WorldWideScience

Sample records for staining dna fragmentation

  1. [Comet assay of DNA fragmentation: modification of silver staining for obtaining permanent preparations].

    Science.gov (United States)

    Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S

    2005-01-01

    Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.

  2. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  3. Subcloning of DNA fragments.

    Science.gov (United States)

    Struhl, K

    2001-05-01

    The essence of recombinant DNA technology is the joining of two or more separate segments of DNA to generate a single DNA molecule that is capable of autonomous replication in a given host. The simplest constructions of hybrid DNA molecules involve the cloning of insert sequences into plasmid or bacteriophage cloning vectors. The insert sequences can derive from essentially any organism, and they may be isolated directly from the genome, from mRNA, or from previously cloned DNA segments (in which case, the procedure is termed subcloning). Alternatively, insert DNAs can be created directly by DNA synthesis. This unit provides protocols for the subcloning of DNA fragments and ligation of DNA fragments in gels.

  4. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  5. DNA Comet Giemsa Staining for Conventional Bright-Field Microscopy

    Directory of Open Access Journals (Sweden)

    Andreyan Osipov

    2014-04-01

    Full Text Available This study was undertaken to evaluate the compatibility of Giemsa staining protocol with the comet assay. We showed, for the first time, that DNA comets can be visualized and analyzed using Giemsa staining. We generated DNA damage dose response curves for human peripheral blood lymphocytes exposed to X-ray radiation using the comet assay with either SybrGreen I or Giemsa stain. The dose response curves were fitted by linear regressions (R2 > 0.977. The SybrGreen I results showed only ~1.2-fold higher slope coefficient (method sensitivity compared to the Giemsa results. The unexpectedly high sensitivity of Giemsa staining for the comet assay is due to the Romanowsky-Giemsa effect, the stain photo-stability and the higher resolution of bright-field imaging compared to fluorescence imaging. Our results demonstrate that Giemsa staining can effectively be used for measuring DNA damage by the comet assay. The low cost and availability of Giemsa stain makes this method affordable for any low budget research and will facilitate new applications of the comet assay in biology and medicine.

  6. DNA Comet Giemsa Staining for Conventional Bright-Field Microscopy

    Science.gov (United States)

    Osipov, Andreyan; Arkhangelskaya, Ekaterina; Vinokurov, Alexei; Smetanina, Nadezhda; Zhavoronkov, Alex; Klokov, Dmitry

    2014-01-01

    This study was undertaken to evaluate the compatibility of Giemsa staining protocol with the comet assay. We showed, for the first time, that DNA comets can be visualized and analyzed using Giemsa staining. We generated DNA damage dose response curves for human peripheral blood lymphocytes exposed to X-ray radiation using the comet assay with either SybrGreen I or Giemsa stain. The dose response curves were fitted by linear regressions (R2 > 0.977). The SybrGreen I results showed only ~1.2-fold higher slope coefficient (method sensitivity) compared to the Giemsa results. The unexpectedly high sensitivity of Giemsa staining for the comet assay is due to the Romanowsky-Giemsa effect, the stain photo-stability and the higher resolution of bright-field imaging compared to fluorescence imaging. Our results demonstrate that Giemsa staining can effectively be used for measuring DNA damage by the comet assay. The low cost and availability of Giemsa stain makes this method affordable for any low budget research and will facilitate new applications of the comet assay in biology and medicine. PMID:24727376

  7. Simple and practical staining of DNA with GelRed in agarose gel electrophoresis.

    Science.gov (United States)

    Huang, Qing; Baum, Larry; Fu, Wei-Ling

    2010-01-01

    Although SYBR Gold or SYBR Green I have been used in the loading buffer as a DNA stain safer than ethidium bromide for agarose gel electrophoresis, electrophoretic mobility of DNA is altered and thus DNA fragment size cannot be accurately determined. A method using GelRed in the loading buffer was developed to stain DNA fragments in agarose gel electrophoresis. Among various concentrations of GelRed, SYBR Gold, or SYBR Green I tested in the loading buffer, only the highest tested concentration of GelRed, i.e., 100x GelRed, did not change band mobility. Evaluations using various sizes of PCR products at different concentrations further confirmed that 100x GelRed could be used to accurately determine DNA fragment size. The reagent can be stored at 4 degrees C for at least 1 year without a decrease in staining sensitivity. The 100x GelRed is a sensitive and safe alternative to ethidium bromide and better than either SYBR Gold or SYBR Green I for size determination in agarose gel electrophoresis. Our laboratory now uses the GelRed method routinely with great consistency and success.

  8. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology was used to analyze ... that 9 of the studied expressed sequence tags (ESTs) are related to protein modification, 12 ESTs are involved in the .... primers were used during the first strand synthesis of our cDNA synthesis ...

  9. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  10. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  12. Clinical aspects of sperm DNA fragmentation detection and male infertility.

    Science.gov (United States)

    Evenson, Donald P; Wixon, Regina

    2006-03-15

    Over the past 25 years, various methods have been developed to measure sperm DNA strand breaks in situ. Currently, there are four major tests of sperm DNA fragmentation, including the Comet, Tunel, sperm chromatin structure assay (SCSA) and the acridine orange test (AOT). The Comet assay is a light microscope technique where the sperm cells are mixed with melted agarose and then placed on a glass slide. The cells are lysed and then subjected to horizontal electrophoresis. The Tunel assay, another light microscope technique, transfers labeled nucleotide to the 3'OH group of a broken DNA strand with the use of terminal deoxynucleotidyl transferase. The fluorescence intensity of each scored sperm is determined as a "yes" or "no" for sperm on a light microscope slide or by channels of fluorescent intensity in a flow cytometer. The light microscope-based AOT, uses the metachromatic properties of acridine orange to stain sperm cells. The SCSA treats sperm with low pH to denature DNA at the sites of DNA strand breaks, followed by acridine orange (AO) staining of green for native DNA and red for denatured DNA as measured by flow cytometry (FCM) as well as % sperm with high DNA stainability (HDS: immature sperm with intact DNA related to decreased fertilization rates). The SCSA method has defined a 27-30% DNA fragmentation index (DFI) as the point in which a man is placed into a statistical category of taking a longer time to in vivo pregnancy, intra uterine insemination (IUI) and more routine in vitro fertilization (IVF) cycles or no pregnancy. Current data suggest that intracytoplasmic sperm injection (ICSI) may help overcome the diminished pregnancy prognosis with high DFI over the other ART or natural methods.

  13. DNA fragmentation by charged particle tracks

    Science.gov (United States)

    Stenerlöw, B.; Höglund, E.; Carlsson, J.

    High-LET (linear energy transfer) charged particles induce DNA double-strand breaks (DSB) in a non-random fashion in mammalian cells. The clustering of DSB, probably determined by track structure as well as chromatin conformation, results in an excess of small- and intermediate-sized DNA fragments. DNA fragmentation in normal human fibroblasts (GM5758) was analyzed by pulsed-field gel electrophoresis after irradiation with photons ( 60Co) or 125 keV/μm nitrogen ions. Compared to conventional DSB analysis, i.e. assays only measuring the fraction of DNA smaller than a single threshold, the relative biological effectiveness (RBE) for DSB induction increased with 100%. Further, the size distribution of DNA fragments showed a significant dependence on radiation quality, with an excess of fragments up to 1 Mbp. Irradiation of naked genomic DNA without histone proteins increased the DSB yields 25 and 13 times for photons and nitrogen ions, respectively. The results suggest possible roles of both track structure and chromatin organization in the distribution of DNA double-strand breaks along the chromosome.

  14. Nucleosomal DNA fragments in autoimmune diseases

    NARCIS (Netherlands)

    Holdenrieder, Stefan; Eichhorn, Peter; Beuers, Ulrich; Samtleben, Walter; Schoenermarck, Ulf; Zachoval, Reinhart; Nagel, Dorothea; Stieber, Petra

    2006-01-01

    The inadequate response of immune cells to circulating apoptotic products, such as nucleosomal DNA fragments, is assumed to be a potent stimulus for the production of autoantibodies during the pathogenesis and progression of systemic lupus erythematosus (SLE). Here, we analyzed the levels of

  15. Cultivated single stranded DNA phages that infect marine Bacteroidetes prove difficult to detect with DNA binding stains

    DEFF Research Database (Denmark)

    Holmfeldt, Karin; Odic, Dusko; Sullivan, Matthew B.

    2012-01-01

    This is the first description of cultivated icosahedral single stranded DNA (ssDNA) phages isolated on heterotrophic marine bacterioplankton and with Bacteroidetes hosts. None of the 8 phages stained well with DNA binding stains, suggesting that in situ abundances of ssDNA phages are drastically...

  16. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  17. Rapid and reliable DNA extraction techniques from trypan-blue-stained mycorrhizal roots: comparison of two methods.

    Science.gov (United States)

    Ishii, Satoshi; Loynachan, Thomas E

    2004-08-01

    Two improved DNA extraction techniques from trypan-blue-stained root fragments were developed and compared for rapid and reliable analyses. In Method A, 1 cm trypan-blue-stained mycorrhizal root fragments were individually isolated, crushed by bead beating, and purified with Chelex-100 (Bio-Rad). In Method B, DNA extraction was carried out using an UltraClean microbial DNA isolation kit (MoBio Laboratories). DNA was extracted from the mycorrhizal roots of four plant species, quantified by UV absorbance, and PCR-amplified with primers specific to arbuscular mycorrhizal fungi. Although PCR inhibitors might still exist when using Method A, appropriate dilution and employment of nested-PCR overcame this problem. Method B removed PCR inhibitors, but sometimes, depending on the mycorrhizal colonization within the root fragments, it also required nested PCR. In conclusion, both methods enabled us to handle many samples in a short time. Method B provided greater reliability and Method A provided better cost performance. Both techniques can be useful for PCR-based applications to identify species and estimate species composition after measuring mycorrhizal colonization rate with trypan blue staining.

  18. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often <100 bp) and may persist in the environment for more than half a million years. Fragmented DNA is recognized as nutrient source f...... quantities in the environment, can be acquired by bacteria through natural transformation. Our findings open for the possibility that natural genetic exchange can occur with DNA up to several hundreds of thousands years old.......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake...

  19. Analysis of parental strain DNA fragments existing in GEMs-Fhhh.

    Science.gov (United States)

    Hao, Chun-Bo; Yan, Jun; Qu, Meng-Meng; Wang, Dong; Cheng, Shu-Pei; Gu, Ji-Dong; Qiu, Wan-Fei; Wang, Yin-Yin

    2003-09-01

    There were 6 target DNA fragments of the three parental strains existing in the cell of GEMs (genetically engineered microorganism strain) Fhhh measured in this research by PCR(polymerase chain reaction). The determination showed that GEMs Fhhh contained all the 6 target DNA fragments, mnp1, mnp2, lip1, lip2, FLO1 and 16S rDNA, and had the molecular genetic stability. Meanwhile the PCR production of each parental strain could only had its target DNA fragments and was different from each other. It may illustrate that the technique of the inter-kingdom protoplast fusion for the construction of GEMs Fhhh through the process of intercellular gene recombination could be used as a reliable bioengineering technique to create the specific functional stain for the pollution control.

  20. Combined beta-galactosidase and immunogold/silver staining for immunohistochemistry and DNA in situ hybridization

    NARCIS (Netherlands)

    van den Brink, W.; van der Loos, C.; Volkers, H.; Lauwen, R.; van den Berg, F.; Houthoff, H. J.; Das, P. K.

    1990-01-01

    A combination of beta-galactosidase enzyme and the immunogold/silver staining method was studied for evaluation of double-staining experiments. Applications are shown for immunohistochemical double staining using two monoclonal antibodies and for combined immunohistochemistry and DNA in situ

  1. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  2. Restriction fragment length polymorphisms of the DNA of selected Naegleria and Acanthamoeba amebae.

    Science.gov (United States)

    McLaughlin, G L; Brandt, F H; Visvesvara, G S

    1988-09-01

    Fourteen strains of Naegleria fowleri, two strains of N. gruberi, and one strain each of N. australiensis, N. jadini, N. lovaniensis, Acanthamoeba sp., A. castellanii, A. polyphaga, and A. comandoni isolated from patients, soil, or water were characterized by restriction fragment length polymorphisms. Total cellular DNA (1 microgram) was digested with either HindIII, BglII, or EcoRI; separated on agarose gels; and stained with ethidium bromide. From 2 to 15 unusually prominent repetitive restriction fragment bands, totaling 15 to 50 kilobases in length and constituting probably more than 30% of the total DNA, were detected for all ameba strains. Each species displayed a characteristic pattern of repetitive restriction fragments. Digests of the four Acanthamoeba spp. displayed fewer, less intensely staining repetitive fragments than those of the Naegleria spp. All N. fowleri strains, whether isolated from the cerebrospinal fluid of patients from different parts of the world or from hot springs, had repetitive restriction fragment bands of similar total lengths (ca. 45 kilobases), and most repetitive bands displayed identical mobilities. However, polymorphic bands were useful in identifying particular isolates. Restriction fragment length polymorphism analysis generally was consistent with taxonomy based on studies of infectivity, morphology, isoenzyme patterns, and antibody reactivity and suggests that this technique may help classify amebae isolated from clinical specimens or from the environment.

  3. DNA fragmentation in spermatozoa and its relationship with impaired spermatogenesis

    Directory of Open Access Journals (Sweden)

    S. A. Rudneva

    2014-01-01

    Full Text Available Sperm cells DNA fragmentation is one of the factors of male sub-/infertility discovered recently. At present, pathophysiological mechanisms that cause DNA fragmentation have not been studied completely. It is suggested that they may be caused with defects of chromatin remodeling, apoptosis, and oxidative stress. Spermiological examination was performed in 461 infertile men. With 23 % of the patients examined, the frequency of sperm cells DNA fragmentation comprises over 15 %, with that, 18 % of the patients demonstrated its range from 15.1 to 30 %, and with 5 % of patients, it exceeded 30 %. We found that the amount of sperm cells with fragmented DNA with severe forms of pathozoospermia is higher that with less manifested disturbances of spermatogenesis. Negative dynamics was revealed regarding the change in sperm concentration in men that have increased frequency of DNA fragmentation. Obtained results confirm the suggestion of the correlation between some semen parameters (concentration, motility, and morphology and sperm DNA fragmentation. Thus, one can state that the DNA fragmentation parameter of sperm cells has a certain diagnostic and forecasting value for married couples with reproduction disorders.

  4. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  5. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  6. Determining if DNA Stained with a Cyanine Dye Can Be Digested with Restriction Enzymes.

    Science.gov (United States)

    Maschmann, April; Masters, Cody; Davison, Melissa; Lallman, Joshua; Thompson, Drew; Kounovsky-Shafer, Kristy L

    2018-02-02

    Visualization of DNA for fluorescence microscopy utilizes a variety of dyes such as cyanine dyes. These dyes are utilized due to their high affinity and sensitivity for DNA. In order to determine if the DNA molecules are full length after the completion of the experiment, a method is required to determine if the stained molecules are full length by digesting DNA with restriction enzymes. However, stained DNA may inhibit the enzymes, so a method is needed to determine what enzymes one could use for fluorochrome stained DNA. In this method, DNA is stained with a cyanine dye overnight to allow the dye and DNA to equilibrate. Next, stained DNA is digested with a restriction enzyme, loaded into a gel and electrophoresed. The experimental DNA digest bands are compared to an in silico digest to determine the restriction enzyme activity. If there is the same number of bands as expected, then the reaction is complete. More bands than expected indicate partial digestion and less bands indicate incomplete digestion. The advantage of this method is its simplicity and it uses equipment that a scientist would need for a restriction enzyme assay and gel electrophoresis. A limitation of this method is that the enzymes available to most scientists are commercially available enzymes; however, any restriction enzymes could be used.

  7. Counterion-dye staining for DNA in electrophoresed gels using indoine blue and methyl orange.

    Science.gov (United States)

    Hwang, Sun-Young; Jin, Li-Tai; Yoo, Gyurng-Soo; Choi, Jung-Kap

    2006-05-01

    In this study, we describe a sensitive staining method for DNA in agarose and polyacrylamide gels using organic visible dyes, indoine blue (IB) and methyl orange (MO). The counterion-dye staining method uses two oppositely charged dyes to form a hydrophobic ion pair complex in the staining solution. A decrease in the number of free forms of dyes in staining solution can enhance the selectivity of binding between the dye and DNA, and can reduce nonspecific background staining. As a result, the sensitivity of counterion-dye staining was significantly improved compared with other dye-based staining. This method uses a staining solution consisting of 0.008% IB, 0.002% MO, 10% ethanol and 0.2 M sodium acetate at pH 4.7, and can detect 5 ng of lambda DNA/HindIII within 60 min in agarose gels and 10 ng of PhiX174 DNA/HaeIII within 20 min in polyacrylamide gels.

  8. Bacterial species determination from DNA-DNA hybridization by using genome fragments and DNA microarrays.

    Science.gov (United States)

    Cho, J C; Tiedje, J M

    2001-08-01

    Whole genomic DNA-DNA hybridization has been a cornerstone of bacterial species determination but is not widely used because it is not easily implemented. We have developed a method based on random genome fragments and DNA microarray technology that overcomes the disadvantages of whole-genome DNA-DNA hybridization. Reference genomes of four fluorescent Pseudomonas species were fragmented, and 60 to 96 genome fragments of approximately 1 kb from each strain were spotted on microarrays. Genomes from 12 well-characterized fluorescent Pseudomonas strains were labeled with Cy dyes and hybridized to the arrays. Cluster analysis of the hybridization profiles revealed taxonomic relationships between bacterial strains tested at species to strain level resolution, suggesting that this approach is useful for the identification of bacteria as well as determining the genetic distance among bacteria. Since arrays can contain thousands of DNA spots, a single array has the potential for broad identification capacity. In addition, the method does not require laborious cross-hybridizations and can provide an open database of hybridization profiles, avoiding the limitations of traditional DNA-DNA hybridization.

