in mixed radiation fields

    International Nuclear Information System (INIS)

    Jancar, A.; Kopecky, Z.; Veskrna, M.

    2014-01-01

    Spectrometric measurements of the mixed fields of neutron and photon radiation in the workplaces with the L-R-0 research reactor located in the UJV Rez and with the Van de Graaff accelerator, located in the UTEF laboratories Prague, are presented in this paper. The experimental spectrometric measurements were performed using a newly developed digital measuring system, based on the technology of analog-digital converters with a very high sampling frequency (up to 2 GHz), in connection with organic scintillation detector, type BC-501A, and stilbene detector. The results of experimental measurements show high quality of spectrometry mixed fields of neutron and photon radiation across the wide dynamic range of measured energy. (authors)

  13. Total phenolic contents and free-radical scavenging activities of grape (Vitis vinifera L.) and grape products.

    Science.gov (United States)

    Keser, Serhat; Celik, Sait; Turkoglu, Semra

    2013-03-01

    Grape is one of the world's largest fruit crops, with an approximate annual production of 58 million metric tons, and it is well known that the grape skins, seeds and stems, waste products generated during wine and grape juice processing, are rich sources of polyphenols. It contains flavonoids, phenolic acids and stilbenes. In this study, we tried to determine antioxidant properties and phenolic contents of grape and grape products (fresh fruit, seed, dried fruit, molasses, pestil, vinegar) of ethanol and water extracts. Antioxidant properties of extracts were investigated by DPPH(√), ABTS(√+), superoxide, H(2)O(2) scavenging, reducing power, metal chelating activity and determination of total phenolic contents. The seed extracts revealed highest ABTS(√+), DPPH(√), H(2)O(2) scavenging and reducing power activities. Furthermore, these extracts showed higher total phenolic contents than other grape product extracts.

  14. Syntheses of Resveratrol Analogues and Evaluation of Their Antioxidant Activity

    International Nuclear Information System (INIS)

    Kim, Mi Jeong; Jung, Se Hoon; Moon, Insu; Jun Jonggab; Lee, Jeong Tae

    2014-01-01

    Free radicals such as superoxide anion radicals (O 2 · - ), hydroxyl radicals (·OH) and non-free radical species such as hydrogen peroxide (H 2 O 2 ) and singlet oxygen ( 1 O 2 ) are considered as ROS. These ROS not only oxidize membrane lipids but damage nucleic acids, proteins and carbohydrates leading to mutations. If ROS are not scavenged by antioxidants, they could be involved in ageing and various diseases related to oxidative stress. Resveratrol is a natural phytoalexin found in the skin of grapes, red wines, and peanuts. It has three hydroxyl groups at the trans-stilbene structure, in which resorcinol and phenol are bridged by a trans double bond. The recent extensive studies on the resveratrol and its derivatives revealed that they have antioxidant, antimutagenic, antiinflammatory, antidiabetic, cardiovascular protective, and anticancer properties. It has been believed that the majority of the biological functions of resveratrol has been attributed to its antioxidant activity

  15. Induction of defence mechanisms in grapevine leaves by emodin- and anthraquinone-rich plant extracts and their conferred resistance to downy mildew.

    Science.gov (United States)

    Godard, Sophie; Slacanin, Ivan; Viret, Olivier; Gindro, Katia

    2009-09-01

    The ability of two plant extracts, Rheum palmatum root extract (RPRE) and Frangula alnus bark extract (FABE), to protect Vitis vinifera leaves from Plasmopara viticola infection was evaluated. These natural products are toxic to the pathogen and induce defence reactions in a susceptible cultivar of V. vinifera (V. vinifera cv. Chasselas), including stilbenic phytoalexin accumulation, enhanced peroxidase (EC 1.11.1.7) activity, and a hypersensitive reaction. Inhibition of the first stage of biotrophic hyphal development of P. Viticola by the two plant extracts was observed. HPLC-DAD-MS analysis showed that these two natural extracts contain many phenolic compounds belonging to the anthraquinone family, such as rhein, frangulin A, emodin, aloe-emodin, chrysophanol, and physcion. Emodin alone is able to impair P. viticola development and to stimulate viniferins and the accumulation of pterostilbene.

  16. Passive assay of plutonium metal plates using a fast-neutron multiplicity counter

    Energy Technology Data Exchange (ETDEWEB)

    Di Fulvio, A., E-mail: difulvio@umich.edu [Department of Nuclear Engineering & Radiological Sciences, University of Michigan, Ann Arbor, MI 48109 (United States); Shin, T.H.; Jordan, T.; Sosa, C.; Ruch, M.L.; Clarke, S.D. [Department of Nuclear Engineering & Radiological Sciences, University of Michigan, Ann Arbor, MI 48109 (United States); Chichester, D.L. [Idaho National Laboratory, Idaho Falls, ID 83415 (United States); Pozzi, S.A. [Department of Nuclear Engineering & Radiological Sciences, University of Michigan, Ann Arbor, MI 48109 (United States)

    2017-05-21

    We developed a fast-neutron multiplicity counter based on organic scintillators (EJ-309 liquid and stilbene). The system detects correlated photon and neutron multiplets emitted by fission reactions, within a gate time of tens of nanoseconds. The system was used at Idaho National Laboratory to assay a variety of plutonium metal plates. A coincidence counting strategy was used to quantify the {sup 240}Pu effective mass of the samples. Coincident neutrons, detected within a 40-ns coincidence window, show a monotonic trend, increasing with the {sup 240}Pu-effective mass (in this work, we tested the 0.005–0.5 kg range). After calibration, the system estimated the {sup 240}Pu effective mass of an unknown sample ({sup 240}Pu{sub eff} >50 g) with an uncertainty lower than 1% in a 4-min assay time.

  17. Innovative Route to Prepare of Au/C Catalysts by Replication of Gold-containing Mesoporous Silicas

    KAUST Repository

    Kerdi, Fatmé

    2011-12-23

    Gold-catalyzed aerobic epoxidations in the liquid phase are generally performed in low-polarity solvents, in which conventional oxide-supported catalysts are poorly dispersed. To improve the wettability of the catalytic powder and, thus, the efficiency of the catalyst, gold nanoparticles (NPs) have been dispersed on meso-structured carbons. Gold is first introduced in functionalized mesostructured silica and particles are formed inside the porosity. Silica pores are then impregnated with a carbon precursor and the composite material is heated at 900 °C under vacuum or nitrogen. Silica is then removed by acid leaching, leading to partially encapsulated gold particles in mesoporous carbon. Carbon prevents aggregation of gold particles at high temperature, both the mean size and distribution being similar to those observed in silica. However, while Au@SiO2 exhibit significant catalytic activity in the aerobic oxidation of trans-stilbene in the liquid phase, its Au@C mesostructured replica is quite inactive.

  18. Innovative preparation of Au/C by replication of gold-containing mesoporous silica catalysts

    KAUST Repository

    Kerdi, Fatmé

    2010-01-01

    A new strategy, based on the nanocasting concept, has been used to prepare gold nanoparticles (NPs) highly dispersed in meso-structured carbons. Gold is first introduced in various functionalized mesostructured silicas (MCM-48 and SBA-15) and particles are formed inside the porosity upon reduction of Au 3+ cations. Silica pores are then impregnated with a carbon precursor and the composite material is heated at 900°C under vacuum. Silica is then removed by acid leaching, leading to partially encapsulated gold particles in mesoporous carbon. Carbon prevents aggregation of gold particles at high temperature, both the mean size and distribution being similar to those observed in silica. However, while Au@SiO2 exhibit significant catalytic activity in the aerobic oxidation of trans-stilbene in the liquid phase, its Au@C mesostructured replica is quite inactive. © 2010 Elsevier B.V. All rights reserved.

  19. Neutron spectrometer for improved SNM search.

    Energy Technology Data Exchange (ETDEWEB)

    Vance, Andrew L.; Aigeldinger, Georg

    2007-03-01

    With the exception of large laboratory devices with very low sensitivities, a neutron spectrometer have not been built for fission neutrons such as those emitted by special nuclear materials (SNM). The goal of this work was to use a technique known as Capture Gated Neutron Spectrometry to develop a solid-state device with this functionality. This required modifications to trans-stilbene, a known solid-state scintillator. To provide a neutron capture signal we added lithium to this material. This unique triggering signal allowed identification of neutrons that lose all of their energy in the detector, eliminating uncertainties that arise due to partial energy depositions. We successfully implemented a capture gated neutron spectrometer and were able to distinguish an SNM like fission spectrum from a spectrum stemming from a benign neutron source.

  20. Effects of radical initiators, polymerization inhibitors, and other agents on the sonochemical unzipping of double-walled carbon nanotubes

    Science.gov (United States)

    Fukumori, Minoru; Hara, Shinnosuke; Ogawa, Takuji; Tanaka, Hirofumi

    2018-03-01

    The mechanism of graphene nanoribbon synthesis by the sonication-assisted unzipping of carbon nanotubes (CNTs) was investigated utilizing 4-methoxyphenol and 1,4-dimethoxybenzene as moieties of poly[(m-phenylenevinylene)-co-(2,5-dioctoxy-p-phenylenevinylene)]. The obtained results revealed that unzipping was promoted by 4-methoxyphenol owing to the facile abstraction of its phenolic hydrogen by sonication-generated radicals on CNTs, whereas 1,4-dimethoxybenzene did not facilitate unzipping, since its methoxy hydrogens were hardly abstracted. Moreover, unzipping was also facilitated by trans-stilbene, the double bond of which reacts with CNT radicals. Furthermore, we succeeded in using a general radical initiator, namely, 2,2‧-azobis[2-(2-imidazolin-2-yl)propane]dihydrochloride to promote unzipping, confirming that it is promoted by radical donors/trapping agents.

  1. A Time of flight spectrometer for measurements of double differential neutron scattering cross sections

    International Nuclear Information System (INIS)

    Padron, I.; Dominguez, O.; Sarria, P. Sandin, C.

    1996-01-01

    The time -of-Flight neutron spectrometry technique by associated particle method was improved using a D-T neutron generator at Laboratory of Nuclear Analysis. This technique was implemented for double differential cross section measurements and supported by the IAEA Project CUB/01/005. An stilbene scintillation detector (dia=100 mm, length=50 mm) was used as principal neutron detector detector and was situated outside a hole in the concrete wall. This way the fligth path was extended and the scattered neutron cone accurate collimated throught the 2 m concrete wall. For the associated particle α detection a thin plastic NE-102 scint illator was used, as well as, two scintilation detectors and a long counter for the neutron flux monitoring. In this TOF neutron spectrometer (3.40 m flight path) a 1.7 nseg. temporal resolution was obtained

  2. A Time of flight spectrometer for measurements of double differential neutron scattering cross sections; Montaje de un espectrometro por tiempo de vuelo para la medicion de secciones doble diferenciales de dispersion de neutrones

    Energy Technology Data Exchange (ETDEWEB)

    Padron, I; Dominguez, O; Sarria, P. Sandin, C. [Centro de Estudios Aplicados al Desarrollo Nuclear (CEADEN), La Habana (Cuba)

    1996-05-01

    The time -of-Flight neutron spectrometry technique by associated particle method was improved using a D-T neutron generator at Laboratory of Nuclear Analysis. This technique was implemented for double differential cross section measurements and supported by the IAEA Project CUB/01/005. An stilbene scintillation detector (dia=100 mm, length=50 mm) was used as principal neutron detector detector and was situated outside a hole in the concrete wall. This way the fligth path was extended and the scattered neutron cone accurate collimated throught the 2 m concrete wall. For the associated particle {alpha} detection a thin plastic NE-102 scint illator was used, as well as, two scintilation detectors and a long counter for the neutron flux monitoring. In this TOF neutron spectrometer (3.40 m flight path) a 1.7 nseg. temporal resolution was obtained.

  3. Chemical Constituents from the Lianas of Gnetum cuspidatum Blume

    International Nuclear Information System (INIS)

    Nik Fatini Nik Azmin; Norizan Ahmat; Nik Khairunissa Nik Abdullah Zawawi; Norizan Ahmat; Nik Khairunissa Nik Abdullah Zawawi

    2016-01-01

    Gnetum is a genus of gymnosperms, the sole genus in the family Gnetaceae with approximately 40 species. Various species has been used for the treatment of rheumatitis, arthritis, bronchitis and asthma in folk medicines. Gnetum cuspidatum Blume is known throughout tropical Southeast Asia from Thailand, Vietnam, Cambodia, Malaysia, Sumatra, Java, and Borneo to the Maluku, Sulawesi and New Guinea. In this research work, a methanol extract of the lianas of Gnetum cuspidatum was subjected to vacuum liquid chromatography for fractionation. Later, several selective fractions had undergone the repetitive radial chromatography technique for further purification. Four known constituents categorized as stilbene type of compound have been successfully isolated and identified which include resveratrol (1), gnetucleistol C (2), gnetucleistol D (3) and gnemonol M (4). The structures and configuration of the reported compounds were elucidated on the basis of 2D-NMR correlations and comparison with the literature. (author)

  4. Hydrofluorination of Alkynes Catalysed by Gold Bifluorides.

    Science.gov (United States)

    Nahra, Fady; Patrick, Scott R; Bello, Davide; Brill, Marcel; Obled, Alan; Cordes, David B; Slawin, Alexandra M Z; O'Hagan, David; Nolan, Steven P

    2015-01-01

    We report the synthesis of nine new N -heterocyclic carbene gold bifluoride complexes starting from the corresponding N -heterocyclic carbene gold hydroxides. A new methodology to access N,N' -bis(2,6-diisopropylphenyl)imidazol-2-ylidene gold(I) fluoride starting from N,N' -bis(2,6-diisopropylphenyl)imidazol-2-ylidene gold(I) hydroxide and readily available potassium bifluoride is also reported. These gold bifluorides were shown to be efficient catalysts in the hydrofluorination of symmetrical and unsymmetrical alkynes, thus affording fluorinated stilbene analogues and fluorovinyl thioethers in good to excellent yields with high stereo- and regioselectivity. The method is exploited further to access a fluorinated combretastatin analogue selectively in two steps starting from commercially available reagents.

  5. HIV-1 protease inhibitory substances from Cassia garrettiana

    Directory of Open Access Journals (Sweden)

    Jindaporn Puripattanvong

    2007-01-01

    Full Text Available Cassia garrettiana Craib, a Thai medicinal plant locally known as Samae-sarn, was investigated for its active constituents against HIV-1 protease (HIV-1 PR. Bioassay-guided fractionation of the heart woodof this plant led to the isolation of a stilbene derivative (1, piceatannol and an anthraquinone derivative (2, chrysophanol. Piceatannol exhibited appreciable inhibitory effect against HIV-1 PR with an IC50 value of25.4 μg/ml, whereas that of chrysophanol was 73.5 μg/ml. In addition, other two stilbenoids together with three anthraquinone derivatives were also investigated for their anti-HIV-1 PR activities. The resultindicated that resveratrol possessed anti-HIV-1 PR activity with an IC50 value of 85.0 μg/ml, whereas other stilbenoid (oxyresveratrol and anthraquinone derivatives (emodin, aloe-emodin, rhein were inactive (IC50 > 100 μg/ml.

  6. Vinyldisiloxanes: their synthesis, cross coupling and applications.

    Science.gov (United States)

    Sore, Hannah F; Boehner, Christine M; Laraia, Luca; Logoteta, Patrizia; Prestinari, Cora; Scott, Matthew; Williams, Katharine; Galloway, Warren R J D; Spring, David R

    2011-01-21

    During the studies towards the development of pentafluorophenyldimethylsilanes as a novel organosilicon cross coupling reagent it was revealed that the active silanolate and the corresponding disiloxane formed rapidly under basic conditions. The discovery that disiloxanes are in equilibrium with the silanolate led to the use of disiloxanes as cross coupling partners under fluoride free conditions. Our previous report focused on the synthesis and base induced cross coupling of aryl substituted vinyldisiloxanes with aryl halides; good yields and selectivities were achieved. As a continuation of our research, studies into the factors which influence the successful outcome of the cross coupling reaction with both alkyl and aryl substituted vinyldisiloxanes were examined and a proposed mechanism discussed. Further investigation into expanding the breadth and diversity of substituted vinyldisiloxanes in cross coupling was explored and applied to the synthesis of unsymmetrical trans-stilbenes and cyclic structures containing the trans-alkene architecture.

  7. The radiation chemistry of organic amides: Pt. 1

    International Nuclear Information System (INIS)

    Langan, J.R.; Liu, K.J.; Salmon, G.A.; Edwards, P.P.; Ellaboudy, A.; Holton, D.M.

    1989-01-01

    Pulse radiolysis of four cyclic amides including N-methylpyrrolidinone (NMP), and the non-cyclic amide tetramethylurea (TMU) yielded absorption spectra in the near infrared that are attributed to solvated electrons. Addition of a variety of alkali-metal salts caused no detectable change in the absorption spectrum of e s - and no new absorptions attributable to alkali-metal anions were detected. The effect of dose on the decay of e s - in NMP was studied in detail. The yields of e s - in these amides were estimated by using trans-stilbene as an electron scavenger. Absorption spectra, which are not removed by saturation with N 2 O and CO 2 , are observed in the wavelength range 300-500 nm. (author)

  8. Recent developments in plastic scintillators with pulse shape discrimination

    Science.gov (United States)

    Zaitseva, N. P.; Glenn, A. M.; Mabe, A. N.; Carman, M. L.; Hurlbut, C. R.; Inman, J. W.; Payne, S. A.

    2018-05-01

    The paper reports results of studies conducted to improve scintillation performance of plastic scintillators capable of neutron/gamma pulse-shape discrimination (PSD). Compositional modifications made with the polymer matrix improved physical stability, allowing for increased loads of the primary dye that, in combination with selected secondary dyes, provided enhanced PSD especially important for the lower energy ranges. Additional measurements were made with a newly-introduced PSD plastic EJ-276, that replaces the first commercially produced EJ-299. Comparative studies conducted with the new materials and EJ-309 liquids at large scale (up to 10 cm) show that current plastics may provide scintillation and PSD performance sufficient for the replacement of liquid scintillators. Comparison to stilbene single crystals compliments the information about the status of the solid-state materials recently developed for fast neutron detection applications.

  9. Rapid identification and simultaneous analysis of multiple constituents from Rheum tanguticum Maxim. ex Balf. by UPLC/Q-TOF-MS.

    Science.gov (United States)

    Gao, Liang-Liang; Guo, Tao; Xu, Xu-Dong; Yang, Jun-Shan

    2017-07-01

    Rhubarb contains biologically active compounds such as anthraquinones, anthrones, stilbenes and tannins. A rapid and efficient UPLC/Q-TOF-MS/MS method was developed and applied towards identifying the constituents of Rheum tanguticum Maxim. ex Balf. for the first time. Chemical constituents were separated and investigated by UPLC/Q-TOF-MS/MS in the negative ion mode. The ESI-MS 2 fragmentation pathways of four types of compounds were interpreted, providing a very useful guidance for the characterisation of different types of compounds. Based on the exact mass information, fragmentation characteristic and LC retention time of 7 reference standards, 30 constituents were tentatively identified from the methanol extract of R. tanguticum. Among them, seven compounds were described for the first time from R. tanguticum and two from the genus Rheum were described for the first time. The analytical tool used here is valuable for the rapid separation and identification of multiple and minor constituents in methanol extracts of R. tanguticum.

  10. Phenolics in Slovenian bilberries ( Vaccinium myrtillus L.) and blueberries ( Vaccinium corymbosum L.).

    Science.gov (United States)

    Moze, Spela; Polak, Tomaz; Gasperlin, Lea; Koron, Darinka; Vanzo, Andreja; Poklar Ulrih, Natasa; Abram, Veronika

    2011-07-13

    Phenolics from bilberries ( Vaccinium myrtillus L.) sampled from seven different locations and highbush blueberries ( Vaccinium corymbosum L.) from one location in Slovenia were analyzed. In samples of both species 15 anthocyanins were identified by LC-MS/MS. Their contents were expressed as cyanidin 3-glucoside equivalents (C3GE); bilberries contained 1210.3 ± 111.5 mg C3GE/100 g fw and blueberries 212.4 ± 14.1 mg C3GE/100 g fw. Glycosides of delphinidin and cyanidin were predominant (488.5 vs 363.6 mg C3GE/100 g fw) in the bilberries and glycosides of malvidin (108.0 vs 100.8 mg C3GE/100 g fw) in the blueberries, whereas the contents of peonidin were lowest (74.5 vs 4.8 mg C3GE/100 g fw) in both berries. The contents of flavanols, flavonols, phenolic acids, and stilbenes were determined by LC-MS. For the first time, rutin was identified (bilberries, 0.2 ± 0.0 mg/100 g fw; blueberries, 3.1 ± 0.1 mg/100 g fw). Chlorogenic acid (as 3-caffeoylquinic acid) was the most abundant among the phenolic acids (23.1 ± 1.0 mg/100 g fw in bilberries and 70.0 ± 3.4 mg/100 g fw in blueberries). Statistical analysis shows that the content of 27 individual flavonoids, phenolic acids, and stilbenes can be used to identify the picking region of these Slovenian bilberries.

  11. Pharmacometrics of 3-Methoxypterostilbene: A Component of Traditional Chinese Medicinal Plants

    Directory of Open Access Journals (Sweden)

    Stephanie E. Martinez

    2013-01-01

    Full Text Available 3-Methoxypterostilbene is a naturally occurring stilbene with potential in the treatment of diabetes. The preclinical pharmacokinetics and pharmacodynamics of 3-methoxypterostilbene were evaluated in the present study. The right jugular veins of male Sprague-Dawley rats were cannulated. The rats were dosed 10 mg/kg or 100 mg/kg of 3-methoxypterostilbene intravenously (IV or orally (PO, respectively. Serum and urine samples were analyzed using a previously validated reversed-phase HPLC method. Serum AUC, serum t1/2, urine t1/2, Cltotal, and Vd for IV dosing were 48.1±23.8 μg/h/mL, 18.9 ± 10.9 h, 9.54 ± 1.51 h, 47.8 ± 23.7 L/h/kg, and 5.11±0.38 L/kg, respectively (mean ± SEM, n=4 . Serum AUC, serum t1/2, urine t1/2, Cltotal, and Vd for PO dosing were 229±44.6 μg/h/mL, 73.3±8.91 h, 20.6±3.01 h, 0.48±0.008 L/h/kg, and 52.0±10.5 L/kg, respectively (mean ± SEM, n=4. Bioavailability of the stilbene was determined to be 50.6%  ± 10.0%. A 3-methoxypterostilbene glucuronidated metabolite was detected in both serum and urine. 3-Methoxypterostilbene exhibited antidiabetic activity including α-glucosidase and α-amylase inhibition as well as concentration-dependent antioxidant capacity similar to resveratrol. 3-Methoxypterostilbene also exhibited anti-inflammatory activity. 3-Methoxypterostilbene appears to be a bioactive compound and may be useful in reducing postprandial hyperglycemia.

  12. Femtosecond quantum dynamics and laser-cooling in thermal molecular systems

    International Nuclear Information System (INIS)

    Warmuth, C.

    2000-01-01

    This work deals with coherent and incoherent vibrational phenomena in thermal systems, wave packet motion and laser-cooling. In the first part, the principle of COIN (Coherence Observation by Interference Noise) has been applied as a new approach to measuring wave packet motion. In the experiment pairs of phase-randomized femtosecond pulses with relative delay-time τ prepare interference fluctuations in the excited state population, so the variance of the correlated fluorescence intensity directly mimics the dynamics of the propagating wave packet. The scheme is demonstrated by measuring the vibrational coherence of wave packet-motion in the B-state of gaseous iodine. The COIN-interferograms obtained recover propagation, recurrences, spreading, and revivals as the typical signature of wave packets. Due to the disharmony of the B-state-potential, fractional revivals have also been found showing the potential of the COIN-technique in quantum-dynamical research. In the second part the fluorescence lifetime of trans-stilbene, isolated and in the presence of 1 atm of Ar gas, respectively, was measured as a function of the detuning of the excitation frequency from the frequency of the 0-0-transition ω 0 . The lifetime was found to decrease on both sides of ω 0 , but the dependence of the lifetime on detuning in the presence of Ar gas is much weaker than for the isolated molecule. Both observations corroborate previous theoretical predictions of laser-cooling of thermal trans-stilbene upon excitation at the ω 0 frequency. The experimental results are in good agreement with theoretical analysis. (author)

  13. Synergistic effects of polyphenols and methylxanthines with Leucine on AMPK/Sirtuin-mediated metabolism in muscle cells and adipocytes.

    Directory of Open Access Journals (Sweden)

    Antje Bruckbauer

    Full Text Available The AMPK-Sirt1 pathway is an important regulator of energy metabolism and therefore a potential target for prevention and therapy of metabolic diseases. We recently demonstrated leucine and its metabolite β-hydroxy-β-methylbutyrate (HMB to synergize with low-dose resveratrol (200 nM to activate sirtuin signaling and stimulate energy metabolism. Here we show that leucine exerts a direct effect on Sirt1 kinetics, reducing its Km for NAD(+ by >50% and enabling low doses of resveratrol to further activate the enzyme (p = 0.012. To test which structure elements of resveratrol are necessary for synergy, we assessed potential synergy of structurally similar and dissimilar polyphenols as well as other compounds converging on the same pathways with leucine using fatty acid oxidation (FAO as screening tool. Dose-response curves for FAO were constructed and the highest non-effective dose (typically 1-10 nM was used with either leucine (0.5 mM or HMB (5 µM to treat adipocytes and myotubes for 24 h. Significant synergy was detected for stilbenes with FAO increase in adipocytes by 60-70% (p2000% (p1 µM and exhibited little or no synergy. Thus, the six-carbon ring structure bound to a carboxylic group seems to be a necessary element for leucine/HMB synergy with other stilbenes and hydroxycinnamic acids to stimulate AMPK/Sirt1 dependent FAO; these effects occur at concentrations that produce no independent effects and are readily achievable via oral administration.

  14. Association between Polyphenol Intake and Hypertension in Adults and Older Adults: A Population-Based Study in Brazil.

    Directory of Open Access Journals (Sweden)

    Andreia Machado Miranda

    Full Text Available Hypertension is an important risk factor for cardiovascular disease, and diet has been identified as a modifiable factor for preventing and controlling hypertension. Besides, epidemiological studies have suggested an inverse association between polyphenol intake and cardiovascular diseases. The aim of this study was to evaluate the association between the intake of polyphenols and hypertension in a general population of Sao Paulo.Data came from the 'Health Survey of Sao Paulo (ISA-Capital' among 550 adults and older adults in Sao Paulo, Brazil. Diet was assessed by two 24-hour dietary recalls (24HR. Usual intakes were calculated using the Multiple Source Method. Polyphenol intake was calculated by matching food consumption data from the 24HR with the Phenol-Explorer database. The associations between the hypertension and tertiles of the total and classes of polyphenols intake were tested by multivariate logistic regression analysis.After multivariate adjustment for potential confounding factors the findings showed an inverse and linearly association between the hypertension and highest tertiles of tyrosols (OR = 0.33; 95%CI 0.18, 0.64, alkylphenols (OR = 0.45; 95%CI 0.23, 0.87, lignans (OR = 0.49; 95%CI 0.25, 0.98, as well as stilbenes (OR = 0.60; 95%CI 0.36, 0.98, and other polyphenols (OR = 0.33; 95%CI 0.14, 0.74. However, total polyphenol intake, and phenolic acids were significantly associated only in the middle tertile with hypertension and flavonoids were not significant associated.There is an inverse and linearly association between the highest tertile of some classes of polyphenols, such as, tyrosols, alkylphenols, lignans, stilbenes, other polyphenols and hypertension.

  15. Cytotoxicity of Labruscol, a New Resveratrol Dimer Produced by Grapevine Cell Suspensions, on Human Skin Melanoma Cancer Cell Line HT-144

    Directory of Open Access Journals (Sweden)

    Laetitia Nivelle

    2017-11-01

    Full Text Available A new resveratrol dimer (1 called labruscol, has been purified by centrifugal partition chromatography of a crude ethyl acetate stilbene extract obtained from elicited grapevine cell suspensions of Vitis labrusca L. cultured in a 14-liter stirred bioreactor. One dimensional (1D and two dimensional (2D nuclear magnetic resonance (NMR analyses including 1H, 13C, heteronuclear single-quantum correlation (HSQC, heteronuclear multiple bond correlation (HMBC, and correlation spectroscopy (COSY as well as high-resolution electrospray ionisation mass spectrometry (HR-ESI-MS were used to characterize this compound and to unambiguously identify it as a new stilbene dimer, though its relative stereochemistry remained unsolved. Labruscol was recovered as a pure compound (>93% in sufficient amounts (41 mg to allow assessment of its biological activity (cell viability, cell invasion and apoptotic activity on two different cell lines, including one human skin melanoma cancer cell line HT-144 and a healthy human dermal fibroblast (HDF line. This compound induced almost 100% of cell viability inhibition in the cancer line at a dose of 100 μM within 72 h of treatment. However, at all tested concentrations and treatment times, resveratrol displayed an inhibition of the cancer line viability higher than that of labruscol in the presence of fetal bovine serum. Both compounds also showed differential activities on healthy and cancer cell lines. Finally, labruscol at a concentration of 1.2 μM was shown to reduce cell invasion by 40%, although no similar activity was observed with resveratrol. The cytotoxic activity of this newly-identified dimer is discussed.

  16. In vitro evaluation of antiproliferative and cytotoxic properties of pterostilbene against human colon cancer cells.

    Science.gov (United States)

    Wawszczyk, Joanna; Kapral, Małgorzata; Hollek, Andrzej; Węglarz, Ludmiła

    2014-01-01

    Colon cancer has been remaining the second leading cause of cancer mortality in Poland in the last years. Epidemiological, preclinical and clinical studies reveal that dietary phytochemicals may exert chemopreventive and therapeutic effect against colorectal cancer. There is a growing interest in identifying new biologically active agents from dietary sources in this respect. Pterostilbene (trans-3,5-dimethoxy-4-hydroxystilbene) is a naturally occurring stilbene, that has been found to have antioxidative, anti-inflammatory and antipro- liferative properties. Compared to other stilbenes, pterostilbene has greater bioavailability, and so, a greater potential for clinical applications. Recent studies showed that pterostilbene exhibits the hallmark characteristics of an anticancer agent. The aim of this study was to analyze antiproliferative and cytotoxic effects of pterostilbene on human colon cancer Caco-2 cells. They were cultured using standard techniques and exposed to increasing doses of pterostilbene (5-100 μM) for 48 and 72 h. Cell proliferation was determined by sulforhodamine B assay. The growth of treated cells was expressed as a percentage of that of untreated control cells. Pterostilbene decreased proliferation rate of Caco-2 cells in a dose- and time-dependent manner. Its concentrations = 25 μM did not affect cell growth after 48 h treatment period. Significant growth inhibition was observed in cultures incubated with higher concentrations of pterostilbene (40-100 μM). Pterostilbene at all concentrations used (5-100 μM) caused significant inhibition of cell proliferation when the experimental time period was elongated to 72 h. The maximum growth reduction was observed at 100 mM pterostilbene. The cytotoxicity of pterostilbene was evaluated in 48 h cultures based on lactate dehydrogenase (LDH) leakage into the culture medium and showed dose-related pattern. The findings of this study showed significant dose-dependent antiproliferative and cytotoxic

  17. Influence of constitutive phenolic compounds on the response of grapevine (Vitis vinifera L.) leaves to infection by Plasmopara viticola.

    Science.gov (United States)

    Latouche, Gwendal; Bellow, Sébastien; Poutaraud, Anne; Meyer, Sylvie; Cerovic, Zoran G

    2013-01-01

    Flavonols and hydroxycinnamic acids are known to contribute to plant resistance against pathogens, but there are few reports on the implication of flavonols in the resistance of grapevine against Plasmopara viticola, and none on the involvement of hydroxycinnamic acids. In order to analyze the effect of flavonols on P. viticola infection, variable amounts of flavonols were induced by different light conditions in otherwise phenologically identical leaves. Differences in content of leaf hydroxycinnamic acids were induced at the same time. A non-invasive monitoring of flavonols and hydroxycinnamic acids was performed with Dualex leaf-clip optical sensors. Whatever the light condition, there were no significant changes in flavonol or in hydroxycinnamic acid contents for control and inoculated leaves during the development of P. viticola until 6 days after inoculation. The violet-blue autofluorescence of stilbenes, the main phytoalexins of grapevine that accumulate in inoculated leaves, was used as an indicator of infection by P. viticola. The implication of leaf constitutive flavonols and hydroxycinnamic acids in the defence of Vitis vinifera against P. viticola could be investigated in vivo thanks to this indicator. The increase in stilbene violet-blue autofluorescence started earlier for leaves with low flavonol content than for leaves with higher content, suggesting that constitutive flavonols are able to slow down the infection by P. viticola. On the contrary, constitutive hydroxycinnamic acids did not seem to play a role in defence against P. viticola. The non-destructive nature of the methods used alleviates the major problem of destructive experiments: the large variability in leaf phenolic contents.

  18. Screening for main components associated with the idiosyncratic hepatotoxicity of a tonic herb, Polygonum multiflorum.

    Science.gov (United States)

    Li, Chunyu; Niu, Ming; Bai, Zhaofang; Zhang, Congen; Zhao, Yanling; Li, Ruiyu; Tu, Can; Li, Huifang; Jing, Jing; Meng, Yakun; Ma, Zhijie; Feng, Wuwen; Tang, Jinfa; Zhu, Yun; Li, Jinjie; Shang, Xiaoya; Zou, Zhengsheng; Xiao, Xiaohe; Wang, Jiabo

    2017-06-01

    The main constituents of a typical medicinal herb, Polygonum multiflorum (Heshouwu in Chinese), that induces idiosyncratic liver injury remain unclear. Our previous work has shown that cotreatment with a nontoxic dose of lipopolysaccharide (LPS) and therapeutic dose of Heshouwu can induce liver injury in rats, whereas the solo treatment cannot induce observable injury. In the present work, using the constituent "knock-out" and "knock-in" strategy, we found that the ethyl acetate (EA) extract of Heshouwu displayed comparable idiosyncratic hepatotoxicity to the whole extract in LPS-treated rats. Results indicated a significant elevation of plasma alanine aminotransferase, aspartate aminotransferase, and liver histologic changes, whereas other separated fractions failed to induce liver injury. The mixture of EA extract with other separated fractions induced comparable idiosyncratic hepatotoxicity to the whole extract in LPS-treated rats. Chemical analysis further revealed that 2,3,5,4'-tetrahydroxy trans-stilbene-2-O-β-glucoside (trans-SG) and its cis-isomer were the two major compounds in EA extract. Furthermore, the isolated cis-, and not its trans-isomer, displayed comparable idiosyncratic hepatotoxicity to EA extract in LPS-treated rats. Higher contents of cis-SG were detected in Heshouwu liquor or preparations from actual liver intoxication patients associated with Heshouwu compared with general collected samples. In addition, plasma metabolomics analysis showed that cis-SG-disturbing enriched pathways remarkably differed from trans-SG ones in LPS-treated rats. All these results suggested that cis-SG was closely associated with the idiosyncratic hepatotoxicity of Heshouwu. Considering that the cis-trans isomerization of trans-SG was mediated by ultraviolet light or sunlight, our findings serve as reference for controlling photoisomerization in drug discovery and for the clinical use of Heshouwu and stilbene-related medications.

  19. Identification of Putative Precursor Genes for the Biosynthesis of Cannabinoid-Like Compound in Radula marginata

    Directory of Open Access Journals (Sweden)

    Tajammul Hussain

    2018-05-01

    Full Text Available The liverwort Radula marginata belongs to the bryophyte division of land plants and is a prospective alternate source of cannabinoid-like compounds. However, mechanistic insights into the molecular pathways directing the synthesis of these cannabinoid-like compounds have been hindered due to the lack of genetic information. This prompted us to do deep sequencing, de novo assembly and annotation of R. marginata transcriptome, which resulted in the identification and validation of the genes for cannabinoid biosynthetic pathway. In total, we have identified 11,421 putative genes encoding 1,554 enzymes from 145 biosynthetic pathways. Interestingly, we have identified all the upstream genes of the central precursor of cannabinoid biosynthesis, cannabigerolic acid (CBGA, including its two first intermediates, stilbene acid (SA and geranyl diphosphate (GPP. Expression of all these genes was validated using quantitative real-time PCR. We have characterized the protein structure of stilbene synthase (STS, which is considered as a homolog of olivetolic acid in R. marginata. Moreover, the metabolomics approach enabled us to identify CBGA-analogous compounds using electrospray ionization mass spectrometry (ESI-MS/MS and gas chromatography mass spectrometry (GC-MS. Transcriptomic analysis revealed 1085 transcription factors (TF from 39 families. Comparative analysis showed that six TF families have been uniquely predicted in R. marginata. In addition, the bioinformatics analysis predicted a large number of simple sequence repeats (SSRs and non-coding RNAs (ncRNAs. Our results collectively provide mechanistic insights into the putative precursor genes for the biosynthesis of cannabinoid-like compounds and a novel transcriptomic resource for R. marginata. The large-scale transcriptomic resource generated in this study would further serve as a reference transcriptome to explore the Radulaceae family.

  20. Growing Mouse Oocytes Transiently Activate Folate Transport via Folate Receptors As They Approach Full Size.

    Science.gov (United States)

    Meredith, Megan; MacNeil, Allison H; Trasler, Jacquetta M; Baltz, Jay M

    2016-06-01

    The folate cycle is central to cellular one-carbon metabolism, where folates are carriers of one-carbon units that are critical for synthesis of purines, thymidylate, and S-adenosylmethionine, the universal methyl donor that forms the cellular methyl pool. Although folates are well-known to be important for early embryo and fetal development, their role in oogenesis has not been clearly established. Here, folate transport proteins were detected in developing neonatal ovaries and growing oocytes by immunohistochemistry, Western blot, and immunofluorescence. The folate receptors FOLR1 and FOLR2 as well as reduced folate carrier 1 (RFC1, SLC19A1 protein) each appeared to be present in follicular cells including granulosa cells. In growing oocytes, however, only FOLR2 immunoreactivity appeared abundant. Localization of apparent FOLR2 immunofluorescence near the plasma membrane increased with oocyte growth and peaked in oocytes as they neared full size. We assessed folate transport using the model folate leucovorin (folinic acid). Unexpectedly, there was a transient burst of folate transport activity for a brief period during oocyte growth as they neared full size, while folate transport was otherwise undetectable for the rest of oogenesis and in fully grown germinal vesicle stage oocytes. This folate transport was inhibited by dynasore, an inhibitor of endocytosis, but insensitive to the anion transport inhibitor stilbene 4-acetamido-40-isothiocyanato-stilbene-2,20-disulfonic acid, consistent with folate receptor-mediated transport but not with RFC1-mediated transport. Thus, near the end of their growth, growing oocytes may take up folates that could support the final stage of oogenesis or be stored to provide the endogenous folates needed in early embryogenesis. © 2016 by the Society for the Study of Reproduction, Inc.

  1. Dendrobium protoplast co-culture promotes phytochemical assemblage in vitro.

    Science.gov (United States)

    Thomas, Abitha; Pujari, Ipsita; Shetty, Vasudeep; Joshi, Manjunath B; Rai, Padmalatha S; Satyamoorthy, Kapaettu; Babu, Vidhu Sankar

    2017-07-01

    The present study is intended to analyze the occurrence of potent, low produce, naturally occurring stilbenes in protoplasts of wild species and hybrids of Dendrobium. The wild species selected for the study was Dendrobium ovatum, endemic to Western Ghats of India. Protoplasts were isolated from leaves and tepal tissues of all the species and were cultured purely to generate homofusants and cross-cultured to raise heterofusants. Phytochemical composition of protoplast culture with atypical and pure microcolonies was performed using mass spectrometry. Enzyme cocktail of 4% pectinase together with 2% cellulase displayed the highest competence for protoplast isolations. Maximum protoplast density of 30.11 × 10 4 /ml was obtained from D. ovatum leaves in 2 h. Subcellular features such as the presence of partially formed cell wall, the position of the nucleus, chloroplast density, colony existence, and integrity of the plasma membrane were analyzed. Among the pure and cross-cultured protoplasts, the number of heterofusants and homofusants formed were enumerated. The spectral feature extraction of the mass spectrometry indicated the presence of five phenolic marker compounds, viz., tristin, confusarin, gigantol, moscatilin, and resveratrol, some of them in pure and others in assorted protoplast cultures raised from Dendrobium leaves and tepals. The study demonstrated that protoplast fusion technique enabled phytochemical assemblage in vitro as stilbenes tend to get restricted either in a tissue or species specific manner. This is the first report showing the presence of resveratrol, moscatilin, tristin, gigantol, and confusarin in wild and hybrid species from cultured Dendrobium protoplasts in vitro.

  2. Kinetic performance of a 50mm long 1.8μm chiral column in supercritical fluid chromatography.

    Science.gov (United States)

    Berger, Terry A

    2016-08-12

    Reduced plate heights (hr) of supercritical fluid chromatography (SFC). The enantiomers of trans-stilbene oxide, were separated on a 4.6×50mm, 1.8μm R,R-Whelk-O1 column, with hr as low as 1.93. The plumbing of a commercial SFC instrument was modified to create a low dispersion version. Without the modification performance was considerably worse. vanDeemter like plots of reduced plate height vs. flow rate, for trans-stilbene oxide, indicate that the optimum flow varied with% modifier. On a 4.6×250mm, 5μm R,R- Whelk-O1 column, the optimum flow was >4mL/min for 5% methanol in CO2, decreasing to 5mL/min with 2.5%, 5%, and 10% methanol, decreasing to between 3 and 3.5mL/min at 40% methanol. This is the first time such shifts have been characterized. Since the solutes were the same in all cases, the differences are likely due to changes in solute diffusion coefficients caused by changes in modifier concentration, and pressure. Pump pressure requirements sometimes exceeded 500bar. It is shown that a 5mL/min flow rate is inadequate for use with 1.8μm particles in a 4.6mm ID column format. Instead, it is suggested to decrease the ID of the column to 3mm, where the optimum flow rates are on the order of 2mL/min with decreased tubing variance. Nevertheless, a number of sub-1min chromatograms are presented. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Fertilization Changes Chemical Defense in Needles of Mature Norway Spruce (Picea abies

    Directory of Open Access Journals (Sweden)

    Line Nybakken

    2018-06-01

    Full Text Available Nitrogen availability limits growth in most boreal forests. However, parts of the boreal zone receive significant levels of nitrogen deposition. At the same time, forests are fertilized to increase volume growth and carbon sequestration. No matter the source, increasing nitrogen in the boreal forest ecosystem will influence the resource situation for its primary producers, the plants, with possible implications for their defensive chemistry. In general, fertilization reduces phenolic compound concentrations in trees, but existing evidence mainly comes from studies on young plants. Given the role of the phenolic compounds in protection against herbivores and other forest pests, it is important to know if phenolics are reduced with fertilization also in mature trees. The evergreen Norway spruce is long-lived, and it is reasonable that defensive strategies could change from the juvenile to the reproductive and mature phases. In addition, as the needles are kept for several years, defense could also change with needle age. We sampled current and previous year needles from an N fertilization experiment in a Norway spruce forest landscape in south-central Norway to which N had been added annually for 13 years. We analyzed total nitrogen (N and carbon (C, as well as low-molecular phenolics and condensed tannins. Needles from fertilized trees had higher N than those from controls plots, and fertilization decreased concentrations of many flavonoids, as well as condensed tannins in current year needles. In previous year needles, some stilbenes and condensed tannins were higher in fertilized trees. In control trees, the total phenolic concentration was almost five times as high in previous year needles compared with those from the current year, and there were great compositional differences. Previous year needles contained highest concentrations of acetophenone and stilbenes, while in the current year needles the flavonoids, and especially coumaroyl

  4. The energy spectrum of neutrons from 7Li(d,n)8Be reaction at deuteron energy 2.9 MeV

    Science.gov (United States)

    Mitrofanov, Konstantin V.; Piksaikin, Vladimir M.; Zolotarev, Konstantin I.; Egorov, Andrey S.; Gremyachkin, Dmitrii E.

