The impact of antegrade intramedullary nailing start site using the SIGN nail in proximal femoral fractures: A prospective cohort study.

Science.gov (United States)

Mustafa Diab, Mohamed; Wu, Hao-Hua; Eliezer, Edmund; Haonga, Billy; Morshed, Saam; Shearer, David W

2018-02-01

In many low and middle-income countries (LMICs) SIGN nail is commonly used for antegrade femoral intramedullary (IM) nailing, using a start site either at the tip of the greater trochanter or piriformis fossa. While a correct start site is considered an essential technical step; few studies have evaluated the impact of using an erroneous start site. This is particularly relevant in settings with limited access to fluoroscopy to aid in creating a nail entry point. The purpose of this study was to evaluate the impact of antegrade SIGN IM nailing start site on radiographic alignment and health-related quality of life. In this prospective cohort study, adult patients with proximal femur fractures (OTA 32, subtrochanteric zone) treated with antegrade IM SIGN nail at Muhimbili Orthopaedic Institute (MOI), Dar es Salaam, Tanzania were enrolled. Start site was determined on the immediate postoperative X-ray and was graded on a continuous scale based on distance of the IM nail center from the greater trochanteric tip. The primary outcome measurement was coronal alignment on the post-operative x-ray. The secondary outcomes were reoperation rates, RUST scores and EQ5D scores at one year follow-up. Seventy-nine patients were enrolled. 50 of them (63.3%) had complete data at 1year and were included in the final data analysis. Of the fifty patients, nine (18%) had IM nails placed laterally, 26 (52%) medially and 15 (30%) directly over the tip of the greater trochanter. Compared to a start site at the tip or medial to the greater trochanter, a lateral start site was 9 times more likely to result in a varus malalignment (95% CI: 1.42-57.70, p=0.021). Lateral start site was associated with varus malalignment. Although lateral start site was not significantly associated with reoperation, varus deformity was associated with higher reoperation rates. Surgeons should consider avoiding a start site lateral to the tip of the greater trochanter or allow the nail to rotate to avoid

Analysis of the pelE promoter in Erwinia chrysanthemi EC16.

Science.gov (United States)

Gold, S; Nishio, S; Tsuyumu, S; Keen, N T

1992-01-01

The pelE gene of Erwinia chrysanthemi strain EC16 encodes an extracellular pectate lyase protein that is important in virulence on plants. Control of pelE expression is complex, because the gene is regulated by catabolite repression, substrate induction, and growth-phase inhibition. A Tn7-lux reporter gene system was employed to define DNA sequences comprising the pelE promoter. When EC16 cells were grown on medium containing sodium polypectate, pelE transcriptional start sites were observed only at 95 and 96 bases upstream of the translational start site. However, DNA sequences required for pelE expression were also shown by deletion analysis to reside between 196 and 215 base pairs upstream of the translational start site. In addition to these upstream elements, two putative operator sequences that interact with negative regulatory factors occurred downstream of the transcriptional start. Finally, deletion of three bases from a putative catabolite gene activator protein binding site in the pelE promoter eliminated activity. The data demonstrate that the pelE promoter is complex and suggest that it interacts with several regulatory proteins.

Promoting academic and social-emotional school readiness: the head start REDI program.

Science.gov (United States)

Bierman, Karen L; Domitrovich, Celene E; Nix, Robert L; Gest, Scott D; Welsh, Janet A; Greenberg, Mark T; Blair, Clancy; Nelson, Keith E; Gill, Sukhdeep

2008-01-01

Forty-four Head Start classrooms were randomly assigned to enriched intervention (Head Start REDI-Research-based, Developmentally Informed) or "usual practice" conditions. The intervention involved brief lessons, "hands-on" extension activities, and specific teaching strategies linked empirically with the promotion of: (a) social-emotional competencies and (b) language development and emergent literacy skills. Take-home materials were provided to parents to enhance skill development at home. Multimethod assessments of three hundred and fifty-six 4-year-old children tracked their progress over the course of the 1-year program. Results revealed significant differences favoring children in the enriched intervention classrooms on measures of vocabulary, emergent literacy, emotional understanding, social problem solving, social behavior, and learning engagement. Implications are discussed for developmental models of school readiness and for early educational programs and policies.

Promoter2.0: for the recognition of PolII promoter sequences

DEFF Research Database (Denmark)

Knudsen, Steen; Knudsen, Steen

1999-01-01

Motivation : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takesadvantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set ofdiscrete subpatterns with variable separation as one pattern: a promoter. The neural...... of optimization, the algorithm was able todiscriminate between vertebrate promoter and non-promoter sequences in a test set with a correlationcoefficient of 0.63. In addition, all five known transcription start sites on the plus strand of the completeadenovirus genome were within 161 bp of 35 predicted...

Expression of the 90K immunostimulator gene is controlled by a promoter with unique features

DEFF Research Database (Denmark)

Brakebusch, C; Jallal, B; Fusco, O

1997-01-01

T3 cells; however, it contained neither a TATA-box nor a SP1 site and was not GC-rich. No known initiator motif was found around the transcription start site. 5'- and 3'-deletions defined a minimal promoter of 51 base pairs (-66 --> -16), not including the start site, essential and sufficient...... for promoter activity. This minimal promoter showed increased activity after stimulation with interferon-gamma or poly(I.C), a substance mimicking viral infection. Essential for both inductions was the integrity of an interferon regulatory factor element within this sequence, a potential binding site...

Identification of the translational start site of codon-optimized mCherry in Mycobacterium tuberculosis

OpenAIRE

Carroll, Paul; Muwanguzi-Karugaba, Julian; Melief, Eduard; Files, Megan; Parish, Tanya

2014-01-01

Background Fluorescent proteins are used widely as reporter genes in many organisms. We previously codon-optimized mCherry for Mycobacterium tuberculosis and generated expression constructs with high level expression in mycobacteria with multiple uses in vitro and in vivo. However, little is known about the expression of fluorescent proteins in mycobacteria and the translational start codon for mCherry has not been experimentally determined. Results We determined the translational start site ...

Comparative analysis of regulatory elements between Escherichia coli and Klebsiella pneumoniae by genome-wide transcription start site profiling.

Directory of Open Access Journals (Sweden)

Donghyuk Kim

Full Text Available Genome-wide transcription start site (TSS profiles of the enterobacteria Escherichia coli and Klebsiella pneumoniae were experimentally determined through modified 5' RACE followed by deep sequencing of intact primary mRNA. This identified 3,746 and 3,143 TSSs for E. coli and K. pneumoniae, respectively. Experimentally determined TSSs were then used to define promoter regions and 5' UTRs upstream of coding genes. Comparative analysis of these regulatory elements revealed the use of multiple TSSs, identical sequence motifs of promoter and Shine-Dalgarno sequence, reflecting conserved gene expression apparatuses between the two species. In both species, over 70% of primary transcripts were expressed from operons having orthologous genes during exponential growth. However, expressed orthologous genes in E. coli and K. pneumoniae showed a strikingly different organization of upstream regulatory regions with only 20% identical promoters with TSSs in both species. Over 40% of promoters had TSSs identified in only one species, despite conserved promoter sequences existing in the other species. 662 conserved promoters having TSSs in both species resulted in the same number of comparable 5' UTR pairs, and that regulatory element was found to be the most variant region in sequence among promoter, 5' UTR, and ORF. In K. pneumoniae, 48 sRNAs were predicted and 36 of them were expressed during exponential growth. Among them, 34 orthologous sRNAs between two species were analyzed in depth, and the analysis showed that many sRNAs of K. pneumoniae, including pleiotropic sRNAs such as rprA, arcZ, and sgrS, may work in the same way as in E. coli. These results reveal a new dimension of comparative genomics such that a comparison of two genomes needs to be comprehensive over all levels of genome organization.

Promoter proximal polyadenylation sites reduce transcription activity

DEFF Research Database (Denmark)

Andersen, Pia Kjølhede; Lykke-Andersen, Søren; Jensen, Torben Heick

2012-01-01

Gene expression relies on the functional communication between mRNA processing and transcription. We previously described the negative impact of a point-mutated splice donor (SD) site on transcription. Here we demonstrate that this mutation activates an upstream cryptic polyadenylation (CpA) site......, which in turn causes reduced transcription. Functional depletion of U1 snRNP in the context of the wild-type SD triggers the same CpA event accompanied by decreased RNA levels. Thus, in accordance with recent findings, U1 snRNP can shield premature pA sites. The negative impact of unshielded pA sites...... on transcription requires promoter proximity, as demonstrated using artificial constructs and supported by a genome-wide data set. Importantly, transcription down-regulation can be recapitulated in a gene context devoid of splice sites by placing a functional bona fide pA site/transcription terminator within ∼500...

Lessons learned from an installation perspective for chemical demilitarization plant start-up at four operating incineration sites.

Energy Technology Data Exchange (ETDEWEB)

Motz, L.; Decision and Information Sciences

2011-02-21

This study presents the lessons learned by chemical storage installations as they prepared for the start of chemical demilitarization plant operations at the four current chemical incinerator sites in Alabama, Arkansas, Oregon, and Utah. The study included interviews with persons associated with the process and collection of available documents prepared at each site. The goal was to provide useful information for the chemical weapons storage sites in Colorado and Kentucky that will be going through plant start-up in the next few years. The study is not a compendium of what to do and what not to do. The information has been categorized into ten lessons learned; each is discussed individually. Documents that may be useful to the Colorado and Kentucky sites are included in the appendices. This study should be used as a basis for planning and training.

Developing and promoting an intranet site for a drug information service.

Science.gov (United States)

Costerison, Emily C; Graham, Angie S

2008-04-01

The development and promotion of a drug information service (DIS) intranet site are described. Stanford Hospital and Clinics (SHC) is an acute and tertiary care facility with 613 licensed inpatient beds and 48 outpatient clinics. A DIS intranet site was developed to allow better accessibility to pharmacy forms and products (e.g., drug shortage list, reference guides) and to reduce repetitive requests to the DIS. The goal was to continue to provide information to SHC health care providers but allow the drug information specialist to focus on answering clinical questions. The intranet site was completed over a four-month period. The intranet site was divided into seven webpages: DIS overview, pharmacy and therapeutics, frequently asked questions, quick drug reference guide, ask the pharmacist, drug information resources, and referral center. The preparation for and implementation of the promotional phase took approximately two months. Promotional strategies included the creation and dissemination of brochures and stickers. The intranet site went live on January 1, 2007, and the advertising campaign began one month later. The utility of the site was measured for five months by tracking the number of visits to the site, the number of visits to each webpage, and the number of downloaded files. Request volume, caller affiliation, and question types received by the DIS call center were also recorded. Establishing a DIS intranet site required a considerable time investment and a willingness to work with existing infrastructures, such as the marketing and communications department and Web marketing staff.

Downstream Antisense Transcription Predicts Genomic Features That Define the Specific Chromatin Environment at Mammalian Promoters.

Directory of Open Access Journals (Sweden)

Christopher A Lavender

2016-08-01

Full Text Available Antisense transcription is a prevalent feature at mammalian promoters. Previous studies have primarily focused on antisense transcription initiating upstream of genes. Here, we characterize promoter-proximal antisense transcription downstream of gene transcription starts sites in human breast cancer cells, investigating the genomic context of downstream antisense transcription. We find extensive correlations between antisense transcription and features associated with the chromatin environment at gene promoters. Antisense transcription downstream of promoters is widespread, with antisense transcription initiation observed within 2 kb of 28% of gene transcription start sites. Antisense transcription initiates between nucleosomes regularly positioned downstream of these promoters. The nucleosomes between gene and downstream antisense transcription start sites carry histone modifications associated with active promoters, such as H3K4me3 and H3K27ac. This region is bound by chromatin remodeling and histone modifying complexes including SWI/SNF subunits and HDACs, suggesting that antisense transcription or resulting RNA transcripts contribute to the creation and maintenance of a promoter-associated chromatin environment. Downstream antisense transcription overlays additional regulatory features, such as transcription factor binding, DNA accessibility, and the downstream edge of promoter-associated CpG islands. These features suggest an important role for antisense transcription in the regulation of gene expression and the maintenance of a promoter-associated chromatin environment.

Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

International Nuclear Information System (INIS)

Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

2003-01-01

The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

Core Promoter Plasticity Between Maize Tissues and Genotypes Contrasts with Predominance of Sharp Transcription Initiation Sites.

Science.gov (United States)

Mejía-Guerra, María Katherine; Li, Wei; Galeano, Narmer F; Vidal, Mabel; Gray, John; Doseff, Andrea I; Grotewold, Erich

2015-12-01

Core promoters are crucial for gene regulation, providing blueprints for the assembly of transcriptional machinery at transcription start sites (TSSs). Empirically, TSSs define the coordinates of core promoters and other regulatory sequences. Thus, experimental TSS identification provides an essential step in the characterization of promoters and their features. Here, we describe the application of CAGE (cap analysis of gene expression) to identify genome-wide TSSs used in root and shoot tissues of two maize (Zea mays) inbred lines (B73 and Mo17). Our studies indicate that most TSS clusters are sharp in maize, similar to mice, but distinct from Arabidopsis thaliana, Drosophila melanogaster, or zebra fish, in which a majority of genes have broad-shaped TSS clusters. We established that ∼38% of maize promoters are characterized by a broader TATA-motif consensus, and this motif is significantly enriched in genes with sharp TSSs. A noteworthy plasticity in TSS usage between tissues and inbreds was uncovered, with ∼1500 genes showing significantly different dominant TSSs, sometimes affecting protein sequence by providing alternate translation initiation codons. We experimentally characterized instances in which this differential TSS utilization results in protein isoforms with additional domains or targeted to distinct subcellular compartments. These results provide important insights into TSS selection and gene expression in an agronomically important crop. © 2015 American Society of Plant Biologists. All rights reserved.

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

Science.gov (United States)

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

It Starts With Me: Privacy concerns and stigma in the evaluation of a Facebook health promotion intervention.

Science.gov (United States)

Witzel, T Charles; Guise, Andy; Nutland, Will; Bourne, Adam

2016-06-01

Background As efforts continue to increase rates of HIV testing and condom use among at-risk communities in England, organisations have sought use social media for health promotion interventions. As part of a wider evaluation of It Starts With Me (ISWM), a sexual health promotion intervention in England targeting gay and bisexual men and African people through Facebook, this study sought to explore how the online environment shapes end user engagement with sexual health interventions. A primary objective was to explore how privacy concerns can act as a barrier to engagement for the audience of ISWM. A purposive sample of 40 individuals were recruited, who were targeted by the intervention for in-depth interviews. Data collection was in two phases. In the first phase, individuals were sampled based on engagement with online health interventions in general, while in the second phase, all individuals were sampled on the basis of engagement with the intervention. Privacy concerns related to the ecology of social networking sites, issues with implied disclosure and discrimination, as well as uncertainty over control of data. These concerns limited the organic reach of the intervention by confining the intervention to those who already held the norms diffused through it, and by discouraging participants from sharing and commenting on content. Care should be taken to address concerns when designing interventions delivered through social media. Gated interventions may be more beneficial for marginalised communities, while large-scale interventions such as ISWM may provide a useful backdrop for face-to-face interventions.

A strategy for health promotion at multiple corporate sites.

Science.gov (United States)

Alexy, B; Eynon, D

1991-02-01

1. The logistical problems associated with delivery of health promotion programs at multiple corporate sites can be addressed through the use of health education packets. 2. The role of the nurse or health coordinator is critical in assisting and guiding the employee as the health plan is executed. 3. Problematic areas related to implementation of programs at remote sites can be alleviated through careful planning and extensive communication. 4. Advertising, input from employees and staff, and follow up are important in the success of a program.

Single-site catalyst promoters accelerate metal-catalyzed nitroarene hydrogenation

KAUST Repository

Wang, Liang

2018-04-04

Atomically dispersed supported metal catalysts are drawing wide attention because of the opportunities they offer for new catalytic properties combined with efficient use of the metals. We extend this class of materials to catalysts that incorporate atomically dispersed metal atoms as promoters. The catalysts are used for the challenging nitroarene hydrogenation and found to have both high activity and selectivity. The promoters are single-site Sn on TiO2 supports that incorporate metal nanoparticle catalysts. Represented as M/Sn-TiO2 (M = Au, Ru, Pt, Ni), these catalysts decidedly outperform the unpromoted supported metals, even for hydrogenation of nitroarenes substituted with various reducible groups. The high activity and selectivity of these catalysts result from the creation of oxygen vacancies on the TiO2 surface by single-site Sn, which leads to efficient, selective activation of the nitro group coupled with a reaction involving hydrogen atoms activated on metal nanoparticles.

Single-site catalyst promoters accelerate metal-catalyzed nitroarene hydrogenation

KAUST Repository

Wang, Liang; Guan, Erjia; Zhang, Jian; Yang, Junhao; Zhu, Yihan; Han, Yu; Yang, Ming; Cen, Cheng; Fu, Gang; Gates, Bruce C.; Xiao, Feng-Shou

2018-01-01

Atomically dispersed supported metal catalysts are drawing wide attention because of the opportunities they offer for new catalytic properties combined with efficient use of the metals. We extend this class of materials to catalysts that incorporate atomically dispersed metal atoms as promoters. The catalysts are used for the challenging nitroarene hydrogenation and found to have both high activity and selectivity. The promoters are single-site Sn on TiO2 supports that incorporate metal nanoparticle catalysts. Represented as M/Sn-TiO2 (M = Au, Ru, Pt, Ni), these catalysts decidedly outperform the unpromoted supported metals, even for hydrogenation of nitroarenes substituted with various reducible groups. The high activity and selectivity of these catalysts result from the creation of oxygen vacancies on the TiO2 surface by single-site Sn, which leads to efficient, selective activation of the nitro group coupled with a reaction involving hydrogen atoms activated on metal nanoparticles.

Efficient use of a translation start codon in BDNF exon I.

Science.gov (United States)

Koppel, Indrek; Tuvikene, Jürgen; Lekk, Ingrid; Timmusk, Tõnis

2015-09-01

The brain-derived neurotrophic factor (BDNF) gene contains a number of 5' exons alternatively spliced with a common 3' exon. BDNF protein is synthesized from alternative transcripts as a prepro-precursor encoded by the common 3' exon IX, which has a translation start site 21 bp downstream of the splicing site. BDNF mRNAs containing exon I are an exception to this arrangement as the last three nucleotides of this exon constitute an in-frame AUG. Here, we show that this AUG is efficiently used for translation initiation in PC12 cells and cultured cortical neurons. Use of exon I-specific AUG produces higher levels of BDNF protein than use of the common translation start site, resulting from a higher translation rate. No differences in protein degradation, constitutive or regulated secretion were detected between BDNF isoforms with alternative 5' termini. As the BDNF promoter preceding exon I is known to be highly regulated by neuronal activity, our results suggest that the function of this translation start site may be efficient stimulus-dependent synthesis of BDNF protein. The brain-derived neurotrophic factor (BDNF) gene contains multiple untranslated 5' exons alternatively spliced to one common protein-coding 3' exon. However, exon I contains an in-frame ATG in a favorable translation context. Here, we show that use of this ATG is associated with more efficient protein synthesis than the commonly used ATG in exon IX. © 2015 International Society for Neurochemistry.

The fitness landscapes of cis-acting binding sites in different promoter and environmental contexts.

Directory of Open Access Journals (Sweden)

Ryan K Shultzaberger

2010-07-01

Full Text Available The biophysical nature of the interaction between a transcription factor and its target sequences in vitro is sufficiently well understood to allow for the effects of DNA sequence alterations on affinity to be predicted. But even in relatively simple in vivo systems, the complexities of promoter organization and activity have made it difficult to predict how altering specific interactions between a transcription factor and DNA will affect promoter output. To better understand this, we measured the relative fitness of nearly all Escherichia coli sigma(70 -35 binding sites in different promoter and environmental contexts by competing four randomized -35 promoter libraries controlling the expression of the tetracycline resistance gene (tetagainst each other in increasing concentrations of drug. We sequenced populations after competition to determine the relative enrichment of each -35 sequence. We observed a consistent relationship between the frequency of recovery of each -35 binding site and its predicted affinity for sigma(70 that varied depending on the sequence context of the promoter and drug concentration. Overall the relative fitness of each promoter could be predicted by a simple thermodynamic model of transcriptional regulation, in which the rate of transcriptional initiation (and hence fitness is dependent upon the overall stability of the initiation complex, which in turn is dependent upon the energetic contributions of all sites within the complex. As implied by this model, a decrease in the free energy of association at one site could be compensated for by an increase in the binding energy at another to produce a similar output. Furthermore, these data show that a large and continuous range of transcriptional outputs can be accessed by merely changing the -35, suggesting that evolved or engineered mutations at this site could allow for subtle and precise control over gene expression.

Identification of the srtC1 Transcription Start Site and Catalytically Essential Residues Required for Actinomyces oris T14V SrtC1 Activity

Science.gov (United States)

2011-07-27

report the identification of the tran scription starting site of the srtC1 determined by rapid amplification of cDNA ends (RACE) method and several...When needed, kanamycin and trimethoprim were included in growth media at concentra tions of 50 and 100mg mL1, respectively. RNA isolation and...tation, resuspended in a small volume of RNase free water and stored at 80 1C. To determine the transcription start site(s) of A. oris srtC1, 50RACE PCR

Systematic clustering of transcription start site landscapes

DEFF Research Database (Denmark)

Zhao, Xiaobei; Valen, Eivind; Parker, Brian J

2011-01-01

and earlier studies have shown that the TSSDs have biological implications in both regulation and function. However, no systematic study has been made to explore how many types of TSSDs and by extension core promoters exist and to understand which biological features distinguish them. In this study, we...... two-class separations of promoter based on TSS distributions are motivated, but the ultra-sharp TSS distributions will confound downstream analyses if not removed....

Promoting cold-start items in recommender systems.

Science.gov (United States)

Liu, Jin-Hu; Zhou, Tao; Zhang, Zi-Ke; Yang, Zimo; Liu, Chuang; Li, Wei-Min

2014-01-01

As one of the major challenges, cold-start problem plagues nearly all recommender systems. In particular, new items will be overlooked, impeding the development of new products online. Given limited resources, how to utilize the knowledge of recommender systems and design efficient marketing strategy for new items is extremely important. In this paper, we convert this ticklish issue into a clear mathematical problem based on a bipartite network representation. Under the most widely used algorithm in real e-commerce recommender systems, the so-called item-based collaborative filtering, we show that to simply push new items to active users is not a good strategy. Interestingly, experiments on real recommender systems indicate that to connect new items with some less active users will statistically yield better performance, namely, these new items will have more chance to appear in other users' recommendation lists. Further analysis suggests that the disassortative nature of recommender systems contributes to such observation. In a word, getting in-depth understanding on recommender systems could pave the way for the owners to popularize their cold-start products with low costs.

Promoting Cold-Start Items in Recommender Systems

Science.gov (United States)

Liu, Jin-Hu; Zhou, Tao; Zhang, Zi-Ke; Yang, Zimo; Liu, Chuang; Li, Wei-Min

2014-01-01

As one of the major challenges, cold-start problem plagues nearly all recommender systems. In particular, new items will be overlooked, impeding the development of new products online. Given limited resources, how to utilize the knowledge of recommender systems and design efficient marketing strategy for new items is extremely important. In this paper, we convert this ticklish issue into a clear mathematical problem based on a bipartite network representation. Under the most widely used algorithm in real e-commerce recommender systems, the so-called item-based collaborative filtering, we show that to simply push new items to active users is not a good strategy. Interestingly, experiments on real recommender systems indicate that to connect new items with some less active users will statistically yield better performance, namely, these new items will have more chance to appear in other users' recommendation lists. Further analysis suggests that the disassortative nature of recommender systems contributes to such observation. In a word, getting in-depth understanding on recommender systems could pave the way for the owners to popularize their cold-start products with low costs. PMID:25479013

5′UTR of the Neurogenic bHLH Nex1/MATH-2/NeuroD6 Gene Is Regulated by Two Distinct Promoters Through CRE and C/EBP Binding Sites

Science.gov (United States)

Uittenbogaard, Martine; Martinka, Debra L.; Johnson, Peter F.; Vinson, Charles; Chiaramello, Anne

2009-01-01

Expression of the bHLH transcription factor Nex1/MATH-2/NeuroD6, a member of the NeuroD subfamily, parallels overt neuronal differentiation and synaptogenesis during brain development. Our previous studies have shown that Nex1 is a critical effector of the NGF pathway and promotes neuronal differentiation and survival of PC12 cells in the absence of growth factors. In this study, we investigated the transcriptional regulation of the Nex1 gene during NGF-induced neuronal differentiation. We found that Nex1 expression is under the control of two conserved promoters, Nex1-P1 and Nex1-P2, located in two distinct non-coding exons. Both promoters are TATA-less with multiple transcription start sites, and are activated on NGF or cAMP exposure. Luciferase-reporter assays showed that the Nex1-P2 promoter activity is stronger than the Nex1-P1 promoter activity, which supports the previously reported differential expression levels of Nex1 transcripts throughout brain development. Using a combination of DNaseI footprinting, EMSA assays, and site-directed mutagenesis, we identified the essential regulatory elements within the first 2 kb of the Nex1 5′UTR. The Nex1-P1 promoter is mainly regulated by a conserved CRE element, whereas the Nex1-P2 promoter is under the control of a conserved C/EBP binding site. Overexpression of wild-type C/EBPβ resulted in increased Nex1-P2 promoter activity in NGF-differentiated PC12 cells. The fact that Nex1 is a target gene of C/EBPβ provides new insight into the C/EBP transcriptional cascade known to promote neurogenesis, while repressing gliogenesis. PMID:17075921

The promoter for a variant surface glycoprotein gene expression site in Trypanosoma brucei

NARCIS (Netherlands)

Zomerdijk, J. C.; Ouellette, M.; ten Asbroek, A. L.; Kieft, R.; Bommer, A. M.; Clayton, C. E.; Borst, P.

1990-01-01

The variant-specific surface glycoprotein (VSG) gene 221 of Trypanosoma brucei is transcribed as part of a 60 kb expression site (ES). We have identified the promoter controlling this multigene transcription unit by the use of 221 chromosome-enriched DNA libraries and VSG gene 221 expression site

Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

International Nuclear Information System (INIS)

Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

1987-01-01

The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

CAGE-defined promoter regions of the genes implicated in Rett Syndrome

DEFF Research Database (Denmark)

Vitezic, Morana; Bertin, Nicolas; Andersson, Robin

2014-01-01

BACKGROUND: Mutations in three functionally diverse genes cause Rett Syndrome. Although the functions of Forkhead box G1 (FOXG1), Methyl CpG binding protein 2 (MECP2) and Cyclin-dependent kinase-like 5 (CDKL5) have been studied individually, not much is known about their relation to each other...... reveal the predominantly used transcription start sites (TSSs) for each gene including novel transcription start sites for FOXG1. We show that FOXG1 expression is poorly correlated with the expression of MECP2 and CDKL5. We identify promoter shapes for each TSS, the predicted location of enhancers...

Online social networking sites-a novel setting for health promotion?

Science.gov (United States)

Loss, Julika; Lindacher, Verena; Curbach, Janina

2014-03-01

Among adolescents, online social networking sites (SNS) such as Facebook are popular platforms for social interaction and may therefore be considered as 'novel settings' that could be exploited for health promotion. In this article, we examine the relevant definitions in health promotion and literature in order to analyze whether key characteristics of 'settings for health promotion' and the socio-ecological settings approach can be transferred to SNS. As many of our daily activities have shifted to cyberspace, we argue that online social interaction may gain more importance than geographic closeness for defining a 'setting'. While exposition to positive references to risk behavior by peers may render the SNS environment detrimental to health, SNS may allow people to create their own content and therefore foster participation. However, those health promotion projects delivered on SNS up until today solely relied on health education directed at end users. It remains unclear how health promotion on SNS can meet other requirements of the settings approach (e.g. building partnerships, changing the environment). As yet, one should be cautious in terming SNS a 'setting'. Copyright © 2013 Elsevier Ltd. All rights reserved.

The promoter for intestinal cell kinase is head-to-head with F-Box 9 and contains functional sites for TCF7L2 and FOXA factors

Directory of Open Access Journals (Sweden)

Cohn Steven M

2010-05-01

Full Text Available Abstract Background Intestinal cell kinase (ICK; GeneID 22858 is a conserved MAPK and CDK-like kinase that is widely expressed in human tissues. Data from the Cancer Genome Anatomy Project indicated ICK mRNA is increased in cancer, and that its expression correlated with expression of mRNA for an uncharacterized F-box protein, FBX9 (GeneID: 26268. ICK and FBX9 genes are arranged head-to-head on opposite strands, with start sites for transcription separated by ~3.3 kb. We hypothesized ICK and FBX9 are potentially important genes in cancer controlled by a bidirectional promoter. Results We assessed promoter activity of the intergenic region in both orientations in cancer cell lines derived from breast (AU565, SKBR3, colon (HCT-15, KM12, and stomach (AGS cancers, as well as in embryonic human kidney (HEK293T cells. The intergenic segment was active in both orientations in all of these lines, and ICK promoter activity was greater than FBX9 promoter activity. Results from deletions and truncations defined a minimal promoter for ICK, and revealed that repressors and enhancers differentially regulate ICK versus FBX9 promoter activity. The ICK promoter contains consensus motifs for several FOX-family transcription factors that align when mouse and human are compared using EMBOSS. FOXA1 and FOXA2 increase luciferase activity of a minimal promoter 10-20 fold in HEK293T cells. Consensus sites for TCF7L2 (TCF4 (Gene Id: 6934 are also present in both mouse and human. The expression of β-catenin increased activity of the minimal promoter ~10 fold. ICK reference mRNAs (NM_014920.3, NM_016513 are expressed in low copy number and increased in some breast cancers, using a ten base tag 5'-TCAACCTTAT-3' specific for both ICK transcripts. Conclusion ICK and FBX9 are divergently transcribed from a bidirectional promoter that is GC-rich and contains a CpG island. A minimal promoter for ICK contains functional sites for β-cateinin/TCF7L2 and FOXA. These data are

Web site development: applying aesthetics to promote breast health education and awareness.

Science.gov (United States)

Thomas, Barbara; Goldsmith, Susan B; Forrest, Anne; Marshall, Renée

2002-01-01

This article describes the process of establishing a Web site as part of a collaborative project using visual art to promote breast health education. The need for a more "user-friendly" comprehensive breast health Web site that is aesthetically rewarding was identified after an analysis of current Web sites available through the World Wide Web. Two predetermined sets of criteria, accountability and aesthetics, were used to analyze these sites and to generate ideas for creating a breast health education Web site using visual art. Results of the analyses conducted are included as well as the factors to consider for incorporating into a Web site. The process specified is thorough and can be applied to establish a Web site that is aesthetically rewarding and informative for a variety of educational purposes.

Multiple distinct stimuli increase measured nucleosome occupancy around human promoters.

Directory of Open Access Journals (Sweden)

Chuong D Pham

Full Text Available Nucleosomes can block access to transcription factors. Thus the precise localization of nucleosomes relative to transcription start sites and other factor binding sites is expected to be a critical component of transcriptional regulation. Recently developed microarray approaches have allowed the rapid mapping of nucleosome positions over hundreds of kilobases (kb of human genomic DNA, although these approaches have not yet been widely used to measure chromatin changes associated with changes in transcription. Here, we use custom tiling microarrays to reveal changes in nucleosome positions and abundance that occur when hormone-bound glucocorticoid receptor (GR binds to sites near target gene promoters in human osteosarcoma cells. The most striking change is an increase in measured nucleosome occupancy at sites spanning ∼1 kb upstream and downstream of transcription start sites, which occurs one hour after addition of hormone, but is lost at 4 hours. Unexpectedly, this increase was seen both on GR-regulated and GR-non-regulated genes. In addition, the human SWI/SNF chromatin remodeling factor (a GR co-activator was found to be important for increased occupancy upon hormone treatment and also for low nucleosome occupancy without hormone. Most surprisingly, similar increases in nucleosome occupancy were also seen on both regulated and non-regulated promoters during differentiation of human myeloid leukemia cells and upon activation of human CD4+ T-cells. These results indicate that dramatic changes in chromatin structure over ∼2 kb of human promoters may occur genomewide and in response to a variety of stimuli, and suggest novel models for transcriptional regulation.

Study on the binding sites of radiosensitivity associated transcription factor in the promoter region of Ier5 gene

International Nuclear Information System (INIS)

Cui Wei; Yin Lingling; Dong Lingyue

2012-01-01

Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)

A Multilevel Approach to Breastfeeding Promotion: Using Healthy Start to Deliver Individual Support and Drive Collective Impact.

Science.gov (United States)

Leruth, Chelsey; Goodman, Jacqueline; Bragg, Brian; Gray, Dara

2017-12-01

Purpose Breastfeeding has been linked to a host of positive health effects for women and children. However, disparities in breastfeeding initiation and duration prevent many low-income and African-American women from realizing these benefits. Existing breastfeeding promotion efforts often do not reach women who need support the most. In response, the Westside Healthy Start program (WHS), located in Chicago, Illinois, developed an ongoing multilevel approach to breastfeeding promotion. Description Key elements of our WHS breastfeeding model include individual education and counseling from pregnancy to 6 months postpartum and partnership with a local safety-net hospital to implement the Baby-Friendly Hospital Initiative and provide lactation support to delivering patients. Assessment In the year our model was implemented, 44.6% (49/110) of prenatal WHS participants reported that they planned to breastfeed, and 67.0% (183/273) of delivered participants initiated. Among participants reaching 6 months postpartum, 10.5% (9/86) were breastfeeding. WHS also had 2667 encounters with women delivering at our partner hospital during breastfeeding rounds, with 65.1% of contacts initiating. Community data was not available to assess the efficacy of our model at the local level. However, WHS participants fared better than all delivering patients at our partner hospital, where 65.0% initiated in 2015. Conclusion Healthy Start programs are a promising vehicle to improve breastfeeding initiation at the individual and community level. Additional evaluation is necessary to understand barriers to duration and services needed for this population.

Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.

Science.gov (United States)

Tencomnao, T; Yu, R K; Kapitonov, D

2001-02-16

UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.

A systematic examination of the use of Online social networking sites for sexual health promotion

Directory of Open Access Journals (Sweden)

Hellard Margaret E

2011-07-01

Full Text Available Abstract Background In recent years social networking sites (SNSs have grown rapidly in popularity. The popularity of these sites, along with their interactive functions, offer a novel environment in which to deliver health promotion messages. The aim of this paper is to examine the extent to which SNSs are currently being used for sexual health promotion and describe the breadth of these activities. Methods We conducted a systematic search of published scientific literature, electronic sources (general and scientific search engines, blogs and SNSs (Facebook, MySpace to identify existing sexual health promotion activities using SNSs. Health promotion activities were eligible for inclusion if they related to sexual health or behaviour, utilised one or more SNSs, and involved some element of health promotion. Information regarding the source and type of health promotion activity, target population and site activity were extracted. Results 178 sexual health promotion activities met the inclusion criteria and were included in the review; only one activity was identified through a traditional systematic search of the published scientific literature. Activities most commonly used one SNS, were conducted by not-for-profit organisations, targeted young people and involved information delivery. Facebook was the most commonly used SNS (used by 71% of all health promotion activities identified, followed by MySpace and Twitter. Seventy nine percent of activities on MySpace were considered inactive as there had been no online posts within the past month, compared to 22% of activities using Facebook and 14% of activities using Twitter. The number of end-users and posts in the last seven days varied greatly between health promotion activities. Conclusions SNSs are being used for sexual health promotion, although the extent to which they are utilised varies greatly, and the vast majority of activities are unreported in the scientific literature. Future studies

A systematic examination of the use of Online social networking sites for sexual health promotion

Science.gov (United States)

2011-01-01

Background In recent years social networking sites (SNSs) have grown rapidly in popularity. The popularity of these sites, along with their interactive functions, offer a novel environment in which to deliver health promotion messages. The aim of this paper is to examine the extent to which SNSs are currently being used for sexual health promotion and describe the breadth of these activities. Methods We conducted a systematic search of published scientific literature, electronic sources (general and scientific search engines, blogs) and SNSs (Facebook, MySpace) to identify existing sexual health promotion activities using SNSs. Health promotion activities were eligible for inclusion if they related to sexual health or behaviour, utilised one or more SNSs, and involved some element of health promotion. Information regarding the source and type of health promotion activity, target population and site activity were extracted. Results 178 sexual health promotion activities met the inclusion criteria and were included in the review; only one activity was identified through a traditional systematic search of the published scientific literature. Activities most commonly used one SNS, were conducted by not-for-profit organisations, targeted young people and involved information delivery. Facebook was the most commonly used SNS (used by 71% of all health promotion activities identified), followed by MySpace and Twitter. Seventy nine percent of activities on MySpace were considered inactive as there had been no online posts within the past month, compared to 22% of activities using Facebook and 14% of activities using Twitter. The number of end-users and posts in the last seven days varied greatly between health promotion activities. Conclusions SNSs are being used for sexual health promotion, although the extent to which they are utilised varies greatly, and the vast majority of activities are unreported in the scientific literature. Future studies should examine the key

A systematic examination of the use of online social networking sites for sexual health promotion.

Science.gov (United States)

Gold, Judy; Pedrana, Alisa E; Sacks-Davis, Rachel; Hellard, Margaret E; Chang, Shanton; Howard, Steve; Keogh, Louise; Hocking, Jane S; Stoove, Mark A

2011-07-21

In recent years social networking sites (SNSs) have grown rapidly in popularity. The popularity of these sites, along with their interactive functions, offer a novel environment in which to deliver health promotion messages. The aim of this paper is to examine the extent to which SNSs are currently being used for sexual health promotion and describe the breadth of these activities. We conducted a systematic search of published scientific literature, electronic sources (general and scientific search engines, blogs) and SNSs (Facebook, MySpace) to identify existing sexual health promotion activities using SNSs. Health promotion activities were eligible for inclusion if they related to sexual health or behaviour, utilised one or more SNSs, and involved some element of health promotion. Information regarding the source and type of health promotion activity, target population and site activity were extracted. 178 sexual health promotion activities met the inclusion criteria and were included in the review; only one activity was identified through a traditional systematic search of the published scientific literature. Activities most commonly used one SNS, were conducted by not-for-profit organisations, targeted young people and involved information delivery. Facebook was the most commonly used SNS (used by 71% of all health promotion activities identified), followed by MySpace and Twitter. Seventy nine percent of activities on MySpace were considered inactive as there had been no online posts within the past month, compared to 22% of activities using Facebook and 14% of activities using Twitter. The number of end-users and posts in the last seven days varied greatly between health promotion activities. SNSs are being used for sexual health promotion, although the extent to which they are utilised varies greatly, and the vast majority of activities are unreported in the scientific literature. Future studies should examine the key factors for success among those

From BookStart to BookSmart : about the importance of an early start with parent-child reading

NARCIS (Netherlands)

Berg, Heleen van den

2015-01-01

BookStart has been developed to enhance parent-child verbal interactions in early childhood by promoting book sharing. Parents receive a voucher for a baby book and free access to baby books in the library. In a large-scale research, we found that if parents complied with the BookStart suggestion to

Sexual health promotion on social networking sites: a process evaluation of The FaceSpace Project.

Science.gov (United States)

Nguyen, Phuong; Gold, Judy; Pedrana, Alisa; Chang, Shanton; Howard, Steve; Ilic, Olivia; Hellard, Margaret; Stoove, Mark

2013-07-01

This article reports findings from an evaluation of reach and engagement of The FaceSpace Project, a novel sexual health promotion project delivered through social networking sites that targeted young people aged 16-29 years. Multiple methods were used to evaluate project reach and engagement. The evaluation focussed on quantitative data (online usage statistics, online surveys), complemented by available qualitative data (project team meeting notes). The project reached 900 fans who were mostly between 18 and 34 years of age. The most successful ways of increasing audience reach were via Facebook advertisements and tagging photos of young people attending a music festival on the project Facebook page. Peaks in Facebook page interactions (comments and "likes") coincided with recruitment peaks and when videos were posted. However, video views varied greatly between postings. Feedback from the project team for increasing engagement in future social networking site interventions included having one centralized Facebook page and using episodic videos. This evaluation is among the first to assess the use of social networking sites for sexual health promotion and provides information to inform the implementation and evaluation of future projects using new media. Social networking sites offer great potential to reach and engage young people for sexual health promotion. However, further work is required to improve implementation and promote audience reach and engagement as well as to determine effectiveness of social networking sites in changing knowledge, attitudes, and behaviors. Copyright © 2013 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

Expression analysis of four flower-specific promoters of Brassica spp ...

African Journals Online (AJOL)

The 5'-flanking region of ca. 1200 bp upstream of the translation start site (TSS) of a putative cell wall protein gene was cloned from Brassica campestris, B. chinensis, B. napus and B. oleracea, and transferred to tobacco via Agrobacterium-mediation after fused to promoter-less beta-glucuronidase (GUS) reporter gene.

Determine the Impact of Novel BRCA1 Translation Start Sites on Therapy Resistance in Ovarian Cancer

Science.gov (United States)

2017-09-01

Award Number: W81XWH-15-1-0197 TITLE: PRINCIPAL INVESTIGATOR: Neil Johnson, Ph.D. CONTRACTING ORGANIZATION: Institute for Cancer Research...Therapy Resistance in Ovarian Cancer The views, opinions and/or findings contained in this report are those of the author(s) and should not be...Start Sites on Therapy 5b. GRANT NUMBER Resistance in Ovarian Cancer W81XWH-15-1-0197 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER Neil

A promoter-level mammalian expression atlas

KAUST Repository

Forest, Alistair R R

2014-03-26

Regulated transcription controls the diversity, developmental pathways and spatial organization of the hundreds of cell types that make up a mammal. Using single-molecule cDNA sequencing, we mapped transcription start sites (TSSs) and their usage in human and mouse primary cells, cell lines and tissues to produce a comprehensive overview of mammalian gene expression across the human body. We find that few genes are truly ‘housekeeping’, whereas many mammalian promoters are composite entities composed of several closely separated TSSs, with independent cell-type-specific expression profiles. TSSs specific to different cell types evolve at different rates, whereas promoters of broadly expressed genes are the most conserved. Promoter-based expression analysis reveals key transcription factors defining cell states and links them to binding-site motifs. The functions of identified novel transcripts can be predicted by coexpression and sample ontology enrichment analyses. The functional annotation of the mammalian genome 5 (FANTOM5) project provides comprehensive expression profiles and functional annotation of mammalian cell-type-specific transcriptomes with wide applications in biomedical research.

A promoter-level mammalian expression atlas

KAUST Repository

Forest, Alistair R R; Kawaji, Hideya; Rehli, Michael; Baillie, John Kenneth; De Hoon, Michiel Jl L; Haberle, Vanja; Lassmann, Timo; Kulakovskiy, Ivan V.; Lizio, Marina; Itoh, Masayoshi; Andersson, Robin; Iida, Kei; Ikawa, Tomokatsu; Jankovic, Boris R.; Jia, Hui; Joshi, Anagha Madhusudan; Jurman, Giuseppe; Kaczkowski, Bogumił; Kai, Chieko; Kaida, Kaoru; Kaiho, Ai; Mungall, Christopher J.; Kajiyama, Kazuhiro; Kanamori-Katayama, Mutsumi; Kasianov, Artem S.; Kasukawa, Takeya; Katayama, Shintaro; Kato, Sachi; Kawaguchi, Shuji; Kawamoto, Hiroshi; Kawamura, Yuki I.; Kawashima, Tsugumi; Meehan, Terrence F.; Kempfle, Judith S.; Kenna, Tony J.; Kere, Juha; Khachigian, Levon M.; Kitamura, Toshio; Klinken, Svend Peter; Knox, Alan; Kojima, Miki; Kojima, Soichi; Kondo, Naoto; Schmeier, Sebastian; Koseki, Haruhiko; Koyasu, Shigeo; Krampitz, Sarah; Kubosaki, Atsutaka; Kwon, Andrew T.; Laros, Jeroen F J; Lee, Weonju; Lennartsson, Andreas; Li, Kang; Lilje, Berit; Bertin, Nicolas; Lipovich, Leonard; MacKay-Sim, Alan; Manabe, Riichiroh; Mar, Jessica; Marchand, Benoî t; Mathelier, Anthony; Mejhert, Niklas; Meynert, Alison M.; Mizuno, Yosuke; De Morais, David A Lima; Jø rgensen, Mette Christine; Morikawa, Hiromasa; Morimoto, Mitsuru; Moro, Kazuyo; Motakis, Efthymios; Motohashi, Hozumi; Mummery, Christine L.; Murata, Mitsuyoshi; Nagao-Sato, Sayaka; Nakachi, Yutaka; Nakahara, Fumio; Dimont, Emmanuel; Nakamura, Toshiyuki; Nakamura, Yukio; Nakazato, Kenichi; Van Nimwegen, Erik; Ninomiya, Noriko; Nishiyori, Hiromi; Noma, Shohei; Nozaki, Tadasuke; Ogishima, Soichi; Ohkura, Naganari; Arner, Erik; Ohmiya, Hiroko; Ohno, Hiroshi; Ohshima, Mitsuhiro; Okada-Hatakeyama, Mariko; Okazaki, Yasushi; Orlando, Valerio; Ovchinnikov, Dmitry A.; Pain, Arnab; Passier, Robert C J J; Patrikakis, Margaret; Schmidl, Christian; Persson, Helena A.; Piazza, Silvano; Prendergast, James G D; Rackham, Owen J L; Ramilowski, Jordan A.; Rashid, Mamoon; Ravasi, Timothy; Rizzu, Patrizia; Roncador, Marco; Roy, Sugata; Schaefer, Ulf; Rye, Morten Beck; Saijyo, Eri; Sajantila, Antti; Saka, Akiko; Sakaguchi, Shimon; Sakai, Mizuho; Sato, Hiroki; Satoh, Hironori; Savvi, Suzana; Saxena, Alka; Medvedeva, Yulia; Schneider, Claudio H.; Schultes, Erik A.; Schulze-Tanzil, Gundula G.; Schwegmann, Anita; Sengstag, Thierry; Sheng, Guojun; Shimoji, Hisashi; Shimoni, Yishai; Shin, Jay W.; Simon, Chris M.; Plessy, Charles; Sugiyama, Daisuke; Sugiyama, Takaaki; Suzuki, Masanori; Suzuki, Naoko; Swoboda, Rolf K.; 't Hoen, Peter Ac Chr; Tagami, Michihira; Tagami, Naokotakahashi; Takai, Jun; Tanaka, Hiroshi; Vitezic, Morana; Tatsukawa, Hideki; Tatum, Zuotian; Thompson, Mark; Toyoda, Hiroo; Toyoda, Tetsuro; Valen, Eivind; Van De Wetering, Marc L.; Van Den Berg, Linda M.; Verardo, Roberto; Vijayan, Dipti; Severin, Jessica M.; Vorontsov, Ilya E.; Wasserman, Wyeth W.; Watanabe, Shoko; Wells, Christine A.; Winteringham, Louise Natalie; Wolvetang, Ernst Jurgen; Wood, Emily J.; Yamaguchi, Yoko; Yamamoto, Masayuki; Yoneda, Misako; Semple, Colin Am M; Yonekura, Yohei; Yoshida, Shigehiro; Zabierowski, Susan E.; Zhang, Peter; Zhao, Xiaobei; Zucchelli, Silvia; Summers, Kim M.; Suzuki, Harukazu; Daub, Carsten Olivier; Kawai, Jun; Ishizu, Yuri; Heutink, Peter; Hide, Winston; Freeman, Tom C.; Lenhard, Boris; Bajic, Vladimir B.; Taylor, Martin S.; Makeev, Vsevolod J.; Sandelin, Albin; Hume, David A.; Carninci, Piero; Young, Robert S.; Hayashizaki, Yoshihide Yoshihide; Francescatto, Margherita; Altschuler, Intikhab Alam; Albanese, Davide; Altschule, Gabriel M.; Arakawa, Takahiro; Archer, John A.C.; Arner, Peter; Babina, Magda; Rennie, Sarah; Balwierz, Piotr J.; Beckhouse, Anthony G.; Pradhan-Bhatt, Swati; Blake, Judith A.; Blumenthal, Antje; Bodega, Beatrice; Bonetti, Alessandro; Briggs, James A.; Brombacher, Frank; Burroughs, Alexander Maxwell; Califano, Andrea C.; Cannistraci, Carlo; Carbajo, Daniel; Chen, Yun; Chierici, Marco; Ciani, Yari; Clevers, Hans C.; Dalla, Emiliano; Davis, Carrie Anne; Detmar, Michael J.; Diehl, Alexander D.; Dohi, Taeko; Drablø s, Finn; Edge, Albert SB B; Edinger, Matthias G.; Ekwall, Karl; Endoh, Mitsuhiro; Enomoto, Hideki; Fagiolini, Michela; Fairbairn, Lynsey R.; Fang, Hai; Farach-Carson, Mary Cindy; Faulkner, Geoffrey J.; Favorov, Alexander V.; Fisher, Malcolm E.; Frith, Martin C.; Fujita, Rie; Fukuda, Shiro; Furlanello, Cesare; Furuno, Masaaki; Furusawa, Junichi; Geijtenbeek, Teunis Bh H; Gibson, Andrew P.; Gingeras, Thomas R.; Goldowitz, Dan; Gough, Julian; Guhl, Sven; Guler, Reto; Gustincich, Stefano; Ha, Thomas; Hamaguchi, Masahide; Hara, Mitsuko; Harbers, Matthias; Harshbarger, Jayson; Hasegawa, Akira; Hasegawa, Yuki; Hashimoto, Takehiro; Herlyn, Meenhard F.; Hitchens, Kelly J.; Sui, Shannan J Ho; Hofmann, Oliver M.; Hoof, Ilka; Hori, Fumi; Huminiecki, Łukasz B.

2014-01-01

Regulated transcription controls the diversity, developmental pathways and spatial organization of the hundreds of cell types that make up a mammal. Using single-molecule cDNA sequencing, we mapped transcription start sites (TSSs) and their usage in human and mouse primary cells, cell lines and tissues to produce a comprehensive overview of mammalian gene expression across the human body. We find that few genes are truly ‘housekeeping’, whereas many mammalian promoters are composite entities composed of several closely separated TSSs, with independent cell-type-specific expression profiles. TSSs specific to different cell types evolve at different rates, whereas promoters of broadly expressed genes are the most conserved. Promoter-based expression analysis reveals key transcription factors defining cell states and links them to binding-site motifs. The functions of identified novel transcripts can be predicted by coexpression and sample ontology enrichment analyses. The functional annotation of the mammalian genome 5 (FANTOM5) project provides comprehensive expression profiles and functional annotation of mammalian cell-type-specific transcriptomes with wide applications in biomedical research.