  9. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  10. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Directory of Open Access Journals (Sweden)

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  11. Advanced microinstrumentation for rapid DNA sequencing and large DNA fragment separation

    Energy Technology Data Exchange (ETDEWEB)

    Balch, J.; Davidson, J.; Brewer, L.; Gingrich, J.; Koo, J.; Mariella, R.; Carrano, A.

    1995-01-25

    Our efforts to develop novel technology for a rapid DNA sequencer and large fragment analysis system based upon gel electrophoresis are described. We are using microfabrication technology to build dense arrays of high speed micro electrophoresis lanes that will ultimately increase the sequencing rate of DNA by at least 100 times the rate of current sequencers. We have demonstrated high resolution DNA fragment separation needed for sequencing in polyacrylamide microgels formed in glass microchannels. We have built prototype arrays of microchannels having up to 48 channels. Significant progress has also been made in developing a sensitive fluorescence detection system based upon a confocal microscope design that will enable the diagnostics and detection of DNA fragments in ultrathin microchannel gels. Development of a rapid DNA sequencer and fragment analysis system will have a major impact on future DNA instrumentation used in clinical, molecular and forensic analysis of DNA fragments.

  12. Bacterial natural transformation by highly fragmented and damaged DNA.

    Science.gov (United States)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic A A; Mayar, J Victor Moreno; Rasmussen, Simon; Dahl, Tais W; Rosing, Minik T; Poole, Anthony M; Sicheritz-Ponten, Thomas; Brunak, Søren; Inselmann, Sabrina; de Vries, Johann; Wackernagel, Wilfried; Pybus, Oliver G; Nielsen, Rasmus; Johnsen, Pål Jarle; Nielsen, Kaare Magne; Willerslev, Eske

    2013-12-03

    DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often bacterial evolution. Here, we show that fragmented DNA molecules (≥ 20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations generated by uptake of short DNA fragments escape mismatch repair. Moreover, double-nucleotide polymorphisms appear more common among genomes of transformable than nontransformable bacteria. Our findings reveal that short and damaged, including truly ancient, DNA molecules, which are present in large quantities in the environment, can be acquired by bacteria through natural transformation. Our findings open for the possibility that natural genetic exchange can occur with DNA up to several hundreds of thousands years old.

  13. DNA fragmentation and sperm head morphometry in cat epididymal spermatozoa.

    Science.gov (United States)

    Vernocchi, Valentina; Morselli, Maria Giorgia; Lange Consiglio, Anna; Faustini, Massimo; Luvoni, Gaia Cecilia

    2014-10-15

    Sperm DNA fragmentation is an important parameter to assess sperm quality and can be a putative fertility predictor. Because the sperm head consists almost entirely of DNA, subtle differences in sperm head morphometry might be related to DNA status. Several techniques are available to analyze sperm DNA fragmentation, but they are labor-intensive and require expensive instrumentations. Recently, a kit (Sperm-Halomax) based on the sperm chromatin dispersion test and developed for spermatozoa of different species, but not for cat spermatozoa, became commercially available. The first aim of the present study was to verify the suitability of Sperm-Halomax assay, specifically developed for canine semen, for the evaluation of DNA fragmentation of epididymal cat spermatozoa. For this purpose, DNA fragmentation indexes (DFIs) obtained with Sperm-Halomax and terminal deoxynucleotidyl transferase-mediated nick-end labeling (TUNEL) were compared. The second aim was to investigate whether a correlation between DNA status, sperm head morphology, and morphometry assessed by computer-assisted semen analysis exists in cat epididymal spermatozoa. No differences were observed in DFIs obtained with Sperm-Halomax and TUNEL. This result indicates that Sperm-Halomax assay provides a reliable evaluation of DNA fragmentation of epididymal feline spermatozoa. The DFI seems to be independent from all the measured variables of sperm head morphology and morphometry. Thus, the evaluation of the DNA status of spermatozoa could effectively contribute to the completion of the standard analysis of fresh or frozen semen used in assisted reproductive technologies. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Purification and cloning of DNA fragments fractionated on agarose gels.

    Science.gov (United States)

    Griffin, H G; Gasson, M J

    1995-04-01

    Purification of DNA fragments from acrylamide or agarose gels is a commonly used technique in the molecular biology laboratory. This article describes a rapid, efficient, and inexpensive method of purifying DNA fractions from an agarose gel. The purified DNA is suitable for use in a wide range of applications including ligation using DNA ligase. The procedure uses standard high-melting-temperature agarose and normal TBE electrophoresis buffer. In addition, the protocol does not involve the use of highly toxic organic solvents such as phenol.

  15. Modified Classical Graph Algorithms for the DNA Fragment Assembly Problem

    Directory of Open Access Journals (Sweden)

    Guillermo M. Mallén-Fullerton

    2015-09-01

    Full Text Available DNA fragment assembly represents an important challenge to the development of efficient and practical algorithms due to the large number of elements to be assembled. In this study, we present some graph theoretical linear time algorithms to solve the problem. To achieve linear time complexity, a heap with constant time operations was developed, for the special case where the edge weights are integers and do not depend on the problem size. The experiments presented show that modified classical graph theoretical algorithms can solve the DNA fragment assembly problem efficiently.

  16. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    . The degrading DNA is fragmented and damaged, often to less than one hundred base pairs. Such DNA is only recognized as microbial nutrients and is not considered as direct contributors to bacterial evolutionary processes. The main study shows natural transformation by very short DNA (≥20bp). Further we also show...... it by damaged short DNA with abasic sites, crosslinks, and miscoding lesions, which are the most common damages in environmental DNA. This is emphasized by successful natural transformation by 43,000-year-old DNA. We find that the process is a simple variant of natural transformation. On top, we illustrate...... with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...

  17. Sperm DNA fragmentation and oxidation are independent of malondialdheyde

    Science.gov (United States)

    2011-01-01

    Background There is clinical evidence to show that sperm DNA damage could be a marker of sperm quality and extensive data exist on the relationship between DNA damage and male fertility status. Detecting such damage in sperm could provide new elements besides semen parameters in diagnosing male infertility. We aimed to assess sperm DNA fragmentation and oxidation and to study the association between these two markers, routine semen parameters and malondialdehyde formation. Methods Semen samples from 55 men attending the Histology-Embryology Laboratory of Sfax Faculty of Medicine, Tunisia, for semen investigations were analysed for sperm DNA fragmentation and oxidation using flow cytometry. The Sperm was also assessed spectrophotometrically for malondialdehyde formation. Results Within the studied group, 21 patients were nonasthenozoospermic (sperm motility ≥ 50%) and 34 patients were considered asthenozoospermic (sperm motility < 50%). A positive correlation was found between sperm DNA fragmentation and oxidation (p = 0.01; r = 0.33). We also found a negative correlation between sperm DNA fragmentation and some sperm parameters: total motility (p = 0.001; r = -0.43), rapid progressive motility (type a motility) (p = 0.04; r = -0.27), slow progressive motility (type b motility) (p = 0.03; r = -0.28), and vitality (p < 0.001; r = -0.65). Sperm DNA fragmentation was positively correlated with coiled tail (p = 0.01; r = 0.34). The two parameters that were found to be correlated with oxidative DNA damage were leucocytes concentrations (p = 0.01; r = 0.38) and broken neck (p = 0.02; r = 0.29). Sperm MDA levels were negatively correlated with sperm concentration (p < 0.001; r = -0.57), total motility (p = 0.01; r = -0.35) and type a motility (p = 0.03; r = -0.32); but not correlated with DNA fragmentation and DNA oxidation. Conclusions Our results support the evidence that oxidative stress plays a key role in inducing DNA damage; but nuclear alterations and

  18. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  19. S - and N-alkylating agents diminish the fluorescence of fluorescent dye-stained DNA.

    Science.gov (United States)

    Giesche, Robert; John, Harald; Kehe, Kai; Schmidt, Annette; Popp, Tanja; Balzuweit, Frank; Thiermann, Horst; Gudermann, Thomas; Steinritz, Dirk

    2017-01-25

    Sulfur mustard (SM), a chemical warfare agent, causes DNA alkylation, which is believed to be the main cause of its toxicity. SM DNA adducts are commonly used to verify exposure to this vesicant. However, the required analytical state-of-the-art mass-spectrometry methods are complex, use delicate instruments, are not mobile, and require laboratory infrastructure that is most likely not available in conflict zones. Attempts have thus been made to develop rapid detection methods that can be used in the field. The analysis of SM DNA adducts (HETE-G) by immunodetection is a convenient and suitable method. For a diagnostic assessment, HETE-G levels must be determined in relation to the total DNA in the sample. Total DNA can be easily visualized by the use of fluorescent DNA dyes. This study examines whether SM and related compounds affect total DNA staining, an issue that has not been investigated before. After pure DNA was extracted from human keratinocytes (HaCaT cells), DNA was exposed to different S- and N-alkylating agents. Our experiments revealed a significant, dose-dependent decrease in the fluorescence signal of fluorescent dye-stained DNA after exposure to alkylating agents. After mass spectrometry and additional fluorescence measurements ruled out covalent modifications of ethidium bromide (EthBr) by SM, we assumed that DNA crosslinks caused DNA condensation and thereby impaired access of the fluorescent dyes to the DNA. DNA digestion by restriction enzymes restored fluorescence, a fact that strengthened our hypothesis. However, monofunctional agents, which are unable to crosslink DNA, also decreased the fluorescence signal. In subsequent experiments, we demonstrated that protons produced during DNA alkylation caused a pH decrease that was found responsible for the reduction in fluorescence. The use of an appropriate buffer system eliminated the adverse effect of alkylating agents on DNA staining with fluorescent dyes. An appropriate buffer system is thus

  20. RNA/DNA co-analysis from human menstrual blood and vaginal secretion stains

    DEFF Research Database (Denmark)

    Haas, Claus; Hanson, E; Anjos, M J

    2014-01-01

    The European DNA Profiling Group (EDNAP) organized a fourth and fifth collaborative exercise on RNA/DNA co-analysis for body fluid identification and STR profiling. The task was to identify dried menstrual blood and vaginal secretion stains using specific RNA biomarkers, and additionally test 3...... housekeeping genes for their suitability as reference genes. Six menstrual blood and six vaginal secretion stains, two dilution series (1/4-1/64 pieces of a menstrual blood/vaginal swab) and, optionally, bona fide or mock casework samples of human or non-human origin were analyzed by 24 participating...... laboratories, using RNA extraction or RNA/DNA co-extraction methods. Two novel menstrual blood mRNA multiplexes were used: MMP triplex (MMP7, MMP10, MMP11) and MB triplex (MSX1, LEFTY2, SFRP4) in conjunction with a housekeeping gene triplex (B2M, UBC, UCE). Two novel mRNA multiplexes and a HBD1 singleplex were...

  1. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  2. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  3. Evaluation of sperm nuclear DNA normality by acridine orange staining technique.

    Science.gov (United States)

    Sukcharoen, N

    1995-02-01

    To determine the relationship between sperm deoxyribonucleic acid (DNA) normality and fertilizing potential, 93 semen samples from 48 fertile donors and 45 male partners of infertile couples whose major abnormalities in the female partner had been ruled out were studied. Semen samples were assessed for conventional parameters (volume, percentage of normal morphology, percentage of progressive motility, sperm concentration, and round cell concentration) according to World Health Organization (WHO) guideline and acridine orange staining. The mean sperm concentration, percentages of progressive motility, and percentage of green fluorescing sperm in semen were significantly higher in samples from fertile donors (p green-fluorescing sperm were significantly higher in fertile donors than infertile patients (65.6% vs 53.3%; p < 0.05). Therefore, the acridine orange staining technique for evaluation of the sperm DNA normality appears to give more information in infertile patients with normal semen analysis. It may be a useful addition to the conventional semen analysis.

  4. Small DNA pieces in C. elegans are intermediates of DNA fragmentation during apoptosis.

    Directory of Open Access Journals (Sweden)

    P Joseph Aruscavage

    2010-06-01

    Full Text Available While studying small noncoding RNA in C. elegans, we discovered that protocols used for isolation of RNA are contaminated with small DNA pieces. After electrophoresis on a denaturing gel, the DNA fragments appear as a ladder of bands, approximately 10 nucleotides apart, mimicking the pattern of nuclease digestion of DNA wrapped around a nucleosome. Here we show that the small DNA pieces are products of the DNA fragmentation that occurs during apoptosis, and correspondingly, are absent in mutant strains incapable of apoptosis. In contrast, the small DNA pieces are present in strains defective for the engulfment process of apoptosis, suggesting they are produced in the dying cell prior to engulfment. While the small DNA pieces are also present in a number of strains with mutations in predicted nucleases, they are undetectable in strains containing mutations in nuc-1, which encodes a DNase II endonuclease. We find that the small DNA pieces can be labeled with terminal deoxynucleotidyltransferase only after phosphatase treatment, as expected if they are products of DNase II cleavage, which generates a 3' phosphate. Our studies reveal a previously unknown intermediate in the process of apoptotic DNA fragmentation and thus bring us closer to defining this important pathway.

  5. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  6. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  7. Avian malaria in Brazilian passerine birds: parasitism detected by nested PCR using DNA from stained blood smears.

    Science.gov (United States)

    Ribeiro, S F; Sebaio, F; Branquinho, F C S; Marini, M A; Vago, A R; Braga, E M

    2005-03-01

    The microscopical examination of Giemsa-stained thin blood smears and a nested PCR were performed to detect avian Plasmodium in 275 passerine birds from small and large fragments of Atlantic Forest, Minas Gerais, Brazil. The 275 blood smears were used both for the microscopical examination and nested PCR providing the DNA template used for the reactions. The sensitivity of the nested PCR assay was higher than that observed for blood smears through microscopical examination. High prevalence (39.6%) of Plasmodium infections was detected by nested PCR while the microscopical examination detected only 16.5 % positive birds. Poor agreement was observed between the results of the two different tests. The PCR data obtained were correlated to the forest fragment size of the Atlantic Forest and also correlated to the biological characteristics of the birds (nest type construction, diet, participation in mixed-species flocks, age and sex). Birds captured in the large forest areas were more infected than birds captured in the small areas (51.9 % and 28.5 %, respectively). Diet and participation in mixed-species flocks were correlated to the Plasmodium parasitism. The insectivorous birds and those that participated in mixed-species flocks were more frequently infected (47% and 41.5%, respectively) than the other groups.

  8. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  9. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Directory of Open Access Journals (Sweden)

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  10. Correlation between sperm DNA fragmentation index and CMA3 positive spermatozoa in globozoospermic patients.

    Science.gov (United States)

    Hosseinifar, H; Yazdanikhah, S; Modarresi, T; Totonchi, M; Sadighi Gilani, M A; Sabbaghian, M

    2015-05-01

    The absence of the acrosome causes the situation which is called globozoospermia. There are a few studies, mostly as case reports, about correlation between levels of sperm DNA damage in patients with total round-headed spermatozoa. We investigated this correlation as well as CMA3 positive spermatozoa in 20 globozoospermic men (with more than 90% round-headed spermatozoa) attending to Royan Institute. Semen samples divided into three parts to semen analysis, to measure DNA fragmentation index (DFI) using sperm chromatin structure assay (SCSA) and to detect CMA3(+) sperm cells by chromomycin A3 staining and fluorescent microscopy. Our results showed that there were significant differences in sperm concentration, total sperm motility, and normal morphology between patients and controls group (p spermatozoa in patients group significantly increases compared with control group (p spermatozoa with round head sperm cells in total globozoospermic men. It seems that the increase in DNA damage may be because of defective sperm DNA compaction, as we detected CMA3 positive sperm cells in these patients. © 2015 American Society of Andrology and European Academy of Andrology.

  11. DNA flow cytometry of human spermatozoa: consistent stoichiometric staining of sperm DNA using a novel decondensation protocol.

    Science.gov (United States)

    Kovács, Tamás; Békési, Gyöngyi; Fábián, Akos; Rákosy, Zsuzsa; Horváth, Gábor; Mátyus, László; Balázs, Margit; Jenei, Attila

    2008-10-01

    Rapid flow cytometric measurement of the frequency of aneuploid human sperms is in increasing demand but development of an exploitable method is hindered by difficulties of stoichiometric staining of sperm DNA. An aggressive decondensation protocol is needed after which cell integrity still remains intact. We used flow cytometry to examine the effect of lithium diiodosalicylate (LIS, chaotropic agent) on fluorescence intensity of propidium iodide-treated human spermatozoa from 10 normozoospermic men. When flow cytometric identification of diploid spermatozoa was achieved, validation was performed after sorting by three-color FISH. In contrast with the extremely variable histograms of nondecondensed sperms, consistent identification of haploid and diploid spermatozoa was possible if samples were decondensed with LIS prior to flow cytometry. A 76-fold enrichment of diploid sperms was observed in the sorted fractions by FISH. A significant correlation was found between the proportion of sorted cells and of diploid sperms by FISH. Application of LIS during the preparation of sperm for flow cytometry appears to ensure the stoichiometric staining of sperm DNA, making quantification of aneuploid sperm percentage possible. To our knowledge this is the first report in terms of separating spermatozoa with confirmedly abnormal chromosomal content. High correlation between the proportion of cells identified as having double DNA content by flow cytometry and diploid sperm by FISH allows rapid calculation of diploidy rate. Copyright 2008 International Society for Advancement of Cytometry.