    2017-09-01

    The neutron beams generated at the electrostatic accelerators using nuclear reactions T(p,n)3He, D(d,n)3He, 7Li(p,n)7Be, T(d,n)4He, 7Li(d,n)8Be, 9Be(d,n)10B are widely used in neutron physics and in many practical applications. Among these reactions the least studied reactions are 7Li(d,n)8Be and 9Be(d,n)10B. The present work is devoted to the measurement of the neutron spectrum from 7Li(d,n)8Be reaction at 0∘ angle to the deuteron beam axis on the electrostatic accelerator Tandetron (JSC "SSC RF - IPPE") using activation method and a stilbene crystal scintillation detector. The first time ever 7Li(d,n)8Be reaction was measured by activation method. The target was a thick lithium layer on metallic backing. The energy of the incident deuteron was 2.9 MeV. As activation detectors a wide range of nuclear reactions were used: 27Al(n,p)27Mg, 27Al(n,α)24Na, 113In(n,n')113mIn, 115In(n,n')115mIn, 115In(n,γ)116mIn, 58Ni(n,p)58mCo, 58Ni(n,2n)57Ni, 197Au(n,γ)198Au, 197Au(n,2n)196Au, 59Co(n,p)59Fe, 59Co(n,2n)58m+gCo, 59Co (n,g)60Co. Measurement of the induced gamma-activity was carried out using HPGe detector Canberra GX5019 [1]. The up-to-date evaluations of the cross sections for these reactions were used in processing of the data. The program STAYSL was used to unfold the energy spectra. The neutron spectra obtained by activation detectors is consistent with the corresponding data measured by a stilbene crystal scintillation detector within their uncertainties.

  5. The energy spectrum of neutrons from 7Li(d,n8Be reaction at deuteron energy 2.9 MeV

    Directory of Open Access Journals (Sweden)

    Mitrofanov Konstantin V.

    2017-01-01

    Full Text Available The neutron beams generated at the electrostatic accelerators using nuclear reactions T(p,n3He, D(d,n3He, 7Li(p,n7Be, T(d,n4He, 7Li(d,n8Be, 9Be(d,n10B are widely used in neutron physics and in many practical applications. Among these reactions the least studied reactions are 7Li(d,n8Be and 9Be(d,n10B. The present work is devoted to the measurement of the neutron spectrum from 7Li(d,n8Be reaction at 0∘ angle to the deuteron beam axis on the electrostatic accelerator Tandetron (JSC “SSC RF – IPPE” using activation method and a stilbene crystal scintillation detector. The first time ever 7Li(d,n8Be reaction was measured by activation method. The target was a thick lithium layer on metallic backing. The energy of the incident deuteron was 2.9 MeV. As activation detectors a wide range of nuclear reactions were used: 27Al(n,p27Mg, 27Al(n,α24Na, 113In(n,n'113mIn, 115In(n,n'115mIn, 115In(n,γ116mIn, 58Ni(n,p58mCo, 58Ni(n,2n57Ni, 197Au(n,γ198Au, 197Au(n,2n196Au, 59Co(n,p59Fe, 59Co(n,2n58m+gCo, 59Co (n,g60Co. Measurement of the induced gamma-activity was carried out using HPGe detector Canberra GX5019 [1]. The up-to-date evaluations of the cross sections for these reactions were used in processing of the data. The program STAYSL was used to unfold the energy spectra. The neutron spectra obtained by activation detectors is consistent with the corresponding data measured by a stilbene crystal scintillation detector within their uncertainties.

  6. Development and validation of a multi-residue method for the detection of a wide range of hormonal anabolic compounds in hair using gas chromatography-tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Rambaud, Lauriane [LABERCA, Ecole Nationale Veterinaire de Nantes, Route de Gachet, BP50707, 44307 Nantes Cedex 3 (France); Monteau, Fabrice [LABERCA, Ecole Nationale Veterinaire de Nantes, Route de Gachet, BP50707, 44307 Nantes Cedex 3 (France); Deceuninck, Yoann [LABERCA, Ecole Nationale Veterinaire de Nantes, Route de Gachet, BP50707, 44307 Nantes Cedex 3 (France); Bichon, Emmanuelle [LABERCA, Ecole Nationale Veterinaire de Nantes, Route de Gachet, BP50707, 44307 Nantes Cedex 3 (France); Andre, Francois [LABERCA, Ecole Nationale Veterinaire de Nantes, Route de Gachet, BP50707, 44307 Nantes Cedex 3 (France); Le Bizec, Bruno [LABERCA, Ecole Nationale Veterinaire de Nantes, Route de Gachet, BP50707, 44307 Nantes Cedex 3 (France)]. E-mail: lebizec@vet-nantes.fr

    2007-03-14

    The monitoring of anabolic steroid residues in hair is undoubtedly one of the most efficient strategies to demonstrate the long-term administration of these molecules in meat production animals. A multi-residue sample preparation procedure was developed and validated for 28 steroids. A 100 mg hair sample was grinded into powder and extracted at 50 deg. C with methanol. After acidic hydrolysis and extraction with ethyl acetate, phenolsteroids, such as estrogens, resorcyclic acid lactones and stilbens in one hand, are separated from androgens and progestagens in the other hand. Solid phase extractions were performed before applying a specific derivatisation for each compound sub-group. Detection and identification were achieved using gas chromatography-tandem mass spectrometry with acquisition in the selected reaction monitoring mode after electron ionisation. The method was validated according to the 2002/657/EC guideline. Decision limits (CC{alpha}) for main steroids were in the 0.1-10 {mu}g kg{sup -1} range.

  7. Ultra-high performance liquid chromatography-tandem mass spectrometry in high-throughput confirmation and quantification of 34 anabolic steroids in bovine muscle.

    Science.gov (United States)

    Vanhaecke, Lynn; Vanden Bussche, Julie; Wille, Klaas; Bekaert, Karen; De Brabander, Hubert F

    2011-08-26

    An ultra-high performance liquid chromatography tandem mass spectrometry multi-residue method for the determination of 34 anabolic steroids (10 estrogens including stilbenes, 14 androgens and 10 gestagens) in meat of bovine origin is reported. The extraction and clean-up procedure involved homogenization with methanol, defatting with hexane, liquid/liquid extraction with diethylether and finally SPE clean-up with coupled Si and NH(2) cartridges. The analytes were separated on a 1.9 μm Hypersil Gold column (100×2.1 mm) and quantified on a triple quadrupole mass spectrometer (TSQ Vantage) operating simultaneously in both positive and negative atmospheric pressure chemical ionisation (APCI) modes. This analytical procedure was subsequently validated according to EU criteria (CD 2002/657/EC), resulting in decision limits and detection capabilities ranging between 0.04 and 0.88 μg kg(-1) and 0.12 and 1.9 μg kg(-1), respectively. The method obtained for all, natural and synthetic steroids, adequate precisions and intra-laboratory reproducibilities (relative standard deviation below 20%), and the linearity ranged between 0.991 and 0.999. The performance characteristics fulfill the recommended concentrations fixed by the Community Reference Laboratories. The developed analysis is sensitive, and robust and therefore useful for confirmation and quantification of anabolic steroids for research purposes and residue control programs. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. Nutraceuticals and their preventive or potential therapeutic value in Parkinson's disease.

    Science.gov (United States)

    Chao, Jianfei; Leung, Yen; Wang, Mingfu; Chang, Raymond Chuen-Chung

    2012-07-01

    Parkinson's disease (PD) is the second most common aging-related disorder in the world, after Alzheimer's disease. It is characterized by the progressive loss of dopaminergic neurons in the substantia nigra pars compacta and other parts of the brain, leading to motor impairment, cognitive impairment, and dementia. Current treatment methods, such as L-dopa therapy, are focused only on relieving symptoms and delaying progression of the disease. To date, there is no known cure for PD, making prevention of PD as important as ever. More than a decade of research has revealed a number of major risk factors, including oxidative stress and mitochondrial dysfunction. Moreover, numerous nutraceuticals have been found to target and attenuate these risk factors, thereby preventing or delaying the progression of PD. These nutraceuticals include vitamins C, D, E, coenzyme Q10, creatine, unsaturated fatty acids, sulfur-containing compounds, polyphenols, stilbenes, and phytoestrogens. This review examines the role of nutraceuticals in the prevention or delay of PD as well as the mechanisms of action of nutraceuticals and their potential applications as therapeutic agents, either alone or in combination with current treatment methods. © 2012 International Life Sciences Institute.

  9. Pharmacological Intervention through Dietary Nutraceuticals in Gastrointestinal Neoplasia.

    Science.gov (United States)

    Ullah, Mohammad F; Bhat, Showket H; Husain, Eram; Abu-Duhier, Faisel; Hadi, S M; Sarkar, Fazlul H; Ahmad, Aamir

    2016-07-03

    Neoplastic conditions associated with gastrointestinal (GI) tract are common worldwide with colorectal cancer alone accounting for the third leading rate of cancer incidence. Other GI malignancies such as esophageal carcinoma have shown an increasing trend in the last few years. The poor survival statistics of these fatal cancer diseases highlight the need for multiple alternative treatment options along with effective prophylactic strategies. Worldwide geographical variation in cancer incidence indicates a correlation between dietary habits and cancer risk. Epidemiological studies have suggested that populations with high intake of certain dietary agents in their regular meals have lower cancer rates. Thus, an impressive embodiment of evidence supports the concept that dietary factors are key modulators of cancer including those of GI origin. Preclinical studies on animal models of carcinogenesis have reflected the pharmacological significance of certain dietary agents called as nutraceuticals in the chemoprevention of GI neoplasia. These include stilbenes (from red grapes and red wine), isoflavones (from soy), carotenoids (from tomatoes), curcuminoids (from spice turmeric), catechins (from green tea), and various other small plant metabolites (from fruits, vegetables, and cereals). Pleiotropic action mechanisms have been reported for these diet-derived chemopreventive agents to retard, block, or reverse carcinogenesis. This review presents a prophylactic approach to primary prevention of GI cancers by highlighting the translational potential of plant-derived nutraceuticals from epidemiological, laboratory, and clinical studies, for the better management of these cancers through consumption of nutraceutical rich diets and their intervention in cancer therapeutics.

  10. Characterization of the Principal Constituents of Danning Tablets, a Chinese Formula Consisting of Seven Herbs, by an UPLC-DAD-MS/MS Approach

    Directory of Open Access Journals (Sweden)

    Changsen Zhan

    2016-05-01

    Full Text Available Danning Tablets are a traditional Chinese formula showing broad clinical applications in hepatobiliary diseases and containing a diversity of bioactive chemicals. However, the chemical profiling of the formula, which serves as the material foundation of its efficacy, is really a big challenge as Danning Tablets consist of seven herbs from different origins. An ultra-performance liquid chromatography coupled to diode array detection and electrospray ionization mass spectrometry (UPLC-DAD-ESI-MS/MS approach was developed to characterize the principal polyphenol constituents in the formula. As a result, a total of 32 constituents, including 14 anthraquinones and their glucosides, four anthrones, two naphthalene glycosides, two stilbenes and 10 flavonoids were identified based on their retention time, UV absorption and MS/MS fragmentation patterns. The sources of these compounds were also illustrated. Most of the bioactive anthraquinone derivatives were found in Rhei Radix et Rhizoma or Polygoni Cuspidati Rhizoma et Radix, which are the Emperor drugs in the formula for its clinic usage. These findings indicate the merit of using this integrated UPLC-DAD-ESI-MS/MS approach to rapidly illustrate the chemical foundation of complex formulas. The present study will facilitate the quality control of Danning Tablet formulas as well as the individual herbs.

  11. Forging a modern generation of polyphenol-based therapeutics.

    Science.gov (United States)

    Wright, Bernice

    2013-06-01

    The long-standing debate that polyphenol secondary metabolites from dietary plants are important nutritional components continues due to compelling evidence for their abilities to ameliorate degenerative conditions including, cancer, neurological disorders and cardiovascular disease. The clinical use of polyphenols is not, however, mainstream as issues regarding poor selectivity, dosage, toxicity and delivery methods are unresolved. The paper by Rieder et al. suggests that the lack of selectivity, at least for the stilbene, resveratrol, may not be a major limiting factor. The present commentary is a critique of this significant finding that is focused on deciding how the use of resveratrol as clinical medicine could be advanced, and how this new information integrates with current knowledge of polyphenol physiological effects. This commentary suggests that the multi-target nature of polyphenols may be translated into reliable therapy using the current systems/network pharmacology approach concerned with developing viable therapeutic agents that achieve specific effects through interactions with a wide array of targets. This article is a commentary on Rieder et al., pp. 1244-1258 of BJP 167:6. To view this paper visit http://dx.doi.org/10.1111/j.1476-5381.2012.02063.x. © 2013 The Author. British Journal of Pharmacology © 2013 The British Pharmacological Society.

  12. Kinetics of olefin arylation by bis(triphenylphosphine) diacetatopalladium(II) (PPAP) and trans-cis isomerization of the latter

    Energy Technology Data Exchange (ETDEWEB)

    Ryabov, A.D.; Yatsimirskii, A.K.

    1979-01-01

    In the absence of olefins, at 70/sup 0/C, PPAP dissolved in glacial acetic acid rapidly decomposed into triphenylphosphine (TPP) oxide, biphenyl, and metallic palladium, after an induction period of about ten minutes. At lower temperatures in this solvent, pure trans-PPAP was converted into the more stable cis-isomer. The conversion was 70-80Vertical Bar3<, increased with temperature (25/sup 0/-45/sup 0/C), and was inhibited by free TPP. Interaction of PPAP with styrene in glacial acetic acid at 70/sup 0/C occurred with an induction period and gave stilbene (80Vertical Bar3< yield) and TPP oxide. The induction period was independent of the concentration of PPAP or olefin and coincided with that in PPAP decomposition in the absence of olefin. Similar regularities were observed in PPAP interaction with p-methoxystyrene and p-nitrostyrene. Apparently, the induction period involves Pd(II) reduction to a phenypalladium(0) species stabilized by TPP and is followed by rapid transfer of phenyl from palladium to olefin.

  13. Resveratrol ameliorates the chemical and microbial induction of inflammation and insulin resistance in human placenta, adipose tissue and skeletal muscle.

    Science.gov (United States)

    Tran, Ha T; Liong, Stella; Lim, Ratana; Barker, Gillian; Lappas, Martha

    2017-01-01

    Gestational diabetes mellitus (GDM), which complicates up to 20% of all pregnancies, is associated with low-grade maternal inflammation and peripheral insulin resistance. Sterile inflammation and infection are key mediators of this inflammation and peripheral insulin resistance. Resveratrol, a stilbene-type phytophenol, has been implicated to exert beneficial properties including potent anti-inflammatory and antidiabetic effects in non-pregnant humans and experimental animal models of GDM. However, studies showing the effects of resveratrol on inflammation and insulin resistance associated with GDM in human tissues have been limited. In this study, human placenta, adipose (omental and subcutaneous) tissue and skeletal muscle were stimulated with pro-inflammatory cytokines TNF-α and IL-1β, the bacterial product lipopolysaccharide (LPS) and the synthetic viral dsRNA analogue polyinosinic:polycytidylic acid (poly(I:C)) to induce a GDM-like model. Treatment with resveratrol significantly reduced the expression and secretion of pro-inflammatory cytokines IL-6, IL-1α, IL-1β and pro-inflammatory chemokines IL-8 and MCP-1 in human placenta and omental and subcutaneous adipose tissue. Resveratrol also significantly restored the defects in the insulin signalling pathway and glucose uptake induced by TNF-α, LPS and poly(I:C). Collectively, these findings suggest that resveratrol reduces inflammation and insulin resistance induced by chemical and microbial products. Resveratrol may be a useful preventative therapeutic for pregnancies complicated by inflammation and insulin resistance, like GDM.

  14. Resveratrol, pterostilbene, and piceatannol in vaccinium berries.

    Science.gov (United States)

    Rimando, Agnes M; Kalt, Wilhelmina; Magee, James B; Dewey, Jim; Ballington, James R

    2004-07-28

    A study was conducted to determine the presence of resveratrol, pterostilbene, and piceatannol in Vaccinium berries. Samples representing selections and cultivars of 10 species from Mississippi, North Carolina, Oregon, and Canada were analyzed by gas chromatography/mass spectrometry. Resveratrol was found in Vaccinium angustifolium (lowbush blueberry), Vaccinium arboretum (sparkleberry), Vaccinium ashei (rabbiteye blueberry), Vaccinium corymbosum (highbush blueberry), Vaccinium elliottii (Elliott's blueberry), Vaccinium macrocarpon (cranberry), Vaccinium myrtillus (bilberry), Vaccinium stamineum (deerberry), Vaccinium vitis-ideae var. vitis-ideae (lingonberry), and Vaccinium vitis-ideae var. minor (partridgeberry) at levels between 7 and 5884 ng/g dry sample. Lingonberry was found to have the highest content, 5884 ng/g dry sample, comparable to that found in grapes, 6471 ng/g dry sample. Pterostilbene was found in two cultivars of V. ashei and in V. stamineum at levels of 99-520 ng/g dry sample. Piceatannol was found in V. corymbosum and V. stamineum at levels of 138-422 ng/g dry sample. These naturally occurring stilbenes, known to be strong antioxidants and to have cancer chemopreventive activities, will add to the purported health benefits derived from the consumption of these small fruits. Copyright 2004 American Chemical Society

  15. Food macromolecule based nanodelivery systems for enhancing the bioavailability of polyphenols

    Directory of Open Access Journals (Sweden)

    Bing Hu

    2017-01-01

    Full Text Available Diet polyphenols—primarily categorized into flavonoids (e.g., flavonols, flavones, flavan-3-ols, anthocyanidins, flavanones, and isoflavones and nonflavonoids (with major subclasses of stilbenes and phenolic acids—are reported to have health-promoting effects, such as antioxidant, antiinflammatory, anticarcinoma, antimicrobial, antiviral, and cardioprotective properties. However, their applications in functional foods or medicine are limited because of their inefficient systemic delivery and poor oral bioavailability. Epigallocatechin-3-gallate, curcumin, and resveratrol are the well-known representatives of the bioactive diet polyphenols but with poor bioavailability. Food macromolecule based nanoparticles have been fabricated using reassembled proteins, crosslinked polysaccharides, protein–polysaccharide conjugates (complexes, as well as emulsified lipid via safe procedures that could be applied in food. The human gastrointestinal digestion tract is the first place where the food grade macromolecule nanoparticles exert their effects on improving the bioavailability of diet polyphenols, via enhancing their solubility, preventing their degradation in the intestinal environment, elevating the permeation in small intestine, and even increasing their contents in the bloodstream. We contend that the stability and structure behaviors of nanocarriers in the gastrointestinal tract environment and the effects of nanoencapsulation on the metabolism of polyphenols warrant more focused attention in further studies.

  16. Organodioxygen complexes of some heavy metal ions and their oxygen transfer reactions

    International Nuclear Information System (INIS)

    Tarafder, M.T.H.; Mei Ling; Gino Mariotto

    2003-09-01

    Several novel organodioxygen complexes of lanthanide ions, viz., lanthanum(m) and cerium(IV) have been synthesized containing a number of organic co- ligands. The complexes characterized were, [La(0 2 )(det)(N0 3 ) 2 ] (1), [La(O 2 )(tet)(NO 3 ) 2 ] (2), [La(O 2 )(C 5 H 5 N)2NO 3 ] (3), [La(O 2 )(C 6 H 18 N 3 PO) 2 (NO 3 ) 2 ] (4), [La(0 2 )(OPPh 3 ) 2 (N0 3 ) 2 ] (5), [La(O 2 ) 2 (NH 2 CH 2 CH 2 NH 2 ) 2 NO 3 ] (6), [La(O 2 )(PPh 3 ) 2 (NO 3 ) 2 ] (7) and [Ce(O 2 )(C 6 H 18 N 3 PO) 2 (NO 3 ) 3 ] (8). IR and Raman spectra revealed that (3) was a peroxo complex while the others were, in particular, superoxo type. The IR spectrum of (3) gives V 1 (O-O) at 851 cm -1 while the Raman spectra of (4), (5), (7) and (8) give V 1 (O 2 ) bands at 1046 cm -1 , 1032 cm 1 , 1100 cm -1 and 1046 cm -1 , respectively. The oxygen transfer reactions of two selected complexes were carried out under stoichiometric conditions. The complex containing a bidentate ligand, (6), was found to oxidize triphenylphosphine and trans-stilbene to their oxides while the complex containing tridentate ligand (1) was stable and inert towards oxidation. (author)

  17. Mediterranean Way of Drinking and Longevity.

    Science.gov (United States)

    Giacosa, Attilio; Barale, Roberto; Bavaresco, Luigi; Faliva, Milena Anna; Gerbi, Vincenzo; La Vecchia, Carlo; Negri, Eva; Opizzi, Annalisa; Perna, Simone; Pezzotti, Mario; Rondanelli, Mariangela

    2016-01-01

    The relation between alcohol consumption and mortality is a J-shaped curve in most of the many studies published on this topic. The Copenhagen Prospective Population Studies demonstrated in the year 2000 that wine intake may have a beneficial effect on all cause mortality that is additive to that of alcohol. Wine contains various poliphenolic substances which may be beneficial for health and in particular flavonols (such as myricetin and quercetin), catechin and epicatechin, proanthocyanidins, anthocyanins, various phenolic acids and the stilbene resveratrol. In particular, resveratrol seems to play a positive effect on longevity because it increases the expression level of Sirt1, besides its antioxidant, anti-inflammatory and anticarcinogenic properties. Moderate wine drinking is part of the Mediterranean diet, together with abundant and variable plant foods, high consumption of cereals, olive oil as the main (added) fat and a low intake of (red) meat. This healthy diet pattern involves a "Mediterranean way of drinking," that is a regular, moderate wine consumption mainly with food (up to two glasses a day for men and one glass for women). Moderate wine drinking increases longevity, reduces the risk of cardiovascular diseases and does not appreciably influence the overall risk of cancer.

  18. Wine and endothelial function.

    Science.gov (United States)

    Caimi, G; Carollo, C; Lo Presti, R

    2003-01-01

    In recent years many studies have focused on the well-known relationship between wine consumption and cardiovascular risk. Wine exerts its protective effects through various changes in lipoprotein profile, coagulation and fibrinolytic cascades, platelet aggregation, oxidative mechanisms and endothelial function. The last has earned more attention for its implications in atherogenesis. Endothelium regulates vascular tone by a delicate balancing among vasorelaxing (nitric oxide [NO]) and vasoconstrincting (endothelins) factors produced by endothelium in response to various stimuli. In rat models, wine and other grape derivatives exerted an endothelium-dependent vasorelaxing capacity especially associated with the NO-stimulating activity of their polyphenol components. In experimental conditions, reservatrol (a stilbene polyphenol) protected hearts and kidneys from ischemia-reperfusion injury through antioxidant activity and upregulation of NO production. Wine polyphenols are also able to induce the expression of genes involved in the NO pathway within the arterial wall. The effects of wine on endothelial function in humans are not yet clearly understood. A favorable action of red wine or dealcoholized wine extract or purple grape juice on endothelial function has been observed by several authors, but discrimination between ethanol and polyphenol effects is controversial. It is, however likely that regular and prolonged moderate wine drinking positively affects endothelial function. The beneficial effects of wine on cardiovascular health are greater if wine is associated with a healthy diet. The most recent nutritional and epidemiologic studies show that the ideal diet closely resembles the Mediterranean diet.

  19. Wine, resveratrol and health: a review.

    Science.gov (United States)

    Guerrero, Raúl F; García-Parrilla, Maria C; Puertas, Belén; Cantos-Villar, Emma

    2009-05-01

    Several studies have cited the Mediterranean diet as an example of healthy eating. In fact, the Mediterranean diet has become the reference diet for the prevention of cardiovascular disease. Red wine seems to be an essential component of the diet, since moderate consumption of wine is associated with lower risk and mortality from cardiovascular disease. Evidence is also accumulating that wine helps prevent the development of certain cancers. Of all the many components of wine, resveratrol, which is a natural component specifically present in wine, has been identified as being mainly responsible for these health-promoting properties. Many valuable properties such as cardioprotective and anticarcinogenic activity have been attributed to resveratrol; however, its bioavailability is quite low. The bioactivity of metabolites derived from resveratrol, and the accumulation of resveratrol in vital organs are still under study, but there are high expectations of positive results. Other stilbene compounds are also considered in this review, despite being present in undetectable or very small quantities in wine. The present paper reviews all aspects of the health properties of wine, bioactive compounds found in wine, and their concentrations, bioavailability and possible synergistic effects.

  20. Antiobesity effects of resveratrol: which tissues are involved?

    Science.gov (United States)

    Fernández-Quintela, Alfredo; Milton-Laskibar, Iñaki; González, Marcela; Portillo, Maria P

    2017-09-01

    The prevalence of obesity has been increasing in recent decades and is reaching epidemic proportions. The current options for overweight and obesity management are energy restriction and physical activity. However, compliance with these treatments is frequently poor and less successful than expected. Therefore, the scientific community is interested in active biomolecules, which may be useful in body weight management. Among them, resveratrol (3,5,4'-trihydroxy-trans-stilbene) has generated great interest as an antiobesity agent. The focus of this report is the mechanisms of action of resveratrol on several tissues (i.e., white and brown adipose tissues, liver, and skeletal muscle). Resveratrol blunts fat accumulation through decreasing adipogenesis and/or de novo lipogenesis in white adipose tissue. The effects on lipolysis are controversial. Regarding brown adipose tissue, resveratrol increases the capacity for adaptive thermogenesis. As far as liver and skeletal muscle is concerned, resveratrol increases lipid oxidation in both tissues. Therefore, in rodents, there is a general consensus concerning the effect of resveratrol on reducing body fat accumulation. By contrast, in humans, the studies are scarce, and no clear antiobesity action has been revealed so far. © 2017 New York Academy of Sciences.

  1. An automatic optosensing device for the simultaneous determination of resveratrol and piceid in wines

    Energy Technology Data Exchange (ETDEWEB)

    Molina-Garcia, Lucia; Ruiz-Medina, Antonio [Department of Physical and Analytical Chemistry, University of Jaen, Campus Las Lagunillas s/n, 23071 Jaen (Spain); Fernandez-de Cordova, Maria Luisa, E-mail: mferna@ujaen.es [Department of Physical and Analytical Chemistry, University of Jaen, Campus Las Lagunillas s/n, 23071 Jaen (Spain)

    2011-03-18

    For the first time, a spectrofluorimetric method is reported for the simultaneous determination of resveratrol (RVT) and piceid (PCD), two stilbenes showing diverse interesting physiological and biochemical attributes, as well as a wide range of health benefits ranging from cardioprotection to chemoprevention. The method makes use of a multicommutated flow-through optosensor in which the resolution of RVT and PCD is accomplished by means the sequential arrival of their photoproducts, on-line generated by UV-irradiation, to the detection area. This is possible due to the different kinetic behaviour of these latter on a solid support (C{sub 18} silica gel) filling a minicolumn placed before the detector. The measurement in solid-phase of the photochemically induced fluorescence of the photoproducts ({lambda}{sub ex}: 257 nm/{lambda}{sub em}: 382 nm) is used as analytical signal for monitoring both compounds. The method has been applied to the analysis of RVT and PCD in wines and requires a previous solid-phase extraction (SPE) using Bakerbond C{sub 18} cartridges. This pretreatment and the use of a solid-support in both the minicolumn and the flow-cell of the detector allow the determination of RVT and PCD by external calibration. Detection limits (DLs) are 9.3 and 12.6 ng mL{sup -1} for RVT and PCD, respectively. Commercial red and white wine samples have been analysed and the results obtained have been satisfactorily validated by high-performance liquid chromatography (HPLC).

  2. SOYBEAN AND CASEIN HYDROLYSATES INDUCE GRAPEVINE IMMUNE RESPONSES AND RESISTANCE AGAINST PLASMOPARA VITICOLA

    Directory of Open Access Journals (Sweden)

    Nihed eLachhab

    2014-12-01

    Full Text Available Plasmopara viticola, the causal agent of grapevine downy mildew, is one of the most devastating grape pathogen in Europe and North America. Although phytochemicals are used to control pathogen infections, the appearance of resistant strains and the concern for possible adverse effects on environment and human health are increasing the search for alternative strategies. In the present investigation, we successfully tested two protein hydrolysates from soybean (soy and casein (cas to trigger grapevine resistance against P. viticola. On Vitis vinifera cv. Marselan plants, the application of soy and cas reduced the infected leaf surface by 76 and 63%, as compared to the control, respectively. Since both hydrolysates might trigger the plant immunity, we investigated their ability to elicit grapevine defence responses. On grapevine cell suspensions, a different free cytosolic calcium signature was recorded for each hydrolysate, whereas a similar transient phosphorylation of two MAP kinases of 45 and 49 kDa was observed. These signalling events were followed by transcriptome reprogramming, including the up-regulation of defence genes encoding pathogenesis-related (PR proteins and the stilbene synthase enzyme responsible for the biosynthesis of resveratrol, the main grapevine phytoalexin. Liquid chromatography analyses confirmed the production of resveratrol and its dimer metabolites, δ- and ε-viniferins. Overall, soy effects were more pronounced as compared to the cas one. Both hydrolysates proved to act as elicitors to enhance grapevine immunity against pathogen attack.

  3. Resveratrol: How Much Wine Do You Have to Drink to Stay Healthy?123

    Science.gov (United States)

    Weiskirchen, Sabine; Weiskirchen, Ralf

    2016-01-01

    Resveratrol is a naturally occurring stilbene endowed with multiple health-promoting effects. It is produced by certain plants including several dietary sources such as grapes, apples, raspberries, blueberries, plums, peanuts, and products derived therefrom (e.g., wine). Resveratrol can be isolated and purified from these biological sources or synthesized in a few steps with an overall high yield. This compound and its glucoside, the trans-polydatin piceid, have received worldwide attention for their beneficial effects on cardiovascular, inflammatory, neurodegenerative, metabolic, and age-related diseases. These health-promoting effects are particularly attractive given the prevalence of resveratrol-based nutraceuticals and the paradoxical epidemiologic observation that wine consumption is inversely correlated to the incidence of coronary heart disease. However, the notion of resveratrol as a “magic bullet" was recently challenged by clinical trials showing that this polyphenol does not have a substantial influence on health status and mortality risk. In the present review, we discuss the proposed therapeutic attributes and the mode of molecular actions of resveratrol. We also cover recent pharmacologic efforts to improve the poor bioavailability of resveratrol and influence the transition between body systems in humans. We conclude with some thoughts about future research directions that might be meaningful for resolving controversies surrounding resveratrol. PMID:27422505

  4. Dietary Resveratrol Does Not Affect Life Span, Body Composition, Stress Response, and Longevity-Related Gene Expression in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Stefanie Staats

    2018-01-01

    Full Text Available In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster. Male and female w1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant (catalase, glutathione-S-transferase, NADH dehydrogenase, glutathione peroxidase, superoxide dismutase 2 and longevity-related genes, including sirtuin 2, spargel, and I’m Not Dead Yet. Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w1118 D. melanogaster.

  5. An Organ System Approach to Explore the Antioxidative, Anti-Inflammatory, and Cytoprotective Actions of Resveratrol

    Science.gov (United States)

    Bath, Sundeep

    2015-01-01

    Resveratrol is a phenolic phytochemical, with a stilbene backbone, derived from edible plants such as grape and peanut. It is a bioactive molecule with physiological effects on multiple organ systems. Its effects range from the neuroprotective to the nephroprotective, including cardiovascular, neuronal, and antineoplastic responses as a part of its broad spectrum of action. In this review, we examine the effects of resveratrol on the following organ systems: the central nervous system, including neurological pathology such as Parkinson's and Alzheimer's disease; the cardiovascular system, including disorders such as atherosclerosis, ischemia-reperfusion injury, and cardiomyocyte hypertrophy; the kidneys, including primary and secondary nephropathies and nephrolithiasis; multiple forms of cancer; and metabolic syndromes including diabetes. We emphasize commonalities in extracellular matrix protein alterations and intracellular signal transduction system induction following resveratrol treatment. We summarize the known anti-inflammatory, antioxidative, and cytoprotective effects of resveratrol across disparate organ systems. Additionally, we analyze the available literature regarding the pharmacokinetics of resveratrol formulations used in these studies. Finally, we critically examine select clinical trials documenting a lack of effect following resveratrol treatment. PMID:26180596

  6. Fast intramolecular electron transfer and dual fluorescence. Configurational change of the amino nitrogen (pyramidal→planar)

    International Nuclear Information System (INIS)

    Haar, Th. von der; Hebecker, A.; Il'Ichev, Yu.; Kuehnle, W.; Zachariasse, K. A.

    1996-01-01

    The fast excited state intramolecular charge transfer (ICT) and dual fluorescence observed with several 4-aminobenzonitriles is discussed. It is shown that the magnitude of the energy gap between the two lowest excited states determines the occurrence or absence of ICT. The photophysical behavior of a series of four 4-aminobenzonitriles in which the amino nitrogen atom is part of a four- to seven-membered heterocyclic ring, P4C to P7C, is studied by using time-resolved fluorescence measurements. The ICT rate constant strongly decreases with decreasing ring size. With P4C in diethyl ether ICT does not occur. This is attributed to the increase of the amino nitrogen inversion barrier with decreasing ring size. The change of the amino nitrogen from pyramidal to planar is considered to be an important reaction coordinate. The photophysics of the 4-aminobenzonitriles is different from that of other ICT systems such as donor/acceptor-substituted stilbenes and 9,9'-bianthryl, which are governed by the charge distribution and macroscopic Coulombic interaction in their CT states

  7. Resveratrol inhibits PDGF receptor mitogenic signaling in mesangial cells: role of PTP1B

    Science.gov (United States)

    Venkatesan, Balachandar; Ghosh-Choudhury, Nandini; Das, Falguni; Mahimainathan, Lenin; Kamat, Amrita; Kasinath, Balakuntalam S.; Abboud, Hanna E.; Choudhury, Goutam Ghosh

    2008-01-01

    Mesangioproliferative glomerulonephritis is associated with overactive PDGF receptor signal transduction. We show that the phytoalexin resveratrol dose dependently inhibits PDGF-induced DNA synthesis in mesangial cells with an IC50 of 10 μM without inducing apoptosis. Remarkably, the increased SIRT1 deacetylase activity induced by resveratrol was not necessary for this inhibitory effect. Resveratrol significantly blocked PDGF-stimulated c-Src and Akt kinase activation, resulting in reduced cyclin D1 expression and attenuated pRb phosphorylation and cyclin-dependent kinase-2 (CDK2) activity. Furthermore, resveratrol inhibited PDGFR phosphorylation at the PI 3 kinase and Grb-2 binding sites tyrosine-751 and tyrosine-716, respectively. This deficiency in PDGFR phosphorylation resulted in significant inhibition of PI 3 kinase and Erk1/2 MAPK activity. Interestingly, resveratrol increased the activity of protein tyrosine phosphatase PTP1B, which dephosphorylates PDGF-stimulated phosphorylation at tyrosine-751 and tyrosine-716 on PDGFR with concomitant reduction in Akt and Erk1/2 kinase activity. PTP1B significantly inhibited PDGF-induced DNA synthesis without inducing apoptosis. These results for the first time provide evidence that the stilbene resveratrol targets PTP1B to inhibit PDGFR mitogenic signaling.—Venkatesan, B., Ghosh-Choudhury, N., Das, F., Mahimainathan, L., Kamat, A., Kasinath, B. S., Abboud, H. E., Choudhury, G. G. Resveratrol inhibits PDGF receptor mitogenic signaling in mesangial cells: role of PTP1B. PMID:18567737

  8. Functional evaluation of synthetic flavonoids and chalcones for potential antiviral and anticancer properties.

    Science.gov (United States)

    Mateeva, Nelly; Eyunni, Suresh V K; Redda, Kinfe K; Ononuju, Ucheze; Hansberry, Tony D; Aikens, Cecilia; Nag, Anita

    2017-06-01

    Flavonoids, stilbenes, and chalcones are plant secondary metabolites that often possess diverse biological activities including anti-inflammatory, anti-cancer, and anti-viral activities. The wide range of bioactivities poses a challenge to identify their targets. Here, we studied a set of synthetically generated flavonoids and chalcones to evaluate for their biological activity, and compared similarly substituted flavonoids and chalcones. Substituted chalcones, but not flavonoids, showed inhibition of viral translation without significantly affecting viral replication in cells infected with hepatitis C virus (HCV). We suggest that the chalcones used in this study inhibit mammalian target of rapamycin (mTOR) pathway by ablating phosphorylation of ribosomal protein 6 (rps6), and also the kinase necessary for phosphorylating rps6 in Huh7.5 cells (pS6K1). In addition, selected chalcones showed inhibition of growth in Ishikawa, MCF7, and MDA-MB-231 cells resulting an IC 50 of 1-6µg/mL. When similarly substituted flavonoids were used against the same set of cancer cells, we did not observe any inhibitory effect. Together, we report that chalcones show potential for anti-viral and anti-cancer activities compared to similarly substituted flavonoids. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Pulse-form discrimination in organic scintillation crystals; Discrimination d'apres la forme de l'impulsion dans les cristaux organiques de scintillation; Diskriminatsiya formy impul'sov v organicheskikh stsintillyatsionnykh kristallakh; Discriminacion de la forma de los impulsos en los cristales de compuestos organicos para contadores de centelleo

    Energy Technology Data Exchange (ETDEWEB)

    De Vries, L J; Udo, F [Instituut voor Kernphysisch Onderzoek, Amsterdam (Netherlands)

    1962-04-15

    Presented is a proton-electron discrimination circuit, based on the pulse-form differences between proton and electron-induced scintillation light pulses in stilbene. The circuit is stable and resolves proton from electron pulses down to a proton energy of 300 keV. The discrimination circuit, which contains only linear elements, is sensitive to pile-up-induced errors for only 0.1 {mu}s after the arrival of a pulse. The described circuit has now been used in a 1-30 MeV neutron spectrometer based on proton-recoil between two silbene crystals. A resolution of 10% at 14 MeV neutron energy was obtained with a detection efficiency of 1.3 x 10{sup -4}. A neutron monitor, also based on linear pulse-form discrimination, could be used to measure a neutron dose of 10% of the maximum permissible dose in the presence of a gamma flux of 4 times the maximum permissible dose. (author) [French] Le memoire decrit un circuit de discrimination proton/electron dont le principe repose sur les differences de forme entre les impulsions lumineuses dans du stilbene, produites par des protons, d'une part, et des electrons, d'autre part. Le circuit est stable et permet de separer les impulsions protoniques des impulsions electroniques, a partir d'une energie protonique de 300 keV. Ce circuit, qui ne contient que des elements lineaires, n'est sujet a des erreurs dues a l'accumulation que pendant 0,1 {mu}s apres l'arrivee de l'impulsion. Il a ete utilise dans un spectrometre neutronique de 1-30 MeV, fonde sur le recul des protons entre deux cristaux de stilbene. On a obtenu une resolution de 10% pour une energie neutronique de 14 MeV, avec une efficacite de detection de 1,3x10{sup -4}. Un detecteur de neutrons procedant egalement par discrimination d'apres la forme des impulsions, pourrait servir a mesurer une dose de neutrons representant 10% de la dose maximum admissible, en presence d'un flux gamma correspondant a une dose quatre fois superieure a la dose maximum admissible. (author

  10. Resveratrol, a Red Wine Polyphenol, Suppresses Pancreatic Cancer by Inhibiting Leukotriene A4 Hydrolase

    Science.gov (United States)

    Oi, Naomi; Jeong, Chul-Ho; Nadas, Janos; Cho, Yong-Yeon; Pugliese, Angelo; Bode, Ann M.; Dong, Zigang

    2016-01-01

    The anticancer effects of red wine have attracted considerable attention. Resveratrol (3,5,4′-trihydroxy-trans-stilbene) is a well-known polyphenolic compound of red wine with cancer chemopreventive activity. However, the basis for this activity is unclear. We studied leukotriene A4 hydrolase (LTA4H) as a relevant target in pancreatic cancer. LTA4H knockdown limited the formation of leukotriene B4 (LTB4), the enzymatic product of LTA4H, and suppressed anchorage-independent growth of pancreatic cancer cells. An in silico shape similarity algorithm predicted that LTA4H might be a potential target of resveratrol. In support of this idea, we found that resveratrol directly bound to LTA4H in vitro and in cells and suppressed proliferation and anchorage-independent growth of pancreatic cancer by inhibiting LTB4 production and expression of the LTB4 receptor 1 (BLT1). Notably, resveratrol exerted relatively stronger inhibitory effects than bestatin, an established inhibitor of LTA4H activity, and the inhibitory effects of resveratrol were reduced in cells where LTA4H was suppressed by shRNA-mediated knockdown. Importantly, resveratrol inhibited tumor formation in a xenograft mouse model of human pancreatic cancer by inhibiting LTA4H activity. Our findings identify LTA4H as a functionally important target for mediating the anticancer properties of resveratrol. PMID:20952510

  11. Phenolics from Winemaking By-Products Better Decrease VLDL-Cholesterol and Triacylglycerol Levels than Those of Red Wine in Wistar Rats.

    Science.gov (United States)

    de Oliveira, Walkia Polliana; Biasoto, Aline Camarão Telles; Marques, Valquíria Fernanda; Dos Santos, Ieda Maria; Magalhães, Kedma; Correa, Luiz Claudio; Negro-Dellacqua, Melissa; Miranda, Maria Spínola; de Camargo, Adriano Costa; Shahidi, Fereidoon

    2017-10-01

    Winemaking by-products account for more than 30% of the grape production, but this inexpensive feedstock has not yet been fully exploited. Accordingly, we evaluated the potential biological activity of winemaking by-products produced with Syrah grapes in comparison with those of the wine produced using the same grape cultivar. Winemaking by-products showed higher contents of total anthocyanins, flavonols, stilbenes, and flavanols than red wine as evaluated by HPLC-DAD-FD (on a dry weight basis). In contrast, red wine was a better source of phenolic acids. However, the contribution of phenolic acids was minor for both samples. Furthermore, equivalent concentration of winemaking by-products (100 mg/kg/d) showed greater biological activity by than that of red wine by decreasing the levels of VLDL-cholesterol and triacylglycerols in Wistar rats. Therefore, this study supports the use of winemaking by-products as an economical source of bioactive phenolics with potential use in the food and nutraceutical industries. © 2017 Institute of Food Technologists®.