Effect of starting microstructure upon the nucleation sites and distribution of graphite particles during a graphitising anneal of an experimental medium-carbon machining steel

Energy Technology Data Exchange (ETDEWEB)

Inam, A., E-mail: aqil.ceet@pu.edu.pk; Brydson, R., E-mail: mtlrmdb@leeds.ac.uk; Edmonds, D.V., E-mail: d.v.edmonds@leeds.ac.uk

2015-08-15

The potential for using graphite particles as an internal lubricant during machining is considered. Graphite particles were found to form during graphitisation of experimental medium-carbon steel alloyed with Si and Al. The graphite nucleation sites were strongly influenced by the starting microstructure, whether ferrite–pearlite, bainite or martensite, as revealed by light and electron microscopy. Favourable nucleation sites in the ferrite–pearlite starting microstructure were, not unexpectedly, found to be located within pearlite colonies, no doubt due to the presence of abundant cementite as a source of carbon. In consequence, the final distribution of graphite nodules in ferrite–pearlite microstructures was less uniform than for the bainite microstructure studied. In the case of martensite, this study found a predominance of nucleation at grain boundaries, again leading to less uniform graphite dispersions. - Highlights: • Metallography of formation of graphite particles in experimental carbon steel. • Potential for using graphite in steel as an internal lubricant during machining. • Microstructure features expected to influence improved machinability studied. • Influence of pre-anneal starting microstructure on graphite nucleation sites. • Influence of pre-anneal starting microstructure on graphite distribution. • Potential benefit is new free-cutting steel compositions without e.g. Pb alloying.

Development of portal web site for fostering of risk literacy 'risk information navigator'

International Nuclear Information System (INIS)

Shobu, Nobuhiro; Mitsui, Seiichiro; Nakamura, Hirofumi

2004-01-01

Risk communication activities are important for promoting mutual understanding between local communities and Japan Nuclear Cycle Development Institutes (JNC). In addition to conventional public relation activities, the risk communication study team of JNC Tokai Works has started practical studies to promote further mutual understanding with its local communities. This paper reports the design and concept of a web site for the fostering of risk literacy, the 'Risk Information Navigator', that was developed as one of the risk communication methods, and surveys the web site from the user's perspective. (author)

NAP SACC: Implementation of an Obesity Prevention Intervention in an American Indian Head Start Program.

Science.gov (United States)

Mattingly, Julie A; Andresen, Pamela A

2016-01-01

Low-income American Indian preschoolers are at greatest risk for overweight and obesity among children aged 2-5 years. The Nutrition and Physical Activity Self-Assessment for Child Care (NAP SACC) program is an evidence-based intervention that promotes healthy weight development for children enrolled in child care centers. The goal of this continuous quality improvement program is for the child care staff to establish environmental policies and practices that positively influence nutrition and physical activity-related behaviors. A community needs assessment of a Head Start program on an American Indian reservation identified obesity as a priority issue. This project implemented NAP SACC at 15 Head Start sites on the reservation.

The Demethylase JMJD2C Localizes to H3K4me3 Positive Transcription Start Sites and Is Dispensable for Embryonic Development

DEFF Research Database (Denmark)

Pedersen, Marianne Terndrup; Agger, Karl; Laugesen, Anne

2014-01-01

cell (ESC) self-renewal and embryonic development. Moreover, we report that JMJD2C localizes to H3K4me3 positive transcription start sites in both primary cells and in the human carcinoma KYSE150 cell line, containing an amplification of the JMJD2C locus. Binding is dependent on the double Tudor domain...... expression of a subset of target genes involved in cell cycle progression. Taken together, we show that JMJD2C is targeted to H3K4me3 positive transcription start sites, where it can contribute to transcriptional regulation, and report that the putative oncogene, JMJD2C, is not generally required...

Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene

International Nuclear Information System (INIS)

Mavrothalassitis, G.J.; Watson, D.K.; Papas, T.S.

1990-01-01

The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical TATA and CAAT elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1,400 base pairs (bp) upstream from the first major transcription initiation site. A G+C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with TATA-less promoters

Earlier school start times are associated with higher rates of behavioral problems in elementary schools.

Science.gov (United States)

Keller, Peggy S; Gilbert, Lauren R; Haak, Eric A; Bi, Shuang; Smith, Olivia A

2017-04-01

Early school start times may curtail children's sleep and inadvertently promote sleep restriction. The current study examines the potential implications for early school start times for behavioral problems in public elementary schools (student ages 5-12 years) in Kentucky. School start times were obtained from school Web sites or by calling school offices; behavioral and disciplinary problems, along with demographic information about schools, were obtained from the Kentucky Department of Education. Estimated associations controlled for teacher/student ratio, racial composition, school rank, enrollment, and Appalachian location. Associations between early school start time and greater behavioral problems (harassment, in-school removals, suspensions, and expulsions) were observed, although some of these associations were found only for schools serving the non-Appalachian region. Findings support the growing body of research showing that early school start times may contribute to student problems, and extend this research through a large-scale examination of elementary schools, behavioral outcomes, and potential moderators of risk. Copyright © 2017 National Sleep Foundation. Published by Elsevier Inc. All rights reserved.

Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

Science.gov (United States)

Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

2012-01-01

Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

Health promotion site selection blues: barriers to participation and implementation.

Science.gov (United States)

Cherniack, Martin; Morse, Tim; Henning, Robert; Seidner, Adam; Punnett, Laura

2010-06-01

To shed light on research-to-practice challenges in workplace health promotion research. More than 1200 companies serviced by a national insurer were assessed by measures, including management surveys, and insurance premium costs and risk profile. A 21-item Workplace Readiness Checklist was the core assessment tool. Quantitative and qualitative measures were used to identify 12 to 14 companies deemed most "ready for change." The four priority candidate companies decided against participation. A post hoc survey to evaluate reasons for non-participation identified factors such as time allocations, the deteriorating economic environment, and the participatory nature of the interventions proposed for half of the study sites. Differing priorities within management also seemed to interfere with participation. A highly structured process for determining corporate readiness for participatory health promotion produced contradictory results.

Spastin subcellular localization is regulated through usage of different translation start sites and active export from the nucleus

International Nuclear Information System (INIS)

Claudiani, Pamela; Riano, Elena; Errico, Alessia; Andolfi, Gennaro; Rugarli, Elena I.

2005-01-01

Most cases of autosomal-dominant hereditary spastic paraplegia are linked to mutations in SPG4 encoding spastin, a protein involved in microtubule dynamics and membrane trafficking. In pyramidal neurons of the motor cortex and in immortalized motor neurons, spastin is localized to the synaptic terminals and growth cones. However, in other neurons and in proliferating cells spastin is prevalently nuclear. The mechanisms that determine targeting of spastin to the nucleus or the cytoplasm are unknown. We show here that the SPG4 mRNA is able to direct synthesis of two spastin isoforms, 68 and 60 kDa, respectively, through usage of two different translational start sites. Both isoforms are imported into the nucleus, but the 68-kDa isoform contains two nuclear export signals that efficiently drive export to the cytoplasm. Nuclear export is leptomycin-B sensitive. The cytoplasmic 68-kDa spastin isoform is more abundant in the brain and the spinal cord than in other tissues. Our data indicate that spastin function is modulated through usage of alternative translational start sites and active nuclear import and export, and open new perspectives for the pathogenesis of hereditary spastic paraplegia

Full-Length Sequence of Mouse Acupuncture-Induced 1-L (Aig1l Gene Including Its Transcriptional Start Site

Directory of Open Access Journals (Sweden)

Mika Ohta

2011-01-01

Full Text Available We have been investigating the molecular efficacy of electroacupuncture (EA, which is one type of acupuncture therapy. In our previous molecular biological study of acupuncture, we found an EA-induced gene, named acupuncture-induced 1-L (Aig1l, in mouse skeletal muscle. The aims of this study consisted of identification of the full-length cDNA sequence of Aig1l including the transcriptional start site, determination of the tissue distribution of Aig1l and analysis of the effect of EA on Aig1l gene expression. We determined the complete cDNA sequence including the transcriptional start site via cDNA cloning with the cap site hunting method. We then analyzed the tissue distribution of Aig1l by means of northern blot analysis and real-time quantitative polymerase chain reaction. We used the semiquantitative reverse transcriptase-polymerase chain reaction to examine the effect of EA on Aig1l gene expression. Our results showed that the complete cDNA sequence of Aig1l was 6073 bp long, and the putative protein consisted of 962 amino acids. All seven tissues that we analyzed expressed the Aig1l gene. In skeletal muscle, EA induced expression of the Aig1l gene, with high expression observed after 3 hours of EA. Our findings thus suggest that the Aig1l gene may play a key role in the molecular mechanisms of EA efficacy.

Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

Science.gov (United States)

Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

2012-06-01

In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

Identification and analysis of an efficient dicot constitutive promoter from tomato

International Nuclear Information System (INIS)

Bacha, S.; Khatoon, A.; Asif, M.; Bashir, A.

2015-01-01

The regulatory sequence of sucrose synthase (susy) was explored in HTGS and screened using various bioinformatics tools for promoter prediction and identification of functional regulatory motifs. Transcription start site (TSS) was predicted in the promoter sequence. Species specific motifs were identified by using Plant PAN database. The Plant Care predicted various light responsive, hormone inducible and tissue specific motifs in the full length promoter which may be essential for the constitutive expression governed by this promoter. Full length susy promoter isolated from tomato (Solanum lycopersicum) drove maximum transient expression of GUS gene in various tissues of tobacco, cotton and peas. The susy promoter identified and analyzed in this study is suitable for transgene expression in economically important agricultural crops, especially to avoid strong over-expression. (author)

The Differential Effects of Social Media Sites for Promoting Cancer Risk Reduction.

Science.gov (United States)

Lauckner, Carolyn; Whitten, Pamela

2016-09-01

Social media are potentially valuable tools for disseminating cancer education messages, but the differential effects of various sites on persuasive outcomes are unknown. In an effort to inform future health promotion, this research tested the effects of Facebook, YouTube, Twitter, and blogs for delivering a cancer risk reduction message. Using an experimental design, participants were randomly placed in several conditions that delivered the same message but with different forms of social media. Effects on comprehension and attitudes were examined, as they are important variables in the behavior change process. YouTube led to higher comprehension and stronger attitudes toward cancer risk reduction than Twitter, but there were no differences between other sites. Additionally, YouTube led to stronger attitudes toward cancer risk reduction as compared to Facebook, but not any other sites. These results demonstrate that, even if the message is kept constant, the form of social media used to deliver content can have an effect on persuasive outcomes. More research is needed to determine the mechanisms behind the differences found, however. Altogether, this line of research is valuable for any individuals seeking to use social media for health promotion purposes and could have direct implications for the development of cancer risk reduction campaigns.

UNESCO SITES AS PUBLIC GOODS: COMPARATIVE EXPERIENCES IN ITALY

Directory of Open Access Journals (Sweden)

Roberto Cellini

Full Text Available ABSTRACT The inclusion of a site in the UNESCO World Heritage List is a "recognition" that can be interpreted as alocal public good. This paper analyzes the effectiveness of the UNESCO recognition in promoting tourism and, more generally, local economic development. We document relevant performance differences across Italian UNESCO sites. We argue that the relevant key factor is the ability of generating additional public goods, starting from the process of recognition. The most recent approach of UNESCO in selecting the sites to include in its list underlines the importance of the immaterial culture embedded in the sites, and the role of local communities in their relationships with the environment and heritage: this is interpreted as a sign of the importance which has to be due to the generation of common goods for making the UNESCO recognition an effective tool to preserve heritage and to use it to promote economic, social and cultural development.

Human holocarboxylase synthetase with a start site at methionine-58 is the predominant nuclear variant of this protein and has catalytic activity

International Nuclear Information System (INIS)

Bao, Baolong; Wijeratne, Subhashinee S.K.; Rodriguez-Melendez, Rocio; Zempleni, Janos

2011-01-01

Highlights: → Unambiguous evidence is provided that methionine-58 serves as an in-frame alternative translation site for holocarboxylase synthetase (HLCS58). → Full-length HLCS and HLCS58 enter the nucleus, but HLCS58 is the predominant variant. → HLCS58 has biological activity as biotin protein ligase. -- Abstract: Holocarboxylase synthetase (HLCS) catalyzes the covalent binding of biotin to both carboxylases in extranuclear structures and histones in cell nuclei, thereby mediating important roles in intermediary metabolism, gene regulation, and genome stability. HLCS has three putative translational start sites (methionine-1, -7, and -58), but lacks a strong nuclear localization sequence that would explain its participation in epigenetic events in the cell nucleus. Recent evidence suggests that small quantities of HLCS with a start site in methionine-58 (HLCS58) might be able to enter the nuclear compartment. We generated the following novel insights into HLCS biology. First, we generated a novel HLCS fusion protein vector to demonstrate that methionine-58 is a functional translation start site in human cells. Second, we used confocal microscopy and western blots to demonstrate that HLCS58 enters the cell nucleus in meaningful quantities, and that full-length HLCS localizes predominantly in the cytoplasm but may also enter the nucleus. Third, we produced recombinant HLCS58 to demonstrate its biological activity toward catalyzing the biotinylation of both carboxylases and histones. Collectively, these observations are consistent with roles of HLCS58 and full-length HLCS in nuclear events. We conclude this report by proposing a novel role for HLCS in epigenetic events, mediated by physical interactions between HLCS and other chromatin proteins as part of a larger multiprotein complex that mediates gene repression.

The architecture of mammalian ribosomal protein promoters

Directory of Open Access Journals (Sweden)

Perry Robert P

2005-02-01

Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

Empowering Head Start African American and Latino Families: Promoting Strengths-Based Parenting Characteristics through Child Parent Relationship Training--An Evidence-Based Group Parenting Program

Science.gov (United States)

Sheely-Moore, Angela I.; Ceballos, Peggy L.

2011-01-01

With the tendency of low-income African American and Latino children identified at-risk for school readiness and school success compared to their early-childhood counterparts, Head Start personnel are challenged to examine the role of family strengths in the promotion of academic success for these populations. This article provides a rationale for…

Promoting Children's Social-Emotional Skills in Preschool Can Enhance Academic and Behavioral Functioning in Kindergarten: Findings from Head Start REDI.

Science.gov (United States)

Nix, Robert L; Bierman, Karen L; Domitrovich, Celene E; Gill, Sukhdeep

2013-01-01

This study examined processes of change associated with the positive preschool and kindergarten outcomes of children who received the Head Start REDI intervention, compared to "usual practice" Head Start. In a large-scale randomized-controlled trial (N = 356 children, 42% African American or Latino, all from low-income families), this study tests the logic model that improving preschool social-emotional skills (e.g., emotion understanding, social problem solving, and positive social behavior) as well as language/emergent literacy skills will promote cross-domain academic and behavioral adjustment after children transition into kindergarten. Validating this logic model, the present study finds that intervention effects on three important kindergarten outcomes (e.g., reading achievement, learning engagement, and positive social behavior) were mediated by preschool gains in the proximal social-emotional and language/emergent literacy skills targeted by the REDI intervention. Importantly, preschool gains in social-emotional skills made unique contributions to kindergarten outcomes in reading achievement and learning engagement, even after accounting for the concurrent preschool gains in vocabulary and emergent literacy skills. These findings highlight the importance of fostering at-risk children's social-emotional skills during preschool as a means of promoting school readiness. The REDI (Research-Based, Developmentally-Informed) enrichment intervention was designed to complement and strengthen the impact of existing Head Start programs in the dual domains of language/emergent literacy skills and social-emotional competencies. REDI was one of several projects funded by the Interagency School Readiness Consortium, a partnership of four federal agencies (the National Institute of Child Health and Human Development, the Administration for Children and Families, the Assistant Secretary for Planning and Evaluation in the Department of Health and Human Services, and the

Beyond Intentions--What Makes a Student Start a Firm?

Science.gov (United States)

Joensuu-Salo, Sanna; Varamäki, Elina; Viljamaa, Anmari

2015-01-01

Purpose: Entrepreneurial intentions have been extensively studied in student populations, with results suggesting that higher education does not promote formation of entrepreneurial intentions (e.g. Varamäki et al., 2013). However, the gap between intending to start a business and actually doing something to start one remains. The purpose of this…

Characterization of the promoter region of the human c-erbB-2 protooncogene

International Nuclear Information System (INIS)

Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

1987-01-01

Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

Identification of Gene Transcription Start Sites and Enhancers Responding to Pulmonary Carbon Nanotube Exposure in Vivo

DEFF Research Database (Denmark)

Bornholdt, Jette; Saber, Anne Thoustrup; Lilje, Bait

2017-01-01

Increased use of nanomaterials in industry, medicine, and consumer products has raised concerns over their toxicity. To ensure safe use of nanomaterials, understanding their biological effects at the molecular level is crucial. In particular, the regulatory mechanisms responsible for the cascade...... of genes activated by nanomaterial exposure are not well-characterized. To this end, we profiled the genome-wide usage of gene transcription start sites and linked active enhancer regions in lungs of C57BL/6 mice 24 h after intratracheal instillation of a single dose of the multiwalled carbon nanotube...

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

Science.gov (United States)

Meier, Daniel; Schindler, Detlev

2011-01-01

The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

Directory of Open Access Journals (Sweden)

Daniel Meier

Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

Promoter characterization and genomic organization of the human X11β gene APBA2.

LENUS (Irish Health Repository)

Hao, Yan

2012-02-15

Overexpression of neuronal adaptor protein X11β has been shown to decrease the production of amyloid-β, a toxic peptide deposited in Alzheimer\\'s disease brains. Therefore, manipulation of the X11β level may represent a potential therapeutic strategy for Alzheimer\\'s disease. As X11β expression can be regulated at the transcription level, we determined the genomic organization and the promoter of the human X11β gene, amyloid β A4 precursor protein-binding family A member 2 (APBA2). By RNA ligase-mediated rapid amplification of cDNA ends, a single APBA2 transcription start site and the complete sequence of exon 1 were identified. The APBA2 promoter was located upstream of exon 1 and was more active in neurons. The core promoter contains several CpG dinucleotides, and was strongly suppressed by DNA methylation. In addition, mutagenesis analysis revealed a putative Pax5-binding site within the promoter. Together, APBA2 contains a potent neuronal promoter whose activity may be regulated by DNA methylation and Pax5.

Promoters of Escherichia coli versus promoter islands: function and structure comparison.

Directory of Open Access Journals (Sweden)

Valeriy V Panyukov

Full Text Available Expression of bacterial genes takes place under the control of RNA polymerase with exchangeable σ-subunits and multiple transcription factors. A typical promoter region contains one or several overlapping promoters. In the latter case promoters have the same or different σ-specificity and are often subjected to different regulatory stimuli. Genes, transcribed from multiple promoters, have on average higher expression levels. However, recently in the genome of Escherichia coli we found 78 regions with an extremely large number of potential transcription start points (promoter islands, PIs. It was shown that all PIs interact with RNA polymerase in vivo and are able to form transcriptionally competent open complexes both in vitro and in vivo but their transcriptional activity measured by oligonucleotide microarrays was very low, if any. Here we confirmed transcriptional defectiveness of PIs by analyzing the 5'-end specific RNA-seq data, but showed their ability to produce short oligos (9-14 bases. This combination of functional properties indicated a deliberate suppression of transcriptional activity within PIs. According to our data this suppression may be due to a specific conformation of the DNA double helix, which provides an ideal platform for interaction with both RNA polymerase and the histone-like nucleoid protein H-NS. The genomic DNA of E.coli contains therefore several dozen sites optimized by evolution for staying in a heterochromatin-like state. Since almost all promoter islands are associated with horizontally acquired genes, we offer them as specific components of bacterial evolution involved in acquisition of foreign genetic material by turning off the expression of toxic or useless aliens or by providing optimal promoter for beneficial genes. The putative molecular mechanism underlying the appearance of promoter islands within recipient genomes is discussed.

Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

Science.gov (United States)

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1988-01-01

Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter

Directory of Open Access Journals (Sweden)

Cominelli Eleonora

2011-11-01

Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.

De-novo discovery of differentially abundant transcription factor binding sites including their positional preference.

Science.gov (United States)

Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo

2011-02-10

Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open

Promoting School Success: Developing Social Skills and Early Literacy in Head Start Classrooms

Science.gov (United States)

Gunn, Barbara; Feil, Ed; Seeley, John; Severson, Herb; Walker, Hill M.

2006-01-01

This article reports the results of a pilot intervention to improve the social skills and literacy preparation of behaviorally at-risk Head Start children. Teachers in eight Head Start classrooms in two Oregon communities participated during the 2002-03 school year. Children in eight classrooms were screened and identified for participation using…

Regulation of ALF promoter activity in Xenopus oocytes.

Directory of Open Access Journals (Sweden)

Dan Li

Full Text Available BACKGROUND: In this report we evaluate the use of Xenopus laevis oocytes as a matched germ cell system for characterizing the organization and transcriptional activity of a germ cell-specific X. laevis promoter. PRINCIPAL FINDINGS: The promoter from the ALF transcription factor gene was cloned from X. laevis genomic DNA using a PCR-based genomic walking approach. The endogenous ALF gene was characterized by RACE and RT-PCR for transcription start site usage, and by sodium bisulfite sequencing to determine its methylation status in somatic and oocyte tissues. Homology between the X. laevis ALF promoter sequence and those from human, chimpanzee, macaque, mouse, rat, cow, pig, horse, dog, chicken and X. tropicalis was relatively low, making it difficult to use such comparisons to identify putative regulatory elements. However, microinjected promoter constructs were very active in oocytes and the minimal promoter could be narrowed by PCR-mediated deletion to a region as short as 63 base pairs. Additional experiments using a series of site-specific promoter mutants identified two cis-elements within the 63 base pair minimal promoter that were critical for activity. Both elements (A and B were specifically recognized by proteins present in crude oocyte extracts based on oligonucleotide competition assays. The activity of promoter constructs in oocytes and in transfected somatic Xenopus XLK-WG kidney epithelial cells was quite different, indicating that the two cell types are not functionally equivalent and are not interchangeable as assay systems. CONCLUSIONS: Overall the results provide the first detailed characterization of the organization of a germ cell-specific Xenopus promoter and demonstrate the feasibility of using immature frog oocytes as an assay system for dissecting the biochemistry of germ cell gene regulation.

Utilizing social networking sites to promote adolescents' health: a pragmatic review of the literature.

Science.gov (United States)

Francomano, Jesse A; Harpin, Scott B

2015-01-01

Social networking site use has exploded among youth in the last few years and is being adapted as an important tool for healthcare interventions and serving as a platform for adolescents to gain access to health information. The aim of this study was to examine the strengths, weaknesses, and best practices of utilizing Facebook in adolescent health promotion and research via pragmatic literature review. We also examine how sites can facilitate ethically sound healthcare for adolescents, particularly at-risk youth. We conducted a literature review of health and social sciences literature from the past 5 years related to adolescent health and social network site use. Publications were grouped by shared content then categorized by themes. Five themes emerged: access to healthcare information, peer support and networking, risk and benefits of social network site use in care delivery, overcoming technological barriers, and social network site interventions. More research is needed to better understand how such Web sites can be better utilized to provide access to adolescents seeking healthcare. Given the broad reach of social network sites, all health information must be closely monitored for accurate, safe distribution. Finally, consent and privacy issues are omnipresent in social network sites, which calls for standards of ethical use.

High-Resolution Profiling of Drosophila Replication Start Sites Reveals a DNA Shape and Chromatin Signature of Metazoan Origins

Directory of Open Access Journals (Sweden)

Federico Comoglio

2015-05-01

Full Text Available At every cell cycle, faithful inheritance of metazoan genomes requires the concerted activation of thousands of DNA replication origins. However, the genetic and chromatin features defining metazoan replication start sites remain largely unknown. Here, we delineate the origin repertoire of the Drosophila genome at high resolution. We address the role of origin-proximal G-quadruplexes and suggest that they transiently stall replication forks in vivo. We dissect the chromatin configuration of replication origins and identify a rich spatial organization of chromatin features at initiation sites. DNA shape and chromatin configurations, not strict sequence motifs, mark and predict origins in higher eukaryotes. We further examine the link between transcription and origin firing and reveal that modulation of origin activity across cell types is intimately linked to cell-type-specific transcriptional programs. Our study unravels conserved origin features and provides unique insights into the relationship among DNA topology, chromatin, transcription, and replication initiation across metazoa.

Geological exploration strategies and site characterisation methodologies

International Nuclear Information System (INIS)

Sprecher, C.

1997-01-01

Starting with a short overview of the Swiss HLW disposal programme the paper addresses the more general issue of how site characterisation programmes can better be matched to the acknowledged data requirements of safety analysts and repository designers. Swiss experience suggests that measures to promote mutual understanding between geologistsand quantitative modelers and advance planning of the GEO-data-synthesis can help to bridge the gap separating performance assessment input parameters and field measurements. This represents a step towards more effective and cost efficient field investigations. (author). 4 figs

Geological exploration strategies and site characterisation methodologies

Energy Technology Data Exchange (ETDEWEB)

Sprecher, C. [National Cooperative for the Disposal of Radioactive Waste, Wettingen (Switzerland)

1997-12-31

Starting with a short overview of the Swiss HLW disposal programme the paper addresses the more general issue of how site characterisation programmes can better be matched to the acknowledged data requirements of safety analysts and repository designers. Swiss experience suggests that measures to promote mutual understanding between geologistsand quantitative modelers and advance planning of the GEO-data-synthesis can help to bridge the gap separating performance assessment input parameters and field measurements. This represents a step towards more effective and cost efficient field investigations. (author). 4 figs.

Iron-regulated transcription of the pvdA gene in Pseudomonas aeruginosa: effect of Fur and PvdS on promoter activity.

OpenAIRE

Leoni, L; Ciervo, A; Orsi, N; Visca, P

1996-01-01

The pvdA gene, encoding the enzyme L-ornithine N5-oxygenase, catalyzes a key step of the pyoverdin biosynthetic pathway in Pseudomonas aeruginosa. Expression studies with a promoter probe vector made it possible to identify three tightly iron-regulated promoter regions in the 5.9-kb DNA fragment upstream of pvdA. The promoter governing pvdA expression was located within the 154-bp sequence upstream of the pvdA translation start site. RNA analysis showed that expression of PvdA is iron regulat...

Identifying functional transcription factor binding sites in yeast by considering their positional preference in the promoters.

Directory of Open Access Journals (Sweden)

Fu-Jou Lai

Full Text Available Transcription factor binding site (TFBS identification plays an important role in deciphering gene regulatory codes. With comprehensive knowledge of TFBSs, one can understand molecular mechanisms of gene regulation. In the recent decades, various computational approaches have been proposed to predict TFBSs in the genome. The TFBS dataset of a TF generated by each algorithm is a ranked list of predicted TFBSs of that TF, where top ranked TFBSs are statistically significant ones. However, whether these statistically significant TFBSs are functional (i.e. biologically relevant is still unknown. Here we develop a post-processor, called the functional propensity calculator (FPC, to assign a functional propensity to each TFBS in the existing computationally predicted TFBS datasets. It is known that functional TFBSs reveal strong positional preference towards the transcriptional start site (TSS. This motivates us to take TFBS position relative to the TSS as the key idea in building our FPC. Based on our calculated functional propensities, the TFBSs of a TF in the original TFBS dataset could be reordered, where top ranked TFBSs are now the ones with high functional propensities. To validate the biological significance of our results, we perform three published statistical tests to assess the enrichment of Gene Ontology (GO terms, the enrichment of physical protein-protein interactions, and the tendency of being co-expressed. The top ranked TFBSs in our reordered TFBS dataset outperform the top ranked TFBSs in the original TFBS dataset, justifying the effectiveness of our post-processor in extracting functional TFBSs from the original TFBS dataset. More importantly, assigning functional propensities to putative TFBSs enables biologists to easily identify which TFBSs in the promoter of interest are likely to be biologically relevant and are good candidates to do further detailed experimental investigation. The FPC is implemented as a web tool at http://santiago.ee.ncku.edu.tw/FPC/.

Interaction between the thyroid hormone receptor and co-factors on the promoter of the gene encoding phospho enol pyruvate carboxykinase

NARCIS (Netherlands)

Schmidt, E. D.; van Beeren, M.; Glass, C. K.; Wiersinga, W. M.; Lamers, W. H.

1993-01-01

Using transient transfection studies we localized a thyroid hormone-responsive element on the promoter of the rat phospho-enol pyruvate carboxykinase gene between 355 and 174 bp upstream of the transcription start site. DNAse 1 footprinting analysis within this region showed that a 28 bp fragment at

Parent Involvement in Head Start and Children's Development: Indirect Effects Through Parenting.

Science.gov (United States)

Ansari, Arya; Gershoff, Elizabeth

2016-04-01

The authors examined the extent to which parent involvement in Head Start programs predicted changes in both parent and child outcomes over time, using a nationally representative sample of 1,020 three-year-old children over 3 waves of the Family and Child Experiences Survey. Center policies that promote involvement predicted greater parent involvement, and parents who were more involved in Head Start centers demonstrated increased cognitive stimulation and decreased spanking and controlling behaviors. In turn, these changes in parenting behaviors were associated with gains in children's academic and behavioral skills. These findings suggest that Head Start programs should do even more to facilitate parent involvement because it can serve as an important means for promoting both parent and child outcomes.

Genomic organization and identification of promoter regions for the BDNF gene in the pond turtle Trachemys scripta elegans.

Science.gov (United States)

Ambigapathy, Ganesh; Zheng, Zhaoqing; Keifer, Joyce

2014-08-01

Brain-derived neurotrophic factor (BDNF) is an important regulator of neuronal development and synaptic function. The BDNF gene undergoes significant activity-dependent regulation during learning. Here, we identified the BDNF promoter regions, transcription start sites, and potential regulatory sequences for BDNF exons I-III that may contribute to activity-dependent gene and protein expression in the pond turtle Trachemys scripta elegans (tBDNF). By using transfection of BDNF promoter/luciferase plasmid constructs into human neuroblastoma SHSY5Y cells and mouse embryonic fibroblast NIH3T3 cells, we identified the basal regulatory activity of promoter sequences located upstream of each tBDNF exon, designated as pBDNFI-III. Further, through chromatin immunoprecipitation (ChIP) assays, we detected CREB binding directly to exon I and exon III promoters, while BHLHB2, but not CREB, binds within the exon II promoter. Elucidation of the promoter regions and regulatory protein binding sites in the tBDNF gene is essential for understanding the regulatory mechanisms that control tBDNF gene expression.

TSSPlant: a new tool for prediction of plant Pol II promoters

KAUST Repository

Shahmuradov, Ilham A.

2017-01-13

Our current knowledge of eukaryotic promoters indicates their complex architecture that is often composed of numerous functional motifs. Most of known promoters include multiple and in some cases mutually exclusive transcription start sites (TSSs). Moreover, TSS selection depends on cell/tissue, development stage and environmental conditions. Such complex promoter structures make their computational identification notoriously difficult. Here, we present TSSPlant, a novel tool that predicts both TATA and TATA-less promoters in sequences of a wide spectrum of plant genomes. The tool was developed by using large promoter collections from ppdb and PlantProm DB. It utilizes eighteen significant compositional and signal features of plant promoter sequences selected in this study, that feed the artificial neural network-based model trained by the backpropagation algorithm. TSSPlant achieves significantly higher accuracy compared to the next best promoter prediction program for both TATA promoters (MCC≃0.84 and F1-score≃0.91 versus MCC≃0.51 and F1-score≃0.71) and TATA-less promoters (MCC≃0.80, F1-score≃0.89 versus MCC≃0.29 and F1-score≃0.50). TSSPlant is available to download as a standalone program at http://www.cbrc.kaust.edu.sa/download/.

TSSPlant: a new tool for prediction of plant Pol II promoters

KAUST Repository

Shahmuradov, Ilham A.; Umarov, Ramzan; Solovyev, Victor V.

2017-01-01

Our current knowledge of eukaryotic promoters indicates their complex architecture that is often composed of numerous functional motifs. Most of known promoters include multiple and in some cases mutually exclusive transcription start sites (TSSs). Moreover, TSS selection depends on cell/tissue, development stage and environmental conditions. Such complex promoter structures make their computational identification notoriously difficult. Here, we present TSSPlant, a novel tool that predicts both TATA and TATA-less promoters in sequences of a wide spectrum of plant genomes. The tool was developed by using large promoter collections from ppdb and PlantProm DB. It utilizes eighteen significant compositional and signal features of plant promoter sequences selected in this study, that feed the artificial neural network-based model trained by the backpropagation algorithm. TSSPlant achieves significantly higher accuracy compared to the next best promoter prediction program for both TATA promoters (MCC≃0.84 and F1-score≃0.91 versus MCC≃0.51 and F1-score≃0.71) and TATA-less promoters (MCC≃0.80, F1-score≃0.89 versus MCC≃0.29 and F1-score≃0.50). TSSPlant is available to download as a standalone program at http://www.cbrc.kaust.edu.sa/download/.

Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny.

Directory of Open Access Journals (Sweden)

Dorcas J Orengo

Full Text Available The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO. We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription.

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

Science.gov (United States)

2009-01-01

Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

Directory of Open Access Journals (Sweden)

Lindberg Pia

2009-03-01

Full Text Available Abstract Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp. To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence.

Genetic variation in the proximal promoter of ABC and SLC superfamilies: liver and kidney specific expression and promoter activity predict variation.

Directory of Open Access Journals (Sweden)

Stephanie E Hesselson

2009-09-01

Full Text Available Membrane transporters play crucial roles in the cellular uptake and efflux of an array of small molecules including nutrients, environmental toxins, and many clinically used drugs. We hypothesized that common genetic variation in the proximal promoter regions of transporter genes contribute to observed variation in drug response. A total of 579 polymorphisms were identified in the proximal promoters (-250 to +50 bp and flanking 5' sequence of 107 transporters in the ATP Binding Cassette (ABC and Solute Carrier (SLC superfamilies in 272 DNA samples from ethnically diverse populations. Many transporter promoters contained multiple common polymorphisms. Using a sliding window analysis, we observed that, on average, nucleotide diversity (pi was lowest at approximately 300 bp upstream of the transcription start site, suggesting that this region may harbor important functional elements. The proximal promoters of transporters that were highly expressed in the liver had greater nucleotide diversity than those that were highly expressed in the kidney consistent with greater negative selective pressure on the promoters of kidney transporters. Twenty-one promoters were evaluated for activity using reporter assays. Greater nucleotide diversity was observed in promoters with strong activity compared to promoters with weak activity, suggesting that weak promoters are under more negative selective pressure than promoters with high activity. Collectively, these results suggest that the proximal promoter region of membrane transporters is rich in variation and that variants in these regions may play a role in interindividual variation in drug disposition and response.

MicroRNA genes preferentially expressed in dendritic cells contain sites for conserved transcription factor binding motifs in their promoters

Directory of Open Access Journals (Sweden)

Huynen Martijn A

2011-06-01

Full Text Available Abstract Background MicroRNAs (miRNAs play a fundamental role in the regulation of gene expression by translational repression or target mRNA degradation. Regulatory elements in miRNA promoters are less well studied, but may reveal a link between their expression and a specific cell type. Results To explore this link in myeloid cells, miRNA expression profiles were generated from monocytes and dendritic cells (DCs. Differences in miRNA expression among monocytes, DCs and their stimulated progeny were observed. Furthermore, putative promoter regions of miRNAs that are significantly up-regulated in DCs were screened for Transcription Factor Binding Sites (TFBSs based on TFBS motif matching score, the degree to which those TFBSs are over-represented in the promoters of the up-regulated miRNAs, and the extent of conservation of the TFBSs in mammals. Conclusions Analysis of evolutionarily conserved TFBSs in DC promoters revealed preferential clustering of sites within 500 bp upstream of the precursor miRNAs and that many mRNAs of cognate TFs of the conserved TFBSs were indeed expressed in the DCs. Taken together, our data provide evidence that selected miRNAs expressed in DCs have evolutionarily conserved TFBSs relevant to DC biology in their promoters.

Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

Energy Technology Data Exchange (ETDEWEB)

Yan, Liu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Lian, Yu [College of Biomedical Engineering and Instrument Science, Zhejiang University, Hangzhou 310027 (China); Zhejiang Province Key Laboratory of Preventive Veterinary Medicine, Institute of Preventive Veterinary Medicine, Zhejiang University, Hangzhou 310029 (China); Xiuyang, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Tingqing, Guo [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Shengpeng, Wang [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Changde, Lu [Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China)

2006-03-31

The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat body nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.

Pim kinases phosphorylate multiple sites on Bad and promote 14-3-3 binding and dissociation from Bcl-XL

Directory of Open Access Journals (Sweden)

Hastie C James

2006-01-01

Full Text Available Abstract Background Pim-1, 2 and 3 are a group of enzymes related to the calcium calmodulin family of protein kinases. Over-expression of Pim-1 and Pim-2 in mice promotes the development of lymphomas, and up-regulation of Pim expression has been observed in several human cancers. Results Here we show that the pim kinases are constitutively active when expressed in HEK-293 cells and are able to phosphorylate the Bcl-2 family member Bad on three residues, Ser112, Ser136 and Ser155 in vitro and in cells. In vitro mapping showed that Pim-2 predominantly phosphorylated Ser112, while Pim-1 phosphorylated Ser112, but also Ser136 and Ser155 at a reduced rate compared to Ser112. Pim-3 was found to be the least specific for Ser112, and the most effective at phosphorylating Ser136 and Ser155. Pim-3 was also able to phosphorylate other sites in Bad in vitro, including Ser170, another potential in vivo site. Mutation of Ser136 to alanine prevented the phosphorylation of Ser112 and Ser155 by Pim kinases in HEK-293 cells, suggesting that this site must be phosphorylated first in order to make the other sites accessible. Pim phosphorylation of Bad was also found to promote the 14-3-3 binding of Bad and block its association with Bcl-XL. Conclusion All three Pim kinase family members predominantly phosphorylate Bad on Ser112 and in addition are capable of phosphorylating Bad on multiple sites associated with the inhibition of the pro-apoptotic function of Bad in HEK-293 cells. This would be consistent with the proposed function of Pim kinases in promoting cell proliferation and preventing cell death.

A mutation in a functional Sp1 binding site of the telomerase RNA gene (hTERC promoter in a patient with Paroxysmal Nocturnal Haemoglobinuria

Directory of Open Access Journals (Sweden)

Mason Philip J

2004-06-01

Full Text Available Abstract Background Mutations in the gene coding for the RNA component of telomerase, hTERC, have been found in autosomal dominant dyskeratosis congenita (DC and aplastic anemia. Paroxysmal nocturnal hemoglobinuria (PNH is a clonal blood disorder associated with aplastic anemia and characterized by the presence of one or more clones of blood cells lacking glycosylphosphatidylinositol (GPI anchored proteins due to a somatic mutation in the PIGA gene. Methods We searched for mutations in DNA extracted from PNH patients by amplification of the hTERC gene and denaturing high performance liquid chromatography (dHPLC. After a mutation was found in a potential transcription factor binding site in one patient electrophoretic mobility shift assays were used to detect binding of transcription factors to that site. The effect of the mutation on the function of the promoter was tested by transient transfection constructs in which the promoter is used to drive a reporter gene. Results Here we report the finding of a novel promoter mutation (-99C->G in the hTERC gene in a patient with PNH. The mutation disrupts an Sp1 binding site and destroys its ability to bind Sp1. Transient transfection assays show that mutations in this hTERC site including C-99G cause either up- or down-regulation of promoter activity and suggest that the site regulates core promoter activity in a context dependent manner in cancer cells. Conclusions These data are the first report of an hTERC promoter mutation from a patient sample which can modulate core promoter activity in vitro, raising the possibility that the mutation may affect the transcription of the gene in hematopoietic stem cells in vivo, and that dysregulation of telomerase may play a role in the development of bone marrow failure and the evolution of PNH clones.

Thyroid hormone receptor binds to a site in the rat growth hormone promoter required for induction by thyroid hormone

International Nuclear Information System (INIS)

Koenig, R.J.; Brent, G.A.; Warne, R.L.; Larsen, P.R.; Moore, D.D.

1987-01-01

Transcription of the rat growth hormone (rGH) gene in pituitary cells is increased by addition of thyroid hormone (T3). This induction is dependent on the presence of specific sequences just upstream of the rGH promoter. The authors have partially purified T3 receptor from rat liver and examined its interaction with these rGH sequences. They show here that T3 receptor binds specifically to a site just upstream of the basal rGH promoter. This binding site includes two copies of a 7-base-pair direct repeat, the centers of which are separated by 10 base pairs. Deletions that specifically remove the T3 receptor binding site drastically reduce response to T3 in transient transfection experiments. These results demonstrate that T3 receptor can recognize specific DNA sequences and suggest that it can act directly as a positive transcriptional regulatory factor

Whi7 is an unstable cell-cycle repressor of the Start transcriptional program.

Science.gov (United States)

Gomar-Alba, Mercè; Méndez, Ester; Quilis, Inma; Bañó, M Carmen; Igual, J Carlos

2017-08-24

Start is the main decision point in eukaryotic cell cycle in which cells commit to a new round of cell division. It involves the irreversible activation of a transcriptional program by G1 CDK-cyclin complexes through the inactivation of Start transcriptional repressors, Whi5 in yeast or Rb in mammals. Here we provide novel keys of how Whi7, a protein related at sequence level to Whi5, represses Start. Whi7 is an unstable protein, degraded by the SCF Grr1 ubiquitin-ligase, whose stability is cell cycle regulated by CDK1 phosphorylation. Importantly, Whi7 associates to G1/S gene promoters in late G1 acting as a repressor of SBF-dependent transcription. Our results demonstrate that Whi7 is a genuine paralog of Whi5. In fact, both proteins collaborate in Start repression bringing to light that yeast cells, as occurs in mammalian cells, rely on the combined action of multiple transcriptional repressors to block Start transition.The commitment of cells to a new cycle of division involves inactivation of the Start transcriptional repressor Whi5. Here the authors show that the sequence related protein Whi7 associates to G1/S gene promoters in late G1 and collaborates with Whi5 in Start repression.

Complete motif analysis of sequence requirements for translation initiation at non-AUG start codons.

Science.gov (United States)

Diaz de Arce, Alexander J; Noderer, William L; Wang, Clifford L

2018-01-25

The initiation of mRNA translation from start codons other than AUG was previously believed to be rare and of relatively low impact. More recently, evidence has suggested that as much as half of all translation initiation utilizes non-AUG start codons, codons that deviate from AUG by a single base. Furthermore, non-AUG start codons have been shown to be involved in regulation of expression and disease etiology. Yet the ability to gauge expression based on the sequence of a translation initiation site (start codon and its flanking bases) has been limited. Here we have performed a comprehensive analysis of translation initiation sites that utilize non-AUG start codons. By combining genetic-reporter, cell-sorting, and high-throughput sequencing technologies, we have analyzed the expression associated with all possible variants of the -4 to +4 positions of non-AUG translation initiation site motifs. This complete motif analysis revealed that 1) with the right sequence context, certain non-AUG start codons can generate expression comparable to that of AUG start codons, 2) sequence context affects each non-AUG start codon differently, and 3) initiation at non-AUG start codons is highly sensitive to changes in the flanking sequences. Complete motif analysis has the potential to be a key tool for experimental and diagnostic genomics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genome-wide analysis of promoter architecture in Drosophila melanogaster

Energy Technology Data Exchange (ETDEWEB)

Hoskins, Roger A.; Landolin, Jane M.; Brown, James B.; Sandler, Jeremy E.; Takahashi, Hazuki; Lassmann, Timo; Yu, Charles; Booth, Benjamin W.; Zhang, Dayu; Wan, Kenneth H.; Yang, Li; Boley, Nathan; Andrews, Justen; Kaufman, Thomas C.; Graveley, Brenton R.; Bickel, Peter J.; Carninci, Piero; Carlson, Joseph W.; Celniker, Susan E.

2010-10-20

Core promoters are critical regions for gene regulation in higher eukaryotes. However, the boundaries of promoter regions, the relative rates of initiation at the transcription start sites (TSSs) distributed within them, and the functional significance of promoter architecture remain poorly understood. We produced a high-resolution map of promoters active in the Drosophila melanogaster embryo by integrating data from three independent and complementary methods: 21 million cap analysis of gene expression (CAGE) tags, 1.2 million RNA ligase mediated rapid amplification of cDNA ends (RLMRACE) reads, and 50,000 cap-trapped expressed sequence tags (ESTs). We defined 12,454 promoters of 8037 genes. Our analysis indicates that, due to non-promoter-associated RNA background signal, previous studies have likely overestimated the number of promoter-associated CAGE clusters by fivefold. We show that TSS distributions form a complex continuum of shapes, and that promoters active in the embryo and adult have highly similar shapes in 95% of cases. This suggests that these distributions are generally determined by static elements such as local DNA sequence and are not modulated by dynamic signals such as histone modifications. Transcription factor binding motifs are differentially enriched as a function of promoter shape, and peaked promoter shape is correlated with both temporal and spatial regulation of gene expression. Our results contribute to the emerging view that core promoters are functionally diverse and control patterning of gene expression in Drosophila and mammals.

Measurement of volatile organic compounds during start-up of bioremediation of French limited superfund site in Crosby Texas using wind dependent whole-air sampling

International Nuclear Information System (INIS)

Pleil, J.D.; Fortune, C.R.; Yoong, M.; Oliver, K.D.

1993-01-01

Whole-air sampling was performed before and after the start-up of the bioremediation of an industrial (primarily petrochemical) waste lagoon in Crosby Texas, near Houston. Four 'Sector Samplers' were deployed at the four corners of the French Limited Superfund Site. These samplers collect air into one of two SUMMA polished canisters depending upon wind direction and speed. When the wind blows at the sampler from across the waste lagoon, air is routed to the 'IN' sector canister, otherwise sample is collected in the 'OUT' sector canister. As such, each sampler provides its own background sample, and, upon gas chromatographic analysis, individual compounds can be associated with the waste lagoon. Five sets of 24-hour sector samples were taken; the first set was collected prior to the start of the bioremediation effort and the remaining four sets were taken sequentially for four 24-hour periods after the start-up of the procedure

Social Networking Sites and Self-Promotional Culture. Notes for a Theory of the Mosaic Identity

Directory of Open Access Journals (Sweden)

Lucía Caro Castaño

2017-05-01

Full Text Available This exploratory work theorizes about how social networking sites favor, as identity technologies, a way of conceiving and presenting individual identity in self-promotional terms. As a result of the normalization of this logic –which is coherent with the late capitalism’ promotional culture–, it is growing the incorporation of self-branding practices in the users's daily communication. Besides, it is increasing the perception of the social profiles as micro-media and the interpretation of the own network as a personal audience. In brief, four main trends in the presentation of identity which are promoted by these web services are identified: a distributed and fragmented conception of the self, where the tiles from mass media become key content to express subjectivity; a tendency to quantify relationships and affections; the perception of being in an unavoidable competition with others; and standardization of the audiovisual presentation of self as a communicative material capable of attracting attention and communicate authenticity.

Implementing a Nutrition and Physical Activity Curriculum in Head Start Through an Academic-Community Partnership.

Science.gov (United States)

Zahnd, Whitney E; Smith, Tracey; Ryherd, Susan J; Cleer, Melissa; Rogers, Valerie; Steward, David E

2017-06-01

Schools may be an effective avenue for interventions that prevent childhood obesity. I am Moving I am Learning/Choosy Kids © (IMIL/CK) is a curriculum recommended by Head Start (HS) for education in nutrition, physical activity, and healthy lifestyle habits. We formed an academic-community partnership (ACP), the Springfield Collaborative for Active Child Health, to promote prevention of childhood obesity, in part, to implement the IMIL/CK curriculum in local HS sites. The ACP included a medical school, HS program, public school district, and state health department. Community-based participatory research principles helped identify and organize important implementation activities: community engagement, curriculum support, professional teacher training, and evaluation. IMIL/CK was piloted in 1 school then implemented in all local HS sites. All sites were engaged in IMIL/CK professional teacher training, classroom curriculum delivery, and child physical activity assessments. Local HS policy changed to include IMIL/CK in lesson plans and additional avenues of collaboration were initiated. Furthermore, improvements in physical activity and/or maintenance or improvement of healthy weight prevalence was seen in 4 of the 5 years evaluated. An ACP is an effective vehicle to implement and evaluate childhood obesity prevention programming in HS sites. © 2017, American School Health Association.

Conference report: 2012 Repository Symposium. Final storage in Germany. New start - ways and consequences of the site selection procedure

International Nuclear Information System (INIS)

Kettler, John

2012-01-01

The Aachen Institute for Nuclear Training invited participants to the 3-day '2012 Repository Symposium - Final Storage in Germany' held in Bonn. The subtitle of the event, 'New Start - Ways and Consequences of the Site Selection Procedure,' expressed the organizers' summary that the Repository Finding Act currently under discussion did not give rise to any expectation of a repository for high-level radioactive waste before 2080. The symposium was attended by more than 120 persons from Germany and abroad. They discussed the basic elements of the site selection procedure and its consequences on the basis of the draft so far known to the public. While extensive public participation is envisaged for the stage of finding a repository, this does not apply to the draft legislation in the same way. The legal determinations are negotiated in a small circle by the political parties and the state governments. Michael Sailer (Oeko-Institut e.V.) holds that agreement on a repository finding act is urgent. Prof. Dr. Bruno Thomauske (RWTH Aachen) arrives at the conclusion mentioned above, that no repository for high-level radioactive waste can start operation before 2080 on the basis of the Repository Finding Act. Dr. Bettina Keienburg, attorney at law, in her paper drew attention to the points of dispute in the draft legislation with regard to changes in competency of public authorities. The draft law indicated a clear shift of competency for finding a repository from the Federal Office for Radiation Protection to a federal agency yet to be set up. Prof. Dr. Christoph Moench outlined the deficiencies of the draft legislation in matters of refinancing and the polluter-pays principle. Among the tentative solutions discussed it was above all the Swedish model which was acclaimed most widely. (orig.)