  12. Validation study of HPV DNA detection from stained FNA smears by polymerase chain reaction

    DEFF Research Database (Denmark)

    Channir, Hani Ibrahim; Larsen, Christian Grønhøj; Ahlborn, Lise Barlebo

    2016-01-01

    BACKGROUND: Human papillomavirus (HPV)-related oropharyngeal squamous cell carcinoma (OPSCC) often presents with cystic cervical metastasis and a small primary tumor localized in the palatine tonsils or base of the tongue, which is diagnostically challenging. Testing for HPV DNA in fine......-needle aspiration (FNA) smears from metastases may facilitate a targeted diagnostic workup for identifying the primary tumor. This study was designed to assess the ability to detect HPV DNA in FNA smears with polymerase chain reaction (PCR). METHODS: May-Grünvald-Giemsa (MGG)-stained FNA smears from metastases...... and corresponding surgical specimens were collected from 71 patients with known HPV-positive OPSCC, 12 patients with oral squamous cell carcinoma (OSCC), 20 patients with branchial cleft cysts, and 20 patients with Warthin tumors. Thirty-eight patients with OPSCC and 7 patients with OSCC had FNA smears available...

  13. Revealing large metagenomic regions through long DNA fragment hybridization capture.

    Science.gov (United States)

    Gasc, Cyrielle; Peyret, Pierre

    2017-03-14

    High-throughput DNA sequencing technologies have revolutionized genomic analysis, including the de novo assembly of whole genomes from single organisms or metagenomic samples. However, due to the limited capacity of short-read sequence data to assemble complex or low coverage regions, genomes are typically fragmented, leading to draft genomes with numerous underexplored large genomic regions. Revealing these missing sequences is a major goal to resolve concerns in numerous biological studies. To overcome these limitations, we developed an innovative target enrichment method for the reconstruction of large unknown genomic regions. Based on a hybridization capture strategy, this approach enables the enrichment of large genomic regions allowing the reconstruction of tens of kilobase pairs flanking a short, targeted DNA sequence. Applied to a metagenomic soil sample targeting the linA gene, the biomarker of hexachlorocyclohexane (HCH) degradation, our method permitted the enrichment of the gene and its flanking regions leading to the reconstruction of several contigs and complete plasmids exceeding tens of kilobase pairs surrounding linA. Thus, through gene association and genome reconstruction, we identified microbial species involved in HCH degradation which constitute targets to improve biostimulation treatments. This new hybridization capture strategy makes surveying and deconvoluting complex genomic regions possible through large genomic regions enrichment and allows the efficient exploration of metagenomic diversity. Indeed, this approach enables to assign identity and function to microorganisms in natural environments, one of the ultimate goals of microbial ecology.

  14. AFSC/RACE/SAP/Shavey: DNA extraction from archived Giemsa-stained blood smears using polymerase chain reaction to detect host and parasitic DNA

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These are the data from a laboratory experiment in which DNA content was removed from blood smears and extracted. The blood smears were either stained with...

  15. Solid Lipid Curcumin Particles Induce More DNA Fragmentation and Cell Death in Cultured Human Glioblastoma Cells than Does Natural Curcumin

    Directory of Open Access Journals (Sweden)

    Panchanan Maiti

    2017-01-01

    Full Text Available Despite recent advancements in cancer therapies, glioblastoma multiforme (GBM remains largely incurable. Curcumin (Cur, a natural polyphenol, has potent anticancer effects against several malignancies, including metastatic brain tumors. However, its limited bioavailability reduces its efficiency for treating GBM. Recently, we have shown that solid lipid Cur particles (SLCPs have greater bioavailability and brain tissue penetration. The present study compares the efficiency of cell death by Cur and/or SLCPs in cultured GBM cells derived from human (U-87MG and mouse (GL261 tissues. Several cell viability and cell death assays and marker proteins (MTT assay, annexin-V staining, TUNEL staining, comet assay, DNA gel electrophoresis, and Western blot were investigated following the treatment of Cur and/or SLCP (25 μM for 24–72 h. Relative to Cur, the use of SLCP increased cell death and DNA fragmentation, produced longer DNA tails, and induced more fragmented nuclear lobes. In addition, cultured GBM cells had increased levels of caspase-3, Bax, and p53, with decreases in Bcl2, c-Myc, and both total Akt, as well as phosphorylated Akt, when SLCP, rather Cur, was used. Our in vitro work suggests that the use of SLCP may be a promising strategy for reversing or preventing GBM growth, as compared to using Cur.

  16. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  17. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  18. A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics

    Science.gov (United States)

    Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.

    2012-01-01

    We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…

  19. Spatial and temporal regulation of DNA fragmentation in the aleurone of germinating barley

    NARCIS (Netherlands)

    Wang, M.; Oppedijk, B.J.; Caspers, M.P.M.; Lamers, G.E.M.; Boot, M.J.; Geerlings, D.N.G.; Bakhuizen, B.; Meijer, A.H.; Duijn, B. van

    1998-01-01

    During germination of barley grains, the appearance of DNA fragmentation started in aleurone cells near the embryo and extended to the distal end in a time-dependent manner. DNA fragmentation was demonstrated to occur only after the expression of α-amylase mRNA in the aleurone layer. In addition,

  20. [Extraction of sperm DNA from mixed stain by the modified differential lysis method combined with silicon bead method].

    Science.gov (United States)

    Han, Hai-Jun; Zhang, Yu-Hong; Yang, Min; Yi, Hai; Yang, Geng-Ye; Jia, Dong-Tao; Lu, Da-Ru

    2014-02-01

    To extract sperm DNA from mixed stain by the modified differential lysis method combined with silicon bead method and to evaluate its application value. Fifty-two mixed stains containing female STR genotypes detected by differential lysis method were collected. The sperm DNA was extracted by the modified method combined with silicon bead method, then genotyped with the Identifiler Kit, and compared with the results of genotyping by the conventional differential lysis method as control. Of the 52 samples, 38 samples with sole male STR genotypes in all loci were detected. The detection rate of male STR genotypes was 98.08% through the modified method combined with silicon bead method. The modified differential lysis method combined with silicon bead method can be used in extraction of sperm DNA from mixed stain.

  1. Nanopore-based assay for detection of methylation in double-stranded DNA fragments.

    Science.gov (United States)

    Shim, Jiwook; Kim, Younghoon; Humphreys, Gwendolyn I; Nardulli, Ann M; Kosari, Farhad; Vasmatzis, George; Taylor, William R; Ahlquist, David A; Myong, Sua; Bashir, Rashid

    2015-01-27

    DNA methylation is an epigenetic modification of DNA in which methyl groups are added at the 5-carbon position of cytosine. Aberrant DNA methylation, which has been associated with carcinogenesis, can be assessed in various biological fluids and potentially can be used as markers for detection of cancer. Analytically sensitive and specific assays for methylation targeting low-abundance and fragmented DNA are needed for optimal clinical diagnosis and prognosis. We present a nanopore-based direct methylation detection assay that circumvents bisulfite conversion and polymerase chain reaction amplification. Building on our prior work, we used methyl-binding proteins (MBPs), which selectively label the methylated DNA. The nanopore-based assay selectively detects methylated DNA/MBP complexes through a 19 nm nanopore with significantly deeper and prolonged nanopore ionic current blocking, while unmethylated DNA molecules were not detectable due to their smaller diameter. Discrimination of hypermethylated and unmethylated DNA on 90, 60, and 30 bp DNA fragments was demonstrated using sub-10 nm nanopores. Hypermethylated DNA fragments fully bound with MBPs are differentiated from unmethylated DNA at 2.1- to 6.5-fold current blockades and 4.5- to 23.3-fold transport durations. Furthermore, these nanopore assays can detect the CpG dyad in DNA fragments and could someday profile the position of methylated CpG sites on DNA fragments.

  2. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Science.gov (United States)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  3. Relative stability of transgene DNA fragments from GM rapeseed in mixed ruminal cultures.

    Science.gov (United States)

    Sharma, Ranjana; Alexander, Trevor W; John, S Jacob; Forster, Robert J; McAllister, Tim A

    2004-05-01

    The use of transgenic crops as feeds for ruminant animals has prompted study of the possible uptake of transgene fragments by ruminal micro-organisms and/or intestinal absorption of fragments surviving passage through the rumen. The persistence in buffered ruminal contents of seven different recombinant DNA fragments from GM rapeseed expressing the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) transgene was tracked using PCR. Parental and transgenic (i.e. glyphosphate-tolerant; Roundup Ready, Monsanto Company, St Louis, MO, USA) rapeseed were incubated for 0, 2, 4, 8, 12, 24 and 48 h as whole seeds, cracked seeds, rapeseed meal, and as pelleted, barley-based diets containing 65 g rapeseed meal/kg. The seven transgene fragments ranged from 179 to 527 bp and spanned the entire 1363 bp EPSPS transgene. A 180 bp ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) small subunit fragment and a 466 bp 16S rDNA fragment were used as controls for endogenous rapeseed DNA and bacterial DNA respectively. The limit of detection of the PCR assay, established using negative controls spiked with known quantities of DNA, was 12.5 pg. Production of gas and NH3 was monitored throughout the incubation and confirmed active in vitro fermentation. Bacterial DNA was detected in all sample types at all time points. Persistence patterns of endogenous (Rubisco) and recombinant (EPSPS) rapeseed DNA were inversely related to substrate digestibility (amplifiable for 48, 8 and 4 h in whole or cracked seeds, meal and diets respectively), but did not differ between parental and GM rapeseed, nor among fragments. Detection of fragments was representative of persistence of the whole transgene. No EPSPS fragments were amplifiable in microbial DNA, suggesting that transformation had not occurred during the 48 h incubation. Uptake of transgenic DNA fragments by ruminal bacteria is probably precluded or time-limited by rapid degradation of plant DNA upon plant cell lysis.

  4. Microfluidic chip for stacking, separation and extraction of multiple DNA fragments.

    Science.gov (United States)

    Wu, Ruige; Seah, Y P; Wang, Zhiping

    2016-03-11

    A disposable integrated microfluidic device was developed for rapid sample stacking, separation and extraction of multiple DNA fragments from a relatively large amount of sample. Isotachophoresis hyphenated gel electrophoresis (ITP-GE) was used to pre-concentrate and separate DNA fragments, followed by extraction of pure DNA fragments with electroelution on-chip. DNA fragments of 200bp, 500bp and 1kbp were successfully separated and collected in the extraction chamber within 25min. The extraction efficiency obtained from the chip was 49.9%, 52.1% and 53.7% for 200bp, 500bp and 1kbp DNA fragments, respectively. The extracted DNA fragments exhibited compatibility with downstream enzymatic reactions, for example PCR. The chip was also used to extract DNA fragments with specific size range from sheared genomic DNA and demonstrated similar performance to that using traditional gel cutting method. The whole assay can finish in 32min, 6 times faster than traditional method. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Influence of the electrokinetic injection conditions on the separation of DNA fragments in capillary electrophoresis

    OpenAIRE

    Catai Jonatan Ricardo; Carrilho Emanuel

    2004-01-01

    In genetic analysis by capillary electrophoresis with polymer solutions there are many variables that affect separation of the DNA fragments. A very critical one is the sample injection process, which can considerably affect the peak efficiency and the resolution. In this work, we have studied the influence of the DNA sample composition and the electrokinetic injection conditions in the separation of DNA fragments by capillary electrophoresis using replaceable polymer solutions. The studies w...

  6. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    International Nuclear Information System (INIS)

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  8. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  9. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    Organisms release DNA both when they live and die. Eventually the DNA disintegrates entirely or it is re-metabolized. There is a constant deposition and decomposition that maintains an environmental pool with large quantities of extracellular DNA, some of which can be thousands of years old. The ...... in chemistry. In addition to qualitative DNA sequencing, statistical analysis of the numerous sequencing reads yields quantitative measurements of DNA modifying reactions....

  10. [Subcloning and sequencing of DNA fragment related to salt tolerance in Sinorhizobium fredii RT19].

    Science.gov (United States)

    Bian, X L; Ge, S C; Yang, S S

    2000-01-01

    A 23 kb DNA fragment related to salt tolerance was obtained from the gene library of S. fredii strain RT19. In this study, BamH I was selected to digest 23 kb DNA fragment into different length of DNA fragments. The resulting fragments were ligated with plasmid pML122, then the recombinant plasmids were transformed to competent cells of E. coli S17-1 on selective medium and three transformants TR were obtained. Two-parental mating experiments were carried out with these transformants as donor and salt sensitive S. fredii strain RC3-3 as recipient, and the transconjugant BR2 was selected on FY plates containing gentamycin and 0.4 mol/L NaCl. Thus, a 4.4 kb DNA fragment related to salt tolerance was obtained. Based on its physical map, six restriction fragments were subcloned into plasmid pUC18 for DNA sequencing. Subsequently, sequencing and analysis of 4.4 kb DNA fragment showed that fixO, fixN genes and three ORFs were obtained.

  11. PCR typing of DNA fragments of the short tandem repeat (STR) system HUMTH01 in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Møller, A; Morling, N

    1994-01-01

    Forensic Science Research and Training Center (FSRTC), Quantico, and at the Institut für Rechtsmedizin, Münster, Germany. Concordant HUMTH01 types were found in 39 out of 40 individuals. The allele which led to discrepant typing results was assigned type 9.3 in two laboratories and type 10 in one......DNA from the short tandem repeat (STR) system HUMTH01 was amplified by the polymerase chain reaction (PCR) and analyzed by vertical electrophoresis in polyacrylamide gels followed by silver staining. DNA samples from 100 unrelated Danes, 147 unrelated Greenland Eskimos, and 89 Danish mother....../child pairs were analyzed. Significant differences were observed between the distribution of fragments ('alleles'), whereby allele number 7 was considerably more frequent in Eskimos (0.687) than in Danes (0.201). The distributions of HUMTH01 phenotypes were in Hardy-Weinberg equilibrium in both the Eskimo...

  12. New approach to assess sperm DNA fragmentation dynamics: Fine-tuning mathematical models.

    Science.gov (United States)

    Ortiz, Isabel; Dorado, Jesús; Morrell, Jane; Gosálvez, Jaime; Crespo, Francisco; Jiménez, Juan M; Hidalgo, Manuel

    2017-01-01

    Sperm DNA fragmentation (sDF) has been proved to be an important parameter in order to predict in vitro the potential fertility of a semen sample. Colloid centrifugation could be a suitable technique to select those donkey sperm more resistant to DNA fragmentation after thawing. Previous studies have shown that to elucidate the latent damage of the DNA molecule, sDF should be assessed dynamically, where the rate of fragmentation between treatments indicates how resistant the DNA is to iatrogenic damage. The rate of fragmentation is calculated using the slope of a linear regression equation. However, it has not been studied if sDF dynamics fit this model. The objectives of this study were to evaluate the effect of different after-thawing centrifugation protocols on sperm DNA fragmentation and elucidate the most accurate mathematical model (linear regression, exponential or polynomial) for DNA fragmentation over time in frozen-thawed donkey semen. After submitting post-thaw semen samples to no centrifugation (UDC), sperm washing (SW) or single layer centrifugation (SLC) protocols, sDF values after 6 h of incubation were significantly lower in SLC samples than in SW or UDC. Coefficient of determination (R 2 ) values were significantly higher for a second order polynomial model than for linear or exponential. The highest values for acceleration of fragmentation (aSDF) were obtained for SW, followed by SLC and UDC. SLC after thawing seems to preserve longer DNA longevity in comparison to UDC and SW. Moreover, the fine-tuning of models has shown that sDF dynamics in frozen-thawed donkey semen fit a second order polynomial model, which implies that fragmentation rate is not constant and fragmentation acceleration must be taken into account to elucidate hidden damage in the DNA molecule.

  13. A simple, efficient and inexpensive method for malaria parasites' DNA catching from fixed Giemsa-stained blood slides.

    Science.gov (United States)

    Eskandarian, Abbas Ali; Moradi, Sara; Abedi, Saeed

    2016-09-01

    As parasitological or microscopic method is the gold standard and the best method for diagnosis of malaria, so fixed Geimsa-stained blood slides in the form of thick and thin blood smears are the most important data collections of malaria, especially historical slides. The parasites are dead but their DNA is valuable for many molecular biologic researches. A simple and efficient method for catching and extraction malaria parasites' DNA with a desired yield from dried and stained blood on slides is the first and major step. Introduction of an applicable, efficient and inexpensive DNA catching method and assessment of its performance in following molecular applications  was the main objective of present study.

  14. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  15. Efficient double fragmentation ChIP-seq provides nucleotide resolution protein-DNA binding profiles

    NARCIS (Netherlands)

    Mokry, M.; Hatzis, P.; de Bruijn, E.; Koster, J.; Versteeg, R.; Schuijers, J.; van de Wetering, M.L.; Guryev, V.; Clevers, H.; Cuppen, E.

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  16. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  17. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Directory of Open Access Journals (Sweden)

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  18. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  19. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  20. The Restriction Fragment Map of Rat-Liver Mitochondrial DNA : A Reconsideration

    NARCIS (Netherlands)

    Pepe, G.; Bakker, H.; Holtrop, M.; Bollen, J.E.; Bruggen, E.F.J. van; Cantatore, P.; Terpstra, P.; Saccone, C.

    1977-01-01

    1. Rat-liver mitochondrial DNA (mtDNA) contains at least 8 cleavage sites for the restriction endonuclease Eco RI, 6 for the restriction endonuclease Hind III, 2 for the restriction endonuclease Bam HI and 11 for the restriction endonuclease Hap II. 2. The physical map of the restriction fragments

  1. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Bungum, Mona Berger Håkonsen; Fedder, J

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR...

  2. [Subcloning and sequencing of DNA fragment related to salt tolerance in Sinorhizobium meliloti 042B].

    Science.gov (United States)

    Ge, S; Fan, Z; Chen, X; Yang, S

    2001-02-01

    A 4 kb ClaI DNA fragment related to salt tolerance from S. meliloti 042B was digested by HindIII down 2.4 kb fragment, and a 1.6 kb ClaII-HindIII fragment was retained on plasmid pML122. Then, the 2.4 kb DNA fragment was ligated with plasmid pBBR1-MCS2, and the recombinant plasmid was transformed to E. coli DH5 alpha, and transformant GS2 was obtained. Three-parental mating experiments were carried out with transformant GS2 as donor, salt sensitive strains GZ17 as recipient and pRK2013 as helper plasmid, then the transconjugant GG2 was selected on FY plates containing kanamycin and 0.4 mol/L NaCl. The remaining DNA fragment was self ligated with pML122 and then transformed into E. coli S17-1 and transformat GS0 was obtained. Two-parental mating experiment was carried out with transformant GS0 as donor and salt sensitive strain GZ17 as recipient, but no transconjugant was obtained on the FY plates. Then, the 2.4 kb HindIII DNA fragment was ligated into sequencing vector pGEM-7Zf(+) for sequencing. The result of sequencing and analysis showed that the 2.4 kb DNA fragment contained three ORFs. According to the result of sequencing, further subcloning was conducted and 1.9 kb HindIII-Sac II DNA fragment related to salt tolerance was obtained.