  12. Phenolic Contents and Compositions in Skins of Red Wine Grape Cultivars among Various Genetic Backgrounds and Originations

    Directory of Open Access Journals (Sweden)

    Lei Zhu

    2012-03-01

    Full Text Available In order to analyze and compare the phenolic characteristics of red wine grapes with diverse genetic backgrounds, skin phenolics among 21 different cultivars belonging to Vitis vinifera L., East Asian and North American Vitis species and hybrids, as well as 2 varieties of muscadine grapes were estimated by HPLC-MS/MS. There were 45 anthocyanins, 28 flavonols, 8 flavan-3-ols, 9 cinnamic acids, 5 benzoic acids, 5 ellagic acids and 2 stilbenes detected in all the samples. Total contents of each phenolic type varied significantly among the different grape cultivars investigated. There was also a large variability in the phenolic compositions of different grape groups. The differences in anthocyanin composition were obvious between V. vinifera and non-V. vinifera grapes and also between the grapes originating from Eurasia and North America. Quercetin-3-glucuronide and quercetin-3-glucoside were marker flavonol compounds for Euvitis grape skins. Flavan-3-ol monomers were dominant in the skins of muscadine and non-V. amurensis East Asian grapes, whereas polymers were more common in V. vinifera and North American grapes. The muscadine grapes were very rich in flavonols, flavan-3-ols and ellagic acids. Via principal component analysis, these grape cultivars were clustered into three groups according to their characteristic phenolic content and composition.

  13. Hypertension, nitric oxide, oxidants, and dietary plant polyphenols.

    Science.gov (United States)

    Galleano, Monica; Pechanova, Olga; Fraga, Cesar G

    2010-12-01

    Fruits and vegetables are key foods whose high ingestion is associated with the improvement of numerous pathological conditions, including hypertension. Such health promoting actions have been increasingly ascribed to the antioxidant characteristics of different polyphenols in fruits and vegetables. Consequently, based on this assumption, many beverages and foods rich in polyphenols, grape, tea, cocoa, and soy products and many of their chemical constituents purified, are being studied both, as antioxidants and antihypertensive agents. This paper reviews the current evidence linking high polyphenol consumption with reductions in blood pressure. Basic chemical aspects of flavanols, flavonols, isoflavones and stilbenes, as possible responsible for the observed effects of those foods on blood pressure are included. Human interventions studies by using grapes and wine, cocoa and chocolate, black and green tea, soy products, and purified compounds ((+)-catequin, quercetin, (-)-epigallocatechin gallate) are summarized. The discussed hypothesis, strongly supported by experimental data in animals, is that by regulating nitric oxide bioavailability, polyphenols present in fruits and vegetables affect endothelial function and as a consequence, blood pressure. Even when data are not definitive and many questions remain open, the whole evidence is encouraging to start considering diets that can provide a benefit to hypertensive subjects, and those benefits will be more significant in people that do not have controlled his/her elevated blood pressure.

  14. Characterization of excited electronic states of naphthalene by resonance Raman and hyper-Raman scattering

    International Nuclear Information System (INIS)

    Bonang, C.C.; Cameron, S.M.

    1992-01-01

    The first resonance Raman and hyper-Raman scattering from naphthalene are reported. Fourth harmonic of a mode-locked Nd:YAG laser is used to resonantly excite the 1 B 1u + transition, producing Raman spectra that confirm the dominance of the vibronically active ν 28 (b 3g ) mode and the Franck--Condon active a g modes, ν 5 and ν 3 . A synchronously pumped stilbene dye laser and its second harmonic are employed as the excitation sources for hyper-Raman and Raman scattering from the overlapping 1 B 2 u + and 1 A g - states. The Raman spectra indicate that the equilibrium geometry of naphthalene is distorted primarily along ν 5 , ν 8 , and ν 7 normal coordinates upon excitation to 1 B 2 u + . The hyper-Raman spectrum shows that ν 25 (b 2u ) is the mode principally responsible for vibronic coupling between the 1 A g - and 1 B 2u + states. The results demonstrate the advantageous features of resonance hyper-Raman scattering for the case of overlapping one- and two-photon allowed transitions. Calculations based on simple molecular orbital configurations are shown to qualitatively agree with the experimental results

  15. Glucuronidation of trans-resveratrol by human liver and intestinal microsomes and UGT isoforms.

    Science.gov (United States)

    Brill, Shirley S; Furimsky, Anna M; Ho, Mark N; Furniss, Michael J; Li, Yi; Green, Adam G; Bradford, Wallace W; Green, Carol E; Kapetanovic, Izet M; Iyer, Lalitha V

    2006-04-01

    Resveratrol (trans-resveratrol, trans-3,5,4'-trihydroxystilbene) is a naturally occurring stilbene analogue found in high concentrations in red wine. There is considerable research interest to determine the therapeutic potential of resveratrol, as it has been shown to have tumour inhibitory and antioxidant properties. This study was performed to investigate the glucuronidation of resveratrol and possible drug interactions via glucuronidation. Two glucuronide conjugates, resveratrol 3-O-glucuronide and resveratrol 4'-O-glucuronide, were formed by human liver and intestinal microsomes. UGT1A1 and UGT1A9 were predominantly responsible for the formation of the 3-O-glucuronide (Km = 149 microM) and 4'-O-glucuronide (Km = 365 microM), respectively. The glucuronide conjugates were formed at higher levels (up to 10-fold) by intestinal rather than liver microsomes. Resveratrol was co-incubated with substrates of UGT1A1 (bilirubin and 7-ethyl-10-hydroxycamptothecin (SN-38)) and UGT1A9 (7-hydroxytrifluoromethyl coumarin (7-HFC)). No major changes were noted in bilirubin glucuronidation in the presence of resveratrol. Resveratrol significantly inhibited the glucuronidation of SN-38 (Ki = 6.2 +/- 2.1 microM) and 7-HFC (Ki = 0.6 +/- 0.2 microM). Hence, resveratrol has the potential to inhibit the glucuronidation of concomitantly administered therapeutic drugs or dietary components that are substrates of UGT1A1 and UGT1A9.

  16. Molecular cloning and functional expression of a stress-induced multifunctional O-methyltransferase with pinosylvin methyltransferase activity from Scots pine (Pinus sylvestris L.).

    Science.gov (United States)

    Chiron, H; Drouet, A; Claudot, A C; Eckerskorn, C; Trost, M; Heller, W; Ernst, D; Sandermann, H

    2000-12-01

    Formation of pinosylvin (PS) and pinosylvin 3-O-monomethyl ether (PSM), as well as the activities of stilbene synthase (STS) and S-adenosyl-1-methionine (SAM):pinosylvin O-methyltransferase (PMT), were induced strongly in needles of Scots pine seedlings upon ozone treatment, as well as in cell suspension cultures of Scots pine upon fungal elicitation. A SAM-dependent PMT protein was purified and partially characterised. A cDNA encoding PMT was isolated from an ozone-induced Scots pine cDNA library. Southern blot analysis of the genomic DNA suggested the presence of a gene family. The deduced protein sequence showed the typical highly conserved regions of O-methyltransferases (OMTs), and average identities of 20-56% to known OMTs. PMT expressed in Escherichia coli corresponded to that of purified PMT (40 kDa) from pine cell cultures. The recombinant enzyme catalysed the methylation of PS, caffeic acid, caffeoyl-CoA and quercetin. Several other substances, such as astringenin, resveratrol, 5-OH-ferulic acid, catechol and luteolin, were also methylated. Recombinant PMT thus had a relatively broad substrate specificity. Treatment of 7-year old Scots pine trees with ozone markedly increased the PMT mRNA level. Our results show that PMT represents a new SAM-dependent OMT for the methylation of stress-induced pinosylvin in Scots pine needles.

  17. Mesostructured Au/C materials obtained by replication of functionalized SBA-15 silica containing highly dispersed gold nanoparticles

    KAUST Repository

    Kerdi, Fatmé

    2011-04-01

    The preparation and characterization of highly dispersed gold nanoparticles in ordered mesoporous carbons CMK-3 are reported. These carbons were obtained using gold-containing functionalized SBA-15 silicas as hard templates. Two series of Au/SiO2 templates were prepared, depending on the nature of the functionalization molecule. While ammonium-functionalized silicas gave gold particles with a size determined by the pores of the silica support, the use of mercaptopropyltrimethoxysilane as grafting molecule afforded the possibility to control the particle size inside the mesopores. Both series gave highly ordered mesoporous carbons with gold particles incorporated in the carbon nanorods. However, the gold particle size in mesoporous carbons was the same for both series and apparently did not depend on the nature of the silica template. Both Au/SiO2 templates and their corresponding Au/CMK-3 materials have been characterized by X-ray diffraction, nitrogen adsorption/desorption, chemical analysis, solid-state nuclear magnetic resonance and transmission electron microscopy. They were also used as catalysts in the aerobic oxidation of cyclohexene and trans-stilbene in the liquid phase. © 2010 Elsevier Inc. All rights reserved.

  18. Expression of the Grape VaSTS19 Gene in Arabidopsis Improves Resistance to Powdery Mildew and Botrytis cinerea but Increases Susceptibility to Pseudomonas syringe pv Tomato DC3000

    Directory of Open Access Journals (Sweden)

    Yaqiong Wang

    2017-09-01

    Full Text Available Stilbene synthase (STS is a key enzyme that catalyzes the biosynthesis of resveratrol compounds and plays an important role in disease resistance. The molecular pathways linking STS with pathogen responses and their regulation are not known. We isolated an STS gene, VaSTS19, from a Chinese wild grape, Vitis amurensis Rupr. cv. “Tonghua-3”, and transferred this gene to Arabidopsis. We then generated VaSTS19-expressing Arabidopsis lines and evaluated the functions of VaSTS19 in various pathogen stresses, including powdery mildew, B. cinerea and Pseudomonas syringae pv. tomato DC3000 (PstDC3000. VaSTS19 enhanced resistance to powdery mildew and B. cinerea, but increased susceptibility to PstDC3000. Aniline blue staining revealed that VaSTS19 transgenic lines accumulated more callose compared to nontransgenic control plants, and showed smaller stomatal apertures when exposed to pathogen-associated molecular patterns (flagellin fragment (flg22 or lipopolysaccharides (LPS. Analysis of the expression of several disease-related genes suggested that VaSTS19 expression enhanced defense responses though salicylic acid (SA and/or jasmonic acid (JA signaling pathways. These findings provide a deeper insight into the function of STS genes in defense against pathogens, and a better understanding of the regulatory cross talk between SA and JA pathways.

  19. Structurally simplified biphenyl combretastatin A4 derivatives retain in vitro anti-cancer activity dependent on mitotic arrest

    Science.gov (United States)

    Tarade, Daniel; Ma, Dennis; Pignanelli, Christopher; Mansour, Fadi; Simard, Daniel; van den Berg, Sean; Gauld, James; McNulty, James; Pandey, Siyaram

    2017-01-01

    The cis-stilbene, combretastatin A4 (CA4), is a potent microtubule targeting and vascular damaging agent. Despite promising results at the pre-clinical level and extensive clinical evaluation, CA4 has yet to be approved for therapeutic use. One impediment to the development of CA4 is an inherent conformational instability about the ethylene linker, which joins two aromatic rings. We have previously published preliminary data regarding structurally simplified biphenyl derivatives of CA4, lacking an ethylene linker, which retain anti-proliferative and pro-apoptotic activity, albeit at higher doses. Our current study provides a more comprehensive evaluation regarding the anti-proliferative and pro-apoptotic properties of biphenyl CA4 derivatives in both 2D and 3D cancerous and non-cancerous cell models. Computational analysis has revealed that cytotoxicity of CA4 and biphenyl analogues correlates with predicted tubulin affinity. Additional mechanistic evaluation of the biphenyl derivatives found that their anti-cancer activity is dependent on prolonged mitotic arrest, in a similar manner to CA4. Lastly, we have shown that cancer cells deficient in the extrinsic pathway of apoptosis experience delayed cell death following treatment with CA4 or analogues. Biphenyl derivatives of CA4 represent structurally simplified analogues of CA4, which retain a similar mechanism of action. The biphenyl analogues warrant in vivo examination to evaluate their potential as vascular damaging agents. PMID:28253265

  20. Structurally simplified biphenyl combretastatin A4 derivatives retain in vitro anti-cancer activity dependent on mitotic arrest.

    Directory of Open Access Journals (Sweden)

    Daniel Tarade

    Full Text Available The cis-stilbene, combretastatin A4 (CA4, is a potent microtubule targeting and vascular damaging agent. Despite promising results at the pre-clinical level and extensive clinical evaluation, CA4 has yet to be approved for therapeutic use. One impediment to the development of CA4 is an inherent conformational instability about the ethylene linker, which joins two aromatic rings. We have previously published preliminary data regarding structurally simplified biphenyl derivatives of CA4, lacking an ethylene linker, which retain anti-proliferative and pro-apoptotic activity, albeit at higher doses. Our current study provides a more comprehensive evaluation regarding the anti-proliferative and pro-apoptotic properties of biphenyl CA4 derivatives in both 2D and 3D cancerous and non-cancerous cell models. Computational analysis has revealed that cytotoxicity of CA4 and biphenyl analogues correlates with predicted tubulin affinity. Additional mechanistic evaluation of the biphenyl derivatives found that their anti-cancer activity is dependent on prolonged mitotic arrest, in a similar manner to CA4. Lastly, we have shown that cancer cells deficient in the extrinsic pathway of apoptosis experience delayed cell death following treatment with CA4 or analogues. Biphenyl derivatives of CA4 represent structurally simplified analogues of CA4, which retain a similar mechanism of action. The biphenyl analogues warrant in vivo examination to evaluate their potential as vascular damaging agents.

  1. Interleukin-17A induces bicarbonate secretion in normal human bronchial epithelial cells

    Science.gov (United States)

    Kreindler, James L.; Bertrand, Carol A.; Lee, Robert J.; Karasic, Thomas; Aujla, Shean; Pilewski, Joseph M.; Frizzell, Raymond A.; Kolls, Jay K.

    2009-01-01

    The innate immune functions of human airways include mucociliary clearance and antimicrobial peptide activity. Both functions may be affected by changes in epithelial ion transport. Interleukin-17A (IL-17A), which has a receptor at the basolateral membrane of airway epithelia, is a T cell cytokine that has been shown to increase mucus secretion and antimicrobial peptide production by human bronchial epithelial (HBE) cells. Furthermore, IL-17A levels are increased in sputum from patients during pulmonary exacerbations of cystic fibrosis. Therefore, we investigated the effects of IL-17A on basal, amiloride-sensitive, and forskolin-stimulated ion transport in mature, well-differentiated HBE cells. Exposure of HBE monolayers to IL-17A for 48 h induced a novel forskolin-stimulated bicarbonate secretion in addition to forskolin-stimulated chloride secretion and resulted in alkalinization of liquid on the mucosal surface of polarized cells. IL-17A-induced bicarbonate secretion was cystic fibrosis transmembrane conductance regulator (CFTR)-dependent, mucosal chloride-dependent, partially Na+-dependent, and sensitive to serosal, but not mucosal, stilbene inhibition. These data suggest that IL-17A modulates epithelial bicarbonate secretion and implicate a mechanism by which airway surface liquid pH changes may be abnormal in cystic fibrosis. PMID:19074559

  2. Expedient construction of small molecule macroarrays via sequential palladium- and copper-mediated reactions and their ex situ biological testing.

    Science.gov (United States)

    Frei, Reto; Breitbach, Anthony S; Blackwell, Helen E

    2012-05-01

    We report the highly efficient syntheses of a series of focused libraries in the small molecule macroarray format using Suzuki-Miyaura and copper-catalyzed azide-alkyne cycloaddition (or "click") reactions. The libraries were based on stilbene and triazole scaffolds, which are known to have a broad range of biological activities, including quorum-sensing (QS) modulation in bacteria. The library products were generated in parallel on the macroarray in extremely short reaction times (~10-20 min) and isolated in excellent purities. Biological testing of one macroarray library post-cleavage (ex situ) revealed several potent agonists of the QS receptor, LuxR, in Vibrio fischeri. These synthetic agonists, in contrast to others that we have reported, were only active in the presence of the native QS signal in V. fischeri, which is suggestive of a different mode of activity. Notably, the results presented herein showcase the ready compatibility of the macroarray platform with chemical reactions that are commonly utilized in small molecule probe and drug discovery today. As such, this work serves to expand the utility of the small molecule macroarray as a rapid and operationally straightforward approach toward the synthesis and screening of bioactive agents.

  3. "1H and "1"3C NMR Data on Hydroxy/methoxy Flavonoids and the Effects of Substituents on Chemical Shifts

    International Nuclear Information System (INIS)

    Yoon, Hyuk; Eom, Sung Lock; Hyun, Ji Ye; Jo, Geun Hyeong; Hwang, Do Seok; Lee, Sun Hee; Yong, Yeon Joong; Lee, Young Han; Lim, Yoong Ho; Park, Jun Cheol

    2011-01-01

    Polyphenols have recently been examined for such applications, and they are classified based on their carbon skeletons: phenolic acids with C6-C1 skeleton, hydrocinammates with C6-C_3 skeleton, stilbenes with C6-C2-C6 skeleton, and flavonoids with C6-C_3-C6 skeleton.2 Of these compounds, flavonoids are ubiquitously found in most plants. Since flavonoids belong to polyphenols, they have many hydroxy groups. From a bioavailability point of view, hydroxy groups prevent cell membrane transport, and hydroxyflavonoids can be metabolized by O-methyltransferases. However, methoxylated flavonoids may not have these problems. Hydroxylated or methoxylated flavonoids are found from natural sources. Nuclear magnetic resonance (NMR) spectroscopy is widely used to identify different compounds including hydroxylated or methoxylated flavonoids. Because the position and the number of substituted hydroxy or/and methoxy groups will change the "1H and "1"3C chemical shifts, it is important to understand these changes so that the structures of newly isolated hydroxy/methoxy-flavonoids can be easily identified

  4. Removal of Water-Soluble Extractives Improves the Enzymatic Digestibility of Steam-Pretreated Softwood Barks.

    Science.gov (United States)

    Frankó, Balázs; Carlqvist, Karin; Galbe, Mats; Lidén, Gunnar; Wallberg, Ola

    2018-02-01

    Softwood bark contains a large amounts of extractives-i.e., soluble lipophilic (such as resin acids) and hydrophilic components (phenolic compounds, stilbenes). The effects of the partial removal of water-soluble extractives before acid-catalyzed steam pretreatment on enzymatic digestibility were assessed for two softwood barks-Norway spruce and Scots pine. A simple hot water extraction step removed more than half of the water-soluble extractives from the barks, which improved the enzymatic digestibility of both steam-pretreated materials. This effect was more pronounced for the spruce than the pine bark, as evidenced by the 30 and 11% glucose yield improvement, respectively, in the enzymatic digestibility. Furthermore, analysis of the chemical composition showed that the acid-insoluble lignin content of the pretreated materials decreased when water-soluble extractives were removed prior to steam pretreatment. This can be explained by a decreased formation of water-insoluble "pseudo-lignin" from water-soluble bark phenolics during the acid-catalyzed pretreatment, which otherwise results in distorted lignin analysis and may also contribute to the impaired enzymatic digestibility of the barks. Thus, this study advocates the removal of extractives as the first step in the processing of bark or bark-rich materials in a sugar platform biorefinery.

  5. Wine Resveratrol: From the Ground Up

    Directory of Open Access Journals (Sweden)

    Luigi Bavaresco

    2016-04-01

    Full Text Available The ability of the grapevine to activate defense mechanisms against some pathogens has been shown to be linked to the synthesis of resveratrol and other stilbenes by the plant (inducible viniferins. Metabolized viniferins may also be produced or modified by extracellular enzymes released by the pathogen in an attempt to eliminate undesirable toxic compounds. Because of the important properties of resveratrol, there is increasing interest in producing wines with higher contents of this compound and a higher nutritional value. Many biotic and abiotic elicitors can trigger the resveratrol synthesis in the berries, and some examples are reported. Under the same elicitation pressure, viticultural and enological factors can substantially affect the resveratrol concentration in the wine. The production of high resveratrol-containing grapes and wines relies on quality-oriented viticulture (suitable terroirs and sustainable cultural practices and winemaking technologies that avoid degradation of the compound. In general, the oenological practices commonly used to stabilize wine after fermentation do not affect resveratrol concentration, which shows considerable stability. Finally the paper reports on two sirtuin genes (SIRT expressed in grapevine leaves and berries and the role of resveratrol on the deacetylation activity of the encoded enzymes.

  6. Dietary Resveratrol Does Not Affect Life Span, Body Composition, Stress Response, and Longevity-Related Gene Expression in Drosophila melanogaster.

    Science.gov (United States)

    Staats, Stefanie; Wagner, Anika E; Kowalewski, Bianca; Rieck, Florian T; Soukup, Sebastian T; Kulling, Sabine E; Rimbach, Gerald

    2018-01-11

    In this study, we tested the effect of the stilbene resveratrol on life span, body composition, locomotor activity, stress response, and the expression of genes encoding proteins centrally involved in ageing pathways in the model organism Drosophila melanogaster . Male and female w 1118 D. melanogaster were fed diets based on sucrose, corn meal, and yeast. Flies either received a control diet or a diet supplemented with 500 µmol/L resveratrol. Dietary resveratrol did not affect mean, median, and maximal life span of male and female flies. Furthermore, body composition remained largely unchanged following the resveratrol supplementation. Locomotor activity, as determined by the climbing index, was not significantly different between control and resveratrol-supplemented flies. Resveratrol-fed flies did not exhibit an improved stress response towards hydrogen peroxide as compared to controls. Resveratrol did not change mRNA steady levels of antioxidant ( catalase , glutathione-S-transferase , NADH dehydrogenase , glutathione peroxidase , superoxide dismutase 2 ) and longevity-related genes, including sirtuin 2 , spargel , and I'm Not Dead Yet . Collectively, present data suggest that resveratrol does not affect life span, body composition, locomotor activity, stress response, and longevity-associated gene expression in w 1118 D. melanogaster .

  7. Resveratrol Protects the Brain of Obese Mice from Oxidative Damage

    Directory of Open Access Journals (Sweden)

    Shraddha D. Rege

    2013-01-01

    Full Text Available Resveratrol (3,5,4′-trihydroxy-trans-stilbene is a polyphenolic phytoalexin that exerts cardioprotective, neuroprotective, and antioxidant effects. Recently it has been shown that obesity is associated with an increase in cerebral oxidative stress levels, which may enhance neurodegeneration. The present study evaluates the neuroprotective action of resveratrol in brain of obese (ob/ob mice. Resveratrol was administered orally at the dose of 25 mg kg−1 body weight daily for three weeks to lean and obese mice. Resveratrol had no effect on body weight or blood glucose levels in obese mice. Lipid peroxides were significantly increased in brain of obese mice. The enzymatic antioxidants superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase, glucose-6-phosphate dehydrogenase and nonenzymatic antioxidants tocopherol, ascorbic acid, and glutathione were decreased in obese mice brain. Administration of resveratrol decreased lipid peroxide levels and upregulated the antioxidant activities in obese mice brain. Our findings indicate a neuroprotective effect of resveratrol by preventing oxidative damage in brain tissue of obese mice.

  8. Trans-resveratrol: a magical elixir of eternal youth?

    Science.gov (United States)

    Orallo, Francisco

    2008-01-01

    Trans-resveratrol or (E)-resveratrol [3,4',5 trihydroxy-trans-stilbene, t-RESV or (E)-RESV] is a natural component of Vitis vinifera L. (Vitaceae), abundant in the skin of grapes (but not in the flesh) and in the leaf epidermis and present in wines (especially red wines). In in vitro, ex vivo and in vivo experiments, t-RESV exhibits a number of biological activities, including anti inflammatory, antioxidant, platelet antiaggregatory and anticarcinogenic properties, and modulation of lipoprotein metabolism. Some of these activities have been implicated in the cardiovascular protective effects attributed to t-RESV and to red wine. Prior to 2002 there had been no previous studies describing the potential effects of t-RESV on the lifespan extension. However, in the last 5 years, several researchers have reported that t-RESV is a potent activator of sirtuin enzymatic activity, mimics the beneficial effects of caloric restriction (CR), retards the aging process and increases longevity in a number of organisms from different phyla such as yeasts, worms, flies and short-lived fish. In addition, t-RESV seems to be effective in delaying the onset of a variety of age-related diseases in mammals (e.g.: rodents). Therefore, this review will basically focus on the possible role of t-RESV to extend life duration and on some of the mechanisms by which t-RESV may act as an anti-aging agent.

  9. Impact of boiling on free and bound phenolic profile and antioxidant activity of commercial gluten-free pasta.

    Science.gov (United States)

    Rocchetti, Gabriele; Lucini, Luigi; Chiodelli, Giulia; Giuberti, Gianluca; Montesano, Domenico; Masoero, Francesco; Trevisan, Marco

    2017-10-01

    Cooking by boiling dry pasta could have varying degrees of influence on nutritional and functional components. In the present study, its effect on total phenolic content and antioxidant capacity, as well as on the comprehensive profile of free and bound phenolics, was investigated in six commercial gluten-free (GF) pasta products. Overall, the heat treatment caused a significant reduction (Pphenolic content as well as FRAP reducing power and ORAC radical scavenging, with significant differences among the pasta samples considered. The highest values were recorded in free phenolic fraction remaining in black rice (41mggallic acid equivalents100g -1 and 25mmolTrolox Equivalents100g -1 ) and quinoa (24mggallic acid equivalents100g -1 and 14mmolTrolox Equivalents100g -1 ) cooked GF pasta. Significant correlations (Pphenolics and both the antioxidant capacity assays performed. UHPLC-ESI/QTOF-MS mass profiling allowed confirming the spectrophotometric results, while identifying the amount of free and bound fractions. Among phenolic classes, lignans exhibited the highest decrease during the cooking process, followed by stilbenes and flavonoids. However, phenolic acids and other phenolics showed the highest stability. Furthermore, cooking by boiling strongly lowered the bound-to-free ratio of phenolic compounds, by an averaged factor ranging from 14-folds for flavonoids to 5-folds for other classes of phenolics. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Scanning of Cargo Containers by Gamma-Ray and Fast Neutron Radiography

    International Nuclear Information System (INIS)

    Yousri, A.M.; Bashter, I.I.; Megahid, M.R.; Osman, A.M.; Kansouh, W.A.; Reda, A.M.

    2011-01-01

    This paper describes the combined systems which were installed and tested to detect contraband smuggled in cargo containers. These combined systems are based on radiographers work by gamma-rays emitted from point source 60 Co with 0.5 Ci activity and neutrons emitted from point isotopic sources of Pu-α-Be as well as 14 MeV neutrons emitted from sealed tube neutron generator. The transmitted gamma ray through the inspected object was measured by gamma detection system with NaI(Tl) detector while the transmitted fast neutron beam was measured by a neutron gamma detection system with stilbene organic scintillator. The later possess the capability of discrimination between between gamma and neutron pulses using a discrimination system based on pulse shape discrimination method. The measured intensities of primary incident and transmitted beams of gamma-rays and fast neutrons were used to construct 2D cross-sectional images of the inspected objects hidden directly within benign materials of the container and for object screened by high dense material to stop object detection by gamma or X-rays. The constructed images for the inspected objects show the good capability and effectiveness of the installed gamma and neutron radiographers to detect illicit materials hidden in air cargo containers and sea containers of med size. They have also indicated that the developed scanning systems possess the ease of mobility and low cost of scanning

  11. Taste-active compounds in a traditional Italian food: 'lampascioni'.

    Science.gov (United States)

    Borgonovo, Gigliola; Caimi, Sara; Morini, Gabriella; Scaglioni, Leonardo; Bassoli, Angela

    2008-06-01

    Nature is a rich source of taste-active compounds, in particular of plant origin, many of which have unusual tastes. Many of these are found in traditional food, where spontaneous plants are used as ingredients. Some taste-active compounds were identified in the bulbs of Muscari comosum, a spontaneous plant belonging to the family of the Liliaceae, very common in the Mediterranean area, and used in traditional gastronomy (called 'lampascioni' in South Italy). The bulbs were extracted with a series of solvents of different polarity. The different fractions were submitted to a preliminary sensory evaluation, and the most interesting ones, characterized by a strong bitter taste and some chemestetic properties, were submitted to further purification and structural analysis. From the ethereal extract, several 3-benzyl-4-chromanones and one stilbene derivative were isolated. Pure compounds were examined for their taste activity by means of sensory evaluation, and proved to be responsible for the characteristic taste of this food. Some of these compounds have been synthesized de novo to confirm their structure.

  12. Berry Phenolics of Grapevine under Challenging Environments

    Directory of Open Access Journals (Sweden)

    Hernâni Gerós

    2013-09-01

    Full Text Available Plant phenolics have been for many years a theme of major scientific and applied interest. Grape berry phenolics contribute to organoleptic properties, color and protection against environmental challenges. Climate change has already caused significant warming in most grape-growing areas of the world, and the climatic conditions determine, to a large degree, the grape varieties that can be cultivated as well as wine quality. In particular, heat, drought and light/UV intensity severely affect phenolic metabolism and, thus, grape composition and development. In the variety Chardonnay, water stress increases the content of flavonols and decreases the expression of genes involved in biosynthesis of stilbene precursors. Also, polyphenolic profile is greatly dependent on genotype and environmental interactions. This review deals with the diversity and biosynthesis of phenolic compounds in the grape berry, from a general overview to a more detailed level, where the influence of environmental challenges on key phenolic metabolism pathways is approached. The full understanding of how and when specific phenolic compounds accumulate in the berry, and how the varietal grape berry metabolism responds to the environment is of utmost importance to adjust agricultural practices and thus, modify wine profile.

  13. Wine phenolics.

    Science.gov (United States)

    Waterhouse, Andrew L

    2002-05-01

    Wine contains many phenolic substances, most of which originate in the grape berry. The phenolics have a number of important functions in wine, affecting the tastes of bitterness and astringency, especially in red wine. Second, the color of red wine is caused by phenolics. Third, the phenolics are the key wine preservative and the basis of long aging. Lastly, since phenolics oxidize readily, they are the component that suffers owing to oxidation and the substance that turns brown in wine (and other foods) when exposed to air. Wine phenolics include the non-flavonoids: hydroxycinnamates, hydroxybenzoates and the stilbenes; plus the flavonoids: flavan-3-ols, the flavonols, and the anthocyanins. While polymeric condensed tannins and pigmented tannins constitute the majority of wine phenolics, their large size precludes absorption and thus they are not likely to have many health effects (except, perhaps, in the gut). The total amount of phenols found in a glass of red wine is on the order of 200 mg versus about 40 mg in a glass of white wine.

  14. A Naturally Occurring Antioxidant Complex from Unripe Grapes: The Case of Sangiovese (v. Vitis vinifera

    Directory of Open Access Journals (Sweden)

    Giovanna Fia

    2018-02-01

    Full Text Available The wine industry is well known for its production of a large amount of wastes and by-products. Among them, unripe grapes from thinning operations are an undervalued by-product. Grapes are an interesting source of natural antioxidants such as flavonoids, non-flavonoids and stilbenes. A potential strategy to exploit unripe grapes was investigated in this study. Juice from unripe grapes, v. Sangiovese, was obtained by an innovative technique of solid-liquid extraction without the use of solvents. The juice was dried by a spray-drying technique with the addition of arabic gum as support to obtain powder; juice and powder were characterized for antioxidant activity, phenolic concentration and profile. Phenolic acids, flavonols, flava-3-ols, procyanidins and resveratrol were detected in the juice and powder. The powder was used as anti-browning additive in white wine to test the potential re-use of the unripe grapes in the wine industry. The results indicated that the antioxidant complex from unripe grapes contributed to increasing the anti-browning capacity of white wine. Other applications, such as food and nutraceutical products development, can be considered for the antioxidant complex extracted from unripe grapes. In conclusion, the method proposed in this study may contribute to the exploitation of unripe grapes as a by-product of the winemaking process.

  15. Effect of Different Solvents on the Measurement of Phenolics and the Antioxidant Activity of Mulberry (Morus atropurpurea Roxb.) with Accelerated Solvent Extraction.

    Science.gov (United States)

    Yang, Jiufang; Ou, XiaoQun; Zhang, Xiaoxu; Zhou, ZiYing; Ma, LiYan

    2017-03-01

    The effects of 9 different solvents on the measurement of the total phenolics and antioxidant activities of mulberry fruits were studied using accelerated solvent extraction (ASE). Sixteen to 22 types of phenolics (flavonols, flavan-3-ols, flavanol, hydroxycinnamic acids, hydroxybenzoic acids, and stilbenes) from different mulberry extracts were characterized and quantified using HPLC-MS/MS. The principal component analysis (PCA) was used to determine the suitable solvents to distinguish between different classes of phenolics. Additionally, the phenolic extraction abilities of ASE and ultrasound-assisted extraction (UAE) were compared. The highest extraction efficiency could be achieved by using 50% acidified methanol (50MA) as ASE solvents with 15.14 mg/gallic acid equivalents g dry weight of mulberry fruit. The PCA results revealed that the 50MA followed by 50% acidified acetone (50AA) was the most efficient solvent for the extraction of phenolics, particularly flavonols (627.12 and 510.31 μg/g dry weight, respectively), while water (W) was not beneficial to the extraction of all categories of phenolics. Besides, the results of 3 antioxidant capability assays (DPPH, ABTS free radical-scavenging assay, and ferric-reducing antioxidant power assay) showed that water-based organic solvents increased the antioxidant capabilities of the extracts compared with water or pure organic solvents. ASE was more suitable for the extraction of phenolics than UAE. © 2017 Institute of Food Technologists®.

  16. Extraction of antioxidants from spruce (Picea abies) bark using eco-friendly solvents.

    Science.gov (United States)

    Co, Michelle; Fagerlund, Amelie; Engman, Lars; Sunnerheim, Kerstin; Sjöberg, Per J R; Turner, Charlotta

    2012-01-01

    Antioxidants are known to avert oxidation processes and they are found in trees and other plant materials. Tree bark is a major waste product from paper pulp industries; hence it is worthwhile to develop an extraction technique to extract the antioxidants. To develop a fast and environmentally sustainable extraction technique for the extraction of antioxidants from bark of spruce (Picea abies) and also to identify the extracted antioxidants that are abundant in spruce bark. A screening experiment that involved three different techniques was conducted to determine the best technique to extract antioxidants. The antioxidant capacity of the extracts was determined with DPPH (2,2-diphenyl-1-picrylhydrazyl) assay. Pressurised fluid extraction (PFE) turned out to be the best technique and a response surface design was therefore utilised to optimise PFE. Furthermore, NMR and HPLC-DAD-MS/MS were applied to identify the extracted antioxidants. PFE using water and ethanol as solvent at 160 and 180°C, respectively, gave extracts of the highest antioxidant capacity. Stilbene glucosides such as isorhapontin, piceid and astringin were identified in the extracts. The study has shown that PFE is a fast and environmentally sustainable technique, using water and ethanol as solvent for the extraction of antioxidants from spruce bark. Copyright © 2011 John Wiley & Sons, Ltd.

  17. Expression of the Grape VaSTS19 Gene in Arabidopsis Improves Resistance to Powdery Mildew and Botrytis cinerea but Increases Susceptibility to Pseudomonas syringe pv Tomato DC3000.

    Science.gov (United States)

    Wang, Yaqiong; Wang, Dejun; Wang, Fan; Huang, Li; Tian, Xiaomin; van Nocker, Steve; Gao, Hua; Wang, Xiping

    2017-09-17

    Stilbene synthase (STS) is a key enzyme that catalyzes the biosynthesis of resveratrol compounds and plays an important role in disease resistance. The molecular pathways linking STS with pathogen responses and their regulation are not known. We isolated an STS gene, VaSTS19 , from a Chinese wild grape, Vitis amurensis Rupr. cv. "Tonghua-3", and transferred this gene to Arabidopsis . We then generated VaSTS19 -expressing Arabidopsis lines and evaluated the functions of VaSTS19 in various pathogen stresses, including powdery mildew, B. cinerea and Pseudomonas syringae pv. tomato DC3000 ( Pst DC3000). VaSTS19 enhanced resistance to powdery mildew and B. cinerea , but increased susceptibility to Pst DC3000. Aniline blue staining revealed that VaSTS19 transgenic lines accumulated more callose compared to nontransgenic control plants, and showed smaller stomatal apertures when exposed to pathogen-associated molecular patterns (flagellin fragment (flg22) or lipopolysaccharides (LPS)). Analysis of the expression of several disease-related genes suggested that VaSTS19 expression enhanced defense responses though salicylic acid (SA) and/or jasmonic acid (JA) signaling pathways. These findings provide a deeper insight into the function of STS genes in defense against pathogens, and a better understanding of the regulatory cross talk between SA and JA pathways.

  18. Polyphenols in Food: Cancer Prevention and Apoptosis Induction.

    Science.gov (United States)

    Sharma, Ashita; Kaur, Mandeep; Katnoria, Jatinder Kaur; Nagpal, Avinash Kaur

    2017-10-06

    Polyphenols are group of water-soluble organic compounds, mainly of natural origin. The compounds having about 5-7 aromatic rings and more than 12 phenolic hydroxyl groups are classified as polyphenols. These are the antioxidants which protect the body from oxidative damage. In plants, they are the secondary metabolites produced as a defense mechanism against stress factors. Antioxidant property of polyphenols is suggested to provide protection against many diseases associated with reactive oxygen species (ROS), including cancer. Various studies carried out across the world have suggested that polyphenols can inhibit the tumor generation, induce apoptosis in cancer cells and interfere in progression of tumors. This group of wonder compounds is present in surplus in natural plants and food products. Intake of polyphenols through diet can scavenge ROS and thus can help in cancer prevention. The plant derived products can also be used along with conventional chemotherapy to enhance the chemopreventive effects. The present review focuses on various in vitro and in vivo studies carried out to assess the anti-carcinogenic potential of polyphenols present in our food. Also, the pathways involved in cancer chemopreventive effects of various subclasses (flavonoids, lignans, stilbenes and phenolic acids) of polyphenols are discussed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  19. Dietary polyphenol supplementation prevents alterations of spatial navigation in middle-aged mice

    Directory of Open Access Journals (Sweden)

    Julien eBensalem

    2016-02-01

    Full Text Available Spatial learning and memory deficits associated with hippocampal synaptic plasticity impairments are commonly observed during aging. Besides, the beneficial role of dietary polyphenols has been suggested as potential functional food candidates to prevent this memory decline. Indeed, polyphenols could potentiate the signaling pathways of synaptic plasticity underlying learning and memory. In this study, spatial learning deficits of middle-aged mice were first highlighted and characterized according to navigation patterns in the Morris water maze task. An eight-week polyphenol-enriched diet, containing a polyphenol-rich extract from grape and blueberry (PEGB (from the Neurophenols Consortium with high contents of flavonoids, stilbenes and phenolic acids, was then successful in reversing these age-induced effects. The use of spatial strategies was indeed delayed with aging whereas a polyphenol supplementation could promote the occurrence of spatial strategies. These behavioral results were associated with neurobiological changes: while the expression of hippocampal CaMKII mRNA levels was reduced in middle-aged animals, the polyphenol-enriched diet could rescue them. Besides, an increased expression of NGF mRNA levels was also observed in supplemented adult and middle-aged mice. Thus these data suggest that supplementation with polyphenols could be an efficient nutritional way to prevent age-induced cognitive decline.

  20. Vitisin A inhibits adipocyte differentiation through cell cycle arrest in 3T3-L1 cells

    International Nuclear Information System (INIS)

    Kim, Soon-hee; Park, Hee-Sook; Lee, Myoung-su; Cho, Yong-Jin; Kim, Young-Sup; Hwang, Jin-Taek; Sung, Mi Jeong; Kim, Myung Sunny; Kwon, Dae Young

    2008-01-01

    Inhibition of adipocyte differentiation is one approach among the anti-obesity strategies. This study demonstrates that vitisin A, a resveratrol tetramer, inhibits adipocyte differentiation most effectively of 18 stilbenes tested. Fat accumulation and PPARγ expression were decreased by vitisin A in a dose-dependent manner. Vitisin A significantly inhibited preadipocyte proliferation and consequent differentiation within the first 2 days of treatment, indicating that the anti-adipogenic effect of vitisin A was derived from anti-proliferation. Based on cell cycle analysis, vitisin A blocked the cell cycle at the G1-S phase transition, causing cells to remain in the preadipocyte state. Vitisin A increased p21 expression, while the Rb phosphorylation level was reduced. Therefore, vitisin A seems to induce G1 arrest through p21- and consequent Rb-dependent suppression of transcription. On the other hand, ERK and Akt signaling pathways were not involved in the anti-mitotic regulation by vitisin A. Taken together, these results suggest that vitisin A inhibits adipocyte differentiation through preadipocyte cell cycle arrest

  1. Ion pairing of radical ions of aromatic alkenes and alkynes studied by pulse radiolysis

    International Nuclear Information System (INIS)

    Yamamoto, Satoshi; Yamamoto, Yukio; Hayashi, Koichiro

    1991-01-01

    Pulse radiolysis of 1,2-dichloroethane solutions of trans,trans-1,4-bis(2-phenylethenyl)benzene and 1,4-bis(2-phenylethynyl)benzene was undertaken in the presence of Bu 4 NPF 6 (Bu=butyl) to investigate the effect of ion pairing of the solute radical cations with PF 6 - . It was also undertaken for the tetrahydrofuran solutions of the above compounds in the presence of Bu 4 NPF 6 and NaBPh 4 , where the solute radical anions are generated and form ion pairs with Bu 4 N + and Na + . The decay of the radical ions, which is due to neutralization, is retarded by the ion pairing. The rate constants for the neutralization reactions in the free-ion and ion-paired states were determined. Also presented are the data for the radical ions of trans-stilbene, diphenylacetylene, trans,trans-1,4-diphenyl-1,3-butadiene, and diphenylbutadiene. The radical ions of the aromatic alkynes are less stabilized by the ion pairing than those of the aromatic alkenes having the same carbon skeletons probably because of more extensive charge delocalization of the former radical ions. Spectral shifts to shorter wavelengths caused by the ion pairing are appreciable for the radical anions. Dependence of the spectral shifts on the size of the radical anions is described. (author)

  2. The role of seaweed bioactives in the control of digestion: implications for obesity treatments.

    Science.gov (United States)

    Chater, Peter I; Wilcox, Matthew D; Houghton, David; Pearson, Jeffrey P

    2015-11-01

    Seaweeds are an underutilised nutritional resource that could not only compliment the current western diet but potentially bring additional health benefits over and above their nutritional value. There are four groups of seaweed algae; green algae (Chlorophyceae), red algae (Rhodophycae), blue-green algae (Cyanophyceae) and brown algae (Phaeophyceae). Seaweeds are rich in bioactive components including polysaccharides and polyphenols. Polysaccharides content, such as fucoidan, laminarin, as well as alginate is generally high in brown seaweeds which are also a source of polyphenols such as phenolic acids, flavonoids, phlorotannin, stilbenes and lignans. These components have been shown to reduce the activity of digestive enzymes, modulating enzymes such as α-amylase, α-glucosidase, pepsin and lipase. This review discusses the effect of several of these components on the digestive processes within the gastrointestinal tract; focusing on the effect of alginate on pancreatic lipase activity and its potential health benefits. Concluding that there is evidence to suggest alginate has the potential to be used as an obesity treatment, however, further in vivo research is required and an effective delivery method for alginate must be designed.

  3. Resveratrol for breast cancer prevention and therapy: Preclinical evidence and molecular mechanisms.

    Science.gov (United States)

    Sinha, Dona; Sarkar, Nivedita; Biswas, Jaydip; Bishayee, Anupam

    2016-10-01

    Globally, breast cancer is the most frequently diagnosed cancer among women. The major unresolved problems with metastatic breast cancer is recurrence after receiving objective response to chemotherapy, drug-induced side effects of first line chemotherapy and delayed response to second line of treatment. Unfortunately, very few options are available as third line treatment. It is clear that under such circumstances there is an urgent need for new and effective drugs. Phytochemicals are among the most promising chemopreventive treatment options for the management of cancer. Resveratrol (3,5,4'-trihydroxy-trans-stilbene), a non-flavonoid polyphenol present in several dietary sources, including grapes, berries, soy beans, pomegranate and peanuts, has been shown to possess a wide range of health benefits through its effect on a plethora of molecular targets.The present review encompasses the role of resveratrol and its natural/synthetic analogue in the light of their efficacy against tumor cell proliferation, metastasis, epigenetic alterations and for induction of apoptosis as well as sensitization toward chemotherapeutic drugs in various in vitro and in vivo models of breast cancer. The roles of resveratrol as a phytoestrogen, an aromatase inhibitor and in stem cell therapy as well as adjuvent treatment are also discussed. This review explores the full potential of resveratrol in breast cancer prevention and treatment with current limitations, challenges and future directions of research. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Improved tolerance toward fungal diseases in transgenic Cavendish banana (Musa spp. AAA group) cv. Grand Nain.