Two DNA sites for MelR in the same orientation are sufficient for optimal MelR-dependent

OpenAIRE

Elrobh, M.; Webster, C.; Samarasinghe, S.; Durose, D.; Busby, S.

2012-01-01

The Escherichia coli melR gene encodes the MelR transcription factor that controls melibiose utilization. Expression of melR is autoregulated by MelR, which represses the melR promoter by binding to a target that overlaps the transcript start. Here, we show that MelR-dependent repression of the melR promoter can be enhanced by the presence of a second single DNA site for MelR located up to 250 base pairs upstream. Parallels with AraC-dependent repression at the araC–araBAD regulatory region a...

Histone modification alteration coordinated with acquisition of promoter DNA methylation during Epstein-Barr virus infection.

Science.gov (United States)

Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi

2017-08-15

Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were "DNA methylation-sensitive" genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A . The other half were "DNA methylation-resistant" genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site.

Identification of operator sites of the CI repressor of phage TP901-1: evolutionary link to other phages

International Nuclear Information System (INIS)

Johansen, Annette H.; Broendsted, Lone; Hammer, Karin

2003-01-01

The repressor encoded by the cI gene of the temperate Lactococcus lactis subsp. cremoris bacteriophage TP901-1 has been purified. Gel-retardation and footprinting analyses identified three palindromic operator sites (O R , O L , and O D ). The operator site O R is located between the two divergent early promoters P R and P L , O L overlaps the transcriptional start of the lytic P L promoter, and O D is located downstream of the mor gene, the first gene in the lytic gene cluster. The function of O L was verified by mutational analysis. Binding was found to be specific and cooperative. Multimeric forms of the repressor were observed, thus indicating that the repressor may bind simultaneously to all three operator sites. Inverted repeats with homology to the operator sites of TP901-1 were identified in phage genomes encoding repressors homologous to CI of TP901-1. Interestingly, the locations of these repeats on the phage genomes correspond to those found in TP901-1, indicating that the same system of cooperative repression of early phage promoters has been inherited by modular evolution

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus

Science.gov (United States)

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-01-01

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934

Human-Specific Histone Methylation Signatures at Transcription Start Sites in Prefrontal Neurons

Science.gov (United States)

Cheung, Iris; Bharadwaj, Rahul; Chou, Hsin-Jung; Houston, Isaac B.; Peter, Cyril J.; Mitchell, Amanda C.; Yao, Wei-Dong; Myers, Richard H.; Chen, Jiang-fan; Preuss, Todd M.; Rogaev, Evgeny I.; Jensen, Jeffrey D.; Weng, Zhiping; Akbarian, Schahram

2012-01-01

Cognitive abilities and disorders unique to humans are thought to result from adaptively driven changes in brain transcriptomes, but little is known about the role of cis-regulatory changes affecting transcription start sites (TSS). Here, we mapped in human, chimpanzee, and macaque prefrontal cortex the genome-wide distribution of histone H3 trimethylated at lysine 4 (H3K4me3), an epigenetic mark sharply regulated at TSS, and identified 471 sequences with human-specific enrichment or depletion. Among these were 33 loci selectively methylated in neuronal but not non-neuronal chromatin from children and adults, including TSS at DPP10 (2q14.1), CNTN4 and CHL1 (3p26.3), and other neuropsychiatric susceptibility genes. Regulatory sequences at DPP10 and additional loci carried a strong footprint of hominid adaptation, including elevated nucleotide substitution rates and regulatory motifs absent in other primates (including archaic hominins), with evidence for selective pressures during more recent evolution and adaptive fixations in modern populations. Chromosome conformation capture at two neurodevelopmental disease loci, 2q14.1 and 16p11.2, revealed higher order chromatin structures resulting in physical contact of multiple human-specific H3K4me3 peaks spaced 0.5–1 Mb apart, in conjunction with a novel cis-bound antisense RNA linked to Polycomb repressor proteins and downregulated DPP10 expression. Therefore, coordinated epigenetic regulation via newly derived TSS chromatin could play an important role in the emergence of human-specific gene expression networks in brain that contribute to cognitive functions and neurological disease susceptibility in modern day humans. PMID:23185133

Communication activities for NUMO's site selection process

International Nuclear Information System (INIS)

Takeuchi, Mitsuo; Okuyama, Shigeru; Kitayama, Kazumi; Kuba, Michiyoshi

2004-01-01

A siting program for geological disposal of high-level radioactive waste (HLW) in Japan has just started and is moving into a new stage of communication with the public. A final repository site will be selected via a stepwise process, as stipulated in the Specified Radioactive Waste Final Disposal Act promulgated in June 2000. Based on the Act, the site selection process of the Nuclear Waste Management Organization of Japan (NUMO, established in October 2000) will be carried out in the three steps: selection of Preliminary Investigation Areas (PIAs), selection of Detailed Investigation Areas (DIAs) and selection of the Repository Site. The Act also defines NUMO's responsibilities in terms of implementing the HLW disposal program in an open and transparent manner. NUMO fully understands the importance of public participation in its activities and is aiming to promote public involvement in the process of site selection based on a fundamental policy, which consists of 'adopting a stepwise approach', 'respecting the initiative of municipalities' and 'ensuring transparency in information disclosure'. This policy is clearly reflected in the adoption of an open solicitation approach for volunteer municipalities for Preliminary Investigation Areas (PIAs). NUMO made the official announcement of the start of its open solicitation program on 19 December 2002. This paper outlines how NUMO's activities are currently carried out with a view to encouraging municipalities to volunteer as PIAs and how public awareness of the safety of the HLW disposal is evaluated at this stage

Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

Science.gov (United States)

Brierley, I; Hoggett, J G

1992-07-01

The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

Core Promoter Structure in the Oomycete Phytophthora infestans

Science.gov (United States)

McLeod, Adele; Smart, Christine D.; Fry, William E.

2004-01-01

We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene β-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (−2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced β-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region. PMID:14871940

ADAM13 cleavage of cadherin-11 promotes CNC migration independently of the homophilic binding site.

Science.gov (United States)

Abbruzzese, Genevieve; Becker, Sarah F; Kashef, Jubin; Alfandari, Dominique

2016-07-15

The cranial neural crest (CNC) is a highly motile population of cells that is responsible for forming the face and jaw in all vertebrates and perturbing their migration can lead to craniofacial birth defects. Cell motility requires a dynamic modification of cell-cell and cell-matrix adhesion. In the CNC, cleavage of the cell adhesion molecule cadherin-11 by ADAM13 is essential for cell migration. This cleavage generates a shed extracellular fragment of cadherin-11 (EC1-3) that possesses pro-migratory activity via an unknown mechanism. Cadherin-11 plays an important role in modulating contact inhibition of locomotion (CIL) in the CNC to regulate directional cell migration. Here, we show that while the integral cadherin-11 requires the homophilic binding site to promote CNC migration in vivo, the EC1-3 fragment does not. In addition, we show that increased ADAM13 activity or expression of the EC1-3 fragment increases CNC invasiveness in vitro and blocks the repulsive CIL response in colliding cells. This activity requires the presence of an intact homophilic binding site on the EC1-3 suggesting that the cleavage fragment may function as a competitive inhibitor of cadherin-11 adhesion in CIL but not to promote cell migration in vivo. Copyright © 2015. Published by Elsevier Inc.

A synthetic arabinose-inducible promoter confers high levels of recombinant protein expression in hyperthermophilic archaeon Sulfolobus islandicus

DEFF Research Database (Denmark)

Peng, Nan; Deng, Ling; Mei, Yuxia

2012-01-01

Despite major progresses in genetic studies of hyperthermophilic archaea, recombinant protein production in these organisms always suffers from low yields and a robust expression system is still in great demand. Here we report a versatile vector that confers high levels of protein expression...... to remove the peptide tags from expressed recombinant proteins. While pEXA employed an araS promoter for protein expression, pSeSD utilized P(araS-SD), an araS derivative promoter carrying an engineered ribosome-binding site (RBS; a Shine-Dalgarno [SD] sequence). We found that P(araS-SD) directed high...... levels of target gene expression. More strikingly, N-terminal amino acid sequencing of recombinant proteins unraveled that the protein synthesized from pEXA-N-lacS lacked the designed 6×His tag and that translation initiation did not start at the ATG codon of the fusion gene. Instead, it started...

The Entrepreneur's Mode of Entry: Business Takeover or New Venture Start?

OpenAIRE

Simon C. Parker; C. Mirjam van Praag

2006-01-01

We analyse the decision to become an entrepreneur by either taking over an established business or starting a new venture from scratch. A model is developed which predicts how several individual- and firm-specific characteristics influence entrepreneurs' entry mode. The new venture creation mode is associated with higher levels of schooling and wealth, whereas managerial experience, new venture start-up capital requirements and risk promote the takeover mode. Entrepreneurs whose parents run a...

Radioactive starting aids for electrodeless light sources

International Nuclear Information System (INIS)

Proud, J.M.; Regan, R.J.; Haugsjaa, P.O.; Baird, D.H.

1980-01-01

The use of radioactive sources of α particles, β particles or γ rays as aids in starting a discharge in an electrodeless light source is discussed. The advantages of siting the sources at various positions in the device are discussed. Preferred materials are 85 Kr and 241 Am. (U.K.)

Outreach for Outreach: Targeting social media audiences to promote a NASA kids’ web site

Science.gov (United States)

Pham, C. C.

2009-12-01

The Space Place is a successful NASA web site that benefits upper elementary school students and educators by providing games, activities, and resources to stimulate interest in science, technology, engineering, and mathematics, as well as to inform the audience of NASA’s contributions. As online social networking grows to be a central component of modern communication, The Space Place has explored the benefits of integrating social networks with the web site to increase awareness of materials the web site offers. This study analyzes the capabilities of social networks, and specifically the demographics of Twitter and Facebook. It then compares these results with the content, audience, and perceived demographics of The Space Place web site. Based upon the demographic results, we identified a target constituency that would benefit from the integration of social networks into The Space Place web site. As a result of this study, a Twitter feed has been established that releases a daily tweet from The Space Place. In addition, a Facebook page has been created to showcase new content and prompt interaction among fans of The Space Place. Currently, plans are under way to populate the Space Place Facebook page. Each social network has been utilized in an effort to spark excitement about the content on The Space Place, as well as to attract followers to the main NASA Space Place web site. To pursue this idea further, a plan has been developed to promote NASA Space Place’s social media tools among the target audience.

Costs of promoting exclusive breastfeeding at community level in three sites in South Africa.

Directory of Open Access Journals (Sweden)

Lungiswa Leonora Nkonki

Full Text Available Community-based peer support has been shown to be effective in improving exclusive breastfeeding rates in a variety of settings.We conducted a cost analysis of a community cluster randomised-controlled trial (Promise-EBF, aimed at promoting exclusive infant feeding in three sites in South Africa. The costs were considered from the perspective of health service providers. Peer supporters in this trial visited women to support exclusive infant feeding, once antenatally and four times postpartum.The total economic cost of the Promise-EBF intervention was US$393 656, with average costs per woman and per visit of US$228 and US$52, respectively. The average costs per woman and visit in an operational 'non research' scenario were US$137 and US$32 per woman and visit, respectively. Investing in the promotion of exclusive infant feeding requires substantial financial commitment from policy makers. Extending the tasks of multi-skilled community health workers (CHWs to include promoting exclusive infant feeding is a potential option for reducing these costs. In order to avoid efficiency losses, we recommend that the time requirements for delivering the promotion of exclusive infant feeding are considered when integrating it within the existing activities of CHWs.This paper focuses on interventions for exclusive infant feeding, but its findings more generally illustrate the importance of documenting and quantifying factors that affect the feasibility and sustainability of community-based interventions, which are receiving increased focus in low income settings.

Negative effect of the 5'-untranslated leader sequence on Ac transposon promoter expression.

Science.gov (United States)

Scortecci, K C; Raina, R; Fedoroff, N V; Van Sluys, M A

1999-08-01

Transposable elements are used in heterologous plant hosts to clone genes by insertional mutagenesis. The Activator (Ac) transposable element has been cloned from maize, and introduced into a variety of plants. However, differences in regulation and transposition frequency have been observed between different host plants. The cause of this variability is still unknown. To better understand the activity of the Ac element, we analyzed the Ac promoter region and its 5'-untranslated leader sequence (5' UTL). Transient assays in tobacco NT1 suspension cells showed that the Ac promoter is a weak promoter and its activity was localized by deletion analyses. The data presented here indicate that the core of the Ac promoter is contained within 153 bp fragment upstream to transcription start sites. An important inhibitory effect (80%) due to the presence of the 5' UTL was found on the expression of LUC reporter gene. Here we demonstrate that the presence of the 5' UTL in the constructs reduces the expression driven by either strong or weak promoters.

Oil field rejuvenation work starts at 14 project sites

International Nuclear Information System (INIS)

Petzet, G.A.

1992-01-01

This paper reports that the U.S. Department of Energy and oil and gas companies have released more information about a joint effort to rejuvenate aging U.S. oil fields in danger of abandonment. Work is starting on 14 demonstration projects that could recover 21 million bbl of oil from the fluvial dominated deltaic (FDD) reservoirs in which they are conducted. Wider application of the same techniques, if they are successful, could results in addition of 6.3 billion bbl of reserves, nearly 25% of U.S. crude oil reserves. A multidisciplinary team approach is to be used, with as many as 11 operators, service companies, universities, or state agencies participating in each project. All of the projects will culminate in extensive technology transfer activities. Here are descriptions of the projects gleaned from public abstracts provided by the DOE contractors

DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

Directory of Open Access Journals (Sweden)

Shimrat Mamrut

Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

Effect of zero-valent iron and trivalent iron on UASB rapid start-up.

Science.gov (United States)

Wang, Jie; Fang, Hongyan; Jia, Hui; Yang, Guang; Gao, Fei; Liu, Wenbin

2018-01-01

In order to realize the rapid start-up of upflow anaerobic sludge blanket (UASB) reactor, the iron ion in different valence state was added to UASB. The results indicated that the start-up time of R3 (FeCl 3 ) was 48 h faster than that of R2 (zero-valent iron (ZVI)). It was because the FeCl 3 could rapidly promote granulation of sludge as a flocculant. However, ZVI released Fe 2+ through corrosion slowly, and then the Fe 2+ increased start-up speed by enhancing enzyme activity and enriching methanogens. In addition, the ZVI and FeCl 3 could promote hydrolysis acidification and strengthen the decomposition of long-chain fatty acids. The detection of iron ions showed that iron ions mainly existed in the sludge. Because the high concentration of Fe 2+ could inhibit anaerobic bacteria activity, excess Fe 3+ could be changed into iron hydroxide precipitation to hinder the mass transfer process of anaerobic bacteria under the alkaline condition. The FeCl 3 was suitable to be added at the initial stage of UASB start-up, and the ZVI was more fitted to be used in the middle stage of reactor start-up to improve the redox ability.

Correction of a splice-site mutation in the beta-globin gene stimulated by triplex-forming peptide nucleic acids

DEFF Research Database (Denmark)

Chin, Joanna Y; Kuan, Jean Y; Lonkar, Pallavi S

2008-01-01

Splice-site mutations in the beta-globin gene can lead to aberrant transcripts and decreased functional beta-globin, causing beta-thalassemia. Triplex-forming DNA oligonucleotides (TFOs) and peptide nucleic acids (PNAs) have been shown to stimulate recombination in reporter gene loci in mammalian...... DNA fragments, can promote single base-pair modification at the start of the second intron of the beta-globin gene, the site of a common thalassemia-associated mutation. This single base pair change was detected by the restoration of proper splicing of transcripts produced from a green fluorescent...

Identification and characterization of a liver stage-specific promoter region of the malaria parasite Plasmodium.

Directory of Open Access Journals (Sweden)

Susanne Helm

Full Text Available During the blood meal of a Plasmodium-infected mosquito, 10 to 100 parasites are inoculated into the skin and a proportion of these migrate via the bloodstream to the liver where they infect hepatocytes. The Plasmodium liver stage, despite its clinical silence, represents a highly promising target for antimalarial drug and vaccine approaches. Successfully invaded parasites undergo a massive proliferation in hepatocytes, producing thousands of merozoites that are transported into a blood vessel to infect red blood cells. To successfully develop from the liver stage into infective merozoites, a tight regulation of gene expression is needed. Although this is a very interesting aspect in the biology of Plasmodium, little is known about gene regulation in Plasmodium parasites in general and in the liver stage in particular. We have functionally analyzed a novel promoter region of the rodent parasite Plasmodium berghei that is exclusively active during the liver stage of the parasite. To prove stage-specific activity of the promoter, GFP and luciferase reporter assays have been successfully established, allowing both qualitative and accurate quantitative analysis. To further characterize the promoter region, the transcription start site was mapped by rapid amplification of cDNA ends (5'-RACE. Using promoter truncation experiments and site-directed mutagenesis within potential transcription factor binding sites, we suggest that the minimal promoter contains more than one binding site for the recently identified parasite-specific ApiAP2 transcription factors. The identification of a liver stage-specific promoter in P. berghei confirms that the parasite is able to tightly regulate gene expression during its life cycle. The identified promoter region might now be used to study the biology of the Plasmodium liver stage, which has thus far proven problematic on a molecular level. Stage-specific expression of dominant-negative mutant proteins and

bTSSfinder: a novel tool for the prediction of promoters in Cyanobacteria andEscherichia coli

KAUST Repository

Shahmuradov, Ilham Ayub

2016-09-29

Motivation: The computational search for promoters in prokaryotes remains an attractive problem in bioinformatics. Despite the attention it has received for many years, the problem has not been addressed satisfactorily. In any bacterial genome, the transcription start site is chosen mostly by the sigma (σ) factor proteins, which control the gene activation. The majority of published bacterial promoter prediction tools target σ70 promoters in Escherichia coli. Moreover, no σ-specific classification of promoters is available for prokaryotes other than for E. coli. Results: Here, we introduce bTSSfinder, a novel tool that predicts putative promoters for five classes of σ factors in Cyanobacteria (σA, σC, σH, σG and σF) and for five classes of sigma factors in E. coli (σ70, σ38, σ32, σ28 and σ24). Comparing to currently available tools, bTSSfinder achieves higher accuracy (MCC=0.86, F1-score=0.93) compared to the next best tool with MCC=0.59, F1-score=0.79) and covers multiple classes of promoters.

Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

International Nuclear Information System (INIS)

Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

2017-01-01

Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

Weight loss after gastric bypass surgery in human obesity remodels promoter methylation

DEFF Research Database (Denmark)

Barres, Romain; Kirchner, Henriette; Rasmussen, Morten

2013-01-01

observed in the normal-weight, healthy subjects. Using bisulfite sequencing, we show that promoter methylation of PGC-1a and PDK4 is altered with obesity and restored to nonobese levels after RYGB-induced weight loss. A genome-wide DNA methylation analysis of skeletal muscle revealed that obesity...... of genes enriched in metabolic process and mitochondrial function. After weight loss, the expression of the majority of the identified genes was normalized to levels observed in normal-weight, healthy controls. Among the 14 metabolic genes analyzed, promoter methylation of 11 genes was normalized to levels...... is associated with hypermethylation at CpG shores and exonic regions close to transcription start sites. Our results provide evidence that obesity and RYGB-induced weight loss have a dynamic effect on the epigenome....

MUS81 promotes common fragile site expression

DEFF Research Database (Denmark)

Ying, Songmin; Minocherhomji, Sheroy; Chan, Kok Lung

2013-01-01

Fragile sites are chromosomal loci with a propensity to form gaps or breaks during early mitosis, and their instability is implicated as being causative in certain neurological disorders and cancers. Recent work has demonstrated that the so-called common fragile sites (CFSs) often impair the fait......Fragile sites are chromosomal loci with a propensity to form gaps or breaks during early mitosis, and their instability is implicated as being causative in certain neurological disorders and cancers. Recent work has demonstrated that the so-called common fragile sites (CFSs) often impair...... the faithful disjunction of sister chromatids in mitosis. However, the mechanisms by which CFSs express their fragility, and the cellular factors required to suppress CFS instability, remain largely undefined. Here, we report that the DNA structure-specific nuclease MUS81-EME1 localizes to CFS loci in early...

Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.

Science.gov (United States)

Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung

2015-07-27

Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Site specific information in site selection

International Nuclear Information System (INIS)

Aeikaes, T.; Hautojaervi, A.

1998-01-01

The programme for the siting of a deep repository for final disposal of spent nuclear fuel was started already in 1983 and is carried out today by Posiva Oy which continues the work started by Teollisuuden Voima Oy. The programme aims at site selection by the end of the year 2000. The programme has progressed in successive interim stages with defined goals. After an early phase for site identification, five sites were selected in 1987 for preliminary site characterisation. Three of these were selected and judged to be best suited for the more detailed characterisation in 1992. An additional new site was included into the programme based on a separate feasibility study in the beginning of 1997. Since the year 1983 several safety assessments together with technical plans of the facility have been completed. When approaching the site selection the needs for more detailed consideration of the site specific properties in the safety assessment have been increased. The Finnish regulator STUK has published a proposal for general safety requirements for the final disposal of spent nuclear fuel in Finland. This set of requirements has been projected to be used in conjunction of the decision making by the end 2000. Based on the site evaluation all sites can provide a stable environment and there is evidence that the requirements for the longevity of the canister can be fulfilled at each site. In this manner the four candidate sites do not differ too much from each other. The main difference between the sites is in the salinity of the deep groundwater. The significance of differences in the salinity for the long-term safety cannot be defined yet. The differences may contribute to the discussion of the longevity of the bentonite buffer and also to the modelling of the groundwater flow and transport. The use of the geosphere as a transport barrier is basically culminated on the questions about sparse but fast flow routes and 'how bad channeling can be'. To answer these questions

Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

Mice and men: their promoter properties.

Directory of Open Access Journals (Sweden)

2006-04-01

Full Text Available Using the two largest collections of Mus musculus and Homo sapiens transcription start sites (TSSs determined based on CAGE tags, ditags, full-length cDNAs, and other transcript data, we describe the compositional landscape surrounding TSSs with the aim of gaining better insight into the properties of mammalian promoters. We classified TSSs into four types based on compositional properties of regions immediately surrounding them. These properties highlighted distinctive features in the extended core promoters that helped us delineate boundaries of the transcription initiation domain space for both species. The TSS types were analyzed for associations with initiating dinucleotides, CpG islands, TATA boxes, and an extensive collection of statistically significant cis-elements in mouse and human. We found that different TSS types show preferences for different sets of initiating dinucleotides and cis-elements. Through Gene Ontology and eVOC categories and tissue expression libraries we linked TSS characteristics to expression. Moreover, we show a link of TSS characteristics to very specific genomic organization in an example of immune-response-related genes (GO:0006955. Our results shed light on the global properties of the two transcriptomes not revealed before and therefore provide the framework for better understanding of the transcriptional mechanisms in the two species, as well as a framework for development of new and more efficient promoter- and gene-finding tools.

Multiple 5' ends of human cytomegalovirus UL57 transcripts identify a complex, cycloheximide-resistant promoter region that activates oriLyt

International Nuclear Information System (INIS)

Kiehl, Anita; Huang, Lili; Franchi, David; Anders, David G.

2003-01-01

The human cytomegalovirus (HCMV) UL57 gene lies adjacent to HCMV oriLyt, from which it is separated by an organizationally conserved, mostly noncoding region that is thought to both regulate UL57 expression and activate oriLyt function. However, the UL57 promoter has not been studied. We determined the 5' ends of UL57 transcripts toward an understanding of the potential relationship between UL57 expression and oriLyt activation. The results presented here identified three distinct 5' ends spread over 800 bp, at nt 90302, 90530, and 91138; use of these sites exhibited differential sensitivity to phosphonoformic acid treatment. Interestingly, a 10-kb UL57 transcript accumulated in cycloheximide-treated infected cells, even though other early transcripts were not detectable. However, the 10-kb transcript did not accumulate in cells treated with the more stringent translation inhibitor anisomycin. Consistent with the notion that the identified 5' ends arise from distinct transcription start sites, the sequences upstream of sites I and II functioned as promoters responsive to HCMV infection in transient assays. However, the origin-proximal promoter region III required downstream sequences for transcriptional activity. Mutation of candidate core promoter elements suggested that promoter III is regulated by an initiator region (Inr) and a downstream promoter element. Finally, a 42-bp sequence containing the candidate Inr activated a minimal oriLyt core construct in transient replication assays. Thus, these studies showed that a large, complex promoter region with novel features controls UL57 expression, and identified a sequence that regulates both UL57 transcription and oriLyt activation

Structural and functional analysis of mouse Msx1 gene promoter: sequence conservation with human MSX1 promoter points at potential regulatory elements.

Science.gov (United States)

Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E

1998-06-01

Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.

Genomic organization and promoter cloning of the human X11α gene APBA1.

LENUS (Irish Health Repository)

Chai, Ka-Ho

2012-05-01

X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.

Viral promoters can initiate expression of toxin genes introduced into Escherichia coli

Directory of Open Access Journals (Sweden)

Jacob Daniela

2005-06-01

Full Text Available Abstract Background The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. Results We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5' LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the existence of bacterial -10 and -35 consensus sequences. The importance of this heterologous gene expression for safety considerations was further supported by analysing fusions between the aforementioned promoters and a promoter-less cytotoxin gene. Conclusion According to our results a high percentage of viral promoters have the ability of initiating gene expression in E. coli. The degree of such heterologous gene expression can be sufficient for the expression of toxin genes and must therefore be considered when defining safety measures for the handling of corresponding genetically modified organisms.

Promoter methylation and age-related downregulation of Klotho in rhesus monkey.

Science.gov (United States)

King, Gwendalyn D; Rosene, Douglas L; Abraham, Carmela R

2012-12-01

While overall DNA methylation decreases with age, CpG-rich areas of the genome can become hypermethylated. Hypermethylation near transcription start sites typically decreases gene expression. Klotho (KL) is important in numerous age-associated pathways including insulin/IGF1 and Wnt signaling and naturally decreases with age in brain, heart, and liver across species. Brain tissues from young and old rhesus monkeys were used to determine whether epigenetic modification of the KL promoter underlies age-related decreases in mRNA and protein levels of KL. The KL promoter in genomic DNA from brain white matter did not show evidence of oxidation in vivo but did exhibit an increase in methylation with age. Further analysis identified individual CpG motifs across the region of interest with increased methylation in old animals. In vitro methyl modification of these individual cytosine residues confirmed that methylation of the promoter can decrease gene transcription. These results provide evidence that changes in KL gene expression with age may, at least in part, be the result of epigenetic changes to the 5' regulatory region.

Sprucing up the site - update

CERN Multimedia

2009-01-01

As mentioned in a previous article the Bulletin will be publishing regular short updates following the consolidation work going on around the CERN sites: All internal lighting is being replaced in the office buildings on the Prevessin site. Work has started in building 866 and will move to 864 and 865 later. New energy-efficient lights are being installed, which will reduce electricity consumption by 30 -50%, and in the common areas like corridors the lighting will be switched on by motion sensors. Also in the Prevessin site, the lines in the car parks are being repainted. This will continue in the Meyrin site later. Work has started in Building 30 to completely refurbish the AT Auditorium.

Queer as F**k: reaching and engaging gay men in sexual health promotion through social networking sites.

Science.gov (United States)

Pedrana, Alisa; Hellard, Margaret; Gold, Judy; Ata, Nadine; Chang, Shanton; Howard, Steve; Asselin, Jason; Ilic, Olivia; Batrouney, Colin; Stoove, Mark

2013-02-07

A growing number of health promotion interventions are taking advantage of the popularity and interactivity of new social media platforms to foster and engage communities for health promotion. However, few health promotion interventions using social networking sites (SNS) have been rigorously evaluated. "Queer as F**k"(QAF) began as pilot project in 2010 to deliver sexual health promotion via short "webisodes" on SNS to gay men. Now in its fifth season, QAF is among the few published examples internationally to demonstrate the sexual health promotion potential of SNS. The objective of this evaluation is to assess reach, interactivity, and engagement generated by QAF to inform future health interventions and evaluations using SNS. We undertook a mixed method process evaluation using an uncontrolled longitudinal study design that compared multiple measurements over time to assess changes in reach and engagement. We adapted evaluation methods from the health promotion, information systems, and creative spheres. We incorporated online usage statistics, interviews informed by user diary-scrapbooks, and user focus groups to assess intervention reach and engagement. During Series 1-3 (April 2010 to April 2011), 32 webisodes were posted on the QAF Facebook and YouTube pages. These webisodes attracted over 30,000 views; ranging from 124-3092 views per individual episode. By April 2011, the QAF Facebook page had 2929 predominantly male fans. Interview and focus group participants supported the balance of education and entertainment. They endorsed the narrative "soap opera" format as an effective way to deliver sexual health messages in an engaging, informative, and accessible manner that encouraged online peer discussion of sexual health and promoted community engagement. QAF offers a successful example of exploiting the reach, interactivity, and engagement potential of SNS; findings from this process evaluation provide a model to inform the delivery and evaluation of future

Transcription of potato spindle tuber viroid by RNA polymerase II starts in the left terminal loop

International Nuclear Information System (INIS)

Kolonko, Nadine; Bannach, Oliver; Aschermann, Katja; Hu, Kang-Hong; Moors, Michaela; Schmitz, Michael; Steger, Gerhard; Riesner, Detlev

2006-01-01

Viroids are single-stranded, circular RNAs of 250 to 400 bases, that replicate autonomously in their host plants but do not code for a protein. Viroids of the family Pospiviroidae, of which potato spindle tuber viroid (PSTVd) is the type strain, are replicated by the host's DNA-dependent RNA polymerase II in the nucleus. To analyze the initiation site of transcription from the (+)-stranded circles into (-)-stranded replication intermediates, we used a nuclear extract from a non-infected cell culture of the host plant S. tuberosum. The (-)-strands, which were de novo-synthesized in the extract upon addition of circular (+)-PSTVd, were purified by affinity chromatography. This purification avoided contamination by host nucleic acids that had resulted in a misassignment of the start site in an earlier study. Primer-extension analysis of the de novo-synthesized (-)-strands revealed a single start site located in the hairpin loop of the left terminal region in circular PSTVd's secondary structure. This start site is supported further by analysis of the infectivity and replication behavior of site-directed mutants in planta

Physical properties of naked DNA influence nucleosome positioning and correlate with transcription start and termination sites in yeast

Directory of Open Access Journals (Sweden)

Soler-López Montserrat

2011-10-01

Full Text Available Abstract Background In eukaryotic organisms, DNA is packaged into chromatin structure, where most of DNA is wrapped into nucleosomes. DNA compaction and nucleosome positioning have clear functional implications, since they modulate the accessibility of genomic regions to regulatory proteins. Despite the intensive research effort focused in this area, the rules defining nucleosome positioning and the location of DNA regulatory regions still remain elusive. Results Naked (histone-free and nucleosomal DNA from yeast were digested by microccocal nuclease (MNase and sequenced genome-wide. MNase cutting preferences were determined for both naked and nucleosomal DNAs. Integration of their sequencing profiles with DNA conformational descriptors derived from atomistic molecular dynamic simulations enabled us to extract the physical properties of DNA on a genomic scale and to correlate them with chromatin structure and gene regulation. The local structure of DNA around regulatory regions was found to be unusually flexible and to display a unique pattern of nucleosome positioning. Ab initio physical descriptors derived from molecular dynamics were used to develop a computational method that accurately predicts nucleosome enriched and depleted regions. Conclusions Our experimental and computational analyses jointly demonstrate a clear correlation between sequence-dependent physical properties of naked DNA and regulatory signals in the chromatin structure. These results demonstrate that nucleosome positioning around TSS (Transcription Start Site and TTS (Transcription Termination Site (at least in yeast is strongly dependent on DNA physical properties, which can define a basal regulatory mechanism of gene expression.

RA-6 reactor's probabilistic safety evaluation. Identification and selection of starting events

International Nuclear Information System (INIS)

Kay, J.; Chiossi, C.; Felizia, E.; Vallerga, H.; Kalejman, G.; Navarro, R.; Caruso, G.J.

1987-01-01

A summary of the 'Identification and selection of starting events' stage of the previous probabilistic safety evaluation of RA-6 reactor is presented. This evaluation was performed to verify if the safety criteria required for the licensing of RA-6 are met and to promote the diffusion of its meaning and usefulness with educational purposes. At this stage the starting events of RA-6 are determined and the probability that such events occur is calculated. The identification and selection of starting events is performed in two steps: determination of proposed starting events and determination of postulated starting events. The proposed starting events are determined by means of the master logic diagram (MLD) method, while the postulated starting events are obtained by grouping the proposed starting events. The simplifying hypothesis required for the application of MLD to the reactor are also formulated. The probability that the proposed and postulated starting events occur is afterwards calculated, adopting different fault models, in accordance with the nature of events that are considered. Conservative hypothesis on the characteristics of these events and the uncertainty of parameter values of those models are also formulated. The numerical values of the above mentioned probabilities are obtained by giving the parameters suitable values that are extracted from specialized publications. (Author)

Joomla! Start to Finish How to Plan, Execute, and Maintain Your Web Site

CERN Document Server

Kramer, Jen

2010-01-01

There is much more to building a great web site than just downloading and installing Joomla!. This book provides crucial content on planning the website, before launching into the technology steps. It will show the reader how to analyze the client company's strategy and how to find out how the organization wants itself reflected and supported by the web site. Then it will cover the right technological solutions to the problems and getting the site structure organized via a site map.  All of this is done before you establish hosting or install Joomla!. Once the technology steps are established,

Plant growth promotion, metabolite production and metal tolerance of dark septate endophytes isolated from metal-polluted poplar phytomanagement sites.

Science.gov (United States)

Berthelot, Charlotte; Leyval, Corinne; Foulon, Julie; Chalot, Michel; Blaudez, Damien

2016-10-01

Numerous studies address the distribution and the diversity of dark septate endophytes (DSEs) in the literature, but little is known about their ecological role and their effect on host plants, especially in metal-polluted soils. Seven DSE strains belonging to Cadophora, Leptodontidium, Phialophora and Phialocephala were isolated from roots of poplar trees from metal-polluted sites. All strains developed on a wide range of carbohydrates, including cell-wall-related compounds. The strains evenly colonized birch, eucalyptus and ryegrass roots in re-synthesis experiments. Root and shoot growth promotion was observed and was both plant and strain dependent. Two Phialophora and Leptodontidium strains particularly improved plant growth. However, there was no correlation between the level of root colonization by DSEs and the intensity of growth promotion. All strains produced auxin and six also stimulated plant growth through the release of volatile organic compounds (VOCs). SPME-GC/MS analyses revealed four major VOCs emitted by Cadophora and Leptodontidium The strains exhibited growth at high concentrations of several metals. The ability of metal-resistant DSE strains to produce both soluble and volatile compounds for plant growth promotion indicates interesting microbial resources with high potential to support sustainable production of bioenergy crops within the context of the phytomanagement of metal-contaminated sites. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Experimental Labs for Start-Ups: The Role of the "Venture-Sitter"

Science.gov (United States)

Matricano, Diego; Pietrobon, Alberto

2010-01-01

Curley and Formica's (2008, 2010) studies of high-expectation entrepreneurship focus on the role of "experimental laboratories" in promoting the start-up and successful development of high-expectation firms. Although it is not difficult to understand the potential usefulness of these experimental labs--business simulators in which skilled partners…

Social Network Sites: A Starting Point for Career Development Practitioners

Science.gov (United States)

Strehlke, Christina

2010-01-01

This action research study explores the career influence of social network sites (SNSs) by examining 14 web-based articles that consider the risks and opportunities of SNSs from a job search perspective. Three themes are discussed: user visibility, self-presentation, and network connections. Practical strategies are identified to help career…

The promotion of sales on the consumer markets: Offer of a new approach of promotional management

OpenAIRE

FRANCISCO JAVIER VILLABA MERLO; IÑAKI PERIÁÑEZ CAÑADILLAS

2002-01-01

Nowadays, there are many factors that have provoked a greater use of promotion by some manufacturers in the consumption markets. Traditionally, firms have used promotion as the last resource for the achievement of the goals of selling. When we analyse promotional management, this kind of performance represents an orientation to sales. In our field work we justify the breaking-off with this management philosophy, starting with a newdefinition for “sales promotion”, that includes the internal c...

Structure and functional regulation of the CD38 promoter

International Nuclear Information System (INIS)

Sun Li; Iqbal, Jameel; Zaidi, Samir; Zhu Linglng; Zhang Xuefeng; Peng Yuanzheng; Moonga, Baljit S.; Zaidi, Mone

2006-01-01

CD38 has multiple roles in biology, including T lymphocyte signaling, neutrophil migration, neurotransmission, cell proliferation, apoptosis, and bone remodeling. To study the transcriptional control of the CD38 gene, we cloned a putative 1.8 kb promoter fragment from a rabbit genomic DNA library. Primer extension analysis indicated two transcription start sites consistent with the absence of a TATA box. Sequence analysis revealed several AP-1, AP-4, myo-D, GATA, and SP-1 sequences. MC3T3.E1 (osteoblast) or RAW-C3 (osteoclast precursor macrophage) cells were then transfected with the CD38 promoter or its deletion fragments ligated to the luciferase reporter gene. Except for the shortest 41 bp fragment, all fragments showed significant luciferase activity. There was a marked stimulation of basal activity in the 93 bp fragment that contained a GC box and SP-1 site. Furthermore, there were significant differences in the activity of the fragments in MC3T3.E1 and RAW-C3 cells. Intracellular Ca 2+ elevations by ionomycin (10 μM) in MC3T3.E1 cells inhibited promoter activity, except in the short 41 bp. In contrast, cAMP elevation by exposure to forskolin (100 μM) inhibited activation of all fragments, except the 0.6 and 1.2 kb fragments. Finally, TNF-α stimulated promoter activity in RAW-C3 cells transfected with the 93 bp and 1.0 kb fragments, consistent with the stimulation of CD38 mRNA by TNF-α. Physiologically, therefore, modulation of the expression of the NAD + -sensing enzyme, CD38, by Ca 2+ , cAMP, and cytokines, such as TNF-α may contribute to coupling the intense metabolic activity of osteoclasts and osteoblasts to their respective bone-resorbing and bone-forming functions

Incorporating availability/bioavailability in risk assessment and decision making of polluted sites, using Germany as an example.

Science.gov (United States)

Kördel, Werner; Bernhardt, Cornelia; Derz, Kerstin; Hund-Rinke, Kerstin; Harmsen, Joop; Peijnenburg, Willie; Comans, Rob; Terytze, Konstantin

2013-10-15

Nearly all publications dealing with availability or bioavailability of soil pollutants start with the following statement: the determination of total pollutant content will lead to an over-estimation of risk. However, an assessment of contaminated sites should be based on the determination of mobile fractions of pollutants, and the fractions with potential for mobilisation that threaten groundwater and surface water, and the actual and potential fractions available for uptake by plants, soil microflora and soil organisms. After reviewing the literature for method proposals concerning the determination of available/bioavailable fractions of contaminants with respect to leaching, plants, microorganisms (biodegradation) and soil organisms, we propose a testing and assessment scheme for contaminated sites. The proposal includes (i) already accepted and used methods, (ii) methods which are under standardisation, and (iii) methods for which development has just started in order to promote urgently needed research. Copyright © 2013 Elsevier B.V. All rights reserved.

Kaiso Directs the Transcriptional Corepressor MTG16 to the Kaiso Binding Site in Target Promoters

Science.gov (United States)

Barrett, Caitlyn W.; Smith, J. Joshua; Lu, Lauren C.; Markham, Nicholas; Stengel, Kristy R.; Short, Sarah P.; Zhang, Baolin; Hunt, Aubrey A.; Fingleton, Barbara M.; Carnahan, Robert H.; Engel, Michael E.; Chen, Xi; Beauchamp, R. Daniel; Wilson, Keith T.; Hiebert, Scott W.; Reynolds, Albert B.; Williams, Christopher S.

2012-01-01

Myeloid translocation genes (MTGs) are transcriptional corepressors originally identified in acute myelogenous leukemia that have recently been linked to epithelial malignancy with non-synonymous mutations identified in both MTG8 and MTG16 in colon, breast, and lung carcinoma in addition to functioning as negative regulators of WNT and Notch signaling. A yeast two-hybrid approach was used to discover novel MTG binding partners. This screen identified the Zinc fingers, C2H2 and BTB domain containing (ZBTB) family members ZBTB4 and ZBTB38 as MTG16 interacting proteins. ZBTB4 is downregulated in breast cancer and modulates p53 responses. Because ZBTB33 (Kaiso), like MTG16, modulates Wnt signaling at the level of TCF4, and its deletion suppresses intestinal tumorigenesis in the ApcMin mouse, we determined that Kaiso also interacted with MTG16 to modulate transcription. The zinc finger domains of Kaiso as well as ZBTB4 and ZBTB38 bound MTG16 and the association with Kaiso was confirmed using co-immunoprecipitation. MTG family members were required to efficiently repress both a heterologous reporter construct containing Kaiso binding sites (4×KBS) and the known Kaiso target, Matrix metalloproteinase-7 (MMP-7/Matrilysin). Moreover, chromatin immunoprecipitation studies placed MTG16 in a complex occupying the Kaiso binding site on the MMP-7 promoter. The presence of MTG16 in this complex, and its contributions to transcriptional repression both required Kaiso binding to its binding site on DNA, establishing MTG16-Kaiso binding as functionally relevant in Kaiso-dependent transcriptional repression. Examination of a large multi-stage CRC expression array dataset revealed patterns of Kaiso, MTG16, and MMP-7 expression supporting the hypothesis that loss of either Kaiso or MTG16 can de-regulate a target promoter such as that of MMP-7. These findings provide new insights into the mechanisms of transcriptional control by ZBTB family members and broaden the scope of co

Testing maternal depression and attachment style as moderators of Early Head Start's effects on parenting.

Science.gov (United States)

Berlin, Lisa J; Whiteside-Mansell, Leanne; Roggman, Lori A; Green, Beth L; Robinson, JoAnn; Spieker, Susan

2011-01-01

This study examined maternal depression, attachment avoidance, and attachment anxiety as moderators of Early Head Start's effects on four parenting outcomes assessed at age three. Participants (N = 947) were drawn from six sites of the Early Head Start National Research and Evaluation Project, a multi-site randomized trial. Findings suggest more positive program effects for mothers with less initial attachment avoidance or attachment anxiety. First, baseline attachment avoidance moderated Early Head Start program effects on observed maternal supportiveness, such that program mothers with lower baseline attachment avoidance were rated as more supportive of their three-year-olds than program mothers with higher baseline attachment avoidance. Second, program effects on spanking varied depending on mothers' baseline attachment anxiety.

Selection on start codons in prokaryotes and potential compensatory nucleotide substitutions.

Science.gov (United States)

Belinky, Frida; Rogozin, Igor B; Koonin, Eugene V

2017-09-29

Reconstruction of the evolution of start codons in 36 groups of closely related bacterial and archaeal genomes reveals purifying selection affecting AUG codons. The AUG starts are replaced by GUG and especially UUG significantly less frequently than expected under the neutral expectation derived from the frequencies of the respective nucleotide triplet substitutions in non-coding regions and in 4-fold degenerate sites. Thus, AUG is the optimal start codon that is actively maintained by purifying selection. However, purifying selection on start codons is significantly weaker than the selection on the same codons in coding sequences, although the switches between the codons result in conservative amino acid substitutions. The only exception is the AUG to UUG switch that is strongly selected against among start codons. Selection on start codons is most pronounced in evolutionarily conserved, highly expressed genes. Mutation of the start codon to a sub-optimal form (GUG or UUG) tends to be compensated by mutations in the Shine-Dalgarno sequence towards a stronger translation initiation signal. Together, all these findings indicate that in prokaryotes, translation start signals are subject to weak but significant selection for maximization of initiation rate and, consequently, protein production.

Peer Effects on Head Start Children’s Preschool Competency

Science.gov (United States)

DeLay, Dawn; Hanish, Laura D.; Martin, Carol Lynn; Fabes, Richard A.

2015-01-01

The goals of the present study were to investigate whether young children attending Head Start (N=292; Mage=4.3 years) selected peers based on their preschool competency and whether children’s levels of preschool competency were influenced by their peers’ levels of preschool competency. Children’s peer interaction partners were intensively observed several times a week over one academic year. Social network analyses revealed that children selected peer interaction partners with similar levels of preschool competency and were influenced over time by their partners’ levels of preschool competency. These effects held even after controlling for several child (e.g., sex and language) and family factors (e.g., financial strain and parent education). Implications for promoting preschool competency among Head Start children are discussed. PMID:26479545

Regional differences in gene expression and promoter usage in aged human brains

KAUST Repository

Pardo, Luba M.

2013-02-19

To characterize the promoterome of caudate and putamen regions (striatum), frontal and temporal cortices, and hippocampi from aged human brains, we used high-throughput cap analysis of gene expression to profile the transcription start sites and to quantify the differences in gene expression across the 5 brain regions. We also analyzed the extent to which methylation influenced the observed expression profiles. We sequenced more than 71 million cap analysis of gene expression tags corresponding to 70,202 promoter regions and 16,888 genes. More than 7000 transcripts were differentially expressed, mainly because of differential alternative promoter usage. Unexpectedly, 7% of differentially expressed genes were neurodevelopmental transcription factors. Functional pathway analysis on the differentially expressed genes revealed an overrepresentation of several signaling pathways (e.g., fibroblast growth factor and wnt signaling) in hippocampus and striatum. We also found that although 73% of methylation signals mapped within genes, the influence of methylation on the expression profile was small. Our study underscores alternative promoter usage as an important mechanism for determining the regional differences in gene expression at old age.

Business start-ups and the effect of coaching programs

OpenAIRE

Loersch, Christian

2015-01-01

Entrepreneurship is known to be a main driver of economic growth. Hence, governments have an interest in supporting and promoting entrepreneurial activities. Start-up subsidies, which have been analyzed extensively, only aim at mitigating the lack of financial capital. However, some entrepreneurs also lack in human, social, and managerial capital. One way to address these shortcomings is by subsidizing coaching programs for entrepreneurs. However, theoretical and empirical evidence about busi...

What do health-promoting schools promote?

DEFF Research Database (Denmark)

Simovska, Venka

2012-01-01

-promotion interventions. Directly or indirectly the articles reiterate the idea that health promotion in schools needs to be linked with the core task of the school – education, and to the values inherent to education, such as inclusion, democracy, participation and influence, critical literacy and action competence......Purpose – The editorial aims to provide a brief overview of the individual contributions to the special issue, and a commentary positioning the contributions within research relating to the health-promoting schools initiative in Europe. Design/methodology/approach – The members of the Schools...... for Health in Europe Research Group were invited to submit their work addressing processes and outcomes in school health promotion to this special issue of Health Education. Additionally, an open call for papers was published on the Health Education web site. Following the traditional double blind peer...

Identification of TNF-α-responsive promoters and enhancers in the intestinal epithelial cell model Caco-2

DEFF Research Database (Denmark)

Boyd, Mette; Coskun, Mehmet; Lilje, Berit

2014-01-01

The Caco-2 cell line is one of the most important in vitro models for enterocytes, and is used to study drug absorption and disease, including inflammatory bowel disease and cancer. In order to use the model optimally, it is necessary to map its functional entities. In this study, we have generated...... genome-wide maps of active transcription start sites (TSSs), and active enhancers in Caco-2 cells with or without tumour necrosis factor (TNF)-α stimulation to mimic an inflammatory state. We found 520 promoters that significantly changed their usage level upon TNF-α stimulation; of these, 52...... promoters. As a case example, we characterize an enhancer regulating the laminin-5 γ2-chain (LAMC2) gene by nuclear factor (NF)-κB binding. This report is the first to present comprehensive TSS and enhancer maps over Caco-2 cells, and highlights many novel inflammation-specific promoters and enhancers....

Analyzing relationships between surface perturbations and local chemical reactivity of metal sites: Alkali promotion of O2 dissociation on Ag(111)

Science.gov (United States)

Xin, Hongliang; Linic, Suljo

2016-06-01

Many commercial heterogeneous catalysts are complex structures that contain metal active sites promoted by multiple additives. Developing fundamental understanding about the impact of these perturbations on the local surface reactivity is crucial for catalyst development and optimization. In this contribution, we develop a general framework for identifying underlying mechanisms that control the changes in the surface reactivity of a metal site (more specifically the adsorbate-surface interactions) upon a perturbation in the local environment. This framework allows us to interpret fairly complex interactions on metal surfaces in terms of specific, physically transparent contributions that can be evaluated independently of each other. We use Cs-promoted dissociation of O2 as an example to illustrate our approach. We concluded that the Cs adsorbate affects the outcome of the chemical reaction through a strong alkali-induced electric field interacting with the static dipole moment of the O2/Ag(111) system.

Early Start Denver Model for Young Children with Autism: Promoting Language, Learning, and Engagement

Science.gov (United States)

Rogers, Sally J.; Dawson, Geraldine

2009-01-01

From leading authorities, this state-of-the-art manual presents the Early Start Denver Model (ESDM), the first comprehensive, empirically tested intervention specifically designed for toddlers and preschoolers with autism. Supported by the principles of developmental psychology and applied behavior analysis, ESDM's intensive teaching interventions…

Site development

International Nuclear Information System (INIS)

Noack, J.