  3. Selenium Incorporated Cationic Organochalcogen: Live Cell Compatible and Highly Photostable Molecular Stain for Imaging and Localization of Intracellular DNA.

    Science.gov (United States)

    Gaur, Pankaj; Kumar, Ajay; Dey, Gourab; Kumar, Rajendra; Bhattacharyya, Shalmoli; Ghosh, Subrata

    2016-05-04

    Successful integration of selenium unit into a newly designed cationic chemical architecture led to the development of a highly photostable molecular maker PA5 to be used in fluorescence microscopy as cellular nucleus staining agent for longer duration imaging under continuous laser illumination. Adaptation of a targeted single-atom modification strategy led to the development of a series of proficient DNA light-up probes (PA1-PA5). Further, their comparative photophysical studies in the presence of DNA revealed the potential of electron rich heteroatoms of chalcogen family in improving binding efficiency and specificity of molecular probes toward DNA. The findings of cell studies confirmed the outstanding cell compatibility of probe PA5 in terms of cell permeability, biostability, and extremely low cytotoxicity. Moreover, the photostability experiment employing continuous laser illumination in solution phase as well as in cell assay (both fixed and live cells) revealed the admirable photobleaching resistance of PA5. Finally, while investigating the phototoxicity of PA5, the probe was found not to exhibit light-induced toxicity even when irradiated for longer duration. All these experimental results demonstrated the promising standing of PA5 as a futuristic cell compatible potential stain for bioimaging and temporal profiling of DNA.

  4. Hyperbolic SOM-based clustering of DNA fragment features for taxonomic visualization and classification.

    Science.gov (United States)

    Martin, Christian; Diaz, Naryttza N; Ontrup, Jörg; Nattkemper, Tim W

    2008-07-15

    Modern high-throughput sequencing technologies enable the simultaneous analysis of organisms in an environment. The analysis of species diversity and the binning of DNA fragments of non-sequenced species for assembly are two major challenges in sequence analysis. To achieve reasonable binnings and classifications, DNA fragment structure has to be represented appropriately, so it can be processed by machine learning algorithms. Hierarchically growing hyperbolic Self-Organizing maps (H(2)SOMs) are trained to cluster small variable-length DNA fragments (0.2-50 kb) of 350 prokaryotic organisms at six taxonomic ranks Superkingdom, Phylum, Class, Order, Genus and Species in the Tree of Life. DNA fragments are mapped to three different types of feature vectors based on the genomic signature: basic features, features considering the importance of oligonucleotide patterns as well as contrast enhanced features. The H (2)SOM classifier achieves high classification rates while at the same time its visualization allows further insights into the projected data and has the potential to support binning of short sequence reads, because DNA fragments can be grouped into phylogenetic groups. An implementation of the H(2)HSOM classifier in Matlab is provided at www.techfak.uni-bielefeld.de/ags/ani/projects/HHSOMSeqData.

  5. Effect of different gravity environments on DNA fragmentation and cell death in Kalanchoe leaves.

    Science.gov (United States)

    Pedroso, M C; Durzan, D J

    2000-11-01

    Different gravity environments have been shown to significantly affect leaf-plantlet formation and asexual reproduction in Kalanchoë daigremontiana Ham. and Perr. In the present work, we investigated the effect of gravity at tissue and cell levels. Leaves and leaf-plantlets were cultured for different periods of time (min to 15 d) in different levels of gravity stimulation: simulated hypogravity (1 rpm clinostats; 2 x 10(-4) g), 1 g (control) and hypergravity (centrifugation; 20 and 150 g). Both simulated hypogravity and hypergravity affected cell death (apoptosis) in this species, and variations in the number of cells showing DNA fragmentation directly correlated with nitric oxide (NO) formation. Apoptosis in leaves was more common as gravity increased. Apoptotic cells were localized in the epidermis, mainly guard cells, in leaf parenchyma, and in tracheary elements undergoing terminal differentiation. Exposures to acute hypergravity (up to 60 min) showed that chloroplast DNA fragmentation occurred prior to nuclear DNA fragmentation, marginalization of chromatin, nuclear condensation, and nuclear blebbing. Addition of sodium nitroprusside (NO donor) mimicked centrifugation. NO and DNA fragmentation decreased with N(G)-monomethyl-L-arginine (NO-synthase inhibitor). The variations in NO levels, nucleoid DNA fragmentation, and cell death show how chloroplasts, cells and leaves may respond (and adapt) to gravity changes. c 2000 Annals of Botany Company.

  6. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  7. Simulating Molecular Interactions of Carbon Nanoparticles with a Double-Stranded DNA Fragment

    Directory of Open Access Journals (Sweden)

    Zhuang Wang

    2015-01-01

    Full Text Available Molecular interactions between carbon nanoparticles (CNPs and a double-stranded deoxyribonucleic acid (dsDNA fragment were investigated using molecular dynamics (MD simulations. Six types of CNPs including fullerenes (C60 and C70, (8,0 single-walled carbon nanotube (SWNT, (8,0 double-walled carbon nanotube (DWNT, graphene quantum dot (GQD, and graphene oxide quantum dot (GOQD were studied. Analysis of the best geometry indicates that the dsDNA fragment can bind to CNPs through pi-stacking and T-shape. Moreover, C60, DWNT, and GOQD bind to the dsDNA molecules at the minor groove of the nucleotide, and C70, SWNT, and GQD bind to the dsDNA molecules at the hydrophobic ends. Estimated interaction energy implies that van der Waals force may mainly contribute to the mechanisms for the dsDNA-C60, dsDNA-C70, and dsDNA-SWNT interactions and electrostatic force may contribute considerably to the dsDNA-DWNT, dsDNA-GQD, and dsDNA-GOQD interactions. On the basis of the results from large-scale MD simulations, it was found that the presence of the dsDNA enhances the dispersion of C60, C70, and SWNT in water and has a slight impact on DWNT, GQD, and GOQD.

  8. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

  9. RNA/DNA co-analysis from human saliva and semen stains--results of a third collaborative EDNAP exercise

    DEFF Research Database (Denmark)

    Haas, Claus; Hanson, E; Anjos, M J

    2013-01-01

    A third collaborative exercise on RNA/DNA co-analysis for body fluid identification and STR profiling was organized by the European DNA Profiling Group (EDNAP). Twenty saliva and semen stains, four dilution series (10-0.01 µl saliva, 5-0.01 µl semen) and, optionally, bona fide or mock casework...... samples of human or non-human origin were analyzed by 20 participating laboratories using an RNA extraction or RNA/DNA co-extraction method. Two novel mRNA multiplexes were used: a saliva triplex (HTN3, STATH and MUC7) and a semen pentaplex (PRM1, PRM2, PSA, SEMG1 and TGM4). The laboratories used...

  10. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... interest by PCR using proof reading DNA polymerase, such as Pfu, KOD and Primerstar, is preferred since the. PCR products with a higher degree of fidelity are required in many investigations. However, traditional blunt-end cloning method for direct cloning of blunt-end PCR products is not efficient since ...

  11. SYBR Green I staining of pulsed field agarose gels is a sensitive and inexpensive way of quantitating DNA double-strand breaks in mammalian cells.

    OpenAIRE

    Kiltie, A E; Ryan, A J

    1997-01-01

    Pulsed field gel electrophoresis (PFGE) is widely used to measure DNA double strand breaks (dsb). The DNA of cultured cells can be prelabelled with radioactivity, which helps greatly in detection and quantitation of DNA dsb. However, this approach cannot be used with non-cycling cells from biopsy material. We describe a method which uses SYBR Green I to stain DNA in dried agarose gels. DNA is detected and analysed using readily available camera equipment and image analysis software. This meth...

  12. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  13. Dual examinations for identification of urine as being of human origin and for DNA-typing from small stains of human urine.

    Science.gov (United States)

    Nakazono, Takehiko; Kashimura, Seiich; Hayashiba, Yasuhiko; Hara, Kenji; Matsusue, Aya; Augustin, Christa

    2008-03-01

    Concurrent methods for identification of urine as being of human origin, and for DNA-typing from small stains of human urine were examined. A urine stain was extracted with phosphate-buffered saline (PBS), and the extract was filtered using a Centricon-100 device. The filtrate was subjected to electrospray ionization liquid chromatography-mass spectrometry (ESI-LC-MS) for identification of human urine and a DNA-typing sample was obtained by dialfiltration of the residue using a DNA purification kit. After the purified residue was treated with an AmpflSTR Profiler PCR amplification kit, the DNA-types were analyzed by capillary electrophoresis using a Genetic Analyzer. It was possible to identify a urine stain as being of human origin, and complete DNA profiles could be successfully obtained from a urine stain which had been created by 50 microL of female urine. Serial analyses of urine stains found at a crime scene provide effective information for forensic investigation. This method is recommended for stain identification and for DNA-typing from a urine stain.

  14. The Flp double cross system a simple efficient procedure for cloning DNA fragments

    Directory of Open Access Journals (Sweden)

    Sadowski Paul D

    2003-07-01

    Full Text Available Abstract Background While conventional cloning methods using restriction enzymes and polynucleotide ligase are adequate for most DNAs, fragments made by the polymerase chain reaction are difficult to clone because the amplifying DNA polymerase tends to add untemplated nucleotides to the 3'-termini of the amplified strands. Conservative site-specific recombinases offer an efficient alternative to conventional cloning methods. Results In this paper I describe the use of the Flp site-specific recombinase for cloning PCR-amplified fragments. A DNA fragment is amplified with primers that contain at their ends inverted target sequences for Flp. Flp readily recombines these fragments in vitro into a vector that also contains two inverted Flp target sequences surrounding the α-complementing region of the lacZ gene of E. coli. The recombinants are conveniently detected as white colonies by the familiar blue/white screening test for lacZ activity. A useful feature of the system is that both orientations of the inserted DNA are usually obtained. If the recipient vector is cut between the two inverted Flp targets, Flp "heals" the double-strand break by inserting a linear fragment flanked by Flp targets. Conclusion This system ("The Flp Double Cross System" should be useful for cloning multiple PCR fragments into many sites in several vectors. It has certain advantages over other available recombinase-based cloning procedures.

  15. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  16. Sperm DNA fragmentation: An early and reliable marker of air pollution.

    Science.gov (United States)

    Bosco, Liana; Notari, Tiziana; Ruvolo, Giovanni; Roccheri, Maria C; Martino, Chiara; Chiappetta, Rosanna; Carone, Domenico; Lo Bosco, Giosuè; Carrillo, Laura; Raimondo, Salvatore; Guglielmino, Antonino; Montano, Luigi

    2018-03-01

    Environmental factors could have a key role in the continuous and remarkable decline of sperm quality observed in the last decades. This study compared the seminal parameters and sperm DFI in men living in areas with different levels of air pollution. Results demonstrate that both steel plants workers and patients living in a high polluted area show a mean percentage of sperm DNA fragmentation above 30%, highlighting a clear sperm damage. In this work, two different techniques were used to measure sperm DNA damage in patients' groups, finding in both cases a high sperm DFI in patients living in polluted areas. We candidate sperm DNA fragmentation as a valuable early marker of the presence and harmful effects of pollution. We suggest that sperm DNA evaluation could be both an indicator of individual health and reproductive capacity, and a suitable datum to connect the surrounding environment with its effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    International Nuclear Information System (INIS)

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  18. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  19. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  20. FragMatch--a program for the analysis of DNA fragment data.

    Science.gov (United States)

    Saari, T A; Saari, S K; Campbell, C D; Alexander, I J; Anderson, I C

    2007-03-01

    FragMatch is a user-friendly Java-supported program that automates the identification of taxa present in mixed samples by comparing community DNA fragment data against a database of reference patterns for known species. The program has a user-friendly Windows interface and was primarily designed for the analysis of fragment data derived from terminal restriction fragment length polymorphism analysis of ectomycorrhizal fungal communities, but may be adapted for other applications such as microsatellite analyses. The program uses a simple algorithm to check for the presence of reference fragments within sample files that can be directly imported, and the results appear in a clear summary table that also details the parameters that were used for the analysis. This program is significantly more flexible than earlier programs designed for matching RFLP patterns as it allows default or user-defined parameters to be used in the analysis and has an unlimited database size in terms of both the number of reference species/individuals and the number of diagnostic fragments per database entry. Although the program has been developed with mycorrhizal fungi in mind, it can be used to analyse any DNA fragment data regardless of biological origin. FragMatch, along with a full description and users guide, is freely available to download from the Aberdeen Mycorrhiza Group web page (http://www.aberdeenmycorrhizas.com).

  1. A general method to modify BACs to generate large recombinant DNA fragments.

    Science.gov (United States)

    Shen, Wei; Huang, Yue; Tang, Yi; Liu, De-Pei; Liang, Chih-Chuan

    2005-11-01

    Bacterial artificial chromosome (BAC) has the capacity to clone DNA fragments in excess of 300 kb. It also has the considerable advantages of stable propagation and ease of purification. These features make BAC suitable in genetic research, such as library construction, transgenic mice production, and gene targeting constructs. Homologous recombination in Escherichia coli, a process named recombineering, has made the modification of BACs easy and reliable. We report here a modified recombineering method that can efficiently mediate the fusion of large DNA fragments from two or more different BACs. With the introduction of kanamycin-resistant gene and proposed rare-cutting restriction endonuclease (RCRE) sites into two BACs, a 82.6-kb DNA fragment containing the inverted human alpha-globin genes (theta, alpha1, alpha2, and zeta) from BAC191K2 and the locus control region (LCR) of human beta-globin gene locus (from the BAC186D7) was reconstructed. This approach for combining different BAC DNA fragments should facilitate many kinds of genomic experiments.

  2. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  3. Romanowsky dyes and Romanowsky-Giemsa effect. 5. Structural investigations of the purple DNA-AB-EY dye complexes of Romanowsky-Giemsa staining.

    Science.gov (United States)

    Friedrich, K; Seiffert, W; Zimmermann, H W

    1990-01-01

    A reproducible Romanowsky-Giemsa staining (RGS) can be carried out with standardized staining solutions containing the two dyes azure B (AB) and eosin Y (EY). After staining, cell nuclei have a purple coloration generated by DNA-AB-EY complexes. The microspectra of cell nuclei have a sharp and intense absorption band at 18,100 cm-1 (552 nm), the so called Romanowsky band (RB), which is due to the EY chromophore of the dye complexes. Other absorption bands can be assigned to the DNA-bound AB cations. Artificial DNA-AB-EY complexes can be prepared outside the cell by subsequent staining of DNA with AB and EY. In the first step of our staining experiments we prepared thin films of blue DNA-AB complexes on microslides with 1:1 composition: each anionic phosphodiester residue of the nucleic acid was occupied by one AB cation. Microspectrophotometric investigations of the dye preparations demonstrated that, besides monomers and dimers, mainly higher AB aggregates are bound to DNA by electrostatic and hydrophobic interactions. These DNA-AB complexes are insoluble in water. Therefore it was possible to stain the DNA-AB films with aqueous EY solutions and also to prepare insoluble DNA-AB-EY films in the second step of the staining experiments. After the reaction with EY, thin sites within the dye preparations were purple. The microspectra of the purple spots show a strong Romanowsky band at 18,100 cm-1. Using a special technique it was possible to estimate the composition of the purple dye complexes. The ratio of the two dyes was approximately EY:AB approximately 1:3. The EY anions are mainly bound by hydrophobic interaction to the AB framework of the electrical neutral DNA-AB complexes. The EY absorption is red shifted by the interaction of EY with the AB framework of DNA-AB-EY. We suppose that this red shift is caused by a dielectric polarization of the bound EY dianions. The DNA chains in the DNA-AB complexes can mechanically be aligned in a preferred direction k. Highly

  4. Digital analysis of cDNA abundance; expression profiling by means of restriction fragment fingerprinting

    Directory of Open Access Journals (Sweden)

    Regenbogen Johannes

    2002-03-01

    Full Text Available Abstract Background Gene expression profiling among different tissues is of paramount interest in various areas of biomedical research. We have developed a novel method (DADA, Digital Analysis of cDNA Abundance, that calculates the relative abundance of genes in cDNA libraries. Results DADA is based upon multiple restriction fragment length analysis of pools of clones from cDNA libraries and the identification of gene-specific restriction fingerprints in the resulting complex fragment mixtures. A specific cDNA cloning vector had to be constructed that governed missing or incomplete cDNA inserts which would generate misleading fingerprints in standard cloning vectors. Double stranded cDNA was synthesized using an anchored oligo dT primer, uni-directionally inserted into the DADA vector and cDNA libraries were constructed in E. coli. The cDNA fingerprints were generated in a PCR-free procedure that allows for parallel plasmid preparation, labeling, restriction digest and fragment separation of pools of 96 colonies each. This multiplexing significantly enhanced the throughput in comparison to sequence-based methods (e.g. EST approach. The data of the fragment mixtures were integrated into a relational database system and queried with fingerprints experimentally produced by analyzing single colonies. Due to limited predictability of the position of DNA fragments on the polyacrylamid gels of a given size, fingerprints derived solely from cDNA sequences were not accurate enough to be used for the analysis. We applied DADA to the analysis of gene expression profiles in a model for impaired wound healing (treatment of mice with dexamethasone. Conclusions The method proved to be capable of identifying pharmacologically relevant target genes that had not been identified by other standard methods routinely used to find differentially expressed genes. Due to the above mentioned limited predictability of the fingerprints, the method was yet tested only with

  5. Labelling of Cells Engaged in DNA Synthesis: Autoradiography and BrdU Staining

    DEFF Research Database (Denmark)

    Madsen, Peder Søndergaard

    2010-01-01

    The cell cycle is divided in four phases: G1 phase, S phase (DNA-synthesis), G2 phase (together termed interphase) and M phase (mitosis). Cells that have ceased proliferation enter a state of quiescence called G0. M phase is itself composed of two tightly coupled processes: mitosis, in which...