    Science.gov (United States)

    Vishnevetsky, Jane; White, Thomas L; Palmateer, Aaron J; Flaishman, Moshe; Cohen, Yuval; Elad, Yigal; Velcheva, Margarita; Hanania, Uri; Sahar, Nachman; Dgani, Oded; Perl, Avihai

    2011-02-01

    The most devastating disease currently threatening to destroy the banana industry worldwide is undoubtedly Sigatoka Leaf spot disease caused by Mycosphaerella fijiensis. In this study, we developed a transformation system for banana and expressed the endochitinase gene ThEn-42 from Trichoderma harzianum together with the grape stilbene synthase (StSy) gene in transgenic banana plants under the control of the 35S promoter and the inducible PR-10 promoter, respectively. The superoxide dismutase gene Cu,Zn-SOD from tomato, under control of the ubiquitin promoter, was added to this cassette to improve scavenging of free radicals generated during fungal attack. A 4-year field trial demonstrated several transgenic banana lines with improved tolerance to Sigatoka. As the genes conferring Sigatoka tolerance may have a wide range of anti-fungal activities we also inoculated the regenerated banana plants with Botrytis cinerea. The best transgenic lines exhibiting Sigatoka tolerance were also found to have tolerance to B. cinerea in laboratory assays.

  5. Identification of Vitis vinifera L. grape berry skin color mutants and polyphenolic profile.

    Science.gov (United States)

    Ferreira, Vanessa; Fernandes, Fátima; Pinto-Carnide, Olinda; Valentão, Patrícia; Falco, Virgílio; Martín, Juan Pedro; Ortiz, Jesús María; Arroyo-García, Rosa; Andrade, Paula B; Castro, Isaura

    2016-03-01

    A germplasm set of twenty-five grapevine accessions, forming eleven groups of possible berry skin color mutants, were genotyped with twelve microsatellite loci, being eleven of them identified as true color mutants. The polyphenolic profiling of the confirmed mutant cultivars revealed a total of twenty-four polyphenols, comprising non-colored compounds (phenolic acids, flavan-3-ols, flavonols and a stilbene) and anthocyanins. Results showed differences in the contribution of malvidin-3-O-glucoside to the characteristic Pinot Noir anthocyanins profile. Regarding the two Pique-Poul colored variants, the lighter variant was richer than the darker one in all classes of compounds, excepting anthocyanins. In Moscatel Galego Roxo the F3'H pathway seems to be more active than F3'5'H, resulting in higher amounts of cyanidin, precursor of the cyanidin derivatives. As far as we are aware, this is the first time that a relationship between the content of polyphenolic compounds is established in groups of grape berry skin color mutant cultivars. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Profile of bioactive compounds from grape pomace (Vitis vinifera and Vitis labrusca) by spectrophotometric, chromatographic and spectral analyses.

    Science.gov (United States)

    Ribeiro, L F; Ribani, R H; Francisco, T M G; Soares, A A; Pontarolo, R; Haminiuk, C W I

    2015-12-15

    The aim of this study was to characterize grape pomace (GP) from winemaking byproducts of different grape samples (Cabernet Sauvignon-CS; Merlot-ME; Mix composed of 65% Bordeaux, 25% Isabel and 10% BRS Violet-MI and Terci-TE) with a view to exploiting its potential as a source of bioactive compounds and an alternative to the reuse of waste. Bioactive compounds such as individual phenolic compounds and polyunsaturated fatty acids (PUFA) were identified and quantified by spectrophotometric, chromatographic and spectral analyses. The sample of MI had the highest concentrations for total phenolic compounds and total flavonoids, while TE had the highest content for total monomeric anthocyanins. For all samples it was possible to identify 13 different anthocyanins by high performance liquid chromatography (HPLC) and mass spectrometry (MS). Moreover, the GP samples showed phenolic acids; flavan-3-ols such as catechin; flavonols such as quercetin, rutin and kaempferol; and stilbenes such as trans-resveratrol. Therefore, grape pomace can be considered a source for the recovery of phenolic compounds having antioxidant activity as well as a rich source of PUFA. Thus it can be used as an ingredient in the development of new food products, since it is suitable for human consumption, and a viable alternative both to adding nutritional value to food and to reduce environmental contamination. Copyright © 2015. Published by Elsevier B.V.

  7. Principal components of phenolics to characterize red Vinho Verde grapes: anthocyanins or non-coloured compounds?

    Science.gov (United States)

    Dopico-García, M S; Fique, A; Guerra, L; Afonso, J M; Pereira, O; Valentão, P; Andrade, P B; Seabra, R M

    2008-06-15

    Phenolic profile of 10 different varieties of red "Vinho Verde" grapes (Azal Tinto, Borraçal, Brancelho, Doçal, Espadeiro, Padeiro de Basto, Pedral, Rabo de ovelha, Verdelho and Vinhão), from Minho (Portugal) were studied. Nine Flavonols, four phenolic acids, three flavan-3-ols, one stilben and eight anthocyanins were determined. Malvidin-3-O-glucoside was the most abundant anthocyanin while the main non-coloured compound was much more heterogeneous: catechin, epicatechin, myricetin-3-O-glucoside, quercetin-3-O-glucoside or syringetin-3-O-glucoside. Anthocyanin contents ranged from 42 to 97%. Principal component analysis (PCA) was applied to analyse the date and study the relations between the samples and their phenolic profiles. Anthocyanin profile proved to be a good marker to characterize the varieties even considering different origin and harvest. "Vinhão" grapes showed anthocyanins levels until twenty four times higher than the rest of the samples, with 97% of these compounds.

  8. Resveratrol Inhibition of Cellular Respiration: New Paradigm for an Old Mechanism

    Directory of Open Access Journals (Sweden)

    Luis Alberto Madrigal-Perez

    2016-03-01

    Full Text Available Resveratrol (3,4′,5-trihydroxy-trans-stilbene, RSV has emerged as an important molecule in the biomedical area. This is due to its antioxidant and health benefits exerted in mammals. Nonetheless, early studies have also demonstrated its toxic properties toward plant-pathogenic fungi of this phytochemical. Both effects appear to be opposed and caused by different molecular mechanisms. However, the inhibition of cellular respiration is a hypothesis that might explain both toxic and beneficial properties of resveratrol, since this phytochemical: (1 decreases the production of energy of plant-pathogenic organisms, which prevents their proliferation; (2 increases adenosine monophosphate/adenosine diphosphate (AMP/ADP ratio that can lead to AMP protein kinase (AMPK activation, which is related to its health effects, and (3 increases the reactive oxygen species generation by the inhibition of electron transport. This pro-oxidant effect induces expression of antioxidant enzymes as a mechanism to counteract oxidative stress. In this review, evidence is discussed that supports the hypothesis that cellular respiration is the main target of resveratrol.

  9. Polyphenol screening of pomace from red and white grape varieties (Vitis vinifera L.) by HPLC-DAD-MS/MS.

    Science.gov (United States)

    Kammerer, Dietmar; Claus, Achim; Carle, Reinhold; Schieber, Andreas

    2004-07-14

    Phenolic compounds of 14 pomace samples originating from red and white winemaking were characterized by HPLC-MS. Up to 13 anthocyanins, 11 hydroxybenzoic and hydroxycinnamic acids, and 13 catechins and flavonols as well as 2 stilbenes were identified and quantified in the skins and seeds by HPLC-DAD. Large variabilities comprising all individual phenolic compounds were observed, depending on cultivar and vintage. Grape skins proved to be rich sources of anthocyanins, hydroxycinnamic acids, flavanols, and flavonol glycosides, whereas flavanols were mainly present in the seeds. However, besides the lack of anthocyanins in white grape pomace, no principal differences between red and white grape varieties were observed. This is the first study presenting comprehensive data on the contents of individual phenolic compounds comprising all polyphenolic subclasses of grapes including a comparison of several red and white pomaces from nine cultivars. The results obtained in the present study confirm that both skins and seeds of most grape cultivars constitute a promising source of polyphenolics.

  10. Interfacial self-organization of bolaamphiphiles bearing mesogenic groups: relationships between the molecular structures and their self-organized morphologies.

    Science.gov (United States)

    Song, Bo; Liu, Guanqing; Xu, Rui; Yin, Shouchun; Wang, Zhiqiang; Zhang, Xi

    2008-04-15

    This article discusses the relationship between the molecular structure of bolaamphiphiles bearing mesogenic groups and their interfacial self-organized morphology. On the basis of the molecular structures of bolaamphiphiles, we designed and synthesized a series of molecules with different hydrophobic alkyl chain lengths, hydrophilic headgroups, mesogenic groups, and connectors between the alkyl chains and the mesogenic group. Through investigating their interfacial self-organization behavior, some experiential rules are summarized: (1) An appropriate alkyl chain length is necessary to form stable surface micelles; (2) different categories of headgroups have a great effect on the interfacial self-organized morphology; (3) different types of mesogenic groups have little effect on the structure of the interfacial assembly when it is changed from biphenyl to azobenzene or stilbene; (4) the orientation of the ester linker between the mesogenic group and alkyl chain can greatly influence the interfacial self-organization behavior. It is anticipated that this line of research may be helpful for the molecular engineering of bolaamphiphiles to form tailor-made morphologies.

  11. One-, two- and three-photon spectroscopy of π-conjugated dendrimers: cooperative enhancement and coherent domains

    International Nuclear Information System (INIS)

    Drobizhev, M.; Rebane, A.; Suo, Z.; Spangler, C.W.

    2005-01-01

    We use wavelength tunable femtosecond pulses to measure intrinsic (simultaneous) two-photon absorption (2PA) and three-photon absorption (3PA) molecular cross section in two series of π-conjugated dendrimers built of identical 4,4'-bis(diphenylamino) stilbene (BDPAS) and 4,4'-bis(diphenylamino) distyrylbenzene (BDPADSB) repeat units. Record large 2PA cross sections, σ 2 =10 -46 cm 4 s are obtained for the largest second-generation BDPAS-based dendrimer, as well as zeroth-generation 4-arm BDPADSB-based dendrimer. In both series, maximum 2PA cross section increases nonlinearly with the number of π-electrons, whereas for higher generations this dependence turns to linear one. 3PA cross section also increases nonlinearly with the size of the system in the series of BDPAS-based molecules, amounting a record large value, σ 3 =10 -79 cm 6 s 2 , for the largest, second-generation dendrimer. We interpret these results in terms of direct inter-branch conjugation, which facilitates cooperative enhancement of the nonlinear-optical response. We propose a simple model which allows us to determine the effective size of coherent domains (extent of conjugation), which, in turn, determines the optimum dendrimer size for most efficient nonlinear response

  12. Light-gated molecular brakes based on pentiptycene-incorporated azobenzenes.

    Science.gov (United States)

    Tan, Wei Shyang; Chuang, Po-Ya; Chen, Chia-Huei; Prabhakar, Chetti; Huang, Shing-Jong; Huang, Shou-Ling; Liu, Yi-Hung; Lin, Ying-Chih; Peng, Shie-Ming; Yang, Jye-Shane

    2015-04-01

    Three azobenzene derivatives (2 R, 2 OR, and 2 NR) that differed in their terminal substituent (alkyl, alkyloxy, and dialkylamino, respectively) have been synthesized and investigated as molecular brakes, in which the rigid H-shaped pentiptycene group functioned as a rotor and the dinitrophenyl group as a "brake pad". The E and Z isomers of these compounds corresponded to the "brake-off" and "brake-on" states, respectively. The rotation rate of the rotor was evaluated by VT NMR spectroscopy for the brake-on state and by DFT calculations for the brake-off state. The difference between the rotation rates for the rotor in the two states was as large as eight orders of magnitude at ambient temperature. Photochemical switching of the azobenzene moieties afforded efficiencies of 55-67%. A combination of photochemical E→Z and thermal Z→E isomerization promoted the switching efficiency up to 78%. The terminal substituent affected both the photochemical and thermal switching efficiencies. Solvent polarity also played an important role in the lifetimes of the Z isomers. These azobenzene systems displayed similar braking powers but superior switching efficiencies to the stilbene analogue (1O R; ca. 60% vs 20%). © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Stereoselective hydrogenation of olefins using rhodium-substituted carbonic anhydrase--a new reductase.

    Science.gov (United States)

    Jing, Qing; Okrasa, Krzysztof; Kazlauskas, Romas J

    2009-01-01

    One useful synthetic reaction missing from nature's toolbox is the direct hydrogenation of substrates using hydrogen. Instead nature uses cofactors like NADH to reduce organic substrates, which adds complexity and cost to these reductions. To create an enzyme that can directly reduce organic substrates with hydrogen, researchers have combined metal hydrogenation catalysts with proteins. One approach is an indirect link where a ligand is linked to a protein and the metal binds to the ligand. Another approach is direct linking of the metal to protein, but nonspecific binding of the metal limits this approach. Herein, we report a direct hydrogenation of olefins catalyzed by rhodium(I) bound to carbonic anhydrase (CA-[Rh]). We minimized nonspecific binding of rhodium by replacing histidine residues on the protein surface using site-directed mutagenesis or by chemically modifying the histidine residues. Hydrogenation catalyzed by CA-[Rh] is slightly slower than for uncomplexed rhodium(I), but the protein environment induces stereoselectivity favoring cis- over trans-stilbene by about 20:1. This enzyme is the first cofactor-independent reductase that reduces organic molecules using hydrogen. This catalyst is a good starting point to create variants with tailored reactivity and selectivity. This strategy to insert transition metals in the active site of metalloenzymes opens opportunities to a wider range of enzyme-catalyzed reactions.

  14. Radioprotectors in radiotherapy – advances in the potential application of phytochemicals

    Directory of Open Access Journals (Sweden)

    Magdalena Szejk

    2016-06-01

    Full Text Available Radiotherapy, in addition to chemotherapy, is currently the primary method of cancer treatment based on destruction of malignant cells by ionizing radiation. Unfortunately, it also affects normal cells, which is associated with negative consequences for a patient. Radioprotectors are compounds used to prevent/protect the non-tumor cells from the harmful effects of radiation. To play their role these compounds should meet several criteria; among others, they should significantly protect normal cells from radiation without changing the tumor cell radiosensitivity. In general, agents used to alter normal tissue toxicity from radiation can be broadly divided into three categories based on timing of delivery in relation to radiation: chemical radioprotectors, mitigators, and treatment. These groups include a diverse range of synthetic compounds in terms of their structure and protective mechanisms. The aminoradiothiol amifostine is the only radioprotectant approved in clinical application. However, its use is limited due to toxicity concerns (it may cause hypotension. Natural compounds, derived from plants, meet all criteria of the ideal radioprotector. They exert their protective actions against adverse effects of ionizing radiation by several mechanisms. Plant compounds that show radioprotective activity include flavonoids and phenolic acids, stilbenes, lycopene, alkaloids, peptides, polysaccharides, and phytohormones. Garlic, green tea, apples, citrus, and ginger are examples of constituents of the human diet that contain radioprotective substances.

  15. Antifungal genes expressed in transgenic pea (Pisum sativum L.) do not affect root colonization of arbuscular mycorrhizae fungi.

    Science.gov (United States)

    Kahlon, Jagroop Gill; Jacobsen, Hans-Jörg; Cahill, James F; Hall, Linda M

    2017-10-01

    Genetically modified crops have raised concerns about unintended consequences on non-target organisms including beneficial soil associates. Pea transformed with four antifungal genes 1-3 β glucanase, endochitinase, polygalacturonase-inhibiting proteins, and stilbene synthase is currently under field-testing for efficacy against fungal diseases in Canada. Transgenes had lower expression in the roots than leaves in greenhouse experiment. To determine the impact of disease-tolerant pea or gene products on colonization by non-target arbuscular mycorrhizae and nodulation by rhizobium, a field trial was established. Transgene insertion, as single gene or stacked genes, did not alter root colonization by arbuscular mycorrhiza fungus (AMF) or root nodulation by rhizobium inoculation in the field. We found no effect of transgenes on the plant growth and performance although, having a dual inoculant with both AMF and rhizobium yielded higher fresh weight shoot-to-root ratio in all the lines tested. This initial risk assessment of transgenic peas expressing antifungal genes showed no deleterious effect on non-target organisms.

  16. Time-dependent density functional methods for Raman spectra in open-shell systems.

    Science.gov (United States)

    Aquino, Fredy W; Schatz, George C

    2014-01-16

    We present an implementation of a time-dependent density functional theory (TD-DFT) linear response module in NWChem for unrestricted DFT calculations and apply it to the calculation of resonant Raman spectra in open-shell molecular systems using the short-time approximation. The new source code was validated and applied to simulate Raman spectra on several doublet organic radicals (e.g., benzyl, benzosemiquinone, TMPD, trans-stilbene anion and cation, and methyl viologen) and the metal complex copper phthalocyanine. We also introduce a divide-and-conquer approach for the evaluation of polarizabilities in relatively large systems (e.g., copper phthalocyanine). The implemented tool gives comparisons with experiment that are similar to what is commonly found for closed-shell systems, with good agreement for most features except for small frequency shifts, and occasionally large deviations for some modes that depend on the molecular system studied, experimental conditions not being accounted in the modeling such as solvation effects and extra solvent-based peaks, and approximations in the underlying theory. The approximations used in the quantum chemical modeling include (i) choice of exchange-correlation functional and basis set; (ii) harmonic approximation used in the frequency analysis to determine vibrational normal modes; and (iii) short-time approximation (omission of nuclear motion effects) used in calculating resonant Raman spectra.

  17. Dietary polyphenols and chromatin remodeling.

    Science.gov (United States)

    Russo, Gian Luigi; Vastolo, Viviana; Ciccarelli, Marco; Albano, Luigi; Macchia, Paolo Emidio; Ungaro, Paola

    2017-08-13

    Polyphenols are the most abundant phytochemicals in fruits, vegetables, and plant-derived beverages. Recent findings suggest that polyphenols display the ability to reverse adverse epigenetic regulation involved in pathological conditions, such as obesity, metabolic disorder, cardiovascular and neurodegenerative diseases, and various forms of cancer. Epigenetics, defined as heritable changes to the transcriptome, independent from those occurring in the genome, includes DNA methylation, histone modifications, and posttranscriptional gene regulation by noncoding RNAs. Sinergistically and cooperatively, these processes regulate gene expression by changing chromatin organization and DNA accessibility. Such induced epigenetic changes can be inherited during cell division, resulting in permanent maintenance of the acquired phenotype, but they may also occur throughout an individual life-course and may ultimately influence phenotypic outcomes (health and disease risk). In the last decade, a number of studies have shown that nutrients can affect metabolic traits by altering the structure of chromatin and directly regulate both transcription and translational processes. In this context, dietary polyphenol-targeted epigenetics becomes an attractive approach for disease prevention and intervention. Here, we will review how polyphenols, including flavonoids, curcuminoids, and stilbenes, modulate the establishment and maintenance of key epigenetic marks, thereby influencing gene expression and, hence, disease risk and health.

  18. Solvothermal Synthesis, Crystal Structure, and Magnetic Properties of [Co3(SDA)3(DMF)2]: 2-D Layered Metal-organic Framework Derived from 4,4'-Stilbenedicarboxylic Acid (H2SDA)

    International Nuclear Information System (INIS)

    Park, Gyung Se; Kim, Hyun Uk; Kim, Ki Moon; Lee, Gang Ho; Park, Sang Kyu

    2006-01-01

    A new 2-D coordination polymer has been synthesized and characterized by using a novel 4,4'-stilbene dicarboxylic acid and Co(ClO 4 ) 2 ·6H 2 O. The title complex has an unique Co 3 pin-wheel cluster in which central Co has octahedral geometry and two surrounding Co have tetrahedral geometry. The Co 3 pin-wheel clusters, the building unit, are linked through carboxylate oxygens to generate a 2-D layered coordination polymer in ABCABC packing mode. Variable-temperature magnetic susceptibility data of the title compound confirms the high spin splitting of Co with S=3/2. Syntheses of MOF by using SDA and other transition metal ions, Zn, Cd, and Mn, are on progress in this lab. Metal-organic frameworks (MOF) have attracted much more attention in the past decade owing to their various intriguing framework topologies and potential applications as functional materials in gas storage, separation, and catalysis. Because high framework stability is fundamental and essential property for many practical applications, multi-dentate linkers such as carboxylates have been extensively investigated for the formation of more rigid frameworks due to their ability to aggregate metal ions into M-O-C clusters called secondary building units (SBUs) rather than N-bound organic linkers such as 4,4-bipyridine (bipy)

  19. Pancreatic lipase inhibitory constituents from Morus alba leaves and optimization for extraction conditions.

    Science.gov (United States)

    Jeong, Ji Yeon; Jo, Yang Hee; Kim, Seon Beom; Liu, Qing; Lee, Jin Woo; Mo, Eun Jin; Lee, Ki Yong; Hwang, Bang Yeon; Lee, Mi Kyeong

    2015-06-01

    The leaves of Morus alba (Moraceae) have been traditionally used for the treatment of metabolic diseases including diabetes and hyperlipidemia. Thus, inhibitory effect of M. alba leaves on pancreatic lipase and their active constituents were investigated in this study. Twenty phenolic compounds including ten flavonoids, eight benzofurans, one stilbene and one chalcones were isolated from the leaves of M. alba. Among the isolated compounds, morachalcone A (20) exerted strong pancreatic lipase inhibition with IC50 value of 6.2 μM. Other phenolic compounds containing a prenyl group showed moderate pancreatic lipase inhibition with IC50 value of <50 μM. Next, extraction conditions with maximum pancreatic lipase inhibition and phenolic content were optimized using response surface methodology with three-level-three-factor Box-Behnken design. Our results suggested the optimized extraction condition for maximum pancreatic lipase inhibition and phenolic content as ethanol concentration of 74.9%; temperature 57.4 °C and sample/solvent ratio, 1/10. The pancreatic lipase inhibition and total phenolic content under optimized condition were found to be 58.5% and 26.2 μg GAE (gallic acid equivalent)/mg extract, respectively, which were well matched with the predicted value. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Evaluating the correlation between chemical and sensory compounds in Blaufränkisch and Cabernet Franc wines

    Directory of Open Access Journals (Sweden)

    Irina Balga

    2014-12-01

    Full Text Available The positive physiological effects of the bioactive compounds of red wines have been known for a long time. Besides that, the polyphenolic compounds of red wines represent one of the most important factors for oenology. With a special chemical analysis, we discover the relationship between chemical and sensory compounds. In this way, we explore which compounds influence sensory properties. The phenolic compounds are the quality attributes of the wine. The analysis of phenolic compounds was carried out in two red wines: Cabernet Franc and Blaufränkisch. The aim of this study was to analyse the chemical and organoleptic characteristics of these two wines and evaluate the connection between the two parameters. In addition, we also examined the influence of the polyphenolic content on sensory perception. The experiment was carried out in a cool climate wine region in Eger, Hungary, in vintage of 2008. We investigated the profile of phenolic contents in new and aged wines. Total polyphenolic content, anthocyanin, leucoanthocyanin and catechin were evaluated by spectrophotometer. Stilbenes were identified and quantified by high-performance liquid chromatography.

  1. Antibacterial and antioxidative compounds from Cassia alata Linn.

    Directory of Open Access Journals (Sweden)

    Trinop Promgool

    2014-08-01

    Full Text Available Phytochemical investigation of Cassia alata Linn. led to the isolation of six known anthraquinones: aloe-emodin (1, emodin (2, ω-hydroxyemodin (3, lunatin (4, physcion (5, and ziganein (6, six flavonoids: apigenin (7, 7,4'-dihydroxy-5- methoxyflavone (8, diosmetin (9, kaempferol (10, luteolin (11, and trans-dihydrokaempferol (12 as well as one stilbene, trans-resveratrol (13. Their structures were elucidated on the basis of spectroscopic methods, including UV, IR, NMR and MS. Nine compounds (3-9 and 12-13 were reported for the first time as metabolites of C. alata. Compound 2 exhibited strong antibacterial activity against methicillin resistant S. aureus (MRSA-SK1 and B. cereus TISTR 687 with MIC values of 4 and 8 µg/mL, respectively. Compound 10 was found to exhibit antioxidative activity with IC50 value of 9.67 µM that was three times stronger than that of ascorbic acid (IC50 25.41 µM.

  2. Electron transfer dynamics of triphenylamine dyes bound to TiO2 nanoparticles from femtosecond stimulated Raman spectroscopy

    KAUST Repository

    Hoffman, David P.

    2013-04-11

    Interfacial electron transfer between sensitizers and semiconducting nanoparticles is a crucial yet poorly understood process. To address this problem, we have used transient absorption (TA) and femtosecond stimulated Raman spectroscopy (FSRS) to investigate the photoexcited dynamics of a series of triphenylamine-coumarin dye/TiO2 conjugates. The TA decay is multiexponential, spanning time scales from 100 fs to 100 ps, while the characteristic transient Raman spectrum of the radical cation decays biexponentially with a dominant ∼3 ps component. To explain these observations, we propose a model in which the decay of the TA is due to hot electrons migrating from surface trap states to the conduction band of TiO 2 while the decay of the Raman signature is due to internal conversion of the dye molecule. Furthermore, the S1 Raman spectrum of TPAC3, a dye wherein a vinyl group separates the triphenylamine and coumarin moieties, is similar to the S1 Raman spectrum of trans-stilbene; we conclude that their S1 potential energy surfaces and reactivity are also similar. This correlation suggests that dyes containing vinyl linkers undergo photoisomerization that competes with electron injection. © 2013 American Chemical Society.

  3. Feeding response of Ips paraconfusus to phloem and phloem metabolites of Heterobasidion annosum-inoculated ponderosa pine, Pinus ponderosa.

    Science.gov (United States)

    McNee, William R; Bonello, Pierluigi; Storer, Andrew J; Wood, David L; Gordon, Thomas R

    2003-05-01

    In studies of feeding by the bark beetle, Ips paraconfusus, two pine stilbenes (pinosylvin and pinosylvin methyl ether), ferulic acid glucoside, and enantiomers of the four most common sugars present in ponderosa pine phloem (sucrose, glucose, fructose, and raffinose) did not stimulate or reduce male feeding when assayed on wet alpha-cellulose with or without stimulatory phloem extractives present. When allowed to feed on wet alpha-cellulose containing sequential extracts (hexane, methanol, and water) of ponderosa pine phloem, methanol and water extractives stimulated feeding, but hexane extractives did not. Males confined in wet alpha-cellulose containing aqueous or organic extracts of culture broths derived from phloem tissue and containing the root pathogen. Heterobasidion annosum, ingested less substrate than beetles confined to control preparations. In an assay using logs from uninoculated ponderosa pines, the mean lengths of phloem in the digestive tracts increased as time spent feeding increased. Males confined to the phloem of basal logs cut from ponderosa pines artificially inoculated with H. annosum ingested significantly less phloem than beetles in logs cut from trees that were (combined) mock-inoculated or uninoculated and did not contain the pathogen. However, individual pathogen-containing treatments were not significantly different from uninoculated controls. It was concluded that altered feeding rates are not a major factor which may explain why diseased ponderosa pines are colonized by I. paraconfusus.

  4. The antimicrobial action of resveratrol against Listeria monocytogenes in food-based models and its antibiofilm properties.

    Science.gov (United States)

    Ferreira, Susana; Domingues, Fernanda

    2016-10-01

    Resveratrol (3,5,4'-trihydroxy-trans-stilbene) is a natural phytoalexin synthesized by plants in response to stress. This compound has several beneficial documented properties, namely anti-inflammatory, antioxidant, neuroprotective and antimicrobial activities. In this study the antimicrobial activity of resveratrol against Listeria monocytogenes and Listeria innocua was investigated. Resveratrol had a minimum inhibitory concentration of 200 µg mL(-1) for the tested strains, with time-kill curves demonstrating bacteriostatic activity. Inhibition of biofilm formation was also assessed, with resveratrol strongly inhibiting biofilm formation by both species even at subinhibitory concentrations. Overall, resveratrol showed antimicrobial properties on planktonic cells and on biofilm formation ability. Considering the potential use of resveratrol as a food preservative, the antimicrobial efficacy of resveratrol in food was studied in milk, lettuce leaf model and chicken juice. Resveratrol retained greater efficacy in both lettuce leaf model and chicken juice, but milk had a negative impact on its antilisterial activity, indicating a possible reduction of resveratrol availability in milk. This study reinforces resveratrol as an antimicrobial agent, pointing out its antibiofilm activity and its potential use as preservative in some food matrices. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  5. Simultaneous quantitative analysis of main components in linderae reflexae radix with one single marker.

    Science.gov (United States)

    Wang, Li-Li; Zhang, Yun-Bin; Sun, Xiao-Ya; Chen, Sui-Qing

    2016-05-08

    Establish a quantitative analysis of multi-components by the single marker (QAMS) method for quality evaluation and validate its feasibilities by the simultaneous quantitative assay of four main components in Linderae Reflexae Radix. Four main components of pinostrobin, pinosylvin, pinocembrin, and 3,5-dihydroxy-2-(1- p -mentheneyl)- trans -stilbene were selected as analytes to evaluate the quality by RP-HPLC coupled with a UV-detector. The method was evaluated by a comparison of the quantitative results between the external standard method and QAMS with a different HPLC system. The results showed that no significant differences were found in the quantitative results of the four contents of Linderae Reflexae Radix determined by the external standard method and QAMS (RSD <3%). The contents of four analytes (pinosylvin, pinocembrin, pinostrobin, and Reflexanbene I) in Linderae Reflexae Radix were determined by the single marker of pinosylvin. This fingerprint was the spectra determined by Shimadzu LC-20AT and Waters e2695 HPLC that were equipped with three different columns.

  6. Microdroplets Accelerate Ring Opening of Epoxides

    Science.gov (United States)

    Lai, Yin-Hung; Sathyamoorthi, Shyam; Bain, Ryan M.; Zare, Richard N.

    2018-03-01

    The nucleophilic opening of an epoxide is a classic organic reaction that has widespread utility in both academic and industrial applications. We have studied the reaction of limonene oxide with morpholine to form 1-methyl-2-morpholino-4-(prop-1-en-2-yl) cyclohexan-1-ol in bulk solution and in electrosprayed microdroplets with a 1:1 v/v water/methanol solvent system. We find that even after 90 min at room temperature, there is no product detected by nuclear magnetic resonance spectroscopy in bulk solution whereas in room-temperature microdroplets (2-3 μm in diameter), the yield is already 0.5% in a flight time of 1 ms as observed by mass spectrometry. This constitutes a rate acceleration of 105 in the microdroplet environment, if we assume that as much as 5% of product is formed in bulk after 90 min of reaction time. We examine how the reaction rate depends on droplet size, solvent composition, sheath gas pressure, and applied voltage. These factors profoundly influence the extent of reaction. This dramatic acceleration is not limited to just one system. We have also found that the nucleophilic opening of cis-stilbene oxide by morpholine is similarly accelerated. Such large acceleration factors in reaction rates suggest the use of microdroplets for ring opening of epoxides in other systems, which may have practical significance if such a procedure could be scaled. [Figure not available: see fulltext.

  7. Microdroplets Accelerate Ring Opening of Epoxides

    Science.gov (United States)

    Lai, Yin-Hung; Sathyamoorthi, Shyam; Bain, Ryan M.; Zare, Richard N.

    2018-05-01

    The nucleophilic opening of an epoxide is a classic organic reaction that has widespread utility in both academic and industrial applications. We have studied the reaction of limonene oxide with morpholine to form 1-methyl-2-morpholino-4-(prop-1-en-2-yl) cyclohexan-1-ol in bulk solution and in electrosprayed microdroplets with a 1:1 v/ v water/methanol solvent system. We find that even after 90 min at room temperature, there is no product detected by nuclear magnetic resonance spectroscopy in bulk solution whereas in room-temperature microdroplets (2-3 μm in diameter), the yield is already 0.5% in a flight time of 1 ms as observed by mass spectrometry. This constitutes a rate acceleration of 105 in the microdroplet environment, if we assume that as much as 5% of product is formed in bulk after 90 min of reaction time. We examine how the reaction rate depends on droplet size, solvent composition, sheath gas pressure, and applied voltage. These factors profoundly influence the extent of reaction. This dramatic acceleration is not limited to just one system. We have also found that the nucleophilic opening of cis-stilbene oxide by morpholine is similarly accelerated. Such large acceleration factors in reaction rates suggest the use of microdroplets for ring opening of epoxides in other systems, which may have practical significance if such a procedure could be scaled. [Figure not available: see fulltext.

  8. Natural fibre high-density polyethylene and lead oxide composites for radiation shielding

    CERN Document Server

    El-Sayed, A; Ismail, M R

    2003-01-01

    Study has been made of the radiation shielding provided by recycled agricultural fibre and industrial plastic wastes produced as composite materials. Fast neutron and gamma-ray spectra behind composites of fibre-plastic (rho = 1.373 g cm sup - sup 3) and fibre-plastic-lead (rho = 2.756 g cm sup - sup 3) have been measured using a collimated reactor beam and neutron-gamma spectrometer with a stilbene scintillator. The pulse shape discriminating technique based on the zero-cross-over method was used to discriminate between neutron and gamma-ray pulses. Slow neutron fluxes have been measured using a collimated reactor beam and BF sub 3 counter, leading to determination of the macroscopic cross-section (SIGMA). The removal cross-sections (SIGMA sub R) of fast neutrons have been determined from measured results and elemental composition of the composites. For gamma-rays, total linear attenuation coefficients (mu) and total mass attenuation coefficients (mu/rho) have been determined from use of the XCOM code and me...

  9. p-aminohippurate transport in the airways: Role of Na sup + and HCO sub 3 -

    Energy Technology Data Exchange (ETDEWEB)

    Cloutier, M.M. (Univ. of Connecticut Health Center, Farmington (USA))

    1989-12-01

    The role of Na{sup +} and HCO{sub 3}- in the transport of p-aminohippurate (PAH) across the canine tracheal epithelium was investigated using Ussing chamber techniques and radiolabeled PAH. Under control conditions, net PAH absorption or a tendency toward net PAH absorption was observed. Neither amiloride (10(-4) M), furosemide (10(-3) M), ouabain (2 x 10(-4) M), nor Na+ substitution of the Ringer solution with choline had any effect on unidirectional PAH fluxes. When the Ringer solution was replaced with a HCO{sub 3}(-)-free solution, net PAH absorption was consistently observed. In HCO{sub 3}(-)-free experiments, unidirectional PAH absorptive fluxes were inhibited by mucosal addition of either of the stilbene derivatives, 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS, 10(-4) M) or 4-acetamido-4'-isothiocyanostilbene-2,2'-disulfonic acid (SITS, 10(-4) M). DIDS was more effective than SITS and was also effective in inhibiting PAH absorption in tissues bathed in Ringer solution. Submucosal DIDS or SITS had no effect on PAH fluxes either in HCO{sub 3}(-)-free or Ringer experiments. We conclude that PAH transport in canine tracheal epithelium occurs by a HCO{sub 3}(-)-PAH exchange process located on the luminal membrane. PAH transport is not Na{sup +} dependent but is inhibited by both DIDS and SITS.

  10. Effect of Known Inhibitors of Ion Transport on Pendrin (SLC26A4 Activity in a Human Kidney Cell Line

    Directory of Open Access Journals (Sweden)

    Emanuele Bernardinelli

    2016-05-01

    Full Text Available Background/Aims: Pendrin is a Cl-/I-/HCO3- exchanger playing a fundamental role in controlling blood pressure and airway function, therefore representing an attractive target for the treatment of hypertensive states and respiratory distresses. A review of the literature regarding the ability of some compounds (namely several known inhibitors of ion transport to block pendrin activity revealed discordant findings. These incongruous findings may be due, in part, to the concentration of compound and/or the nature of the model system used in the study. Methods: Pendrin activity was evaluated by measuring pendrin-dependent iodide influx following overexpression of the transporter in a human kidney cell line, in the presence of selected test compounds or the respective vehicles. Results: Pendrin activity was significantly hampered by 0.1 mM 5-nitro-2-[(3-phenylpropylamino]benzoic acid (NPPB, niflumic acid and tenidap, but was resistant to 0.1 mM 4, 4′-diisothiocyano-2, 2′-stilbene-disulfonic acid (DIDS, furosemide and probenecid. Conclusions: The results of the present study indicate that clinically effective non-steroidal anti-inflammatory drugs (niflumic acid and tenidap directly inhibit pendrin activity.

  11. Photo-physics of third-order nonlinear optical processes in organic dyes

    International Nuclear Information System (INIS)

    Delysse, Stephane

    1997-01-01

    We study some aspects of the nonlinear picosecond photo-physics in organic dyes using Kerr ellipsometry. The aim is to establish link between the photo-physics and nonlinear optics in these compounds. First, we study coherent processes directly linked to the third-order susceptibility. Thus, we measure two-photon absorption spectra of large internal charge transfer dyes. We take into account all coupling between three electronic states which can interfere to explain the particular response of some stilbene dyes. On the second hand, we expose a more photophysical approach to determine the S 1 → S n transition energies and moments using the measurement of excited state absorption cross sections. These results allow the prediction of the susceptibilities relevant to alternative nonlinear optical methods. Nevertheless, the stationary approach hides the complex relaxation processes which can take place in organic dyes. As an illustration, we study the formation and disappearance of a TICT (Twisted intramolecular charge transfer) in a pyrylium salt in solvents of increasing viscosity. (author) [fr

  12. An automatic optosensing device for the simultaneous determination of resveratrol and piceid in wines

    International Nuclear Information System (INIS)

    Molina-Garcia, Lucia; Ruiz-Medina, Antonio; Fernandez-de Cordova, Maria Luisa

    2011-01-01

    For the first time, a spectrofluorimetric method is reported for the simultaneous determination of resveratrol (RVT) and piceid (PCD), two stilbenes showing diverse interesting physiological and biochemical attributes, as well as a wide range of health benefits ranging from cardioprotection to chemoprevention. The method makes use of a multicommutated flow-through optosensor in which the resolution of RVT and PCD is accomplished by means the sequential arrival of their photoproducts, on-line generated by UV-irradiation, to the detection area. This is possible due to the different kinetic behaviour of these latter on a solid support (C 18 silica gel) filling a minicolumn placed before the detector. The measurement in solid-phase of the photochemically induced fluorescence of the photoproducts (λ ex : 257 nm/λ em : 382 nm) is used as analytical signal for monitoring both compounds. The method has been applied to the analysis of RVT and PCD in wines and requires a previous solid-phase extraction (SPE) using Bakerbond C 18 cartridges. This pretreatment and the use of a solid-support in both the minicolumn and the flow-cell of the detector allow the determination of RVT and PCD by external calibration. Detection limits (DLs) are 9.3 and 12.6 ng mL -1 for RVT and PCD, respectively. Commercial red and white wine samples have been analysed and the results obtained have been satisfactorily validated by high-performance liquid chromatography (HPLC).

  13. HKUST-1 as a Heterogeneous Catalyst for the Synthesis of Vanillin.

    Science.gov (United States)

    Yépez, Rebeca; Illescas, Juan F; Gijón, Paulina; Sánchez-Sánchez, Manuel; González-Zamora, Eduardo; Santillan, Rosa; Álvarez, J Raziel; Ibarra, Ilich A; Aguilar-Pliego, Julia

    2016-07-23

    Vanillin (4-hydoxy-3-methoxybenzaldehyde) is the main component of the extract of vanilla bean. The natural vanilla scent is a mixture of approximately 200 different odorant compounds in addition to vanillin. The natural extraction of vanillin (from the orchid Vanilla planifolia, Vanilla tahitiensis and Vanilla pompon) represents only 1% of the worldwide production and since this process is expensive and very long, the rest of the production of vanillin is synthesized. Many biotechnological approaches can be used for the synthesis of vanillin from lignin, phenolic stilbenes, isoeugenol, eugenol, guaicol, etc., with the disadvantage of harming the environment since these processes use strong oxidizing agents and toxic solvents. Thus, eco-friendly alternatives on the production of vanillin are very desirable and thus, under current investigation. Porous coordination polymers (PCPs) are a new class of highly crystalline materials that recently have been used for catalysis. HKUST-1 (Cu3(BTC)2(H2O)3, BTC = 1,3,5-benzene-tricarboxylate) is a very well known PCP which has been extensively studied as a heterogeneous catalyst. Here, we report a synthetic strategy for the production of vanillin by the oxidation of trans-ferulic acid using HKUST-1 as a catalyst.

  14. Characterization of CYP154F1 from Thermobifida fusca YX and Extension of Its Substrate Spectrum by Site-Directed Mutagenesis.

    Science.gov (United States)

    Rühlmann, Ansgar; Groth, Georg; Urlacher, Vlada B

    2018-03-02

    Previous studies on cytochrome P450 monooxygenases (CYP) from family 154 reported their substrate promiscuity and high activity. Hence, herein, the uncharacterized family member CYP154F1 is described. Screening of more than 100 organic compounds revealed that CYP154F1 preferably accepts small linear molecules with a carbon chain length of 8-10 atoms. In contrast to thoroughly characterized CYP154E1, CYP154F1 has a much narrower substrate spectrum and lower activity. A structural alignment of homology models of CYP154F1 and CYP154E1 revealed few differences in the active sites of both family members. By gradual mutagenesis of the CYP154F1 active site towards those of CYP154E1, a key residue accounting for the different activities of both enzymes was identified at position 234. Substitution of T234 for large hydrophobic amino acids led to up to tenfold higher conversion rates of small substrates, such as geraniol. Replacement of T234 by small hydrophobic amino acids, valine or alanine, resulted in mutants with extended substrate spectra. These mutants are able to convert some of the larger substrates of CYP154E1, such as (E)-stilbene and (+)-nootkatone. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Theoretical and Kinetic Tools for Selecting Effective Antioxidants: Application to the Protection of Omega-3 Oils with Natural and Synthetic Phenols

    Directory of Open Access Journals (Sweden)

    Romain Guitard

    2016-07-01

    Full Text Available Radical-scavenging antioxidants play crucial roles in the protection of unsaturated oils against autoxidation and, especially, edible oils rich in omega-3 because of their high sensitivity to oxygen. Two complementary tools are employed to select, among a large set of natural and synthetic phenols, the most promising antioxidants. On the one hand, density functional theory (DFT calculations provide bond dissociation enthalpies (BDEs of 70 natural (i.e., tocopherols, hydroxybenzoic and cinnamic acids, flavonoids, stilbenes, lignans, and coumarins and synthetic (i.e., 2,6-di-tert-butyl-4-methylphenol (BHT, 3-tert-butyl-4-hydroxyanisol (BHA, and tert-butylhydroquinone (TBHQ phenols. These BDEs are discussed on the basis of structure–activity relationships with regard to their potential antioxidant activities. On the other hand, the kinetic rate constants and number of hydrogen atoms released per phenol molecule are measured by monitoring the reaction of phenols with 2,2-diphenyl-1-picrylhydrazyl (DPPH• radical. The comparison of the results obtained with these two complementary methods allows highlighting the most promising antioxidants. Finally, the antioxidant effectiveness of the best candidates is assessed by following the absorption of oxygen by methyl esters of linseed oil containing 0.5 mmol L−1 of antioxidant and warmed at 90 °C under oxygen atmosphere. Under these conditions, some natural phenols namely epigallocatechin gallate, myricetin, rosmarinic and carnosic acids were found to be more effective antioxidants than α-tocopherol.