1975-01-01

The subject of this paper is a general view over all necessary considerations to develop the site after it has been chosen and before starting with the construction of a nuclear power plant. (orig./RW) [de

Assessment of clusters of transcription factor binding sites in relationship to human promoter, CpG islands and gene expression

Directory of Open Access Journals (Sweden)

Sakaki Yoshiyuki

2004-02-01

Full Text Available Abstract Background Gene expression is regulated mainly by transcription factors (TFs that interact with regulatory cis-elements on DNA sequences. To identify functional regulatory elements, computer searching can predict TF binding sites (TFBS using position weight matrices (PWMs that represent positional base frequencies of collected experimentally determined TFBS. A disadvantage of this approach is the large output of results for genomic DNA. One strategy to identify genuine TFBS is to utilize local concentrations of predicted TFBS. It is unclear whether there is a general tendency for TFBS to cluster at promoter regions, although this is the case for certain TFBS. Also unclear is the identification of TFs that have TFBS concentrated in promoters and to what level this occurs. This study hopes to answer some of these questions. Results We developed the cluster score measure to evaluate the correlation between predicted TFBS clusters and promoter sequences for each PWM. Non-promoter sequences were used as a control. Using the cluster score, we identified a PWM group called PWM-PCP, in which TFBS clusters positively correlate with promoters, and another PWM group called PWM-NCP, in which TFBS clusters negatively correlate with promoters. The PWM-PCP group comprises 47% of the 199 vertebrate PWMs, while the PWM-NCP group occupied 11 percent. After reducing the effect of CpG islands (CGI against the clusters using partial correlation coefficients among three properties (promoter, CGI and predicted TFBS cluster, we identified two PWM groups including those strongly correlated with CGI and those not correlated with CGI. Conclusion Not all PWMs predict TFBS correlated with human promoter sequences. Two main PWM groups were identified: (1 those that show TFBS clustered in promoters associated with CGI, and (2 those that show TFBS clustered in promoters independent of CGI. Assessment of PWM matches will allow more positive interpretation of TFBS in

Dynamic nucleosome organization at hox promoters during zebrafish embryogenesis.

Directory of Open Access Journals (Sweden)

Steven E Weicksel

Full Text Available Nucleosome organization at promoter regions plays an important role in regulating gene activity. Genome-wide studies in yeast, flies, worms, mammalian embryonic stem cells and transformed cell lines have found well-positioned nucleosomes flanking a nucleosome depleted region (NDR at transcription start sites. This nucleosome arrangement depends on DNA sequence (cis-elements as well as DNA binding factors and ATP-dependent chromatin modifiers (trans-factors. However, little is understood about how the nascent embryonic genome positions nucleosomes during development. This is particularly intriguing since the embryonic genome must undergo a broad reprogramming event upon fusion of sperm and oocyte. Using four stages of early embryonic zebrafish development, we map nucleosome positions at the promoter region of 37 zebrafish hox genes. We find that nucleosome arrangement at the hox promoters is a progressive process that takes place over several stages. At stages immediately after fertilization, nucleosomes appear to be largely disordered at hox promoter regions. At stages after activation of the embryonic genome, nucleosomes are detectable at hox promoters, with positions becoming more uniform and more highly occupied. Since the genomic sequence is invariant during embryogenesis, this progressive change in nucleosome arrangement suggests that trans-factors play an important role in organizing nucleosomes during embryogenesis. Separating hox genes into expressed and non-expressed groups shows that expressed promoters have better positioned and occupied nucleosomes, as well as distinct NDRs, than non-expressed promoters. Finally, by blocking the retinoic acid-signaling pathway, we disrupt early hox gene transcription, but observe no effect on nucleosome positions, suggesting that active hox transcription is not a driving force behind the arrangement of nucleosomes at the promoters of hox genes during early development.

Setting Adolescents up for Success: Promoting a Policy to Delay High School Start Times

Science.gov (United States)

Barnes, Margaux; Davis, Krista; Mancini, Mackenzie; Ruffin, Jasmine; Simpson, Tina; Casazza, Krista

2016-01-01

Background: A unique biological shift in sleep cycles occurs during adolescence causing later sleep and wake times. This shift is not matched by a concurrent modification in school start times, resulting in sleep curtailment for a large majority of adolescents. Chronic inadequate sleep is associated with poor academic performance including…

Bioinformatics Identification of Modules of Transcription Factor Binding Sites in Alzheimer's Disease-Related Genes by In Silico Promoter Analysis and Microarrays

Directory of Open Access Journals (Sweden)

Regina Augustin

2011-01-01

Full Text Available The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases.

Characterization and functional analyses of the human G protein-coupled receptor kinase 4 gene promoter.

Science.gov (United States)

Hasenkamp, Sandra; Telgmann, Ralph; Staessen, Jan A; Hagedorn, Claudia; Dördelmann, Corinna; Bek, Martin; Brand-Herrmann, Stefan-Martin; Brand, Eva

2008-10-01

The G protein-coupled receptor kinase 4 is involved in renal sodium handling and blood pressure regulation. Missense variants have already been tested functionally and are associated with hypertension, but no data on promoter analyses are yet available. We scanned 94 hypertensive white subjects for genetic variation and performed promoter reporter gene analyses in HEK293T, COS7, and SaOs-2 cells. Transient transfections with various full lengths and wild-type deletion constructs revealed that 1851 bp of the flanking region and 275 bp of the 5'-untranslated region were sufficient for transcriptional activities and composed a powerful cis-active element in the distal 293 bp. The -1702T and +2T alleles resulted in drastic general reductions of promoter function, whereas an activity increasing effect of +268C was cell type specific. Electrophoretic mobility-shift assay, supershift, and cotransfection analyses of transcription factor binding sites predicted in silico (Alibaba2.1/Transfac7) resulted in allele-specific binding patterns of nuclear proteins and identified the participation of CCAAT/enhancer-binding protein transcription factor family members. The G protein-coupled receptor kinase 4 core promoter resides in the first 1851 bp upstream of its transcription start site. The 4 identified genetic variants within this region exert allele-specific impact on both cell type- and stimulation-dependent transcription and may affect the expression balance of renal G protein-coupled receptor kinase 4.

Platelet-rich plasma-containing fragmin-protamine micro-nanoparticles promote epithelialization and angiogenesis in split-thickness skin graft donor sites.

Science.gov (United States)

Takabayashi, Yuki; Ishihara, Masayuki; Sumi, Yuki; Takikawa, Makoto; Nakamura, Shingo; Kiyosawa, Tomoharu

2015-01-01

Platelet-rich plasma (PRP) contains multiple growth factors, and fragmin-protamine micro-nanoparticles (F-P M-NPs) significantly enhance and stabilize growth factors. The purpose of this study was to evaluate the effects of PRP-containing F-P M-NPs (PRP&F-P M-NPs) on wound repair in split-thickness skin graft (STSG-) donor sites (DS). A total of 56 inbred male rats were anesthetized and split-thickness skin graft donor site (STSG-DS) were created with a Padgett dermatome. PRP&F-P M-NPs, F-P M-NPs, PRP, and saline (control) were then intradermally injected evenly into the STSG-DSs. On 3, 4, 5, 7, and 10 d after creation of STSG-DS, skin sample sections were stained with hematoxylin and eosin to evaluate reepithelialization and angiogenesis. Treatment of STSG-DS with PRP&F-P M-NPs effectively promoted epithelialization and new vessel formation compared with those treated with PRP, F-P M-NPs, and control (saline). The intradermal injection of PRP&F-P M-NPs promotes epithelialization and angiogenesis in STSG-DS wounds. Copyright © 2015 Elsevier Inc. All rights reserved.

Pseudomonas fluorescens JH 70-4 promotes pb stabilization and early seedling growth of sudan grass in contaminated mining site soil.

Science.gov (United States)

Shim, Jaehong; Babu, A Giridhar; Velmurugan, Palanivel; Shea, Patrick J; Oh, Byung-Taek

2014-01-01

A bacterial strain (JH 70-4) exhibiting plant growth promoting characteristics (indoleacetic acid production and 1-aminocyclopropane-1-carboxylate deaminase activity), as well as heavy metal(loid) (HM) tolerance and Pb precipitation, was isolated from HM-contaminated soil at an abandoned mine site. The bacterium was identified as Pseudomonas fluorescens based on 16S rDNA sequencing. The JH 70-4 strain induced precipitation of Pb as PbS nanoparticles, confirmed by X-ray diffraction. Solution pH, incubation time, and Pb concentration influenced removal and PbS formation. Inoculating contaminated soil with JH 70-4 decreased Pb availability; exchangeable Pb decreased while organic- and sulphide-bound Pb increased. The toxicity characteristic leaching procedure showed a 65% decrease in Pb in leachate 60 d after inoculating soil with JH 70-4. Shoot and root lengths of Sudan grass grown in the inoculated soil were greater than in the uninoculated soil. Findings suggest that microbial Pb fixation is a viable strategy for remediating soil and promoting plant growth for phytostabilization of contaminated sites.

Baikal-1 stand complex. Preparation and carrying out of the first energy start-up of the IVG-1 reactor

International Nuclear Information System (INIS)

Tikhomirov, L.N.

1995-01-01

The IVG-1 reactor was a first ground prototype of nuclear rocket engine. The reactor was built on the site 10 of the Semipalatinsk test site. Since the first energy start-up in 1975 the reactor was exploited 14 years till its modernization in 1989. The Bajkal-1 stand complex was designed and built for the carrying out of tests for fuel assemblies of different modifications. The energy start-up has been sum of long creative work of different research and constructive staffs on creation of high-temperature gas-cooled IVG-1 reactor. The history of construction, project and assembling of the stand complex is presented. Complex start and put works were carried out in the December 1974. Control physical start-up was carried out in the January 1975. Cold start-up by hydrogen was in the February 1975. Hot start-up was in the March 1975. The result of the hot start-up was experimental confirmation of metodics of thermohydrovlical estimations. 2 figs., 3 tabs

Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

DEFF Research Database (Denmark)

van Wezel, G P; Krab, I M; Douthwaite, S

1994-01-01

Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

Best Practices and Barriers to Obesity Prevention in Head Start: Differences Between Director and Teacher Perceptions.

Science.gov (United States)

Byrd-Williams, Courtney; Dooley, Erin E; Sharma, Shreela V; Chuang, Ru-Jye; Butte, Nancy; Hoelscher, Deanna M

2017-12-21

Practices and barriers to promoting healthy eating and physical activity at Head Start centers may influence children's energy balance behaviors. We examined differences between directors' and teachers' perspectives on best practices and barriers to promoting healthy eating and physical activity in Head Start centers. We conducted a cross-sectional study of directors (n = 23) and teachers (n = 113) at 23 Head Start centers participating in the baseline assessment of the Texas Childhood Obesity Research Demonstration study. Participants completed surveys about practices and barriers to promoting healthy eating and physical activity. Multilevel regression models examined differences between director and teacher responses. More than half of directors and teachers reported meeting most best practices related to nutrition and physical activity; few directors or teachers (foods (especially sweets, salty snacks, and sugary drinks) in front of children" and "Teachers talk to children about trying/enjoying new foods" (P food service staff support, limited time, and insufficient funds (P < .05). More barriers to healthy eating were reported than were barriers to physical activity indicating that more support may be needed for healthy eating. Differences between responses of directors and teachers may have implications for future assessments of implementation of best practices and barriers to implementation related to nutrition and physical activity in early care and education centers.

RESEARCH ARTICLE Codon usage vis-a-vis start and stop codon ...

Indian Academy of Sciences (India)

Prosen

codon usage at start and stop site showed variation in codon selection in ..... pressure is 8.3%, 0.5% and 18.5% while the influence of other factors, for example natural ..... The codon Adaptation Index--a measure of directional synonymous.

Early Head Start and African American Families: Impacts and Mechanisms of Child Outcomes

Science.gov (United States)

Harden, Brenda Jones; Sandstrom, Heather; Chazan-Cohen, Rachel

2012-01-01

Persistent disparities exist between African American children and their European American counterparts across developmental domains. Early childhood intervention may serve to promote more positive outcomes among African American children. The current study examined whether and how the Early Head Start (EHS) program benefited African American…

Transrepression of the estrogen receptor promoter by calcitriol in human breast cancer cells via two negative vitamin D response elements.

Science.gov (United States)

Swami, Srilatha; Krishnan, Aruna V; Peng, Lihong; Lundqvist, Johan; Feldman, David

2013-08-01

Calcitriol (1,25-dihydroxyvitamin D3), the hormonally active metabolite of vitamin D, exerts its anti-proliferative activity in breast cancer (BCa) cells by multiple mechanisms including the downregulation of the expression of estrogen receptor α (ER). We analyzed an ∼3.5 kb ER promoter sequence and demonstrated the presence of two potential negative vitamin D response elements (nVDREs), a newly identified putative nVDRE upstream at -2488 to -2473 bp (distal nVDRE) and a previously published sequence (proximal nVDRE) at -94 to -70 bp proximal to the P1 start site. Transactivation analysis using ER promoter deletion constructs and heterologous promoter-reporter constructs revealed that both nVDREs functioned to mediate calcitriol transrepression. In the electrophoretic mobility shift assay, the vitamin D receptor (VDR) showed strong binding to both nVDREs in the presence of calcitriol, and the chromatin immunoprecipitation assay demonstrated the recruitment of the VDR to the distal nVDRE site. Mutations in the 5' hexameric DNA sequence of the distal nVDRE resulted in the loss of calcitriol-mediated transrepression and the inhibition of protein-DNA complex formation, demonstrating the importance of these nucleotides in VDR DNA binding and transrepression. A putative nuclear factor-Y (NFY) binding site, identified within the distal nVDRE, led to the findings that NFY bound to the distal nVDRE site interfered with the binding of the VDR at the site and reduced calcitriol-mediated transrepression. In conclusion, the ER promoter region contains two negative VDREs that act in concert to bind to the VDR and both nVDREs are required for the maximal inhibition of ER expression by calcitriol. The suppression of ER expression and estrogen-mediated signaling by calcitriol in BCa cells suggests that vitamin D may be useful in the treatment of ER+ BCa.

AKT increases VEGF expression in tumor cells by transactivating the proximal VEGF promoter

International Nuclear Information System (INIS)

Pore, N.; Bernhard, E.J.; Shu, H.-K.; Li, B.; O'Rourke, D.M.; Maity, A.; Haas-Kogan, D.

2003-01-01

Vascular endothelial growth factor (VEGF) is overexpressed in many cancers including glioblastomas and may contribute to their growth. Epidermal growth factor receptor (EGFR) amplification and loss of PTEN, commonly found in glioblastomas leading to increase phosphatidylinositol-3-kinase (PI3K) activity and VEGF expression. In the current study we show that AKT, which is downstream of PI3K, regulates VEGF expression. U87MG human glioblastoma cells lack wildtype PTEN and express high levels of phosphorylated AKT. Over expression of AKT either by stable expression in immortalized human astrocytes or by transduction with adenovirus containing activated myristoylated AKT in SF188 glioblastoma cells increases VEGF expression. Moreover the elevation of angiogenesis by constitutively expressed AKT is further confirmed by in vivo matrigel plug assay in nude mice. The upregulation of VEGF by AKT is mediated through a region in the proximal promoter located between -88 and -70 (+1 is transcription start site). In transient transfection activity of a luciferase reporter containing the -88/+54 region of the VEGF promoter is increased by cotransfection with myristoylated AKT and downregulated by a dominant negative AKT expression vector. Mutation of the putative Sp1 binding sites located in the -88/-70 region we show that AKT acts through Sp1 to transactivate the VEGF promoter. Cotransfection of the VEGF promoter reporter with both Sp1 and myristoylated AKT expression vectors increases promoter activity to a greater extent than either Sp1 or Akt by itself. In vivo phosphate labeling of proteins reveals that AKT leads to increased Sp1 phosphorylation. Gel shift assays using a radio labeled probe corresponding to nucleotides -88 through -66 in the promoter show increased binding with nuclear extracts from cells transduced with adenovirus expressing myristoylated AKT. In conclusion, our results suggest that loss of PTEN leads to increased VEGF expression by increasing AKT

Why START?

International Nuclear Information System (INIS)

Mendelsohn, J.

1991-01-01

Barring some major unexpected downturn in US-Soviet relations, it seems likely that the long-awaited Strategic Arms Reduction Talks (START) treaty will be signed sometime in 1991. Under negotiation for the past nine years, public acceptance and Senate approval of a START treaty will be facilitated by the generally less confrontational East-West relationship which has evolved over that time, by the growing constraints on the US defense budget, and by the obvious merits of the treaty itself. Not only will the nearly complete START treaty be an extremely useful and powerful arms control agreement, it is also decidedly advantageous to US security interests. First and foremost, a START treaty will cap and reduce the steady buildup of nuclear weapons that has characterized the last 30 years of the US-Soviet strategic relationship. As a result of the basic outline originally agreed to at the Reykjavik summit, START will take a 25 to 35 percent bite out of existing nuclear arsenals, impose approximately a 50 percent cut in overall Soviet ballistic missile warheads and throw-weight (lifting power or payload capacity), and produce an exact 50 percent cut in Soviet SS-18 missiles

CO Reduction to CH3OSiMe3: Electrophile-Promoted Hydride Migration at a Single Fe Site.

Science.gov (United States)

Deegan, Meaghan M; Peters, Jonas C

2017-02-22

One of the major challenges associated with developing molecular Fischer-Tropsch catalysts is the design of systems that promote the formation of C-H bonds from H 2 and CO while also facilitating the release of the resulting CO-derived organic products. To this end, we describe the synthesis of reduced iron-hydride/carbonyl complexes that enable an electrophile-promoted hydride migration process, resulting in the reduction of coordinated CO to a siloxymethyl (L n Fe-CH 2 OSiMe 3 ) group. Intramolecular hydride-to-CO migrations are extremely rare, and to our knowledge the system described herein is the first example where such a process can be accessed from a thermally stable M(CO)(H) complex. Further addition of H 2 to L n Fe-CH 2 OSiMe 3 releases CH 3 OSiMe 3 , demonstrating net four-electron reduction of CO to CH 3 OSiMe 3 at a single Fe site.

From Head Start to Sure Start: Reflections on Policy Transfer

Science.gov (United States)

Welshman, John

2010-01-01

This article uses the history of debates over the US Head Start programme (1965), Early Head Start (1994) and the UK Sure Start initiative (1998), as a window on to policy transfer. In all the three, the aim was that early intervention could offer a means of boosting children's educational attainment and of countering the wider effects of poverty…

A multi-scale model of hepcidin promoter regulation reveals factors controlling systemic iron homeostasis.

Directory of Open Access Journals (Sweden)

Guillem Casanovas

2014-01-01

Full Text Available Systemic iron homeostasis involves a negative feedback circuit in which the expression level of the peptide hormone hepcidin depends on and controls the iron blood levels. Hepcidin expression is regulated by the BMP6/SMAD and IL6/STAT signaling cascades. Deregulation of either pathway causes iron-related diseases such as hemochromatosis or anemia of inflammation. We quantitatively analyzed how BMP6 and IL6 control hepcidin expression. Transcription factor (TF phosphorylation and reporter gene expression were measured under co-stimulation conditions, and the promoter was perturbed by mutagenesis. Using mathematical modeling, we systematically analyzed potential mechanisms of cooperative and competitive promoter regulation by the transcription factors, and experimentally validated the model predictions. Our results reveal that hepcidin cross-regulation primarily occurs by combinatorial transcription factor binding to the promoter, whereas signaling crosstalk is insignificant. We find that the presence of two BMP-responsive elements enhances the steepness of the promoter response towards the iron-sensing BMP signaling axis, which promotes iron homeostasis in vivo. IL6 co-stimulation reduces the promoter sensitivity towards the BMP signal, because the SMAD and STAT transcription factors compete for recruiting RNA polymerase to the transcription start site. This may explain why inflammatory signals disturb iron homeostasis in anemia of inflammation. Taken together, our results reveal why the iron homeostasis circuit is sensitive to perturbations implicated in disease.

Promotion of Cultural Heritage in Batangas and Cavite

Directory of Open Access Journals (Sweden)

Dr. Dexter R. Buted

2014-06-01

Full Text Available – The study aimed to identify the commonly visited cultural heritage sites in Batangas and Cavite; to assess the cultural heritage sites in Batangas and Cavite in terms of physical, social and economic aspects; and to determine existing promotional patterns of Batangas and Cavite. Descriptive type of research was utilized in the study. Results showed that the most visited cultural heritage attraction in Taal, Batangas was Basilica of St. Martin de Tours while in Maragondon, Cavite the most visited was Andres Bonifacio Trial House . Blogs, Websites and Facebook are mostly used by the municipality of Taal in promoting their cultural heritage sites. While Cavite sticks to always using leaflets/flyers, brochures as their promotional materials. Cultural heritage sites in both Taal and Maragondon were perceived to have positive results in the assessments based on different aspects such as physical, social and economic aspects. The promotional materials of Taal and Maragondon are often used. A proposed plan of action was made to promote cultural attraction in Maragondon, Cavite and Taal, Batangas.

A Start-Up Produces Infomercials for the Internet

Institute of Scientific and Technical Information of China (English)

2011-01-01

@@ The one thing online shopping is missing, says Sukhinder Singh Cassidy, a former Google executive, is infomercials. Ms.Singh Cassidy introduced her new shopping start-up, Joyus.It is an e-commerce site that produces videos to sell products, like a Web version of the Home Shopping Network. "If you think about the ways to sell online, video is underutilized," she said."It's a new way for brands to merchandise their product."

Reach, engagement, and effectiveness: a systematic review of evaluation methodologies used in health promotion via social networking sites.

Science.gov (United States)

Lim, Megan S C; Wright, Cassandra J C; Carrotte, Elise R; Pedrana, Alisa E

2016-02-01

Issue addressed Social networking sites (SNS) are increasingly popular platforms for health promotion. Advancements in SNS health promotion require quality evidence; however, interventions are often not formally evaluated. This study aims to describe evaluation practices used in SNS health promotion. Methods A systematic review was undertaken of Medline, PsycINFO, Scopus, EMBASE, CINAHL Plus, Communication and Mass Media Complete, and Cochrane Library databases. Articles published between 2006 and 2013 describing any health promotion intervention delivered using SNS were included. Results Forty-seven studies were included. There were two main evaluation approaches: closed designs (n=23), which used traditional research designs and formal recruitment procedures; and open designs (n=19), which evaluated the intervention in a real-world setting, allowing unknown SNS users to interact with the content without enrolling in research. Closed designs were unable to assess reach and engagement beyond their research sample. Open designs often relied on weaker study designs with no use of objective outcome measures and yielded low response rates. Conclusions Barriers to evaluation included low participation rates, high attrition, unknown representativeness and lack of comparison groups. Acceptability was typically assessed among those engaged with the intervention, with limited population data available to accurately assess intervention reach. Few studies were able to assess uptake of the intervention in a real-life setting while simultaneously assessing effectiveness of interventions with research rigour. So what? Through use of quasi-experimental or well designed before-after evaluations, in combination with detailed engagement metrics, it is possible to balance assessment of effectiveness and reach to evaluate SNS health promotion.

DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

Directory of Open Access Journals (Sweden)

Deming Li

2014-06-01

Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.

Downregulation of a tumor suppressor RECK by hypoxia through recruitment of HDAC1 and HIF-1alpha to reverse HRE site in the promoter.

Science.gov (United States)

Lee, Kyung Ju; Lee, Kwang Youl; Lee, You Mie

2010-05-01

Reversion-inducing cysteine-rich protein with Kazal motifs (RECK) is a tumor suppressor and the suppression of RECK is induced by Ras or Her-2/neu oncogenes. However, regulation of RECK under hypoxic microenvironment is largely unknown. Here, we identified that hypoxia significantly downregulates RECK mRNA and protein expression using semiquantitative RT-PCR, real-time RT-PCR and western blot analysis. This repression was reversed by the HDAC inhibitor, trichostatin A (TSA) and HIF-1 inhibitor, YC-1. Hypoxia-induced downregulation of RECK was abolished by knockdown of HDAC1 and HIF-1alpha with respective small interfering RNAs (siRNAs), whereas overexpression of HDAC1 and HIF-1alpha suppressed RECK expression similar to the level under hypoxic conditions. Transfection of a deletion mutant of the second reverse HRE (rHRE2, -2345 to -2333) site of RECK promoter completely removed RECK suppression under hypoxia, indicating that the rHRE2 site is responsible for the inhibition of RECK. Chromatin immunoprecipitation and DNA affinity precipitation assays demonstrated that HDAC1 and HIF-1alpha were recruited to the rHRE2 region of RECK promoter under hypoxic conditions, but the treatment of TSA or YC-1 inhibited their binding to the rHRE2 site. Moreover, TSA and YC-1 inhibited hypoxia-induced cancer cell migration, invasion and MMPs secretion. Taken together, we can conclude that hypoxia induces RECK downregulation through the recruitment of HDAC1 and HIF-1alpha to the rHRE2 site in the promoter and the inhibition of hypoxic RECK silencing would be a therapeutic and preventive target for early tumorigenesis. Copyright 2010 Elsevier B.V. All rights reserved.

Caspase 8 and maspin are downregulated in breast cancer cells due to CpG site promoter methylation

International Nuclear Information System (INIS)

Wu, Yanyuan; Alvarez, Monica; Slamon, Dennis J; Koeffler, Phillip; Vadgama, Jaydutt V

2010-01-01

Epigenetic changes associated with promoter DNA methylation results in silencing of several tumor suppressor genes that lead to increased risk for tumor formation and for progression of the cancer. Methylation specific PCR (MSP) and bisulfite sequencing were used for determination of proapoptotic gene Caspase 8 (CASP8) and the tumor suppressor gene maspin promoter methylation in four breast cancer and two non-tumorigenic breast cell lines. Involvement of histone H3 methylation in those cell lines were examined by CHIP assay. The CpG sites in the promoter region of CASP8 and maspin were methylated in all four breast cancer cell lines but not in two non-tumorigenic breast cell lines. Demethylation agent 5-aza-2'-deoxycytidine (5-aza-dc) selectively inhibits DNA methyltransferases, DNMT3a and DNMT3b, and restored CASP8 and maspin gene expression in breast cancer cells. 5-aza-dc also reduced histone H3k9me2 occupancy on CASP8 promoter in SKBR3cells, but not in MCF-7 cells. Combination of histone deacetylase inhibitor Trichostatin A (TSA) and 5-aza-dc significant decrease in nuclear expression of Di-methyl histone H3-Lys27 and slight increase in acetyl histone H3-Lys9 in MCF-7 cells. CASP8 mRNA and protein level in MCF-7 cells were increased by the 5-aza-dc in combination with TSA. Data from our study also demonstrated that treatment with 5-FU caused a significant increase in unmethylated CASP8 and in CASP8 mRNA in all 3 cancer lines. CASP8 and maspin expression were reduced in breast cancer cells due to promoter methylation. Selective application of demethylating agents could offer novel therapeutic opportunities in breast cancer

Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

DEFF Research Database (Denmark)

Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

1994-01-01

To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

Promoting an "Active Start" for Young Children: Developing Competent and Confident Early Movers

Science.gov (United States)

Goodway, Jacqueline D.; Wall, Sarah; Getchell, Nancy

2009-01-01

With childhood obesity and physical inactivity at an all-time high, parents and physical educators alike must look to the early years to promote competent and confident young movers. Popular opinion believes that children are naturally active and motor skill development progresses as a normal function of getting older. However, if one looks at…

Starting up a Firm or Not: Differences in the Antecedents of Entrepreneurial Intentions

Science.gov (United States)

Varamäki, Elina; Joensuu, Sanna; Viljamaa, Anmari

2016-01-01

Entrepreneurial intentions (EIs) and their antecedents have been extensively studied in student populations. The results suggest that higher education does not promote the formation of EI in students. This article examines the antecedents of intentions in two different student populations: those who are currently starting a firm and those who are…

Start up testing for the secure automated fabrication line

International Nuclear Information System (INIS)

Gerber, E.W.; Benson, E.M.; Dahl, R.E.

1986-01-01

The Secure Automated Fabrication (SAF) Line has been designed and built by Westinghouse Hanford Company for the Department of Energy at the Hanford Site near Richland, Washington. The SAF Line will provide the capability for remote manufacture of fuel for Liquid Metal Reactors, and will supply fuel for the Fast Flux Test Facility (FFTF). The SAF process is highly automated and represents a major advancement in nuclear fuel manufacturing, offering significant improvements in product quality, productivity, safety, and accountability of Special Nuclear Materials. The construction phase of the project is complete, and testing has been initiated to accomplish start up of the plant for manufacture of FFTF fuel. This paper describes the test methodology used for SAF Line start up

A downstream CpG island controls transcript initiation and elongation and the methylation state of the imprinted Airn macro ncRNA promoter.

Directory of Open Access Journals (Sweden)

Martha V Koerner

Full Text Available A CpG island (CGI lies at the 5' end of the Airn macro non-protein-coding (nc RNA that represses the flanking Igf2r promoter in cis on paternally inherited chromosomes. In addition to being modified on maternally inherited chromosomes by a DNA methylation imprint, the Airn CGI shows two unusual organization features: its position immediately downstream of the Airn promoter and transcription start site and a series of tandem direct repeats (TDRs occupying its second half. The physical separation of the Airn promoter from the CGI provides a model to investigate if the CGI plays distinct transcriptional and epigenetic roles. We used homologous recombination to generate embryonic stem cells carrying deletions at the endogenous locus of the entire CGI or just the TDRs. The deleted Airn alleles were analyzed by using an ES cell imprinting model that recapitulates the onset of Igf2r imprinted expression in embryonic development or by using knock-out mice. The results show that the CGI is required for efficient Airn initiation and to maintain the unmethylated state of the Airn promoter, which are both necessary for Igf2r repression on the paternal chromosome. The TDRs occupying the second half of the CGI play a minor role in Airn transcriptional elongation or processivity, but are essential for methylation on the maternal Airn promoter that is necessary for Igf2r to be expressed from this chromosome. Together the data indicate the existence of a class of regulatory CGIs in the mammalian genome that act downstream of the promoter and transcription start.

Identification of a novel temperature sensitive promoter in cho cells

Directory of Open Access Journals (Sweden)

Hesse Friedemann

2011-05-01

Full Text Available Abstract Background The Chinese hamster ovary (CHO expression system is the leading production platform for manufacturing biopharmaceuticals for the treatment of numerous human diseases. Efforts to optimize the production process also include the genetic construct encoding the therapeutic gene. Here we report about the successful identification of an endogenous highly active gene promoter obtained from CHO cells which shows conditionally inducible gene expression at reduced temperature. Results Based on CHO microarray expression data abundantly transcribed genes were selected as potential promoter candidates. The S100a6 (calcyclin and its flanking regions were identified from a genomic CHO-K1 lambda-phage library. Computational analyses showed a predicted TSS, a TATA-box and several TFBSs within the 1.5 kb region upstream the ATG start signal. Various constructs were investigated for promoter activity at 37°C and 33°C in transient luciferase reporter gene assays. Most constructs showed expression levels even higher than the SV40 control and on average a more than two-fold increase at lower temperature. We identified the core promoter sequence (222 bp comprising two SP1 sites and could show a further increase in activity by duplication of this minimal sequence. Conclusions This novel CHO promoter permits conditionally high-level gene expression. Upon a shift to 33°C, a two to three-fold increase of basal productivity (already higher than SV40 promoter is achieved. This property is of particular advantage for a process with reduced expression during initial cell growth followed by the production phase at low temperature with a boost in expression. Additionally, production of toxic proteins becomes feasible, since cell metabolism and gene expression do not directly interfere. The CHO S100a6 promoter can be characterized as cold-shock responsive with the potential for improving process performance of mammalian expression systems.

PROMOTION STRATEGIES IN WINE MARKETING

Directory of Open Access Journals (Sweden)

Ştefan MATEI

2014-06-01

Full Text Available Marketing has proven to be very useful instrument in the wine industry, in fostering comprehensive, cohesive and effective strategies which wineries require to effectively compete in today’s almost saturated wine market. But within wine marketing, the promotion strategy, from our point of view, is the most important component of the winery that can ensure the success in the market or can shorten the life cycle of the product. This being said, the aim of the paper is twofold. Firstly, to determine and analyze the steps that are required to create a promotion strategy in the wine industry, by comparing different approaches. Secondly, to identify the instruments of the promotional mix that helps a winery to implement its promotional strategy. Bearing that in mind, the paper starts with some theoretical aspects regarding the promotion strategy and ends by providing a brief overview of the main findings.

Identification and functional analysis of a second RBF-2 binding site within the HIV-1 promoter

International Nuclear Information System (INIS)

Dahabieh, Matthew S.; Ooms, Marcel; Malcolm, Tom; Simon, Viviana; Sadowski, Ivan

2011-01-01

Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutations in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.

TSSer: an automated method to identify transcription start sites in prokaryotic genomes from differential RNA sequencing data.

Science.gov (United States)

Jorjani, Hadi; Zavolan, Mihaela

2014-04-01

Accurate identification of transcription start sites (TSSs) is an essential step in the analysis of transcription regulatory networks. In higher eukaryotes, the capped analysis of gene expression technology enabled comprehensive annotation of TSSs in genomes such as those of mice and humans. In bacteria, an equivalent approach, termed differential RNA sequencing (dRNA-seq), has recently been proposed, but the application of this approach to a large number of genomes is hindered by the paucity of computational analysis methods. With few exceptions, when the method has been used, annotation of TSSs has been largely done manually. In this work, we present a computational method called 'TSSer' that enables the automatic inference of TSSs from dRNA-seq data. The method rests on a probabilistic framework for identifying both genomic positions that are preferentially enriched in the dRNA-seq data as well as preferentially captured relative to neighboring genomic regions. Evaluating our approach for TSS calling on several publicly available datasets, we find that TSSer achieves high consistency with the curated lists of annotated TSSs, but identifies many additional TSSs. Therefore, TSSer can accelerate genome-wide identification of TSSs in bacterial genomes and can aid in further characterization of bacterial transcription regulatory networks. TSSer is freely available under GPL license at http://www.clipz.unibas.ch/TSSer/index.php

Characteristics of food industry web sites and "advergames" targeting children.

Science.gov (United States)

Culp, Jennifer; Bell, Robert A; Cassady, Diana

2010-01-01

To assess the content of food industry Web sites targeting children by describing strategies used to prolong their visits and foster brand loyalty; and to document health-promoting messages on these Web sites. A content analysis was conducted of Web sites advertised on 2 children's networks, Cartoon Network and Nickelodeon. A total of 290 Web pages and 247 unique games on 19 Internet sites were examined. Games, found on 81% of Web sites, were the most predominant promotion strategy used. All games had at least 1 brand identifier, with logos being most frequently used. On average Web sites contained 1 "healthful" message for every 45 exposures to brand identifiers. Food companies use Web sites to extend their television advertising to promote brand loyalty among children. These sites almost exclusively promoted food items high in sugar and fat. Health professionals need to monitor food industry marketing practices used in "new media." Published by Elsevier Inc.

Effects of cytosine methylation on transcription factor binding sites

KAUST Repository

Medvedeva, Yulia A

2014-03-26

Background: DNA methylation in promoters is closely linked to downstream gene repression. However, whether DNA methylation is a cause or a consequence of gene repression remains an open question. If it is a cause, then DNA methylation may affect the affinity of transcription factors (TFs) for their binding sites (TFBSs). If it is a consequence, then gene repression caused by chromatin modification may be stabilized by DNA methylation. Until now, these two possibilities have been supported only by non-systematic evidence and they have not been tested on a wide range of TFs. An average promoter methylation is usually used in studies, whereas recent results suggested that methylation of individual cytosines can also be important.Results: We found that the methylation profiles of 16.6% of cytosines and the expression profiles of neighboring transcriptional start sites (TSSs) were significantly negatively correlated. We called the CpGs corresponding to such cytosines " traffic lights" We observed a strong selection against CpG " traffic lights" within TFBSs. The negative selection was stronger for transcriptional repressors as compared with transcriptional activators or multifunctional TFs as well as for core TFBS positions as compared with flanking TFBS positions.Conclusions: Our results indicate that direct and selective methylation of certain TFBS that prevents TF binding is restricted to special cases and cannot be considered as a general regulatory mechanism of transcription. 2013 Medvedeva et al.; licensee BioMed Central Ltd.

Knockdown of menin affects pre-mRNA processing and promoter fidelity at the interferon-gamma inducible IRF1 gene

Directory of Open Access Journals (Sweden)

Auriemma Lauren B

2012-01-01

Full Text Available Abstract Background The tumor suppressor menin (MEN1 is mutated in the inherited disease multiple endocrine neoplasia type I, and has several documented cellular roles, including the activation and repression of transcription effected by several transcription factors. As an activator, MEN1 is a component of the Set1-like mixed lineage leukemia (MLL MLL1/MLL2 methyltransferase complex that methylates histone H3 lysine 4 (H3K4. MEN1 is localized to the signal transducer and activator of transcription 1 (STAT1-dependent gene, interferon regulatory factor 1 (IRF1, and is further recruited when IRF1 transcription is triggered by interferon-γ signaling. Results RNAi-mediated knockdown of MEN1 alters the H3K4 dimethylation and H3 acetylation profiles, and the localization of histone deacetylase 3, at IRF1. While MEN1 knockdown does not impact the rate of transcription, IRF1 heteronuclear transcripts become enriched in MEN1-depleted cells. The processed mRNA and translated protein product are concomitantly reduced, and the antiviral state is attenuated. Additionally, the transcription start site at the IRF1 promoter is disrupted in the MEN1-depleted cells. The H3K4 demethylase, lysine specific demethylase 1, is also associated with IRF1, and its inhibition alters H3K4 methylation and disrupts the transcription start site as well. Conclusions Taken together, the data indicate that MEN1 contributes to STAT1-activated gene expression in a novel manner that includes defining the transcription start site and RNA processing.

ERalpha and AP-1 interact in vivo with a specific sequence of the F promoter of the human ERalpha gene in osteoblasts.

Science.gov (United States)

Lambertini, Elisabetta; Tavanti, Elisa; Torreggiani, Elena; Penolazzi, Letizia; Gambari, Roberto; Piva, Roberta

2008-07-01

Estrogen-responsive genes often have an estrogen response element (ERE) positioned next to activator protein-1 (AP-1) binding sites. Considering that the interaction between ERE and AP-1 elements has been described for the modulation of bone-specific genes, we investigated the 17-beta-estradiol responsiveness and the role of these cis-elements present in the F promoter of the human estrogen receptor alpha (ERalpha) gene. The F promoter, containing the sequence analyzed here, is one of the multiple promoters of the human ERalpha gene and is the only active promoter in bone tissue. Through electrophoretic mobility shift (EMSA), chromatin immunoprecipitation (ChIP), and re-ChIP assays, we investigated the binding of ERalpha and four members of the AP-1 family (c-Jun, c-fos, Fra-2, and ATF2) to a region located approximately 800 bp upstream of the transcriptional start site of exon F of the human ERalpha gene in SaOS-2 osteoblast-like cells. Reporter gene assay experiments in combination with DNA binding assays demonstrated that F promoter activity is under the control of upstream cis-acting elements which are recognized by specific combinations of ERalpha, c-Jun, c-fos, and ATF2 homo- and heterodimers. Moreover, ChIP and re-ChIP experiments showed that these nuclear factors bind the F promoter in vivo with a simultaneous occupancy stimulated by 17-beta-estradiol. Taken together, our findings support a model in which ERalpha/AP-1 complexes modulate F promoter activity under conditions of 17-beta-estradiol stimulation. (c) 2008 Wiley-Liss, Inc.

Behavioral and Psychosocial Characteristics Among Head Start Childcare Providers.

Science.gov (United States)

Ling, Jiying

2017-01-01

The aim of the study was twofold: (a) describe behavioral and psychosocial characteristics of Head Start childcare providers including technology use, physical activity, nutrition, depression, and quality of life and (b) examine associations among these characteristics. Using a cross-sectional design, a nonrandom sample of 80 Head Start childcare providers completed an online survey via SurveyMonkey. About 80.1% were overweight or obese. Nearly all had a computer or smartphone. About 55% met the national physical activity recommendation of 150 min/week. Approximately 56.2% did not know the recommended daily servings of fruits and vegetables, and 26.3% had ≥3 servings of vegetables per day. About 38.8% had major depression or dysthymia, and 31.3% had depressive symptoms. The top two perceived health needs were weight loss and stress management. Providing a health promotion and stress management program to childcare providers may benefit both providers and children, considering the strong influence of teachers on children.

Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

Science.gov (United States)

Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

2012-05-01

To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.

Lean start-up

DEFF Research Database (Denmark)

Rasmussen, Erik Stavnsager; Tanev, Stoyan

2016-01-01

The risk of launching new products and starting new firms is known to be extremely high. The Lean Start-up approach is a way of reducing these risks and enhancing the chances for success by validating the products and services in the market with customers before launching it in full scale. The ma...... and the final business model. In other words: The start-up must first nail the problem together with the customers, then develop the solution and test, and then in the end scale it to a full-grown business model.......The risk of launching new products and starting new firms is known to be extremely high. The Lean Start-up approach is a way of reducing these risks and enhancing the chances for success by validating the products and services in the market with customers before launching it in full scale. The main...

Desert Tortoise Head-start Program at Twentynine Palms Marine Base

Science.gov (United States)

2013-04-02

starting method, extinction , predation, mortality, survivorship Kenneth An Nagy, Scott Hillard University of California - Los Angeles Regents of the...the netting problems were corrected. The remaining two predators were ants : native fire ants (Solenopsis xyloni—already known as hatchling...predators from another study site) and common Harvester Ants , Pogonomyrmex californicus. Both have been controlled when and where necessary by cautious use

A single-copy galK promoter cloning vector suitable for cloning strong promoters

DEFF Research Database (Denmark)

Dandanell, Gert; Court, Donald L.; Hammer, Karin

1986-01-01

We report the construction of lambda galK promoter cloning vectors for cloning and characterization of strong promoters. This phage, which contains a unique HindIII cloning site, was applied to the cloning and analysis of transcription initiations of the regulatory region of the deo-operon of...

Key parameters of the swimming start and their relationship to start performance.

Science.gov (United States)

Tor, Elaine; Pease, David L; Ball, Kevin A

2015-01-01

The swimming start is typically broken into three sub-phases; on-block, flight, and underwater phases. While overall start performance is highly important to elite swimming, the contribution of each phase and important technical components within each phase, particularly with the new kick-start technique, has not been established. The aim of this study was to identify technical factors associated with overall start performance, with a particular focus on the underwater phase. A number of parameters were calculated from 52 starts performed by elite freestyle and butterfly swimmers. These parameters were split into above-water and underwater groupings, before factor analysis was used to reduce parameter numbers for multiple regression. For the above-water phases, 81% of variance in start performance was accounted for by take-off horizontal velocity. For the underwater water phase, 96% of variance was accounted for with time underwater in descent, time underwater in ascent and time to 10 m. Therefore, developing greater take-off horizontal velocity and focussing on the underwater phase by finding the ideal trajectory will lead to improved start performance.

Transcriptional start site turnover in the evolution of bacterial paralogous genes - the pelE-pelD virulence genes in Dickeya.

Science.gov (United States)

Duprey, Alexandre; Nasser, William; Léonard, Simon; Brochier-Armanet, Céline; Reverchon, Sylvie

2016-11-01

After a gene duplication event, the resulting paralogous genes frequently acquire distinct expression profiles, roles, and/or functions but the underlying mechanisms are poorly understood. While transcription start site (TSS) turnover, i.e., the repositioning of the TSS during evolution, is widespread in eukaryotes, it is less documented in bacteria. Using pelD and pelE, two closely related paralogous genes encoding key virulence factors in Dickeya, a gamma proteobacterial genus of phytopathogens, we show that pelE has been selected as an initiator of bacterial aggression, while pelD acts at a later stage, thanks to modifications in the transcriptional regulation of these two genes. This expression change is linked to a few mutations that caused a shift in the position of the pelETSS and the rapid divergence in the regulation of these genes after their duplication. Genomic surveys detected additional examples of putative turnovers in other bacteria. This first report of TSS shifting in bacteria suggests that this mechanism could play a major role in paralogous genes fixation in prokaryotes. © 2016 Federation of European Biochemical Societies.

From START to NEW START. The dilemma and future of nuclear disarmament; Von START zu NEW START. Das Dilemma und die Zukunft der Nuklearen Abruestung

Energy Technology Data Exchange (ETDEWEB)

Plettenberg, Lars

2012-07-01

The report describes the existing four agreements on nuclear disarmament: START I (1991). START II (1993), SORT (2002) and NEW START (2010). The chapter on the dependence between nuclear disarmament and strategic stability covers the issues mutual assured destruction (MAD), credibility, overkill capacity; the role of nuclear weapons in the national strategies of the USA and NATO, Russia, Great Britain, France, China and the other nuclear states. Ways out of MAD include disarmament, de-alerting and mutual assured protection (MAP).

Loviisa starts low-level operating waste disposal in 1997

International Nuclear Information System (INIS)

Snellman, J.

1996-01-01

At an early stage Imatran Voima Oy (IVO) decided to construct a waste repository for Loviisa NPP. The suitability of the power plant site for final disposal of low- and intermediate- level operating waste was studied. In the site report in 1982 the plant site was found to be geologically suitable and economically feasible for construction. The necessary preparations started in 1992. The repository will be constructed in three phases. The first phase will cover the transport tunnel, construction of one maintenance waste tunnel and the excavation of another maintenance waste tunnel together with a hall for solidified wastes. This phase will be finished by the end of 1996. During the second phase in the beginning of next century the remaining already excavated rooms will be furnished. Finally in the third phase the repository will be extended for the decommissioning waste somewhere around years 2020-2025. (3 figs., 1 tab.)

The impact of tobacco promotion at the point of sale: a systematic review.

Science.gov (United States)

Paynter, Janine; Edwards, Richard

2009-01-01

Tobacco promotion increases the likelihood that adolescents will start smoking. Much of the tobacco industry's promotional budget is spent on point of sale (PoS) promotion in many jurisdictions. Consequently, tobacco is an eye-catching feature at the PoS in many places. We reviewed the evidence that PoS tobacco promotion influences key smoking-related behaviors and beliefs, increases susceptibility to smoking in youth, undermines smokers' quit attempts, and promotes relapse among ex-smokers. We found 12 peer-reviewed studies, 10 of which were focused on children. Seven of 8 observational studies found statistically significant associations between exposure to tobacco promotion at the PoS and smoking initiation or susceptibility to smoking. Two experimental studies of children found statistically significant associations between exposure to PoS tobacco promotions and beliefs about ease of getting tobacco and smoking prevalence among their peers. An experimental study with adults found that a picture of collected tobacco pack elicited cravings for cigarettes among smokers. A cross-sectional study found that 25% of adult smokers reported impulse purchasing and a third of recent ex-smokers reported urges to start smoking after seeing tobacco displayed. More prospective studies are needed to clarify the temporal relationship between exposure to PoS tobacco and outcome. However, given the addictiveness of tobacco, the severity of the health hazards posed by smoking, the evidence that tobacco promotion encourages children to start smoking, and the consistency of the evidence that PoS promotion influences children's smoking, we believe that ample justification exists for banning PoS advertising and displays of smoked tobacco products.

With online shopping as the starting point and to promote the development of electronic commerce in the western area%以网购为抓手，促进西部地区电子商务发展

Institute of Scientific and Technical Information of China (English)

沈坤华; 陈忠余

2014-01-01

我国电子商务发展极不平衡，网购的自身特点决定了网购成为西部地区电子商务发展的重要抓手，以网购为抓手四步推动电子商务发展。%The development of e-commerce in China is extremely uneven,due to the characteristics of online shopping online shopping has become an important starting point of the western region development of e-commerce,online shopping as the starting point to the four step to promote the development of electronic commerce.

Novel core promoter elements and a cognate transcription factor in the divergent unicellular eukaryote Trichomonas vaginalis.

Science.gov (United States)

Smith, Alias J; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G; Jonsson, Zophonias O; Wohlschlegel, James A; Johnson, Patricia J

2011-04-01

A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5' untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif.

Novel Core Promoter Elements and a Cognate Transcription Factor in the Divergent Unicellular Eukaryote Trichomonas vaginalis▿

Science.gov (United States)

Smith, Alias J.; Chudnovsky, Lorissa; Simoes-Barbosa, Augusto; Delgadillo-Correa, Maria G.; Jonsson, Zophonias O.; Wohlschlegel, James A.; Johnson, Patricia J.

2011-01-01

A highly conserved DNA initiator (Inr) element has been the only core promoter element described in the divergent unicellular eukaryote Trichomonas vaginalis, although genome analyses reveal that only ∼75% of protein-coding genes appear to contain an Inr. In search of another core promoter element(s), a nonredundant database containing 5′ untranslated regions of expressed T. vaginalis genes was searched for overrepresented DNA motifs and known eukaryotic core promoter elements. In addition to identifying the Inr, two elements that lack sequence similarity to the known protein-coding gene core promoter, motif 3 (M3) and motif 5 (M5), were identified. Mutational and functional analyses demonstrate that both are novel core promoter elements. M3 [(A/G/T)(A/G)C(G/C)G(T/C)T(T/A/G)] resembles a Myb recognition element (MRE) and is bound specifically by a unique protein with a Myb-like DNA binding domain. The M5 element (CCTTT) overlaps the transcription start site and replaces the Inr as an alternative, gene-specific initiator element. Transcription specifically initiates at the second cytosine within M5, in contrast to characteristic initiation by RNA polymerase II at an adenosine. In promoters that combine M3 with either M5 or Inr, transcription initiation is regulated by the M3 motif. PMID:21245378

Identification of a starting point of breast skin tears during chicken plucking.

Science.gov (United States)

Pitcovski, J; Ohana, N; Amzaleg, L; Krispel, S; Bercovich, D; Pinchasov, Y

1997-02-01

A site (STP) was identified on the skin of the chicken, during defeathering in the slaughter house, at which about 90% of breast skin tears started. This site is on the ventral side of the pectoral tract area. There was no difference in location of this site with respect to different commercial lines, sexes, flocks, or time of the day. In order to demonstrate the importance of a small skin tear to ultimate damage, defeathered chickens with a minor tear at a particular site and undamaged defeathered chickens were passed through the defeathering machine a second time. Thirty-six percent of the STP chickens were torn further, but only a small percentage (about 4%) of the undamaged chickens were harmed.

Start your own blogging business generate income from advertisers, subscribers, merchandising, and more

CERN Document Server

Rich, Jason R

2014-01-01

Fully revised with new and expanded chapters, Start Your Own Blogging Business delivers the perfect startup guide for online enthusiasts. Providing valuable updates such as the latest forms of blogging including Twitter/micro-blogging, mobile blogging, and video blogging, the experts at Entrepreneur lead aspiring bloggers from planning and publishing their blog to promoting themselves and turning a profit. Also included are an appendix with Ten Proven Ways to Promote your Blog and How to Avoid the Most Common Blogging Mistakes, and a new chapter on creating creating original content to attract new and continuous followers, as well as updated interviews, insight, examples, and tips. Entrepreneurs are presented with new content ideas, fresh ways to promote their blogs, new techniques for generating revenue, and priceless advice from successful bloggers of today.