  6. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  7. SYBR Green I staining of pulsed field agarose gels is a sensitive and inexpensive way of quantitating DNA double-strand breaks in mammalian cells.

    Science.gov (United States)

    Kiltie, A E; Ryan, A J

    1997-07-15

    Pulsed field gel electrophoresis (PFGE) is widely used to measure DNA double strand breaks (dsb). The DNA of cultured cells can be prelabelled with radioactivity, which helps greatly in detection and quantitation of DNA dsb. However, this approach cannot be used with non-cycling cells from biopsy material. We describe a method which uses SYBR Green I to stain DNA in dried agarose gels. DNA is detected and analysed using readily available camera equipment and image analysis software. This method is as sensitive as [3H]thymidine prelabelling of cells and allows DNA dsb to be measured simply and economically in non-cycling cells.

  8. Generation of longer 3' cDNA fragments from massively parallel signature sequencing tags.

    Science.gov (United States)

    Silva, Ana Paula M; Chen, Jianjun; Carraro, Dirce M; Wang, San Ming; Camargo, Anamaria A

    2004-07-06

    Massively Parallel Signature Sequencing (MPSS) is a powerful technique for genome-wide gene expression analysis, which, similar to SAGE, relies on the production of short tags proximal to the 3'end of transcripts. A single MPSS experiment can generate over 10(7) tags, providing a 10-fold coverage of the transcripts expressed in a human cell. A significant fraction of MPSS tags cannot be assigned to known transcripts (orphan tags) and are likely to be derived from transcripts expressed at very low levels (approximately 1 copy per cell). In order to explore the potential of MPSS for the characterization of the human transcriptome, we have adapted the GLGI protocol (Generation of Longer cDNA fragments from SAGE tags for Gene Identification) to convert MPSS tags into their corresponding 3' cDNA fragments. GLGI-MPSS was applied to 83 orphan tags and 41 cDNA fragments were obtained. The analysis of these 41 fragments allowed the identification of novel transcripts, alternative tags generated from polymorphic and alternatively spliced transcripts, as well as the detection of artefactual MPSS tags. A systematic large-scale analysis of the genome by MPSS, in combination with the use of GLGI-MPSS protocol, will certainly provide a complementary approach to generate the complete catalog of human transcripts.

  9. Generation of longer 3′ cDNA fragments from massively parallel signature sequencing tags

    Science.gov (United States)

    Silva, Ana Paula M.; Chen, Jianjun; Carraro, Dirce M.; Wang, San Ming; Camargo, Anamaria A.

    2004-01-01

    Massively Parallel Signature Sequencing (MPSS) is a powerful technique for genome-wide gene expression analysis, which, similar to SAGE, relies on the production of short tags proximal to the 3′end of transcripts. A single MPSS experiment can generate over 107 tags, providing a 10-fold coverage of the transcripts expressed in a human cell. A significant fraction of MPSS tags cannot be assigned to known transcripts (orphan tags) and are likely to be derived from transcripts expressed at very low levels (∼1 copy per cell). In order to explore the potential of MPSS for the characterization of the human transcriptome, we have adapted the GLGI protocol (Generation of Longer cDNA fragments from SAGE tags for Gene Identification) to convert MPSS tags into their corresponding 3′ cDNA fragments. GLGI-MPSS was applied to 83 orphan tags and 41 cDNA fragments were obtained. The analysis of these 41 fragments allowed the identification of novel transcripts, alternative tags generated from polymorphic and alternatively spliced transcripts, as well as the detection of artefactual MPSS tags. A systematic large-scale analysis of the genome by MPSS, in combination with the use of GLGI-MPSS protocol, will certainly provide a complementary approach to generate the complete catalog of human transcripts. PMID:15247327

  10. Extraction and detection of Mycobacterium leprae DNA from ZNCF-stained skin smear slides for better identification of negative skin smears

    Directory of Open Access Journals (Sweden)

    Kamble R

    2010-01-01

    Full Text Available Abstract Identification of Mycobacterium leprae, which causes leprosy, is done by Ziehl Neelsen Carbol Fuchsin (ZNCF stained slit skin smear microscopy that aids in the diagnosis and quantification of approximate bacterial load carried by the patient. We attempted M. leprae DNA extraction from 46 stained slit skin smear negative slides, using Proteinase K and SDS lysis, followed by ethanol precipitation. M. leprae specific primers (16SrRNA were used for PCR-based amplification of DNA. We could detect M. leprae DNA in 15 (32.6% samples. The method can be useful in the diagnosis of apparently slit skin smear negative leprosy cases.

  11. Combination of native and denaturing PAGE for the detection of protein binding regions in long fragments of genomic DNA

    Directory of Open Access Journals (Sweden)

    Metsis Madis

    2008-06-01

    Full Text Available Abstract Background In a traditional electrophoresis mobility shift assay (EMSA a 32P-labeled double-stranded DNA oligonucleotide or a restriction fragment bound to a protein is separated from the unbound DNA by polyacrylamide gel electrophoresis (PAGE in nondenaturing conditions. An extension of this method uses the large population of fragments derived from long genomic regions (approximately 600 kb for the identification of fragments containing protein binding regions. With this method, genomic DNA is fragmented by restriction enzymes, fragments are amplified by PCR, radiolabeled, incubated with nuclear proteins and the resulting DNA-protein complexes are separated by two-dimensional PAGE. Shifted DNA fragments containing protein binding sites are identified by using additional procedures, i. e. gel elution, PCR amplification, cloning and sequencing. Although the method allows simultaneous analysis of a large population of fragments, it is relatively laborious and can be used to detect only high affinity protein binding sites. Here we propose an alternative and straightforward strategy which is based on a combination of native and denaturing PAGE. This strategy allows the identification of DNA fragments containing low as well as high affinity protein binding regions, derived from genomic DNA ( Results We have combined an EMSA-based selection step with subsequent denaturing PAGE for the localization of protein binding regions in long (up to10 kb fragments of genomic DNA. Our strategy consists of the following steps: digestion of genomic DNA with a 4-cutter restriction enzyme (AluI, BsuRI, TruI, etc, separation of low and high molecular weight fractions of resultant DNA fragments, 32P-labeling with Klenow polymerase, traditional EMSA, gel elution and identification of the shifted bands (or smear by denaturing PAGE. The identification of DNA fragments containing protein binding sites is carried out by running the gel-eluted fragments alongside

  12. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  13. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  14. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Directory of Open Access Journals (Sweden)

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  15. From the chromosome to DNA: Restriction fragment length polymorphism analysis and its clinical application.

    Science.gov (United States)

    Todd, R; Donoff, R B; Kim, Y; Wong, D T

    2001-06-01

    Understanding how chromosomal alterations contribute to acquired and inherited human disease requires the ability to manage the enormous physical and informational complexity of the deoxyribonucleic acid (DNA) packaged within. Important concepts and techniques involved in the analysis of DNA include restriction enzymes, Southern blotting, and restriction fragment length polymorphism/linkage analysis. These techniques have been essential in the understanding and diagnosis of several syndromes associated with the head and neck. The purpose of this article is to introduce DNA structure, describe some techniques fundamental to DNA analysis, and provide a brief overview of the clinical applications of this technology with respect to dentinogenesis imperfecta and oral field cancerization. Copyright 2001 American Association of Oral and Maxillofacial Surgeons.

  16. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    International Nuclear Information System (INIS)

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  17. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Energy Technology Data Exchange (ETDEWEB)

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  18. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  19. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    International Nuclear Information System (INIS)

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  20. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  1. Assessment of sperm function parameters and DNA fragmentation in ejaculated alpaca sperm (Lama pacos) by flow cytometry.

    Science.gov (United States)

    Cheuquemán, C; Merino, O; Giojalas, L; Von Baer, A; Sánchez, R; Risopatrón, J

    2013-06-01

    Flow cytometry has been shown to be an accurate and highly reproducible tool for the analysis of sperm function. The main objective of this study was to assess sperm function parameters in ejaculated alpaca sperm by flow cytometry. Semen samples were collected from six alpaca males and processed for flow cytometric analysis of sperm viability and plasma membrane integrity using SYBR-14⁄PI staining; acrosomal membrane integrity using FITC-conjugated Pisum Sativum Agglutinin⁄PI labelling; mitochondrial membrane potential (Δψm) by staining with JC-1 and DNA Fragmentation Index (DFI) by TUNEL. The results indicate that the mean value for sperm viability was 57 ± 8 %. Spermatozoa with intact acrosome membrane was 87.9 ± 5%, and viable sperm with intact acrosomal membrane was 46.8 ± 9%, high mitochondrial membrane potential (Δψm) was detected in 66.32 ± 9.51% of spermatozoa and mean DFI value was 0.91 ± 0.9%. The DFI was inversely correlated with high Δψm (p = 0.04; r = -0.41) and with plasma membrane integrity (p = 0.01; r = -0.47). To our knowledge, this is the first report of the assessment on the same sample of several parameters of sperm function in ejaculated alpaca sperm by flow cytometry. © 2012 Blackwell Verlag GmbH.

  2. Cell-free DNA fragmentation patterns in amniotic fluid identify genetic abnormalities and changes due to storage.

    Science.gov (United States)

    Peter, Inga; Tighiouart, Hocine; Lapaire, Olav; Johnson, Kirby L; Bianchi, Diana W; Terrin, Norma

    2008-09-01

    Circulating cell-free DNA (cfDNA) has become a promising biomarker in prenatal diagnosis. However, despite extensive studies in different body fluids, cfDNA predictive value is uncertain owing to the confounding factors that can affect its levels, such as gestational age, maternal weight, smoking status, and medications. Residual fresh and archived amniotic fluid (AF) supernatants were obtained from gravid women (mean gestational age 17 wk) carrying euploid (N=36) and aneuploid (N=29) fetuses, to characterize cfDNA-fragmentation patterns with regard to aneuploidy and storage time (-80 degrees C). AF cfDNA was characterized by the real-time quantitative polymerase chain reaction amplification of glyceraldehyde-3-phosphate dehydrogenase, gel electrophoresis, and pattern recognition of the DNA fragmentation. The distributions of cfDNA fragment lengths were compared using 6 measures that defined the locations and slopes for the first and last peaks, after elimination of the confounding variables. This method allowed for the unique classification of euploid and aneuploid cfDNA samples in AF, which had been matched for storage time. In addition, we showed that archived euploid AF samples gradually lose long cfDNA fragments: this loss accurately distinguishes them from the fresh samples. We present preliminary data using cfDNA-fragmentation patterns, to uniquely distinguish between AF samples of pregnant women with regard to aneuploidy and storage time, independent of gestational age and initial DNA amount. In addition to potential applications in prenatal diagnosis, these data suggest that archived AF samples consist of large amounts of short cfDNA fragments, which are undetectable using standard real-time polymerase chain reaction amplification.

  3. Dimerization of the Klenow fragment of Escherichia coli DNA polymerase I is linked to its mode of DNA binding.

    Science.gov (United States)

    Bailey, Michael F; Van der Schans, Edwin J C; Millar, David P

    2007-07-10

    Upon associating with a proofreading polymerase, the nascent 3' end of a DNA primer/template has two possible fates. Depending upon its suitability as a substrate for template-directed extension or postsynthetic repair, it will bind either to the 5'-3' polymerase active site, yielding a polymerizing complex, or to the 3'-5' exonuclease site, yielding an editing complex. In this investigation, we use a combination of biochemical and biophysical techniques to probe the stoichiometry, thermodynamic, and kinetic stability of the polymerizing and editing complexes. We use the Klenow fragment of Escherichia coli DNA polymerase I (KF) as a model proofreading polymerase and oligodeoxyribonucleotide primer/templates as model DNA substrates. Polymerizing complexes are produced by mixing KF with correctly base paired (matched) primer/templates, whereas editing complexes are produced by mixing KF with multiply mismatched primer/templates. Electrophoretic mobility shift titrations carried out with matched and multiply mismatched primer/templates give rise to markedly different electrophoretic patterns. In the case of the matched primer/template, the KF.DNA complex is represented by a slow moving band. However, in the case of the multiply mismatched primer/template, the complex is predominantly represented by a fast moving band. Analytical ultracentrifugation measurements indicate that the fast and slow moving bands correspond to 1:1 and 2:1 KF.DNA complexes, respectively. Fluorescence anisotropy titrations reveal that KF binds with a higher degree of cooperativity to the matched primer/template. Taken together, these results indicate that KF is able to dimerize on a DNA primer/template and that dimerization is favored when the first molecule is bound in the polymerizing mode, but disfavored when it is bound in the editing mode. We suggest that self-association of the polymerase may play an important and as yet unexplored role in coordinating high-fidelity DNA replication.

  4. Fragmentation of bacteriophage S13 replicative from DNA by restriction endonucleases from Hemophilus influenzae and Hemophilus aegyptius.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); K.M. Ojamaa; J.H. Spencer

    1976-01-01

    textabstractThe restriction enzymes Hind from Hemophilus influenzae and HaeIII from Hemophilus aegyptius cleave bacteriophage S13 replicative form (RF) DNA into 13 and 10 specific fragments, respectively. The sizes of these fragments were estimated by gel electrophoresis, electron microscopy, and

  5. Use of DNA sequencing to detect pathogenic, saprotrophic, and stain fungi in sapwood of declining red pine (Pinus resinosa) in the Upper Midwest

    Science.gov (United States)

    M.T. Banik; D.L. Lindner; J. Juzwik; J.A. Glaeser

    2013-01-01

    An inexpensive kit was developed to collect wood samples for molecular detection of pathogenic, saprotrophic and stain fungi in declining Pinus resinosa in the Upper Midwest. The kit contained materials for "clean" collection of sapwood drill shavings, which were then subjected to PCR of the rDNA ITS region with fungal-specific primers,...

  6. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  7. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Directory of Open Access Journals (Sweden)

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  8. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  9. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  10. Melting profiles may affect detection of residual HPV L1 gene DNA fragments in Gardasil®.

    Science.gov (United States)

    Lee, Sin Hang

    2014-03-01

    Gardasil® is a quadrivalent human papillomavirus (HPV) protein-based vaccine containing genotype-specific L1 capsid proteins of HPV-16, HPV-18, HPV-6 and HPV-11 in the form of virus-like-particles (VLPs) as the active ingredient. The VLPs are produced by a DNA recombinant technology. It is uncertain if the residual HPV L1 gene DNA fragments in the vaccine products are considered contaminants or excipients of the Gardasil® vaccine. Because naked viral DNA fragments, if present in the vaccine, may bind to the insoluble amorphous aluminum hydroxyphosphate sulfate (AAHS) adjuvant which may help deliver the foreign DNA into macrophages, causing unintended pathophysiologic effects, experiments were undertaken to develop tests for HPV L1 gene DNA fragments in the final products of Gardasil® by polymerase chain reaction (PCR) and direct DNA sequencing. The results showed that while the HPV-11 and HPV-18 L1 gene DNA fragments in Gardasil® were readily amplified by the common GP6/MY11 degenerate consensus primers, the HPV-16 L1 gene DNA may need specially designed non-degenerate PCR primers for amplification at different regions of the L1 gene and different stringency conditions for detection. These variable melting profiles of HPV DNA in the insoluble fraction of the Gardasil® vaccine suggest that the HPV DNA fragments are firmly bound to the aluminum AAHS adjuvant. All methods developed for detecting residual HPV DNA in the vaccine Gardasil® for quality assurance must take into consideration the variable melting profiles of the DNA to avoid false negative results.

  11. Analysis of DNA from post-blast pipe bomb fragments for identification and determination of ancestry.

    Science.gov (United States)

    Tasker, Esiri; LaRue, Bobby; Beherec, Charity; Gangitano, David; Hughes-Stamm, Sheree

    2017-05-01

    Improvised explosive devices (IEDs) such as pipe bombs are weapons used to detrimentally affect people and communities. A readily accessible brand of exploding targets called Tannerite® has been identified as a potential material for abuse as an explosive in pipe bombs. The ability to recover and genotype DNA from such weapons may be vital in the effort to identify suspects associated with these devices. While it is possible to recover DNA from post-blast fragments using short tandem repeat markers (STRs), genotyping success can be negatively affected by low quantities of DNA, degradation, and/or PCR inhibitors. Alternative markers such as insertion/null (INNULs) and single nucleotide polymorphisms (SNPs) are bi-allelic genetic markers that are shorter genomic targets than STRs for amplification, which are more likely to resist degradation. In this study, we constructed pipe bombs that were spiked with known amounts of biological material to: 1) recover "touch" DNA from the surface of the device, and 2) recover traces of blood from the ends of wires (simulated finger prick). The bombs were detonated with the binary explosive Tannerite® using double-base smokeless powder to initiate the reaction. DNA extracted from the post-blast fragments was quantified with the Quantifiler® Trio DNA Quantification Kit. STR analysis was conducted using the GlobalFiler® Amplification Kit, INNULs were amplified using an early-access version of the InnoTyper™ 21 Kit, and SNP analysis via massively parallel sequencing (MPS) was performed using the HID-Ion Ampliseq™ Identity and Ancestry panels using the Ion Chef and Ion PGM sequencing system. The results of this study showed that INNUL markers resulted in the most complete genetic profiles when compared to STR and SNP profiles. The random match probabilities calculated for samples using INNULs were lower than with STRs when less than 14 STR alleles were reported. These results suggest that INNUL analysis may be well suited for

  12. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  13. Novel extraction method of genomic DNA suitable for long-fragment amplification from small amounts of milk.