  16. Flavonoids from leaves of Derris urucu: assessment of potential effects on seed germination and development of weeds

    Directory of Open Access Journals (Sweden)

    EWERTON A.S. DA SILVA

    2013-09-01

    Full Text Available In some previous studies, we described the isolation of nine compounds from leaves of Derris urucu, a species found widely in the Amazon rainforest, identified as five stilbenes and four dihydroflavonols. In this work, three of these dihydroflavonols [urucuol A (1, urucuol B (2 and isotirumalin (3] were evaluated to identify their potential as allelochemicals, and we are also reporting the isolation and structural determination of a new flavonoid [5,3′-dihydroxy-4′-methoxy-(7,6:5″,6″-2″,2″-dimethylpyranoflavanone (4]. We investigated the effects of the dihydroflavonols 1-3 on seed germination and radicle and hypocotyl growth of the weed Mimosa pudica, using solutions at 150 mg.L–1. Urucuol B, alone, was the substance with the greatest potential to inhibit seed germination (26%, while isotirumalin showed greater ability to reduce the development of the hypocotyl (25%, but none of the three substances showed the potential to inhibit radicle. When combined in pairs, the substances showed synergism for the development of root and hypocotyl and effects on seed germination that could be attributed to antagonism. When tested separately, the trend has become more intense effects on seed germination, while for the substances tested in pairs, the intensity of the effect was greater on development of weed.

  17. Związki polifenolowe i ich suplementacja u kobiet po menopauzie

    Directory of Open Access Journals (Sweden)

    Ireneusz Połać

    2011-04-01

    Full Text Available Polyphenolic compounds are a broad group of organic compounds of plant secondary metabolites, whichhave in their structure one or more aromatic rings and from one to several hydroxyl groups with acidic character.Due to their heterogeneous construction polyphenolic compounds have been classified into several groups:simple phenols, phenolic acids, coumarins, xanthones, stilbenes, lignans, anthraquinones and the largest group– flavonoids. Polyphenols are characterized by a variety of biological activity. As natural antioxidants, they mayprotect against reactive oxygen species (ROS and reactive nitrogen species (RNS. Moreover, they have theability to seal blood vessels and of vasodilatation. Polyphenolic compounds also have anti allergic, antibiotic,antibacterial, antiviral, antifungal, anti-inflammatory and anticoagulation effects. Many recent studies haveshown that a diet rich in polyphenolic compounds modulates several biomarkers of cardiovascular diseaseand cancer. Thanks to their pro-health properties, an increasing number of dietary supplements based on plantextracts are introduced for commercial use. Clinical studies confirm the effectiveness of supplementation withproducts containing polyphenolic compounds in the prevention of cardiovascular disease in postmenopausalwomen. Polyphenols also have the ability of aromatase inhibition, which means that they can be used in theprevention of breast cancer. This article describes the characteristics and biological properties of polyphenoliccompounds, as well as clinical studies conducted in postmenopausal women taking polyphenols.

  18. Modulation of photochemical damage in normal and malignant cells by naturally occurring compounds.

    Science.gov (United States)

    Lee, Yuan-Hao; Kumar, Neeru C; Glickman, Randolph D

    2012-01-01

    Certain phytochemicals, such as the stilbene, resveratrol (RES, found in red grapes and berries), and the triterpenoid, ursolic acid (UA, found in waxy berries and herbs such as rosemary and oregano), have antioxidant, anti-inflammatory and antiproliferative effects. Two human-derived cell lines, hTERT-RPE with a nonmalignant phenotype derived from retinal pigment epithelium, and ATCC CRL-11147 derived from a malignant skin melanoma, were used as in vitro models of photooxidative stress produced by exposure to the broadband output of a 150 W Hg vapor arc lamp at an irradiance of 19-26 mW cm(-2). In untreated cells, UV-VIS broadband light exposure produced a loss of proliferative ability, an activation of NF-κB and an increase in protein carbonyl adducts at 24 h postexposure. Pretreatment of the cells with RES or UA at 1-2 μmsignificantly reduced the amount of phosphorylated NF-κB at 24 h postexposure. RES pretreatment reduced the burden of light-induced protein carbonyl adducts by up to 25% in exposed cells. UA treatment markedly increased the sensitivity of melanoma cells to UV radiation, while conferring some photoprotection to RPE cells. These observations indicate that phytochemicals modulate the cellular response to photochemical stress by interacting with specific cell-signaling pathways. © 2012 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2012 The American Society of Photobiology.

  19. Syntheses of Resveratrol Analogues and Evaluation of Their Antioxidant Activity

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Mi Jeong; Jung, Se Hoon; Moon, Insu; Jun Jonggab; Lee, Jeong Tae [Hallym Univ., Chuncheon (Korea, Republic of)

    2014-05-15

    Free radicals such as superoxide anion radicals (O{sub 2}·{sup -}), hydroxyl radicals (·OH) and non-free radical species such as hydrogen peroxide (H{sub 2}O{sub 2}) and singlet oxygen ({sup 1}O{sub 2}) are considered as ROS. These ROS not only oxidize membrane lipids but damage nucleic acids, proteins and carbohydrates leading to mutations. If ROS are not scavenged by antioxidants, they could be involved in ageing and various diseases related to oxidative stress. Resveratrol is a natural phytoalexin found in the skin of grapes, red wines, and peanuts. It has three hydroxyl groups at the trans-stilbene structure, in which resorcinol and phenol are bridged by a trans double bond. The recent extensive studies on the resveratrol and its derivatives revealed that they have antioxidant, antimutagenic, antiinflammatory, antidiabetic, cardiovascular protective, and anticancer properties. It has been believed that the majority of the biological functions of resveratrol has been attributed to its antioxidant activity.

  20. Reduction of uranium(IV) and its mixtures with an olefin or an alkyne in tetrahydrofuran solutions by solvated electrons

    International Nuclear Information System (INIS)

    Koulkes-Pujo, A.M.; Le Marechal, J.F.; Le Motais, B.; Folcher, G.

    1985-01-01

    The reduction of UCl 4 and its mixtures with different olefins (stilbene, St, diphenylethylene, DPE, acenaphtylene, Ac or with diphenylacetylene (DPA) was studied by pulse radiolysis of tetrahydrofuran (THF) solutions. U(III) was formed by U(IV) reaction either with the solvated electrons created by THF radiolysis or with the transitory anions St - and DPA - . In the latter case, the reaction proceeds via a first step leading to [St-U(IV)] - or [DPA-U(IV)] - . In the case of DPE - the first species, [DPE-U(IV)] - , does not lead to U(III) but is destroyed by THF(H) + giving DPE(H). and U(IV). Ac - does not react with U(IV). A mechanistic scheme of this electron attachment is discussed as well as its implication in catalytic hydrogenation of olefins in LiAlH 4 -UCl 4 solutions. It is concluded that the catalytic effect observed is rather the result of a hydride transfer from a uranium transient compound to the alkenes. 22 references, 8 figures, 1 table

  1. Piceatannol extends the lifespan of Caenorhabditis elegans via DAF-16.

    Science.gov (United States)

    Shen, Peiyi; Yue, Yiren; Sun, Quancai; Kasireddy, Nandita; Kim, Kee-Hong; Park, Yeonhwa

    2017-05-06

    Piceatannol is a natural stilbene with many beneficial effects, such as antioxidative, anti-inflammatory, antiatherogenic activities; however, its role on aging is not known. In this study, we used Caenorhabditis elegans as an animal model to study the effect of piceatannol on its lifespan and investigated the underlying mechanisms. The results showed that 50 and 100 µM piceatannol significantly extended the lifespan of C. elegans without altering the growth rate, worm size and progeny production. Piceatannol delayed the age-related decline of pumping rate and locomotive activity, and protected the worms from heat and oxidative stress. This study further indicated that lifespan extension and enhanced stress resistance induced by piceatannol requires DAF-16. Since DAF-16 is conserved from nematodes to mammals, our study may have important implications in utilizing piceatannol to promote healthy aging and combat age-related disease in humans. © 2016 BioFactors, 43(3):379-387, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

  2. Polydatin inhibits cell proliferation and induces apoptosis in laryngeal cancer and HeLa cells via suppression of the PDGF/AKT signaling pathway.

    Science.gov (United States)

    Li, Haixia; Shi, Baoyuan; Li, Yanyun; Yin, Fengfang

    2017-07-01

    Polydatin (PD), a stilbene compound extracted from Polygonum cuspidatum, is suggested to possess anti-cancer activities, including inhibition of cell proliferation, cell cycle arrest, and induction of apoptosis. The platelet-derived growth factor (PDGF)/AKT signaling pathway plays complex roles in tumor suppression. However, the effect of PD on the PDGF/AKT signaling pathway in laryngeal cancer and HeLa cells has not been explored. MTT assay and flow cytometry showed that PD inhibited cell proliferation and induced apoptosis in Hep-2 and AMC-HN-8 cells. Western blot analysis indicated that PD inhibited the expression levels of PDGF-B and phosphorylated AKT (p-AKT) in both cells. Treatment of PDGF-B siRNA or PDGFR inhibitor found that after the PDGF signaling was inactivated, p-AKT expression was significantly decreased in Hep-2 cells. Tumor xenograft experiment in nude mice indicated PD significantly inhibited the growth of Hep-2 cells in vivo. In conclusion, PD inhibited cell proliferation and induced apoptosis in laryngeal cancer and HeLa cells via inactivation of the PDGF/AKT signaling pathway. © 2017 Wiley Periodicals, Inc.

  3. Study of Grape Polyphenols by Liquid Chromatography-High-Resolution Mass Spectrometry (UHPLC/QTOF and Suspect Screening Analysis

    Directory of Open Access Journals (Sweden)

    Riccardo Flamini

    2015-01-01

    Full Text Available Suspect screening analysis is a targeted metabolomics method in which the identification of compounds relies on specific available information, such as their molecular formula and isotopic pattern. This method, coupled to liquid chromatography-high-resolution mass spectrometry, is effective in the study of grape metabolomics, in particular for characterization of flavonols, stilbene derivatives, and anthocyanins. For identification of compounds expected in the samples, a new database of putative compounds was expressly constructed by using the molecular information on potential metabolites of grape and wine from the literature and other electronic databases. Currently, this database contains around 1,100 compounds. The method allows identification of several hundred grape metabolites with two analyses (positive and negative ionization modes, and performing of data reprocessing using “untargeted” algorithms also provided the identification of some flavonols and resveratrol trimers and tetramers in grape for the first time. This approach can be potentially used in the study of metabolomics of varieties of other plant species.

  4. Nobiletin Stimulates Chloride Secretion in Human Bronchial Epithelia via a cAMP/PKA-Dependent Pathway

    Directory of Open Access Journals (Sweden)

    Yuan Hao

    2015-08-01

    Full Text Available Background/Aims: Nobiletin, a citrus flavonoid isolated from tangerines, alters ion transport functions in intestinal epithelia, and has antagonistic effects on eosinophilic airway inflammation of asthmatic rats. The present study examined the effects of nobiletin on basal short-circuit current (ISC in a human bronchial epithelial cell line (16HBE14o-, and characterized the signal transduction pathways that allowed nobiletin to regulate electrolyte transport. Methods: The ISC measurement technique was used for transepithelial electrical measurements. Intracellular calcium ([Ca2+]i and cAMP were also quantified. Results: Nobiletin stimulated a concentration-dependent increase in ISC, which was due to Cl- secretion. The increase in ISC was inhibited by a cystic fibrosis transmembrane conductance regulator inhibitor (CFTRinh-172, but not by 4,4'-diisothiocyano-stilbene-2,2'-disulphonic acid (DIDS, Chromanol 293B, clotrimazole, or TRAM-34. Nobiletin-stimulated ISC was also sensitive to a protein kinase A (PKA inhibitor, H89, and an adenylate cyclase inhibitor, MDL-12330A. Nobiletin could not stimulate any increase in ISC in a cystic fibrosis (CF cell line, CFBE41o-, which lacked a functional CFTR. Nobiletin stimulated a real-time increase in cAMP, but not [Ca2+]i. Conclusion: Nobiletin stimulated transepithelial Cl- secretion across human bronchial epithelia. The mechanisms involved activation of adenylate cyclase- and cAMP/PKA-dependent pathways, leading to activation of apical CFTR Cl- channels.

  5. Influence of Ripeness and Drying Process on the Polyphenols and Tocopherols of Pistacia vera L.

    Directory of Open Access Journals (Sweden)

    Gabriele Ballistreri

    2009-10-01

    Full Text Available This paper highlights, for the first time, the changes in the phenolics fraction (anthocyanins, flavonoids and stilbenes and tocopherols of unpeeled Pistacia vera L. var. bianca with ripening, and the effect of the sun-drying process. The total polyphenol levels in pistachios, measured as mg of Gallic Acid Equivalent (GAE, were: 201 ± 10.1, 349 ± 18.3 and 184.7 ± 6.2 mg GAE/100 g DM in unripe, ripe and dried ripe samples, respectively. Most phenolics in ripe pistachios were found to be anthocyanins. They increased with ripening, while the sun drying process caused a susbtantial loss. Flavonoids found in all pistachio samples were daidzein, genistein, daidzin, quercetin, eriodictyol, luteolin, genistin and naringenin, which decreased both with ripening and drying. Before the drying process both unripe and ripe pistachios showed a higher content of trans-resveratrol than dried ripe samples. γ-Tocopherol was the major vitamin E isomer found in pistachios. The total content (of α- and γ-tocopherols decreased, both during ripening and during the drying process. These results suggested that unpeeled pistachios can be considered an important source of phenolics, particularly of anthocyanins. Moreover, in order to preserve these healthy characteristics, new and more efficient drying processes should be adopted.

  6. Resveratrol-Sensitized UVA Induced Apoptosis in Human Keratinocytes through Mitochondrial Oxidative Stress and Pore Opening

    Science.gov (United States)

    Boyer, Jean Z; Jandova, Jana; Janda, Jaroslav; Vleugels, Frank R; Elliott, David; Sligh, James E

    2012-01-01

    Resveratrol (3, 5, 4′-trihydroxy- trans- stilbene), a polyphenol compound, is derived from natural products such as the skin of red grapes, blueberries and cranberries. Resveratrol not only exhibits antioxidant, cardioprotection, and anti-aging properties, but can also inhibit cancer cell growth and induce apoptosis. It has been shown that resveratrol inhibits the activation of Nf-kB and subsequently down regulates the expression of Nf-kB regulated genes such as interleukin-2 and Bcl-2, leading to cell cycle arrest and increased apoptosis in multiple myeloma cells. In the skin, resveratrol has been reported to sensitize keratinocytes to UVA induced apoptosis. However, the effect of resveratrol on opening of the mitochondrial permeability transition pore has not been previously examined. Our data show that UVA (14J/cm2) along with resveratrol causes massive oxidative stress in mitochondria. As a consequence of oxidative stress, the mitochondrial membrane potential decreases which results in opening of the mitochondrial pores ultimately leading to apoptosis in human keratinocytes. These results may have clinical implications for development of future chemotherapeutic treatment for tumors of the skin. PMID:22673012

  7. Effects of styrene unit on molecular conformation and spectral properties of CNsbnd PhCHdbnd NPhCHdbnd CHPhsbnd CN

    Science.gov (United States)

    Fang, Zhengjun; Wu, Feng; Jiao, Yingchun; Wang, Nanfang; Au, Chaktong; Cao, Chenzhong; Yi, Bing

    2018-05-01

    Compound CN-PhCH=NPhCH=CHPh-CN with both stilbene and benzylidene aniline units was synthesized, and studied from the viewpoint of molecular conformation and spectroscopic property by a combined use of experimental and computational methods. The maximum UV absorption wavelength (λmax) of the compound in ethanol, acetonitrile, chloroform and cyclohexane solvents were measured, and the 13C NMR chemical shift value δC(Cdbnd N) in chloroform-d was determined. The crystal structure of the compound was determined by X-ray diffraction. The frontier molecular orbital was calculated by density functional theory method. The results show that the UV absorption spectrum of the titled compound is similar to those of Schiff bases, while there is a larger red shift of λmax comparing to that of CN-PhCH=NPh-CN. Moreover, the molecular configuration of the titled compound relative to Cdbnd N is anti-form, having a more obvious twisted structure. The spectral and structural behaviors are further supported by the results of frontier molecular orbital analyses, NBO, electrostatic potentials and TD-DFT calculations. The study provides deeper insights into the molecular conformation of Schiff bases.

  8. The Role of Resveratrol in Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Jeong-Hyeon Ko

    2017-12-01

    Full Text Available Abstract: Natural product compounds have recently attracted significant attention from the scientific community for their potent effects against inflammation-driven diseases, including cancer. A significant amount of research, including preclinical, clinical, and epidemiological studies, has indicated that dietary consumption of polyphenols, found at high levels in cereals, pulses, vegetables, and fruits, may prevent the evolution of an array of diseases, including cancer. Cancer development is a carefully orchestrated progression where normal cells acquires mutations in their genetic makeup, which cause the cells to continuously grow, colonize, and metastasize to other organs such as the liver, lungs, colon, and brain. Compounds that modulate these oncogenic processes can be considered as potential anti-cancer agents that may ultimately make it to clinical application. Resveratrol, a natural stilbene and a non-flavonoid polyphenol, is a phytoestrogen that possesses anti-oxidant, anti-inflammatory, cardioprotective, and anti-cancer properties. It has been reported that resveratrol can reverse multidrug resistance in cancer cells, and, when used in combination with clinically used drugs, it can sensitize cancer cells to standard chemotherapeutic agents. Several novel analogs of resveratrol have been developed with improved anti-cancer activity, bioavailability, and pharmacokinetic profile. The current focus of this review is resveratrol’s in vivo and in vitro effects in a variety of cancers, and intracellular molecular targets modulated by this polyphenol. This is also accompanied by a comprehensive update of the various clinical trials that have demonstrated it to be a promising therapeutic and chemopreventive agent.

  9. Glasses impregnated with lead for radiation shielding

    International Nuclear Information System (INIS)

    Abd El Monem, A.M.; Kansouh, W.A.; Megahid, R.M.; Ismail, A.L.; Awad, E.M.

    2005-01-01

    The attenuation properties of glasses with different concentration of lead have been investigated for the attenuation of gamma-rays from cesium-137 and for total gamma rays using a beam of neutrons and gamma rays emitted from californium-252 source. Measurements have been performed using a gamma-ray spectrometer with Nal(T1) detector for gamma-rays emitted from 137 Cs and a neutron/gamma spectrometer with stilbene scintillator for measurement of total gamma-rays from 252 Cf neutron source. The latter applied the pulse shape discrimination technique to distinguish between recoil proton and recoil electron pulses. The obtained results given the form displayed pulse height spectra and attenuation relations which were used to derive the linear attenuation coefficient (μ), and the mass attenuation coefficient (mu/p) of the investigated glasses. In addition, calculations were performed to determine the attenuation properties of glass shields under investigation using XCOM code given by the others. A comparison of the shielding properties of these glasses with some standard shielding materials indicated that, the investigated glasses process the shielding advantages required for different nuclear technology applications

  10. Post-harvest UVC irradiation effect on anthocyanin profile of grape berries

    International Nuclear Information System (INIS)

    Rosas, I. de; Ponce, M.; Gargantini, R.; Martinez, L.

    2010-01-01

    Anthocyanins are a class of phenolic compounds that contribute to the color of red grapes and have shown nutraceutical properties for human health. UVC light irradiation has been proved to increase phenolic compounds such as stilbenes, but its effect on anthocyanins has not been reported. The aim of this work was to identify the best treatment conditions of UVC light irradiation on post-harvest berries of Malbec (M), Cabernet Sauvignon (CS) and Tempranillo (T) for anthocyanin increments. Grape berries were irradiated with 240 W at 20 and 40 cm from the light source, for 30, 60 and 120 seconds. Both, irradiated and control grapes were stored on darkness at 20 C degree until anthocyanin extraction with methanol/ClH. HPLC analysis were performed and nine anthocyanins were quantified. UVC light irradiation modified the anthocyanin profile of the three cultivars. All the glucoside anthocyanins derivates and peonidin-acetyl-glucoside, as well as total anthocyanins were increased when CS berries were exposed to UVC for 120 s at 40 cm. This suggests that UVC stimulated the entire biosynthetic pathway. The anthocyanin content of the control berries was always higher than the treatments with UVC on M and T, making necessary to evaluate less rigorous conditions for these varieties. (authors)

  11. Synthesis and Biological Evaluation of Resveratrol Derivatives as Melanogenesis Inhibitors

    Directory of Open Access Journals (Sweden)

    Qing Liu

    2015-09-01

    Full Text Available Resveratrol (1, a naturally occurring stilbene compound, has been suggested as a potential whitening agent with strong inhibitory activity on melanin synthesis. However, the use of resveratrol in cosmetics has been limited due to its chemical instability and poor bioavailability. Therefore, resveratrol derivatives were prepared to improve bioavailability and anti-melanogenesis activity. Nine resveratrol derivatives including five alkyl ether derivatives with C2H5, C4H9, C5H11, C6H13, and C8H17 (2a–2e and four ester derivatives with CH3, CH=C(CH32, CH(C2H5C4H9, C7H15 (3a–3d were newly synthesized and their effect on melanin synthesis were assessed. All the synthetic derivatives efficiently reduced the melanin content in α-MSH stimulated B16F10 melanoma cells. Further investigation showed that the inhibitory effect of 2a on melanin synthesis was achieved not by the inhibition of tyrosinase activity but by the inhibition of melanogenic enzyme expressions such as tyrosinase and tyrosinase-related protein (TRP-1. Our synthetic resveratrol derivatives have more lipophilic properties than resveratrol by the addition of alkyl or acyl chains to free hydroxyl moiety of resveratrol; thus, they are expected to show better bioavailability in skin application. Therefore, we suggest that our synthetic resveratrol derivatives might be promising candidates for better practical application to skin-whitening cosmetics.

  12. Specific Conditions for Resveratrol Neuroprotection against Ethanol-Induced Toxicity

    Directory of Open Access Journals (Sweden)

    Brigitte Gonthier

    2012-01-01

    Full Text Available Aims. 3,5,4′-Trihydroxy-trans-stilbene, a natural polyphenolic compound present in wine and grapes and better known as resveratrol, has free radical scavenging properties and is a potent protector against oxidative stress induced by alcohol metabolism. Today, the mechanism by which ethanol exerts its toxicity is still not well understood, but it is generally considered that free radical generation plays an important role in the appearance of structural and functional alterations in cells. The aim of this study was to evaluate the protective action of resveratrol against ethanol-induced brain cell injury. Methods. Primary cultures of rat astrocytes were exposed to ethanol, with or without a pretreatment with resveratrol. We examined the dose-dependent effects of this resveratrol pretreatment on cytotoxicity and genotoxicity induced by ethanol. Cytotoxicity was assessed using the MTT reduction test. Genotoxicity was evidenced using single cell gel electrophoresis. In addition, DNA staining with fluorescent dyes allowed visualization of nuclear damage using confocal microscopy. Results. Cell pretreatment with low concentrations of trans-resveratrol (0.1–10 μM slowed down cell death and DNA damage induced by ethanol exposure, while higher concentrations (50–100 μM enhanced these same effects. No protection by cis-resveratrol was observed. Conclusion. Protection offered by trans-resveratrol against ethanol-induced neurotoxicity was only effective for low concentrations of this polyphenol.

  13. Characterization of antiproliferative activity constituents from Artocarpus heterophyllus.

    Science.gov (United States)

    Zheng, Zong-Ping; Xu, Yang; Qin, Chuan; Zhang, Shuang; Gu, Xiaohong; Lin, Yingying; Xie, Guobin; Wang, Mingfu; Chen, Jie

    2014-06-18

    Artocarpus heterophyllus is an evergreen fruit tree cultivated in many tropical regions. Previous studies have shown that some of its compositions exhibited potential tyrosinase inhibition activities. This study indentified 8 new phenolic compounds, artoheterophyllins E-J (1-6), 4-geranyl-2',3,4',5-tetrahydroxy-cis-stilbene (7), and 5-methoxymorican M (8) and 2 new natural compounds (9 and 10), 2,3-dihydro-5,7-dihydroxy-2-(2-hydroxy-4-methoxyphenyl)-4H-benzopyran-4-one and 6-[(1S,2S)-1,2-dihydroxy-3-methylbutyl]-2-(2,4-dihydroxyphenyl)-5-hydroxy-7-methoxy-3-(3-methyl-2-buten-1-yl)-4H-1-benzopyran-4-one, together with 23 known compounds (11-33), from the ethanol extract of the wood of A. heterophyllus. The structures of the eight new compounds (1-8) and two new natural compounds were established by extensive 1D- and 2D-NMR experiments. The anticancer effects of the isolated compounds were examined in MCF-7, H460, and SMMC-7721 human cancer cell lines by MTT assay. Compounds 5, 11, 12, and 30 significantly reduced the cell viabilities of these cell lines. Especially, compounds 11 and 30 resulted in more potent cytotoxicity than the positive control, 5-fluorouracil (5-Fu), in SMMC-7721 cell line, with IC50 values of 15.85 and 12.06 μM, whereas compound 30 exhibited more potent cytotoxicity than 5-Fu in NCI-H460 cell line, with an IC50 value of 5.19 μM. In addition, this study suggests that compounds 11 and 30 from the wood of A. heterophyllus have anticancer potential via MAPK pathways.

  14. Phenolic Profiling for Traceability of Vanilla ×tahitensis

    Directory of Open Access Journals (Sweden)

    Matteo Busconi

    2017-10-01

    the different phenolic patterns. Among the 260 compounds, metabolomics analysis enabled the detection of previously unreported phenolics in vanilla (such as flavonoids, lignans, stilbenes and other polyphenols.

  15. Preparation and Characterization of Pd Modified TiO2 Nanofiber Catalyst for Carbon–Carbon Coupling Heck Reaction

    Directory of Open Access Journals (Sweden)

    Leah O. Nyangasi

    2017-01-01

    Full Text Available TiO2 fibers were prepared through electrospinning of poly methyl methacrylate (PMMA and titanium isopropoxide (TIP solution followed by calcination of fibers in air at 500°C. Cetyltrimethylammonium bromide (CTAB protected palladium nanoparticles (Pd NPs prepared through reduction method were successfully adsorbed on the TiO2 nanofibers (NF. Combined studies of X-ray diffraction (XRD, scanning electron microscope (SEM, and transmission electron microscope (TEM indicated that the synthesized Pd/TiO2 had anatase. BET indicated that the synthesized TiO2 and Pd/TiO2 had a surface area of 53.4 and 43.4 m2/g, respectively. The activity and selectivity of 1 mol% Pd/TiO2 in the Heck reaction have been investigated towards the Mizoroki-Heck carbon–carbon cross-coupling of bromobenzene (ArBr and styrene. Temperature, time, solvent, and base were optimized and catalyst was recycled thrice. 1H NMR and 13C NMR indicated that stilbene, a known compound from literature, was obtained in various Heck reactions at temperatures between 100°C and 140°C but the recyclability was limited due to some palladium leaching and catalyst poisoning which probably arose from some residual carbon from the polymer. The catalyst was found to be highly active under air atmosphere with reaction temperatures up to 140°C. Optimized reaction condition resulted in 89.7% conversions with a TON of 1993.4 and TOF value of 332.2 hr−1.

  16. A mechanistic study on the phototoxicity of atorvastatin: singlet oxygen generation by a phenanthrene-like photoproduct.

    Science.gov (United States)

    Montanaro, Sara; Lhiaubet-Vallet, Virginie; Iesce, MariaRosaria Iesce; Previtera, Lucio; Miranda, Miguel Angel

    2009-01-01

    Atorvastatin calcium (ATV) is one of the most frequently prescribed drugs worldwide. Among the adverse effects observed for this lipid-lowering agent, clinical cases of cutaneous adverse reactions have been reported and associated with photosensitivity disorders. Previous work dealing with ATV photochemistry has shown that exposure to natural sunlight in aqueous solution leads to photoproducts resulting from oxidation of the pyrrole ring and from cyclization to a phenanthrene derivative. Laser flash photolysis of ATV, at both 266 and 308 nm, led to a transient spectrum with two maxima at lambda= 360 and lambda= 580 nm (tau= 41 micro), which was assigned to the primary intermediate of the stilbene-like photocyclization. On the basis of the absence of a triplet-triplet absorption, the role of the parent drug as singlet oxygen photosensitizer can be discarded. By contrast, a stable phenanthrene-like photoproduct would be a good candidate to play this role. Laser flash photolysis of this compound showed a triplet-triplet transient absorption at lambdamax = 460 nm with a lifetime of 26 micro, which was efficiently quenched by oxygen (kq = 3 (+/-0.2) x 10(9) M(-1) s(-1)). Its potential to photosensitize formation of singlet oxygen was confirmed by spin trapping experiments, through conversion of TEMP to the stable free radical TEMPO. The photoreactivity of the phenanthrene-like photoproduct was investigated using Trp as a marker. The disappearance of the amino acid fluorescence (lambdamax = 340 nm) after increasing irradiation times at 355 nm was taken as a measurement of photodynamic oxidation. To confirm the involvement of a type II mechanism, the same experiment was also performed in D2O; this resulted in a significant enhancement of the reaction rate. On the basis of the obtained photophysical and photochemical results, the phototoxicity of atorvastatin can be attributed to singlet oxygen formation with the phenanthrene-like photoproduct as a photosensitizer.

  17. Resveratrol induces cellular senescence with attenuated mono-ubiquitination of histone H2B in glioma cells

    International Nuclear Information System (INIS)

    Gao, Zhen; Xu, Michael S.; Barnett, Tamara L.; Xu, C. Wilson

    2011-01-01

    Research highlights: → Resveratrol induces cellular senescence in glioma cell. → Resveratrol inhibits mono-ubiquitination of histone H2B at K120. → Depletion of RNF20, phenocopies the inhibitory effects of resveratrol. → Mono-ubiquitination of histone H2B at K120 is a novel target of resveratrol. → RNF20 inhibits cellular senescence in proliferating glioma cells. -- Abstract: Resveratrol (3,4',5-trihydroxy-trans-stilbene), a polyphenol naturally occurring in grapes and other plants, has cancer chemo-preventive effects and therapeutic potential. Although resveratrol modulates multiple pathways in tumor cells, how resveratrol or its affected pathways converge on chromatin to mediate its effects is not known. Using glioma cells as a model, we showed here that resveratrol inhibited cell proliferation and induced cellular hypertrophy by transforming spindle-shaped cells to enlarged, irregular and flatten-shaped ones. We further showed that resveratrol-induced hypertrophic cells expressed senescence-associated-β-galactosidase, suggesting that resveratrol-induced cellular senescence in glioma cells. Consistent with these observations, we demonstrated that resveratrol inhibited clonogenic efficiencies in vitro and tumor growth in a xenograft model. Furthermore, we found that acute treatment of resveratrol inhibited mono-ubiquitination of histone H2B at K120 (uH2B) in breast, prostate, pancreatic, lung, brain tumor cells as well as primary human cells. Chronic treatment with low doses of resveratrol also inhibited uH2B in the resveratrol-induced senescent glioma cells. Moreover, we showed that depletion of RNF20, a ubiquitin ligase of histone H2B, inhibited uH2B and induced cellular senescence in glioma cells in vitro, thereby recapitulated the effects of resveratrol. Taken together, our results suggest that uH2B is a novel direct or indirect chromatin target of resveratrol and RNF20 plays an important role in inhibiting cellular senescence programs that are

  18. Biological effects of combined resveratrol and vitamin D3 on ovarian tissue.

    Science.gov (United States)

    Uberti, Francesca; Morsanuto, Vera; Aprile, Silvio; Ghirlanda, Sabrina; Stoppa, Ian; Cochis, Andrea; Grosa, Giorgio; Rimondini, Lia; Molinari, Claudio

    2017-09-15

    Resveratrol (3,5,4'-trihydroxy-trans-stilbene) is a natural antioxidant polyphenol able to exert a wide range of biological effect on several tissues. Despite its important beneficial properties, it has a low water solubility, which limits its therapeutic applications in humans. Resveratrol also acts as a phytoestrogen that modulates estrogen receptor (ER)-mediated transcription. In addition, it has been shown that ovarian tissues benefit greatly from vitamin D3, which exerts its beneficial effects through VDR receptors. The aim was to evaluate the cooperative effects of resveratrol combined with vitamin D3 on ovarian cells and tissues and some other organs as well. Moreover, the modulation of specific intracellular pathways involving ER and VDR receptors has been studied. The experiments were performed both in vitro and in vivo, to analyze cell viability, radical oxygen species production, signal transductions through Western Blot, and resveratrol quantification by HPLC. Cell viability, radical oxygen species production, and intracellular pathways have been studied on CHO-K1 cells. Also, the relative mechanism activated following oral intake in female Wistar rats as animal model was investigated, evaluating bioavailability, biodistribution and signal transduction in heart, kidney, liver and ovarian tissues. Both in in vitro and in vivo experiments, resveratrol exerts more evident effects when administered in combination with vitD in ovarian cells, showing a common biphasic cooperative effect: The role of vitamin D3 in maintaining and supporting the biological activity of resveratrol has been clearly observed. Moreover, resveratrol plus vitamin D3 blood concentrations showed a biphasic absorption rate. Such results could be used as a fundamental data for the development of new therapies for gynecological conditions, such as hot-flashes.

  19. Resveratrol induces cellular senescence with attenuated mono-ubiquitination of histone H2B in glioma cells

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Zhen; Xu, Michael S.; Barnett, Tamara L. [Nevada Cancer Institute, Las Vegas, NV 89135 (United States); Xu, C. Wilson, E-mail: wxu@nvcancer.org [Nevada Cancer Institute, Las Vegas, NV 89135 (United States)

    2011-04-08

    Research highlights: {yields} Resveratrol induces cellular senescence in glioma cell. {yields} Resveratrol inhibits mono-ubiquitination of histone H2B at K120. {yields} Depletion of RNF20, phenocopies the inhibitory effects of resveratrol. {yields} Mono-ubiquitination of histone H2B at K120 is a novel target of resveratrol. {yields} RNF20 inhibits cellular senescence in proliferating glioma cells. -- Abstract: Resveratrol (3,4',5-trihydroxy-trans-stilbene), a polyphenol naturally occurring in grapes and other plants, has cancer chemo-preventive effects and therapeutic potential. Although resveratrol modulates multiple pathways in tumor cells, how resveratrol or its affected pathways converge on chromatin to mediate its effects is not known. Using glioma cells as a model, we showed here that resveratrol inhibited cell proliferation and induced cellular hypertrophy by transforming spindle-shaped cells to enlarged, irregular and flatten-shaped ones. We further showed that resveratrol-induced hypertrophic cells expressed senescence-associated-{beta}-galactosidase, suggesting that resveratrol-induced cellular senescence in glioma cells. Consistent with these observations, we demonstrated that resveratrol inhibited clonogenic efficiencies in vitro and tumor growth in a xenograft model. Furthermore, we found that acute treatment of resveratrol inhibited mono-ubiquitination of histone H2B at K120 (uH2B) in breast, prostate, pancreatic, lung, brain tumor cells as well as primary human cells. Chronic treatment with low doses of resveratrol also inhibited uH2B in the resveratrol-induced senescent glioma cells. Moreover, we showed that depletion of RNF20, a ubiquitin ligase of histone H2B, inhibited uH2B and induced cellular senescence in glioma cells in vitro, thereby recapitulated the effects of resveratrol. Taken together, our results suggest that uH2B is a novel direct or indirect chromatin target of resveratrol and RNF20 plays an important role in inhibiting cellular

  20. Identification of Biomarkers for Defense Response to Plasmopara viticola in a Resistant Grape Variety

    Directory of Open Access Journals (Sweden)

    Giulia Chitarrini

    2017-09-01

    Full Text Available Downy mildew (Plasmopara viticola is one of the most destructive diseases of the cultivated species Vitis vinifera. The use of resistant varieties, originally derived from backcrosses of North American Vitis spp., is a promising solution to reduce disease damage in the vineyards. To shed light on the type and the timing of pathogen-triggered resistance, this work aimed at discovering biomarkers for the defense response in the resistant variety Bianca, using leaf discs after inoculation with a suspension of P. viticola. We investigated primary and secondary metabolism at 12, 24, 48, and 96 h post-inoculation (hpi. We used methods of identification and quantification for lipids (LC-MS/MS, phenols (LC-MS/MS, primary compounds (GC-MS, and semi-quantification for volatile compounds (GC-MS. We were able to identify and quantify or semi-quantify 176 metabolites, among which 53 were modulated in response to pathogen infection. The earliest changes occurred in primary metabolism at 24–48 hpi and involved lipid compounds, specifically unsaturated fatty acid and ceramide; amino acids, in particular proline; and some acids and sugars. At 48 hpi, we also found changes in volatile compounds and accumulation of benzaldehyde, a promoter of salicylic acid-mediated defense. Secondary metabolism was strongly induced only at later stages. The classes of compounds that increased at 96 hpi included phenylpropanoids, flavonols, stilbenes, and stilbenoids. Among stilbenoids we found an accumulation of ampelopsin H + vaticanol C, pallidol, ampelopsin D + quadrangularin A, Z-miyabenol C, and α-viniferin in inoculated samples. Some of these compounds are known as phytoalexins, while others are novel biomarkers for the defense response in Bianca. This work highlighted some important aspects of the host response to P. viticola in a commercial variety under controlled conditions, providing biomarkers for a better understanding of the mechanism of plant defense and a

  1. Multi-Omics and Integrated Network Analyses Reveal New Insights into the Systems Relationships between Metabolites, Structural Genes, and Transcriptional Regulators in Developing Grape Berries (Vitis vinifera L. Exposed to Water Deficit

    Directory of Open Access Journals (Sweden)

    Stefania Savoi

    2017-07-01

    Full Text Available Grapes are one of the major fruit crops and they are cultivated in many dry environments. This study comprehensively characterizes the metabolic response of grape berries exposed to water deficit at different developmental stages. Increases of proline, branched-chain amino acids, phenylpropanoids, anthocyanins, and free volatile organic compounds have been previously observed in grape berries exposed to water deficit. Integrating RNA-sequencing analysis of the transcriptome with large-scale analysis of central and specialized metabolites, we reveal that these increases occur via a coordinated regulation of key structural pathway genes. Water deficit-induced up-regulation of flavonoid genes is also coordinated with the down-regulation of many stilbene synthases and a consistent decrease in stilbenoid concentration. Water deficit activated both ABA-dependent and ABA-independent signal transduction pathways by modulating the expression of several transcription factors. Gene-gene and gene-metabolite network analyses showed that water deficit-responsive transcription factors such as bZIPs, AP2/ERFs, MYBs, and NACs are implicated in the regulation of stress-responsive metabolites. Enrichment of known and novel cis-regulatory elements in the promoters of several ripening-specific/water deficit-induced modules further affirms the involvement of a transcription factor cross-talk in the berry response to water deficit. Together, our integrated approaches show that water deficit-regulated gene modules are strongly linked to key fruit-quality metabolites and multiple signal transduction pathways may be critical to achieve a balance between the regulation of the stress-response and the berry ripening program. This study constitutes an invaluable resource for future discoveries and comparative studies, in grapes and other fruits, centered on reproductive tissue metabolism under abiotic stress.

  2. Multi-Omics and Integrated Network Analyses Reveal New Insights into the Systems Relationships between Metabolites, Structural Genes, and Transcriptional Regulators in Developing Grape Berries (Vitis vinifera L.) Exposed to Water Deficit.

    Science.gov (United States)

    Savoi, Stefania; Wong, Darren C J; Degu, Asfaw; Herrera, Jose C; Bucchetti, Barbara; Peterlunger, Enrico; Fait, Aaron; Mattivi, Fulvio; Castellarin, Simone D

    2017-01-01

    Grapes are one of the major fruit crops and they are cultivated in many dry environments. This study comprehensively characterizes the metabolic response of grape berries exposed to water deficit at different developmental stages. Increases of proline, branched-chain amino acids, phenylpropanoids, anthocyanins, and free volatile organic compounds have been previously observed in grape berries exposed to water deficit. Integrating RNA-sequencing analysis of the transcriptome with large-scale analysis of central and specialized metabolites, we reveal that these increases occur via a coordinated regulation of key structural pathway genes. Water deficit-induced up-regulation of flavonoid genes is also coordinated with the down-regulation of many stilbene synthases and a consistent decrease in stilbenoid concentration. Water deficit activated both ABA-dependent and ABA-independent signal transduction pathways by modulating the expression of several transcription factors. Gene-gene and gene-metabolite network analyses showed that water deficit-responsive transcription factors such as bZIPs, AP2/ERFs, MYBs, and NACs are implicated in the regulation of stress-responsive metabolites. Enrichment of known and novel cis -regulatory elements in the promoters of several ripening-specific/water deficit-induced modules further affirms the involvement of a transcription factor cross-talk in the berry response to water deficit. Together, our integrated approaches show that water deficit-regulated gene modules are strongly linked to key fruit-quality metabolites and multiple signal transduction pathways may be critical to achieve a balance between the regulation of the stress-response and the berry ripening program. This study constitutes an invaluable resource for future discoveries and comparative studies, in grapes and other fruits, centered on reproductive tissue metabolism under abiotic stress.

  3. Roostocks/scion/ nitrogen interactions affect secondary metabolism in the grape berry

    Directory of Open Access Journals (Sweden)

    Aude Habran

    2016-08-01

    Full Text Available ABSTRACT : The present work investigates the interactions between soil content, rootstock and scion by focusing on the effects of roostocks and nitrogen supply on grape berry content. Scions of Cabernet Sauvignon (CS and Pinot Noir (PN varieties were grafted either on Riparia Gloire de Montpellier (RGM or 110 Richter (110R rootstock. The 4 rooststock/scion combinations were fertilized with 3 different levels of nitrogen after fruit set. Both in 2013 and 2014, N supply increased N uptake by the plants, and N content both in vegetative and reproductory organs. Rootstock, variety and year affected berry weight at harvest, while nitrogen did not affect significantly this parameter. Grafting on RGM consistently increased berry weight compared to 110R. PN consistently produced bigger berries than CS. CS berries were heavier in 2014 than in 2013, but the year effect was less marked for PN berries. The berries were collected between veraison and maturity, separated in skin and pulp, and their content was analyzed by conventional analytical procedures and untargeted metabolomics. For anthocyanins, the relative quantitation was fairly comparable with both LC-MS determination and HPLC-DAD, which is a fully quantitative technique. The data show complex responses of the metabolite content (sugars, organic acids, amino acids, anthocyanins, flavonols, flavan-3-ols/procyanidins, stilbenes, hydroxycinnamic and hydroxybenzoic acids. that depend on the rootstock, the scion, the vintage, the nitrogen level, the berry compartment. This opens a wide range of possibilities to adjust the content of these compounds through the choice of the roostock, variety and nitrogen fertilization.

  4. Transcriptome and metabolome reprogramming in Vitis vinifera cv. Trincadeira berries upon infection with Botrytis cinerea.