Promotion and co-ordination in Switzerland within the framework of the EU Motor Challenge Program - Final report; Promotion und Koordination in der Schweiz zum Motor Challenge Programm der EU - Schlussbericht

Energy Technology Data Exchange (ETDEWEB)

Nipkow, J. [Arena, Zuerich (Switzerland); Tanner, R. [Semafor, Basel (Switzerland); Gloor, R. [Gloor Engineering, Sufers (Switzerland)

2008-07-01

The goal of the Motor Challenge Promotion project was to establish information on the European Motor Challenge Programme to users of electric motor driven systems, and to encourage them to start activities on energy efficient drives in their plants and sites. The promotion project served also as National Contact Point of the European Motor Challenge Programme in Switzerland and coordinated information transfer of national activities on drives efficiency. Dissemination of Motor Challenge information and know-how was achieved mainly by these means: Internet (www.motorchallenge.ch), electronic newsletter twice a year, articles in technical publications, presentations at events on energy efficiency and in training courses at technical universities. Communication with the EU-Motor Challenge Programme was provided by e-mail exchange and by attending conferences and workshops, e.g. EEMODS 2005 (Heidelberg), Motor Challenge Workshop 2007 (Paris). Queries and the attendance at information events showed a growing interest in efficiency of electric drives. The Swiss Motor Challenge team was involved in the preparation of the SwissEnergy implementation programme on drives efficiency. The Swiss agency for efficient energy use S.A.F.E. launched the programme named 'Topmotors' in autumn 2007. The Motor Challenge activities will pass over to Topmotors; the web site will be linked to www.topmotors.ch and a Topmotors newsletter will be launched. (author)

Take Control of Getting Started with Dreamweaver

CERN Document Server

Keller, Arnie

2009-01-01

Learn fundamental Web design principles and become comfortable working in Dreamweaver's complex interface! Dreamweaver 8 is a great Web design tool for pros, but newcomers may be overwhelmed by its interface or want to know more about how to work creatively and intelligently in the program. Help is at hand in Take Control of Getting Started with Dreamweaver, which offers a detailed tutorial for making your first site in Dreamweaver. Author Arnie Keller, who teaches Web design at the University of Victoria, shows you how to style type the smart way with CSS, create a sophisticated page layout

Western Pond Turtle Head-starting and Reintroduction; 2004-2005 Annual Report.

Energy Technology Data Exchange (ETDEWEB)

Van Leuven, Susan; Allen, Harriet; Slavin, Kate (Washington Department of Fish and Wildlife, Wildlife Management Program, Olympia, WA)

2005-09-01

This report covers the results of the western pond turtle head-starting and reintroduction project for the period of October 2004-September 2005. Wild hatchling western pond turtles from the Columbia River Gorge were reared at the Woodland Park and Oregon Zoos in 2004 and 2005 as part of the recovery effort for this Washington State endangered species. The objective of the program is to reduce losses to introduced predators like bullfrogs and largemouth bass by raising the hatchlings to a size where they are too large to be eaten by most of these predators. Thirty-five turtles were placed at the Woodland Park Zoo and 53 at the Oregon Zoo. Of these, 77 head-started juvenile turtles were released at three sites in the Columbia Gorge in 2005. Four were held back to attain more growth in captivity. Eleven were released at the Klickitat ponds, 22 at the Klickitat lake, 39 at the Skamania site, and 5 at Pierce National Wildlife Refuge (NWR). This brought the total number of head-start turtles released since 1991 to 257 for the Klickitat ponds, 136 for the Klickitat lake, 206 for the Skamania pond complex, and 255 at Pierce NWR. In 2005, 34 females from the two Columbia Gorge populations were equipped with transmitters and monitored for nesting activity. Twenty-four nests were located and protected; these produced 90 hatchlings. The hatchlings were collected in September and transported to the Oregon and Woodland Park zoos for rearing in the head-start program. During the 2005 field season trapping effort, 486 western pond turtles were captured in the Columbia Gorge, including 430 previously head-started turtles. These recaptures, together with confirmed nesting by head-start females and visual resightings, indicate the program is succeeding in boosting juvenile recruitment to increase the populations. Records were also collected on 216 individual painted turtles captured in 2005 during trapping efforts at Pierce NWR, to gather baseline information on this native

Western Pond Turtle Head-starting and Reintroduction, 2005-2006 Annual Report.

Energy Technology Data Exchange (ETDEWEB)

Van Leuven, Susan; Allen, Harriet; Slavens, Kate (Washington Department of Fish and Wildlife, Wildlife Management Program, Olympia, WA)

2006-11-01

This report covers the results of the western pond turtle head-starting and reintroduction project for the period of October 2005-September 2006. Wild hatchling western pond turtles from the Columbia River Gorge were reared at the Woodland Park and Oregon zoos in 2005 and 2006 as part of the recovery effort for this Washington State endangered species. The objective of the program is to reduce losses to introduced predators like bullfrogs and largemouth bass by raising the hatchlings to a size where they are too large to be eaten by most of these predators. Twenty-six turtles were placed at the Woodland Park Zoo and 62 at the Oregon Zoo in fall 2005. These turtles joined two that were held back from release in summer 2005 due to their small size. All 90 juvenile turtles were released at three sites in the Columbia Gorge in 2006. Twenty-eight juvenile turtles were released at the Klickitat ponds, 22 at the Klickitat lake, 21 at the Skamania site, and 19 at Pierce National Wildlife Refuge (NWR). This brought the total number of head-start turtles released since 1991 to 944; 285 for the Klickitat ponds, 158 for the Klickitat lake, 227 for the Skamania pond complex, and 274 at Pierce NWR. In 2006, 20 females from the Klickitat population were equipped with transmitters and monitored for nesting activity. Fifteen nests were located and protected; these produced 55 hatchlings. The hatchlings were collected in September and transported to the Oregon and Woodland Park zoos for rearing in the head-start program. One wild hatchling captured in spring 2006 was placed in the head-start program to attain more growth in captivity. During the 2006 field season trapping effort, 414 western pond turtles were captured in the Columbia Gorge, including 374 previously head-started turtles. These recaptures, together with confirmed nesting by head-start females and visual resightings, indicate the program is succeeding in boosting juvenile recruitment to increase the populations

Viral DNA Replication Orientation and hnRNPs Regulate Transcription of the Human Papillomavirus 18 Late Promoter.

Science.gov (United States)

Wang, Xiaohong; Liu, Haibin; Ge, Hui; Ajiro, Masahiko; Sharma, Nishi R; Meyers, Craig; Morozov, Pavel; Tuschl, Thomas; Klar, Amar; Court, Donald; Zheng, Zhi-Ming

2017-05-30

-stranded oligonucleotides targeting the replication fork on either leading or lagging strands, we showed that viral lagging-strand replication activates the promoter. We also identified a transcriptional repressor element located upstream of the promoter transcription start site which interacts with cellular proteins hnRNP D0B and hnRNP A/B and modulates the late promoter activity. This is the first report on how DNA replication activates a viral late promoter. Copyright © 2017 Wang et al.

Delaying Middle School and High School Start Times Promotes Student Health and Performance: An American Academy of Sleep Medicine Position Statement.

Science.gov (United States)

Watson, Nathaniel F; Martin, Jennifer L; Wise, Merrill S; Carden, Kelly A; Kirsch, Douglas B; Kristo, David A; Malhotra, Raman K; Olson, Eric J; Ramar, Kannan; Rosen, Ilene M; Rowley, James A; Weaver, Terri E; Chervin, Ronald D

2017-04-15

During adolescence, internal circadian rhythms and biological sleep drive change to result in later sleep and wake times. As a result of these changes, early middle school and high school start times curtail sleep, hamper a student's preparedness to learn, negatively impact physical and mental health, and impair driving safety. Furthermore, a growing body of evidence shows that delaying school start times positively impacts student achievement, health, and safety. Public awareness of the hazards of early school start times and the benefits of later start times are largely unappreciated. As a result, the American Academy of Sleep Medicine is calling on communities, school boards, and educational institutions to implement start times of 8:30 AM or later for middle schools and high schools to ensure that every student arrives at school healthy, awake, alert, and ready to learn. © 2017 American Academy of Sleep Medicine

Law-based arguments and messages to advocate for later school start time policies in the United States.

Science.gov (United States)

Lee, Clark J; Nolan, Dennis M; Lockley, Steven W; Pattison, Brent

2017-12-01

The increasing scientific evidence that early school start times are harmful to the health and safety of teenagers has generated much recent debate about changing school start times policies for adolescent students. Although efforts to promote and implement such changes have proliferated in the United States in recent years, they have rarely been supported by law-based arguments and messages that leverage the existing legal infrastructure regulating public education and child welfare in the United States. Furthermore, the legal bases to support or resist such changes have not been explored in detail to date. This article provides an overview of how law-based arguments and messages can be constructed and applied to advocate for later school start time policies in US public secondary schools. The legal infrastructure impacting school start time policies in the United States is briefly reviewed, including descriptions of how government regulates education, what legal obligations school officials have concerning their students' welfare, and what laws and public policies currently exist that address adolescent sleep health and safety. On the basis of this legal infrastructure, some hypothetical examples of law-based arguments and messages that could be applied to various types of advocacy activities (eg, litigation, legislative and administrative advocacy, media and public outreach) to promote later school start times are discussed. Particular consideration is given to hypothetical arguments and messages aimed at emphasizing the consistency of later school start time policies with existing child welfare law and practices, legal responsibilities of school officials and governmental authorities, and societal values and norms. Copyright © 2017 National Sleep Foundation. Published by Elsevier Inc. All rights reserved.

Start of the international tokamak physics activity

International Nuclear Information System (INIS)

Campbell, D.

2001-01-01

This newsletter comprises a summary on the start of the International Tokamak Physics activity (ITPA) by Dr. D. Campbell, Chair of the ITPA Co-ordinating Committee. As the ITER EDA drew to a close, it became clear that it was desirable to establish a new mechanism in order to promote the continued development of the physics basis for burning plasma experiments and to preserve the invaluable collaborations between the major international fusion communities which had been established through the ITER physics expert groups. As a result of the discussions of the representatives of the European Union, Japan, the Russian Federation and the United States the agreed principles for conducting the International Tokamak Physics Activity (ITPA) were elaborated and ITPA topical physics groups were organized

KNOWLEDGE AND VALORIZATION OF HISTORICAL SITES THROUGH 3D DOCUMENTATION AND MODELING

Directory of Open Access Journals (Sweden)

E. Farella

2016-06-01

Full Text Available The paper presents the first results of an interdisciplinary project related to the 3D documentation, dissemination, valorization and digital access of archeological sites. Beside the mere 3D documentation aim, the project has two goals: (i to easily explore and share via web references and results of the interdisciplinary work, including the interpretative process and the final reconstruction of the remains; (ii to promote and valorize archaeological areas using reality-based 3D data and Virtual Reality devices. This method has been verified on the ruins of the archeological site of Pausilypon, a maritime villa of Roman period (Naples, Italy. Using Unity3D, the virtual tour of the heritage site was integrated and enriched with the surveyed 3D data, text documents, CAAD reconstruction hypotheses, drawings, photos, etc. In this way, starting from the actual appearance of the ruins (panoramic images, passing through the 3D digital surveying models and several other historical information, the user is able to access virtual contents and reconstructed scenarios, all in a single virtual, interactive and immersive environment. These contents and scenarios allow to derive documentation and geometrical information, understand the site, perform analyses, see interpretative processes, communicate historical information and valorize the heritage location.

Possibility to Use Mobile Learning to Promote World Heritage Site Preservation Awareness in Luang Prabang, Lao Pdr: a Readiness Study

Science.gov (United States)

Poong, Y. S.; Yamaguchi, S.; Takada, J.

2013-07-01

This paper elucidates the current state of mobile technology readiness among young adults in higher education institution based on surveys and interviews. Although Lao PDR is ranked as low category in the ICT Index by International Telecommunication Union (ITU), findings show that there exists high level of readiness among the young adults. Recommendations for future research are developed to guide the development of mobile learning application with the aim to promote World Heritage Site preservation awareness.

Exercise starts and ends in the brain.

Science.gov (United States)

Kayser, Bengt

2003-10-01

Classically the limit to endurance of exercise is explained in terms of metabolic capacity. Cardio-respiratory capacity and muscle fatigue are thought to set the limit and the majority of studies on factors limiting endurance exercise discuss issues such as maximal oxygen uptake (VO2max), aerobic enzyme capacity, cardiac output, glycogen stores, etc. However, this paradigm does not explain the limitation to endurance exercise with large muscle groups at altitude, when at exhaustion exercise is ended without limb locomotor muscle fatigue and with sub-maximal cardiac output. A simple fact provides a basis for an explanation. Voluntary exercise starts and ends in the brain. It starts with spatial and temporal recruitment of motor units and ends with their de-recruitment. A conscious decision precedes a voluntary effort. The end of effort is again volitional and a forced conscious decision to stop precedes it, but it is unknown what forces the off-switch of recruitment at exhaustion although sensation of exertion certainly plays a role. An alternative model explaining the limitation of exercise endurance thus proposes that the central nervous system integrates input from various sources all related to the exercise and limits the intensity and duration of recruitment of limb skeletal muscle to prevent jeopardizing the integrity of the organism. This model acknowledges the cardio-respiratory and muscle metabolic capacities as prime actors on the performance scene, while crediting the central nervous system for its pivotal role as the ultimate site where exercise starts and ends.

Supporting Head Start Parents: Impact of a Text Message Intervention on Parent-Child Activity Engagement

Science.gov (United States)

Hurwitz, Lisa B.; Lauricella, Alexis R.; Hanson, Ann; Raden, Anthony; Wartella, Ellen

2015-01-01

Head Start emphasises parent engagement as a critical strategy in promoting children's long-term learning. Parents can support children's positive development by engaging them in stimulating activities. The following study assessed whether a service that delivered parenting tips via text message could prompt parents of children enrolled in Head…

Office of Disease Prevention and Health Promotion

Science.gov (United States)

... Health Literacy Health Care Quality Healthy People healthfinder Office of Disease Prevention and Health Promotion Spotlight: This ... 16/2017 This site is coordinated by the Office of Disease Prevention and Health Promotion, Office of ...

Later Start, Longer Sleep: Implications of Middle School Start Times

Science.gov (United States)

Temkin, Deborah A.; Princiotta, Daniel; Ryberg, Renee; Lewin, Daniel S.

2018-01-01

Background: Although adolescents generally get less than the recommended 9 hours of sleep per night, research and effort to delay school start times have generally focused on high schools. This study assesses the relation between school start times and sleep in middle school students while accounting for potentially confounding demographic…

Construction of recombinant adenovirus with Egr-1 promoter and Smad7 cDNA and study of the Egr-1 promoter's biological activity

International Nuclear Information System (INIS)

Cai Xuwei; Fu Xiaolong; Yang Jian; Song Houyan

2005-01-01

Objective: To construct a recombinant replication-defective adenovirus containing Egr-1 promoter and Smad7 cDNA, then to evaluate the biological activity of Egr-1 promoter. Methods: Based on Adeno- X TM expression system, CMV promoter of the pShuttle vector was replaced by Egr-1 promoter, and the Smad7 cDNA was subcloned into the MCS(multiple cloning site) of pShuttle. The recombinant pShuttle was then sub-cloned into the Adeno-X TM genome, which was transformed into E. coli to get recombinant Adeno-X TM plasmid DNA. The recombinant adenovirus was packaged and amplified in the transfected HEK293 cells before it was purified and tested for viral titer. The fibroblasts (3T6 cells) infected by the recombinant adenovirus were irradiated , and the activity of Egr-1 promoter was quantitively determined by the amount of Smad7 protein expressed in the 3T6 cells using Western blot. Results: Identified by restriction endonuclease analysis and PCR, the recombinant adenovirus containing Egr-1 promoter and Smad7 cDNA was constructed successfully, with a viral titer of 1.0 x 10 11 TCID 50 /ml. The expressed amount of Smad7 protein varied at different dose levels and different time points post-irradiation in the 3T6 cells infected with the recombinant adenovirus. The amount of Smad7 protein increased along with the rising of the irradiation dose, and remained at a high expression level from 8 Gy to 15 Gy. The amount of Smad7 protein started to increase at 2 hours post-irradiation, and maintained a relatively high level for the next 5 hours before it descended, which was not observed in the control 3T6 cells. Conclusions: With the aid of Adeno-X TM expression system and molecular cloning techniques, construction of recombinant adenovirus could be quick and efficient. The recombined Egr-1 promoter has the activity of regulating the expression of downstream Smad7 cDNA. The increase in Smad7 expression under control of Egr-1 promoter induced by ionizing radiation is time- and dose

Hanford Site Waste management units report

International Nuclear Information System (INIS)

1992-01-01

This report summarizes the operable units in several areas of the Hanford Site Waste Facility. Each operable unit has several waste units (crib, ditch, pond, etc.). The operable units are summarized by describing each was unit. Some of the descriptions are unit name, unit type, waste category start data, site description, etc. The descriptions will vary for each waste unit in each operable unit and area of the Hanford Site

Work site stress management: national survey results.

Science.gov (United States)

Fielding, J E

1989-12-01

The National Survey of Work Site Health Promotion Activities established baseline data on the frequency of nine types of health promotion activity at private work sites with more than 50 employees in the United States. Stress management activities were provided at 26.6% of work sites. Types of activities at those work sites with some stress management activity included group counseling (58.5%), individual counseling (39.3%), follow-up counseling (25.9%), special events (11.5%), providing information about stress (80.7%), providing a place to relax (64.8%), and making organizational changes to reduce employee stress (81.2%). Frequency of activities varied by industry type and by region of the country. Incidence of most types of activities did not increase as work site size increased, although the likelihood of having any of these activities did increase with work site size. Stress management activities were more likely to be present at work sites with a medical staff or health educator. An increase in output, productivity, or quality was the most frequently cited benefit (46.5%). Negative effects were reported at 2.6% of the work sites. Other health promotion activities found at the work sites surveyed included smoking cessation (61.8%), treatment and control of high blood pressure (36.7%), and weight control (34.7%). Employee Assistance Programs were responsible for stress management at 62% of the work sites with an Employee Assistance Program.

Article Commentary: Researching Prescription Drug Misuse among First Nations in Canada: Starting from a Health Promotion Framework

Directory of Open Access Journals (Sweden)

Colleen Anne Dell

2012-01-01

Full Text Available The intentional misuse of psychotropic drugs is recognized as a significant public health concern in Canada, although there is a lack of empirical research detailing this. Even less research has been documented on the misuse of prescription drugs among First Nations in Canada. In the past, Western biomedical and individual-based approaches to researching Indigenous health have been applied, whereas First Nations’ understandings of health are founded on a holistic view of wellbeing. Recognition of this disjuncture, alongside the protective influence of First Nations traditional culture, is foundational to establishing an empirical understanding of and comprehensive response to prescription drug misuse. We propose health promotion as a framework from which to begin to explore this. Our work with a health promotion framework has conveyed its potential to support the consideration of Western and Indigenous worldviews together in an ‘ethical space’, with illustrations provided. Health promotion also allots for the consideration of Canada's colonial history of knowledge production in public health and supports First Nations’ self-determination. Based on this, we recommend three immediate ways in which a health promotion framework can advance research on prescription drug misuse among First Nations in Canada.

Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

Directory of Open Access Journals (Sweden)

Altenbuchner Josef

2011-10-01

Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

Comparative Analysis of Chloroplast psbD Promoters in Terrestrial Plants

Directory of Open Access Journals (Sweden)

Shuichi Shimmura

2017-07-01

Full Text Available The transcription of photosynthesis genes encoded by the plastid genome is mainly mediated by a prokaryotic-type RNA polymerase called plastid-encoded plastid RNA polymerase (PEP. Standard PEP-dependent promoters resemble bacterial sigma-70-type promoters containing the so-called -10 and -35 elements. On the other hand, an unusual light- and stress-responsive promoter (psbD LRP that is regulated by a 19-bp AAG-box immediately upstream of the -35 element has been mapped upstream of the psbD-psbC operon in some angiosperms. However, the occurrence of the AAG-box containing psbD LRP in plant evolution remains elusive. We have mapped the psbD promoters in eleven embryophytes at different evolutionary stages from liverworts to angiosperms. The psbD promoters were mostly mapped around 500–900 bp upstream of the psbD translational start sites, indicating that the psbD mRNAs have unusually long 5′-UTR extensions in common. The -10 elements of the psbD promoter are well-conserved in all embryophytes, but not the -35 elements. We found that the AAG-box sequences are highly conserved in angiosperms and gymnosperms except for gnetaceae plants. Furthermore, partial AAG-box-like sequences have been identified in the psbD promoters of some basal embryophytes such as moss, hornwort, and lycophyte, whereas liverwort has the standard PEP promoter without the AAG-box. These results suggest that the AAG-box sequences of the psbD LRP may have evolved from a primitive type of AAG-box of basal embryophytes. On the other hand, monilophytes (ferns use another type of psbD promoter composed of a distinct cis-element upstream of the potential -35 element. Furthermore, we found that psbD expression is not regulated by light in gymnosperms or basal angiosperms, although they have the well-conserved AAG-box sequences. Thus, it is unlikely that acquisition of the AAG-box containing psbD promoter is directly associated with light-induced transcription of the psb

DNA hypomethylation of a transcription factor binding site within the promoter of a gout risk gene NRBP1 upregulates its expression by inhibition of TFAP2A binding.

Science.gov (United States)

Zhu, Zaihua; Meng, Weida; Liu, Peiru; Zhu, Xiaoxia; Liu, Yun; Zou, Hejian

2017-01-01

Genome-wide association studies (GWASs) have identified dozens of loci associated with gout, but for most cases, the risk genes and the underlying molecular mechanisms contributing to these associations are unknown. This study sought to understand the molecular mechanism of a common genetic variant, rs780093, in the development of gout, both in vitro and in vivo. Nuclear receptor binding protein 1 ( NRBP1 ), as a gout risk gene, and its regulatory region, 72 bp upstream of the transcription start site, designated as B1, were identified through integrative analyses of genome-wide genotype and DNA methylation data. We observed elevated NRBP1 expression in human peripheral blood mononuclear cells (PBMCs) from gout patients. In vitro luciferase reporter and protein pulldown assay results showed that DNA methylation could increase the binding of the transcription factor TFAP2A to B1, leading to suppressed gene expression. There results were further confirmed by in vivo bisulfite pyrosequencing showing that hypomethylation on B1 is associated with increased NRBP1 expression in gout patients. Hypomethylation at the promoter region of NRBP1 reduces the binding of TFAP2A and thus leads to elevated NRBP1 expression, which might contribute to the development of gout.

76 FR 37174 - Capital Investment Program-New Starts and Small Starts Program Funds

Science.gov (United States)

2011-06-24

... DEPARTMENT OF TRANSPORTATION Federal Transit Administration Capital Investment Program--New Starts... apportionment of the FY 2011 Capital Investment (New Starts and Small Starts) program funds. The funds will be... FY 2011, $1,596,800,000 was appropriated for the Capital Investments Grant Account, which includes...

Giving offspring a healthy start: parents' experiences of health promotion and lifestyle change during pregnancy and early parenthood

Directory of Open Access Journals (Sweden)

Edvardsson Kristina

2011-12-01

Full Text Available Abstract Background There are good opportunities in Sweden for health promotion targeting expectant parents and parents of young children, as almost all are reached by antenatal and child health care. In 2005, a multisectoral child health promotion programme (the Salut Programme was launched to further strengthen such efforts. Methods Between June and December 2010 twenty-four in-depth interviews were conducted separately with first-time mothers and fathers when their child had reached 18 months of age. The aim was to explore their experiences of health promotion and lifestyle change during pregnancy and early parenthood. Qualitative manifest and latent content analysis was applied. Results Parents reported undertaking lifestyle changes to secure the health of the fetus during pregnancy, and in early parenthood to create a health-promoting environment for the child. Both women and men portrayed themselves as highly receptive to health messages regarding the effect of their lifestyle on fetal health, and they frequently mentioned risks related to tobacco and alcohol, as well as toxins and infectious agents in specific foods. However, health promotion strategies in pregnancy and early parenthood did not seem to influence parents to make lifestyle change primarily to promote their own health; a healthy lifestyle was simply perceived as 'common knowledge'. Although trust in health care was generally high, both women and men described some resistance to what they saw as preaching, or very directive counselling about healthy living and the lack of a holistic approach from health care providers. They also reported insufficient engagement with fathers in antenatal care and child health care. Conclusion Perceptions about risks to the offspring's health appear to be the primary driving force for lifestyle change during pregnancy and early parenthood. However, as parents' motivation to prioritise their own health per se seems to be low during this period

Information technology in health promotion.

Science.gov (United States)

Lintonen, T P; Konu, A I; Seedhouse, D

2008-06-01

eHealth, the use of information technology to improve or enable health and health care, has recently been high on the health care development agenda. Given the vivid interest in eHealth, little reference has been made to the use of these technologies in the promotion of health. The aim of this present study was to conduct a review on recent uses of information technology in health promotion through looking at research articles published in peer-reviewed journals. Fifteen relevant journals with issues published between 2003 and June 2005 yielded altogether 1352 articles, 56 of which contained content related to the use of information technology in the context of health promotion. As reflected by this rather small proportion, research on the role of information technology is only starting to emerge. Four broad thematic application areas within health promotion were identified: use of information technology as an intervention medium, use of information technology as a research focus, use of information technology as a research instrument and use of information technology for professional development. In line with this rather instrumental focus, the concepts 'ePromotion of Health' or 'Health ePromotion' would come close to describing the role of information technology in health promotion.

Earlier School Start Times as a Risk Factor for Poor School Performance: An Examination of Public Elementary Schools in the Commonwealth of Kentucky

Science.gov (United States)

Keller, Peggy S.; Smith, Olivia A.; Gilbert, Lauren R.; Bi, Shuang; Haak, Eric A.; Buckhalt, Joseph A.

2015-01-01

Adequate sleep is essential for child learning. However, school systems may inadvertently be promoting sleep deprivation through early school start times. The current study examines the potential implications of early school start times for standardized test scores in public elementary schools in Kentucky. Associations between early school start…

Public policy for start-up entrepreneurship with venture capital and bank finance

DEFF Research Database (Denmark)

Keuschnigg, Christian; Nielsen, Søren Bo

2003-01-01

This paper proposes and analyses a model of start-up investment. Innovative entrepreneursare commercially inexperienced and can benefit from venture capital support. Only part ofthem succeed in matching with a venture capitalist while the rest must resort to standard bankfinance. We consider a nu...... a number of policies to promote entrepreneurship and venture capitalbacked innovation.JEL Classification: D82, G24, G28, H24.Keywords: venture capital bank finance, matching, moral hazard, public policy....

Expression of the nifA gene of Herbaspirillum seropedicae: role of the NtrC and NifA binding sites and of the -24/-12 promoter element.

Science.gov (United States)

Souza, E M; Pedrosa, F O; Rigo, L U; Machado, H B; Yates, M G

2000-06-01

The nifA promoter of Herbaspirillum seropedicae contains potential NtrC, NifA and IHF binding sites together with a -12/-24 sigma(N)-dependent promoter. This region has now been investigated by deletion mutagenesis for the effect of NtrC and NifA on the expression of a nifA::lacZ fusion. A 5' end to the RNA was identified at position 641, 12 bp downstream from the -12/-24 promoter. Footprinting experiments showed that the G residues at positions -26 and -9 are hypermethylated, and that the region from -10 to +10 is partially melted under nitrogen-fixing conditions, confirming that this is the active nifA promoter. In H. seropedicae nifA expression from the sigma(N)-dependent promoter is repressed by fixed nitrogen but not by oxygen and is probably activated by the NtrC protein. NifA protein is apparently not essential for nifA expression but it can still bind the NifA upstream activating sequence.

The heptanucleotide motif GAGACGC is a key component of a cis-acting promoter element that is critical for SnSAG1 expression in Sarcocystis neurona.

Science.gov (United States)

Gaji, Rajshekhar Y; Howe, Daniel K

2009-07-01

The apicomplexan parasite Sarcocystis neurona undergoes a complex process of intracellular development, during which many genes are temporally regulated. The described study was undertaken to begin identifying the basic promoter elements that control gene expression in S. neurona. Sequence analysis of the 5'-flanking region of five S. neurona genes revealed a conserved heptanucleotide motif GAGACGC that is similar to the WGAGACG motif described upstream of multiple genes in Toxoplasma gondii. The promoter region for the major surface antigen gene SnSAG1, which contains three heptanucleotide motifs within 135 bases of the transcription start site, was dissected by functional analysis using a dual luciferase reporter assay. These analyses revealed that a minimal promoter fragment containing all three motifs was sufficient to drive reporter molecule expression, with the presence and orientation of the 5'-most heptanucleotide motif being absolutely critical for promoter function. Further studies should help to identify additional sequence elements important for promoter function and for controlling gene expression during intracellular development by this apicomplexan pathogen.

Honokiol promotes non-rapid eye movement sleep via the benzodiazepine site of the GABA(A) receptor in mice.

Science.gov (United States)

Qu, Wei-Min; Yue, Xiao-Fang; Sun, Yu; Fan, Kun; Chen, Chang-Rui; Hou, Yi-Ping; Urade, Yoshihiro; Huang, Zhi-Li

2012-10-01

Decoctions of the Chinese herb houpu contain honokiol and are used to treat a variety of mental disorders, including depression. Depression commonly presents alongside sleep disorders and sleep disturbances, which appear to be a major risk factor for depression. Here, we have evaluated the somnogenic effect of honokiol and the mechanisms involved. Honokiol was administered i.p. at 20:00 h in mice. Flumazenil, an antagonist at the benzodiazepine site of the GABA(A) receptor, was administered i.p. 15 min before honokiol. The effects of honokiol were measured by EEG and electromyogram (EMG), c-Fos expression and in vitro electrophysiology. Honokiol (10 and 20 mg·kg⁻¹) significantly shortened the sleep latency to non-rapid eye movement (non-REM, NREM) sleep and increased the amount of NREM sleep. Honokiol increased the number of state transitions from wakefulness to NREM sleep and, subsequently, from NREM sleep to wakefulness. However, honokiol had no effect on either the amount of REM sleep or EEG power density of both NREM and REM sleep. Honokiol increased c-Fos expression in ventrolateral preoptic area (VLPO) neurons, as examined by immunostaining, and excited sleep-promoting neurons in the VLPO by whole-cell patch clamping in the brain slice. Pretreatment with flumazenil abolished the somnogenic effects and activation of the VLPO neurons by honokiol. Honokiol promoted NREM sleep by modulating the benzodiazepine site of the GABA(A) receptor, suggesting potential applications in the treatment of insomnia, especially for patients who experience difficulty in falling and staying asleep. © 2012 The Authors. British Journal of Pharmacology © 2012 The British Pharmacological Society.

siRNAs targeted to certain polyadenylation sites promote specific, RISC-independent degradation of messenger RNAs.

Science.gov (United States)

Vickers, Timothy A; Crooke, Stanley T

2012-07-01

While most siRNAs induce sequence-specific target mRNA cleavage and degradation in a process mediated by Ago2/RNA-induced silencing complex (RISC), certain siRNAs have also been demonstrated to direct target RNA reduction through deadenylation and subsequent degradation of target transcripts in a process which involves Ago1/RISC and P-bodies. In the current study, we present data suggesting that a third class of siRNA exist, which are capable of promoting target RNA reduction that is independent of both Ago and RISC. These siRNAs bind the target messenger RNA at the polyA signal and are capable of redirecting a small amount of polyadenylation to downstream polyA sites when present, however, the majority of the activity appears to be due to inhibition of polyadenylation or deadenylation of the transcript, followed by exosomal degradation of the immature mRNA.

Work site health promotion research: to what extent can we generalize the results and what is needed to translate research to practice?

Science.gov (United States)

Bull, Sheana Salyers; Gillette, Cynthia; Glasgow, Russell E; Estabrooks, Paul

2003-10-01

Information on external validity of work site health promotion research is essential to translate research findings to practice. The authors provide a literature review of work site health behavior interventions. Using the RE-AIM framework, they summarize characteristics and results of these studies to document reporting of intervention reach, adoption, implementation, and maintenance. The authors reviewed a total of 24 publications from 11 leading health behavior journals. They found that participation rates among eligible employees were reported in 87.5% of studies; only 25% of studies reported on intervention adoption. Data on characteristics of participants versus nonparticipants were reported in fewer than 10% of studies. Implementation data were reported in 12.5% of the studies. Only 8% of studies reported any type of maintenance data. Stronger emphasis is needed on representativeness of employees, work site settings studied, and longer term results. Examples of how this can be done are provided.

Hon-yaku: a biology-driven Bayesian methodology for identifying translation initiation sites in prokaryotes

Directory of Open Access Journals (Sweden)

de Hoon Michiel JL

2007-02-01

Full Text Available Abstract Background Computational prediction methods are currently used to identify genes in prokaryote genomes. However, identification of the correct translation initiation sites remains a difficult task. Accurate translation initiation sites (TISs are important not only for the annotation of unknown proteins but also for the prediction of operons, promoters, and small non-coding RNA genes, as this typically makes use of the intergenic distance. A further problem is that most existing methods are optimized for Escherichia coli data sets; applying these methods to newly sequenced bacterial genomes may not result in an equivalent level of accuracy. Results Based on a biological representation of the translation process, we applied Bayesian statistics to create a score function for predicting translation initiation sites. In contrast to existing programs, our combination of methods uses supervised learning to optimally use the set of known translation initiation sites. We combined the Ribosome Binding Site (RBS sequence, the distance between the translation initiation site and the RBS sequence, the base composition of the start codon, the nucleotide composition (A-rich sequences following start codons, and the expected distribution of the protein length in a Bayesian scoring function. To further increase the prediction accuracy, we also took into account the operon orientation. The outcome of the procedure achieved a prediction accuracy of 93.2% in 858 E. coli genes from the EcoGene data set and 92.7% accuracy in a data set of 1243 Bacillus subtilis 'non-y' genes. We confirmed the performance in the GC-rich Gamma-Proteobacteria Herminiimonas arsenicoxydans, Pseudomonas aeruginosa, and Burkholderia pseudomallei K96243. Conclusion Hon-yaku, being based on a careful choice of elements important in translation, improved the prediction accuracy in B. subtilis data sets and other bacteria except for E. coli. We believe that most remaining

Breast-feeding trends and the breast-feeding promotion programme in the Philippines.

Science.gov (United States)

Williamson, N E

1990-03-01

Breastfeeding (BF) duration and incidence have declined in the Philippines since 1973, particularly among urban, better-educated and higher income groups. As more and more women move into these modern groups, BF may continue to decline, making attempts to decrease fertility more difficult. The National Movement for the Promotion of Breastfeeding (NMPB) seeks to overcome the declines by encouraging a wide range of BF promotion activities including improving hospital practices and implementing a 5-year plan. In 1988, the 2nd 5 years of the United Nations International Children's Emergency Fund support for BF promotion started as part of a program to strengthen health services for child survival. Also in 1988, the Ministry of Health directed private hospitals to have rooming-in. In 1984, BF promotion messages began in the mass media. In 1983, NMPB was set up. The NMPB is housed in the Department of Public Health and has 30 member agencies: 14 governmental organizations and 25 nongovernmental agencies/institutions. From 1982-84 a longitudinal study on decision making regrading infant feeding practices was started. A hospital-based BF promotion program was started in the city of Baguio in the 70s. "Rooming-in" is required in government facilities, but there is a need for education programs for women so that they will continue their healthy practices at home. Challenges of the Philippines BF promotion program corner 4 areas: 1) health facilities; 2) information, education, and communication; 3) training; and 4) outreach. Research activities for the future include: 1) continued monitoring of patterns and trends of BF, including evaluation of the 1988 national survey; 2) analysis of the impact of "rooming-in" programs; 3) studies on the cost effectiveness of different strategies for increasing BF incidence and length and modifying BF practices and beliefs; 4) testing of strategies for helping working women to breastfeed; 5) research on obstacles to BF in private hospitals

STARTing Again: What Happens After START I Expires?

International Nuclear Information System (INIS)

Mladineo, Stephen V.; Durbin, Karyn R.; Eastman, Christina M.

2007-01-01

The Strategic Arms Reduction Treaty (START I), a seminal arms control agreement that substantially reduced the levels of deployed strategic nuclear arms in the United States and Russia, will expire in December 2009. At this time, it is unclear what - if anything - will replace it. While the treaty remains relevant, more than a simple extension is appropriate. Instead the authors advocate for a successor regime that builds on the START I legacy but does not rely on the traditional tools of arms control. This paper examines the strategic context in which a successor regime would be developed and proposes several recommendations for future action

Novel strong tissue specific promoter for gene expression in human germ cells

Directory of Open Access Journals (Sweden)

Kuzmin Denis

2010-08-01

Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.

The Influence of an Early Childhood Program on Parental Involvement: Perceptions of Former Head Start Parents

Science.gov (United States)

Croft, Stacey

2017-01-01

A key component of effective early childhood programs is collaborative relationships between schools, families, and the community (Fiese, Eckert, & Spagnola, 2005). One of these early childhood programs, Head Start, stands out among the others in its efforts to work with children, families, and communities to promote parental involvement. Some…

The biology of eukaryotic promoter prediction - a review

DEFF Research Database (Denmark)

Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves

1999-01-01

between functional promoters has been estimated to be in the range of 30-40 kilobases. Although it is conceivable that some of these predicted promoters correspond to cryptic initiation sites that are used in vivo, it is likely that most are false positives. This suggests that it is important to carefully......Computational prediction of eukaryotic promoters from the nucleotide sequence is one of the most attractive problems in sequence analysis today, but it is also a very difficult one. Thus, current methods predict in the order of one promoter per kilobase in human DNA, while the average distance...... reconsider the biological data that forms the basis of current algorithms, and we here present a review of data that may be useful in this regard. The review covers the following topics: (1) basal transcription and core promoters, (2) activated transcription and transcription factor binding sites, (3) Cp...

Physical constraints determine the logic of bacterial promoter architectures

Science.gov (United States)

Ezer, Daphne; Zabet, Nicolae Radu; Adryan, Boris

2014-01-01

Site-specific transcription factors (TFs) bind to their target sites on the DNA, where they regulate the rate at which genes are transcribed. Bacterial TFs undergo facilitated diffusion (a combination of 3D diffusion around and 1D random walk on the DNA) when searching for their target sites. Using computer simulations of this search process, we show that the organization of the binding sites, in conjunction with TF copy number and binding site affinity, plays an important role in determining not only the steady state of promoter occupancy, but also the order at which TFs bind. These effects can be captured by facilitated diffusion-based models, but not by standard thermodynamics. We show that the spacing of binding sites encodes complex logic, which can be derived from combinations of three basic building blocks: switches, barriers and clusters, whose response alone and in higher orders of organization we characterize in detail. Effective promoter organizations are commonly found in the E. coli genome and are highly conserved between strains. This will allow studies of gene regulation at a previously unprecedented level of detail, where our framework can create testable hypothesis of promoter logic. PMID:24476912

From START to NEW START. The dilemma and future of nuclear disarmament

International Nuclear Information System (INIS)

Plettenberg, Lars

2012-01-01

The report describes the existing four agreements on nuclear disarmament: START I (1991). START II (1993), SORT (2002) and NEW START (2010). The chapter on the dependence between nuclear disarmament and strategic stability covers the issues mutual assured destruction (MAD), credibility, overkill capacity; the role of nuclear weapons in the national strategies of the USA and NATO, Russia, Great Britain, France, China and the other nuclear states. Ways out of MAD include disarmament, de-alerting and mutual assured protection (MAP).

Use of the Performance Diagnostic Checklist to Select an Intervention Designed to Increase the Offering of Promotional Stamps at Two Sites of a Restaurant Franchise

Science.gov (United States)

Rodriguez, Manuel; Wilder, David A.; Therrien, Kelly; Wine, Byron; Miranti, Reylissa; Daratany, Kenneth; Salume, Gloria; Baranovsky, Greg; Rodriquez, Matias

2006-01-01

The performance diagnostic checklist (PDC) was administered to examine the variables influencing the offering of promotional stamps by employees at two sites of a restaurant franchise. PDC results suggested that a lack of appropriate antecedents, equipment and processes, and consequences were responsible for the deficits. Based on these results,…

The impact of dry-land sprint start training on the short track speed skating start.

Science.gov (United States)

Haug, William B; Drinkwater, Eric J; Cicero, Nicholas J; Barthell, J Anthony; Chapman, Dale W

2017-05-05

This investigation sought to determine the effects of dry-land sprint start training on short track speed skating (STSS) start performance. Nine highly trained short track athletes completed a control period of normal STSS training followed by a four-week training intervention. Before and after the control and intervention periods, athletes performed three electronically timed dry-land and on-ice 14.43 m maximal sprint start efforts. The intervention consisted of two sprint sessions per week consisting of nine electronically timed 14.43 m dry-land sprint starts in addition to normal STSS training. The control period resulted in no substantial change in on-ice start performance (Mean Δ: -0.01 s, 95% Confidence Limits (CL): -0.08 to 0.05 s; Effect Size (ES): -0.05; Trivial) however, a small change was observed in dry-land start performance (Mean Δ: -0.07 s, 95% CL: -0.13 to -0.02 s; ES: -0.49). Following brief specific dry-land sprint start training a small improvement was observed in both on-ice (Mean Δ: -0.07 s, 95% CL: -0.13 to -0.01 s; ES: -0.33) and dry-land (Mean Δ: -0.04 s, 95% CL: -0.09 to 0.00 s; ES: -0.29) start performance. This investigation suggests STSS start performance can be improved through a brief dry-land sprint start training program.

Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.

Science.gov (United States)

Kageyama, R; Merlino, G T; Pastan, I

1989-09-15

Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.

Tolerance of transgenic canola plants (Brassica napus) amended with plant growth-promoting bacteria to flooding stress at a metal-contaminated field site

International Nuclear Information System (INIS)

Farwell, Andrea J.; Vesely, Susanne; Nero, Vincent; Rodriguez, Hilda; McCormack, Kimberley; Shah, Saleh; Dixon, D. George; Glick, Bernard R.

2007-01-01

The growth of transgenic canola (Brassica napus) expressing a gene for the enzyme 1-aminocyclopropane-1-carboxylate (ACC) deaminase was compared to non-transformed canola exposed to flooding and elevated soil Ni concentration, in situ. In addition, the ability of the plant growth-promoting bacterium Pseudomonas putida UW4, which also expresses ACC deaminase, to facilitate the growth of non-transformed and transgenic canola under the above mentioned conditions was examined. Transgenic canola and/or canola treated with P. putida UW4 had greater shoot biomass compared to non-transformed canola under low flood-stress conditions. Under high flood-stress conditions, shoot biomass was reduced and Ni accumulation was increased in all instances relative to low flood-stress conditions. This is the first field study to document the increase in plant tolerance utilizing transgenic plants and plant growth-promoting bacteria exposed to multiple stressors. - Using transgenic plants and plant growth-promoting bacteria as phytoremediation methods increased plant tolerance at a metal-contaminated field site under low flood conditions

Starting an Online Business All-in-One For Dummies

CERN Document Server

Belew, Shannon

2011-01-01

Conquer the online marketplace with this new version of a bestseller! Whether you've thought of starting an online business or you're already selling online, this update to a bestseller presents invaluable advice for getting--and keeping--online customers. Covering everything from creating a business plan and building a customer-friendly site to marketing with Facebook and Twitter, this fun and friendly guide features eleven minibooks that cover online business basics, legal and accounting matters, website design, online and operating issues, Internet security, techniques for boosting sales, s

CREB, NF-Y and MEIS1 conserved binding sites are essential to balance Myostatin promoter/enhancer activity during early myogenesis.

Science.gov (United States)

Grade, Carla Vermeulen Carvalho; Mantovani, Carolina Stefano; Fontoura, Marina Alves; Yusuf, Faisal; Brand-Saberi, Beate; Alvares, Lúcia Elvira

2017-10-01

Myostatin (MSTN) is a strong inhibitor of skeletal muscle growth in human and other vertebrates. Its transcription is controlled by a proximal promoter/enhancer (Mstn P/E) containing a TATA box besides CREB, NF-Y, MEIS1 and FXR transcription factor binding sites (TFBSs), which are conserved throughout evolution. The aim of this work was to investigate the role of these TFBSs on Mstn P/E activity and evaluate the potential of their putative ligands as Mstn trans regulators. Mstn P/E mutant constructs were used to establish the role of conserved TFBSs using dual-luciferase assays. Expression analyses were performed by RT-PCR and in situ hybridization in C2C12 myoblasts and E10.5 mouse embryos, respectively. Our results revealed that CREB, NF-Y and MEIS1 sites are required to balance Mstn P/E activity, keeping Mstn transcription within basal levels during myoblast proliferation. Furthermore, our data showed that NF-Y site is essential, although not sufficient, to mediate Mstn P/E transcriptional activity. In turn, CREB and MEIS1 binding sites seem to depend on the presence of NF-Y site to induce Mstn P/E. FXR appears not to confer any effect on Mstn P/E activity, except in the absence of all other conserved TFBS. Accordingly, expression studies pointed to CREB, NF-Y and MEIS1 but not to FXR factors as possible regulators of Mstn transcription in the myogenic context. Altogether, our findings indicated that CREB, NF-Y and MEIS1 conserved sites are essential to control basal Mstn transcription during early myogenesis, possibly by interacting with these or other related factors.

Starting Point: Linking Methods and Materials for Introductory Geoscience Courses

Science.gov (United States)

Manduca, C. A.; MacDonald, R. H.; Merritts, D.; Savina, M.

2004-12-01

Introductory courses are one of the most challenging teaching environments for geoscience faculty. Courses are often large, students have a wide variety of background and skills, and student motivation can include completing a geoscience major, preparing for a career as teacher, fulfilling a distribution requirement, and general interest. The Starting Point site (http://serc.carleton.edu/introgeo/index.html) provides help for faculty teaching introductory courses by linking together examples of different teaching methods that have been used in entry-level courses with information about how to use the methods and relevant references from the geoscience and education literature. Examples span the content of geoscience courses including the atmosphere, biosphere, climate, Earth surface, energy/material cycles, human dimensions/resources, hydrosphere/cryosphere, ocean, solar system, solid earth and geologic time/earth history. Methods include interactive lecture (e.g think-pair-share, concepTests, and in-class activities and problems), investigative cases, peer review, role playing, Socratic questioning, games, and field labs. A special section of the site devoted to using an Earth System approach provides resources with content information about the various aspects of the Earth system linked to examples of teaching this content. Examples of courses incorporating Earth systems content, and strategies for designing an Earth system course are also included. A similar section on Teaching with an Earth History approach explores geologic history as a vehicle for teaching geoscience concepts and as a framework for course design. The Starting Point site has been authored and reviewed by faculty around the country. Evaluation indicates that faculty find the examples particularly helpful both for direct implementation in their classes and for sparking ideas. The help provided for using different teaching methods makes the examples particularly useful. Examples are chosen from

Identification of evolutionarily invariant sequences in the protein C gene promoter

NARCIS (Netherlands)

Spek, C. A.; Bertina, R. M.; Reitsma, P. H.

1998-01-01

Recent studies on human protein C gene expression have revealed the presence of three transcription factor binding sites in close proximity to the transcription start site. Binding sites for the liver-enriched hepatocyte nuclear factors 1 and 3 (HNF-1 and HNF-3, respectively) are located immediately

WSDM : A user-centred design method for web sites

NARCIS (Netherlands)

de Troyer, O.M.F.; Leune, C.J.

1998-01-01

WSDM is a user-centered method for the design of kiosk Web Sites. By explicitly starting from the requirements of the users or visitors, WSDM solves Web site problems that are primarily caused by that fact that a site has no underlying design at all, or that the design is mostly data-driven.

School Starting Age and Crime

DEFF Research Database (Denmark)

Landersø, Rasmus; Nielsen, Helena Skyt; Simonsen, Marianne

This paper investigates the effects of school starting age on crime while relying on variation in school starting age induced by administrative rules; we exploit that Danish children typically start first grade in the calendar year they turn seven, which gives rise to a discontinuity in children......’s school starting age. Analyses are carried out using register-based Danish data. We find that higher age at school start lowers the propensity to commit crime, but that this reduction is caused by incapacitation while human capital accumulation is unaffected. Importantly, we also find that the individuals...

A Healthy Start: Promoting Mental Health and Well-Being in the Early Primary School Years

Science.gov (United States)

Cefai, Carmel; Camilleri, Liberato

2015-01-01

Mental health problems in children represent a significant international health concern, with up to one in five children using mental health services during the course of any given year. Identifying the processes of what prevents social, emotional and behaviour difficulties (SEBD) and promotes healthy development from an early age can make a…

An assessment of oral health promotion programmes in the United Kingdom.

Science.gov (United States)

Passalacqua, A; Reeves, A O; Newton, T; Hughes, R; Dunne, S; Donaldson, N; Wilson, N

2012-02-01

Improving oral health and reducing tooth decay is a key area for action, both in the United Kingdom (UK) and overseas. The World Health Organization (WHO) has highlighted the unique advantage schools have in promoting oral health. We summarise current oral health promotion strategies in the United Kingdom and estimate the spread of their use as well as their impact on oral health and influence on the oral health-related knowledge and behaviour in a patient population. A structured overview of published papers, government publications, official government websites and policy reports. A cross-sectional study of patients referred for a tooth extraction in one dental surgery in south-east London. Statistical methods consisted of logistic and ordinal regressions to model the likelihood of exposure to oral health promotion and of obtaining higher levels of knowledge of oral health issues, respectively. Linear regression was used to model the level of oral health and knowledge of oral health issues. We found three main promotion programmes, namely, National Healthy Schools (NHS), Sure Start and Brushing for life plus a small number of local initiatives. Sure Start targets disadvantaged areas, but is limited. In our observational study, 34% of the patients reported exposure to a settings-based oral health education programme: Sure Start (5%), NHS (7%) and other (22%). This exposure was not influenced by age or gender, but an association with education was detected. Although oral health promotion was not found to influence the actual knowledge of oral health issues, it was found to influence some oral health-related attitudes and perceptions. Participation in an oral health promotion programme was found to be significantly associated with the patients' education, their belief that they can prevent oral disease and the subjective perception of their own oral health. The WHO principles need to be embedded across all schools to achieve a true national oral health promotion

Promotional Chat on the Internet

OpenAIRE

Dina Mayzlin

2006-01-01

Chat rooms, recommendation sites, and customer review sections allow consumers to overcome geographic boundaries and to communicate based on mutual interests. However, marketers also have incentives to supply promotional chat or reviews in order to influence the consumers' evaluation of their products. Moreover, firms can disguise their promotion as consumer recommendations due to the anonymity afforded by online communities. We explore this new setting where advertising and word of mouth bec...