    Science.gov (United States)

    Liu, Y F; Gao, J L; Yang, Y F; Ku, T; Zan, L S

    2014-11-01

    Isolation of genomic DNA is a prerequisite for assessment of milk quality. As a source of genomic DNA, milk somatic cells from milking ruminants are practical, animal friendly, and cost-effective sources. Extracting DNA from milk can avoid the stress response caused by blood and tissue sampling of cows. In this study, we optimized a novel DNA extraction method for amplifying long (>1,000 bp) DNA fragments and used it to evaluate the isolation of DNA from small amounts of milk. The techniques used for the separation of milk somatic cell were explored and combined with a sodium dodecyl sulfate (SDS)-phenol method for optimizing DNA extraction from milk. Spectrophotometry was used to determine the concentration and purity of the extracted DNA. Gel electrophoresis and DNA amplification technologies were used for to determine DNA size and quality. The DNA of 112 cows was obtained from milk (samples of 13 ± 1 mL) and the corresponding optical density ratios at 260:280 nm were between 1.65 and 1.75. Concentrations were between 12 and 45 μg/μL and DNA size and quality were acceptable. The specific PCR amplification of 1,019- and 729-bp bovine DNA fragments was successfully carried out. This novel method can be used as a practical, fast, and economical mean for long genomic DNA extraction from a small amount of milk. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  15. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. In vivo assembly of DNA-fragments in the moss, Physcomitrella patens

    DEFF Research Database (Denmark)

    King, Brian Christopher; Vavitsas, Konstantinos; Ikram, Nur Kusaira Binti Khairul

    2016-01-01

    enabled the complete replacement of eukaryotic chromosomes with heterologous DNA. The moss Physcomitrella patens, a non-vascular and spore producing land plant (Bryophyte), has a well-established capacity for homologous recombination. Here, we demonstrate the in vivo assembly of multiple DNA fragments...

  17. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  18. Sperm DNA fragmentation and mitochondrial membrane potential combined are better for predicting natural conception than standard sperm parameters.

    Science.gov (United States)

    Malić Vončina, Slađana; Golob, Barbara; Ihan, Alojz; Kopitar, Andreja Nataša; Kolbezen, Mojca; Zorn, Branko

    2016-03-01

    To evaluate whether DNA fragmentation and/or mitochondrial membrane potential (MMP) predict natural conception better than standard sperm parameters. Prospective cross-sectional study. University medical center. Eighty-five infertile and 51 fertile men. Assessment of sperm DNA fragmentation, MMP, and standard semen parameters over a 6- to 12-month observation period. Comparison between the results of DNA fragmentation, MMP, and standard sperm parameters alone or combined and achievement of natural conception. Twenty-six of the 85 (31%) men from infertile couples conceived naturally. The median values of DNA fragmentation and MMP in the men who conceived within the observation period were similar to those in the fertile controls. Optimal threshold values of DNA fragmentation and MMP were 25% as determined by receiver operating characteristic analysis (area under the curve [AUC], 0.70; 95% confidence interval (CI) 0.58-0.82) and 62.5% (AUC, 0.68, 95% CI 0.56-0.80), respectively. The men in the infertile group with values of DNA fragmentation ≤25% and with MMP values ≥62.5% had significantly higher odds for conception (odds ratio [OR], 5.22; 95% CI 1.82-14.93] and OR, 4.67; 95% CI 1.74-12.5, respectively). Normal semen analysis alone had no predictive value for natural conception (OR, 1.84; 95% CI 0.67-5.07]). Both sperm function tests combined had significant odds for natural conception (OR, 8.24; 95% CI 2.91-23.33]), with a probability of 0.607 (60.7%) for both normal values and 0.158 (15.8%) for abnormal values. Sperm DNA fragmentation and MMP combined may be superior to standard semen parameters for the prediction of natural conception. Copyright © 2016. Published by Elsevier Inc.

  19. Sex determination in highly fragmented human DNA by high-resolution melting (HRM analysis.

    Directory of Open Access Journals (Sweden)

    Brenda A Álvarez-Sandoval

    Full Text Available Sex identification in ancient human remains is a common problem especially if the skeletons are sub-adult, incomplete or damaged. In this paper we propose a new method to identify sex, based on real-time PCR amplification of small fragments (61 and 64 bp of the third exon within the amelogenin gene covering a 3-bp deletion on the AMELX-allele, followed by a High Resolution Melting analysis (HRM. HRM is based on the melting curves of amplified fragments. The amelogenin gene is located on both chromosomes X and Y, showing dimorphism in length. This molecular tool is rapid, sensitive and reduces the risk of contamination from exogenous genetic material when used for ancient DNA studies. The accuracy of the new method described here has been corroborated by using control samples of known sex and by contrasting our results with those obtained with other methods. Our method has proven to be useful even in heavily degraded samples, where other previously published methods failed. Stochastic problems such as the random allele drop-out phenomenon are expected to occur in a less severe form, due to the smaller fragment size to be amplified. Thus, their negative effect could be easier to overcome by a proper experimental design.

  20. Sex determination in highly fragmented human DNA by high-resolution melting (HRM) analysis.

    Science.gov (United States)

    Álvarez-Sandoval, Brenda A; Manzanilla, Linda R; Montiel, Rafael

    2014-01-01

    Sex identification in ancient human remains is a common problem especially if the skeletons are sub-adult, incomplete or damaged. In this paper we propose a new method to identify sex, based on real-time PCR amplification of small fragments (61 and 64 bp) of the third exon within the amelogenin gene covering a 3-bp deletion on the AMELX-allele, followed by a High Resolution Melting analysis (HRM). HRM is based on the melting curves of amplified fragments. The amelogenin gene is located on both chromosomes X and Y, showing dimorphism in length. This molecular tool is rapid, sensitive and reduces the risk of contamination from exogenous genetic material when used for ancient DNA studies. The accuracy of the new method described here has been corroborated by using control samples of known sex and by contrasting our results with those obtained with other methods. Our method has proven to be useful even in heavily degraded samples, where other previously published methods failed. Stochastic problems such as the random allele drop-out phenomenon are expected to occur in a less severe form, due to the smaller fragment size to be amplified. Thus, their negative effect could be easier to overcome by a proper experimental design.

  1. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  2. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  3. Single-cell pulsed-field gel electrophoresis to detect the early stage of DNA fragmentation in human sperm nuclei.

    Directory of Open Access Journals (Sweden)

    Satoru Kaneko

    Full Text Available Single-cell pulsed-field gel electrophoresis (SCPFGE with dual electrode pairs was developed to detect the early stage of DNA fragmentation in human sperm. The motile sperm were purified by the commonly used density-gradient centrifugation technique and subsequent swim-up. The sperm were embedded in a thin film of agarose containing bovine trypsin (20 µg/mL and were then lysed. Prior to SCPFGE, proteolysis of DNA-binding components, such as protamine and the nuclear matrix was essential to separate the long chain fibers from the fibrous and granular fragments derived from a single nucleus. The overall electrophoretic profiles elucidated the course of DNA fragmentation. A few large fibrous fragments were observed at the beginning of the process, however, as the fragmentation advanced, the long chain fibers decreased and shortened, and, conversely, the granular fragments increased until finally almost all the DNA was shredded. Although the ejaculate contained sperm with heterogeneous stages, the purified motile sperm exhibited several dozens of uniformly elongated fibers arising from the tangled DNA at the origin, whereas a part of these fibers gave rise to fibrous fragments beyond the tip of the elongated fibers, and their numbers and sizes varied among the sperm. Conventional intra-cytoplasmic sperm injection (ICSI usually depends on intra-operative light microscopic observation to select a sperm for injection. The present results revealed that sperm motility could not give full assurance of DNA integrity. SCPFGE is likely to serve an important role in the preoperative differential diagnosis to determine the competence of the sperm population provided for injection.

  4. Phenotypic changes in Cyprinus carpiovar var. Jian introduced by sperm-mediated transgenesis of rearranged homologous DNA fragments.

    Science.gov (United States)

    Cao, Zheming; Ding, Weidong; Ren, Hongtao

    2013-09-01

    Common carp, specifically the Jian variety (Cyprinus carpiovar var. Jian), is an important Chinese and global aquatic stock for commercial foodstuff. Homologous recombination of carp gene sequences has been widely used in population genetics to broadly screen for beneficial phenotypical variations, thus optimizing artificially engineered carp stocks with Jian variety and native stock varieties. Random rearrangement of homologous DNA fragments from parent specimens of C. carpiovar var. Jian were attained by digestion of genomic DNA with MspI followed by religation and redigestion with EcoR I to specifically rearrange homologous DNA fragments of myostatin and microsatellite genes. Based on known characteristics of myostatin gene function, growth pattern changes in resultant carp mutant varieties was expected. DNA fragments were introduced into metaphase-II oocytes, resulting in one to several dozen insertions of homologous fragments into the host genome by sperm-mediated transgenesis. Introduction of rearranged homologous DNA fragments often resulted in phenotypic changes in C. carpiovar var. Jian, including significant phenotypic changes linked to growth rate at 4 months.

  5. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Science.gov (United States)

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  6. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  7. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  8. Colloidal centrifugation of stallion semen results in a reduced rate of sperm DNA fragmentation.

    Science.gov (United States)

    Crespo, F; Gosalvez, J; Gutiérrez-Cepeda, L; Serres, C; Johnston, S D

    2013-04-01

    Stallion spermatozoa recovered and examined immediately after colloidal centrifugation resulted in a higher straight-line velocity (VSL) than sperm processed using direct conventional centrifugation (p = 0.000), but there was no differences in the progressive motility or sperm DNA fragmentation (SDF) as determined by the sperm chromatin dispersion assay. However, when centrifuged spermatozoa were incubated at 37 °C for 24 h to determine the rate of SDF (r-SDF), a lower r-SDF (p = 0.0011) was observed in those sperm recovered after colloidal separation (0.5 ± 0.1%/h) compared to direct (1.2 ± 0.4%/h) or no centrifugation (r-SDF = 1.2 ± 0.3%/h). These results confirm that colloidal separation of stallion spermatozoa results in prolonged sperm DNA longevity, but these differences were only apparent following a period of incubation and dynamic assessment. Consequently, we strongly recommend the use of the dynamic form of the SDF assay for evaluating centrifugation and/or other ex vivo procedures, as a single basal assessment of SDF may inadvertently result in a false-positive evaluation of DNA quality. © 2012 Blackwell Verlag GmbH.

  9. Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

    Science.gov (United States)

    Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

    2014-01-01

    Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

  10. Fluorescent SSCP of overlapping fragments (FSSCP-OF): a highly sensitive method for the screening of mitochondrial DNA variation

    DEFF Research Database (Denmark)

    Salas, A; Rasmussen, Erik Michael; Lareu, M V

    2001-01-01

    The mtDNA analysis (mtDNA) is increasingly being demanded for forensic purposes due to the fact that many times the use of standard nuclear marker fails to analyze degraded samples (such as bones) and specially for the analysis of hair shafts (a common sample in the crime scene). However, analysis...... conformation polymorphism (SSCP) of overlapping fragments (FSSCP-OF). FSSCP-OF is based on the basic theory of SSCP analysis and combines two complementary strategies: the use of PCR amplified overlapping fragments and fluorescent detection technology. The overlap region contains a high percentage (50...... fragments. The use of multicolor fluorescent technology allows also the multiplex amplification of overlapping fragment and its subsequent analysis in an automatic sequencer. We have analyzed 50 samples of unrelated individuals through the FSSCP-OF technique and we have found that using this methodology...

  11. Comparison of Gram stain with DNA probe for detection of Neisseria gonorrhoeae in urethras of symptomatic males.

    Science.gov (United States)

    Juchau, S V; Nackman, R; Ruppart, D

    1995-01-01

    The comparison of Gram-stained urethral smears with Gen-Probe for the detection of Neisseria Gonorrhoeae in the urethras of males with symptomatic urethritis revealed a 99.6% correlation between the two methods. A simple Gram stain would appear to be the method of choice for the detection of gonorrhea in symptomatic males, because it is much less expensive and much more rapid than the Gen-Probe method. PMID:8576380

  12. Techniques for Dual Staining of DNA and Intracellular Immunoglobulins in Murine Hybridoma Cells: Applications to Cell-Cycle Analysis of Hyperosmotic Cultures

    OpenAIRE

    McNeeley, Kathleen M.; Sun, Zhe; Sharfstein, Susan T.

    2005-01-01

    Flow cytometry was used to evaluate the effects of hyperosmotic stress on cell-cycle distribution and cell-associated immunoglobulins for murine hybridoma cells grown in batch culture. Paraformaldehyde/methanol fixation substantially increased the fluorescence signal for intracellular immunoglobulins compared to ethanol fixation. For surface immunoglobulins, similar fluorescence signals were observed regardless of fixation method. Dual staining of immunoglobulins and cellular DNA was employed...

  13. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  14. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  15. Characterization of six rat strains (Rattus norvegicus by mitochondrial DNA restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Hilsdorf A.W.

    1999-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP was used to examine the extent of mtDNA polymorphism among six strains of rats (Rattus norvegicus - Wistar, Wistar Munich, Brown Norway, Wistar Kyoto, SHR and SHR-SP. A survey of 26 restriction enzymes has revealed a low level of genetic divergence among strains. The sites of cleavage by EcoRI, NcoI and XmnI were shown to be polymorphic. The use of these three enzymes allows the 6 strains to be classified into 4 haplotypes and identifies specific markers for each one. The percentage of sequence divergence among all pairs of haplotypes ranged from 0.035 to 0.33%, which is the result of a severe population constriction undergone by the strains. These haplotypes are easily demonstrable and therefore RFLP analysis can be employed for genetic monitoring of rats within animal facilities or among different laboratories.

  16. A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

    Directory of Open Access Journals (Sweden)

    Erwan Quéméré

    Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

  17. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  18. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Science.gov (United States)

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  19. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    2012-09-01

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em

  20. The Society for Translational Medicine: clinical practice guidelines for sperm DNA fragmentation testing in male infertility

    Science.gov (United States)

    Cho, Chak-Lam; Majzoub, Ahmad; Esteves, Sandro C.

    2017-01-01

    Sperm DNA fragmentation (SDF) testing has been emerging as a valuable tool for male fertility evaluation. While the essential role of sperm DNA integrity in human reproduction was extensively studied, the clinical indication of SDF testing is less clear. This clinical practice guideline provides recommendations of clinical utility of the test supported by evidence. It is intended to serve as a reference for fertility specialists in identifying the circumstances in which SDF testing should be of greatest clinical value. SDF testing is recommended in patients with clinical varicocele and borderline to normal semen parameters as it can better select varicocelectomy candidates. Outcomes of natural pregnancy and assisted reproductive techniques (ART) can be predicted by result of SDF tests. High SDF is also linked with recurrent pregnancy loss (RPL) and failure of ART. Result of SDF testing may change the management decision by selecting the most appropriate ART with the highest success rate for infertile couples. Several studies have demonstrated the benefit in using testicular instead of ejaculated sperm in men with high SDF, oligozoospermia or recurrent in vitro fertilization (IVF) failure. Infertile men with modifiable lifestyle factor may benefit from SDF testing by reinforcing risk factor modification and monitoring patient’s progress to intervention. PMID:29082206

  1. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    Science.gov (United States)

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  3. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  4. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  5. Rapid assembly of multiple DNA fragments through direct transformation of PCR products into E. coli and Lactobacillus.

    Science.gov (United States)

    Cao, Pinghua; Wang, Lei; Zhou, Guangxian; Wang, Yaoyue; Chen, Yulin

    2014-11-01

    This article describes a rapid, highly efficient and versatile method for seamlessly assembling multiple DNA fragments into a vector at any desired position. The inserted fragments and vector backbone were amplified by high-fidelity PCR containing 20 bp to 50 bp overlapping regions at 3' and/or 5' termini. These linearised fragments were equimolarly mixed, and then cyclised in a prolonged overlap extension PCR without adding primers. The resulting PCR products were DNA multimers that could be directly transformed into host strains, yielding the desired chimeric plasmid. The proposed method was illustrated by constructing an Escherichia coli co-expression vector. The feasibility of the method in Lactobacillus was further validated by assembling an E. coli-Lactobacillus shuttle vector. Results showed that three to four fragments could be simultaneously and precisely inserted in a vector in only 2-3 days using the proposed method. The acceptable transformation efficiency was determined through the tested host strains; more than 95% of the colonies were positive transformants. Therefore, the proposed method is sufficiently competent for high-efficiency insertion of multiple DNA fragments into a plasmid and has theoretically good application potential for gene cloning and protein expression because it is simple, easy to implement, flexible and yields highly positive clones. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Gram staining.

    Science.gov (United States)

    Coico, Richard

    2005-10-01

    Named after Hans Christian Gram who developed the method in 1884, the Gram stain allows one to distinguish between Gram-positive and Gram-negative bacteria on the basis of differential staining with a crystal violet-iodine complex and a safranin counterstain. The cell walls of Gram-positive organisms retain this complex after treatment with alcohol and appear purple, whereas gram-negative organisms decolorize following such treatment and appear pink. The method described here is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures.

  7. Time Course of Detection of Human Male DNA from Stained Blood Sample on Various Surfaces by Loop Mediated Isothermal Amplification and Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Panan Kanchanaphum

    2018-01-01

    Full Text Available This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP, and LAMP-Lateral Flow Dipstick (LFD. For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, wood, clay, and tile. Then, the samples were stored at room temperature for 1, 7, 30, and 60 day(s. After the DNA amplification, the gel electrophoresis process was applied to detect LAMP product. The LFD was combined with the LAMP to detect LAMP product on the male cloth samples. For the male samples, the time course of detection on the first and seventh days indicated positive for both LAMP and PCR products on all the surfaces while no DNA amplification was found on any of the female samples. On day 30, positive LAMP product was still found on all the male samples. However, it had faded on the tiles. Moreover, all the male samples, which had tested positive for PCR product, were blurred and unclear. On day 60, LAMP product was still found on all the male samples. Conversely, the PCR method resulted in no bands showing for any of the male samples. However, the LAMP-LFD method detected product on all the male samples of cloth. The results show that the LAMP is an effective, practical, and reliable molecular-biological method. Moreover, the LFD can increase the efficiency and sensitivity of the LAMP, making it more suitable for field studies because gel electrophoresis apparatus is not required.