    Science.gov (United States)

    Agudelo-Romero, Patricia; Erban, Alexander; Rego, Cecília; Carbonell-Bejerano, Pablo; Nascimento, Teresa; Sousa, Lisete; Martínez-Zapater, José M; Kopka, Joachim; Fortes, Ana Margarida

    2015-04-01

    Vitis vinifera berries are sensitive towards infection by the necrotrophic pathogen Botrytis cinerea, leading to important economic losses worldwide. The combined analysis of the transcriptome and metabolome associated with fungal infection has not been performed previously in grapes or in another fleshy fruit. In an attempt to identify the molecular and metabolic mechanisms associated with the infection, peppercorn-sized fruits were infected in the field. Green and veraison berries were collected following infection for microarray analysis complemented with metabolic profiling of primary and other soluble metabolites and of volatile emissions. The results provided evidence of a reprogramming of carbohydrate and lipid metabolisms towards increased synthesis of secondary metabolites involved in plant defence, such as trans-resveratrol and gallic acid. This response was already activated in infected green berries with the putative involvement of jasmonic acid, ethylene, polyamines, and auxins, whereas salicylic acid did not seem to be involved. Genes encoding WRKY transcription factors, pathogenesis-related proteins, glutathione S-transferase, stilbene synthase, and phenylalanine ammonia-lyase were upregulated in infected berries. However, salicylic acid signalling was activated in healthy ripening berries along with the expression of proteins of the NBS-LRR superfamily and protein kinases, suggesting that the pathogen is able to shut down defences existing in healthy ripening berries. Furthermore, this study provided metabolic biomarkers of infection such as azelaic acid, a substance known to prime plant defence responses, arabitol, ribitol, 4-amino butanoic acid, 1-O-methyl- glucopyranoside, and several fatty acids that alone or in combination can be used to monitor Botrytis infection early in the vineyard. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email

  5. Roostocks/Scion/Nitrogen Interactions Affect Secondary Metabolism in the Grape Berry.

    Science.gov (United States)

    Habran, Aude; Commisso, Mauro; Helwi, Pierre; Hilbert, Ghislaine; Negri, Stefano; Ollat, Nathalie; Gomès, Eric; van Leeuwen, Cornelis; Guzzo, Flavia; Delrot, Serge

    2016-01-01

    The present work investigates the interactions between soil content, rootstock, and scion by focusing on the effects of roostocks and nitrogen supply on grape berry content. Scions of Cabernet Sauvignon (CS) and Pinot Noir (PN) varieties were grafted either on Riparia Gloire de Montpellier (RGM) or 110 Richter (110R) rootstock. The 4 rooststock/scion combinations were fertilized with 3 different levels of nitrogen after fruit set. Both in 2013 and 2014, N supply increased N uptake by the plants, and N content both in vegetative and reproductory organs. Rootstock, variety and year affected berry weight at harvest, while nitrogen did not affect significantly this parameter. Grafting on RGM consistently increased berry weight compared to 110R. PN consistently produced bigger berries than CS. CS berries were heavier in 2014 than in 2013, but the year effect was less marked for PN berries. The berries were collected between veraison and maturity, separated in skin and pulp, and their content was analyzed by conventional analytical procedures and untargeted metabolomics. For anthocyanins, the relative quantitation was fairly comparable with both LC-MS determination and HPLC-DAD, which is a fully quantitative technique. The data show complex responses of the metabolite content (sugars, organic acids, amino acids, anthocyanins, flavonols, flavan-3-ols/procyanidins, stilbenes, hydroxycinnamic, and hydroxybenzoic acids) that depend on the rootstock, the scion, the vintage, the nitrogen level, the berry compartment. This opens a wide range of possibilities to adjust the content of these compounds through the choice of the roostock, variety and nitrogen fertilization.

  6. Phenolic Profiling for Traceability of Vanilla ×tahitensis.

    Science.gov (United States)

    Busconi, Matteo; Lucini, Luigi; Soffritti, Giovanna; Bernardi, Jamila; Bernardo, Letizia; Brunschwig, Christel; Lepers-Andrzejewski, Sandra; Raharivelomanana, Phila; Fernandez, Jose A

    2017-01-01

    phenolic patterns. Among the 260 compounds, metabolomics analysis enabled the detection of previously unreported phenolics in vanilla (such as flavonoids, lignans, stilbenes and other polyphenols).

  7. Potential of Polygonum cuspidatum Root as an Antidiabetic Food: Dual High-Resolution α-Glucosidase and PTP1B Inhibition Profiling Combined with HPLC-HRMS and NMR for Identification of Antidiabetic Constituents.

    Science.gov (United States)

    Zhao, Yong; Chen, Martin Xiaoyong; Kongstad, Kenneth Thermann; Jäger, Anna Katharina; Staerk, Dan

    2017-06-07

    The worldwide increasing incidence of type 2 diabetes has fueled an intensified search for food and herbal remedies with preventive and/or therapeutic properties. Polygonum cuspidatum Siebold & Zucc. (Polygonaceae) is used as a functional food in Japan and South Korea, and it is also a well-known traditional antidiabetic herb used in China. In this study, dual high-resolution α-glucosidase and protein-tyrosine phosphatase 1B (PTP1B) inhibition profiling was used for the identification of individual antidiabetic constituents directly from the crude ethyl acetate extract and fractions of P. cuspidatum. Subsequent preparative-scale HPLC was used to isolate a series of α-glucosidase inhibitors, which after HPLC-HRMS and NMR analysis were identified as procyanidin B2 3,3″-O-digallate (3) and (-)-epicatechin gallate (5) with IC 50 values of 0.42 ± 0.02 and 0.48 ± 0.0004 μM, respectively, as well as a series of stilbene analogues with IC 50 value in the range from 6.05 ± 0.05 to 116.10 ± 2.04 μM. In addition, (trans)-emodin-physcion bianthrone (15b) and (cis)-emodin-physcion bianthrone (15c) were identified as potent PTP1B inhibitors with IC 50 values of 2.77 ± 1.23 and 7.29 ± 2.32 μM, respectively. These findings show that P. cuspidatum is a potential functional food for management of type 2 diabetes.

  8. Evaluation of fish models of soluble epoxide hydrolase inhibition.

    Science.gov (United States)

    Newman, J W; Denton, D L; Morisseau, C; Koger, C S; Wheelock, C E; Hinton, D E; Hammock, B D

    2001-01-01

    Substituted ureas and carbamates are mechanistic inhibitors of the soluble epoxide hydrolase (sEH). We screened a set of chemicals containing these functionalities in larval fathead minnow (Pimphales promelas) and embryo/larval golden medaka (Oryzias latipes) models to evaluate the utility of these systems for investigating sEH inhibition in vivo. Both fathead minnow and medaka sEHs were functionally similar to the tested mammalian orthologs (murine and human) with respect to substrate hydrolysis and inhibitor susceptibility. Low lethality was observed in either larval or embryonic fish exposed to diuron [N-(3,4-dichlorophenyl), N'-dimethyl urea], desmethyl diuron [N-(3,4-dichlorophenyl), N'-methyl urea], or siduron [N-(1-methylcyclohexyl), N'-phenyl urea]. Dose-dependent inhibition of sEH was a sublethal effect of substituted urea exposure with the potency of siduron diuron = diuron, differing from the observed in vitro sEH inhibition potency of siduron > desmethyl diuron > diuron. Further, siduron exposure synergized the toxicity of trans-stilbene oxide in fathead minnows. Medaka embryos exposed to diuron, desmethyl diuron, or siduron displayed dose-dependent delays in hatch, and elevated concentrations of diuron and desmethyl diuron produced developmental toxicity. The dose-dependent toxicity and in vivo sEH inhibition correlated, suggesting a potential, albeit undefined, relationship between these factors. Additionally, the observed inversion of in vitro to in vivo potency suggests that these fish models may provide tools for investigating the in vivo stability of in vitro inhibitors while screening for untoward effects. PMID:11171526

  9. Molecular and analysis of a phenylalanine ammonia-lyase gene (LrPAL2) from Lycoris radiata.

    Science.gov (United States)

    Jiang, Yumei; Xia, Bing; Liang, Lijian; Li, Xiaodan; Xu, Sheng; Peng, Feng; Wang, Ren

    2013-03-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme of phenylpropanoid biosynthesis, participates in the biosynthesis of flavonoids, lignins, stilbenes and many other compounds. In this study, we cloned a 2,326 bp full-length PAL2 gene from Lycoris radiata by using degenerate oligonucleotide primer PCR (DOP-PCR) and the rapid amplification of cDNA ends method. The cDNA contains a 2,124 bp coding region encoding 707 amino acids. The LrPAL2 shares about 77.0 % nucleic acid identity and 83 % amino acid identity with LrPAL1. Furthermore, genome sequence analysis demonstrated that LrPAL2 gene contains one intron and two exons. The 5' flanking sequence of LrPAL2 was also cloned by self-formed adaptor PCR (SEFA-PCR), and a group of putative cis-acting elements such as TATA box, CAAT box, G box, TC-rich repeats, CGTCA motif and TCA-element were identified. The LrPAL2 was detected in all tissues examined, with high abundance in bulbs at leaf sprouting stage and in petals at blooming stage. Besides, LrPAL2 drastically responded to MJ, SNP and UV, moderately responded to GA and SA, and a little increased under wounding. Comparison of LrPAL2 expression and LrPAL1 expression demonstrated that LrPAL2 can be more significantly induced than LrPAL1 under the above treatments, and LrPAL2 transcripts accumulated prominently at blooming stage, especially in petals, while LrPAL1 transcripts did not accumulated significantly at blooming stage. All these results suggested that LrPAL2 might play distinct roles in different branches of the phenylpropanoid pathway.

  10. A review on chemical and biological properties of Cayratia trifolia Linn. (Vitaceae).

    Science.gov (United States)

    Kumar, Dinesh; Kumar, Sunil; Gupta, Jyoti; Arya, Renu; Gupta, Ankit

    2011-07-01

    Cayratia trifolia Linn. Domin Syn. Vitis trifolia (Family: Vitaceae) is commonly known as Fox grape in English; Amlabel, Ramchana in Hindi and Amlavetash in Sanskrit. It is native to India, Asia and Australia. It is a perennial climber having trifoliated leaves with 2-3 cm long petioles and ovate to oblong-ovate leaflets. Flowers are small greenish white and brown in color. Fruits are fleshy, juicy, dark purple or black, nearly spherical, about 1 cm in diameter. It is found throughout the hills in India. This perennial climber is also found in the hotter part of India from Jammu and Rajasthan to Assam extending into the peninusular India upto 600 m height. Whole plant of Cayratia trifolia has been reported to contain yellow waxy oil, steroids/terpenoids, flavonoids, tannins upon preliminary phytochemical screening. Leaves contain stilbenes (piceid, reveratrol, viniferin, ampelopsin). Stem, leaves, roots are reported to possess hydrocyanic acid, delphinidin and several flavonoids such as cyanidin is reported in the leaves. This plant also contains kaempferol, myricetin, quercetin, triterpenes and epifriedelanol. Infusion of seeds along with extract of tubers is traditionally given orally to diabetic patients to check sugar level of blood. Paste of tuberous is applied on the affected part in the treatment of snake bite. Whole plant is used as diuretic, in tumors, neuralgia and splenopathy. Its climbers wrapped around the neck of frantic bullock and poultice of leaves are used to yoke sores of bullock. The bark extract shows the antiviral, antibacterial, antiprotozoal, hypoglycemic, anticancer and diuretic activity. This article focuses on the upgraded review on chemical and biological properties of Cayratia trifolia Linn. and triggers further investigation on this plant.

  11. Cl--HCO-3 antiport in rat lacrimal gland

    International Nuclear Information System (INIS)

    Lambert, R.W.; Bradley, M.E.; Mircheff, A.K.

    1988-01-01

    With the use of analytical subcellular fractionation and tracer uptake methods the authors have demonstrated the presence of a Cl - -HCO - 3 antiport mechanism in the rat exorbital lacrimal gland. They find that outwardly directed gradients of HCO - 3 and of 35 Cl - accelerated the flux of 36 Cl - into isolated membrane vesicles. Because vesicle membrane potentials were clamped to 0 mV with K + -valinomycin, the observed anion gradient-dependent acceleration of Cl - influx could not be attributed to conductive fluxes. The antiporter had an apparent K 0.5 for Cl - between 6 and 10 mM. It was sensitive to the stilbene derivatives 4-acetamido-4'-isothiocyanostilbene-2,2'-disulfonic acid (SITS) and 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS). It was also sensitive to the loop diuretic furosemide, which has frequently been used in tests for NaKCl 2 symporter activity. Other anions inhibited anion gradient-driven Cl - influx in the sequence SCN - > NO - 3 > Cl - HCO - 3 > SO 2- 4 . The density distribution of Cl - -HCO - 3 antiport activity indicated that ∼80% of the transporter was associated with intracellular membranes, suggesting the presence of cytoplasmic pools of functional antiporters. Because several studies have already shown the presence of Na + -H + antiporter activity in lacrimal acinar cell basolateral membranes, a cellular model for lacrimal acinar electrolyte secretion is proposed in which a parallel array of Cl - -HCO - 3 and Na + -H + antiporters mediates the Na + -dependent accumulation of Cl - against its electrochemical potential gradient

  12. Dry-air drying at room temperature - a practical pre-treatment method of tree leaves for quantitative analyses of phenolics?

    Science.gov (United States)

    Tegelberg, Riitta; Virjamo, Virpi; Julkunen-Tiitto, Riitta

    2018-03-09

    In ecological experiments, storage of plant material is often needed between harvesting and laboratory analyses when the number of samples is too large for immediate, fresh analyses. Thus, accuracy and comparability of the results call for pre-treatment methods where the chemical composition remains unaltered and large number of samples can be treated efficiently. To study if a fast dry-air drying provides an efficient pre-treatment method for quantitative analyses of phenolics. Dry-air drying of mature leaves was done in a drying room equipped with dehumifier (10% relative humidity, room temperature) and results were compared to freeze-drying or freeze-drying after pre-freezing in liquid nitrogen. The quantities of methanol-soluble phenolics of Betula pendula Roth, Betula pubescens Ehrh., Salix myrsinifolia Salisb., Picea abies L. Karsten and Pinus sylvestris L. were analysed with HPLC and condensed tannins were analysed using the acid-butanol test. In deciduous tree leaves (Betula, Salix), the yield of most of the phenolic compounds was equal or higher in samples dried in dry-air room than the yield from freeze-dried samples. In Picea abies needles, however, dry-air drying caused severe reductions in picein, stilbenes, condensed tannin and (+)-catechin concentrations compared to freeze-drying. In Pinus sylvestris highest yields of neolignans but lowest yields of acetylated flavonoids were obtained from samples freeze-dried after pre-freezing. Results show that dry-air drying provides effective pre-treatment method for quantifying the soluble phenolics for deciduous tree leaves, but when analysing coniferous species, the different responses between structural classes of phenolics should be taken into account. Copyright © 2018 John Wiley & Sons, Ltd.

  13. Expression of the grape VqSTS21 gene in Arabidopsis confers resistance to osmotic stress and biotrophic pathogens but not Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Li Huang

    2016-09-01

    Full Text Available Stilbene synthase (STS is a key gene in the biosynthesis of various stilbenoids, including resveratrol and its derivative glucosides (such as piceid, that has been shown to contribute to disease resistance in plants. However, the mechanism behind such a role has yet to be elucidated. Furthermore, the function of STS genes in osmotic stress tolerance remains unclear. As such, we sought to elucidate the role of STS genes in the defense against biotic and abiotic stress in the model plant Arabidopsis thaliana. Expression profiling of 31 VqSTS genes from Vitis quinquangularis revealed that VqSTS21 was up-regulated in response to powdery mildew (PM infection. To provide a deeper understanding of the function of this gene, we cloned the full-length coding sequence of VqSTS21 and overexpressed it in Arabidopsis thaliana via Agrobacterium-mediated transformation. The resulting VqSTS21 Arabidopsis lines produced trans-piceid rather than resveratrol as their main stilbenoid product and exhibited improved disease resistance to PM and Pseudomonas syringae pv. tomato DC3000, but displayed increased susceptibility to Botrytis cinerea. In addition, transgenic Arabidopsis lines were found to confer tolerance to salt and drought stress from seed germination through plant maturity. Intriguingly, qPCR assays of defense-related genes involved in salicylic acid, jasmonic acid, and abscisic acid-induced signaling pathways in these transgenic lines suggested that VqSTS21 plays a role in various phytohormone-related pathways, providing insight into the mechanism behind VqSTS21-mediated resistance to biotic and abiotic stress.

  14. Flavonoids from the leaves of Deguelia utilis (Leguminosae): structural elucidation and neuroprotective properties

    International Nuclear Information System (INIS)

    Oliveira, Dalglish G. de; Almeida, Cecilia M.C. de; Silva, Consuelo Y.Y. e; Arruda, Mara S.P.; Arruda, Alberto C.; Silva, Milton N. da; Lopes, Dielly C.F.; Yamada, Elizabeth S.; Costa, Edmar T. da; MFilho, Arnaldo Jorge

    2012-01-01

    Five new flavonoids, 5,3'-dihydroxy-4'-methoxy-2'',2''dimethylchromene-(5''6'':6,7)- dihydroflavonol (1), 5,3'-dihydroxy-7,4'-dimethoxy-6,8-dimethylallyl-dihydroflavonol (2), 5,3'-dihydroxy-4'-methoxy-8-allyl-2'',2''-dimethylchromene-(5'',6'':6,7) flavanone (3), 5,3'-dihydroxy-7,4'-dimethoxy-6,8-dimethylallyl-flavanone (4), 3,5,3'-trihydroxy-7,4'-dimethoxy- 6,8-dimethylallyl-flavanol (5), together with the stilbenes 4-methoxylonchocarpene (6) and lonchocarpene (7) were isolated from the leaves of Deguelia utilis. Their chemical structures were established on the basis of NMR (nuclear magnetic resonance) spectral data and HRESITOF-MS (electrospray ionization-high resolution time-of-flight mass spectrometry). Also, in order to investigate potential cytoprotective effects of these flavonoids, we used a fraction eluted with hexane:EtOAc containing all seven flavonoids, in an in vitro model of neurodegeneration, using hippocampal primary cultures from neonatal (PND2-P3) rats exposed to rotenone, a mitochondrial complex I inhibitor. There was a significant reduction in cell viability (19.4 ± 1.6%) when the cultures were exposed to 30 nmol L -1 rotenone for 72 h. Concomitant exposure of the cultures to the FR3 (5 μg mL -1 ) and 30 nmol L -1 rotenone resulted in values of cell viability similar to control groups (99.6 ± 4.8%), strongly suggesting a cytoprotective effect for this flavonoid-rich fraction. (author)

  15. Using liposomes as carriers for polyphenolic compounds: the case of trans-resveratrol.

    Directory of Open Access Journals (Sweden)

    Claudia Bonechi

    Full Text Available Resveratrol (3,5,4'-trihydroxy-trans-stilbene is a polyphenol found in various plants, especially in the skin of red grapes. The effect of resveratrol on human health is the topic of numerous studies. In fact this molecule has shown anti-cancer, anti-inflammatory, blood-sugar-lowering ability and beneficial cardiovascular effects. However, for many polyphenol compounds of natural origin bioavailability is limited by low solubility in biological fluids, as well as by rapid metabolization in vivo. Therefore, appropriate carriers are required to obtain efficient therapeutics along with low administration doses.Liposomes are excellent candidates for drug delivery purposes, due to their biocompatibility, wide choice of physico-chemical properties and easy preparation.In this paper liposome formulations made by a saturated phosphatidyl-choline (DPPC and cholesterol (or its positively charged derivative DC-CHOL were chosen to optimize the loading of a rigid hydrophobic molecule such as resveratrol.Plain and resveratrol loaded liposomes were characterized for size, surface charge and structural details by complementary techniques, i.e. Dynamic Light Scattering (DLS, Zeta potential and Small Angle X-ray Scattering (SAXS. Nuclear and Electron Spin magnetic resonances (NMR and ESR, respectively were also used to gain information at the molecular scale.The obtained results allowed to give an account of loaded liposomes in which resveratrol interacted with the bilayer, being more deeply inserted in cationic liposomes than in zwitterionic liposomes. Relevant properties such as the mean size and the presence of oligolamellar structures were influenced by the loading of RESV guest molecules.The toxicity of all these systems was tested on stabilized cell lines (mouse fibroblast NIH-3T3 and human astrocytes U373-MG, showing that cell viability was not affected by the administration of liposomial resveratrol.

  16. Catalytic asymmetric dihydroxylation of olefins with reusable OsO(4)(2-) on ion-exchangers: the scope and reactivity using various cooxidants.

    Science.gov (United States)

    Choudary, Boyapati M; Chowdari, Naidu S; Jyothi, Karangula; Kantam, Mannepalli L

    2002-05-15

    Exchanger-OsO(4) catalysts are prepared by an ion-exchange technique using layered double hydroxides and quaternary ammonium salts covalently bound to resin and silica as ion-exchangers. The ion-exchangers with different characteristics and opposite ion selectivities are specially chosen to produce the best heterogeneous catalyst that can operate using the various cooxidants in the asymmetric dihydroxylation reaction. LDH-OsO(4) catalysts composed of different compositions are evaluated for the asymmetric dihydroxylation of trans-stilbene. Resin-OsO(4) and SiO(2)-OsO(4) designed to overcome the problems associated with LDH-OsO(4) indeed show consistent activity and enantioselectivity in asymmetric dihydroxylation of olefins using K(3)Fe(CN)(6) and molecular oxygen as cooxidants. Compared to the Kobayashi heterogeneous systems, resin-OsO(4) is a very efficient catalyst for the dihydroxylation of a wide variety of aromatic, aliphatic, acyclic, cyclic, mono-, di-, and trisubstituted olefins to afford chiral vicinal diols with high yields and enantioselectivities irrespective of the cooxidant used. Resin-OsO(4) is recovered quantitatively by a simple filtration and reused for a number of cycles with consistent activity. The high binding ability of the heterogeneous osmium catalyst enables the use of an equimolar ratio of ligand to osmium to give excellent enantioselectives in asymmetric dihydroxylation in contrast to the homogeneous osmium system in which excess molar quantities of the expensive chiral ligand to osmium are invariably used. The complexation of the chiral ligand (DHQD)(2)PHAL, having very large dimension, a prerequisite to obtain higher ee, is possible only with the OsO(4)(2-) located on the surface of the supports.

  17. The Down regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein.

    Science.gov (United States)

    Silberg, D G; Wang, W; Moseley, R H; Traber, P G

    1995-05-19

    A gene has been described, Down Regulated in Adenoma (dra), which is expressed in normal colon but is absent in the majority of colon adenomas and adenocarcinomas. However, the function of this protein is unknown. Because of sequence similarity to a recently cloned membrane sulfate transporter in rat liver, the transport function of Dra was examined. We established that dra encodes for a Na(+)-independent transporter for both sulfate and oxalate using microinjected Xenopus oocytes as an assay system. Sulfate transport was sensitive to the anion exchange inhibitor DIDS (4,4'-diisothiocyano-2,2' disulfonic acid stilbene). Using an RNase protection assay, we found that dra mRNA expression is limited to the small intestine and colon in mouse, therefore identifying Dra as an intestine-specific sulfate transporter. dra also had a unique pattern of expression during intestinal development. Northern blot analysis revealed a low level of expression in colon at birth with a marked increase in the first 2 postnatal weeks. In contrast, there was a lower, constant level of expression in small intestine in the postnatal period. Caco-2 cells, a colon carcinoma cell line that differentiates over time in culture, demonstrated a marked induction of dra mRNA as cells progressed from the preconfluent (undifferentiated) to the postconfluent (differentiated) state. These results show that Dra is an intestine-specific Na(+)-independent sulfate transporter that has differential expression during colonic development. This functional characterization provides the foundation for investigation of the role of Dra in intestinal sulfate transport and in the malignant phenotype.

  18. Proton accumulation and ATPase activity in Golgi apparatus-enriched vesicles from rat liver

    International Nuclear Information System (INIS)

    Yeh, H.I.; van Rossum, G.D.

    1991-01-01

    We have studied the mechanism by which liver Golgi apparatus maintains the acidity of its contents, using a subcellular fraction from rat liver highly enriched in Golgi marker enzymes. Proton accumulation (measured by quenching of acridine-orange fluorescence) and anion-dependent ATPase were characterized and compared. Maximal ATPase and proton accumulation required ATP; GTP and other nucleotides gave 10% to 30% of maximal activity. Among anions, Cl- and Br- approximately doubled the activities; others were much less effective. Half-maximal increase of ATPase and H+ uptake required 55 mmol/L and 27 mmol/L Cl-, respectively. In predominantly chloride media, SCN- and NO3- markedly inhibited H+ uptake. Nitrate competitively inhibited both the chloride-dependent ATPase (apparent Ki 6 mmol/L) and proton uptake (apparent Ki 2 mmol/L). Nitrate and SCN- also inhibited uptake of 36Cl. Replacing K+ with Na+ had no effect on the initial rate of proton uptake but somewhat reduced the steady state attained. Replacement of K+ with NH4+ and choline reduced proton uptake without affecting ATPase. The ATPase and H+ uptake were supported equally well by Mg2+ or Mn2+. The ATPase was competitively inhibited by 4-acetamido-4'-isothiocyano-stilbene-2,2'-disulfonic acid (apparent Ki 39 mumol/L). Other agents inhibiting both H+ uptake and ATPase were N-ethylmaleimide, N,N'-dicyclohexylcarbodiimide, chlorpromazine, diethylstilbestrol, Zn2+, Co2+ and Cu2+. In the Cl- medium, accumulated protons were released by ionophores at the relative rates, monensin = nigericin greater than valinomycin greater than carbonyl cyanide mchlorophenylhydrazone; the last of these also reduced ATPase activity. In the absence of Cl-, monensin and valinomycin both stimulated the ATPase. These results show a close association between ATPase activity and acidification of liver Golgi vesicles

  19. ABH antigens as recognition sites for the activation of red blood cell anion exchange by the lectin ulex europaeus agglutinin I.

    Science.gov (United States)

    Engelmann, B

    1993-11-01

    The blood group antigen H (blood group O) and fucose-specific lectin Ulex europaeus agglutinin I (UEA1) (10 micrograms/ml) was found to increase the rate constant of Cl- efflux into 100 mM Na+ oxalate media by about 40% in erythrocytes taken from antigen H donors. In 100 mM K+ oxalate, 150 mM Na+ pyruvate and in 150 mM Na+ acetate media the lectin elevated the rate constant of Cl- efflux by 20-50%. The acceleration of Cl- efflux by UEA1 was completely blocked by 10 microM 4,4'-diisothiocyanato-stilbene-2,2'-disulfonic acid (DIDS) indicating that the effect of the lectin is mediated by the anion exchanger of human erythrocytes (band 3 protein). In antigen A1 erythrocytes no significant stimulation of anion exchange by UEA1 was seen. The activation of Cl- efflux was completely prevented by addition of 1 mM fucose to the medium. These results suggest that the effect of UEA1 is mediated through interaction with the fucose residues of H antigens. Increasing extracellular Ca++ from 0.5 to 5 mM in Na+ pyruvate or Na+ acetate media slightly reduced the acceleration of anion exchange by the lectin. On the other hand, replacing part of extracellular chloride by bicarbonate did not considerably alter the (previously reported) stimulatory effect of UEA1 on red blood cell Ca++ uptake. This suggests that the acceleration of anion exchange and of Ca++ uptake by UEA1, respectively, are mediated by different mechanisms. It is concluded that UEA1 activates anion exchange of human erythrocytes most probably by a direct interaction with H antigens present on extracellular domains of the band 3 protein.

  20. Simultaneous determination of phenolic compounds in Cynthiana grape (Vitis aestivalis) by high performance liquid chromatography-electrospray ionisation-mass spectrometry.

    Science.gov (United States)

    Ramirez-Lopez, L M; McGlynn, W; Goad, C L; Mireles Dewitt, C A

    2014-04-15

    Phenolic acids, flavanols, flavonols and stilbenes (PAFFS) were isolated from whole grapes, juice, or pomace and purified using enzymatic hydrolysis. Only anthocyanin mono-glucosides and a few of the oligomers from Cynthiana grape (Vitis aestivalis) were analysed. Flavonoid-anthocyanin mono-glucosides (FA) were isolated using methanol/0.1% hydrochloric acid extraction. In addition, crude extractions of phenolic compounds from Cynthiana grape using 50% methanol, 70% methanol, 50% acetone, 0.01% pectinase, or petroleum ether were also evaluated. Reverse phase high performance liquid chromatography (RP-HPLC) with photodiode array (PDA) detector was used to identify phenolic compounds. A method was developed for simultaneous separation, identification and quantification of both PAFFS and FA. Quantification was performed by the internal standard method using a five points regression graph of the UV-visible absorption data collected at the wavelength of maximum absorbance for each analyte. From whole grape samples nine phenolic compounds were tentatively identified and quantified. The individual phenolic compounds content varied from 3 to 875 mg kg⁻¹ dry weight. For juice, twelve phenolic compounds were identified and quantified. The content varied from 0.07 to 910 mg kg⁻¹ dry weight. For pomace, a total of fifteen phenolic compounds were tentatively identified and quantified. The content varied from 2 mg kg⁻¹ to 198 mg kg⁻¹ dry matter. Results from HPLC analysis of the samples showed that gallic acid and (+)-catechin hydrate were the major phenolic compounds in both whole grapes and pomace. Cyanidin and petunidin 3-O-glucoside were the major anthocyanin glucosides in the juice. Published by Elsevier Ltd.

  1. Resveratrols in grape berry skins and leaves in vitis germplasm.

    Science.gov (United States)

    Wang, Lijun; Xu, Man; Liu, Chunyan; Wang, Junfang; Xi, Huifen; Wu, Benhong; Loescher, Wayne; Duan, Wei; Fan, Peige; Li, Shaohua

    2013-01-01

    Resveratrol is an important stilbene that benefits human health. However, it is only distributed in a few species including grape and is very expensive. At present, grape has been an important source resveratrol. However, the details are scarce on resveratrol distribution in different Vitis species or cultivars. The composition and content of resveratrols were investigated by HPLC for assessing genotypic variation in berry skins and leaves of 75 grape cultivars, belonging to 3 species and 7 interspecific hybrids. Trans-resveratrol, cis-piceid and trans-piceid were detected in berry skins and leaves, but cis-resveratrol was not. Resveratrol content largely varied with genetic background as well as usage. In most cultivars, total resveratrol including the above three compounds was higher in berry skins than leaves. In berry skins of most cultivars and leaves of almost all cultivars, cis-piceid was the most abundant resveratrol; trans-resveratrol and trans-piceid were minor components. Some specific cultivars were found with extremely high levels of trans-resveratrol, cis- piceid, trans-piceid or total resveratrols in berry skins or leaves. In skins and leaves, rootstock cultivars had a higher content of total resveratrols, and the cultivated European type cultivars and their hybrids with V. labrusca had relatively low totals. There were no significant correlations of the amounts of total resveratrols or any individual resveratrol between berry skins and leaves. All 75 cultivars can be divided into four groups based on the composition of resveratrols and their concentration by principal component analysis. Resveratrol content of grape berries and leaves varied largely with their genetic background and usage. Rootstock cultivars had a higher content of total resveratrols than the other germplasm. Total resveratrols were lower in leaves than berry skins in most cultivars. Cis-piceid was the most abundant resveratrol in most cultivars, and trans-res and trans-pd were

  2. Voltage-Gated Potassium Channels Kv1.3--Potentially New Molecular Target in Cancer Diagnostics and Therapy.

    Science.gov (United States)

    Teisseyre, Andrzej; Gąsiorowska, Justyna; Michalak, Krystyna

    2015-01-01

    Voltage-gated potassium channels, Kv1.3, which were discovered in 1984, are integral membrane proteins which are activated ("open") upon change of the cell membrane potential, enabling a passive flux of potassium ions across the cell membrane. The channels are expressed in many different tissues, both normal and cancer. Since 2005 it has been known that the channels are expressed not only in the plasma membrane, but also in the inner mitochondrial membrane. The activity of Kv1.3 channels plays an important role, among others, in setting the cell resting membrane potential, cell proliferation, apoptosis and volume regulation. For some years, these channels have been considered a potentially new molecular target in both the diagnostics and therapy of some cancer diseases. This review article focuses on: 1) changes of expression of the channels in cancer disorders with special regard to correlations between the channels' expression and stage of the disease, 2) influence of inhibitors of Kv1.3 channels on proliferation and apoptosis of cancer cells, 3) possible future applications of Kv1.3 channels' inhibitors in therapy of some cancer diseases. In the last section, the results of studies performed in our Laboratory of Bioelectricity on the influence of selected biologically active plant-derived compounds from the groups of flavonoids and stilbenes and their natural and synthetic derivatives on the activity of Kv1.3 channels in normal and cancer cells are reviewed. A possible application of some compounds from these groups to support therapy of cancer diseases, such as breast, colon and lymph node cancer, and melanoma or chronic lymphocytic leukemia (B-CLL), is announced.

  3. Antibacterial screening of Rumex species native to the Carpathian Basin and bioactivity-guided isolation of compounds from Rumex aquaticus.

    Science.gov (United States)

    Orbán-Gyapai, Orsolya; Liktor-Busa, Erika; Kúsz, Norbert; Stefkó, Dóra; Urbán, Edit; Hohmann, Judit; Vasas, Andrea

    2017-04-01

    Plants belonging to the genus Rumex (family Polygonaceae) are used worldwide in traditional medicine for the treatment of various diseases caused by different microorganisms (e.g. bacteria-related dermatologic conditions, dysentery and enteritis). The present study focused on the antibacterial screening of Rumex species native to the Carpathian Basin, and isolation of compounds from one of the most efficient species, Rumex aquaticus. The antibacterial effects of n-hexane, chloroform and aqueous fractions of methanol extracts prepared from different parts of 14 Rumex species (R. acetosella, R. acetosa, R. alpinus, R. aquaticus, R. conglomeratus, R. crispus, R. hydrolapathum, R. obtusifolius subsp. obtusifolius, R. obtusifolius subsp. subalpinus, R. patientia, R. pulcher, R. scutatus, R. stenophyllus and R. thyrsiflorus) were investigated against Staphylococcus epidermidis, S. aureus, MRSA, Bacillus subtilis, Moraxella catarrhalis, Streptococcus pyogenes, S. pneumoniae, S. agalactiae, Pseudomonas aeruginosa, Escherichia coli and Klebsiella pneumoniae using the disc diffusion method. Mainly the n-hexane and chloroform extracts prepared from the roots of the plants displayed high antibacterial activity (inhibition zones>15mm) against one or more bacterial strains. The highly active extracts of the aerial part and root of R. aquaticus were subjected to a multistep separation procedure. 19 Compounds, among them naphthalenes (musizin, and its glucoside, torachrysone-glucoside, 2-methoxystypandrone), anthraquinones (emodin, chrysophanol, physcion, citreorosein, chrysophanol-8-O-glucoside), flavonoids (quercetin, quercetin-3,3'-dimethylether, isokaempferide, quercetin 3-O-arabinoside, quercetin 3-O-galactoside, catechin), stilbenes (resveratrol, piceid), and 1-stearoylglycerol were isolated from the plant. The antibacterial activities of isolated compounds were determined, and it was observed that especially naphthalenes exerted remarkable antibacterial effects against

  4. Characterization of GABA/sub A/ receptor-mediated 36chloride uptake in rat brain synaptoneurosomes

    International Nuclear Information System (INIS)

    Luu, M.D.; Morrow, A.L.; Paul, S.M.; Schwartz, R.D.

    1987-01-01

    γ-Aminobutyric acid (GABA) receptor-mediated 36 chloride ( 36 Cl - ) uptake was measured in synaptoneurosomes from rat brain. GABA and GABA agonists stimulated 36 Cl - uptake in a concentration-dependent manner with the following order of potency: Muscimol>GABA>piperidine-4-sulfonic acid (P4S)>4,5,6,7-tetrahydroisoxazolo-[5,4-c]pyridin-3-ol (THIP)=3-aminopropanesulfonic acid (3APS)>>taurine. Both P4S and 3APS behaved as partial agonists, while the GABA/sub B/ agonist, baclofen, was ineffective. The response to muscimol was inhibited by bicuculline and picrotoxin in a mixed competitive/non-competitive manner. Other inhibitors of GABA receptor-opened channels or non-neuronal anion channels such as penicillin, picrate, furosemide and disulfonic acid stilbenes also inhibited the response to muscimol. A regional variation in muscimol-stimulated 36 Cl - uptake was observed; the largest responses were observed in the cerebral cortex, cerebellum and hippocampus, moderate responses were obtained in the striatum and hypothalamus and the smallest response was observed in the pons-medulla. GABA receptor-mediated 36 Cl - uptake was also dependent on the anion present in the media. The muscinol response varied in media containing the following anions: Br - >Cl - ≥NO 3 - >I - ≥SCN - >>C 3 H 5 OO - ≥ClO 4 - >F - , consistent with the relative anion permeability through GABA receptor-gated anion channels and the enhancement of convulsant binding to the GABA receptor-gated Cl - channel. 43 references, 4 figures, 3 tables

  5. Flavonoids from the leaves of Deguelia utilis (Leguminosae): structural elucidation and neuroprotective properties

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, Dalglish G. de; Almeida, Cecilia M.C. de; Silva, Consuelo Y.Y. e; Arruda, Mara S.P.; Arruda, Alberto C.; Silva, Milton N. da, E-mail: yumilton@yahoo.com.br [Laboratorio de Cromatografia Liquida, Universidade Federal do Para, Guama, Belem-PA (Brazil); Lopes, Dielly C.F.; Yamada, Elizabeth S.; Costa, Edmar T. da; MFilho, Arnaldo Jorge [Laboratorio de Neuropatologia Experimental, Hospital Universitario Barros Barreto, Guama, Belem-PA (Brazil)

    2012-11-15

    Five new flavonoids, 5,3'-dihydroxy-4'-methoxy-2'',2''dimethylchromene-(5''6'':6,7)- dihydroflavonol (1), 5,3'-dihydroxy-7,4'-dimethoxy-6,8-dimethylallyl-dihydroflavonol (2), 5,3'-dihydroxy-4'-methoxy-8-allyl-2'',2''-dimethylchromene-(5'',6'':6,7) flavanone (3), 5,3'-dihydroxy-7,4'-dimethoxy-6,8-dimethylallyl-flavanone (4), 3,5,3'-trihydroxy-7,4'-dimethoxy- 6,8-dimethylallyl-flavanol (5), together with the stilbenes 4-methoxylonchocarpene (6) and lonchocarpene (7) were isolated from the leaves of Deguelia utilis. Their chemical structures were established on the basis of NMR (nuclear magnetic resonance) spectral data and HRESITOF-MS (electrospray ionization-high resolution time-of-flight mass spectrometry). Also, in order to investigate potential cytoprotective effects of these flavonoids, we used a fraction eluted with hexane:EtOAc containing all seven flavonoids, in an in vitro model of neurodegeneration, using hippocampal primary cultures from neonatal (PND2-P3) rats exposed to rotenone, a mitochondrial complex I inhibitor. There was a significant reduction in cell viability (19.4 {+-} 1.6%) when the cultures were exposed to 30 nmol L{sup -1}rotenone for 72 h. Concomitant exposure of the cultures to the FR3 (5 {mu}g mL{sup -1}) and 30 nmol L{sup -1} rotenone resulted in values of cell viability similar to control groups (99.6 {+-} 4.8%), strongly suggesting a cytoprotective effect for this flavonoid-rich fraction. (author)

  6. Flavonoids from the leaves of Deguelia utilis (Leguminosae): structural elucidation and neuroprotective properties

    Energy Technology Data Exchange (ETDEWEB)

    Oliveira, Dalglish G. de; Almeida, Cecilia M.C. de; Silva, Consuelo Y.Y. e; Arruda, Mara S.P.; Arruda, Alberto C., E-mail: yumilton@yahoo.com.br [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Lab. de Cromatografia Liquida; Lopes, Dielly C.F.; Yamada, Elizabeth S.; Costa, Edmar T. da; Silva, Milton N. da [Hospital Universitario Barros Barreto, Belem, PA (Brazil). Lab. de Neuropatologia Experimental

    2012-10-15

    Five new flavonoids, 5,3'-dihydroxy-4'-methoxy-2{sup ,}2{sup -}dimethylchromene-(5''6''6,7)- dihydroflavonol (1), 5,3'-dihydroxy-7,4'-dimethoxy-6,8-dimethylallyl-dihydroflavonol (2), 5,3'-dihydroxy-4'-methoxy-8-allyl-2'', 2''-dimethylchromene-(5{sup ,}6{sup :}6,7) flavanone (3), 5,3'-dihydroxy-7,4'-dimethoxy-6,8-dimethylallyl-flavanone (4), 3,5,3'-trihydroxy-7,4'-dimethoxy- 6,8-dimethylallyl-flavanol (5), together with the stilbenes 4-methoxylonchocarpene (6) and lonchocarpene (7) were isolated from the leaves of Deguelia utilis. Their chemical structures were established on the basis of NMR (nuclear magnetic resonance) spectral data and HRESITOF-MS (electrospray ionization-high resolution time-of-flight mass spectrometry). Also, in order to investigate potential cytoprotective effects of these flavonoids, we used a fraction eluted with hexane:EtOAc containing all seven flavonoids, in an in vitro model of neurodegeneration, using hippocampal primary cultures from neonatal (PND2-P3) rats exposed to rotenone, a mitochondrial complex I inhibitor. There was a significant reduction in cell viability (19.4 {+-} 1.6%) when the cultures were exposed to 30 nmol L{sup -1} rotenone for 72 h. Concomitant exposure of the cultures to the FR3 (5 {mu}g mL{sup -1}) and 30 nmol L{sup -1} rotenone resulted in values of cell viability similar to control groups (99.6 {+-} 4.8%), strongly suggesting a cytoprotective effect for this flavonoid-rich fraction. (author)

  7. The synthesis and study of new electroluminescent materials

    International Nuclear Information System (INIS)

    Pillow, J.

    1998-01-01

    Dendrimers offer many potential advantages over other organic electroluminescent materials that have been developed for use in light emitting diodes. This thesis describes the preparation of new electroluminescent dendrimers that consist of a luminescent core, charge-transporting stilbene dendrons and solubilising t-butyl surface groups. Choosing the core to have a longer conjugation length than the dendrons establishes an energy gradient that ensures that light emission occurs from the dendrimer core. Two convergent syntheses were developed for the preparation of dendrons that had aldehyde, bromide and styryl focal groups. The Heck reaction between styrene focused dendrons and 3,5-dibromoaryls was used to increase the dendron generation. This reaction was then alternated with the Wittig or Stille reactions in an iterative cycle to prepare dendrons of up to the third generation. The luminescent cores were chosen to be 1,4-distyrylbenzene, 1,4-distyrylanthracene and meso-tetraaryl porphyrin to emit blue, green and red light respectively. Dendrimers up to the third generation were prepared containing these cores. Further control over the emission colour was demonstrated by the chelation of metals into the porphyrin core. Computer modelling was used to predict the conformations of the dendrimers, with confirmation provided by GPC and X-ray crystallography. The modelled structures were then used to interpret the photoluminescence and electroluminescence spectra. Electrochemical analyses allowed the comparison of the HOMO and LUMO energy levels with the Fermi levels of the metal electrodes, which was used to explain the behaviour of the dendrimers in single layer light-emitting diodes. (author)

  8. Pentiptycene-derived light-driven molecular brakes: substituent effects of the brake component.

    Science.gov (United States)

    Sun, Wei-Ting; Huang, Yau-Ting; Huang, Guan-Jhih; Lu, Hsiu-Feng; Chao, Ito; Huang, Shou-Ling; Huang, Shing-Jong; Lin, Ying-Chih; Ho, Jinn-Hsuan; Yang, Jye-Shane

    2010-10-11

    Five pentiptycene-derived stilbene systems (1 R; R = H, OM, NO, Pr, and Bu) have been prepared and investigated as light-driven molecular brakes that have different-sized brake components (1 Hbrake component in the trans form ((E)-1 R), which corresponds to the brake-off state. When the brake is turned on by photoisomerization to the cis form ((Z)-1 R), the pentiptycene rotation can be arrested on the NMR spectroscopic timescale at temperatures that depend on the brake component. In the cases of (Z)-1 NO, (Z)-1 Pr, and (Z)-1 Bu, the rotation is nearly blocked (k(rot)=2-6 s(-1)) at 298 K. It is also demonstrated that the rotation is slower in [D(6)]DMSO than in CD(2)Cl(2). A linear relationship between the free energies of the rotational barrier and the steric parameter A values is present only for (Z)-1 H, (Z)-1 OM, and (Z)-1 NO, and it levels off on going from (Z)-1 NO to (Z)-1 Pr and (Z)-1 Bu. DFT calculations provide insights into the substituent effects in the rotational ground and transition states. The molar reversibility of the E-Z photoswitching is up to 46%, and both the E and Z isomers are stable under the irradiation conditions. Copyright © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Studying the shielding properties of lead glass composites using neutrons and gamma rays

    International Nuclear Information System (INIS)

    Osman, A.M.; El-Sarraf, M.A.; Abdel-Monem, A.M.; El-Sayed Abdo, A.