Effectiveness of an oral health program in improving the knowledge and competencies of head start staff.

Science.gov (United States)

Chinn, Courtney Hugh

2011-01-01

Head Start and Early Head Start (HS/EHS) programs have partnered with the American Academy of Pediatric Dentistry to promote oral health and increase access to dental homes. Preparing HS/EHS staff for issues related to pediatric oral health promises to improve effectiveness of this collaboration. This paper's purpose was to describe the Columbia Head Start Oral Health Program (C-HSOHP) and changes in HS/EHS staff pediatric oral health knowledge and competencies after participating in C-HSOHP. Four HS/EHS grantees in New York City engaged in the 2008-09 C-HSOHP. A convenience sample of 61 staff completed pre- and postself assessments of knowledge and competencies. Significant paired mean improvements were found for staff-reported level of preparation to explain dental issues during pregnancy, the tooth decay process, and preparing parents for their child's first dental visit. Significant improvements were found in staff confidence in teaching parents about children's oral health issues, referring for pediatric dental services, and talking to a dentist about a concern. The Columbia Head Start Oral Health Program was effective in improving Head Start/Early Head Start staff self-confidence and self-perceived preparedness in teaching parents about oral health, applying oral health knowledge to HS/EHS programs, communicating with dental professionals, and improving access to pediatric dental services.

Molecular characterization of the sweet potato peroxidase SWPA4 promoter which responds to abiotic stresses and pathogen infection.

Science.gov (United States)

Ryu, Sun-Hwa; Kim, Yun-Hee; Kim, Cha Young; Park, Soo-Young; Kwon, Suk-Yoon; Lee, Haeng-Soon; Kwak, Sang-Soo

2009-04-01

Previously, the swpa4 peroxidase gene has been shown to be inducible by a variety of abiotic stresses and pathogenic infections in sweet potato (Ipomoea batatas). To elucidate its regulatory mechanism at the transcriptional level under various stress conditions, we isolated and characterized the promoter region (2374 bp) of swpa4 (referred to as SWPA4). We performed a transient expression assay in tobacco protoplasts with deletions from the 5'-end of SWPA4 promoter fused to the beta-glucuronidase (GUS) reporter gene. The -1408 and -374 bp deletions relative to the transcription start site (+1) showed 8 and 4.5 times higher GUS expression than the cauliflower mosaic virus 35S promoter, respectively. In addition, transgenic tobacco plants expressing GUS under the control of -2374, -1408 or -374 bp region of SWPA4 promoter were generated and studied in various tissues under abiotic stresses and pathogen infection. Gel mobility shift assays revealed that nuclear proteins from sweet potato cultured cells specifically interacted with 60-bp fragment (-178/-118) in -374 bp promoter region. In silico analysis indicated that four kinds of cis-acting regulatory sequences, reactive oxygen species-related element activator protein 1 (AP1), CCAAT/enhancer-binding protein alpha element, ethylene-responsive element (ERE) and heat-shock element, are present in the -60 bp region (-178/-118), suggesting that the -60 bp region might be associated with stress inducibility of the SWPA4 promoter.

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter

Directory of Open Access Journals (Sweden)

Wanying Li

2018-03-01

Full Text Available ZmbZIP25 (Zea mays bZIP (basic leucine zipper transcription factor 25 is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction. In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367 and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1. Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence.

Temelin 3,4 Siting

International Nuclear Information System (INIS)

Kubanova, Iva; Fuzer, Jiri

2011-01-01

In the future the Czech Republic will need new energetic resources in spite of current decrease of electricity consumption due to economical crisis. Nuclear power generation is considered as important part of energetic mix of the Czech Republic and this opinion is newly reflected in new government official statement issued in August 2010. CEZ, a. s. prepares new nuclear power plants projects accordingly governmental expectations. Currently 3 projects are in preparation. Temelin 3, 4 project is in the most advanced status, tender is in progress. Potential construction of Dukovany unit 5 and new Jaslovske Bohunice units are analyzed in feasibility studies. Temelin 3, 4 project activities were started 4 years ago. Preparatory analyses, market investigation, feasibility study including many particular studies were elaborated in years 2006-2008. Later on decision to work on bid invitation specification was done and followed. EIA process was started in July 2008 by Intention Announcement and continues. Public tender for EPC contract was announced in August 2009 and it is in progress accordingly schedule. Siting process is in the initial stage. EIA process started in July 2008 through Intention Announcement in spite of anti - nuclear political climate in the Czech Republic. EIA process is interstate process, Austria and Germany participate. Investigation Process Protocol was issued by Ministry of Environment in February 2009 with 34 main conditions and 165 additional comments, requirements, statements. CEZ, a. s. adopted the positive approach with philosophy to deal with all conditions and requirements properly. Elaboration of EIA documentation took 18 months. In May 2010 CEZ, a. s. handed over the EIA documentation to the Ministry of Environment and consequently all legal steps followed including hand-over of EIA documentation to Austria and Germany. In next weeks and months all comments will be gathered by Ministry of Environment and relevant decisions and legal steps

Maternal BMI at the start of pregnancy and offspring epigenome-wide DNA methylation

DEFF Research Database (Denmark)

Sharp, Gemma C; Salas, Lucas A; Monnereau, Claire

2017-01-01

-analysed the association between pre-pregnancy maternal BMI and methylation at over 450,000 sites in newborn blood DNA, across 19 cohorts (9,340 mother-newborn pairs). We attempted to infer causality by comparing the effects of maternal versus paternal BMI and incorporating genetic variation. In four additional cohorts (1......,817 mother-child pairs), we meta-analysed the association between maternal BMI at the start of pregnancy and blood methylation in adolescents. In newborns, maternal BMI was associated with small (.... Adjustment for estimated cell proportions greatly attenuated the number of significant CpGs to 104, including 86 sites common to the unadjusted model. At 72/86 sites, the direction of the association was the same in newborns and adolescents, suggesting persistence of signals. However, we found evidence...

Spermatogenesis-related ring finger gene ZNF230 promoter: identification and functional analysis

DEFF Research Database (Denmark)

Xu, Wenming; Zhang, Sizhong; Qiu, Weimin

2009-01-01

reporter Plasmids. Overexpression and site-directed mutation test were used to characterize the cis-element. The results showed ZNF230 gene promoter to be GC rich and not contain a TATA box. Deletion analysis of the 5'-flanking region of ZNF230 in HEK293 cells indicated that the sequence encompassing from...... nt -131 to +152 has a basal transcriptional activity. Site-directed mutation test and mithramycin A treatment demonstrated that the ZNF230 promoter contained a functional Sp1 site. Overexpression of the Sox5 protein activated the promoter activity. A 312-bp fragment surrounding the transcription...

The prognostic value of the suPARnosticTM ELISA assay in HIV-1 infected individuals is not affected by uPAR promoter polymorphisms

DEFF Research Database (Denmark)

Schneider, Uffe; Nielsen, Rikke; Pedersen, Court

2007-01-01

. METHODS: DNA samples were collected retrospectively from 145 Danes infected with HIV-1 with known seroconversion times. In addition, plasma was collected retrospectively from 81 of these participants for use in the suPAR analysis. Survival was analysed using Kaplan Meier analysis. RESULTS: Survival...... to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART...

The Italian START-Register on Anticoagulation with Focus on Atrial Fibrillation

Science.gov (United States)

2015-01-01

START-Register – Survey on anTicoagulated pAtients RegisTer – is an independent, inception-cohort, observational, collaborative database aimed at recording prospectively the clinical history of adult patients starting anticoagulant treatment for any reason and using whatever drug. In this article we present the START-Register and give cross section baseline data focusing on non valvular atrial fibrillation (NVAF). Participants are asked to insert prospectively consecutive patients recorded as electronic file on the web-site of the registry. Required data are: demographic and clinical characteristics of patients, associated risk factors for stroke and bleeding, laboratory routine data, clinical indication for treatment, expected therapeutic range (in cases of treatment with vitamin K antagonists -VKAs). The follow-up is carried out to record: quality of treatment (for patients on VKAs), bleeding complications, thrombotic events, and the onset of any type of associated disease. To date 5252 patients have been enrolled; 97.6% were on VKAs because direct oral anticoagulants (DOAC) have been available in Italy only recently. The median age was 74 years [interquartile range (IQR) 64-80]; males 53.7%. This analysis is focused on the 3209 (61.1%) NVAF patients. Mean CHADS2 score was 2.1±1.1, CHADSVASc score was 3.1±1.3;median age was 76 years (IQR 70-81); 168 patients (5.3%) had severe renal failure [Creatinine clearance (CrCl) START-Register data shows that two-third of patients who started chronic anticoagulant treatment had NVAF, one-third of them was > 80 years with high prevalence of renal failure. PMID:26001109

A promoter-level mammalian expression atlas

NARCIS (Netherlands)

Forrest, A.R.R.; Kawaji, H.; Rehli, M.; Baillie, J.K.; de Hoon, M.J.L.; Haberle, V.; Lassmann, T.; Kulakovskiy, I.V.; Lizio, M.; Itoh, M.; Andersson, R.; Mungall, C.J.; Meehan, T.F.; Schmeier, S.; Bertin, N.; Jorgensen, M.; Dimont, E.; Arner, E.; Schmidl, C.; Schaefer, U.; Medvedeva, Y.A.; Plessy, C.; Vitezic, M.; Severin, J.; Semple, C.A.; Ishizu, Y.; Young, R.S.; Francescatto, M.; Alam, I.; Albanese, D.; Altschuler, G.M.; Arakawa, T.; Archer, J.A.C.; Arner, P.; Babina, M.; Rennie, S.; Balwierz, P.J.; Beckhouse, A.G.; Pradhan-Bhatt, S.; Blake, J.A.; Blumenthal, A.; Bodega, B.; Bonetti, A.; Briggs, J.; Brombacher, F.; Burroughs, A.M.; Califano, A.; Cannistraci, C.V.; Carbajo, D.; Chen, Y.; Chierici, M.; Ciani, Y.; Clevers, H.C.; Dalla, E.; Davis, C.A.; Detmar, M.; Diehl, A.D.; Dohi, T.; Drablos, F.; Edge, A.S.B.; Edinger, M.; Ekwall, K.; Endoh, M.; Enomoto, H.; Fagiolini, M.; Fairbairn, L.; Fang, H.; Farach-Carson, M.C.; Faulkner, G.J.; Favorov, A.V.; Fisher, M.E.; Frith, M.C.; Fujita, R.; Fukuda, S.; Furlanello, C.; Furuno, M.; Furusawa, J.; Geijtenbeek, T.B.; Gibson, A.P.; Gingeras, T.; Goldowitz, D.; Gough, J.; Guhl, S.; Guler, R.; Gustincich, S.; Ha, T.J.; Hamaguchi, M.; Hara, M.; Harbers, M.; Harshbarger, J.; Hasegawa, A.; Hasegawa, Y.; Hashimoto, T.; Herlyn, M.; Hitchens, K.J.; Sui, S.J.H.; Hofmann, O.M.; Hoof, I.; Hori, F.; Rizzu, P.; Heutink, P.; Carninci, P.; Hayashizaki, Y.

2014-01-01

Regulated transcription controls the diversity, developmental pathways and spatial organization of the hundreds of cell types that make up a mammal. Using single-molecule cDNA sequencing, we mapped transcription start sites (TSSs) and their usage in human and mouse primary cells, cell lines and

Functional analysis of the OCA-B promoter.

Science.gov (United States)

Stevens, S; Wang, L; Roeder, R G

2000-06-15

OCA-B was identified as a B cell-specific coactivator that functions with either Oct-1 or Oct-2 to mediate efficient cell type-specific transcription via the octamer site (ATGCAAAT) both in vivo and in vitro. Mice lacking OCA-B exhibit normal Ag-independent B cell maturation. In contrast, Ag-dependent functions, including production of secondary Ig isotypes and germinal center formation, are greatly affected. To better understand OCA-B expression and, ultimately, the defects observed in the OCA-B knockout mice, we have cloned the OCA-B promoter and examined its function in both transformed and primary B cells. We show here that the OCA-B promoter is developmentally regulated, with activity increasing throughout B cell differentiation. Through physical and functional assays, we have found an activating transcription factor/cAMP response element binding protein binding site (or cAMP response element) that is crucial for OCA-B promoter activity. Furthermore, we demonstrate that IL-4 and anti-CD40 induce both the OCA-B promoter and octamer-dependent promoters, thus implicating OCA-B in B cell signaling events in the nucleus.

Starting an aphasia center?

Science.gov (United States)

Elman, Roberta J

2011-08-01

Starting an aphasia center can be an enormous challenge. This article provides initial issues to review and consider when deciding whether starting a new organization is right for you. Determining the need for the program in your community, the best size and possible affiliation for the organization, and available resources, as well as developing a business plan, marketing the program, and building awareness in the community, are some of the factors that are discussed. Specific examples related to starting the Aphasia Center of California are provided. © Thieme Medical Publishers.

The anti-tumor drug bleomycin preferentially cleaves at the transcription start sites of actively transcribed genes in human cells.

Science.gov (United States)

Murray, Vincent; Chen, Jon K; Galea, Anne M

2014-04-01

The genome-wide pattern of DNA cleavage at transcription start sites (TSSs) for the anti-tumor drug bleomycin was examined in human HeLa cells using next-generation DNA sequencing. It was found that actively transcribed genes were preferentially cleaved compared with non-transcribed genes. The 143,600 identified human TSSs were split into non-transcribed genes (82,596) and transcribed genes (61,004) for HeLa cells. These transcribed genes were further split into quintiles of 12,201 genes comprising the top 20, 20-40, 40-60, 60-80, and 80-100 % of expressed genes. The bleomycin cleavage pattern at highly transcribed gene TSSs was greatly enhanced compared with purified DNA and non-transcribed gene TSSs. The top 20 and 20-40 % quintiles had a very similar enhanced cleavage pattern, the 40-60 % quintile was intermediate, while the 60-80 and 80-100 % quintiles were close to the non-transcribed and purified DNA profiles. The pattern of bleomycin enhanced cleavage had peaks that were approximately 200 bp apart, and this indicated that bleomycin was identifying the presence of phased nucleosomes at TSSs. Hence bleomycin can be utilized to detect chromatin structures that are present at actively transcribed genes. In this study, for the first time, the pattern of DNA damage by a clinically utilized cancer chemotherapeutic agent was performed on a human genome-wide scale at the nucleotide level.

Speed checks on the CERN site

CERN Multimedia

2007-01-01

In view of the significant number of speeding incidents that have been reported, CERN will shortly start to carry out speed checks on the site. The radar used for this purpose will show drivers the speed measured. The disciplinary measures taken against those exceeding the authorised limit (generally 50 k.p.h.) will include a ban from driving on the site for a minimum of one month. Maximilian Metzger
Secretary-General

Operative Start Time Does Not Affect Post-Operative Infection Risk.

Science.gov (United States)

Guidry, Christopher A; Davies, Stephen W; Willis, Rhett N; Dietch, Zachary C; Shah, Puja M; Sawyer, Robert G

2016-10-01

Surgical care is delivered 24 h a day at most institutions. Alarmingly, some authors have found that certain operative start times are associated with greater morbidity and mortality rates. This effect has been noted in both the public and private sector. Although some of these differences may be related to process, they may also be caused by the human circadian rhythm and corresponding changes in host defenses. We hypothesized that the time of day of an operation would impact the frequency of certain post-operative outcomes significantly. Cases at a single tertiary-care center reported to the American College of Surgeons National Surgical Quality Improvement Program over a 10-year period were identified. Operative start times were divided into six-hour blocks, with 6 am to noon serving as the reference. Standard univariable techniques were applied. Multivariable logistic regression with mixed effects modeling then was used to determine the relation between operative start times and infectious outcomes, controlling for surgeon clustering. Statistical significance was set at p operative infectious complication. Seventy percent of these infections (n = 1,506) were surgical site infections. On univariable analysis considering all cases, nighttime and evening operations had higher rates of post-operative infections than those in performed during the day (9.1% from 6 am to noon; 9.7% from noon to 6 pm; 14.8% from 6 pm to midnight; and 14.4% from midnight to 6 am; p operative start time was not associated with the risk of post-operative infection, even when emergency cases were considered independently. Our data suggest that operative start times have no correlation with post-operative infectious complications. Further work is required to identify the source of the time-dependent outcome variability observed in previous studies.

Intrinsically bent DNA in replication origins and gene promoters.

Science.gov (United States)

Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

2008-06-24

Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

Marketing Strategies Used to Promote Children's Medicine Sold on Internet Sites of Pharmaceutical Stores.

Science.gov (United States)

Basch, Corey H; Roberts, Katherine J; Zagnit, Emily A; Martinez, Amairany

2016-12-01

Retail sales of over the counter (OTC) medications have risen steadily over the years; however, these products are not without potential risk. The aim of this study was to describe the marketing strategies used to promote OTC medicines to children and their parents. Data were collected from 187 product packaging of fever reducer, allergy, and cough medicines posted on the Internet sites of three of the largest pharmacies in the United States. Specific marketing information was collected related to flavorings and pictures appearing on the packaging. There was no significant difference between the type of medicine and whether they were flavored or not, as almost every product (95.7 %) indicated that it resembles a food flavoring. On almost all the packaging (92.5 %) the flavor was also indicated by words in different font sizes. Most of the products (83.4 %) showed a picture of a food product on their packaging. There was a significant difference between the medicine types by picture, with fever medicines having more pictures of food than either cough or allergy medicine. Stronger regulations of marketing strategies of these products are needed.

Would you tell everyone this? Facebook conversations as health promotion interventions.

Science.gov (United States)

Syred, Jonathan; Naidoo, Carla; Woodhall, Sarah C; Baraitser, Paula

2014-04-11

Health promotion interventions on social networking sites can communicate individually tailored content to a large audience. User-generated content helps to maximize engagement, but health promotion websites have had variable success in supporting user engagement. The aim of our study was to examine which elements of moderator and participant behavior stimulated and maintained interaction with a sexual health promotion site on Facebook. We examined the pattern and content of posts on a Facebook page. Google analytics was used to describe the number of people using the page and viewing patterns. A qualitative, thematic approach was used to analyze content. During the study period (January 18, 2010, to June 27, 2010), 576 users interacted 888 times with the site through 508 posts and 380 comments with 93% of content generated by users. The user-generated conversation continued while new participants were driven to the site by advertising, but interaction with the site ceased rapidly after the advertising stopped. Conversations covered key issues on chlamydia and chlamydia testing. Users endorsed testing, celebrated their negative results, and modified and questioned key messages. There was variation in user approach to the site from sharing of personal experience and requesting help to joking about sexually transmitted infection. The moderator voice was reactive, unengaged, tolerant, simplistic, and was professional in tone. There was no change in the moderator approach throughout the period studied. Our findings suggest this health promotion site provided a space for single user posts but not a self-sustaining conversation. Possible explanations for this include little new content from the moderator, a definition of content too narrow to hold the interest of participants, and limited responsiveness to user needs. Implications for health promotion practice include the need to consider a life cycle approach to online community development for health promotion and the

Transcription factor binding sites prediction based on modified nucleosomes.

Directory of Open Access Journals (Sweden)

Mohammad Talebzadeh

Full Text Available In computational methods, position weight matrices (PWMs are commonly applied for transcription factor binding site (TFBS prediction. Although these matrices are more accurate than simple consensus sequences to predict actual binding sites, they usually produce a large number of false positive (FP predictions and so are impoverished sources of information. Several studies have employed additional sources of information such as sequence conservation or the vicinity to transcription start sites to distinguish true binding regions from random ones. Recently, the spatial distribution of modified nucleosomes has been shown to be associated with different promoter architectures. These aligned patterns can facilitate DNA accessibility for transcription factors. We hypothesize that using data from these aligned and periodic patterns can improve the performance of binding region prediction. In this study, we propose two effective features, "modified nucleosomes neighboring" and "modified nucleosomes occupancy", to decrease FP in binding site discovery. Based on these features, we designed a logistic regression classifier which estimates the probability of a region as a TFBS. Our model learned each feature based on Sp1 binding sites on Chromosome 1 and was tested on the other chromosomes in human CD4+T cells. In this work, we investigated 21 histone modifications and found that only 8 out of 21 marks are strongly correlated with transcription factor binding regions. To prove that these features are not specific to Sp1, we combined the logistic regression classifier with the PWM, and created a new model to search TFBSs on the genome. We tested the model using transcription factors MAZ, PU.1 and ELF1 and compared the results to those using only the PWM. The results show that our model can predict Transcription factor binding regions more successfully. The relative simplicity of the model and capability of integrating other features make it a superior method

Barriers and Facilitators to Healthy Eating and Activity in Head Start Staff: An Opportunity for Worksite Wellness

Science.gov (United States)

Hibbs-Shipp, Sarah K.; Milholland, Michelle; Bellows, Laura

2015-01-01

Background: Head Start (HS) staff are ideally positioned to promote healthy behaviors to over one million low-income children each year, however little is understood about their own health. Purpose: To conduct a needs assessment with HS staff to: 1) understand perceptions, barriers and motivators to healthful behaviors; and 2) ascertain interest…

Mochovce site

International Nuclear Information System (INIS)

1997-01-01

In Mochovce site the construction of four units of WWER 440 NPP with V-213 type of reactor is being carried out. The financing of Mochovce units completion was resolved in April 1996. The completion work commenced at the construction site under leadership of SKODA Prague, the general supplier. The completion work on building part and tests of constructional electric distributions and lightning constructors started. The revisions in technological part were finished, and final protocols from revisions are the basis for starting of completion work. The assembly of transport container anchorage,ventilation system in hermetic areas and hermetic coverage of pools for stored spent nuclear fuel is being carried out. The pre-completion tests of instrumentation and control of ventilation systems, individual dosimetric control in medical station, and tests of nuclear programme according to commissioning and assembling work schedule at the equipment for physical protection of the NPP area started. Inspection activities at Mochovce were performed in accordance with inspection plan for 1996. Evaluation of routine inspections was performed by means of quarterly protocols. Main findings from the inspections performed in Mochovce were in the following areas: (a) deficiencies in the knowledge of the respective regulation and conditions from the Resolution of the state regulatory body, concerning selected employees; (b) training of the selected employees; (c) aim of the measures imposes by inspectors is to eliminate deficiencies in preparation of programmes for pre-completion and completion testing. NRA SR assessment activities at Mochovce NPP were focused mainly on approving and inspecting of design modification to approving programmes for pre-completion and completion testing of system s and equipment and on approving quality assurance programmes. The suggestions of international missions, which reviewed Mochovce safety in the years, were taken into consideration in the programme

Transcriptional activation of transforming growth factor alpha by estradiol: requirement for both a GC-rich site and an estrogen response element half-site.

Science.gov (United States)

Vyhlidal, C; Samudio, I; Kladde, M P; Safe, S

2000-06-01

17beta-Estradiol (E2) induces transforming growth factor alpha (TGFalpha) gene expression in MCF-7 cells and previous studies have identified a 53 bp (-252 to -200) sequence containing two imperfect estrogen responsive elements (EREs) that contribute to E2 responsiveness. Deletion analysis of the TGFalpha gene promoter in this study identified a second upstream region of the promoter (-623 to -549) that is also E2 responsive. This sequence contains three GC-rich sites and an imperfect ERE half-site, and the specific cis-elements and trans-acting factors were determined by promoter analysis in transient transfection experiments, gel mobility shift assays and in vitro DNA footprinting. The results are consistent with an estrogen receptor alpha (ERalpha)/Sp1 complex interacting with an Sp1(N)(30) ERE half-site ((1/2)) motif in which both ERalpha and Sp1 bind promoter DNA. The ER/Sp1-DNA complex is formed using nuclear extracts from MCF-7 cells but not with recombinant human ERalpha or Sp1 proteins, suggesting that other nuclear factor(s) are required for complex stabilization. The E2-responsive Sp1(N)(x)ERE(1/2) motif identified in the TGFalpha gene promoter has also been characterized in the cathepsin D and heat shock protein 27 gene promoters; however, in the latter two promoters the numbers of intervening nucleotides are 23 and 10 respectively.

Transition from site selection to site confirmation phase: New challenge to Posiva's communication and public involvement

International Nuclear Information System (INIS)

Seppaelae, Timo

2001-01-01

In Finland, Posiva Oy is responsible for the final disposal of spent nuclear fuel. In the 1990's investigations have been carried out on four intended sites for final disposal. Posiva implemented Environmental Impact Assessment (EIA) on the investigation sites in 1997-1999. The results of the EIA procedure were published in the EIA report which was attached to the application filed to the Government in May 1999 for a policy decision on the construction of the final disposal facility in Olkiluoto in the municipality of Eurajoki. In December 2000, the Finnish Government made a favourable policy decision ( D ecision in Principle ) on the construction of final disposal facility for spent nuclear fuel in Olkiluoto. According to the decision, the facility is in line with the overall good of the society. According to the Government's decision the prerequisites of the policy decision had been met. The municipality of Eurajoki supported the construction of the facility in Olkiluoto and STUK, the Radiation and Nuclear Safety Authority, also approved of the advancement of the project. The positive policy decision of the Government will still need to be ratified by the Parliament. The parliamentary proceedings of the policy decision will probably start in February 2001. The policy decision will make it possible for Posiva to concentrate the future site confirmation studies in Olkiluoto, Eurajoki, and construct an underground research facility there. The excavation of the research facility in the bedrock is planned to start in a few years' time. The construction of the final disposal facility is scheduled to start after the year 2010. The transition from the site selection to the site confirmation phase in Eurajoki means a new challenge not only to Posiva's research work but also to Posiva's communication. In addition to meeting the safety criteria, Posiva's activities shall in the future also meet all the criteria specified by the surrounding society

Promoter hypomethylation and upregulation of trefoil factors in prostate cancer

DEFF Research Database (Denmark)

Vestergaard, Else Marie; Nexø, Ebba; Tørring, Niels

2010-01-01

cell lines with significant TFF expression as compared to benign immortalized prostate cell lines and PC cell lines not expressing trefoil factor. The most striking difference was observed for CpG sites located close to the AUG start codon overlapping several putative binding sites for cellular...

A promoter-level mammalian expression atlas

DEFF Research Database (Denmark)

Forest, Alistair R.R.; Kawaji, Hideya; Rehli, Michael

2014-01-01

Regulated transcription controls the diversity, developmental pathways and spatial organization of the hundreds of cell types that make up a mammal. Using single-molecule cDNA sequencing, we mapped transcription start sites (TSSs) and their usage in human and mouse primary cells, cell lines and t...

Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

Science.gov (United States)

Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

2011-01-01

CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

30 CFR 75.1913 - Starting aids.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Starting aids. 75.1913 Section 75.1913 Mineral... SAFETY STANDARDS-UNDERGROUND COAL MINES Diesel-Powered Equipment § 75.1913 Starting aids. (a) Volatile fuel starting aids shall be used in accordance with recommendations provided by the starting aid...

Preparation of Al/Fe-Pillared Clays: Effect of the Starting Mineral.

Science.gov (United States)

Muñoz, Helir-Joseph; Blanco, Carolina; Gil, Antonio; Vicente, Miguel-Ángel; Galeano, Luis-Alejandro

2017-11-28

Four natural clays were modified with mixed polyoxocations of Al/Fe for evaluating the effect of the physicochemical properties of the starting materials (chemical composition, abundance of expandable clay phases, cationic exchange capacity and textural properties) on final physicochemical and catalytic properties of Al/Fe-PILCs. The aluminosilicate denoted C2 exhibited the highest potential as starting material in the preparation of Al/Fe-PILC catalysts, mainly due to its starting cationic exchange capacity (192 meq/100 g) and the dioctahedral nature of the smectite phase. These characteristics favored the intercalation of the mixed (Al 13- x /Fe x ) 7+ Keggin-type polyoxocations, stabilizing a basal spacing of 17.4 Å and high increase of the BET surface (194 m²/g), mainly represented in microporous content. According to H₂-TPR analyses, catalytic performance of the incorporated Fe in the Catalytic Wet Peroxide Oxidation (CWPO) reaction strongly depends on the level of location in mixed Al/Fe pillars. Altogether, such physicochemical characteristics promoted high performance in CWPO catalytic degradation of methyl orange in aqueous medium at very mild reaction temperatures (25.0 ± 1.0 °C) and pressure (76 kPa), achieving TOC removal of 52% and 70% of azo-dye decolourization in only 75 min of reaction under very low concentration of clay catalyst (0.05 g/L).

Resilient Partners: The Development of a University-Community Collaboration to Promote Wellness for Head Start Children and Families

Science.gov (United States)

Mendez, Julia L.; Lloyd, Blake Te'Neil

2005-01-01

This paper describes a theoretically driven approach uniquely suited for the development of research partnerships between university teams and local communities serving children enrolled in Head Start programs. A literature review on dimensions of successful research partnerships provides a backdrop for presenting the Resilience…

Press Start

Science.gov (United States)

Harteveld, Casper

This level sets the stage for the design philosophy called “Triadic Game Design” (TGD). This design philosophy can be summarized with the following sentence: it takes two to tango, but it takes three to design a meaningful game or a game with a purpose. Before the philosophy is further explained, this level will first delve into what is meant by a meaningful game or a game with a purpose. Many terms and definitions have seen the light and in this book I will specifically orient at digital games that aim to have an effect beyond the context of the game itself. Subsequently, a historical overview is given of the usage of games with a serious purpose which starts from the moment we human beings started to walk on our feet till our contemporary society. It turns out that we have been using games for all kinds of non-entertainment purposes for already quite a long time. With this introductory material in the back of our minds, I will explain the concept of TGD by means of a puzzle. After that, the protagonist of this book, the game Levee Patroller, is introduced. Based on the development of this game, the idea of TGD, which stresses to balance three different worlds, the worlds of Reality, Meaning, and Play, came into being. Interested? Then I suggest to quickly “press start!”

Characterization and sequence analysis of the F2 promoter from corynephage BFK20

International Nuclear Information System (INIS)

Koptides, M.; Ugorcakova, J.; Baloghova, E.; Bukovska, G.; Timko, J.

1994-01-01

F2 promoter from corynephage BFK20 was isolated and characterized. It was functional in Escherichia coli and Corynebacterium glutamicum. Cloning of the F2 promoter into the pJUP05 promoter probe vector caused an increase of the neomycin phosphotransferase II specific activity. According to the Northern blot hybridization the nptII gene was expressed from the cloned F2 promoter. The apparent transcription start point in E. coli and C. glutamicum was determined. The-35 region of F2 promoter showed high similarity to that of E. coli promoter consensus sequence, but its - 10 region was G+C rich and had no significant homology to that. (author)

Jump Starting Entrepreneurship

DEFF Research Database (Denmark)

Burcharth, Ana; Smith, Pernille; Frederiksen, Lars

How do laid-off employees become entrepreneurs after receiving a dream start into self-employment? This question is relevant for policy makers and entrepreneurship researchers alike since it raises the possibility of a reverse entrepreneurial opportunity, in which the chance of becoming an entrep......How do laid-off employees become entrepreneurs after receiving a dream start into self-employment? This question is relevant for policy makers and entrepreneurship researchers alike since it raises the possibility of a reverse entrepreneurial opportunity, in which the chance of becoming...... an entrepreneur emerges before the discovery of a profitable opportunity. We empirically examine this question on the unique setting of a corporate entrepreneurship program. In the midst of a corporate crisis, Nokia supported laid-off employees to start their own ventures under favorable conditions. We...... persevered in their endeavors and eventually became comfortable with their new career prospects. We discuss the psychological factors that impact career transition after organizational closure and theorize weather they encourage or discourage entrepreneurship....

Promoting physical activity, healthy eating and gross motor skills development among preschoolers attending childcare centers: Process evaluation of the Healthy Start-Départ Santé intervention using the RE-AIM framework.

Science.gov (United States)

Ward, Stéphanie; Chow, Amanda Froehlich; Humbert, M Louise; Bélanger, Mathieu; Muhajarine, Nazeem; Vatanparast, Hassan; Leis, Anne

2018-06-01

The Healthy Start-Départ Santé intervention was developed to promote physical activity, gross motor skills and healthy eating among preschoolers attending childcare centers. This process evaluation aimed to report the reach, effectiveness, adoption, implementation and maintenance of the Healthy Start-Départ Santé intervention. The RE-AIM framework was used to guide this process evaluation. Data were collected across 140 childcare centers who received the Healthy Start-Départ Santé intervention in the provinces of Saskatchewan and New Brunswick, Canada. Quantitative data were collected through director questionnaires at 10 months and 2 years after the initial training and analyzed using descriptive statistics. Qualitative data were collected throughout the intervention. The intervention was successful in reaching a large number of childcare centres and engaging both rural and urban communities across Saskatchewan and New Brunswick. Centres reported increasing opportunities for physical activity and healthy eating, which were generally low-cost, easy and quick to implement. However, these changes were rarely transformed into formal written policies. A total of 87% of centers reported using the physical activity resource and 68% using the nutrition resource on a weekly basis. Implementation fidelity of the initial training was high. Of those centers who received the initial training, 75% participated in the mid-point booster session training. Two year post-implementation questionnaires indicated that 47% of centers were still using the Active Play Equipment kit, while 42% were still using the physical activity resource and 37% were still using the nutrition resource. Key challenges to implementation and sustainability identified during the evaluation were consistent among all of the REAIM elements. These challenges included lack of time, lack of support from childcare staff and low parental engagement. Findings from this study suggest the implementation of

Mapping of RNA initiation sites by high doses of uv iradiation: evidence for three independent promoters within the left 11% of the Ad-2 genome

International Nuclear Information System (INIS)

Wilson, M.C.; Fraser, N.W.; Darnell, J.E. Jr.

1979-01-01

Cells infected with Ad-2 virus were irradiated so that uv-induced lesions were introduced every 500 to 1000 nucleotides in the genomes, consequently leading to the premature termination of RNA transcription. Such cells when labeled with [ 3 H]uridine accumulate labeled promoter proximal RNA. Hybridization of this RNA after size fractionation to restriction fragments of the Ad-2 genome allowed the identification of DNA sequences containing active RNA initiation sites. Early during the infectious cycle two active RNA initiation sites were found within the left 11% of the Ad-2 genome within the 0 to 3.0 and 4.4 to 8.0 restriction fragments. During late infection (15 hr) an additional uv resistant transcript was detected indicating that a newly activated RNA initiation site, presumably for protein IX, resides within the fragment 8.0 to 11.2

Profound human/mouse differences in alpha-dystrobrevin isoforms: a novel syntrophin-binding site and promoter missing in mouse and rat

Directory of Open Access Journals (Sweden)

Jin Hong

2009-12-01

Full Text Available Abstract Background The dystrophin glycoprotein complex is disrupted in Duchenne muscular dystrophy and many other neuromuscular diseases. The principal heterodimeric partner of dystrophin at the heart of the dystrophin glycoprotein complex in the main clinically affected tissues (skeletal muscle, heart and brain is its distant relative, α-dystrobrevin. The α-dystrobrevin gene is subject to complex transcriptional and post-transcriptional regulation, generating a substantial range of isoforms by alternative promoter use, alternative polyadenylation and alternative splicing. The choice of isoform is understood, amongst other things, to determine the stoichiometry of syntrophins (and their ligands in the dystrophin glycoprotein complex. Results We show here that, contrary to the literature, most α-dystrobrevin genes, including that of humans, encode three distinct syntrophin-binding sites, rather than two, resulting in a greatly enhanced isoform repertoire. We compare in detail the quantitative tissue-specific expression pattern of human and mouse α-dystrobrevin isoforms, and show that two major gene features (the novel syntrophin-binding site-encoding exon and the internal promoter and first exon of brain-specific isoforms α-dystrobrevin-4 and -5 are present in most mammals but specifically ablated in mouse and rat. Conclusion Lineage-specific mutations in the murids mean that the mouse brain has fewer than half of the α-dystrobrevin isoforms found in the human brain. Our finding that there are likely to be fundamental functional differences between the α-dystrobrevins (and therefore the dystrophin glycoprotein complexes of mice and humans raises questions about the current use of the mouse as the principal model animal for studying Duchenne muscular dystrophy and other related disorders, especially the neurological aspects thereof.

Report of JLC site study group

CERN Document Server

Hasegawa, T; Yamashita, S

2003-01-01

This study group selected some good sites for construction of JLC (Electron-Positron Linear Collider) on the basis of investigation of data and field survey. The aims, activity, use of underground of private land, conditions of site, selection of site at present and future, summary and proposal are reported. 9 sites (Hidaka, Kitakami, Murayama, Abukuma, Kitaibaraki, Aichi and Gifu, Takamatsu, Hiroshima and Seburi range) are selected for the construction on the basis of firm ground and 4 sites (Okinawa, Harima, Tsukuba and Mutsuogawara) for development and researches. 9 sites area consists of plutonic rock or old strata of Paleozoic era. Many problems in each site are reported. There are three following proposals; 1) the self-governing communities of the sites have to understand JLC and start to construct it by information, 2) a site evaluation committee consists of specialist of civil engineering, building, social and natural environment and disaster prevention and 3) the vibration test should be carried out ...

76 FR 50813 - Major Capital Investment Projects; Guidance on News Starts/Small Starts Policies and Procedures

Science.gov (United States)

2011-08-16

... DEPARTMENT OF TRANSPORTATION Federal Transit Administration Major Capital Investment Projects; Guidance on News Starts/Small Starts Policies and Procedures AGENCY: Federal Transit Administration (FTA... Administration (FTA) to publish policy guidance on the New and Small Starts capital project review and evaluation...

Three Approaches to Preschoolers' Social and Emotional Competence: A Summary of Impact and Implementation Findings from Head Start CARES

Science.gov (United States)

MDRC, 2015

2015-01-01

This summary describes the Head Start CARES research project, which evaluated three classroom-based approaches to enhancing children's social-emotional development: (1) The Incredible Years Teacher Training Program; (2) Preschool PATHS (Promoting Alternative Thinking Strategies); and (3) Tools of the Mind--Play. The three social-emotional…

IFI44L promoter methylation as a blood biomarker for systemic lupus erythematosus

Science.gov (United States)

Zhao, Ming; Zhou, Yin; Zhu, Bochen; Wan, Mengjie; Jiang, Tingting; Tan, Qiqun; Liu, Yan; Jiang, Juqing; Luo, Shuaihantian; Tan, Yixin; Wu, Haijing; Renauer, Paul; Gutiérrez, Maria del Mar Ayala; Palma, Maria Jesús Castillo; Castro, Rafaela Ortega; Fernández-Roldán, Concepción; Raya, Enrique; Faria, Raquel; Carvalho, Claudia; Alarcón-Riquelme, Marta E; Xiang, Zhongyuan; Chen, Jinwei; Li, Fen; Ling, Guanghui; Zhao, Hongjun; Liao, Xiangping; Lin, Youkun; Sawalha, Amr H; Lu, Qianjin

2016-01-01

Objective Systemic lupus erythematosus (SLE) is a clinically heterogeneous disease with limited reliable diagnostic biomarkers. We investigated whether gene methylation could meet sensitivity and specificity criteria for a robust biomarker. Methods IFI44L promoter methylation was examined using DNA samples from a discovery set including 377 patients with SLE, 358 healthy controls (HCs) and 353 patients with rheumatoid arthritis (RA). Two independent sets including 1144 patients with SLE, 1350 HCs, 429 patients with RA and 199 patients with primary Sjögren’s syndrome (pSS) were used for validation. Results Significant hypomethylation of two CpG sites within IFI44L promoter, Site1 (Chr1: 79 085 222) and Site2 (Chr1: 79 085 250; cg06872964), was identified in patients with SLE compared with HCs, patients with RA and patients with pSS. In a comparison between patients with SLE and HCs included in the first validation cohort, Site1 methylation had a sensitivity of 93.6% and a specificity of 96.8% at a cut-off methylation level of 75.5% and Site2 methylation had a sensitivity of 94.1% and a specificity of 98.2% at a cut-off methylation level of 25.5%. The IFI44L promoter methylation marker was also validated in an European-derived cohort. In addition, the methylation levels of Site1 and Site2 within IFI44L promoter were significantly lower in patients with SLE with renal damage than those without renal damage. Patients with SLE showed significantly increased methylation levels of Site1 and Site2 during remission compared with active stage. Conclusions The methylation level of IFI44L promoter can distinguish patients with SLE from healthy persons and other autoimmune diseases, and is a highly sensitive and specific diagnostic marker for SLE. PMID:26787370

45 CFR 1308.21 - Parent participation and transition of children into Head Start and from Head Start to public...

Science.gov (United States)

2010-10-01

... into Head Start and from Head Start to public school. 1308.21 Section 1308.21 Public Welfare... AND HUMAN SERVICES THE ADMINISTRATION FOR CHILDREN, YOUTH AND FAMILIES, HEAD START PROGRAM HEAD START... Standards § 1308.21 Parent participation and transition of children into Head Start and from Head Start to...

Health Promotion at the Construction Work Site: The Lunch Truck Pilot Study.

Science.gov (United States)

Caban-Martinez, Alberto J; Moore, Kevin J; Clarke, Tainya C; Davila, Evelyn P; Clark, John D; Lee, David J; Fleming, Lora E

2018-04-01

The transient nature of construction work makes it difficult to conduct longitudinal worksite-based health promotion activities. As part of a workplace health assessment pilot study, we worked with a commercial lunch truck company to disseminate four types of health education materials including cancer screening, workplace injury prevention, fruit and vegetable consumption, and smoking cessation to construction workers purchasing food items from the truck during their job breaks. Two weeks following the worksite assessment, we followed up with these workers to ascertain their use of the health promotion materials. Of the 54 workers surveyed, 83% reported reviewing and sharing the cancer screening materials with their families, whereas 44% discussed the cancer screening materials with coworkers. Similar proportions of workers reviewed, shared, and discussed the other health promotion materials with their family. Lunch trucks may be an effective strategy and delivery method for educating construction workers on healthy behaviors and injury prevention practices.

Cell- and stage-specific chromatin structure across the Complement receptor 2 (CR2/CD21) promoter coincide with CBF1 and C/EBP-beta binding in B cells.

Science.gov (United States)

Cruickshank, Mark N; Fenwick, Emily; Karimi, Mahdad; Abraham, Lawrence J; Ulgiati, Daniela

2009-08-01

Stringent developmental transcription requires multiple transcription factor (TF) binding sites, cell-specific expression of signaling molecules, TFs and co-regulators and appropriate chromatin structure. During B-lymphopoiesis, human Complement receptor 2 (CR2/CD21) is detected on immature and mature B cells but not on B cell precursors and plasma cells. We examined cell- and stage-specific human CR2 gene regulation using cell lines modeling B-lymphopoiesis. Chromatin accessibility assays revealed a region between -409 and -262 with enhanced accessibility in mature B cells and pre-B cells, compared to either non-lymphoid or plasma cell-types, however, accessibility near the transcription start site (TSS) was elevated only in CR2-expressing B cells. A correlation between histone acetylation and CR2 expression was observed, while histone H3K4 dimethylation was enriched near the TSS in both CR2-expressing B cells and non-expressing pre-B cells. Candidate sites within the CR2 promoter were identified which could regulate chromatin, including a matrix attachment region associated with CDP, SATB1/BRIGHT and CEBP-beta sites as well as two CBF1 sites. ChIP assays verified that both CBF1 and C/EBP-beta bind the CR2 promoter in B cells raising the possibility that these factors facilitate or respond to alterations in chromatin structure to control the timing and/or level of CR2 transcription.

CTCF Prevents the Epigenetic Drift of EBV Latency Promoter Qp

Science.gov (United States)

Tempera, Italo; Wiedmer, Andreas; Dheekollu, Jayaraju; Lieberman, Paul M.

2010-01-01

The establishment and maintenance of Epstein-Barr Virus (EBV) latent infection requires distinct viral gene expression programs. These gene expression programs, termed latency types, are determined largely by promoter selection, and controlled through the interplay between cell-type specific transcription factors, chromatin structure, and epigenetic modifications. We used a genome-wide chromatin-immunoprecipitation (ChIP) assay to identify epigenetic modifications that correlate with different latency types. We found that the chromatin insulator protein CTCF binds at several key regulatory nodes in the EBV genome and may compartmentalize epigenetic modifications across the viral genome. Highly enriched CTCF binding sites were identified at the promoter regions upstream of Cp, Wp, EBERs, and Qp. Since Qp is essential for long-term maintenance of viral genomes in type I latency and epithelial cell infections, we focused on the role of CTCF in regulating Qp. Purified CTCF bound ∼40 bp upstream of the EBNA1 binding sites located at +10 bp relative to the transcriptional initiation site at Qp. Mutagenesis of the CTCF binding site in EBV bacmids resulted in a decrease in the recovery of stable hygromycin-resistant episomes in 293 cells. EBV lacking the Qp CTCF site showed a decrease in Qp transcription initiation and a corresponding increase in Cp and Fp promoter utilization at 8 weeks post-transfection. However, by 16 weeks post-transfection, bacmids lacking CTCF sites had no detectable Qp transcription and showed high levels of histone H3 K9 methylation and CpG DNA methylation at the Qp initiation site. These findings provide direct genetic evidence that CTCF functions as a chromatin insulator that prevents the promiscuous transcription of surrounding genes and blocks the epigenetic silencing of an essential promoter, Qp, during EBV latent infection. PMID:20730088

Archaeal promoter architecture and mechanism of gene activation

DEFF Research Database (Denmark)

Peng, Nan; Ao, Xiang; Liang, Yun Xiang

2011-01-01

element named ara box directing arabinose-inducible expression and the basal promoter element TATA, serving as the binding site for the TATA-binding protein. Strikingly, these promoters possess a modular structure that allows an essentially inactive basal promoter to be strongly activated. The invoked...... mechanisms include TFB (transcription factor B) recruitment by the ara-box-binding factor to activate gene expression and modulation of TFB recruitment efficiency to yield differential gene expression....

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

Science.gov (United States)

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

Site characterization plan: Yucca Mountain Site, Nevada Research and Development Area, Nevada: Volume 9, Index

Energy Technology Data Exchange (ETDEWEB)

NONE

1988-12-01

This site characterization plan (SCP) has been developed for the candidate repository site at Yucca Mountain in the State of Nevada. The SCP includes a description of the Yucca Mountain site (Chapters 1-5), a conceptual design for the repository (Chapter 6), a description of the packaging to be used for the waste to be emplaced in the repository (Chapter 7), and a description of the planned site characterization activities (Chapter 8). The schedules and milestones presented in Sections 8.3 and 8.5 of the SCP were developed to be consistent with the June 1988 draft Amendment to the DOE`s Mission Plan for the Civilian Radioactive Waste Management Program. The five month delay in the scheduled start of exploratory shaft construction that was announced recently is not reflected in these schedules.

Direct-to-consumer Internet promotion of robotic prostatectomy exhibits varying quality of information.

Science.gov (United States)

Mirkin, Joshua N; Lowrance, William T; Feifer, Andrew H; Mulhall, John P; Eastham, James E; Elkin, Elena B

2012-04-01

Robotic surgery to remove a cancerous prostate has become a popular treatment. Internet marketing of this surgery provides an intriguing case study of direct-to-consumer promotions of medical devices, which are more loosely regulated than pharmaceutical promotions. We investigated whether the claims made in online promotions of robotic prostatectomy were consistent with evidence from comparative effectiveness studies. After performing a search and cross-sectional analysis of websites that mentioned the procedure, we found that many sites claimed benefits that were unsupported by evidence and that 42 percent of the sites failed to mention risks. Most sites were published by hospitals and physicians, which the public may regard as more objective than pages published by manufacturers. Unbalanced information may inappropriately raise patients' expectations. Increasing enforcement and regulation of online promotions may be beyond the capabilities of federal authorities. Thus, the most feasible solution may be for the government and medical societies to promote the production of balanced educational material.

Direct-To-Consumer Internet Promotion Of Robotic Prostatectomy Exhibits Varying Quality Of Information

Science.gov (United States)

Mirkin, Joshua N.; Lowrance, William T.; Feifer, Andrew H.; Mulhall, John P.; Eastham, James E.; Elkin, Elena B.

2013-01-01

Robotic surgery to remove a cancerous prostate has become a popular treatment. Internet marketing of this surgery provides an intriguing case study of direct-to-consumer promotions of medical devices, which are more loosely regulated than pharmaceutical promotions. We investigated whether the claims made in online promotions of robotic prostatectomy were consistent with evidence from comparative effectiveness studies. After performing a search and crosssectional analysis of websites that mentioned the procedure, we found that many sites claimed benefits that were unsupported by evidence and that 42 percent of the sites failed to mention risks. Most sites were published by hospitals and physicians, which the public may regard as more objective than pages published by manufacturers. Unbalanced information may inappropriately raise patients’ expectations. Increasing enforcement and regulation of online promotions may be beyond the capabilities of federal authorities. Thus, the most feasible solution may be for the government and medical societies to promote the production of balanced educational material. PMID:22492893

Early Site Permit Demonstration Program: Recommendations for communication activities and public participation in the Early Site Permit Demonstration Program

International Nuclear Information System (INIS)

1993-01-01

On October 24, 1992, President Bush signed into law the National Energy Policy Act of 1992. The bill is a sweeping, comprehensive overhaul of the Nation's energy laws, the first in more than a decade. Among other provisions, the National Energy Policy Act reforms the licensing process for new nuclear power plants by adopting a new approach developed by the US Nuclear Regulatory Commission (NRC) in 1989, and upheld in court in 1992. The NRC 10 CFR Part 52 rule is a three-step process that guarantees public participation at each step. The steps are: early site permit approval; standard design certifications; and, combined construction/operating licenses for nuclear power reactors. Licensing reform increases an organization's ability to respond to future baseload electricity generation needs with less financial risk for ratepayers and the organization. Costly delays can be avoided because design, safety and siting issues will be resolved before a company starts to build a plant. Specifically, early site permit approval allows for site suitability and acceptability issues to be addressed prior to an organization's commitment to build a plant. Responsibility for site-specific activities, including communications and public participation, rests with those organizations selected to try out early site approval. This plan has been prepared to assist those companies (referred to as sponsoring organizations) in planning their communications and public involvement programs. It provides research findings, information and recommendations to be used by organizations as a resource and starting point in developing their own plans

Pre-start timing information is used to set final linear speed in a C-start manoeuvre.