  8. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Autophagic degradation of dBruce controls DNA fragmentation in nurse cells during late Drosophila melanogaster oogenesis

    Science.gov (United States)

    Shravage, Bhupendra V.; Sagona, Antonia P.; Lamark, Trond; Bjørkøy, Geir; Johansen, Terje; Rusten, Tor Erik; Brech, Andreas; Baehrecke, Eric H.

    2010-01-01

    Autophagy is an evolutionarily conserved pathway responsible for degradation of cytoplasmic material via the lysosome. Although autophagy has been reported to contribute to cell death, the underlying mechanisms remain largely unknown. In this study, we show that autophagy controls DNA fragmentation during late oogenesis in Drosophila melanogaster. Inhibition of autophagy by genetically removing the function of the autophagy genes atg1, atg13, and vps34 resulted in late stage egg chambers that contained persisting nurse cell nuclei without fragmented DNA and attenuation of caspase-3 cleavage. The Drosophila inhibitor of apoptosis (IAP) dBruce was found to colocalize with the autophagic marker GFP-Atg8a and accumulated in autophagy mutants. Nurse cells lacking Atg1 or Vps34 in addition to dBruce contained persisting nurse cell nuclei with fragmented DNA. This indicates that autophagic degradation of dBruce controls DNA fragmentation in nurse cells. Our results reveal autophagic degradation of an IAP as a novel mechanism of triggering cell death and thereby provide a mechanistic link between autophagy and cell death. PMID:20713604

  10. Optimized quantification of fragmented, free circulating DNA in human blood plasma using a calibrated duplex real-time PCR.

    Directory of Open Access Journals (Sweden)

    Martin Horlitz

    Full Text Available BACKGROUND: Duplex real-time PCR assays have been widely used to determine amounts and concentrations of free circulating DNA in human blood plasma samples. Circulatory plasma DNA is highly fragmented and hence a PCR-based determination of DNA concentration may be affected by the limited availability of full-length targets in the DNA sample. This leads to inaccuracies when counting PCR target copy numbers as whole genome equivalents. METHODOLOGY/PRINCIPAL FINDINGS: A model system was designed allowing for assessment of bias in a duplex real-time PCR research assay. We collected blood plasma samples from male donors in pools of 6 to 8 individuals. Circulatory plasma DNA was extracted and separated by agarose gel electrophoresis. Separated DNA was recovered from the gel in discrete size fractions and analyzed with different duplex real-time PCR Taqman assays detecting a Y chromosome-specific target and an autosomal target. The real-time PCR research assays used differed significantly in their ability to determine the correct copy number ratio of 0.5 between Y chromosome and autosome targets in DNA of male origin. Longer PCR targets did not amplify quantitatively in circulatory DNA, due to limited presence of full-length target sequence in the sample. CONCLUSIONS: PCR targets of the same small size are preferred over longer targets when comparing fractional circulatory DNA concentrations by real-time PCR. As an example, a DYS14/18S duplex real-time PCR research assay is presented that correctly measures the fractional concentration of male DNA in a male/female mixture of circulatory, fragmented DNA.

  11. Mitochondrial DNA diversity and population structure of a forest-dependent rodent, Praomys taitae (Rodentia: Muridae) Heller 1911, in the fragmented forest patches of Taita Hills, Kenya

    DEFF Research Database (Denmark)

    Nyakaana, S.; Tumusiime, C.; Oguge, N.

    2008-01-01

    The population genetic structure of the forest-dependent rodent, Praomys taitae, sampled from nine indigenous forest fragments sampled from nine indigenous forest fragments distributed over three ranges of the Taita Hills in Kenya, was determined using mitochondrial DNA (mtDNA) control region seq...

  12. Detection of transformed cells in crown gall tumors using the GUS reporter gene and correlation of GUS stained cells with T-DNA gene activity

    International Nuclear Information System (INIS)

    Black, R.C.; Labriola, J.; Binns, A.N.

    1990-01-01

    Crown gall tumors are a mixture of transformed hormone producing cells and normal cells. Until now it has not been possible to directly visualize these cell types in situ. We have constructed strains of Agrobacterium tumefaciens that carry the 35S-β-glucuronidase (GUS) reporter gene in either wild type or mutant Ti plasmids. Using histochemical staining for GUS activity, blue (GUS positive) sectors are observed in tumor sections. In order to demonstrate that the blue sectors actually represent cells expressing other T-DNA genes, we have looked for T-DNA gene encoded enzyme activity in the stained and unstained sectors. The blue sectors accumulate octopine (a product of the octopine synthase gene on the T-DNA) while the white (GUS negative) sectors do not. We conclude that the use of the GUS reporter gene provides a sensitive and reliable method for visualizing transformation events in plant tissues. A comparison of the proportion of transformed and nontransformed cells in wild type tumors vs. tumors deficient in auxin or cytokinin encoding genes will be discussed

  13. RADOM, an efficient in vivo method for assembling designed DNA fragments up to 10 kb long in Saccharomyces cerevisiae.

    Science.gov (United States)

    Lin, Qiuhui; Jia, Bin; Mitchell, Leslie A; Luo, Jingchuan; Yang, Kun; Zeller, Karen I; Zhang, Wenqian; Xu, Zhuwei; Stracquadanio, Giovanni; Bader, Joel S; Boeke, Jef D; Yuan, Ying-Jin

    2015-03-20

    We describe rapid assembly of DNA overlapping multifragments (RADOM), an improved assembly method via homologous recombination in Saccharomyces cerevisiae, which combines assembly in yeasto with blue/white screening in Escherichia coli. We show that RADOM can successfully assemble ∼3 and ∼10 kb DNA fragments that are highly similar to the yeast genome rapidly and accurately. This method was tested in the Build-A-Genome course by undergraduate students, where 125 ∼3 kb "minichunks" from the synthetic yeast genome project Sc2.0 were assembled. Here, 122 out of 125 minichunks achieved insertions with correct sizes, and 102 minichunks were sequenced verified. As this method reduces the time-consuming and labor-intensive efforts of yeast assembly by improving the screening efficiency for correct assemblies, it may find routine applications in the construction of DNA fragments, especially in hierarchical assembly projects.

  14. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Science.gov (United States)

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  15. DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

    Directory of Open Access Journals (Sweden)

    Saeed Samarghandian

    2013-01-01

    Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.

  16. [Romanowsky dyes and the Romanowsky-Giemsa effect. 3. Microspectrophotometric studies of Romanowsky-Giemsa staining. Spectroscopic evidence of a DNA-azure B-eosin Y complex producing the Romanowsky-Giemsa effect].

    Science.gov (United States)

    Zipfel, E; Grezes, J R; Naujok, A; Seiffert, W; Wittekind, D H; Zimmermann, H W

    1984-01-01

    The Romanowsky-Giemsa staining (RG staining) has been studied by means of microspectrophotometry using various staining conditions. As cell material we employed in our model experiments mouse fibroblasts, LM cells. They show a distinct Romanowsky-Giemsa staining pattern. The RG staining was performed with the chemical pure dye stuffs azure B and eosin Y. In addition we stained the cells separately with azure B or eosin Y. Staining parameters were pH value, dye concentration, staining time etc. Besides normal LM cells we also studied cells after RNA or DNA digestion. The spectra of the various cell species were measured with a self constructed microspectrophotometer by photon counting technique. The optical ray pass and the diagramm of electronics are briefly discussed. The nucleus of RG stained LM cells, pH congruent to 7, is purple, the cytoplasm blue. After DNA or RNA digestion the purple respectively blue coloration in the nucleus or the cytoplasm completely disappeares. Therefore DNA and RNA are the preferentially stained biological substrates. In the spectrum of RG stained nuclei, pH congruent to 7, three absorption bands are distinguishable: They are A1 (15400 cm-1, 649 nm), A2 (16800 cm-1, 595 nm) the absorption bands of DNA-bound monomers and dimers of azure B and RB (18100 cm-1, 552 nm) the distinct intense Romanowsky band. Our extensive experimental material shows clearly that RB is produced by a complex of DNA, higher polymers of azure B (degree of association p greater than 2) and eosin Y. The complex is primarily held together by electrostatic interaction: inding of polymer azure B cations to the polyanion DNA generates positively charged binding sites in the DNA-azure B complex which are subsequently occupied by eosin Y anions. It can be spectroscopically shown that the electronic states of the azure B polymers and the attached eosin Y interact. By this interaction the absorption of eosin Y is red shifted and of the azure B polymers blue shifted. The

  17. Comprehensive examination of conventional and innovative body fluid identification approaches and DNA profiling of laundered blood- and saliva-stained pieces of cloths.

    Science.gov (United States)

    Kulstein, G; Wiegand, P

    2018-01-01

    Body fluids like blood and saliva are commonly encountered during investigations of high volume crimes like homicides. The identification of the cellular origin and the composition of the trace can link suspects or victims to a certain crime scene and provide a probative value for criminal investigations. To erase all traces from the crime scene, perpetrators often wash away their traces. Characteristically, items that show exposed stains like blood are commonly cleaned or laundered to free them from potential visible leftovers. Mostly, investigators do not delegate the DNA analysis of laundered items. However, some studies have already revealed that items can still be used for DNA analysis even after they have been laundered. Nonetheless, a systematical evaluation of laundered blood and saliva traces that provides a comparison of different established and newly developed methods for body fluid identification (BFI) is still missing. Herein, we present the results of a comprehensive study of laundered blood- and saliva-stained pieces of cloths that were applied to a broad range of methods for BFI including conventional approaches as well as molecular mRNA profiling. The study included the evaluation of cellular origin as well as DNA profiling of blood- and saliva-stained (synthetic fiber and cotton) pieces of cloths, which have been washed at various washing temperatures for one or multiple times. Our experiments demonstrate that, while STR profiling seems to be sufficiently sensitive for the individualization of laundered items, there is a lack of approaches for BFI with the same sensitivity and specificity allowing to characterize the cellular origin of challenging, particularly laundered, blood and saliva samples.

  18. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Directory of Open Access Journals (Sweden)

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  19. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  20. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  1. Genotyping the hepatitis B virus with a fragment of the HBV DNA polymerase gene in Shenyang, China

    Directory of Open Access Journals (Sweden)

    Juan Feng

    2011-06-01

    Full Text Available Abstract The hepatitis B virus (HBV has been classified into eight genotypes (A-H based on intergenotypic divergence of at least 8% in the complete nucleotide sequence or more than 4% in the S gene. To facilitate the investigation of the relationship between the efficacy of drug treatment and the mutation with specific genotype of HBV, we have established a new genotyping strategy based on a fragment of the HBV DNA polymerase gene. Pairwise sequence and phylogenetic analyses were performed using CLUSTAL V (DNASTAR on the eight (A-H standard full-length nucleotide sequences of HBV DNA from GenBank (NCBI and the corresponding semi-nested PCR products from the HBV DNA polymerase gene. The differences in the semi-nested PCR fragments of the polymerase genes among genotypes A through F were greater than 4%, which is consistent with the intergenotypic divergence of at least 4% in HBV DNA S gene sequences. Genotyping using the semi-nested PCR products of the DNA polymerase genes revealed that only genotypes B, C, and D were present in the 50 cases, from Shenyang, China, with a distribution of 11 cases (22%, 25 cases (50%, and 14 cases (28% respectively. These results demonstrate that our new genotyping method utilizing a fragment of the HBV DNA polymerase gene is valid and can be employed as a general genotyping strategy in areas with prevalent HBV genotypes A through F. In Shenyang, China, genotypes C, B, and D were identified with this new genotyping method, and genotype C was demonstrated to be the dominant genotype.

  2. Restriction fragment length polymorphisms of mitochondrial DNA among five freshwater fish species of the genus Astyanax (Pisces, Characidae

    Directory of Open Access Journals (Sweden)

    Cinthia Bachir Moysés

    2002-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis of mitochondrial DNA (mtDNA was employed to characterize species and populations of Astyanax, a Neotropical freshwater fish genus. Samples of five species, A. altiparanae, A. fasciatus, A. lacustris, A. scabripinnis paranae and A. schubarti, from the Upper Paraná and São Francisco river basins were analyzed. Two out of the ten restriction enzymes employed generated species-specific mtDNA patterns for each of the five species. MtDNA exhibited considerable polymorphism within and among populations. All populations sampled showed relatively high values of haplotype diversity. Geographically localized haplotypes were detected for A. altiparanae and A. fasciatus from the Upper Paraná and São Francisco basins. The relationships between populations are discussed.

  3. ABNORMAL CHROMATIN CONDENSATION IN SPERMATOZOA AND DNA FRAGMENTATION IN SPERMATOZOA: IS THERE A CORRELATION?

    Directory of Open Access Journals (Sweden)

    E. E. Bragina

    2017-01-01

    Full Text Available Introduction. In the last decade, an understanding of the two-fold nature of genetic apparatus damage in spermatozoa has emerged: abnormal chromatin condensation (“immature” chromatin, ICH related to defective protaminization and leading to altered epigenetic regulation of the early embryogenesis, and disruption of DNA integrity, i. e. DNA fragmentation (DFS.Objective. Study of the correlation between abnormal chromatin condensation in spermatozoa and DFS.Materials and methods. The study included spermatozoa of 54 fertile males (1st group, control, 46 patients with primary infertility (2nd group, and 111 patients whose wives had a history of pregnancy abnormalities or failures of the assisted reproductive technology (ART, i. e. arrested embryonic development (3rd group. Presence of ICH was identified by quantitative electron microscopy, presence of DFS by TUNEL. Study of ICH and DFS in the same spermatozoon was conducted using correlation microscopy (TUNEL with subsequent ultrastructural analysis of the labeled cells.Results. The number of ICH spermatozoa significantly differed in the 3rd group from the control group (29.26 ± 13.49 vs. 22.43 ± 9.54; p = 0.006. The number of ICH spermatozoa in the 2nd group was higher than in the control group, but the difference wasn’t statistically significant (p = 0.061. A significant difference in the number of spermatozoa with residual cytoplasm on the head was observed between the fertile group and 2nd and 3rd groups (p = 0.0001 and p = 0.0006, respectively and on the neck (p = 0.0002 and p = 0.0003, respectively. Number of DFS spermatozoa in the second group significantly differed from the control (21.40 ± 11.88 vs. 13.70 ± 7.00, p = 0.03, but this difference wasn’t observed for the 3rd group. A very weak correlation between the number of DFS and ICH spermatozoa was observed in all three groups (r = 0.18, r = 0.33, and r = 0.01, respectively. Forty-six (46 spermatozoa were studied using

  4. Sperm DNA fragmentation index does not correlate with blastocyst aneuploidy or morphological grading.

    Directory of Open Access Journals (Sweden)

    Itai Gat

    Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.

  5. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Science.gov (United States)

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  6. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  7. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

    Directory of Open Access Journals (Sweden)

    D. Vaamonde

    2014-12-01

    Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

  8. Effects of chronic buproprion and nicotine administration on cell genesis and DNA fragmentation in adult rat dentate gyrus

    OpenAIRE

    Scerri, Charles;

    2006-01-01

    Previous experiments have shown that chronic subcutaneous administration of nicotine dose-dependently inhibits the acquisition and retention of a spatial task in the Morris water maze and reduces cell genesis in the dentate gyrus (DG) of adult rats.1 In the present study, the effects of nicotine and buproprion, an atypical antidepressant used in smoking cessation, on dentate gyrus cell genesis and DNA fragmentation were investigated. The results show that nicotine, chronically infused for 21 ...

  9. Use of laptop computers connected to internet through Wi-Fi decreases human sperm motility and increases sperm DNA fragmentation.

    Science.gov (United States)

    Avendaño, Conrado; Mata, Ariela; Sanchez Sarmiento, César A; Doncel, Gustavo F

    2012-01-01

    To evaluate the effects of laptop computers connected to local area networks wirelessly (Wi-Fi) on human spermatozoa. Prospective in vitro study. Center for reproductive medicine. Semen samples from 29 healthy donors. Motile sperm were selected by swim up. Each sperm suspension was divided into two aliquots. One sperm aliquot (experimental) from each patient was exposed to an internet-connected laptop by Wi-Fi for 4 hours, whereas the second aliquot (unexposed) was used as control, incubated under identical conditions without being exposed to the laptop. Evaluation of sperm motility, viability, and DNA fragmentation. Donor sperm samples, mostly normozoospermic, exposed ex vivo during 4 hours to a wireless internet-connected laptop showed a significant decrease in progressive sperm motility and an increase in sperm DNA fragmentation. Levels of dead sperm showed no significant differences between the two groups. To our knowledge, this is the first study to evaluate the direct impact of laptop use on human spermatozoa. Ex vivo exposure of human spermatozoa to a wireless internet-connected laptop decreased motility and induced DNA fragmentation by a nonthermal effect. We speculate that keeping a laptop connected wirelessly to the internet on the lap near the testes may result in decreased male fertility. Further in vitro and in vivo studies are needed to prove this contention. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  10. In Vitro Effect of Cell Phone Radiation on Motility, DNA Fragmentation and Clusterin Gene Expression in Human Sperm

    Directory of Open Access Journals (Sweden)

    Adel Zalata

    2015-04-01

    Full Text Available Background: Use of cellular phones emitting radiofrequency electromagnetic field (RF-EMF has been increased exponentially and become a part of everyday life. This study aimed to investigate the effects of in vitro RF-EMF exposure emitted from cellular phones on sperm motility index, sperm DNA fragmentation and seminal clusterin (CLU gene expression. Materials and Methods: In this prospective study, a total of 124 semen samples were grouped into the following main categories: i. normozoospermia (N, n=26, ii. asthenozoospermia (A, n=32, iii. asthenoteratozoospermia (AT, n=31 and iv. oligoasthenoteratozoospermia (OAT, n=35. The same semen samples were then divided into two portions non-exposed and exposed samples to cell phone radiation for 1 hour. Before and immediately after exposure, both aliquots were subjected to different assessments for sperm motility, acrosin activity, sperm DNA fragmentation and CLU gene expression. Statistical differences were analyzed using paired t student test for comparisons between two sub-groups where pAT>A>N groups, respectively (p<0.05. Conclusion: Cell phone emissions have a negative impact on exposed sperm motility index, sperm acrosin activity, sperm DNA fragmentation and seminal CLU gene expression, especially in OAT cases.