    2015-01-01

    Highlights: • Samples of sodalime silica glass loaded with different ratios of PbO were prepared. • Leaded glass composites were investigated for radiation shielding. • Experimental and theoretical attenuation parameters were studied. • Experimental and theoretical (MCNP5) results were in good agreement. - Abstract: The present work deals with the shielding properties of lead glass composites to find out its integrity for practical shielding applications and radiological safety. Composites of different lead oxide ratios (x = 0, 5, 10, 15 and 25 wt.%) have been prepared by the Nasser Glass and Crystal Company (Egypt). Attenuation measurements have been carried out using a collimated emitted beam from a fission 252 Cf (100 μg) neutron source, and the neutron–gamma spectrometer with stilbene scintillator. The pulse shape discriminating (P.S.D.) technique based on the zero cross-over method was used to discriminate between neutron and gamma-ray pulses. Thermal neutron fluxes were measured using the BF3 detector and thermal neutron detection system. The attenuation relations were used to evaluate fast neutron macroscopic effective removal cross-section Σ R-Meas (cm −1 ), gamma rays total attenuation coefficient μ (cm −1 ) and thermal neutron macroscopic cross-section Σ Meas (cm −1 ). Theoretical calculations have been achieved using MCNP5 code to calculate the same two parameters. Also, MERCSF-N program was used to calculate fast neutron macroscopic removal cross-section Σ R-MER (cm −1 ). Measured and MCNP5 calculated results have been compared and were found to be in reasonable agreement

  10. Oxyresveratrol ameliorates nonalcoholic fatty liver disease by regulating hepatic lipogenesis and fatty acid oxidation through liver kinase B1 and AMP-activated protein kinase.

    Science.gov (United States)

    Lee, Ju-Hee; Baek, Su Youn; Jang, Eun Jeong; Ku, Sae Kwang; Kim, Kyu Min; Ki, Sung Hwan; Kim, Chang-Eop; Park, Kwang Il; Kim, Sang Chan; Kim, Young Woo

    2018-06-01

    Oxyresveratrol (OXY) is a naturally occurring polyhydroxylated stilbene that is abundant in mulberry wood (Morus alba L.), which has frequently been supplied as a herbal medicine. It has been shown that OXY has regulatory effects on inflammation and oxidative stress, and may have potential in preventing or curing nonalcoholic fatty liver disease (NAFLD). This study examined the effects of OXY on in vitro model of NAFLD in hepatocyte by the liver X receptor α (LXRα)-mediated induction of lipogenic genes and in vivo model in mice along with its molecular mechanism. OXY inhibited the LXRα agonists-mediated sterol regulatory element binding protein-1c (SREBP-1c) induction and expression of the lipogenic genes and upregulated the mRNA of fatty acid β-oxidation-related genes in hepatocytes, which is more potent than genistein and daidzein. OXY also induced AMP-activated protein kinase (AMPK) activation in a time-dependent manner. Moreover, AMPK activation by the OXY treatment helped inhibit SREBP-1c using compound C as an AMPK antagonist. Oral administration of OXY decreased the Oil Red O stained-positive areas significantly, indicating lipid droplets and hepatic steatosis regions, as well as the serum parameters, such as fasting glucose, total cholesterol, and low density lipoprotein-cholesterol in high fat diet fed-mice, as similar with orally treatment of atorvastatin. Overall, this result suggests that OXY has the potency to inhibit hepatic lipogenesis through the AMPK/SREBP-1c pathway and can be used in the development of pharmaceuticals to prevent a fatty liver. Copyright © 2018. Published by Elsevier B.V.

  11. A single-cell technique for the measurement of membrane potential, membrane conductance, and the efflux of rapidly penetrating solutes in Amphiuma erythrocytes.

    Science.gov (United States)

    Stoner, L C; Kregenow, F M

    1980-10-01

    We describe a single-cell technique for measuring membrane potential, membrane resistance, and the efflux of rapidly penetrating solutes such as Cl and H2O. Erythrocytes from Amphiuma means were aspirated into a Sylgard (Dow Corning Corp.)-coated capillary. The aspirated cell separated a solution within the capillary from a solution in the bath. Each of these two solutions was contiguous with approximately 5% of the total membrane surface. Microelectrodes placed concentrically within the capillary permit the measurement of intracellular voltage, specific membrane resistance, and the electrical seal between the two solutions. The intracellular voltage averaged -17.7 mV (pH 7.6) and changed as either intra- or extracellular chloride was varied. The average specific membrane resistance measured by passing current across the exposed membrane surface was 110 ohm-cm2. 36Cl and tritiated H2O fluxes (0.84 +/- 0.05 x 10(-6) M . cm-2 . min-1 and 6.4 +/- 1.5 x 10(-3) M . cm-2 . min-1, respectively) were determined by noting the rate at which isotope leaves the cell and crosses the membrane exposed to the bath. Our measured values for the flux of 36Cl and tritiated H2O approximate reported values for free-floating cells. 36Cl efflux, in addition, is inhibited by 4-acetamido-4'-isothiocyano-stilbene 2,2'-disulfonic acid (SITS) and furosemide, known inhibitors of the anion exchange mechanism responsible for the rapid anion fluxes of red blood cells. One can also demonstrate directly that > 89% of 36Cl efflux is "electrically silent" by analyzing the flux in the presence of an imposed transcellular voltage.

  12. Removal of distal protein-water hydrogen bonds in a plant epoxide hydrolase increases catalytic turnover but decreases thermostability.

    Science.gov (United States)

    Thomaeus, Ann; Naworyta, Agata; Mowbray, Sherry L; Widersten, Mikael

    2008-07-01

    A putative proton wire in potato soluble epoxide hydrolase 1, StEH1, was identified and investigated by means of site-directed mutagenesis, steady-state kinetic measurements, temperature inactivation studies, and X-ray crystallography. The chain of hydrogen bonds includes five water molecules coordinated through backbone carbonyl oxygens of Pro(186), Leu(266), His(269), and the His(153) imidazole. The hydroxyl of Tyr(149) is also an integrated component of the chain, which leads to the hydroxyl of Tyr(154). Available data suggest that Tyr(154) functions as a final proton donor to the anionic alkylenzyme intermediate formed during catalysis. To investigate the role of the putative proton wire, mutants Y149F, H153F, and Y149F/H153F were constructed and purified. The structure of the Y149F mutant was solved by molecular replacement and refined to 2.0 A resolution. Comparison with the structure of wild-type StEH1 revealed only subtle structural differences. The hydroxyl group lost as a result of the mutation was replaced by a water molecule, thus maintaining a functioning hydrogen bond network in the proton wire. All mutants showed decreased catalytic efficiencies with the R,R-enantiomer of trans-stilbene oxide, whereas with the S,S-enantiomer, k (cat)/K (M) was similar or slightly increased compared with the wild-type reactions. k (cat) for the Y149F mutant with either TSO enantiomer was increased; thus the lowered enzyme efficiencies were due to increases in K (M). Thermal inactivation studies revealed that the mutated enzymes were more sensitive to elevated temperatures than the wild-type enzyme. Hence, structural alterations affecting the hydrogen bond chain caused increases in k (cat) but lowered thermostability.

  13. Neutron Measurements for Radiation Protection in Low Earth Orbit - History and Future

    Science.gov (United States)

    Golightly, M. J.; Se,pmes. E/

    2003-01-01

    The neutron environment inside spacecraft has been of interest from a scientific and radiation protection perspective since early in the history of manned spaceflight. With 1:.1e exception of a few missions which carried plutonium-fueled radioisotope thermoelectric generators, all of the neutrons inside the spacecraft are secondary radiations resulting from interactions of high-energy charged particles with nuclei in the Earth's atmosphere, spacecraft structural materials, and the astronaut's own bodies. Although of great interest, definitive measurements of the spacecraft neutron field have been difficult due to the wide particle energy range and the limited available volume and power for traditional techniques involving Bonner spheres. A multitude of measurements, however, have been made of the neutron environment inside spacecraft. The majority of measurements were made using passive techniques including metal activation fo ils, fission foils, nuclear photoemulsions, plastic track detectors, and thermoluminescent detectors. Active measurements have utilized proton recoil spectrometers (stilbene), Bonner Spheres eRe proportional counter based), and LiI(Eu)phoswich scintillation detectors. For the International Space Station (ISS), only the plastic track! thermoluminescent detectors are used with any regularity. A monitoring program utilizing a set of active Bonner spheres was carried out in the ISS Lab module from March - December 200l. These measurements provide a very limited look at the crew neutron exposure, both in time coverage and neutron energy coverage. A review of the currently published data from past flights will be made and compared with the more recent results from the ISS. Future measurement efforts using currently available techniques and those in development will be also discussed.

  14. Cotransport of sodium and chloride by the adult mammalian choroid plexus

    Energy Technology Data Exchange (ETDEWEB)

    Johanson, C.E.; Sweeney, S.M.; Parmelee, J.T.; Epstein, M.H. (Brown Univ./Rhode Island Hospital, Providence (USA))

    1990-02-01

    Cerebrospinal fluid formation stems primarily from the transport of Na and Cl in choroid plexus (CP). To characterize properties and modulation of choroidal transporters, we tested diuretics and other agents for ability to alter ion transport in vitro. Adult Sprague-Dawley rats were the source of CPs preincubated with drug for 20 min and then transferred to cerebrospinal fluid (CSF) medium containing 22Na or 36Cl with (3H)mannitol (extracellular correction). Complete base-line curves were established for cellular uptake of Na and Cl at 37 degrees C. The half-maximal uptake occurred at 12 s, so it was used to assess drug effects on rate of transport (nmol Na or Cl/mg CP). Bumetanide (10(-5) and 10(-4) M) decreased uptake of Na and Cl with maximal inhibition (up to 45%) at 10(-5) M. Another cotransport inhibitor, furosemide (10(-4) M), reduced transport of Na by 25% and Cl by 33%. However, acetazolamide (10(-4) M) and atriopeptin III (10(-7) M) significantly lowered uptake of Na (but not Cl), suggesting effect(s) other than on cotransport. The disulfonic stilbene 4,4'-diisothiocyanostilbene-2,2'-disulfonic acid (DIDS; 10(-4) M), known to inhibit Cl-HCO3 exchange, substantially reduced the transport of 36Cl. Bumetanide plus DIDS (both 10(-4) M) caused additive inhibition of 90% of Cl uptake, which provides strong evidence for the existence of both cotransport and antiport Cl carriers. Overall, this in vitro analysis, uncomplicated by variables of blood flow and neural tone, indicates the presence in rat CP of the cotransport of Na and Cl in addition to the established Na-H and Cl-HCO3 exchangers.

  15. Comprehensive Quantitative Analysis of 32 Chemical Ingredients of a Chinese Patented Drug Sanhuang Tablet.

    Science.gov (United States)

    Fung, Hau-Yee; Lang, Yan; Ho, Hing-Man; Wong, Tin-Long; Ma, Dik-Lung; Leung, Chung-Hang; Han, Quan-Bin

    2017-01-12

    Sanhuang Tablet (SHT) is a Chinese patented drug commonly used for the treatment of inflammations of the respiratory tract, gastrointestinal tract, and skin. It contains a special medicinal composition including the single compound berberine hydrochloride, extracts of Scutellariae Radix and Rhei Radix et Rhizoma, as well as the powder of Rhei Radix et Rhizoma. Despite advances in analytical techniques, quantitative evaluation of a Chinese patented drug like SHT remains a challenge due to the complexity of its chemical profile. In this study, ultra-high performance liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry (UHPLC-Q-TOF-MS) was used to simultaneously quantify 29 non-sugar small molecule components of SHT (11 flavonoids, two isoflavonoids, one flavanone, five anthraquinones, two dianthranones, five alkaloids, two organic acids and one stilbene). Three major saccharide components, namely fructose, glucose, and sucrose, were also quantitatively determined using high performance liquid chromatography-charged aerosol detector (HPLC-CAD) on an Asahipak NH₂P-50 4E amino column. The established methods were validated in terms of linearity, sensitivity, precision, accuracy, and stability, and then successfully applied to analyze 27 batches of commercial SHT products. A total of up to 57.61% ( w / w ) of SHT could be quantified, in which the contents of the determined non-saccharide small molecules varied from 5.91% to 16.83% ( w / w ) and three saccharides accounted for 4.41% to 48.05% ( w / w ). The results showed that the quality of the commercial products was inconsistent, and only four of those met Chinese Pharmacopoeia criteria.

  16. Comprehensive Quantitative Analysis of 32 Chemical Ingredients of a Chinese Patented Drug Sanhuang Tablet

    Directory of Open Access Journals (Sweden)

    Hau-Yee Fung

    2017-01-01

    Full Text Available Sanhuang Tablet (SHT is a Chinese patented drug commonly used for the treatment of inflammations of the respiratory tract, gastrointestinal tract, and skin. It contains a special medicinal composition including the single compound berberine hydrochloride, extracts of Scutellariae Radix and Rhei Radix et Rhizoma, as well as the powder of Rhei Radix et Rhizoma. Despite advances in analytical techniques, quantitative evaluation of a Chinese patented drug like SHT remains a challenge due to the complexity of its chemical profile. In this study, ultra-high performance liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry (UHPLC-Q-TOF-MS was used to simultaneously quantify 29 non-sugar small molecule components of SHT (11 flavonoids, two isoflavonoids, one flavanone, five anthraquinones, two dianthranones, five alkaloids, two organic acids and one stilbene. Three major saccharide components, namely fructose, glucose, and sucrose, were also quantitatively determined using high performance liquid chromatography-charged aerosol detector (HPLC-CAD on an Asahipak NH2P-50 4E amino column. The established methods were validated in terms of linearity, sensitivity, precision, accuracy, and stability, and then successfully applied to analyze 27 batches of commercial SHT products. A total of up to 57.61% (w/w of SHT could be quantified, in which the contents of the determined non-saccharide small molecules varied from 5.91% to 16.83% (w/w and three saccharides accounted for 4.41% to 48.05% (w/w. The results showed that the quality of the commercial products was inconsistent, and only four of those met Chinese Pharmacopoeia criteria.

  17. Benefits of Wine Polyphenols on Human Health: A Review

    Directory of Open Access Journals (Sweden)

    Roxana Banc

    2014-11-01

    Full Text Available This paper presents  an overview of the health benefits of wine polyphenols, induced by a moderate consumption. Several studies have shown that moderate wine intake may have many beneficial effects on human health and these effects are mainly attributed to the phenolic derivatives, especially flavonoids. Beside flavonoid compounds, phenolic acids (hydroxybenzoic acids and hydroxycinnamic acids and stilbenes are important non-flavonoid compounds present in grapes and wine. In the present review, the biological role of these classes of polyphenols in wine is briefly introduced, together with the knowledge on their bioavailability. The health-protective properties of wines are mainly due to antioxidant activities and capability to eliminate free radicals of the phenolic compounds. Additionally, these compounds (e.g. catechin and their oligomers and proanthocyanidins, quercetin, resveratrol have been reported to have multiple biological activities, including cardioprotective, anti-carcinogenic, anti-atherogenic, anti-inflammatory, antiviral and antibacterial properties. Epidemiological and clinical studies have pointed out that regular and moderate red wine consumption (one to two glasses a day is associated with decreased incidence of cardiovascular disease, hypertension, diabetes, and certain types of cancer, including lung, esophagus, stomach, colon, endometrium, ovarian and prostate cancer. The bioavailability of phenolic compounds differs largely among different polyphenol molecules, thus the most abundant polyphenols in wines are not necessarily those leading to the highest levels of active metabolites in target tissues. Therefore, since wine is a complex mixture, it is likely that a multitude of chemical constituents, as well as their metabolites, act synergistically on human health.

  18. Loss of Slc4a1b chloride/bicarbonate exchanger function protects mechanosensory hair cells from aminoglycoside damage in the zebrafish mutant persephone.

    Directory of Open Access Journals (Sweden)

    Dale W Hailey

    Full Text Available Mechanosensory hair cell death is a leading cause of hearing and balance disorders in the human population. Hair cells are remarkably sensitive to environmental insults such as excessive noise and exposure to some otherwise therapeutic drugs. However, individual responses to damaging agents can vary, in part due to genetic differences. We previously carried out a forward genetic screen using the zebrafish lateral line system to identify mutations that alter the response of larval hair cells to the antibiotic neomycin, one of a class of aminoglycoside compounds that cause hair cell death in humans. The persephone mutation confers resistance to aminoglycosides. 5 dpf homozygous persephone mutants are indistinguishable from wild-type siblings, but differ in their retention of lateral line hair cells upon exposure to neomycin. The mutation in persephone maps to the chloride/bicarbonate exchanger slc4a1b and introduces a single Ser-to-Phe substitution in zSlc4a1b. This mutation prevents delivery of the exchanger to the cell surface and abolishes the ability of the protein to import chloride across the plasma membrane. Loss of function of zSlc4a1b reduces hair cell death caused by exposure to the aminoglycosides neomycin, kanamycin, and gentamicin, and the chemotherapeutic drug cisplatin. Pharmacological block of anion transport with the disulfonic stilbene derivatives DIDS and SITS, or exposure to exogenous bicarbonate, also protects hair cells against damage. Both persephone mutant and DIDS-treated wild-type larvae show reduced uptake of labeled aminoglycosides. persephone mutants also show reduced FM1-43 uptake, indicating a potential impact on mechanotransduction-coupled activity in the mutant. We propose that tight regulation of the ionic environment of sensory hair cells, mediated by zSlc4a1b activity, is critical for their sensitivity to aminoglycoside antibiotics.

  19. Conditioned medium from LS 174T goblet cells treated with oxyresveratrol strengthens tight junctions in Caco-2 cells.

    Science.gov (United States)

    Hwang, Dahyun; Jo, HyunA; Hwang, Seonwook; Kim, Jeong-Keun; Kim, In-Ho; Lim, Young-Hee

    2017-01-01

    Strengthening of intestinal tight junctions provides an effective barrier from the external environment. Goblet cell-derived trefoil factor 3 (TFF3) increases transepithelial resistance by upregulating the expression of tight junction proteins. Oxyresveratrol (OXY) is a hydroxyl-substituted stilbene found in the roots, leaves, stems, and fruit of many plants and known to have various biological activities. In this study, we investigated the strengthening effect of OXY on intestinal tight junctions through stimulation of TFF production in goblet cells. We prepared conditioned medium from LS 174T goblet cells treated with OXY (GCO-CM) and investigated the effect of GCO-CM on strengthening tight junctions of Caco-2 cells. The mRNA and protein expression levels of major tight junction components (claudin-1, occludin, and ZO-1) were measured by quantitative real-time PCR and western blotting, respectively. Transepithelial electric resistance (TEER) was measured using an ohm/V meter. Monolayer permeability was evaluated by paracellular transport of fluorescein isothiocyanate-dextran. OXY showed a strong antioxidant activity. It significantly increased the expression level of TFF3 in LS 174T goblet cells. GCO-CM prepared by treatment with 2.5, 5, and 10μg/ml OXY did not show cytotoxicity in Caco-2 cells. GCO-CM increased the mRNA and protein expression levels of claudin-1, occludin, and ZO-1. It also significantly increased tight junction integrity and reduced permeability in a dose-dependent manner. OXY stimulates the expression of TFF3 in goblet cells, which might increase the integrity of the intestinal tight junction barrier. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  20. Comprehensive analysis of Polygoni Multiflori Radix of different geographical origins using ultra-high-performance liquid chromatography fingerprints and multivariate chemometric methods

    Directory of Open Access Journals (Sweden)

    Li-Li Sun

    2018-01-01

    Full Text Available Polygoni Multiflori Radix (PMR is increasingly being used not just as a traditional herbal medicine but also as a popular functional food. In this study, multivariate chemometric methods and mass spectrometry were combined to analyze the ultra-high-performance liquid chromatograph (UPLC fingerprints of PMR from six different geographical origins. A chemometric strategy based on multivariate curve resolution–alternating least squares (MCR–ALS and three classification methods is proposed to analyze the UPLC fingerprints obtained. Common chromatographic problems, including the background contribution, baseline contribution, and peak overlap, were handled by the established MCR–ALS model. A total of 22 components were resolved. Moreover, relative species concentrations were obtained from the MCR–ALS model, which was used for multivariate classification analysis. Principal component analysis (PCA and Ward's method have been applied to classify 72 PMR samples from six different geographical regions. The PCA score plot showed that the PMR samples fell into four clusters, which related to the geographical location and climate of the source areas. The results were then corroborated by Ward's method. In addition, according to the variance-weighted distance between cluster centers obtained from Ward's method, five components were identified as the most significant variables (chemical markers for cluster discrimination. A counter-propagation artificial neural network has been applied to confirm and predict the effects of chemical markers on different samples. Finally, the five chemical markers were identified by UPLC–quadrupole time-of-flight mass spectrometer. Components 3, 12, 16, 18, and 19 were identified as 2,3,5,4′-tetrahydroxy-stilbene-2-O-β-d-glucoside, emodin-8-O-β-d-glucopyranoside, emodin-8-O-(6′-O-acetyl-β-d-glucopyranoside, emodin, and physcion, respectively. In conclusion, the proposed method can be applied for the

  1. HYS-32, a novel analogue of combretastatin A-4, enhances connexin43 expression and gap junction intercellular communication in rat astrocytes.

    Science.gov (United States)

    Lin, Pei-Chun; Shen, Chien-Chang; Liao, Chih-Kai; Jow, Guey-Mei; Chiu, Chi-Ting; Chung, Tun-Hui; Wu, Jiahn-Chun

    2013-05-01

    HYS-32 [4-(3,4-dimethoxyphenyl)-3-(naphthalen-2-yl)-2(5H)-furanone] is a new analogue of the anti-tumor compound combretastatin A-4 containing a cis-stilbene moiety. In this study, we investigated its effects on Cx43 gap junction intercellular communication (GJIC) and the signaling pathway involved in rat primary astrocytes. Western blot analyses showed that HYS-32 dose- and time-dependently upregulated Cx43 expression. A confocal microscopic study and scrape-loading/dye transfer analyses demonstrated that HYS-32 (5μM) induced microtubule coiling, accumulation of Cx43 in gap junction plaques, and increased GJIC in astrocytes. The HYS-32-induced microtubule coiling and Cx43 accumulation in gap junction plaques was reversed when HYS-32 was removed. Treatment of astrocytes with cycloheximide resulted in time-dependent degradation of by co-treatment with HYS-32 by increasing the half-life of Cx43. Co-treatment with HYS-32 also prevented the LPS-induced downregulation of Cx43 and inhibition of GJIC in astrocytes. HYS-32 induced activation of PKC, ERK, and JNK, and co-treatment with the PKC inhibitor Go6976 or the ERK inhibitor PD98059, but not the JNK inhibitor SP600125, prevented the HYS-32-induced increase in Cx43 expression and GJIC. Go6976 suppressed the HYS-32-induced PKC phosphorylation and increase in phospho-ERK levels, while PD98059 did not prevent the HYS-32-induced increase in phospho-PKC levels, suggesting that PKC is an upstream effector of ERK. In conclusion, our results show that HYS-32 increases the half-life of Cx43 and enhances Cx43 expression and GJIC in astrocytes via a PKC-ERK signaling cascade. These novel biological effects of HYS-32 on astrocyte gap junctions support its potential for therapeutic use as a protective agent for the central nervous system. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Inhibition of STAT3 Expression and Signaling in Resveratrol-Differentiated Medulloblastoma Cells

    Directory of Open Access Journals (Sweden)

    Li-Jun Yu

    2008-07-01

    Full Text Available In this study, the potential influence of resveratrol (3,5,4′-trihydroxy-trans-stilbene in signal transducer and activator of transcription 3 (STAT3 signaling of medulloblastoma cells was evaluated by checking the status of STAT3 signaling and its downstream gene expression in two medulloblastoma cell lines (UW228-2 and UW228-3 with and without resveratrol treatment. The results revealed that resveratrol induced neuronal differentiation of medulloblastoma cells. Signal transducer and activator of transcription 3 expression and phosphorylation were detected in normally cultured UW228-2 and UW228-3 cells that were apparently attenuated after resveratrol treatment. The expression of STAT3 downstream genes, survivin, cyclin D1, Cox-2, and c-Myc, was suppressed but Bcl-2 was enhanced by resveratrol. Meanwhile, the production and secretion of leukemia inhibitory factor, a STAT3 activator, became active in resveratrol-treated cells. To further ascertain the significance of STAT3 signaling for medulloblastoma cells, AG490, a selective inhibitor of STAT3 phosphorylation, was used to treat UW228-3 cells. Phosphorylation of STAT3 was inhibited by AG490 accompanied with growth suppression, differentiation-like changes, and down-regulation of survivin, cyclin D1, Cox-2, and c-Myc. Our data thus suggest the importance of STAT3 signaling in maintenance and survival of medulloblastoma cells. This signaling may be the major target of resveratrol. Enhanced leukemia inhibitory factor and Bcl-2 expressions in resveratrol-treated cells might reflect a compensatory response to the loss of STAT3 function.

  3. Properties of high pressure nitrogen-argon and nitrogen-xenon gas scintillators

    International Nuclear Information System (INIS)

    Tornow, W.; Huck, H.; Koeber, H.J.; Mertens, G.

    1976-01-01

    Investigations of scintillation light output and energy resolution have been made at pressures up to 90 atm in gaseous mixtures of nitrogen with both argon and xenon by stopping of 210 Po-alpha particles. In the absence of a wavelength shifter, the N 2 -Ar mixtures gave a maximum pulse height at a ratio of nitrogen to argon partial pressures rsub(N 2 /Ar) approximately =0.2. However, when using the wavelength shifter diphenyl stilbene (DPS), the measured light output was much larger at lower values of rsub(N 2 /Ar), whereas for rsub(N 2 /Ar)>0.2 pulse height and energy resolution of the studied N 2 -Ar mixtures were roughly indentical with and without DPS. The N 2 -Xe gas mixtures exhibited a similar dependence of pulse height and energy resolution to that of the N 2 -Ar mixtures employing DPS, but the pulse height was larger by a factor of about 7. A 40 atm 50% N 2 -50% Xe gas scintillator showed an energy resolution ΔE/E=0.25, while an 80 atm 75% N 2 -25% Xe scintillator gave ΔE/E=0.6. The pulse height from the 80 atm N 2 -Xe scintillator was smaller by a factor of about 240 than the pulse height from a 20 atm pure Xe gas scintillator, but larger by a factor of about 20 than the pulse height from a 75 atm pure N 2 gas scintillator. The N 2 -Xe mixtures showed a remarkable increase of light output as the temperature of the gas was descreased. (Auth.)

  4. Effective atomic number, energy loss and radiation damage studies in some materials commonly used in nuclear applications for heavy charged particles such as H, C, Mg, Fe, Te, Pb and U

    Science.gov (United States)

    Kurudirek, Murat

    2016-05-01

    Commonly used nuclear physics materials such as water, concrete, Pb-glass, paraffin, freon and P 10 gases, some alloys such as brass, bronze, stainless-steel and some scintillators such as anthracene, stilbene and toluene have been investigated with respect to the heavy charged particle interaction as means of projected range and effective atomic number (Zeff) in the energy region 10 keV to 10 MeV. Calculations were performed for heavy ions such as H, C, Mg, Fe, Te, Pb and U. Also, the energy loss and radiation damage were studied using SRIM Monte Carlo code for anthracene for different heavy ions of 100 keV kinetic energy. It has been observed that the variation in Zeff becomes less when the atomic number of the ions increase. Glass-Pb, bronze, brass, stainless-steel and Freon gas were found to vary less than 10% in the energy region 10 keV to 10 MeV. For total proton interaction, discrepancies up to 10% and 18% between two databases namely PSTAR and SRIM were noted in mass stopping power and Zeff of water, respectively. The range calculations resulted with a conclusion that the metal alloys and glass-Pb have lowest values of ranges confirming best shielding against energetic heavy ions whereas freon and P 10 gases have the highest values of ranges in the entire energy region. The simulation results showed that the energy loss (%) to target electrons decreases as the Z of the incident ion increases. Also, it was observed that the radiation damage first increases with Z of the ion and then keeps almost constant for ions with Z≥52.

  5. Rheum australe D. Don: a review of its botany, ethnobotany, phytochemistry and pharmacology.

    Science.gov (United States)

    Rokaya, Maan Bahadur; Münzbergová, Zuzana; Timsina, Binu; Bhattarai, Krishna Ram

    2012-06-14

    Rheum australe D. Don (Polygonaceae) has been commonly used in traditional medicine for a wide range of ailments related to the circulatory, digestive, endocrine, respiratory and skeletal systems as well as to infectious diseases. To provide the up-to-date information that is available on the botany, traditional uses, phytochemistry, pharmacology and toxicology of Rheum australe. Additionally, to highlight the possible uses of this species to treat different diseases and to provide a basis for future research. The present review covers the literature available from 1980 to 2011. The information was collected from scientific journals, books, theses and reports via a library and electronic search (Google Scholar, Web of Science and ScienceDirect). Ethnomedical uses of Rheum australe have been recorded from China, India, Nepal and Pakistan for 57 different types of ailments. The phytochemical studies have shown the presence of many secondary metabolites belonging to anthraquinones, stilbenes, anthrones, oxantrone ethers and esters, chromones, flavonoids, carbohydrate, lignans, phenols and sterols. Crude extracts and isolated compounds from Rheum australe show a wide spectrum of pharmacological activities, such as antidiabetic, anti-inflammatory, antifungal, antimicrobial, antioxidant, anticancer, hepatoprotective and immune-enhancing activities, as well as a usefulness for improving renal function. Rheum australe has been widely used source of medicine for years without any adverse effects. Many studies have provided evidence for various traditional uses. However, there is a need for additional studies of the isolated compounds to validate the traditional uses in human models. The present review on the botany, traditional uses, phytochemistry and toxicity has provided preliminary information for further studies and commercial exploitations of the plant. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  6. Isorhapontigenin (ISO) Inhibits Invasive Bladder Cancer Formation In Vivo and Human Bladder Cancer Invasion In Vitro by Targeting STAT1/FOXO1 Axis.

    Science.gov (United States)

    Jiang, Guosong; Wu, Amy D; Huang, Chao; Gu, Jiayan; Zhang, Liping; Huang, Haishan; Liao, Xin; Li, Jingxia; Zhang, Dongyun; Zeng, Xingruo; Jin, Honglei; Huang, Haojie; Huang, Chuanshu

    2016-07-01

    Although our most recent studies have identified Isorhapontigenin (ISO), a novel derivative of stilbene that isolated from a Chinese herb Gnetum cleistostachyum, for its inhibition of human bladder cancer growth, nothing is known whether ISO possesses an inhibitory effect on bladder cancer invasion. Thus, we addressed this important question in current study and discovered that ISO treatment could inhibit mouse-invasive bladder cancer development following bladder carcinogen N-butyl-N-(4-hydroxybutyl) nitrosamine (BBN) exposure in vivo We also found that ISO suppressed human bladder cancer cell invasion accompanied by upregulation of the forkhead box class O 1 (FOXO1) mRNA transcription in vitro Accordingly, FOXO1 was profoundly downregulated in human bladder cancer tissues and was negatively correlated with bladder cancer invasion. Forced expression of FOXO1 specifically suppressed high-grade human bladder cancer cell invasion, whereas knockdown of FOXO1 promoted noninvasive bladder cancer cells becoming invasive bladder cancer cells. Moreover, knockout of FOXO1 significantly increased bladder cancer cell invasion and abolished the ISO inhibition of invasion in human bladder cancer cells. Further studies showed that the inhibition of Signal transducer and activator of transcription 1 (STAT1) phosphorylation at Tyr701 was crucial for ISO upregulation of FOXO1 transcription. Furthermore, this study revealed that metalloproteinase-2 (MMP-2) was a FOXO1 downstream effector, which was also supported by data obtained from mouse model of ISO inhibition BBN-induced mouse-invasive bladder cancer formation. These findings not only provide a novel insight into the understanding of mechanism of bladder cancer's propensity to invasion, but also identify a new role and mechanisms underlying the natural compound ISO that specifically suppresses such bladder cancer invasion through targeting the STAT1-FOXO1-MMP-2 axis. Cancer Prev Res; 9(7); 567-80. ©2016 AACR. ©2016 American

  7. Mechanisms of Photoaging and Cutaneous Photocarcinogenesis, and Photoprotective Strategies with Phytochemicals

    Directory of Open Access Journals (Sweden)

    Ricardo Bosch

    2015-03-01

    Full Text Available Photoaging and photocarcinogenesis are primarily due to solar ultraviolet (UV radiation, which alters DNA, cellular antioxidant balance, signal transduction pathways, immunology, and the extracellular matrix (ECM. The DNA alterations include UV radiation induced thymine-thymine dimers and loss of tumor suppressor gene p53. UV radiation reduces cellular antioxidant status by generating reactive oxygen species (ROS, and the resultant oxidative stress alters signal transduction pathways such as the mitogen-activated protein kinase (MAPK, the nuclear factor-kappa beta (NF-κB/p65, the janus kinase (JAK, signal transduction and activation of transcription (STAT and the nuclear factor erythroid 2-related factor 2 (Nrf2. UV radiation induces pro-inflammatory genes and causes immunosuppression by depleting the number and activity of the epidermal Langerhans cells. Further, UV radiation remodels the ECM by increasing matrixmetalloproteinases (MMP and reducing structural collagen and elastin. The photoprotective strategies to prevent/treat photoaging and photocarcinogenesis include oral or topical agents that act as sunscreens or counteract the effects of UV radiation on DNA, cellular antioxidant balance, signal transduction pathways, immunology and the ECM. Many of these agents are phytochemical derivatives and include polyphenols and non-polyphenols. The flavonoids are polyphenols and include catechins, isoflavones, proanthocyanidins, and anthocyanins, whereas the non-flavonoids comprise mono phenolic acids and stilbenes. The natural sources of polyphenols include tea, cocoa, grape/wine, soy, pomegranate, and Polypodium leucotomos. The non-phenolic phytochemicals include carotenoids, caffeine and sulphoraphance (SFN. In addition, there are other phytochemical derivatives or whole extracts such as baicalin, flavangenol, raspberry extract, and Photomorphe umbellata with photoprotective activity against UVB radiation, and thereby carcinogenesis.

  8. Improved method for lifetime measurements; Methode perfectionnee de mesure de la duree de vie; Usovershenstvovannyj metod izmereniya vremeni zhizni; Metodo perfeccionado para medir la vida media de los estados de excitacion

    Energy Technology Data Exchange (ETDEWEB)

    Weinzierl, P; Bartl, W [Oesterreichische Studiengesellschaft fuer Atomenergie, Seibersdorf (Austria)

    1962-04-15

    The measurement of the lifetime of excited states of nuclei is mostly based on the measurement of the delay of a {gamma}-ray (II) in respect to another {gamma}-ray (I) or a {beta}-particle. Organic scintillators allow the best time resolution for the measurement of this decay time, but for complicated decay schemes the identification of {gamma}-energy is important and best achieved by NaI(Tl) scintillators. To combine the merits of both detectors the {gamma}-ray (II) is at first scattered in an organic crystal (stilbene) and the scattered quantum is detected in a Nal(Tl) crystal. In order to allow large acceptance angles between the two scintillators, the measurement of the {gamma}-energy is achieved after adding the pulse heights of both scintillation pulses. To allow a reliable function of the adding unit the pulses from the organic crystal pass first through a gate circuit which is triggered by coincidence between the two scintillators. The pulse spectrum from the adding unit is fed to a single-channel analyser for energy selection. {gamma}-ray (I) is detected in another organic crystal. Fast pulses from both organic scintillators go to a time-to-pulse-height converter and multichannel analyser. This analyser is gated by a slow coincidence between the pulse-height discriminators. (author) [French] La mesure de la duree de vie des etats excites des noyaux repose essentiellement sur celle du retard d'un rayon gamma (II) par rapport a un autre rayon gamma (I) ou a une particule beta. Les scintillateurs organiques permettent de mesurer cette duree de vie avec la meilleure resolution en temps; toutefois, pour les processus des excitations complexes, il est important de determiner l'energie gamma; les scintillateurs a NaI(Tl) sont les plus indiques a cette fin. Pour combiner les avantages de ces deux types de detecteurs, les rayons gamma (II) sont d'abord diffuses dans un cristal organique (stilbene); le quantum emergeant est ensuite detecte dans un cristal de Nal

  9. Energy Pooling Upconversion in Free Space and Optical Cavities

    Science.gov (United States)

    LaCount, Michael D.

    The ability to efficiently convert the wavelength of light has value in a wide range of disciplines that include the fields of photovoltaics, plant growth, optics and medicine. The processes by which such transformations are carried out are known as upconversions and downconversions. There are several ways to up/down convert light, each with its own attributes, issues, and competing mechanisms. Most are associated with one-body or two-body processes. Three-body dynamics are also possible though, going by the names of quantum cutting (downconversion) and energy pooling (upconversion). These use virtual excited electronic states to mediate conversions as has been experimentally realized using lanthanide ions embedded in wide bandgap materials. The use of lanthanides to convert light is not ideal due to their relative scarcity, toxicity, and the limited range of light frequencies that can be absorbed and emitted. Organic molecules, on the other hand, are typically non-toxic, are made up of abundant elements, and can be designed with tailored spectral properties. At issue is whether or not they can be used to carry out efficient energy pooling, the central question to be answered in this thesis. The research presented here draws on a perturbative quantum electrodynamics framework previously established for generic energy pooling. It was used to develop a computational methodology for determining the rate of energy pooling and its competing processes. This, in turn, draws on a combination of time-dependent density functional theory, quantum electrodynamics, and perturbation theory to generate the requisite material property data. This computational model was applied to two test systems consisting of stilbene-fluorescein and hexabenzocoronene-oligothiophene. The stilbene-fluorescein system was found to have a maximum energy pooling rate efficiency (as compared to competing processes) of 17% and the hexabenzocoronene-oligothiophene system was found to have a maximum

  10. Light Conversion and Scattering in UV Protective Textiles

    Directory of Open Access Journals (Sweden)

    Grancarić Ana Marija

    2014-12-01

    Full Text Available The primary cause of skin cancer is believed to be a long exposure to solar ultraviolet radiation (UV-R crossed with the amount of skin pigmentation in the population. It is believed that in childhood and adolescence 80% of UV-R gets absorbed, whilst in the remaining 20% gets absorbed later in the lifetime. This suggests that proper and early photoprotection may reduce the risk of subsequent occurrence of skin cancer. Textile and clothing are the most suitable interface between environment and human body. It can show UV protection, but in most cases it does not provide full sun screening properties. UV protection ability highly depends on large number of factors such as type of fibre, fabric surface and construction, type and concentration of dyestuff, fluorescent whitening agent (FWA, UV-B protective agents, as well as nanoparticles, if applied. Based on electronically excited state by energy of UV-R (usually 340-370 nm, the molecules of FWAs show the phenomenon of fluorescence giving to white textiles high whiteness of outstanding brightness by reemitting the energy at the blue region (typically 420-470 nm of the spectrum. By absorbing UV-A radiation, optical brightened fabrics transform this radiation into blue fluorescence, which leads to better UV protection. Natural zeolites are rock-forming, microporous silicate minerals. Applied as nanoparticles to textile surface, it scatters the UV-R resulting in lower UV-A and UV-B transmission. If applied with other UV absorbing agents, e.g. FWAs, synergistic effect occurs. Silicones are inert, synthetic compounds with a variety of forms and uses. It provides a unique soft touch, is very resistant to washing and improves the property of fabric to protect against UV radiation. Therefore, the UV protective properties of cotton fabric achieved by light conversion and scattering was researched in this paper. For that purpose, the stilbene-derived FWAs were applied on cotton fabric in wide concentration

  11. A novel approach to the quantitative detection of anabolic steroids in bovine muscle tissue by means of a hybrid quadrupole time-of-flight-mass spectrometry instrument.