Science.gov (United States)

Reinel, Caroline; Schuster, Stefan

2014-08-15

In their unique hunting behaviour, archerfish use a complex motor decision to secure their prey: based solely on how dislodged prey initially falls, they select an adapted C-start manoeuvre that turns the fish right towards the point on the water surface where their prey will later land. Furthermore, they take off at a speed that is set so as to arrive in time. We show here that the C-start manoeuvre and not subsequent tail beating is necessary and sufficient for setting this adaptive level of speed. Furthermore, the C-start pattern is adjusted to independently determine both the turning angle and the take-off speed. The selection of both aspects requires no a priori information and is done based on information sampled from the onset of target motion until the C-start is launched. Fin strokes can occur right after the C-start manoeuvre but are not required to fine-tune take-off speed, but rather to maintain it. By probing the way in which the fish set their take-off speed in a wide range of conditions in which distance from the later catching point and time until impact varied widely and unpredictably, we found that the C-start manoeuvre is programmed based on pre-C-start estimates of distance and time until impact. Our study hence provides the first evidence for a C-start that is fine-tuned to produce an adaptive speed level. © 2014. Published by The Company of Biologists Ltd.

RFWD3-Mediated Ubiquitination Promotes Timely Removal of Both RPA and RAD51 from DNA Damage Sites to Facilitate Homologous Recombination.

Science.gov (United States)

Inano, Shojiro; Sato, Koichi; Katsuki, Yoko; Kobayashi, Wataru; Tanaka, Hiroki; Nakajima, Kazuhiro; Nakada, Shinichiro; Miyoshi, Hiroyuki; Knies, Kerstin; Takaori-Kondo, Akifumi; Schindler, Detlev; Ishiai, Masamichi; Kurumizaka, Hitoshi; Takata, Minoru

2017-06-01

RFWD3 is a recently identified Fanconi anemia protein FANCW whose E3 ligase activity toward RPA is essential in homologous recombination (HR) repair. However, how RPA ubiquitination promotes HR remained unknown. Here, we identified RAD51, the central HR protein, as another target of RFWD3. We show that RFWD3 polyubiquitinates both RPA and RAD51 in vitro and in vivo. Phosphorylation by ATR and ATM kinases is required for this activity in vivo. RFWD3 inhibits persistent mitomycin C (MMC)-induced RAD51 and RPA foci by promoting VCP/p97-mediated protein dynamics and subsequent degradation. Furthermore, MMC-induced chromatin loading of MCM8 and RAD54 is defective in cells with inactivated RFWD3 or expressing a ubiquitination-deficient mutant RAD51. Collectively, our data reveal a mechanism that facilitates timely removal of RPA and RAD51 from DNA damage sites, which is crucial for progression to the late-phase HR and suppression of the FA phenotype. Copyright © 2017 Elsevier Inc. All rights reserved.

Contaminant transport modeling studies of Russian sites

International Nuclear Information System (INIS)

Tsang, Chin-Fu

1993-01-01

Lawrence Berkeley Laboratory (LBL) established mechanisms that promoted cooperation between U.S. and Russian scientists in scientific research as well as environmental technology transfer. Using Russian experience and U.S technology, LBL developed approaches for field investigations, site evaluation, waste disposal, and remediation at Russian contaminated sites. LBL assessed a comprehensive database as well as an actual, large-scale contaminated site to evaluate existing knowledge of and test mathematical models used for the assessment of U.S. contaminated sites

Building trust with the public in site selection of radioactive waste repository in Croatia

International Nuclear Information System (INIS)

Cerskov Klika, Mirjana; Schaller, Antun

1995-01-01

It should be emphasised that the Republic of Croatia ought to find a solution to dispose not only radioactive waste generated on its own territory, i.e. waste derived from diverse medical, industrial and scientific nuclear applications which does not exceed some 70 cubic metres: in total. It is also obliged to find acceptable solutions for disposal of a half of total radioactive waste accumulating in the Krsko NPP which is situated in Slovenia, but is a joint venture facility of both countries, Slovenia and Croatia. Therefore, one of essential duties of the APO - Hazardous Waste Management Agency is just performance of these activities in Croatia. The site selection process of low- and intermediate radioactive waste disposal in Croatia started in 1988. The site selection process itself is organized in two stages: (1) site survey stage; and 2) site evaluation stage. The first stage, being currently in progress, is related to all activities directed to inclusion of preferred sites into the Regional Plan of Croatia, whilst the second stage includes a necessary on-field investigations at few preferred sites and identification of the most suitable one, i.e. the final repository site. Eight potential areas containing even 42 potential sites have been determined so far. Promotion of several preferred sites is expected to be done until July 1995. Official announcement of preferred sites will be followed by public debate on their acceptance at a level of political-territorial organization, including local communities. The people working in APO - Hazardous Waste Management Agency have been aware of considerable public resistance to most of activities the Agency is dealing with since the very beginning of its operation. Consequently, permanent education and honest information to the public have been taken as the Agency's high priority tasks. Namely, if the public is treated as a competent participant in decision making process then it gets obvious that publicity of work is

Preschool Facilities - MDC_HeadStart

Data.gov (United States)

NSGIC Local Govt | GIS Inventory — A label (point) feature class of Head Start / Early Head Start/ Delegate Agencies/ Child Care Partnership & Family Day Care Homes Programs location in Miami-Dade...

Virtual Seismic Observation (VSO) with Sparsity-Promotion Inversion

Science.gov (United States)

Tiezhao, B.; Ning, J.; Jianwei, M.

2017-12-01

Large station interval leads to low resolution images, sometimes prevents people from obtaining images in concerned regions. Sparsity-promotion inversion, a useful method to recover missing data in industrial field acquisition, can be lent to interpolate seismic data on none-sampled sites, forming Virtual Seismic Observation (VSO). Traditional sparsity-promotion inversion suffers when coming up with large time difference in adjacent sites, which we concern most and use shift method to improve it. The procedure of the interpolation is that we first employ low-pass filter to get long wavelength waveform data and shift the waveforms of the same wave in different seismograms to nearly same arrival time. Then we use wavelet-transform-based sparsity-promotion inversion to interpolate waveform data on none-sampled sites and filling a phase in each missing trace. Finally, we shift back the waveforms to their original arrival times. We call our method FSIS (Filtering, Shift, Interpolation, Shift) interpolation. By this way, we can insert different virtually observed seismic phases into none-sampled sites and get dense seismic observation data. For testing our method, we randomly hide the real data in a site and use the rest to interpolate the observation on that site, using direct interpolation or FSIS method. Compared with directly interpolated data, interpolated data with FSIS can keep amplitude better. Results also show that the arrival times and waveforms of those VSOs well express the real data, which convince us that our method to form VSOs are applicable. In this way, we can provide needed data for some advanced seismic technique like RTM to illuminate shallow structures.

Tips for starting your own nurse practitioner practice.

Science.gov (United States)

Calmelat, A

1993-04-01

The decision to open a nurse practitioner practice is often difficult to make. Success depends on the possession of specific resources, such as adequate skills, finances, emotional support and the desire to be one's own boss. These skills will be critical as the NP develops a business plan and a budget, and makes important decisions, such as the form the business will take: sole proprietorship, partnership or corporation. Using external resources such as attorneys and accountants is also useful, especially when tackling issues of licenses, taxes and insurance. Start-up costs can be kept to a minimum with creativity and used equipment. In-house laboratories and reference laboratories must conform to strict regulations. A practice without established patients will need to market services aggressively through a successful mix of product, price, place and promotion. Patients' acceptance of the NP office will be enhanced by smooth patient flow, adequate space and cleanliness.

Criteria of site assessment

International Nuclear Information System (INIS)

Gibbs, P.; Fuchs, H.

1975-01-01

The criteria which lead to the choice of a particular site for a nuclear power station are in general very similar to those which would apply to any other type of power station. The principal differences derive from the simpler transport problems for the fuel compared with, say, solid fuel and the special safety considerations which attach to nuclear reactors. The search for a suitable site obviously starts by considering where the power is needed, i.e. where the load centers are and also the existing transmission network which may help to bring the power from a more remote site to the load centers. This economic incentive to put the plant close to loads conflicts directly with the nuclear safety argument which favours more remote siting, and part of the problem of site selection is to reconcile these two matters. In addition, there are many other important matters which will be considered later concerning the adequacy of cooling water supplies, foundation conditions, etc., all of which must be examined in considerable detail. (orig./TK) [de

Specialized sorting and measuring system for site remediation

International Nuclear Information System (INIS)

Runge, H.; Christ, G.

2001-01-01

The machine design and measurement philosophy of the SSGE, developed for excavation and treatment of some 21,000 metric tons of ground material and concrete from NUKEM decommissioned fuel element factory, have already been passed the official licensing procedure. The start up of site clean-up is scheduled for summer 2001. With the SSGE there has been made available a method to safe and economically remediate contaminated ground of nuclear sites. The SSEG, being a mobile system, can be applied at various sites

Identification and characterization of Kaposi's sarcoma-associated herpesvirus open reading frame 11 promotor activation

Energy Technology Data Exchange (ETDEWEB)

Chen, Lei [Los Alamos National Laboratory

2008-01-01

Open reading frame 11 (ORF11) of Kaposi's sarcoma-associated herpesvirus belongs to a herpesviral homologous protein family shared by some members of the gamma- herpesvirus subfamily. Little is known about this ORF11 homologous protein family. We have characterized an unknown open reading frame, ORF11, located adjacent and in the opposite orientation to a well-characterized viral IL-6 gene. Northern blot analysis reveals that ORF11 is expressed during the KSHV lytic cycle with delayed-early transcription kinetics. We have determined the 5{prime} and 3{prime} untranslated region of the unspliced ORF11 transcript and identified both the transcription start site and the transcription termination site. Core promoter region, representing ORF11 promoter activity, was mapped to a 159nt fragment 5{prime} most proximal to the transcription start site. A functional TATA box was identified in the core promoter region. Interestingly, we found that ORF11 transcriptional activation is not responsive to Rta, the KSHV lytic switch protein. We also discovered that part of the ORF11 promoter region, the 209nt fragment upstream of the transcription start site, was repressed by phorbol esters. Our data help to understand transcription regulation of ORF11 and to elucidate roles of ORF11 in KSHV pathogenesis and life cycle.

Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites

DEFF Research Database (Denmark)

Tornøe, Jens; Kusk, P.; Johansen, T.E.

2002-01-01

The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C......, was obtained. The measured activity of each promoter in the library was highly specific and reproducible when tested in HiB5 and ARPE-19 cell culture....

Creating a web site the missing manual

CERN Document Server

MacDonald, Matthew

2008-01-01

Think you have to be a technical wizard to build a great web site? Think again. If you want to create an engaging web site, this thoroughly revised, completely updated edition of Creating a Web Site: The Missing Manual demystifies the process and provides tools, techniques, and expert guidance for developing a professional and reliable web presence. Whether you want to build a personal web site, an e-commerce site, a blog, or a web site for a specific occasion or promotion, this book gives you detailed instructions and clear-headed advice for: Everything from planning to launching. From pi

Comparison of microbial contamination at various sites along the ...

African Journals Online (AJOL)

This study was aimed at investigating and comparing the microbial contamination levels at various sites in the Plankenburg and Diep Rivers in the Western Cape, South Africa. Sampling of sites along the Plankenburg River started in June 2004 and continued for a period of 1 year until June 2005. Sampling of the Diep ...

Getting started with Unity

CERN Document Server

Felicia, Patrick

2013-01-01

Getting Started with Unity is written in an easy-to-follow tutorial format.""Getting Started with Unity"" is for[ 3D game developers[/color] who would like to learn how to use Unity3D and become familiar with its core features. This book is also suitable for intermediate users who would like to improve their skills. No prior knowledge of Unity3D is required.

Generation of a synthetic mammalian promoter library by modification of sequences spacing transcription factor binding sites

DEFF Research Database (Denmark)

Tornøe, Jens; Kusk, P.; Johansen, T.E.

2002-01-01

The development of a set of synthetic mammalian promoters with different specific activities is described. The library is based on a synthetic promoter, JeT, constructed as a 200 bp chimeric promoter built from fragments of the viral SV40 early promoter and the human beta-actin and ubiquitin C...

Calcium alginate dressings promote healing of split skin graft donor sites.

LENUS (Irish Health Repository)

O'Donoghue, J M

2012-02-03

A prospective controlled trial was carried out to assess the healing efficacy of calcium alginate and paraffin gauze on split skin graft donor sites. Thirty patients were randomised to the calcium alginate group and 21 to the paraffin gauze group. The donor sites were assessed at 10 days post harvesting to determine if they were completely healed (100%) or not. Twenty one of the 30 patients dressed with calcium alginate were completely healed at day 10, while only 7\\/21 in the paraffin gauze group were healed (p < 0.05). There were two infections in the study, both occurring in the alginate group while there was no difference in dressing slippage between the two groups. Calcium alginate dressings provide a significant improvement in healing split skin graft donor sites.

Prospects for site specific weed management

DEFF Research Database (Denmark)

Christensen, Svend; Rasmussen, Jesper; Pedersen, Søren Marcus

2014-01-01

Research on Site Specific Weed Management (SSWM) started in the late 80's. Since that moment, considerable research has been conducted on different aspects of SSWM, from fundamental studies on the spatial ecology of weeds to the applied development and testing of new technologies for weed detection...

Vandellos 1 NPP partial site release after level 2 decommissioning, using Marssim

Energy Technology Data Exchange (ETDEWEB)

Medinilla, G.; Sanchez, M.; Peinador, M. [Initec-Westinghouse, Madrid (Spain); Lopez, M.T. [ENRESA, Madrid (Spain)

2008-07-01

The Vandellos 1 nuclear power plant is a french technology 480 MWe graphite gas cooled reactor, located in the spanish mediterranean coast, in the province of Tarragona. It started commercial operations in 1972 and that was definitively shutdown after a turbine fire in 1989, being decommissioned by ENRESA to reach IAEA level 2 in 2005, starting a dormancy period that will last around 20 years before the final phase of the decommissioning is executed to reach the ''greenfield'' state. For the plant remaining structures during this dormancy period the site needs not to keep its original size of approx. 130000 m{sup 2}, so ENRESA took the decision of starting a partial site release process of almost a half of the site aiming to exclude that part from regulatory control, applying US MARSSIM methodology. Main activities included: - Site radiological characterization - Derived concentration guideline limits calculation - Definition and classification of survey units Development and testing of scanning devices and procedures - Pilot application of full process to two survey units A summary of the scope and results of these activities is presented in this paper. (authors)

Corporate social responsibility and the significance of its promotion

Directory of Open Access Journals (Sweden)

Veljković Dobrinka

2010-01-01

Full Text Available Corporate Social Responsibility is today frequently used concept, as companies to a larger extent are held accountable for what is happening in the society. In their effort to make a contribution on the solution of various societal problems, the companies engage in different corporative social initiatives. To enjoy multiple benefits arising from implementation of CSR practices companies should reaffirm their commitment to issues of wide public interests as well as promote all the activities pursued in diminishing and solving different social and environmental problems. It is very important to make company's social involvement as transparent as possible, which can be, aparat from other ways, enhanced by proper and up-to-date use of the web site. Through the web site company can inform wide public (all relevant stakeholders about its CSR activities - programs, undertaken initiatives, partners involved, results achieved and future plans and goals in CSR domain. Placing these informating represents an efficient way of promoting company's CSR profile. Aparat from that, company can regulary place announcements on its web site about all other ways of promoting its CSR engagement.

Adaptive evolution of transcription factor binding sites

Directory of Open Access Journals (Sweden)

Berg Johannes

2004-10-01

Full Text Available Abstract Background The regulation of a gene depends on the binding of transcription factors to specific sites located in the regulatory region of the gene. The generation of these binding sites and of cooperativity between them are essential building blocks in the evolution of complex regulatory networks. We study a theoretical model for the sequence evolution of binding sites by point mutations. The approach is based on biophysical models for the binding of transcription factors to DNA. Hence we derive empirically grounded fitness landscapes, which enter a population genetics model including mutations, genetic drift, and selection. Results We show that the selection for factor binding generically leads to specific correlations between nucleotide frequencies at different positions of a binding site. We demonstrate the possibility of rapid adaptive evolution generating a new binding site for a given transcription factor by point mutations. The evolutionary time required is estimated in terms of the neutral (background mutation rate, the selection coefficient, and the effective population size. Conclusions The efficiency of binding site formation is seen to depend on two joint conditions: the binding site motif must be short enough and the promoter region must be long enough. These constraints on promoter architecture are indeed seen in eukaryotic systems. Furthermore, we analyse the adaptive evolution of genetic switches and of signal integration through binding cooperativity between different sites. Experimental tests of this picture involving the statistics of polymorphisms and phylogenies of sites are discussed.

A new approach to the LILW repository site selection

International Nuclear Information System (INIS)

Mele, I.; Zeleznik, N.

1998-01-01

After the failure of site selection, which was performed between 1990-1993, the Agency for Radwaste Management was urged to start a new site selection process for low and intermediate level waste (LILW). Since this is the most sensitive and delicate phase of the whole disposal project extensive analyses of foreign and domestic experiences in siting were performed. Three different models were studied and discussed at a workshop on preparation of the siting procedure for LILW repository. The participants invited to the workshop supported the combined approach, to the site selection, which is presented in this paper.(author)

The respiratory syncytial virus polymerase has multiple RNA synthesis activities at the promoter.

Directory of Open Access Journals (Sweden)

Sarah L Noton

Full Text Available Respiratory syncytial virus (RSV is an RNA virus in the Family Paramyxoviridae. Here, the activities performed by the RSV polymerase when it encounters the viral antigenomic promoter were examined. RSV RNA synthesis was reconstituted in vitro using recombinant, isolated polymerase and an RNA oligonucleotide template representing nucleotides 1-25 of the trailer complement (TrC promoter. The RSV polymerase was found to have two RNA synthesis activities, initiating RNA synthesis from the +3 site on the promoter, and adding a specific sequence of nucleotides to the 3' end of the TrC RNA using a back-priming mechanism. Examination of viral RNA isolated from RSV infected cells identified RNAs initiated at the +3 site on the TrC promoter, in addition to the expected +1 site, and showed that a significant proportion of antigenome RNAs contained specific nucleotide additions at the 3' end, demonstrating that the observations made in vitro reflected events that occur during RSV infection. Analysis of the impact of the 3' terminal extension on promoter activity indicated that it can inhibit RNA synthesis initiation. These findings indicate that RSV polymerase-promoter interactions are more complex than previously thought and suggest that there might be sophisticated mechanisms for regulating promoter activity during infection.

Indigenous microbial capability in solid manure residues to start-up solid-phase anaerobic digesters.

Science.gov (United States)

Yap, S D; Astals, S; Jensen, P D; Batstone, D J; Tait, S

2017-06-01

Batch solid-phase anaerobic digestion is a technology for sustainable on-farm treatment of solid residues, but is an emerging technology that is yet to be optimised with respect to start-up and inoculation. In the present study, spent bedding from two piggeries (site A and B) were batch digested at total solids (TS) concentration of 5, 10 and 20% at mesophilic (37°C) and thermophilic (55°C) temperatures, without adding an external inoculum. The results showed that the indigenous microbial community present in spent bedding was able to recover the full methane potential of the bedding (140±5 and 227±6L CH 4 kgVS fed -1 for site A and B, respectively), but longer treatment times were required than for digestion with an added external inoculum. Nonetheless, at high solid loadings (i.e. TS level>10%), the digestion performance was affected by chemical inhibition due to ammonia and/or humic acid. Thermophilic temperatures did not influence digestion performance but did increase start-up failure risk. Further, inoculation of residues from the batch digestion to subsequent batch enhanced start-up and achieved full methane potential recovery of the bedding. Inoculation with liquid residue (leachate) was preferred over a solid residue, to preserve treatment capacity for fresh substrate. Overall, the study highlighted that indigenous microbial community in the solid manure residue was capable of recovering full methane potential and that solid-phase digestion was ultimately limited by chemical inhibition rather than lack of suitable microbial community. Copyright © 2017 Elsevier Ltd. All rights reserved.

Starting out

NARCIS (Netherlands)

Ans Merens; Freek Bucx

2018-01-01

Original title: Werken aan de start Women in the Netherlands have been outperforming men in education for many years now. However, this superior educational achievement does not translate into a better position on the labour market. More women work today than in the past, but still fewer than men.

Stereospecific suppression of active site mutants by methylphosphonate substituted substrates reveals the stereochemical course of site-specific DNA recombination

OpenAIRE

Rowley, Paul A.; Kachroo, Aashiq H.; Ma, Chien-Hui; Maciaszek, Anna D.; Guga, Piotr; Jayaram, Makkuni

2015-01-01

Tyrosine site-specific recombinases, which promote one class of biologically important phosphoryl transfer reactions in DNA, exemplify active site mechanisms for stabilizing the phosphate transition state. A highly conserved arginine duo (Arg-I; Arg-II) of the recombinase active site plays a crucial role in this function. Cre and Flp recombinase mutants lacking either arginine can be rescued by compensatory charge neutralization of the scissile phosphate via methylphosphonate (MeP) modificati...

Cell-type specific oxytocin gene expression from AAV delivered promoter deletion constructs into the rat supraoptic nucleus in vivo.

Directory of Open Access Journals (Sweden)

Raymond L Fields

Full Text Available The magnocellular neurons (MCNs in the hypothalamus selectively express either oxytocin (OXT or vasopressin (AVP neuropeptide genes, a property that defines their phenotypes. Here we examine the molecular basis of this selectivity in the OXT MCNs by stereotaxic microinjections of adeno-associated virus (AAV vectors that contain various OXT gene promoter deletion constructs using EGFP as the reporter into the rat supraoptic nucleus (SON. Two weeks following injection of the AAVs, immunohistochemical assays of EGFP expression from these constructs were done to determine whether the EGFP reporter co-localizes with either the OXT- or AVP-immunoreactivity in the MCNs. The results show that the key elements in the OT gene promoter that regulate the cell-type specific expression the SON are located -216 to -100 bp upstream of the transcription start site. We hypothesize that within this 116 bp domain a repressor exists that inhibits expression specifically in AVP MCNs, thereby leading to the cell-type specific expression of the OXT gene only in the OXT MCNs.

Composing a Tumor Specific Bacterial Promoter.

Directory of Open Access Journals (Sweden)

Igor V Deyneko

Full Text Available Systemically applied Salmonella enterica spp. have been shown to invade and colonize neoplastic tissues where it retards the growth of many tumors. This offers the possibility to use the bacteria as a vehicle for the tumor specific delivery of therapeutic molecules. Specificity of such delivery is solely depending on promoter sequences that control the production of a target molecule. We have established the functional structure of bacterial promoters that are transcriptionally active exclusively in tumor tissues after systemic application. We observed that the specific transcriptional activation is accomplished by a combination of a weak basal promoter and a strong FNR binding site. This represents a minimal set of control elements required for such activation. In natural promoters, additional DNA remodeling elements are found that alter the level of transcription quantitatively. Inefficiency of the basal promoter ensures the absence of transcription outside tumors. As a proof of concept, we compiled an artificial promoter sequence from individual motifs representing FNR and basal promoter and showed specific activation in a tumor microenvironment. Our results open possibilities for the generation of promoters with an adjusted level of expression of target proteins in particular for applications in bacterial tumor therapy.

Start 2: Thinking one move ahead

Energy Technology Data Exchange (ETDEWEB)

Gaines, L.L.

1991-11-01

At their summit meeting in the spring of 1990, Presidents Bush and Gorbachev issued a joint statement expressing their intentions to continue the process of strategic arms control beyond the Strategic Arms Reduction Treaty (START), which was eventually signed in July 1991, toward agreement on further reductions. They set general goals for negotiation of a follow-on treaty to START, which has been called START II. President Bush`s historic speech on September 27, 1991, reinforced those goals and specified several actions the US would take. It is the purpose of this report to examine possible provisions of START II and the implications of those provisions for achievement of the goals set at the 1990 summit, for verifiability, and for US force planning. This look ahead will contribute to advance planning of appropriate negotiating positions, verification research and development (R&D), and force modernization and restructuring. This report describes the goals for a START II treaty and possible means for achieving them. It postulates one set of provisions for such a treaty, while it examines force structures for the US that could result from adoption of a treaty with these provisions. The adequacy of methods for verifying START II are examined and the implications of a START II treaty are postulated.

Start 2: Thinking one move ahead

Energy Technology Data Exchange (ETDEWEB)

Gaines, L.L.

1991-11-01

At their summit meeting in the spring of 1990, Presidents Bush and Gorbachev issued a joint statement expressing their intentions to continue the process of strategic arms control beyond the Strategic Arms Reduction Treaty (START), which was eventually signed in July 1991, toward agreement on further reductions. They set general goals for negotiation of a follow-on treaty to START, which has been called START II. President Bush's historic speech on September 27, 1991, reinforced those goals and specified several actions the US would take. It is the purpose of this report to examine possible provisions of START II and the implications of those provisions for achievement of the goals set at the 1990 summit, for verifiability, and for US force planning. This look ahead will contribute to advance planning of appropriate negotiating positions, verification research and development (R D), and force modernization and restructuring. This report describes the goals for a START II treaty and possible means for achieving them. It postulates one set of provisions for such a treaty, while it examines force structures for the US that could result from adoption of a treaty with these provisions. The adequacy of methods for verifying START II are examined and the implications of a START II treaty are postulated.

Reactor decommissioning strategy: a new start for BNFL

International Nuclear Information System (INIS)

Woollam, P.; Nurden, P.

2001-01-01

The key points of BNFL Magnox Electric's revised waste management and reactor decommissioning strategy for the reactor sites are enlisted. Reactors will be defuelled as soon as practicable after shutdown. Predominantly Caesium contaminated plant will be dismantled when it is no longer needed. Cobalt contaminated plant such as boilers will remain in position until the reactors are dismantled, but appropriate decontamination technology will be regularly reviewed. All buildings except the reactor buildings will be dismantled as soon as practicable after they are no longer needed. Operational ILW, except some activated components, will be retrieved and packaged during the Care and Maintenance preparation period. All wastes will be stored on site, and handled in the long term in accordance with Government policy. Reactor buildings and their residual contents will be placed in a passive safe storage Care and Maintenance condition in a manner appropriate for the site. Contaminated land will be managed to maintain public safety. The reactors will be finally dismantled in a sequenced programme with a start date and duration to be decided at the appropriate time in the light of circumstances prevalent at that time. Currently, the Company is considering a sequenced programme across all sites, notionally beginning around 100 years from station shutdown, leading to a range of deferral periods. For provisioning purposes, the Company has costed a strategy involving reactor dismantling deferrals ranging from 85 to about 105 years in order to demonstrate prudent provisioning to meet its liabilities. A risk provision to reflect the potential for shorter deferral periods is included in the cost estimates. The end point for reactor decommissioning is site clearance and delicensing, based on the assumption that a reasonably practicable interpretation of the 'no danger' clause in the Nuclear Installations Act 1965 (as amended) can be developed. In line with Government policy, and taking

The prognostic value of the suPARnosticTM ELISA assay in HIV-1 infected individuals is not affected by uPAR promoter polymorphisms

DEFF Research Database (Denmark)

Schneider, Uffe Vest; Nielsen, Rikke Lyngaa; Pedersen, Court

2007-01-01

BACKGROUND: High blood levels of soluble urokinase Plasminogen Activator Receptor (suPAR) are associated with poor outcomes in human immunodeficiency-1 (HIV-1) infected individuals. Research on the clinical value of suPAR in HIV-1 infection led to the development of the suPARnosticTM assay...... for commercial use in 2006. The aim of this study was to: 1) Evaluate the prognostic value of the new suPARnosticTM assay and 2) Determine whether polymorphisms in the active promoter of uPAR influences survival and/or suPAR values in HIV-1 patients who are antiretroviral therapy (ART) naive. METHODS: DNA...... and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART-naive HIV-1 infected...

Early Site Permit Demonstration Program: Recommendations for communication activities and public participation in the Early Site Permit Demonstration Program

Energy Technology Data Exchange (ETDEWEB)

1993-01-27

On October 24, 1992, President Bush signed into law the National Energy Policy Act of 1992. The bill is a sweeping, comprehensive overhaul of the Nation`s energy laws, the first in more than a decade. Among other provisions, the National Energy Policy Act reforms the licensing process for new nuclear power plants by adopting a new approach developed by the US Nuclear Regulatory Commission (NRC) in 1989, and upheld in court in 1992. The NRC 10 CFR Part 52 rule is a three-step process that guarantees public participation at each step. The steps are: early site permit approval; standard design certifications; and, combined construction/operating licenses for nuclear power reactors. Licensing reform increases an organization`s ability to respond to future baseload electricity generation needs with less financial risk for ratepayers and the organization. Costly delays can be avoided because design, safety and siting issues will be resolved before a company starts to build a plant. Specifically, early site permit approval allows for site suitability and acceptability issues to be addressed prior to an organization`s commitment to build a plant. Responsibility for site-specific activities, including communications and public participation, rests with those organizations selected to try out early site approval. This plan has been prepared to assist those companies (referred to as sponsoring organizations) in planning their communications and public involvement programs. It provides research findings, information and recommendations to be used by organizations as a resource and starting point in developing their own plans.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

Science.gov (United States)

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Start-up and operation of Laguna Verde-2

International Nuclear Information System (INIS)

Torres Ramirez, J.F.

1996-01-01

The 665 MWe Laguna Verde-2 nuclear generating unit was accepted into commercial operation on April 10, 1995. The boiling water reactor plant by General Electric (GE) was first synchronized with the grid on November 11, 1994. Laguna Verde-2 is identical with Laguna Verde-1 on the same site. That unit had gone critical for the first time in November 1988 and had first been synchronized with the power grid on April 13, 1989. Commercial operation of Laguna Verde-1 had been started on July 29, 1990. Mexico's only nuclear power plant had been built 70 km north of Veracruz on the east coast and had been scheduled to start operation in 1976. As the Mexican nuclear power program was reduced, the scheduled commissioning dates suffered more and more delays. In the full of 1987, the investigation by the Operational Safety Review Team (Osart) of the International Atomic Energy Agency (IAEA) had indicated that the safety requirements of installations and equpiment were met, and that the whole plant was well prepared for fueling. In mid-1988, the Mexican Government had issued the permit to fuel the Laguna Verde-1 reactor. The contract to build the two units had been awarded in 1972/73. No other nuclear power plants are currently under construction or in the planning phase in Mexico. (orig.) [de

Genome-wide Anaplasma phagocytophilum AnkA-DNA interactions are enriched in intergenic regions and gene promoters and correlate with infection-induced differential gene expression.

Directory of Open Access Journals (Sweden)

J Stephen Dumler

2016-09-01

Full Text Available Anaplasma phagocytophilum, an obligate intracellular prokaryote, infects neutrophils and alters cardinal functions via reprogrammed transcription. Large contiguous regions of neutrophil chromosomes are differentially expressed during infection. Secreted A. phagocytophilum effector AnkA transits into the neutrophil or granulocyte nucleus to complex with DNA in heterochromatin across all chromosomes. AnkA binds to gene promoters to dampen cis-transcription and also has features of matrix attachment region (MAR-binding proteins that regulate three-dimensional chromatin architecture and coordinate transcriptional programs encoded in topologically-associated chromatin domains. We hypothesize that identification of additional AnkA binding sites will better delineate how A. phagocytophilum infection results in reprogramming of the neutrophil genome. Using AnkA-binding ChIP-seq, we showed that AnkA binds broadly throughout all chromosomes in a reproducible pattern, especially at: i intergenic regions predicted to be matrix attachment regions (MARs; ii within predicted lamina-associated domains; and iii at promoters ≤3,000 bp upstream of transcriptional start sites. These findings provide genome-wide support for AnkA as a regulator of cis-gene transcription. Moreover, the dominant mark of AnkA in distal intergenic regions known to be AT-enriched, coupled with frequent enrichment in the nuclear lamina, provides strong support for its role as a MAR-binding protein and genome re-organizer. AnkA must be considered a prime candidate to promote neutrophil reprogramming and subsequent functional changes that belie improved microbial fitness and pathogenicity.

Teaching iSTART to Understand Spanish

Science.gov (United States)

Dascalu, Mihai; Jacovina, Matthew E.; Soto, Christian M.; Allen, Laura K.; Dai, Jianmin; Guerrero, Tricia A.; McNamara, Danielle S.

2017-01-01

iSTART is a web-based reading comprehension tutor. A recent translation of iSTART from English to Spanish has made the system available to a new audience. In this paper, we outline several challenges that arose during the development process, specifically focusing on the algorithms that drive the feedback. Several iSTART activities encourage…

Strategies for effective management of health and safety in confined site construction

Directory of Open Access Journals (Sweden)

John Spillane

2013-12-01

Full Text Available Purpose: The overall aim of this research is to identify and catalogue the numerous managerial strategies for effective management of health and safety on a confined, urban, construction site. Design/Methodology/Approach: This is achieved by utilising individual interviews, focus groups discussion on selected case studies of confined construction sites, coupled with a questionnaire survey. Findings: The top five key strategies include (1 Employ safe system of work plans to mitigate personnel health and safety issues; (2 Inform personnel, before starting on-site, of the potential issues using site inductions; (3 Effective communication among site personnel; (4 Draft and implement an effective design site layout prior to starting on-site; and (5 Use of banksman (traffic co-ordinator to segregate personnel from vehicular traffic. Practical Implication: The construction sector is one of the leading industries in accident causation and with the continued development and regeneration of our urban centres, confined site construction is quickly becoming the norm - an environment which only fuels accident creation within the construction sector. Originality/Value: This research aids on-site management that requires direction and assistance in the identification and implementation of key strategies for the management of health and safety, particularly in confined construction site environments.

Afraid to Start Because the Outcome is Uncertain?: Social Site Characterization as a Tool for Informing Public Engagement Efforts

Science.gov (United States)

Wade, S.; Greenberg, S.

2009-01-01

This paper introduces the concept of social site characterization as a parallel effort to technical site characterization to be used in evaluating and planning carbon dioxides capture and storage (CCS) projects. Social site characterization, much like technical site characterization, relies on a series of iterative investigations into public attitudes towards a CCS project and the factors that will shape those views. This paper also suggests ways it can be used to design approaches for actively engaging stakeholders and communities in the deployment of CCS projects. This work is informed by observing the site selection process for FutureGen and the implementation of research projects under the Regional Carbon Sequestration Partnership Program. ?? 2009 Elsevier Ltd. All rights reserved.

Soft-Starting Power-Factor Motor Controller

Science.gov (United States)

Nola, F. J.

1983-01-01

Three-phase power-factor controller with soft start is based on earlier version that does not control starting transients. Additional components serve to turn off "run" command signal and substitute gradual startup command signal during preset startup interval. Improved controller reduces large current surge that usually accompanies starting. Controller applies power smoothly, without causing motor vibrations.

What Happens at the Lesson Start?

Science.gov (United States)

Saloviita, Timo

2016-01-01

Transitional periods, such as lesson starts, are necessary steps from one activity to another, but they also compete with time for actual learning. The aim of the present study was to replicate a previous pilot study on lesson starts and explore possible disturbances. In total, 130 lesson starts in Finnish basic education in grades 1-9 were…

46 CFR 112.50-3 - Hydraulic starting.

Science.gov (United States)

2010-10-01

... POWER SYSTEMS Emergency Diesel and Gas Turbine Engine Driven Generator Sets § 112.50-3 Hydraulic starting. A hydraulic starting system must meet the following: (a) The hydraulic starting system must be a... 46 Shipping 4 2010-10-01 2010-10-01 false Hydraulic starting. 112.50-3 Section 112.50-3 Shipping...

Architecture and Development of DCMP Web Site

Science.gov (United States)

Bariakhtar, Irina

2003-03-01

The multi-tier implementation of DCMP Web site is discussed. It is based upon newly developed PHP technology. The technology allows for creating dynamic content and scalable solutions for Web site capabilities. There are several aspects as to what type of information is to be on the site. First, it should serve the immediate needs of the researchers in the field, namely, conferences, journals, news, funds, etc. This is currently available on the site, but can be extended and improved if needed. Second, the site will reflect the connection between Condensed matter physics and the technological breakthroughs that drive the economy. Third, the site will carry an educational mission helping educate the general public, and on the other hand, help young people to start their careers in the field. The content of the DCMP Web site is under active development. It depends upon wide involvement of DCMP members.

Transcriptional Inhibition of Matrix Metal loproteinase 9 (MMP-9 Activity by a c-fos/Estrogen Receptor Fusion Protein is Mediated by the Proximal AP-1 Site of the MMP-9 Promoter and Correlates with Reduced Tumor Cell Invasion

Directory of Open Access Journals (Sweden)

David L. Crowe

1999-10-01

Full Text Available Tumor cell invasion of basement membranes is one of the hallmarks of malignant transformation. Tumor cells secrete proteolytic enzymes known as matrix metalloproteinases (MMPs which degrade extracellular matrix molecules. Increased expression of MMP-9 has been associated with acquisition of invasive phenotype in many tumors. However, multiple mechanisms for regulation of MMP-9 gene expression by tumor cell lines have been proposed. A number of transcription factor binding sites have been characterized in the upstream regulatory region of the MMP-9 gene, including those for AP-1. To determine how a specific AP-1 family member, c-fos, regulates MMP-9 promoter activity through these sites, we used an expression vector containing the c-fos coding region fused to the estrogen receptor (ER ligand binding domain. This construct is activated upon binding estradiol. Stable expression of this construct in ER negative squamous cell carcinoma (SCC lines produced an estradiol dependent decrease in the number of cells that migrated through a reconstituted basement membrane. This decreased invasiveness was accompanied by estradiol dependent downregulation of MMP-9 activity as determined by gelatin zymography. Estradiol also produced transcriptional downregulation of an MMP-9 promoter construct in cells transiently transfected with the c-fosER expression vector. This downregulation was mediated by the AP-1 site at —79 by in the MMP-9 promoter. We concluded that the proximal AP-1 site mediated the transcriptional downregulation of the MMP-9 promoter by a conditionally activated c-fos fusion protein.

Epigenetic mismatches with mutated transcribing genes at leukemogenic S-phase binding/start sites--potential targets for therapy with enzyme inhibitors.

Science.gov (United States)

Prindull, Gregor

2012-11-01

This review focuses on gene transcription patterns of leukemogenic S-phases in mitotic cell cycles for identification of enzymatic reactions as potential targets for epigenetics-based drug therapy. Transcription of leukemic genes is triggered by reprogrammed transcription factors (TFs) mediated by chromatin histones. Reprogrammed TFs originate from transcriptional alterations of CpG methylation patterns of mutated epigenetic genes. They preserve memory information of earlier leukemogenic exposures, even transgenerationally via the zygote, through small (e.g. pi)RNA transmitted between cells by exosomes. Normally, reprogrammed TFs are enzymatically silenced and stored as markers in heterochromatic domains. Failure of intra S-phase surveillance (IS) permits the formation and continual operation of DNA replication forks in spite of persisting genotoxic stress. Silenced TFs are re-activated by euchromatin, most likely through leakages of insulator barriers of cis-regulating chromatin modulators (CRM) that normally separate hetero- from euchromatin domains. During transport by sliding nucleosomes, reprogrammed leukemogenic TFs are misplaced at transcription factor binding-/starting-sites (TFBS /TSS) allowing them to interact with and trigger replication of mutated leukemic genes. Interactions of enzymatically reprogrammed TFs, transcribed from mutated epigenetic genes, with replicating leukemic genes at TFBS/TSSs are key driving forces in leukemogenesis. Probably, epigenetic genes, although mutated, still retain their control of replication of leukemic genes. Epigenetics-based enzyme inhibitors must target reprogrammed TFs. Prudently, therapeutic corrections should be introduced within the frame of conventional, cytoreductive treatment protocols. Alternatively, reprogrammed TFs could be replaced by cell populations with regular TF production. Clinically, classification of leukemias should be based on their epigenetic presentation.

Preparatory hydrogeological calculations for site scale models of Aberg, Beberg and Ceberg

International Nuclear Information System (INIS)

Gylling, B.; Lindgren, M.; Widen, H.

1999-03-01

The purpose of the study is to evaluate the basis for site scale models of the three sites Aberg, Beberg and Ceberg in terms of: extent and position of site scale model domains; numerical implementation of geologic structural model; systematic review of structural data and control of compatibility in data sets. Some of the hydrogeological features of each site are briefly described. A summary of the results from the regional modelling exercises for Aberg, Beberg and Ceberg is given. The results from the regional models may be used as a base for determining the location and size of the site scale models and provide such models with boundary conditions. Results from the regional models may also indicate suitable locations for repositories. The resulting locations and sizes for site scale models are presented in figures. There are also figures showing that the structural models interpreted by HYDRASTAR do not conflict with the repository tunnels. It has in addition been verified with TRAZON, a modified version of HYDRASTAR for checking starting positions, revealing conflicts between starting positions and fractures zones if present

Evaluation of the 'healthy start to pregnancy' early antenatal health promotion workshop: a randomized controlled trial

Directory of Open Access Journals (Sweden)

Wilkinson Shelley A

2012-11-01

Full Text Available Abstract Background Pregnancy is an ideal time to encourage healthy lifestyles as most women access health services and are more receptive to health messages; however few effective interventions exist. The aim of this research was to deliver a low-intensity, dietitian-led behavior change workshop at a Maternity Hospital to influence behaviors with demonstrated health outcomes. Methods Workshop effectiveness was evaluated using an RCT; ‘usual care’ women (n = 182 received a nutrition resource at their first antenatal visit and 'intervention' women also attended a one-hour ‘Healthy Start to Pregnancy’ workshop (n = 178. Dietary intake, physical activity levels, gestational weight gain knowledge, smoking cessation, and intention to breastfeed were assessed at service-entry and 12 weeks later. Intention-to-treat (ITT and per-protocol (PP analyses examined change over time between groups. Results Approximately half (48.3% the intervention women attended the workshop and overall response rate at time 2 was 67.2%. Significantly more women in the intervention met pregnancy fruit guidelines at time 2 (+4.3%, p = 0.011 and had a clinically-relevant increase in physical activity (+27 minutes/week compared with women who only received the resource (ITT. Women who attended the workshop increased their consumption of serves of fruit (+0.4 serves/day, p = 0.004, vegetables (+0.4 serves/day, p = 0.006, met fruit guidelines (+11.9%, p , had a higher diet quality score (p = 0.027 and clinically-relevant increases in physical activity (+21.3 minutes/week compared with those who only received the resource (PP. Conclusions The Healthy Start to Pregnancy workshop attendance facilitates improvements in important health behaviors. Service changes and accessibility issues are required to assist women's workshop attendance to allow more women to benefit from the workshop’s effects. Trial registration Australian New Zealand Clinical Trials Registry ACTRN

The Hanford Site: An anthology of early histories

Energy Technology Data Exchange (ETDEWEB)

Gerber, M.S.

1993-10-01

This report discusses the following topics: Memories of War: Pearl Harbor and the Genesis of the Hanford Site; safety has always been promoted at the Hanford Site; women have an important place in Hanford Site history; the boom and bust cycle: A 50-year historical overview of the economic impacts of Hanford Site Operations on the Tri-Cities, Washington; Hanford`s early reactors were crucial to the sites`s history; T-Plant made chemical engineering history; the UO{sub 3} plant has a long history of service. PUREX Plant: the Hanford Site`s Historic Workhorse. PUREX Plant Waste Management was a complex challenge; and early Hanford Site codes and jargon.

Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

Science.gov (United States)

Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

2017-10-01

PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

Polymorphism in the PER3 promoter associates with diurnal preference and delayed sleep phase disorder.

Science.gov (United States)

Archer, Simon N; Carpen, Jayshan D; Gibson, Mark; Lim, Gim Hui; Johnston, Jonathan D; Skene, Debra J; von Schantz, Malcolm

2010-05-01

To screen the PER3 promoter for polymorphisms and investigate the phenotypic associations of these polymorphisms with diurnal preference, delayed sleep phase disorder/syndrome (DSPD/DSPS), and their effects on reporter gene expression. Interspecific comparison was used to define the approximate extent of the PER3 promoter as the region between the transcriptional start site and nucleotide position -874. This region was screened in DNA pools using PCR and direct sequencing, which was also used to screen DNA from individual participants. The different promoter alleles were cloned into a luciferase expression vector and a deletion library created. Promoter activation was measured by chemiluminescence. N/A. DNA samples were obtained from volunteers with defined diurnal preference (3 x 80, selected from a pool of 1,590), and DSPD patients (n=23). N/A. We verified three single nucleotide polymorphisms (G -320T, C -319A, G -294A), and found a novel variable number tandem repeat (VNTR) polymorphism (-318 1/2 VNTR). The -320T and -319A alleles occurred more frequently in DSPD compared to morning (P = 0.042 for each) or evening types (P = 0.006 and 0.033). The allele combination TA2G was more prevalent in DSPD compared to morning (P 0.033) or evening types (P = 0.002). Luciferase expression driven by the TA2G combination was greater than for the more common GC2A (P < 0.05) and the rarer TA1G (P < 0.001) combinations. Deletion reporter constructs identified two enhancer regions (-703 to -605, and -283 to -80). Polymorphisms in the PER3 promoter could affect its expression, leading to potential differences in the observed functions of PER3.

Readiness to Change Over Time: Change Commitment and Change Efficacy in a Workplace Health-Promotion Trial.

Science.gov (United States)

Helfrich, Christian D; Kohn, Marlana J; Stapleton, Austin; Allen, Claire L; Hammerback, Kristen Elizabeth; Chan, K C Gary; Parrish, Amanda T; Ryan, Daron E; Weiner, Bryan J; Harris, Jeffrey R; Hannon, Peggy A

2018-01-01

Organizational readiness to change may be a key determinant of implementation success and a mediator of the effectiveness of implementation interventions. If organizational readiness can be reliably and validly assessed at the outset of a change initiative, it could be used to assess the effectiveness of implementation-support activities by measuring changes in readiness factors over time. We analyzed two waves of readiness-to-change survey data collected as part of a three-arm, randomized controlled trial to implement evidence-based health promotion practices in small worksites in low-wage industries. We measured five readiness factors: context (favorable broader conditions); change valence (valuing health promotion); information assessment (demands and resources to implement health promotion); change commitment (an intention to implement health promotion); and change efficacy (a belief in shared ability to implement health promotion). We expected commitment and efficacy to increase at intervention sites along with their self-reported effort to implement health promotion practices, termed wellness-program effort. We compared means between baseline and 15 months, and between intervention and control sites. We used linear regression to test whether intervention and control sites differed in their change-readiness scores over time. Only context and change commitment met reliability thresholds. Change commitment declined significantly for both control (-0.39) and interventions sites (-0.29) from baseline to 15 months, while context did not change for either. Only wellness program effort at 15 months, but not at baseline, differed significantly between control and intervention sites (1.20 controls, 2.02 intervention). Regression analyses resulted in two significant differences between intervention and control sites in changes from baseline to 15 months: (1) intervention sites exhibited significantly smaller change in context scores relative to control sites

Readiness to Change Over Time: Change Commitment and Change Efficacy in a Workplace Health-Promotion Trial

Directory of Open Access Journals (Sweden)

Christian D. Helfrich

2018-04-01

Full Text Available IntroductionOrganizational readiness to change may be a key determinant of implementation success and a mediator of the effectiveness of implementation interventions. If organizational readiness can be reliably and validly assessed at the outset of a change initiative, it could be used to assess the effectiveness of implementation-support activities by measuring changes in readiness factors over time.MethodsWe analyzed two waves of readiness-to-change survey data collected as part of a three-arm, randomized controlled trial to implement evidence-based health promotion practices in small worksites in low-wage industries. We measured five readiness factors: context (favorable broader conditions; change valence (valuing health promotion; information assessment (demands and resources to implement health promotion; change commitment (an intention to implement health promotion; and change efficacy (a belief in shared ability to implement health promotion. We expected commitment and efficacy to increase at intervention sites along with their self-reported effort to implement health promotion practices, termed wellness-program effort. We compared means between baseline and 15 months, and between intervention and control sites. We used linear regression to test whether intervention and control sites differed in their change-readiness scores over time.ResultsOnly context and change commitment met reliability thresholds. Change commitment declined significantly for both control (−0.39 and interventions sites (−0.29 from baseline to 15 months, while context did not change for either. Only wellness program effort at 15 months, but not at baseline, differed significantly between control and intervention sites (1.20 controls, 2.02 intervention. Regression analyses resulted in two significant differences between intervention and control sites in changes from baseline to 15 months: (1 intervention sites exhibited significantly smaller change in

High Time Resolution Measurements of VOCs from Vehicle Cold Starts: The Air Toxic Cold Start Pulse

Science.gov (United States)

Jobson, B. T.; Huangfu, Y.; Vanderschelden, G. S.

2017-12-01

Pollutants emitted during motor vehicle cold starts, especially in winter in some climates, is a significant source of winter time air pollution. While data exist for CO, NO, and total hydrocarbon emissions from federal testing procedures for vehicle emission certification, little is known about the emission rates of individual volatile organic compounds, in particular the air toxics benzene, formaldehyde, and acetaldehyde. Little is known about the VOC speciation and temperature dependence for cold starts. The US EPA vehicle emission model MOVES assumes that cold start emissions have the same speciation profile as running emissions. We examined this assumption by measuring cold start exhaust composition for 4 vehicles fueled with E10 gasoline over a temperature range of -4°C to 10°C in winter of 2015. The extra cold start emissions were determined by comparison with emissions during engine idling. In addition to CO and NOx measurements a proton transfer reaction mass spectrometer was used to measure formaldehyde, acetaldehyde, benzene, toluene, and C2-alkylbenzenes at high time resolution to compare with the cold start emission speciation profiles used in the EPA MOVES2014 model. The results show that after the vehicle was started, CO mixing ratios can reach a few percent of the exhaust and then drop to several ppmv within 2 minutes of idling, while NOx showed different temporal behaviors among the four vehicles. VOCs displayed elevated levels during cold start and the peak mixing ratios can be two orders higher than idling phase levels. Molar emission ratios relative to toluene were used to compare with the emission ratio used in MOVES2014 and we found the formaldehyde-to-toluene emission ratio was about 0.19, which is 5 times higher than the emission ratio used in MOVES2014 and the acetaldehyde-to-toluene emission ratios were 0.86-0.89, which is 8 times higher than the ones in MOVES2014. The C2-alkylbenzene-to-toluene ratio agreed well with moves. Our results

Scheduling with target start times

NARCIS (Netherlands)

Hoogeveen, J.A.; Velde, van de S.L.; Klein Haneveld, W.K.; Vrieze, O.J.; Kallenberg, L.C.M.