    Science.gov (United States)

    Bussche, Julie Vanden; Decloedt, Anneleen; Van Meulebroek, Lieven; De Clercq, Nathalie; Lock, Stephen; Stahl-Zeng, Jianru; Vanhaecke, Lynn

    2014-09-19

    In recent years, the analysis of veterinary drugs and growth-promoting agents has shifted from target-oriented procedures, mainly based on liquid chromatography coupled to triple-quadrupole mass spectrometry (LC-QqQ-MS), towards accurate mass full scan MS (such as Time-of-Flight (ToF) and Fourier Transform (FT)-MS). In this study, the performance of a hybrid analysis instrument (i.e. UHPLC-QuadrupoleTime-of-Flight-MS (QqToF-MS)), able to exploit both full scan HR and MS/MS capabilities within a single analytical platform, was evaluated for confirmatory analysis of anabolic steroids (gestagens, estrogens including stilbenes and androgens) in meat. The validation data was compared to previously obtained results (CD 2002/657/EC) for QqQ-MS and single stage Orbitrap-MS. Additionally, a fractional factorial design was used to shorten and optimize the sample extraction. Validation according to CD 2002/657/EC demonstrated that steroid analysis using QqToF has a higher competing value towards QqQ-MS in terms of selectivity/specificity, compared to single stage Orbitrap-MS. While providing excellent linearity, based on lack-of-fit calculations (F-test, α=0.05 for all steroids except 17β-ethinylestradiol: α=0.01), the sensitivity of QqToF-MS proved for 61.8% and 85.3% of the compounds more sensitive compared to QqQ-MS and Orbitrap-MS, respectively. Indeed, the CCα values, obtained upon ToF-MS/MS detection, ranged from 0.02 to 1.74μgkg(-1) for the 34 anabolic steroids, while for QqQ-MS and Orbitrap-MS values ranged from 0.04 to 0.88μgkg(-1) and from 0.07 to 2.50μgkg(-1), respectively. Using QqToF-MS and QqQ-MS, adequate precision was obtained as relative standard deviations for repeatability and within-laboratory reproducibility, were below 20%. In case of Orbitrap-MS, some compounds (i.e. some estrogens) displayed poor precision, which was possibly caused by some lack of sensitivity at lower concentrations and the absence of MRM-like experiments. Overall, it can be

  12. Resveratrol Induced Premature Senescence Is Associated with DNA Damage Mediated SIRT1 and SIRT2 Down-Regulation.

    Directory of Open Access Journals (Sweden)

    Mehtap Kilic Eren

    Full Text Available The natural polyphenolic compound resveratrol (3,4,5-trihydroxy-trans-stilbene has broad spectrum health beneficial activities including antioxidant, anti-inflammatory, anti-aging, anti-cancer, cardioprotective, and neuroprotective effects. Remarkably, resveratrol also induces apoptosis and cellular senescence in primary and cancer cells. Resveratrol's anti-aging effects both in vitro and in vivo attributed to activation of a (NAD-dependent histone deacetylase family member sirtuin-1 (SIRT1 protein. In mammals seven members (SIRT1-7 of sirtuin family have been identified. Among those, SIRT1 is the most extensively studied with perceptive effects on mammalian physiology and suppression of the diseases of aging. Yet no data has specified the role of sirtuins, under conditions where resveratrol treatment induces senescence. Current study was undertaken to investigate the effects of resveratrol in human primary dermal fibroblasts (BJ and to clarify the role of sirtuin family members in particular SIRT1 and SIRT2 that are known to be involved in cellular stress responses and cell cycle, respectively. Here, we show that resveratrol decreases proliferation of BJ cells in a time and dose dependent manner. In addition the increase in senescence associated β-galactosidase (SA-β-gal activity and methylated H3K9-me indicate the induction of premature senescence. A significant increase in phosphorylation of γ-H2AX, a surrogate of DNA double strand breaks, as well as in levels of p53, p21CIP1 and p16INK4A is also detected. Interestingly, at concentrations where resveratrol induced premature senescence we show a significant decrease in SIRT1 and SIRT2 levels by Western Blot and quantitative RT-PCR analysis. Conversely inhibition of SIRT1 and SIRT2 via siRNA or sirtinol treatment also induced senescence in BJ fibroblasts associated with increased SA-β-gal activity, γ-H2AX phosphorylation and p53, p21CIP1 and p16INK4A levels. Interestingly DNA damaging

  13. Resveratrol and Clinical Trials: The Crossroad from In Vitro Studies to Human Evidence

    Science.gov (United States)

    Tomé-Carneiro, Joao; Larrosa, Mar; González-Sarrías, Antonio; Tomás-Barberán, Francisco A.; García-Conesa, María Teresa; Espín, Juan Carlos

    2013-01-01

    Resveratrol (3,5,4’-trihydroxy-trans-stilbene) is a non-flavonoid polyphenol that may be present in a limited number of food-stuffs such as grapes and red wine. Resveratrol has been reported to exert a plethora of health benefits through many different mechanisms of action. This versatility and presence in the human diet have drawn the worldwide attention of many research groups over the past twenty years, which has resulted in a huge output of in vitro and animal (preclinical) studies. In line with this expectation, many resveratrol-based nutraceuticals are consumed all over the world with questionable clinical/scientific support. In fact, the confirmation of these benefits in humans through randomized clinical trials is still very limited. The vast majority of preclinical studies have been performed using assay conditions with a questionable extrapolation to humans, i.e. too high concentrations with potential safety concerns (adverse effects and drug interactions), short-term exposures, in vitro tests carried out with non-physiological metabolites and/or concentrations, etc. Unfortunately, all these hypothesis-generating studies have contributed to increased the number of ‘potential’ benefits and mechanisms of resveratrol but confirmation in humans is very limited. Therefore, there are many issues that should be addressed to avoid an apparent endless loop in resveratrol research. The so-called ‘Resveratrol Paradox’, i.e., low bioavailability but high bioactivity, is a conundrum not yet solved in which the final responsible actor (if any) for the exerted effects has not yet been unequivocally identified. It is becoming evident that resveratrol exerts cardioprotective benefits through the improvement of inflammatory markers, atherogenic profile, glucose metabolism and endothelial function. However, safety concerns remain unsolved regarding chronic consumption of high RES doses, specially in medicated people. This review will focus on the currently

  14. Synthesis and Characterization of Polyfunctional Polyhedral Silsesquioxane Cages

    Science.gov (United States)

    Sulaiman, Santy

    Recent studies on octameric polyhedral silsesquioxanes, (RSiO1.5 )8, indicate that the silsesquioxane cage is not just a passive component but appears to be involved in electron delocalization with conjugated organic tethers in the excited state. This dissertation presents the synthesis and characterization of (RSiO1.5)8 molecules with unique photophysical properties that provide support for the existence of conjugation that involves the (RSiO1.5)8 cage. The dissertation first discusses the elaboration of octavinylsilsesquioxane via cross-metathesis to form styrenyl-functionalized octasilsesquioxane molecules. Subsequent Heck coupling reactions of p-bromostyrenyl derivative provides vinylstilbene-functionalized octasilsesquioxane. The amino derivative, NH2VinylStilbeneOS, show highly red-shifted emission spectrum (100 nm from the simple organic analog p-vinylstilbene) and high two-photon absorption (TPA) cross-section value (100 GM/moiety), indicating charge-transfer processes involving the silsesquioxane cage as the electron acceptor. The unique photophysical properties of polyfunctional luminescent cubic silsesquioxanes synthesized from ortho-8-, (2,5)-16-, and 24-brominated octaphenylsilsesquioxane (OPS) via Heck coupling show how the steric interactions of the organic tethers at the silsesquioxane cage corner affect conjugation with the silsesquioxane cage. Furthermore, the high TPA cross-section (10 GM/moiety) and photoluminescence quantum yield (20%) of OPS functionalized with 24 acetoxystyrenyl groups suggest that the existence excited states in these molecules with similar energies and decay rates: normal radiative pi- pi* transition and charge transfer involving the silsesquioxane cage. The fluoride ion-catalyzed rearrangement reactions of cage and polymeric silsesquioxanes provide a convenient route to a mixture of deca- and dodecameric silsesquioxane molecules in high yields, giving us the opportunity to investigate the effect of silsesquioxane cage

  15. Anion exchanger and the resistance against thermal haemolysis.

    Science.gov (United States)

    Ivanov, I T; Zheleva, A; Zlatanov, I

    2011-01-01

    4,4'-Diiso-thiocyanato stilbene-2,2'-disulphonic acid (DIDS) is a membrane-impermeable, highly specific covalent inhibitor and powerful thermal stabiliser of the anion exchanger (AE1), the major integral protein of erythrocyte membrane (EM). Suspensions of control and DIDS-treated (15 µM, pH 8.2) human erythrocytes were heated from 20° to 70°C using various but constant heating rates (1-8°C/min). The cellular electrolyte leakage exhibited a sigmoidal response to temperature as detected by conductometry. The critical midpoint temperature of leakage, T(mo), extrapolated to low heating rate (0.5°C/min) was used as a measure for EM thermostability. T(mo) was greater for DIDS-treated erythrocytes, 63.2° ± 0.3°C, than for intact erythrocytes, 60.7° ± 0.2°C. The time, t(1/2), for 50% haemolysis of erythrocytes, exposed to 53°C was used as a measure for the resistance of erythrocytes against thermal haemolysis. The t(1/2) was also greater for DIDS-treated erythrocytes, 63 ± 3 min, than for intact erythrocytes, 38 ± 2 min. The fluorescent label N-(3-pyrenyl)maleimide and EPR spin label 3-maleimido-proxyl, covalently bound to sulphydryl groups of major EM proteins, were used to monitor the changes in molecular motions during transient heating. Both labels reported an intensification of the motional dynamics at the denaturation temperatures of spectrin (50°C) and AE1 (67°C), and, surprisingly, immobilisation of a major EM protein, presumably the AE1, at T(mo). The above results are interpreted in favour of the possible involvement of a predenaturational rearrangement of AE1 copies in the EM thermostability and the resistance against thermal haemolysis.

  16. Transcriptomic analysis of grape (Vitis vinifera L. leaves after exposure to ultraviolet C irradiation.

    Directory of Open Access Journals (Sweden)

    Huifen Xi

    Full Text Available BACKGROUND: Only a small amount of solar ultraviolet C (UV-C radiation reaches the Earth's surface. This is because of the filtering effects of the stratospheric ozone layer. Artificial UV-C irradiation is used on leaves and fruits to stimulate different biological processes in plants. Grapes are a major fruit crop and are grown in many parts of the world. Research has shown that UV-C irradiation induces the biosynthesis of phenols in grape leaves. However, few studies have analyzed the overall changes in gene expression in grape leaves exposed to UV-C. METHODOLOGY/PRINCIPAL FINDINGS: In the present study, transcriptional responses were investigated in grape (Vitis vinifera L. leaves before and after exposure to UV-C irradiation (6 W·m-2 for 10 min using an Affymetrix Vitis vinifera (Grape Genome Array (15,700 transcripts. A total of 5274 differentially expressed probe sets were defined, including 3564 (67.58% probe sets that appeared at both 6 and 12 h after exposure to UV-C irradiation but not before exposure. A total of 468 (8.87% probe sets and 1242 (23.55% probe sets were specifically expressed at these times. The probe sets were associated with a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes, protein fate (i.e., HSPs, primary and secondary metabolism, and transcription factors. Interestingly, some of the genes involved in secondary metabolism, such as stilbene synthase, responded intensely to irradiation. Some of the MYB and WRKY family transcription factors, such as VvMYBPA1, VvMYB14, VvMYB4, WRKY57-like, and WRKY 65, were also strongly up-regulated (about 100 to 200 fold. CONCLUSIONS: UV-C irridiation has an important role in some biology processes, especially cell rescue, protein fate, secondary metabolism, and regulation of transcription.These results opened up ways of exploring the molecular mechanisms underlying the effects of UV-C irradiation on grape leaves and have

  17. Metabolite and transcript profiling of berry skin during fruit development elucidates differential regulation between Cabernet Sauvignon and Shiraz cultivars at branching points in the polyphenol pathway.

    Science.gov (United States)

    Degu, Asfaw; Hochberg, Uri; Sikron, Noga; Venturini, Luca; Buson, Genny; Ghan, Ryan; Plaschkes, Inbar; Batushansky, Albert; Chalifa-Caspi, Vered; Mattivi, Fulvio; Delledonne, Massimo; Pezzotti, Mario; Rachmilevitch, Shimon; Cramer, Grant R; Fait, Aaron

    2014-07-26

    metabolism, stronger in Shiraz than Cabernet Sauvignon. RNAseq analysis also revealed that the two cultivars exhibited distinct pattern of changes in genes related to abscisic acid (ABA) biosynthesis enzymes. Compared with CS, Shiraz showed higher number of significant correlations between metabolites, which together with the relatively higher expression of flavonoid genes supports the evidence of increased accumulation of coumaroyl anthocyanins in that cultivar. Enhanced stress related metabolism, e.g. trehalose, stilbene and ABA in Shiraz berry-skin are consistent with its relatively higher susceptibility to environmental cues.

  18. Chiral bis(amino acid)- and bis(amino alcohol)-oxalamide gelators. Gelation properties, self-assembly motifs and chirality effects.

    Science.gov (United States)

    Frkanec, Leo; Zinić, Mladen

    2010-01-28

    Bis(amino acid)- and bis(amino alcohol)oxalamide gelators represent the class of versatile gelators whose gelation ability is a consequence of strong and directional intermolecular hydrogen bonding provided by oxalamide units and lack of molecular symmetry due to the presence of two chiral centres. Bis(amino acid)oxalamides exhibit ambidextrous gelation properties, being capable to form gels with apolar and also highly polar solvent systems and tend to organise into bilayers or inverse bilayers in hydrogel or organic solvent gel assemblies, respectively. (1)H NMR and FTIR studies of gels revealed the importance of the equilibrium between the assembled network and smaller dissolved gelator assemblies. The organisation in gel assemblies deduced from spectroscopic structural studies are in certain cases closely related to organisations found in the crystal structures of selected gelators, confirming similar organisations in gel assemblies and in the solid state. The pure enantiomer/racemate gelation controversy is addressed and the evidence provided that rac-16 forms a stable toluene gel due to resolution into enantiomeric bilayers, which then interact giving gel fibres and a network of different morphology compared to its (S,S)-enantiomer gel. The TEM investigation of both gels confirmed distinctly different gel morphologies, which allowed the relationship between the stereochemical form of the gelator, the fibre and the network morphology and the network solvent immobilisation capacity to be proposed. Mixing of the constitutionally different bis(amino acid) and bis(amino alcohol)oxalamide gelators resulted in some cases in highly improved gelation efficiency denoted as synergic gelation effect (SGE), being highly dependent also on the stereochemistry of the component gelators. Examples of photo-induced gelation based on closely related bis(amino acid)-maleic acid amide and -fumaramide and stilbene derived oxalamides where gels form by irradiation of the solution of

  19. A new automated method for the determination of the Total Antioxidant Capacity (TAC of human plasma, based on the crocin bleaching assay

    Directory of Open Access Journals (Sweden)

    Notas George

    2002-08-01

    Full Text Available Abstract Background Antioxidant molecules, which scavenge free radical species to prevent or delay oxidative damage of important macromolecules, membrane lipids and lipoproteins, are prevalent in plasma and other biological fluids. Among them, bilirubin, uric acid and protein thiols are the major endogenous antioxidants, while vitamins C and E, as well as a number of food-derived (polyaromatic substances, belonging to stilbens, flavonoids and phenolic acids, are the main classes of nutritional antioxidants. Assays for total antioxidant capacity in plasma differ in their type of oxidation source, target and measurement used to detect the oxidized product. Methods In the present work we present an automated assay for the estimation of blood total antioxidant capacity (TAC assay, based on the crocin bleaching (oxidation method. This method was adapted on a modern autoanalyzer, was linear over a wide range of values (0–3 mmol/L, and performed using an end point measurement. Results The TAC method presented a linear correlation with another automated commercial Total Antioxidant Status (TAS test. Detection of the interference of different metabolites revealed a significant participation of TAC from uric acid, bilirubin, albumin, a minor interference from ascorbic acid, and no interference from hemoglobin. TAC was not modified by two freeze/thawing cycles, and was stable in samples stored at room temperature for 4 hours. K-EDTA and heparin were the best anticoagulants, while citrate decreased TAC by 20%. Reference values derived from samples of normal blood donors was 1.175 ± 0.007 mmol/L (mean ± SEM, while a diet rich in antioxidants more than doubled this value. Conclusions The proposed TAC assay, is fully automated, stable and reliable, and could be of value in the estimation of the AC of plasma. It is further proposed to calculate the antioxidant capacity of plasma after a subtraction of all interference deriving from endogenous and

  20. Silk fibroin nanoparticles constitute a vector for controlled release of resveratrol in an experimental model of inflammatory bowel disease in rats

    Directory of Open Access Journals (Sweden)

    Lozano-Pérez AA

    2014-09-01

    Full Text Available Antonio Abel Lozano-Pérez,1 Alba Rodriguez-Nogales,2 Víctor Ortiz-Cullera,1 Francesca Algieri,2 José Garrido-Mesa,2 Pedro Zorrilla,2 M Elena Rodriguez-Cabezas,2 Natividad Garrido-Mesa,2 M Pilar Utrilla,2 Laura De Matteis,3 Jesús Martínez de la Fuente,3 José Luis Cenis,1 Julio Gálvez2 1Instituto Murciano de Investigación y Desarrollo Agrario y Alimentario, Murcia, Spain; 2Centro de Investigaciones Biomédicas en Red – Enfermedades Hepáticas y Digestivas, Department of Pharmacology, ibs Granada, Center for Biomedical Research, University of Granada, Granada, Spain; 3Instituto de Nanociencia de Aragón, Universidad de Zaragoza, Zaragoza, Spain Purpose: We aimed to evaluate the intestinal anti-inflammatory properties of silk fibroin nanoparticles, around 100 nm in size, when loaded with the stilbene compound resveratrol, in an experimental model of rat colitis. Methods: Nanoparticles were loaded with resveratrol by adsorption. The biological effects of the resveratrol-loaded nanoparticles were tested both in vitro, in a cell culture of RAW 264.7 cells (mouse macrophages, and in vivo, in the trinitrobenzenesulfonic acid model of rat colitis, when administered intracolonically.Results: The resveratrol liberation in 1× phosphate-buffered saline (PBS; pH 7.4 was characterized by fast liberation, reaching the solubility limit in 3 hours, which was maintained over a period of 80 hours. The in vitro assays revealed immunomodulatory properties exerted by these resveratrol-loaded nanoparticles since they promoted macrophage activity in basal conditions and inhibited this activity when stimulated with lipopolysaccharide. The in vivo experiments showed that after evaluation of the macroscopic symptoms, inflammatory markers, and intestinal barrier function, the fibroin nanoparticles loaded with resveratrol had a better effect than the single treatments, being similar to that produced by the glucocorticoid dexamethasone. Conclusion: Silk

  1. Short-term molecular acclimation processes of legume nodules to increased external oxygen concentration

    Directory of Open Access Journals (Sweden)

    Ulrike eAvenhaus

    2016-01-01

    Full Text Available Nitrogenase is an oxygen labile enzyme. Microaerobic conditions within the infected zone of nodules are maintained primarily by an oxygen diffusion barrier located in the nodule cortex. Flexibility of the oxygen diffusion barrier is important for the acclimation processes of nodules in response to changes in external oxygen concentration. The hypothesis of the present study was that there are additional molecular mechanisms involved. Nodule activity of Medicago truncatula plants were continuously monitored during a change from 21 to 25 or 30 % oxygen around root nodules by measuring nodule H2 evolution. Within about two minutes of the increase in oxygen concentration, a steep decline in nitrogenase activity occurred. A quick recovery commenced about eight minutes later. A qPCR-based analysis of the expression of genes for nitrogenase components showed a tendency towards upregulation during the recovery. The recovery resulted in a new constant activity after about 30 minutes, corresponding to approximately 90 % of the pre-treatment level. An RNAseq-based comparative transcriptome profiling of nodules at that point in time revealed that genes for nodule-specific cysteine-rich (NCR peptides, defensins, leghaemoglobin and chalcone and stilbene synthase were significantly upregulated when considered as a gene family. A gene for a nicotianamine synthase-like protein (Medtr1g084050 showed a strong increase in count number. The gene appears to be of importance for nodule functioning, as evidenced by its consistently high expression in nodules and a strong reaction to various environmental cues that influence nodule activity. A Tnt1-mutant that carries an insert in the coding sequence (cds of that gene showed reduced nitrogen fixation and less efficient acclimation to an increased external oxygen concentration. It was concluded that sudden increases in oxygen concentration around nodules destroy nitrogenase, which is quickly counteracted by an increased

  2. Transcriptomic analysis of grape (Vitis vinifera L.) leaves after exposure to ultraviolet C irradiation.

    Science.gov (United States)

    Xi, Huifen; Ma, Ling; Liu, Guotian; Wang, Nian; Wang, Junfang; Wang, Lina; Dai, Zhanwu; Li, Shaohua; Wang, Lijun

    2014-01-01

    Only a small amount of solar ultraviolet C (UV-C) radiation reaches the Earth's surface. This is because of the filtering effects of the stratospheric ozone layer. Artificial UV-C irradiation is used on leaves and fruits to stimulate different biological processes in plants. Grapes are a major fruit crop and are grown in many parts of the world. Research has shown that UV-C irradiation induces the biosynthesis of phenols in grape leaves. However, few studies have analyzed the overall changes in gene expression in grape leaves exposed to UV-C. In the present study, transcriptional responses were investigated in grape (Vitis vinifera L.) leaves before and after exposure to UV-C irradiation (6 W·m-2 for 10 min) using an Affymetrix Vitis vinifera (Grape) Genome Array (15,700 transcripts). A total of 5274 differentially expressed probe sets were defined, including 3564 (67.58%) probe sets that appeared at both 6 and 12 h after exposure to UV-C irradiation but not before exposure. A total of 468 (8.87%) probe sets and 1242 (23.55%) probe sets were specifically expressed at these times. The probe sets were associated with a large number of important traits and biological pathways, including cell rescue (i.e., antioxidant enzymes), protein fate (i.e., HSPs), primary and secondary metabolism, and transcription factors. Interestingly, some of the genes involved in secondary metabolism, such as stilbene synthase, responded intensely to irradiation. Some of the MYB and WRKY family transcription factors, such as VvMYBPA1, VvMYB14, VvMYB4, WRKY57-like, and WRKY 65, were also strongly up-regulated (about 100 to 200 fold). UV-C irridiation has an important role in some biology processes, especially cell rescue, protein fate, secondary metabolism, and regulation of transcription.These results opened up ways of exploring the molecular mechanisms underlying the effects of UV-C irradiation on grape leaves and have great implications for further studies.

  3. Triplet and ground state potential energy surfaces of 1,4-diphenyl-1,3-butadiene: theory and experiment.

    Science.gov (United States)

    Saltiel, J; Dmitrenko, O; Pillai, Z S; Klima, R; Wang, S; Wharton, T; Huang, Z-N; van de Burgt, L J; Arranz, J

    2008-05-01

    Relative energies of the ground state isomers of 1,4-diphenyl-1,3-butadiene (DPB) are determined from the temperature dependence of equilibrium isomer compositions obtained with the use of diphenyl diselenide as catalyst. Temperature and concentration effects on photostationary states and isomerization quantum yields with biacetyl or fluorenone as triplet sensitizers with or without the presence of O(2), lead to significant modification of the proposed DPB triplet potential energy surface. Quantum yields for ct-DPB formation from tt-DPB increase with [tt-DPB] revealing a quantum chain process in the tt --> ct direction, as had been observed for the ct --> tt direction, and suggesting an energy minimum at the (3)ct* geometry. They confirm the presence of planar and twisted isomeric triplets in equilibrium (K), with energy transfer from planar or quasi-planar geometries (quantum chain events from tt and ct triplets) and unimolecular decay (k(d)) from twisted geometries. Starting from cc-DPB, varphi(cc-->tt) increases with increasing [cc-DPB] whereas varphi(cc-->ct) is relatively insensitive to concentration changes. The concentration and temperature dependencies of the decay rate constants of DPB triplets in cyclohexane are consistent with the mechanism deduced from the photoisomerization quantum yields. The experimental DeltaH between (3)tt-DPB* and (3)tp-DPB*, 2.7 kcal mol(-1), is compared with the calculated energy difference [DFT with B3LYP/6-31+G(d,p) basis set]. Use of the calculated DeltaS = 4.04 eu between the two triplets gives k(d) = (2.4-6.4) x 10(7) s(-1), close to 1.70 x 10(7) s(-1), the value for twisted stilbene triplet decay. Experimental and calculated relative energies of DPB isomers on the ground and triplet state surfaces agree and theory is relied upon to deduce structural characteristics of the equilibrated conformers in the DPB triplet state.

  4. Model-based design evaluation of a compact, high-efficiency neutron scatter camera

    Science.gov (United States)

    Weinfurther, Kyle; Mattingly, John; Brubaker, Erik; Steele, John

    2018-03-01

    pillar dimensions, scintillator material (EJ-204, EJ-232Q and stilbene), and photodetector (MCP-PM vs. SiPM) response vs. time. We demonstrate that the most precise estimates of incident neutron direction and energy can be obtained using a combination of scintillator material with high luminosity and a photodetector with a narrow impulse response. Specifically, we conclude that an SVSC-PiPS constructed using EJ-204 (a high luminosity plastic scintillator) and an MCP-PM will produce the most precise estimates of incident neutron direction and energy.

  5. Investigation of the hyperfine structure of Praseodymium-transitions using laser spectroscopy

    International Nuclear Information System (INIS)

    Shamim Khan

    2011-01-01

    A comprehensive knowledge of the electron levels in an atom is one of the prerequisite for understanding the electron-electron and electron-nucleus interactions inside an atom and for the classification of the atomic spectrum of an element. The spin-orbit interaction is the largest relativistic effect and is responsible for the fine structure splitting in an atom. The hyperfine structure splitting of the fine structure atomic energy levels arise as a result of the interaction between spinning and orbiting electrons and electromagnetic multipole nuclear moments. The electronic ground state configuration of praseodymium 59 Pr 141 is [Xe] 4f 3 6s 2 , with ground state level 4 I 9/2 . Because of its 5 outer electrons Praseodymium has a high density of energy levels which give rise to an extremely line rich emission spectrum. Due to this fact praseodymium serves as an efficient testing ground for hyperfine structure studies. The thesis is mainly devoted to the finding of previously unknown energy levels by the investigation of spectral lines and their hyperfine structures. In a hollow cathode discharge lamp praseodymium atoms and ions in ground and excited states are excited to high lying states by laser light. The excitation source is a tunable ring-dye laser system, operated with Stilbene 3, Rhodamine 6G, Kiton Red, DCM and LD 700. A high resolution Fourier Transform spectrum is used for extracting excitation wavelengths. Then the laser wavelength is tuned to a strong hyperfine component of the spectral line to be investigated, and a search for fluorescence from excited levels is performed. From the observed hyperfine structure pattern, J-values and hyperfine interaction constants A of the combining levels are determined. This information, together with excitation and fluorescence wavelengths, allows us to find the energies of the involved levels. During the course of this dissertation 313 new energy levels of Pr I and 4 new energy levels of Pr II were discovered

  6. Disruptores endocrinos. El caso particular de los xenobióticos estrogénicos. II Estrógenos sintéticos Endocrine disrupters. The case of oestrogenic xenobiotics II: synthetic oestrogens

    Directory of Open Access Journals (Sweden)

    P. Martín Olmedo

    2001-11-01

    Full Text Available En los últimos años se ha puesto en evidencia que muchas sustancias químicas de origen antropogénico son capaces de alterar el sistema endocrino de los seres vivos y se ha acuñado el nombre de disruptores endocrinos para definirlas. El número de disruptores endocrinos es una preocupación creciente si se añade a la inclusión de nuevos compuestos químicos, hasta ahora insospechados, la información generada sobre sus precursores, metabolitos y productos de degradación que tan solo ahora empiezan a conocerse. No se ha podido definir una estructura química única que permita clasificar a un compuesto químico como mimetizador de las hormonas sexuales femeninas, de tal manera que estructuras químicas similares a los estrógenos naturales, basados en el ciclopentanoperhidrofenantreno, comparten con los estilbenos, bisfenoles, bifenilos, alquilfenoles, dioxinas, furanos y parabenes su efecto hormonal estrogénico. El reconocimiento de la actividad estrogénica en diferentes modelos biológicos se ha utilizado para actualizar el censo de xenoestrógenos y poner de manifiesto fuentes de exposición humana hasta el momento insospechadas.In recent years, it has been demonstrated that endocrine systems of living beings can be altered by many chemical substances of anthropogenic origin, designated as endocrine disrupters. There are growing concerns about the number of these endocrine disrupters. It has not been possible to define a single chemical structure that allows the classification of a chemical compound as a mimic of female sex hormones, so that chemical structures similar to natural estrogens, based on cyclopentanoperhydrophenanthrene, share their hormonal effect with stilbenes, bisphenols, alkylphenols, dioxins, furans and parabenes. The recognition of estrogenic activity in different biological models has been used to update the list of xenoestrogens and reveal sources of human exposure that were previously unknown. New previously

  7. LC-MS/MS Tandem Mass Spectrometry for Analysis of Phenolic Compounds and Pentacyclic Triterpenes in Antifungal Extracts of Terminalia brownii (Fresen

    Directory of Open Access Journals (Sweden)

    Enass Y. A. Salih

    2017-12-01

    Full Text Available Decoctions and macerations of the stem bark and wood of Terminalia brownii Fresen. are used in traditional medicine for fungal infections and as fungicides on field crops and in traditional granaries in Sudan. In addition, T. brownii water extracts are commonly used as sprays for protecting wooden houses and furniture. Therefore, using agar disc diffusion and macrodilution methods, eight extracts of various polarities from the stem wood and bark were screened for their growth-inhibitory effects against filamentous fungi commonly causing fruit, vegetable, grain and wood decay, as well as infections in the immunocompromised host. Ethyl acetate extracts of the stem wood and bark gave the best antifungal activities, with MIC values of 250 µg/mL against Nattrassia mangiferae and Fusarium verticillioides, and 500 µg/mL against Aspergillus niger and Aspergillus flavus. Aqueous extracts gave almost as potent effects as the ethyl acetate extracts against the Aspergillus and Fusarium strains, and were slightly more active than the ethyl acetate extracts against Nattrassia mangiferae. Thin layer chromatography, RP-HPLC-DAD and tandem mass spectrometry (LC-MS/MS, were employed to identify the chemical constituents in the ethyl acetate fractions of the stem bark and wood. The stem bark and wood were found to have a similar qualitative composition of polyphenols and triterpenoids, but differed quantitatively from each other. The stilbene derivatives, cis- (3 and trans- resveratrol-3-O-β-galloylglucoside (4, were identified for the first time in T. brownii. Moreover, methyl-(S-flavogallonate (5, quercetin-7-β-O-di-glucoside (8, quercetin-7-O-galloyl-glucoside (10, naringenin-4′-methoxy-7-pyranoside (7, 5,6-dihydroxy-3′,4′,7-tri-methoxy flavone (12, gallagic acid dilactone (terminalin (6, a corilagin derivative (9 and two oleanane type triterpenoids (1 and (2 were characterized. The flavonoids, a corilagin derivative and terminalin, have not been

  8. Control of cell volume in the J774 macrophage by microtubule disassembly and cyclic AMP

    Science.gov (United States)

    Melmed, RN; Karanian, PJ; Berlin, RD

    1981-01-01

    We have explored the possibilities that cell volume is regulated by the status of microtubule assembly and cyclic AMP metabolism and may be coordinated with shape change. Treatment of J774.2 mouse macrophages with colchicine caused rapid microtubule disassembly and was associated with a striking increase (from 15-20 to more than 90 percent) in the proportion of cells with a large protuberance at one pole. This provided a simple experimental system in which shape changes occurred in virtually an entire cell population in suspension. Parallel changes in cell volume could then be quantified by isotope dilution techniques. We found that the shape change caused by colchicine was accompanied by a decrease in cell volume of approximately 20 percent. Nocodozole, but not lumicolchicine, caused identical changes in both cell shape and cell volume. The volume loss was not due to cell lysis nor to inhibition of pinocytosis. The mechanism of volume loss was also examined. Colchicine induced a small but reproducible increase in activity of the ouabain-sensitive Na(+), K(+)-dependent ATPase. However, inhibition of this enzyme/transport system by ouabain did not change cell volume nor did it block the colchicines-induced decrease in volume. One the other hand, SITS (4’acetamido, 4-isothiocyano 2,2’ disulfonic acid stilbene), an inhibitor of anion transport, inhibited the effects of colchicines, thus suggesting a role for an anion transport system in cell volume regulation. Because colchicine is known to activate adenylate cyclase in several systems and because cell shape changes are often induced by hormones that elevate cyclic AMP, we also examined the effects of cyclic AMP on cell volume. Agents that act to increase syclic AMP (cholera toxin, which activates adenylate cyclase; IBMX, and inhibitor of phosphodiesterase; and dibutyryl cyclic AMP) all caused a volume decrease comparable to that of colchicine. To define the effective metabolic pathway, we studied two mutants of J

  9. Revista de revistas

    Directory of Open Access Journals (Sweden)

    Facultad de Medicina Revista

    1941-12-01

    Full Text Available Autores, Patey, D. H., Robertson, J. D. Artículo, comprenssion treatment of crush injuries of limbs. Revista, Lancet. Tomo 1. Páginas 780-782. Tratamiento por comprensión de las lesiones de los miembros a consecuencia de aplastamiento / Autores. Della Vida, B. L. Dyke, S. c. Arículo, blood-Picture in trichiniasis. Revista, Lancet. Abreviación, Tomo 2. Páginas 67-71. Fecha 19/7/41. Cuadro hemático en la triquinosis. Autores Bowesman, C. Artículo, A. Short report on the use of 4:4' - Diamidi - no stilbene in the treatment of human sleeping sickness. Revista, Annals of Tropical Medicine and Parasitology. Abreviación, Ann. Trop. Med. & Parasit. Tomo 34. páginas 217-222. Fecha 31/12/40 . Informe breve sobre el empleo del 4:4' - diamidino stilbeno en el tratamiento de la enfermedad del sueño en el hombre. Autores, Findlay, G. M. Artículo, The action of sulphanilamide on the virus of lymphogranuloma venereum. Revista, Britis Journal of Experimental Pathology. Abreviación, Brit. J. Exper. Path. Tomo 21. Páginas, 356-360. Fecha, diciembre, 1940. La acción de la sulfanilamida sobre el virus del linfogranuloma venereo. Autores, Beck, S. Peacock, P. R. Artículo Gastro-Papillomatosis due to Vitamin A deficiency induced by heated fats. Revista, British Medical Journal. Abreviación. Brit. med. J. Tomo 2. Páginas 81-83. Fecha 19/7/41 / Gastro-papilomatosis debida a deficiencia en vitamina a provocada por calentamiento de grasas. Autores, Sommerville, J. Artículo, Acute Gonorrhoea: Further Observation on treatment by sulphapiridine fowolled by Lavage. Revista, British Medical Journal. Abreviación, Brit. med. J. Tomo 1. Páginas 961-962-28-6/41. Gonorrea aguda: nuevas observaciones sobre el tratamiento con sulfapiridina seguido de lavados.

  10. Ozone-induced gene expression occurs via ethylene-dependent and -independent signalling.

    Science.gov (United States)

    Grimmig, Bernhard; Gonzalez-Perez, Maria N; Leubner-Metzger, Gerhard; Vögeli-Lange, Regina; Meins, Fred; Hain, Rüdiger; Penuelas, Josep; Heidenreich, Bernd; Langebartels, Christian; Ernst, Dieter; Sandermann, Heinrich

    2003-03-01

    Recent studies suggest that ethylene is involved in signalling ozone-induced gene expression. We show here that application of ozone increased glucuronidase (GUS) expression of chimeric reporter genes regulated by the promoters of the tobacco class I beta-1,3-glucanases (GLB and Gln2) and the grapevine resveratrol synthase (Vst1) genes in transgenic tobacco leaves. 5'-deletion analysis of the class I beta-1,3-glucanase promoter revealed that ozone-induced gene regulation is mainly mediated by the distal enhancer region containing the positively acting ethylene-responsive element (ERE). In addition, application of 1-methylcyclopropene (1-MCP), an inhibitor of ethylene action, blocked ozone-induced class I beta-1,3-glucanase promoter activity. Enhancer activity and ethylene-responsiveness depended on the integrity of the GCC boxes, cis-acting elements present in the ERE of the class I beta-1,3-glucanase and the basic-type pathogenesis-related PR-1 protein (PRB-1b) gene promoters. The minimal PRB-1b promoter containing only the ERE with intact GCC boxes, was sufficient to confer 10-fold ozone inducibility to a GUS-reporter gene, while a substitution mutation in the GCC box abolished ozone responsiveness. The ERE region of the class I beta-1,3-glucanase promoter containing two intact GCC boxes confered strong ozone inducibility to a minimal cauliflower mosaic virus (CaMV) 35S RNA promoter, whereas two single-base substitution in the GCC boxes resulted in a complete loss of ozone inducibility. Taken together, these datastrongly suggest that ethylene is signalling ozone-induced expression of class I beta-l,3-glucanase and PRB-1b genes. Promoter analysis of the stilbene synthase Vst1 gene unravelled different regions for ozone and ethylene-responsiveness. Application of 1-MCP blocked ethylene-induced Vst1 induction, but ozone induction was not affected. This shows that ozone-induced gene expression occurs via at least two different signalling mechanisms and suggests an

  11. N,N-Dihexyl-4-[2-(4-nitrophenylvinyl]aniline

    Directory of Open Access Journals (Sweden)

    Dieter Schollmeyer

    2011-06-01

    Full Text Available The title compound, C26H36N2O2, was prepared by Horner olefination of p-dihexylaminobenzaldehyde and diethyl p-nitrobenzylphosphonate. It crystallizes with two independent molecules in the asymmetric unit. Both have similar geometries of the π-systems but the conformations of all hexyl chains are different. Whereas one hexyl chain of the first molecule shows the typical all-anti conformation, the second is arranged in a gauche-anti-gauche-anti conformation with N—C—C—C, C—C—C—C, C—C—C—C and C—C—C—C torsion angles of −65.1 (4, 167.3 (3, 63.3 (4, and 179.4 (3°. One of the hexyl chains in the other molecule has an anti-anti-gauche-anti conformation [N—C—C—C, C—C—C—C, C—C—C—C and C—C—C—C torsion angles = 179.6 (3, −179.8 (3, −68.7 (5 and −178.8 (4°], the other starts with an anti-gauche-gauche sequence. Molecules A and B are composed of five planar subunits. The angle sums around the N atoms are in the range 356 (2–360.0 (2°. Torsion angles between these segments do not exceed 4.9 (4°, except for one of the alkyl chains each [molecule A = 26.2 (4°; molecule B = −6.0 (4°]. The high planarity of the molecules and the short aniline C—N bonds [1.385 (3 Å in molecule A and 1.378 (3 Å in molecule B] indicate a strong electronic coupling through the stilbene unit. One methylene group is disordered over two positions with an occupancy ratio of 0.72:0.28.

  12. Botany, phytochemistry, pharmacology, and potential application of Polygonum cuspidatum Sieb.et Zucc.: a review.

    Science.gov (United States)

    Peng, Wei; Qin, Rongxin; Li, Xiaoli; Zhou, Hong

    2013-07-30

    Polygonum cuspidatum Sieb. et Zucc. (Polygonum cuspidatum), also known as Reynoutria japonica Houtt and Huzhang in China, is a traditional and popular Chinese medicinal herb. Polygonum cuspidatum with a wide spectrum of pharmacological effects has been used for treatment of inflammation, favus, jaundice, scald, and hyperlipemia, etc. The present paper reviews the traditional applications as well as advances in botany, phytochemistry, pharmacodynamics, pharmacokinetics and toxicology of this plant. Finally, the tendency and perspective for future investigation of this plant are discussed, too. A systematic review of literature about Polygonum cuspidatum is carried out using resources including classic books about Chinese herbal medicine, and scientific databases including Pubmed, SciFinder, Scopus, the Web of Science and others. Polygonum cuspidatum is widely distributed in the world and has been used as a traditional medicine for a long history in China. Over 67 compounds including quinones, stilbenes, flavonoids, counmarins and ligans have been isolated and identified from this plant. The root of this plant is used as the effective agent in pre-clinical and clinical practice for regulating lipids, anti-endotoxic shock, anti-infection and anti-inflammation, anti-cancer and other diseases in China and Japan. As an important traditional Chinese medicine, Polygonum cuspidatum has been used for treatment of hyperlipemia, inflammation, infection and cancer, etc. Because there is no enough systemic data about the chemical constituents and their pharmacological effects or toxicities, it is important to investigate the pharmacological effects and molecular mechanisms of this plant based on modern realization of diseases' pathophysiology. Drug target-guided and bioactivity-guided isolation and purification of the chemical constituents from this plant and subsequent evaluation of their pharmacologic effects will promote the development of new drug and make sure which

  13. Indigoid Photoswitches: Visible Light Responsive Molecular Tools.

    Science.gov (United States)

    Petermayer, Christian; Dube, Henry

    2018-05-15

    less developed compared to, for example, azobenzenes or stilbenes. By testing different substitution patterns, we were able to produce strongly beneficial property combinations in hemithioindigo, hemiindigo, or indigo photoswitches, for example, red-light responsiveness together with very high thermal bistability of the switching states. This is of particular importance for photopharmacological and biological applications of these switches to reduce the damage from high-energy light and to enable deep penetration of the light into tissues. An additional ground state twisting in hemithioindigo allowed us to control the type of light-induced bond rotation simply by the polarity of the solvent. With the aid of time-resolved spectroscopy and quantum yield measurements, we could show that in apolar cyclohexane exclusive double bond rotation takes place while in polar DMSO sole single bond rotation is observed. Such precise control over geometrical changes is of great interest for the construction of future sophisticated molecular machinery. In this field, we have introduced hemithioindigo photoswitches as novel core structure for molecular motors providing very fast directional motions upon irradiation with visible light. The mechanism of the directional rotation adheres to a four-step process, which could directly be observed in situ with a slower second-generation motor. Further applications of indigoid photoswitches were made in our laboratory in the realms of photocontrolled folding and host-guest chemistry as well as in molecular digital information processing showcasing the great versatility and enormous future promise of indigoid photoswitches.

  14. Phenolic characterization and antioxidant capacity of ten autochthonous vines grown in southern Italy / Caratterizzazione fenolica e potere antiossidante di dieci vitigni autoctoni allevati nel Sud Italia

    Directory of Open Access Journals (Sweden)

    Milella Rosa Anna

    2016-01-01

    Full Text Available In plant foods are naturally present some bioactive compounds, that are compounds having or not nutritional value and with biological activity that is expressed in reducing the risk of developing many chronic diseases, therefore leading a key protective effect on our health. Within this group of compounds the antioxidants are included. The importance of antioxidants contained in food is associated with their ability to exert in vivo, in the human body, beneficial effects against chronical- degenerative diseases induced by oxidative stress and age. It has been attributed a positive role to grape polyphenols in terms of increase in endogenous antioxidant defenses, thanks to regulation of genes coding for key enzymes of antioxidant system. For the polyphenols it has also been recognized a specific action of tumor growth inhibition, linked to the modulation of enzymes involved in carcinogenesis or to the inhibition of growth factors and cell proliferation activation. After carbohydrates and acids, the phenolic compounds represent the largest group among grape constituents. The synthesis of these secondary metabolites takes place in two distinct phases of vine growth cycle: fruit set and maturation. The polyphenolic composition contributes to grapes and wine sensory properties, such as color, flavor, astringency, and determines the antioxidant capacity of the extract. These metabolites are mainly related to the variety and their content is influenced by climatic and environmental factors. Among the polyphenols, anthocyanins, hydroxicinnamiltartaric acids, flavonols, flavans, stilbene and resveratrol are of particular interest. Despite numerous studies in the vine-wine industry on polyphenols quantification and qualification, we don't know much about the environmental conditions that affect their synthesis in grapes and how they are extracted from it in wine production. Therefore, the aim of this work has been the study of antioxidant property and

  15. Gas release and leachates at bark storage: Laboratory and field studies. Final report

    International Nuclear Information System (INIS)

    Jirjis, Raida; Andersson, Paal; Aronsson, Paer

    2005-01-01

    stilbenes and the sugars were clearly reduced in spruce bark while the content of fatty a cids was increased. The changes in pine extractives were minimal. The amount of water that was leached after laboratory irrigation experiment was very little due to the accumulation of water in the bark material and its evaporation during storage. The pH value of the leached water was low (3.6-4.6) while the value of the total organic carbon (TOC) was very high reaching up to 15,000 mg/I. The TOC measured in leakage from spruce bark (4.6-6.2 mg TOC/g) was higher than that of pine which was 2.9-4.0 mg/g. In the large-scale storage trial, rapid temperature development was registered reaching around 75 deg C by the end of the storage after 7 weeks. The initial release of total VOC, dominated by monoterpenes, was high but declined within two weeks to less than 5% of the initial value. The total emission during the first 6 weeks was equivalent to 12 g TVOC/I of the surface area of the pile or 20 mg/kg bark. The measurements of VOC in the area around the storage site had an average of 47 μg/m 3 , of which 70% was monoterpenes. This value is well below the hygienic limits and therefore constitutes low risk for the workers. The leached water recovered after irrigation was only 4% of the applied amount and contained, in average, 2400 mg TOC/I which is a very small amount of the total water-extractable fraction of the bark. Our calculations showed that an annual precipitation of 700 mm could yield 84 g TOC/m 2 /y. The general conclusion of this study is that seasonal storage of bark, under conditions similar to those reported here, creates minimal problems concerning fuel quality, VOC emissions and leakage issue. Microbial activity may some times give some concern and using protective masks is recommended. However, it should be stated that storage of very large piles for extended periods could lead to different results and should, therefore, be closely monitored