1997-01-01

We address the single-machine problem of scheduling n independent jobs subject to target start times. Target start times are essentially release times that may be violated at a certain cost. The goal is to minimize an objective function that is composed of total completion time and maximum

Banking Time in Head Start: Early Efficacy of an Intervention Designed to Promote Supportive Teacher-Child Relationships

Science.gov (United States)

Driscoll, Katherine C.; Pianta, Robert C.

2010-01-01

Research Findings: This exploratory study encompassed a collaboration to implement and evaluate the early efficacy of Banking Time, a dyadic intervention designed to promote supportive teacher-child relationships. Banking Time is a set of one-on-one meetings between a teacher and a child consisting of child-led play and teacher facilitation…

Histone Deacetylase Inhibition Promotes Osteoblast Maturation by Altering the Histone H4 Epigenome and Reduces Akt Phosphorylation*

Science.gov (United States)

Dudakovic, Amel; Evans, Jared M.; Li, Ying; Middha, Sumit; McGee-Lawrence, Meghan E.; van Wijnen, Andre J.; Westendorf, Jennifer J.

2013-01-01

Bone has remarkable regenerative capacity, but this ability diminishes during aging. Histone deacetylase inhibitors (HDIs) promote terminal osteoblast differentiation and extracellular matrix production in culture. The epigenetic events altered by HDIs in osteoblasts may hold clues for the development of new anabolic treatments for osteoporosis and other conditions of low bone mass. To assess how HDIs affect the epigenome of committed osteoblasts, MC3T3 cells were treated with suberoylanilide hydroxamic acid (SAHA) and subjected to microarray gene expression profiling and high-throughput ChIP-Seq analysis. As expected, SAHA induced differentiation and matrix calcification of osteoblasts in vitro. ChIP-Seq analysis revealed that SAHA increased histone H4 acetylation genome-wide and in differentially regulated genes, except for the 500 bp upstream of transcriptional start sites. Pathway analysis indicated that SAHA increased the expression of insulin signaling modulators, including Slc9a3r1. SAHA decreased phosphorylation of insulin receptor β, Akt, and the Akt substrate FoxO1, resulting in FoxO1 stabilization. Thus, SAHA induces genome-wide H4 acetylation and modulates the insulin/Akt/FoxO1 signaling axis, whereas it promotes terminal osteoblast differentiation in vitro. PMID:23940046

Increased sensitivity of transforming growth factor (TGF) beta 1 null cells to alkylating agents reveals a novel link between TGFbeta signaling and O(6)-methylguanine methyltransferase promoter hypermethylation.

Science.gov (United States)

Yamada, H; Vijayachandra, K; Penner, C; Glick, A

2001-06-01

Inactivation of the transforming growth factor beta (TGFbeta)-signaling pathway and gene silencing through hypermethylation of promoter CpG islands are two frequent alterations in human and experimental cancers. Here we report that nonneoplastic TGFbeta1-/- keratinocyte cell lines exhibit increased sensitivity to cell killing by alkylating agents, and this is due to lack of expression of the DNA repair enzyme O(6)-methylguanine DNA methyltransferase (MGMT). In TGFbeta1-/- but not TGFbeta1+/- cell lines, the CpG dinucleotides in the MGMT promoter are hypermethylated, as measured by restriction enzyme analysis and methylation specific polymerase chain reaction. In one unstable TGFbeta1+/- cell line, loss of the wild type TGFbeta1 allele correlates with the appearance of methylation in the MGMT promoter. Bisulfite sequencing shows that in the KO3 TGFbeta1-/- cell line nearly all of the 28 CpG sites in the MGMT promoter 475 base pairs upstream of the start site of transcription are methylated, whereas most are unmethylated in the H1 TGFbeta1+/- line. Treatment of the TGFbeta1-/- cell lines with 5-azacytidine causes reexpression of MGMT mRNA and demethylation of CpG islands in the promoter. Analysis of the time course of methylation using methylation-specific polymerase chain reaction shows a lack of methylation in primary TGFbeta1-/- keratinocytes and increasing methylation with passage number of immortalized clones. Subcloning of early passage clones reveals a remarkable heterogeneity and instability of the methylation state in the TGFbeta1-/- keratinocytes. Thus, the TGFbeta1-/- genotype does not directly regulate MGMT methylation but predisposes cells to immortalization-associated MGMT hypermethylation.

Application of intelligent soft start in asynchronous motor

Science.gov (United States)

Du, Xue; Ye, Ying; Wang, Yuelong; Peng, Lei; Zhang, Suying

2018-05-01

The starting way of three phase asynchronous motor has full voltage start and step-down start. Direct starting brings large current impact, causing excessive local temperature to the power grid and larger starting torque will also impact the motor equipment and affect the service life of the motor. Aim at the problem of large current and torque caused by start-up, an intelligent soft starter is proposed. Through the application of intelligent soft start on asynchronous motor, highlights its application advantage in motor control.

Data in support of FSH induction of IRS-2 in human granulosa cells: Mapping the transcription factor binding sites in human IRS-2 promoter

Directory of Open Access Journals (Sweden)

Surleen Kaur

2016-03-01

Full Text Available Insulin receptor substrate-2 (IRS-2 plays critical role in the regulation of various metabolic processes by insulin and IGF-1. The defects in its expression and/or function are linked to diseases like polycystic ovary syndrome (PCOS, insulin resistance and cancer. To predict the transcription factors (TFs responsible for the regulation of human IRS-2 gene expression, the transcription factor binding sites (TFBS and the corresponding TFs were investigated by analysis of IRS-2 promoter sequence using MatInspector Genomatix software (Cartharius et al., 2005 [1]. The ibid data is part of author׳s publication (Anjali et al., 2015 [2] that explains Follicle stimulating hormone (FSH mediated IRS-2 promoter activation in human granulosa cells and its importance in the pathophysiology of PCOS. Further analysis was carried out for binary interactions of TF regulatory genes in IRS-2 network using Cytoscape software tool and R-code. In this manuscript, we describe the methodology used for the identification of TFBSs in human IRS-2 promoter region and provide details on experimental procedures, analysis method, validation of data and also the raw files. The purpose of this article is to provide the data on all TFBSs in the promoter region of human IRS-2 gene as it has the potential for prediction of the regulation of IRS-2 gene in normal or diseased cells from patients with metabolic disorders and cancer. Keywords: IRS-2, TFBS, FSH, SP1, ChIP

De-escalatory confidence-building measures after START

International Nuclear Information System (INIS)

Stockton, P.N.

1992-01-01

The very notion of examining de-escalatory CBMs in the context of the START negotiations appears odd. Given the immense progress in US-Soviet relations, of which the proposed START agreement is emblematic, the risk of the two nations stumbling to the brink of war seems increasingly remote. Why bother analyzing CBMs designed to help resolve such an improbable event? The obvious answer is that relations between the US and the Soviet Union - or whatever array of nations succeed it - could take an unforeseeable turn for the worse. Once ratified, the START agreement is supposed to remain in force for seven years, more than enough time for political tensions to return with a vengeance. This suggests a more prudent question: if our two nations do stumble to the brink of war, will the START agreement affect the prospect of de-escalatory CBMs? And if the US and Soviet Union pursue deeper force-reductions in a follow-on START II agreement, could that agreement be designed to facilitate more effective de-escalatory measures? This paper sets the stage for addressing such questions by outlining the START agreement and offering a brief overview of how START might affect the prospects for CBMs. Then, after examining some specific CBM proposals in light of START, an analysis will be made of the de-escalatory problems and opportunities that a Start II treaty might create

Recombinational micro-evolution of functionally different metallothionein promoter alleles from Orchesella cincta

Directory of Open Access Journals (Sweden)

van Straalen Nico M

2007-06-01

Full Text Available Abstract Background Metallothionein (mt transcription is elevated in heavy metal tolerant field populations of Orchesella cincta (Collembola. This suggests that natural selection acts on transcriptional regulation of mt in springtails at sites where cadmium (Cd levels in soil reach toxic values This study investigates the nature and the evolutionary origin of polymorphisms in the metallothionein promoter (pmt and their functional significance for mt expression. Results We sequenced approximately 1600 bp upstream the mt coding region by genome walking. Nine pmt alleles were discovered in NW-European populations. They differ in the number of some indels, consensus transcription factor binding sites and core promoter elements. Extensive recombination events between some of the alleles can be inferred from the alignment. A deviation from neutral expectations was detected in a cadmium tolerant population, pointing towards balancing selection on some promoter stretches. Luciferase constructs were made from the most abundant alleles, and responses to Cd, paraquat (oxidative stress inducer and moulting hormone were studied in cell lines. By using paraquat we were able to dissect the effect of oxidative stress from the Cd specific effect, and extensive differences in mt induction levels between these two stressors were observed. Conclusion The pmt alleles evolved by a number of recombination events, and exhibited differential inducibilities by Cd, paraquat and molting hormone. In a tolerant population from a metal contaminated site, promoter allele frequencies differed significantly from a reference site and nucleotide polymorphisms in some promoter stretches deviated from neutral expectations, revealing a signature of balancing selection. Our results suggest that the structural differences in the Orchesella cincta metallothionein promoter alleles contribute to the metallothionein -over-expresser phenotype in cadmium tolerant populations.

Two distinct promoters drive transcription of the human D1A dopamine receptor gene.

Science.gov (United States)

Lee, S H; Minowa, M T; Mouradian, M M

1996-10-11

The human D1A dopamine receptor gene has a GC-rich, TATA-less promoter located upstream of a small, noncoding exon 1, which is separated from the coding exon 2 by a 116-base pair (bp)-long intron. Serial 3'-deletions of the 5'-noncoding region of this gene, including the intron and 5'-end of exon 2, resulted in 80 and 40% decrease in transcriptional activity of the upstream promoter in two D1A-expressing neuroblastoma cell lines, SK-N-MC and NS20Y, respectively. To investigate the function of this region, the intron and 245 bp at the 5'-end of exon 2 were investigated. Transient expression analyses using various chloramphenicol acetyltransferase constructs showed that the transcriptional activity of the intron is higher than that of the upstream promoter by 12-fold in SK-N-MC cells and by 5.5-fold in NS20Y cells in an orientation-dependent manner, indicating that the D1A intron is a strong promoter. Primer extension and ribonuclease protection assays revealed that transcription driven by the intron promoter is initiated at the junction of intron and exon 2 and at a cluster of nucleotides located 50 bp downstream from this junction. The same transcription start sites are utilized by the chloramphenicol acetyltransferase constructs employed in transfections as well as by the D1A gene expressed within the human caudate. The relative abundance of D1A transcripts originating from the upstream promoter compared with those transcribed from the intron promoter is 1.5-2.9 times in SK-N-MC cells and 2 times in the human caudate. Transcript stability studies in SK-N-MC cells revealed that longer D1A mRNA molecules containing exon 1 are degraded 1.8 times faster than shorter transcripts lacking exon 1. Although gel mobility shift assay could not detect DNA-protein interaction at the D1A intron, competitive co-transfection using the intron as competitor confirmed the presence of trans-acting factors at the intron. These data taken together indicate that the human D1A gene has

Sequence elements controlling expression of Barley stripe mosaic virus subgenomic RNAs in vivo

International Nuclear Information System (INIS)

Johnson, Jennifer A.; Bragg, Jennifer N.; Lawrence, Diane M.; Jackson, Andrew O.

2003-01-01

Barley stripe mosaic virus (BSMV) contains three positive-sense, single-stranded genomic RNAs, designated α, β, and γ, that encode seven major proteins and one minor translational readthrough protein. Three proteins (αa, βa, and γa) are translated directly from the genomic RNAs and the remaining proteins encoded on RNAβ and RNAγ are expressed via three subgenomic messenger RNAs (sgRNAs). sgRNAβ1 directs synthesis of the triple gene block 1 (TGB1) protein. The TGB2 protein, the TGB2' minor translational readthrough protein, and the TGB3 protein are expressed from sgRNAβ2, which is present in considerably lower abundance than sgRNAβ1. A third sgRNA, sgRNAγ, is required for expression of the γb protein. We have used deletion analyses and site-specific mutations to define the boundaries of promoter regions that are critical for expression of the BSMV sgRNAs in infected protoplasts. The results reveal that the sgRNAβ1 promoter encompasses positions -29 to -2 relative to its transcription start site and is adjacent to a cis-acting element required for RNAβ replication that maps from -107 to -74 relative to the sgRNAβ1 start site. The core sgRNAβ2 promoter includes residues -32 to -17 relative to the sgRNAβ2 transcriptional start site, although maximal activity requires an upstream hexanucleotide sequence residing from positions -64 to -59. The sgRNAγ promoter maps from -21 to +2 relative to its transcription start site and therefore partially overlaps the γa gene. The sgRNAβ1, β2, and γ promoters also differ substantially in sequence, but have similarities to the putative homologous promoters of other Hordeiviruses. These differences are postulated to affect competition for the viral polymerase, coordination of the temporal expression and abundance of the TGB proteins, and constitutive expression of the γb protein

Barriers to promote cardiovascular health in community pharmacies: a systematic review.

Science.gov (United States)

Alonso-Perales, María Del Mar; Lasheras, Berta; Beitia, Guadalupe; Beltrán, Idoia; Marcos, Beatriz; Núñez-Córdoba, Jorge M

2017-06-01

Community pharmacists play an important role in the provision of health promotion services, and community pharmacies are considered as a potentially ideal site for cardiovascular health promotion. Information based on a systematic review of barriers to promoting cardiovascular health in community pharmacy is currently lacking. We have sought to identify the most important barriers to cardiovascular health promotion in the community pharmacy. We have systematically searched PubMed and International Pharmaceutical Abstracts for a period of 15 years from 1 April 1998 to 1 April 2013, contacted subject experts and hand-searched bibliographies. We have included peer-reviewed articles, with English abstracts in the analysis, if they reported community pharmacists' perceptions of the barriers to cardiovascular health promotion activities in a community pharmacy setting. Two reviewers have independently extracted study characteristics and data. We identified 24 studies that satisfy the eligibility criteria. The main barriers to cardiovascular health promotion in the community pharmacy included pharmacist-related factors; practice site factors; financial factors; legal factors; and patient-related factors. This review will help to provide reliable evidence for health promotion practitioners of the barriers to promoting cardiovascular health in the community pharmacy setting. This knowledge is valuable for the improvement of cardiovascular health promotion in this setting and guiding future research. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

46 CFR 112.50-7 - Compressed air starting.

Science.gov (United States)

2010-10-01

... 46 Shipping 4 2010-10-01 2010-10-01 false Compressed air starting. 112.50-7 Section 112.50-7... air starting. A compressed air starting system must meet the following: (a) The starting, charging... air compressors addressed in paragraph (c)(3)(i) of this section. (b) The compressed air starting...

The Hanford Site: An anthology of early histories

International Nuclear Information System (INIS)

Gerber, M.S.

1993-10-01

This report discusses the following topics: Memories of War: Pearl Harbor and the Genesis of the Hanford Site; safety has always been promoted at the Hanford Site; women have an important place in Hanford Site history; the boom and bust cycle: A 50-year historical overview of the economic impacts of Hanford Site Operations on the Tri-Cities, Washington; Hanford's early reactors were crucial to the sites's history; T-Plant made chemical engineering history; the UO 3 plant has a long history of service. PUREX Plant: the Hanford Site's Historic Workhorse. PUREX Plant Waste Management was a complex challenge; and early Hanford Site codes and jargon

Step sites in syngas catalysis

DEFF Research Database (Denmark)

Rostrup-Nielsen, J.; Nørskov, Jens Kehlet

2006-01-01

Step sites play an important role in many catalytic reactions. This paper reviews recent results on metal catalysts for syngas reactions with emphasis on steam reforming. Modern characterization techniques (STEM, HREM...) and theoretical calculations (DFT) has allowed a more quantitative explanat......Step sites play an important role in many catalytic reactions. This paper reviews recent results on metal catalysts for syngas reactions with emphasis on steam reforming. Modern characterization techniques (STEM, HREM...) and theoretical calculations (DFT) has allowed a more quantitative...... explanation of the impact of step sites on catalyst activity and side reactions such as carbon formation. This leads to a discussion of principles for catalyst promotion....

Technological start of T-15 tokamak. The start-up diagnostic complex

International Nuclear Information System (INIS)

Notkin, G.E.

1989-01-01

The T-15 tokamak with superconducting toroidal winding reached the technological start-up phase. The results of the first operating tests of the main tokamak components are reported. Due to improper function of both the vacuum and the cryogenic system, the nominal parameters of the vacuum and of the toroidal magnetic field have not been achieved. The non-optimum vacuum conditions made the discharge start-up difficult even when a pre-ionizing electron beam and a gyrotron generator were used. The pre-discharge plasma parametes were studied by means of a limited set of plasma diagnostic apparatus. Due to substantially deteriorated vacuum conditions, it was not possible to repeat the only one successful discharge with a current of 100 kA, lasting for 50 ms. (J.U.)

Tissue specific promoters improve the localization of radiation-inducible gene expression

International Nuclear Information System (INIS)

Hallahan, Dennis; Kataoka, Yasushi; Kuchibhotla, Jaya; Virudachalam, Subbu; Weichselbaum, Ralph

1996-01-01

Purpose: Site-specific activation of gene expression can be achieved by the use of a promoter that is induced by physical agents such as x-rays. The purpose of the present study was to determine whether site-specific activation of gene therapy can also be achieved within the vascular endothelium by use of radiation-inducible promoters. We studied induction of promoter-reporter gene constructs using previously identified radiation-promoters from c-jun, c-fos, Egr-1, ICAM-1, ELAM-1 after transfection into in the vascular endothelium. Methods: The following radiation-inducible genetic constructs were created: The ELAM-1 promoter fragment was cloned into pOGH to obtain the pE-sel(-587 +35)GH reporter construct. The ICAM-1 promoter fragment (-1162/+1) was cloned upstream of the CAT coding region of the pCAT-plasmid (Promega) after removal of the SV40 promoter by Bgl2/Stu1 digestion to create the pBS-CAT plasmid. The 132 to +170 bp segment of the 5' untranslated region of the c-jun promoter was cloned to the CAT reporter gene to create the -132/+170 cjun-CAT. The Egr-1 promoter fragment (-425/+75) was cloned upstream of the CAT coding region to create the pE425-CAT plasmid. Tandem repeats of the AP-1 binding site were cloned upstream of the CAT coding region (3 xTRE-CAT). Tandem repeats of the Egr binding site (EBS) were cloned upstream of the CAT coding region (EBS-CAT). Human vascular endothelial cells from both large vessel and small vessel origin (HUVEC and HMEC), as well as human tumor cell lines were transfected with plasmids -132/+170 cjun-CAT, pE425-CAT, 3 xTRE-CAT, EBS-CAT, pE-sel-GH and pBS-CAT by use of liposomes. Humor tumor cell lines included SQ20B (squamous), RIT3 (sarcoma), and HL525 (leukemia). Each plasmid was cotransfected with a plasmid containing a CMV promoter linked to the LacZ gene (1 μg). Transfected cells were treated with mock irradiation or x-rays. Cell extracts were assayed for reporter gene expression. Results: Radiation-induced gene

New concept of siting in the 21st century

International Nuclear Information System (INIS)

Nakayama, Katsuma; Otsubo, Fumiharu; Kumagai, Shigeru

1995-01-01

The New Concept of Siting in the 21st Century -- the theme of this paper -- is the concept of a new siting technology which combines the application of man - made islands (offshore), underground (steep mountains along the sea), and quaternary ground with the symbiosis with local communities. It is intended not only for promotion of the construction of nuclear power plants but also for the development of a 'new community', including the inducement of enterprises to the construction site and the promotion of new industries at the site. In studying the new concept, it is necessary to select model areas, discuss design and construction methods, and make a rough calculation of construction cost. In addition, we plan to estimate economic effects of the new concept on the construction site area. During 1993, we discussed appropriate physical conditions (topographic feature, geological structure, etc.) and geographical conditions (population density, national parks, fishing right, etc.) for the application of the siting technology giving consideration to the concept symbiosis with local communities. At present, the estimations of construction cost and future effects of new siting technology on local communities are carried on to study the new concept of siting in the 21st century. (author)

Precision agriculture - from mapping to site-specific application

DEFF Research Database (Denmark)

Pedersen, Søren Marcus; Lind, Kim Martin Hjorth

2017-01-01

of each chapter in the book. Each chapter address a different topic starting with an overview of technologies that are currently available, followed by specific Variable-Rate Technologies such as VRT fertilizer application, VRT pesticide application, site-specific irrigation management, Auto...

In silico Analysis of osr40c1 Promoter Sequence Isolated from Indica Variety Pokkali

OpenAIRE

W.S.I. de Silva; M.M.N. Perera; K.L.N.S. Perera; A.M. Wickramasuriya; G.A.U. Jayasekera

2017-01-01

The promoter region of a drought and abscisic acid (ABA) inducible gene, osr40c1, was isolated from a salt-tolerant indica rice variety Pokkali, which is 670 bp upstream of the putative translation start codon. In silico promoter analysis of resulted sequence showed that at least 15 types of putative motifs were distributed within the sequence, including two types of common promoter elements, TATA and CAAT boxes. Additionally, several putative cis-acing regulatory elements which may be involv...

Start Later, Sleep Later: School Start Times and Adolescent Sleep in Homeschool vs. Public/Private School Students

Science.gov (United States)

Meltzer, Lisa J.; Shaheed, Keisha; Ambler, Devon

2014-01-01

Homeschool students provide a naturalistic comparison group for later/flexible school start times. This study compared sleep patterns and sleep hygiene for homeschool students and public/private school students (grades 6-12). Public/private school students (n=245) and homeschool students (n=162) completed a survey about sleep patterns and sleep hygiene. Significant school group differences were found for weekday bedtime, wake time, and total sleep time, with homeschool students waking later and obtaining more sleep. Homeschool students had later school start times, waking at the same time that public/private school students were starting school. Public/private school students had poorer sleep hygiene practices, reporting more homework and use of technology in the hour before bed. Regardless of school type, technology in the bedroom was associated with shorter sleep duration. Later school start times may be a potential countermeasure for insufficient sleep in adolescents. Future studies should further examine the relationship between school start times and daytime outcomes, including academic performance, mood, and health. PMID:25315902

Milestones in Nordic Health Promotion research.

Science.gov (United States)

Haglund, Bo J A; Tillgren, Per

2018-02-01

Based on the storytelling tradition and analyses of conference material, this article provides an overview of the evolving Nordic Health Promotion Research Network (NHPRN) and its conferences over the last 20 years. The story goes from the planning of the first conference in Bergen, Norway, back in 1996 to the eighth conference in Jyväskylä, Finland, in 2016. There have been three phases of development. During the first phase, 1996-2007, the five first conferences were initiated and implemented by departments of public health in the Nordic countries. The World Health Organization (WHO) collaborative centres of Health Promotion in Bergen University and a group at Karolinska Institute, Department of Social Medicine, creating supportive environments for health in Stockholm played key roles in initiating and supporting NHPRN. During the second phase, 2007-2014, the network was strengthened and supported by the Nordic School of Public Health (NHV) in Gothenburg. The third phase started when NHV closed down in 2015 and networking activities were transferred to the European Office of WHO in Copenhagen. The Nordic Health Promotion Research Conference series has served several purposes and will continue to do so. They are important Nordic meeting places, stimulating Health Promotion research, as well as explicitly managing ongoing concerns in the international Health Promotion community. This is reflected in the shift of foci over time. The content of the conferences has been highly responsive to whatever challenges are particularly relevant at different points in time, while also contributing to developing Health Promotion as a discipline, given that every conference has built on the previous ones.

Nevada Test Site closure program

International Nuclear Information System (INIS)

Shenk, D.P.

1994-08-01

This report is a summary of the history, design and development, procurement, fabrication, installation and operation of the closures used as containment devices on underground nuclear tests at the Nevada Test Site. It also addresses the closure program mothball and start-up procedures. The Closure Program Document Index and equipment inventories, included as appendices, serve as location directories for future document reference and equipment use

Determining the marketing mix for a start-up travel agency aimed at the Belgian market

OpenAIRE

Hanák, Marek

2014-01-01

This thesis suggests a marketing mix consisting of 4 P's for a start-up travel agency. It created a product according to the quantitative research, n=140, and a qualitative research on the Belgian market. It includes the price of the product according to a competitor analysis, price expectation of the segment and a calculation of all costs connected with providing the service. It suggests also a promotion strategy aimed at the target audience and describes the place in terms point of sale ded...

Characteristics of Food Industry Web Sites and "Advergames" Targeting Children

Science.gov (United States)

Culp, Jennifer; Bell, Robert A.; Cassady, Diana

2010-01-01

Objective: To assess the content of food industry Web sites targeting children by describing strategies used to prolong their visits and foster brand loyalty; and to document health-promoting messages on these Web sites. Design: A content analysis was conducted of Web sites advertised on 2 children's networks, Cartoon Network and Nickelodeon. A…

Fresh Start, a postpartum weight loss intervention for diverse low-income women: design and methods for a randomized clinical trial

Directory of Open Access Journals (Sweden)

Milagros C. Rosal

2016-09-01

Full Text Available Abstract Background Overweight and obesity are prevalent among young women and are greater among minority and low-income women. The postpartum period is critical in women’s weight trajectories as many women do not lose their pregnancy weight, and others lose some and then plateau or experience weight gain. Excess weight puts women at greater risk of chronic disease and thus weight loss in the postpartum period may be key to the long-term health of young women. This paper describes the design and methods of a randomized clinical trial of Fresh Start, an innovative narrative-based group intervention aimed at promoting postpartum weight loss among low-income, diverse women. Methods/design Study participants were recruited from the five sites of the Women, Infants and Children (WIC program in central Massachusetts. Participants were English-speaking, age ≥ 18 years, 6 weeks to 6 months postpartum, with a body mass index (BMI ≥ 27 kg/m2. The Fresh Start postpartum weight loss intervention, adapted from the Diabetes Prevention Program (DPP in collaboration with WIC staff and clients, consisted of an 8-week group-based curriculum followed by nine monthly telephone calls. It included a narrative component (i.e., storytelling, group discussions, print materials and access to exercise facilities. The study is a two-arm randomized controlled trial. The control condition included print materials and access to exercise facilities. In-person assessments were conducted at baseline and at 6 and 12 months following the eight-week intervention phase. Discussion The Fresh Start intervention translated key elements of an evidence-based weight loss protocol into a format that is hypothesized to be relevant, acceptable and effective for the target audience of low-SES postpartum women. This novel intervention was developed in collaboration with WIC to be sustainable within the context of its clinics, which reach approximately 9 million individuals

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

A healthy school start - Parental support to promote healthy dietary habits and physical activity in children: Design and evaluation of a cluster-randomised intervention

Directory of Open Access Journals (Sweden)

Elinder Liselotte

2011-03-01

Full Text Available Abstract Background Childhood obesity is multi-factorial and determined to a large extent by dietary habits, physical activity and sedentary behaviours. Previous research has shown that school-based programmes are effective but that their effectiveness can be improved by including a parental component. At present, there is a lack of effective parental support programmes for improvement of diet and physical activity and prevention of obesity in children. Methods/Design This paper describes the rationale and design of a parental support programme to promote healthy dietary habits and physical activity in six-year-old children starting school. The study is performed in close collaboration with the school health care and is designed as a cluster-randomised controlled trial with a mixed methods approach. In total, 14 pre-school classes are included from a municipality in Stockholm county where there is large variation in socio-economic status between the families. The school classes are randomised to intervention (n = 7 and control (n = 7 groups including a total of 242 children. The intervention is based on social cognitive theory and consists of three main components: 1 a health information brochure; 2 two motivational interviewing sessions with the parents; and 3 teacher-led classroom activities with the children. The primary outcomes are physical activity in the children measured objectively by accelerometry, children's dietary and physical activity habits measured with a parent-proxy questionnaire and parents' self-efficacy measured by a questionnaire. Secondary outcomes are height, weight and waist circumference in the children. The duration of the intervention is six months and includes baseline, post intervention and six months follow-up measurements. Linear and logistic regression models will be used to analyse differences between intervention and control groups in the outcome variables. Mediator and moderator analysis will be performed

Starting a business through a franchise

OpenAIRE

Dubravka Mahaček; Maja Martinko Lihtar

2013-01-01

A business can be launched by establishing a new entity, purchasing an existing entity or through a franc - hise. There are certain prerequisites for starting a business, the most important ones being a quality idea and start-up capital. Potential start-up difficulties are inadequate financing, existing competition as well as the process of building your own market position. By purchasing an existing business some risks may be avoided and the opportunity for gaining profit may ...

Healthy Start vitamins—a missed opportunity: findings of a multimethod study

Science.gov (United States)

McFadden, Alison; Green, Josephine M; McLeish, Jenny; McCormick, Felicia; Williams, Victoria; Renfrew, Mary J

2015-01-01

Objective To evaluate and provide a real-life view of the operation of the Healthy Start vitamins scheme. Setting The study took place in primary care and community settings that served rural, urban and ethnically diverse populations, in two sentinel sites: London, and Yorkshire and the Humber. An online consultation and stakeholder workshops elicited views from across England. Participants 669 health and social care practitioners including health visitors, midwives, public health practitioners, general practitioners, paediatricians and support staff participated in focus group discussions (n=49) and an online consultation (n=620). 56 participants representing health and social care practitioners, policymakers, service commissioners, and voluntary and independent sectors took part in stakeholder workshops. Methods Three-phase multimethod study comprising focus group discussions, an online consultation and stakeholder workshops. Qualitative data were analysed thematically and quantitative data from the online survey were analysed using descriptive statistics. Results Study participants were concerned about the low uptake of Healthy Start vitamin supplements and the consequences of this for health outcomes for women and young children. They experienced Healthy Start vitamin distribution as logistically complex, requiring the time, resources and creative thinking of a range of local and regional practitioners from senior strategists to administrative support workers. In the light of this, many participants argued that moving to universal provision of vitamin supplements would be more cost-effective than the current system. Conclusions There is consistency of views of health practitioners that the current targeted system of providing free vitamin supplements for low-income childbearing women and young children via the Healthy Start programme is not fulfilling its potential to address vitamin deficiencies. There is wide professional and voluntary sector support for

Automated extinction monitor for the NLOT site survey

Science.gov (United States)

Kumar Sharma, Tarun

In order to search a few potential sites for the National Large Optical Telescope (NLOT) project, we have initiated a site survey program. Since, most of instruments used for the site survey are custom made, we also started developing our own site characterization instruments. In this process we have designed and developed a device called Automated Extinction Monitor (AEM) and installed the same at IAO, Hanle. The AEM is a small wide field robotic telescope, dedicated to record atmospheric extinction in one or more photometric bands. It gives very accurate statistics of the distribution of photometric nights. In addition to this, instrument also provides the measurement of sky brightness. Here we briefly describe overall instrument and initial results obtained.

RNA polyadenylation sites on the genomes of microorganisms, animals, and plants.

Directory of Open Access Journals (Sweden)

Xiu-Qing Li

Full Text Available Pre-messenger RNA (mRNA 3'-end cleavage and subsequent polyadenylation strongly regulate gene expression. In comparison with the upstream or downstream motifs, relatively little is known about the feature differences of polyadenylation [poly(A] sites among major kingdoms. We suspect that the precise poly(A sites are very selective, and we therefore mapped mRNA poly(A sites on complete and nearly complete genomes using mRNA sequences available in the National Center for Biotechnology Information (NCBI Nucleotide database. In this paper, we describe the mRNA nucleotide [i.e., the poly(A tail attachment position] that is directly in attachment with the poly(A tail and the pre-mRNA nucleotide [i.e., the poly(A tail starting position] that corresponds to the first adenosine of the poly(A tail in the 29 most-mapped species (2 fungi, 2 protists, 18 animals, and 7 plants. The most representative pre-mRNA dinucleotides covering these two positions were UA, CA, and GA in 17, 10, and 2 of the species, respectively. The pre-mRNA nucleotide at the poly(A tail starting position was typically an adenosine [i.e., A-type poly(A sites], sometimes a uridine, and occasionally a cytidine or guanosine. The order was U>C>G at the attachment position but A>>U>C≥G at the starting position. However, in comparison with the mRNA nucleotide composition (base composition, the poly(A tail attachment position selected C over U in plants and both C and G over U in animals, in both A-type and non-A-type poly(A sites. Animals, dicot plants, and monocot plants had clear differences in C/G ratios at the poly(A tail attachment position of the non-A-type poly(A sites. This study of poly(A site evolution indicated that the two positions within poly(A sites had distinct nucleotide compositions and were different among kingdoms.

FCGR2A Promoter Methylation and Risks for Intravenous Immunoglobulin Treatment Responses in Kawasaki Disease

Directory of Open Access Journals (Sweden)

Ho-Chang Kuo

2015-01-01

Full Text Available Kawasaki disease (KD is characterized by pediatric systemic vasculitis of an unknown cause. The low affinity immunoglobulin gamma Fc region receptor II-a (FCGR2A gene was reported to be involved in the susceptibility of KD. DNA methylation is one of the epigenetic mechanisms that control gene expression; thus, we hypothesized that methylation status of CpG islands in FCGR2A promoter associates with the susceptibility and therapeutic outcomes of Kawasaki disease. In this study, 36 KD patients and 24 healthy subjects from out-patient clinic were recruited. Eleven potential methylation sites within the targeted promoter region of FCGR2A were selected for investigation. We marked the eleven methylation sites from A to K. Our results indicated that methylation at the CpG sites G, H, and J associated with the risk of KD. CpG sites B, C, E, F, H, J, and K were found to associate with the outcomes of IVIG treatment. In addition, CpG sites G, J, and K were predicted as transcription factors binding sites for NF-kB, Myc-Max, and SP2, respectively. Our study reported a significant association among the promoter methylation of FCGR2A, susceptibility of KD, and the therapeutic outcomes of IVIG treatment. The methylation levels of CpG sites of FCGR2A gene promoter should be an important marker for optimizing IVIG therapy.

Comparison of outcomes between emergent-start and planned-start peritoneal dialysis in incident ESRD patients: a prospective observational study.

Science.gov (United States)

Li, Wen-Yi; Wang, Yi-Cheng; Hwang, Shang-Jyh; Lin, Shih-Hua; Wu, Kwan-Dun; Chen, Yung-Ming

2017-12-11

The clinical consequences of starting chronic peritoneal dialysis (PD) after emergent dialysis via a temporary hemodialysis (HD) catheter has rarely been evaluated within a full spectrum of treated end-stage renal disease (ESRD). We investigated the longer-term outcomes of patients undergoing emergent-start PD in comparison with that of other practices of PD or HD in a prospective cohort of new-onset ESRD. This was a 2-year prospective observational study. We enrolled 507 incident ESRD patients, among them 111 chose PD (43 planned-start, 68 emergent-start) and 396 chose HD (116 planned-start, 280 emergent-start) as the long-term dialysis modality. The logistic regression model was used to identify variables associated with emergent-start dialysis. The Kaplan-Meier survival analysis was used to determine patient survival and technique failure. The propensity score-adjusted Cox regression model was used to identify factors associated with patient outcomes. During the 2-year follow-up, we observed 5 (4.5%) deaths, 15 (13.5%) death-censored technique failures (transfer to HD) and 3 (2.7%) renal transplantations occurring in the PD population. Lack of predialysis education, lower predialysis estimated glomerular filtration rate and serum albumin were predictors of being assigned to emergent dialysis initiation. The emergent starters of PD displayed similar risks of patient survival, technique failure and overall hospitalization, compared with the planned-start counterparts. By contrast, the concurrent planned-start and emergent-start HD patients with an arteriovenous fistula or graft were protected from early overall death and access infection-related mortality, compared with the emergent HD starters using a central venous catheter. In late-referred chronic kidney disease patients who have initiated emergent dialysis via a temporary HD catheter, post-initiation PD can be a safe and effective long-term treatment option. Nevertheless, due to the potential complications

Lean Start-up in Established Companies

DEFF Research Database (Denmark)

Goduscheit, René Chester

2018-01-01

Lean start-up is an emergent perspective on how entrepreneurs can bring new products and services to the market. This approach challenges the dominant role of lengthy business plans, linear product development processes, and seeking complete overview of the potential of the new products....../services before market launch. Instead it suggests that start-ups could benefit from a ‘minimum-viable product’ approach where products and services are launched when they contain critical features. The emphasis in the lean start-up approach is on business models rather than the elaborate business plan...... at the companies (strategy meetings, development workshops etc.). The aim is to shed light on the implications for companies that seek to employ lean start-up. These implications will be aimed at aspects like innovation management, organizational structure, customer relations etc....

Virtual worlds: taking health promotion to new levels.

Science.gov (United States)

Annang, Lucy; Muilenburg, Jessica L; Strasser, Sheryl M

2010-01-01

Health promotion strategies continue to evolve, with interventions using e-mail, text messaging, and Web sites becoming commonplace. The use of online virtual worlds is a less familiar venue for health promotion but offers numerous possibilities for wired citizens with health issues. The authors discuss three examples of virtual worlds--the River City Project, Whyville, and Second Life--and how health promotion strategies can be implemented in virtual worlds. They also address several challenges associated with implementing health interventions in virtual worlds, including questions of ethics, diffusion of health knowledge and logistics of intervening outside of the real world.

Characterization of the human Activin-A receptor type II-like kinase 1 (ACVRL1 promoter and its regulation by Sp1

Directory of Open Access Journals (Sweden)

Botella Luisa M

2010-06-01

Full Text Available Abstract Background Activin receptor-like kinase 1 (ALK1 is a Transforming Growth Factor-β (TGF-β receptor type I, mainly expressed in endothelial cells that plays a pivotal role in vascular remodelling and angiogenesis. Mutations in the ALK1 gene (ACVRL1 give rise to Hereditary Haemorrhagic Telangiectasia, a dominant autosomal vascular dysplasia caused by a haploinsufficiency mechanism. In spite of its patho-physiological relevance, little is known about the transcriptional regulation of ACVRL1. Here, we have studied the different origins of ACVRL1 transcription, we have analyzed in silico its 5'-proximal promoter sequence and we have characterized the role of Sp1 in the transcriptional regulation of ACVRL1. Results We have performed a 5'Rapid Amplification of cDNA Ends (5'RACE of ACVRL1 transcripts, finding two new transcriptional origins, upstream of the one previously described, that give rise to a new exon undiscovered to date. The 5'-proximal promoter region of ACVRL1 (-1,035/+210 was analyzed in silico, finding that it lacks TATA/CAAT boxes, but contains a remarkably high number of GC-rich Sp1 consensus sites. In cells lacking Sp1, ACVRL1 promoter reporters did not present any significant transcriptional activity, whereas increasing concentrations of Sp1 triggered a dose-dependent stimulation of its transcription. Moreover, silencing Sp1 in HEK293T cells resulted in a marked decrease of ACVRL1 transcriptional activity. Chromatin immunoprecipitation assays demonstrated multiple Sp1 binding sites along the proximal promoter region of ACVRL1 in endothelial cells. Furthermore, demethylation of CpG islands, led to an increase in ACVRL1 transcription, whereas in vitro hypermethylation resulted in the abolishment of Sp1-dependent transcriptional activation of ACVRL1. Conclusions Our results describe two new transcriptional start sites in ACVRL1 gene, and indicate that Sp1 is a key regulator of ACVRL1 transcription, providing new insights into

So You Want to Start a Peer Online Writing Center?

Directory of Open Access Journals (Sweden)

Christine Rosalia

2013-03-01

Full Text Available The purpose of this article is to share lessons learned in setting up three different peer online writing centers in three different contexts (EFL, Generation 1.5, and ESL. In each center the focus was on the language learner as a peer online writing advisor and their needs in maintaining centers “for and by” learners. Technology affordances and constraints for local contexts, which promote learner autonomy, are analyzed. The open-source platforms (Moodle, Drupal, and Google Apps are compared in terms of usability for peer writing center work, particularly centers where groups co-construct feedback for writers, asynchronously. This paper is useful for readers who would like a head start or deeper understanding of potential logistics and decision-making involved in establishing a peer online writing center within coursework and/or a self-access learning center.

Promoter characteristics of two cyp19 genes differentially expressed in the brain and ovary of teleost fish.

Science.gov (United States)

Tchoudakova, A; Kishida, M; Wood, E; Callard, G V

2001-11-01

Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most

Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

Science.gov (United States)

Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

1993-12-22

The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

Physical signals for protein–DNA recognition

International Nuclear Information System (INIS)

Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

2009-01-01

This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein–DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do

Drug Abuse Prevention Starts with Parents

Science.gov (United States)

... Stages Listen Español Text Size Email Print Share Drug Abuse Prevention Starts with Parents Page Content Article Body ... for a time when drugs may be offered. Drug abuse prevention starts with parents learning how to talk ...

Ames expedited site characterization demonstration at the former manufactured gas plant site, Marshalltown, Iowa

International Nuclear Information System (INIS)

Bevolo, A.J.; Kjartanson, B.H.; Wonder, J.D.

1996-03-01

The goal of the Ames Expedited Site Characterization (ESC) project is to evaluate and promote both innovative technologies (IT) and state-of-the-practice technologies (SOPT) for site characterization and monitoring. In April and May 1994, the ESC project conducted site characterization, technology comparison, and stakeholder demonstration activities at a former manufactured gas plant (FMGP) owned by Iowa Electric Services (IES) Utilities, Inc., in Marshalltown, Iowa. Three areas of technology were fielded at the Marshalltown FMGP site: geophysical, analytical and data integration. The geophysical technologies are designed to assess the subsurface geological conditions so that the location, fate and transport of the target contaminants may be assessed and forecasted. The analytical technologies/methods are designed to detect and quantify the target contaminants. The data integration technology area consists of hardware and software systems designed to integrate all the site information compiled and collected into a conceptual site model on a daily basis at the site; this conceptual model then becomes the decision-support tool. Simultaneous fielding of different methods within each of the three areas of technology provided data for direct comparison of the technologies fielded, both SOPT and IT. This document reports the results of the site characterization, technology comparison, and ESC demonstration activities associated with the Marshalltown FMGP site. 124 figs., 27 tabs

Talent identification and promotion programmes of Olympic athletes.

Science.gov (United States)

Vaeyens, Roel; Güllich, Arne; Warr, Chelsea R; Philippaerts, Renaat

2009-11-01

The start of a new Olympic cycle offers a fresh chance for individuals and nations to excel at the highest level in sport. Most countries attempt to develop systematic structures to identify gifted athletes and to promote their development in a certain sport. However, forecasting years in advance the next generation of sporting experts and stimulating their development remains problematic. In this article, we discuss issues related to the identification and preparation of Olympic athletes. We provide field-based data suggesting that an earlier onset and a higher volume of discipline-specific training and competition, and an extended involvement in institutional talent promotion programmes, during adolescence need not necessarily be associated with greater success in senior international elite sport. Next, we consider some of the promising methods that have been (recently) presented in the literature and applied in the field. Finally, implications for talent identification and promotion and directions for future research are highlighted.

Modeling promoter grammars with evolving hidden Markov models

DEFF Research Database (Denmark)

Won, Kyoung-Jae; Sandelin, Albin; Marstrand, Troels Torben

2008-01-01

MOTIVATION: Describing and modeling biological features of eukaryotic promoters remains an important and challenging problem within computational biology. The promoters of higher eukaryotes in particular display a wide variation in regulatory features, which are difficult to model. Often several...... factors are involved in the regulation of a set of co-regulated genes. If so, promoters can be modeled with connected regulatory features, where the network of connections is characteristic for a particular mode of regulation. RESULTS: With the goal of automatically deciphering such regulatory structures......, we present a method that iteratively evolves an ensemble of regulatory grammars using a hidden Markov Model (HMM) architecture composed of interconnected blocks representing transcription factor binding sites (TFBSs) and background regions of promoter sequences. The ensemble approach reduces the risk...

Dampak Mentoring Pada Keberhasilan Start-Up Business: Studi Kasus Pada Start-Up Business di Indonesia [Mentoring the Impact of Success of a Start-Up Business: A Case Study of a Start-Up Business in Indonesia

Directory of Open Access Journals (Sweden)

Christina Yanita Setyawati

2016-10-01

Full Text Available Entrepreneurship is a highly developed science today, as well as in the world of education in Indonesia. Teaching entrepreneurship at the university level, especially at some universities in Surabaya, the second largest city in Indonesia, shows the positive impact that there were 74.03% of start-up businesses that survived and thrived in 2014. Based on the previous observation, some business start-ups are accompanied by a mentor. Mentoring is a process of forming and maintaining lasting relationships that develop intensively among seniors with juniors. The mentoring function includes career and psychosocial functions. The main purpose of this research is to study the relationship between mentoring and the success of a start-up business. This study is a quantitative descriptive study using a random sampling method to obtain 100 samples. The tool used to collect data was a questionnaire. The methodology used to analyze the quantitative description to test the hypothesis. The results of this study indicate that mentoring influences the success of a start-up business that was owned by university students in Surabaya, Indonesia by 32% and 78% was influenced by other variables.

Faulting in mudrocks: the selection of potential research sites

International Nuclear Information System (INIS)

Alexander, J.

1990-01-01

The British Geological Survey, in cooperation with Ismes of Italy, has carried out a research programme into faults through clay formations. The research programme commenced in April 1986 and work started at the Down Ampney site in February 1987

Security scanning of Web sites at CERN

CERN Multimedia

IT Department

2010-01-01

As of early 2010, the CERN Computer Security Team will start regular scanning of all Web sites and Web applications at CERN, visible on the Internet, or on the General Purpose Network (office network). The goal of this scanning is to improve the quality of CERN Web sites. All deficits found will be reported by e-mail to the relevant Web site owners, and must be fixed in a timely manner. Web site owners may also request one-off scans of their Web site or Web application, by sending an e-mail to Computer.Security@cern.ch. These Web scans are designed to limit the impact on the scanned Web sites. Nevertheless, in very rare cases scans may cause undesired side-effects, e.g. generate a large number of log entries, or cause particularly badly designed or less robust Web applications to crash. If a Web site is affected by these security scans, it will also be susceptible to any more aggressive scan that can be performed any time by a malicious attacker. Such Web applications should be fixed, and also additionally...

Health Coordination Manual. Head Start Health Services.

Science.gov (United States)

Administration for Children, Youth, and Families (DHHS), Washington, DC. Head Start Bureau.

Part 1 of this manual on coordinating health care services for Head Start children provides an overview of what Head Start health staff should do to meet the medical, mental health, nutritional, and/or dental needs of Head Start children, staff, and family members. Offering examples, lists, action steps, and charts for clarification, part 2…

Genome-scale portrait and evolutionary significance of human-specific core promoter tri- and tetranucleotide short tandem repeats.

Science.gov (United States)

Nazaripanah, N; Adelirad, F; Delbari, A; Sahaf, R; Abbasi-Asl, T; Ohadi, M

2018-04-05

While there is an ongoing trend to identify single nucleotide substitutions (SNSs) that are linked to inter/intra-species differences and disease phenotypes, short tandem repeats (STRs)/microsatellites may be of equal (if not more) importance in the above processes. Genes that contain STRs in their promoters have higher expression divergence compared to genes with fixed or no STRs in the gene promoters. In line with the above, recent reports indicate a role of repetitive sequences in the rise of young transcription start sites (TSSs) in human evolution. Following a comparative genomics study of all human protein-coding genes annotated in the GeneCards database, here we provide a genome-scale portrait of human-specific short- and medium-size (≥ 3-repeats) tri- and tetranucleotide STRs and STR motifs in the critical core promoter region between - 120 and + 1 to the TSS and evidence of skewing of this compartment in reference to the STRs that are not human-specific (Levene's test p human-specific transcripts was detected in the tri and tetra human-specific compartments (mid-p genome-scale skewing of STRs at a specific region of the human genome and a link between a number of these STRs and TSS selection/transcript specificity. The STRs and genes listed here may have a role in the evolution and development of characteristics and phenotypes that are unique to the human species.

Regulation of the cd38 promoter in human airway smooth muscle cells by TNF-α and dexamethasone

Directory of Open Access Journals (Sweden)

Walseth Timothy F

2008-03-01

Full Text Available Abstract Background CD38 is expressed in human airway smooth muscle (HASM cells, regulates intracellular calcium, and its expression is augmented by tumor necrosis factor alpha (TNF-α. CD38 has a role in airway hyperresponsiveness, a hallmark of asthma, since deficient mice develop attenuated airway hyperresponsiveness compared to wild-type mice following intranasal challenges with cytokines such as IL-13 and TNF-α. Regulation of CD38 expression in HASM cells involves the transcription factor NF-κB, and glucocorticoids inhibit this expression through NF-κB-dependent and -independent mechanisms. In this study, we determined whether the transcriptional regulation of CD38 expression in HASM cells involves response elements within the promoter region of this gene. Methods We cloned a putative 3 kb promoter fragment of the human cd38 gene into pGL3 basic vector in front of a luciferase reporter gene. Sequence analysis of the putative cd38 promoter region revealed one NF-κB and several AP-1 and glucocorticoid response element (GRE motifs. HASM cells were transfected with the 3 kb promoter, a 1.8 kb truncated promoter that lacks the NF-κB and some of the AP-1 sites, or the promoter with mutations of the NF-κB and/or AP-1 sites. Using the electrophoretic mobility shift assays, we determined the binding of nuclear proteins to oligonucleotides encoding the putative cd38 NF-κB, AP-1, and GRE sites, and the specificity of this binding was confirmed by gel supershift analysis with appropriate antibodies. Results TNF-α induced a two-fold activation of the 3 kb promoter following its transfection into HASM cells. In cells transfected with the 1.8 kb promoter or promoter constructs lacking NF-κB and/or AP-1 sites or in the presence of dexamethasone, there was no induction in the presence of TNF-α. The binding of nuclear proteins to oligonucleotides encoding the putative cd38 NF-κB site and some of the six AP-1 sites was increased by TNF-α, and to