  11. In vitro effect of cell phone radiation on motility, DNA fragmentation and clusterin gene expression in human sperm.

    Science.gov (United States)

    Zalata, Adel; El-Samanoudy, Ayman Z; Shaalan, Dalia; El-Baiomy, Youssef; Mostafa, Taymour

    2015-01-01

    Use of cellular phones emitting radiofrequency electromagnetic field (RF-EMF) has been increased exponentially and become a part of everyday life. This study aimed to investigate the effects of in vitro RF-EMF exposure emitted from cellular phones on sperm motility index, sperm DNA fragmentation and seminal clusterin (CLU) gene expression. In this prospective study, a total of 124 semen samples were grouped into the following main categories: i. normozoospermia (N, n=26), ii. asthenozoospermia (A, n=32), iii. asthenoteratozoospermia (AT, n=31) and iv. oligoasthenoteratozoospermia (OAT, n=35). The same semen samples were then divided into two portions non-exposed and exposed samples to cell phone radiation for 1 hour. Before and immediately after exposure, both aliquots were subjected to different assessments for sperm motility, acrosin activity, sperm DNA fragmentation and CLU gene expression. Statistical differences were analyzed using paired t student test for comparisons between two sub-groups where pAT>A>N groups, respectively (pCell phone emissions have a negative impact on exposed sperm motility index, sperm acrosin activity, sperm DNA fragmentation and seminal CLU gene expression, especially in OAT cases.

  12. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  13. Influence of thickness of alkyl-silane coupling agent coating on separation of small DNA fragments in capillary gel electrophoresis

    Science.gov (United States)

    Nakazumi, T.; Hara, Y.

    2017-09-01

    To simplify the process of coating capillaries with fused silica, we herein set out to develop a one-step procedure for coating capillaries to prevent electro-osmotic flow (EOF) during the separation of small DNA fragments. We selected a short capillary (total length = 15 cm; effective length = 7.5 cm) for use in a compact capillary gel electrophoresis (CGE) system. To develop a one-step coating procedure, we employed alkyltrimethoxysilane agents because they are cheap and can be easily acquired, in contrast to polyethylene glycol (PEG) silane coupling agents. We examined a 100-bp DNA Ladder sample using fused silica capillaries, which were coated with alkyltrimethoxysilane agents of five different molecular lengths (C4, C6, C8, C12, and C16). We found that a fused-silica capillary with C8 alkyltrimethoxysilane is optimal for separating small DNA samples.

  14. Phosphorylation regulates proteasomal-mediated degradation and solubility of TAR DNA binding protein-43 C-terminal fragments

    Directory of Open Access Journals (Sweden)

    Zhang Yong-Jie

    2010-08-01

    Full Text Available Abstract Background Inclusions of TAR DNA binding protein-43 (TDP-43 are the defining histopathological feature of several neurodegenerative diseases collectively referred to as TDP-43 proteinopathies. These diseases are characterized by the presence of cellular aggregates composed of abnormally phosphorylated, N-terminally truncated and ubiquitinated TDP-43 in the spinal cord and/or brain. Recent studies indicate that C-terminal fragments of TDP-43 are aggregation-prone and induce cytotoxicity. However, little is known regarding the pathways responsible for the degradation of these fragments and how their phosphorylation contributes to the pathogenesis of disease. Results Herein, we established a human neuroblastoma cell line (M17D3 that conditionally expresses an enhanced green fluorescent protein (GFP-tagged caspase-cleaved C-terminal TDP-43 fragment (GFP-TDP220-414. We report that expression of this fragment within cells leads to a time-dependent formation of inclusions that are immunoreactive for both ubiquitin and phosphorylated TDP-43, thus recapitulating pathological hallmarks of TDP-43 proteinopathies. Phosphorylation of GFP-TDP220-414 renders it resistant to degradation and enhances its accumulation into insoluble aggregates. Nonetheless, GFP-TDP220-414 inclusions are reversible and can be cleared through the ubiquitin proteasome system. Moreover, both Hsp70 and Hsp90 bind to GFP-TDP220-414 and regulate its degradation. Conclusions Our data indicates that inclusions formed from TDP-43 C-terminal fragments are reversible. Given that TDP-43 inclusions have been shown to confer toxicity, our findings have important therapeutic implications and suggest that modulating the phosphorylation state of TDP-43 C-terminal fragments may be a promising therapeutic strategy to clear TDP-43 inclusions.

  15. Assessment of sperm DNA fragmentation in stallion (Equus caballus) and donkey (Equus asinus) using the sperm chromatin dispersion test.

    Science.gov (United States)

    Cortés-Gutiérrez, E I; Crespo, F; Serres-Dalmau, C; Gutiérrez de las Rozas, A L; Dávila-Rodríguez, M I; López-Fernández, C; Gósalvez, J

    2009-10-01

    Sperm DNA fragmentation (sDF) is an important parameter to assessing sperm quality. Information about sperm quality is not available for donkeys, especially in some breeds at risk of extinction. The objectives of this research were to test the four commercial variants of sperm chromatin dispersion test (SCD; sperm Halomax test), originally developed to assess sDF in boars, bulls, rams and stallions, in order to scrutinize their applicability in the study of sDF in a donkey breed at risk of extinction (Zamorano-Leonesa), for which there is no specific test available to analyze sperm at present. Only the SCD test, originally developed for stallions, produced stable and consistent results, and was deemed suitable to assess DNA fragmentation in sperm samples from donkeys. Image analysis was used to compare differences between the SCD methodology applied to stallion and donkey semen samples processed under the same experimental conditions. The extent of SCD in the SCD test was approximately 20% lower in donkey sperm than in stallion sperm. Yet, the ratio of chromatin sperm dispersion achieved in fragmented and unfragmented nuclei did not differ significantly between species. These data suggest that a similar protein depletion treatment can cause differences in protein removal in equivalent cells from different species and that sperm chromatin may be organized differently in stallions and donkeys.

  16. Molecular genetic testing of uveal melanoma from routinely processed and stained cytology specimens

    Science.gov (United States)

    Christopher, Benjamin N.; Cebulla, Colleen M.; Wakely, Paul E.; Davidorf, Frederick H.; Abdel-Rahman, Mohamed H.

    2013-01-01

    In the following study we investigated the utility of molecular genetic testing of the DNA extracted from routinely stained and processed smears from uveal melanoma (UM). Smears from five uveal melanoma cell lines and 12 primary tumors were prepared and stained with Papanicolaou and Romanowsky stains. Genotyping was carried out utilizing 14 microsatellite markers on chromosomes 3, 6 and 8. Mutational screening for alterations in GNAQ and GNA11 genes was carried out by restriction fragment length polymorphism. The results were compared to those obtained through direct sequencing of frozen tumor tissues. High quality DNA was extracted from the stained slides with no difference in the efficiency of DNA extraction between the two staining techniques. The extracted DNA was of adequate quality for genotyping and mutational screening. DNA extracted from approximately 200 tumor cells is sufficient for reproducible testing of allelic imbalances and for studying the common somatic mutations in GNAQ and GNA11 genes. In conclusion, we presented the feasibility of utilizing routinely stained cytology smears from UM for molecular genetic testing. The DNA obtained is of sufficient quality to carry out genotyping for markers on chromosome 3, 6 and 8, as well as screening for somatic mutations in GNAQ and GNA11 genes. PMID:21945171

  17. Utility of 5-Methylcytosine Immunohistochemical Staining to Assess Global DNA Methylation and Its Prognostic Impact in MDS Patients

    Science.gov (United States)

    Chandra, Dinesh; Tyagi, Seema; Singh, Jasdeep; Deka, Roopam; Manivannan, Prabhu; Mishra, Pravas; Pati, Hara Prasad; Saxena, Renu

    2017-12-29

    Background: DNA methylation plays a vital role in the pathogenesis of the myelodysplastic syndrome (MDS), a heterogeneous group of clonal hematopoietic stem cell (HSC) disorders. It is reported to be an independent prognostic factor affecting overall survival (OS). Our aim was to analyze the role of global DNA methylation using an anti-5-methylcytosine (5-MC) antibody by immunohistochemistry (IHC) of bone marrow biopsy (BM Bx) specimens in MDS patients, assessing correlations with various clinical and biological prognostic factors. Material and methods: A total of 59 MDS cases, classified as per the World Health Organization (WHO) 2008 guidelines, were evaluated over a period of 4 years. Clinical data were retrieved from departmental case records and anti-5-MC expression was analyzed with formalin fixed paraffin embedded sections of BM Bx specimens of MDS patients and controls. Results: The median age at diagnosis was 52 years (15-85years). Patients were categorized into low risk (59%) and high risk (41%) according to International Prognostic Scoring System (IPSS). The median follow-up time was 10 months (1 to 37 months). We generated a methylation score (M-score) using anti-5-MC and with the derived cut-off of 30.5 from the receiver operator curve (ROC), there was a significant difference between the two groups in the percentage of BM blasts (p=0.01), WHO sub-type (p=0.01), IPSS (p=0.004), progression to AML (p=0.04) on univariate analysis. Interestingly, patients showing a high M-score (M-score ≥ 30.5) demonstrated a significantly shorter OS and progression to AML. However, on multivariate analysis, only BM blasts (p=0.01) and IPSS (p=0.02) remained independent variables for progression to AML and OS respectively. Conclusion: Immunostaining with anti-5-MC antibody with BM Bx samples is a simple and cost effective technique to detect global methylation, a powerful tool to predict overall survival in patients with MDS. Creative Commons Attribution License

  18. [Large-scale fragmentation of dna and the death of tumor cells by the action of the binary system ascorbic acid-metallocomplexes of cobalt in vitro].

    Science.gov (United States)

    Medvedev, A I; Leshchenko, V V

    2012-01-01

    High-molecular-weight DNA fragments are the markers of the early stage of apoptosis induced in eukaryotic cells by cytotoxins of different nature. The dynamics of the development of large-scale DNA fragmentation in K-562 leukemia cells by the action of the antitumor drug, the binary system ascorbic acid--cobalt phthalocyanine within 48 h of incubation, which correspond to two periods of the doubling of cell number in growing control cultures, have been studied. It was shown that, within the first hours of incubation, hydrogen peroxide generated by the system induces the formation of DNA fragments from 2200 to 50 kbp long. Later on the cell death accompanied by a decrease in the content of fragmented DNA is observed. Within 24 h of incubation, part of fragmented DNA remains unrepaired; after 48 h of incubation, a delay or a slowed down proliferation of K-562 cells, which differ from control cells also by a high level of death and a higher content of high-molecular-weight DNA fragments, is observed.

  19. DNA fragmentation in frozen sperm of Equus asinus: Zamorano-Leonés, a breed at risk of extinction.

    Science.gov (United States)

    Cortés-Gutiérrez, E I; Crespo, F; Gosálvez, A; Dávila-Rodríguez, M I; López-Fernández, C; Gósalvez, J

    2008-05-01

    The dynamics of sperm DNA fragmentation (sDF) and sperm viability were analyzed in frozen-thawed sperm samples of Equus asinus (Zamorano-Leonés), a breed at risk of extinction. Sperm DNA fragmentation was assessed using an adaptation of the sperm chromatin dispersion test developed for stallions in five different frozen samples. Sperm were thawed and incubated at different temperatures (37 degrees C, 25 degrees C, and 4 degrees C) and sDF was assessed at different times and compared. The mean sDF after thawing at the beginning of the experiment was 18.20+/-14.77% and did not differ significantly from the results of a neutral comet assay (22.0+/-19.34%). The tendency in the sDF of all donkeys indicated that sperm DNA is more sensitive to breakage when incubated at 37 degrees C than when incubated at 25 degrees C or 4 degrees C. Interestingly, the tendency was not the same when different animals were compared, and differences in sDF dynamics were established among individuals. sDF correlated negatively with sperm viability in some individuals but not in others. From a conservation perspective, sDF analysis may offer a new way to assess sperm quality in endangered breeds in order to identify and select the best semen samples for artificial reproduction purposes. In particular, we recommend for artificial insemination the use of semen samples with a slow increase in sDF with time after thawing.

  20. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval. PMID:28440264

  1. Effect of Incubation Time and Vitamin E Supplementation on Sperm Motility, Viability and DNA Fragmentation in Asthenoteratozoospermic Samples

    Directory of Open Access Journals (Sweden)

    Ali Asghar Ghafarizadeh

    2017-09-01

    Full Text Available Abstract Background: In Asthenoteratozoospermic‎ men, low motility, defected DNA and highly oxidative stress in ‎sperm ‎‎cause ‎poor‎ assisted reproductive techniques (ART outcomes. The aim of this study was to determine the effect of Vitamin E (Vit E, as a potent antioxidant, on sperm motility, viability and DNA integrity at different times of in vitro incubation (after 2, 4 and 6-h to improve asthenoteratozoospermic semen samples for ART. Materials and Methods: Asthenoteratozoospermic semen samples of 50 volunteers were collected and examined. Each sample was divided into two groups of control and vitamin E (2mM and kept in the 37 °C and 6 % CO2 for 2, 4 and 6 hours. After this incubation, sperm motility, viability and sperm DNA fragmentation (SCD were evaluated in each group. Data were analyzed using repeated measurement of ANOVA and T-test. The means were considered significantly different at p<0.05. Results:Significant decrease in total and progressive motility and viability as well as significant increase in sperm DNA damage (after 6h of incubation were found in control group vs. the control group before incubation (p<0.05. The sperm motility and viability was significantly higher in vitamin E group compared to untreated control group (p<0.05. Our results also showed that DNA fragmentation significantly was lower after 6h of vitamin E treatment (p<0.05. Conclusion: In vitro supplementation of vitamin E in asthenoteratozoospermia semen samples may protect spermatozoa from maltreatment effect of ROS during sperm sampling via keeping enzymatic and antioxidant process in optimum condition.

  2. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

  3. Direct Visualization of RNA-DNA Primer Removal from Okazaki Fragments Provides Support for Flap Cleavage and Exonucleolytic Pathways in Eukaryotic Cells.

    Science.gov (United States)

    Liu, Bochao; Hu, Jiazhi; Wang, Jingna; Kong, Daochun

    2017-03-24

    During DNA replication in eukaryotic cells, short single-stranded DNA segments known as Okazaki fragments are first synthesized on the lagging strand. The Okazaki fragments originate from ∼35-nucleotide-long RNA-DNA primers. After Okazaki fragment synthesis, these primers must be removed to allow fragment joining into a continuous lagging strand. To date, the models of enzymatic machinery that removes the RNA-DNA primers have come almost exclusively from biochemical reconstitution studies and some genetic interaction assays, and there is little direct evidence to confirm these models. One obstacle to elucidating Okazaki fragment processing has been the lack of methods that can directly examine primer removal in vivo In this study, we developed an electron microscopy assay that can visualize nucleotide flap structures on DNA replication forks in fission yeast ( Schizosaccharomyces pombe ). With this assay, we first demonstrated the generation of flap structures during Okazaki fragment processing in vivo The mean and median lengths of the flaps in wild-type cells were ∼51 and ∼41 nucleotides, respectively. We also used yeast mutants to investigate the impact of deleting key DNA replication nucleases on these flap structures. Our results provided direct in vivo evidence for a previously proposed flap cleavage pathway and the critical function of Dna2 and Fen1 in cleaving these flaps. In addition, we found evidence for another previously proposed exonucleolytic pathway involving RNA-DNA primer digestion by exonucleases RNase H2 and Exo1. Taken together, our observations suggest a dual mechanism for Okazaki fragment maturation in lagging strand synthesis and establish a new strategy for interrogation of this fascinating process. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    Directory of Open Access Journals (Sweden)

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  5. Restarting and recentering genetic algorithm variations for DNA fragment assembly: The necessity of a multi-strategy approach.

    Science.gov (United States)

    Hughes, James Alexander; Houghten, Sheridan; Ashlock, Daniel

    2016-12-01

    DNA Fragment assembly - an NP-Hard problem - is one of the major steps in of DNA sequencing. Multiple strategies have been used for this problem, including greedy graph-based algorithms, deBruijn graphs, and the overlap-layout-consensus approach. This study focuses on the overlap-layout-consensus approach. Heuristics and computational intelligence methods are combined to exploit their respective benefits. These algorithm combinations were able to produce high quality results surpassing the best results obtained by a number of competitive algorithms specially designed and tuned for this problem on thirteen of sixteen popular benchmarks. This work also reinforces the necessity of using multiple search strategies as it is clearly observed that algorithm performance is dependent on problem instance; without a deeper look into many searches, top solutions could be missed entirely. Copyright © 2016. Published by Elsevier Ireland Ltd.

  6. [Subcloning and sequencing of promoter active DNA fragment from Streptomyces lividans].

    Science.gov (United States)

    Jiang, H; Dong, K; Huan, L

    1994-12-01

    Random subfragments with strong promoter activities were isolated from 2. 1 kb fragment of pMG50-25 using a promoter-probe vector pIJ4083. One of the promoter-active region was narrowed down to a 220bp sequence. Putative promoter regions, SD sequence and start codons were found.

  7. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  8. Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

    Directory of Open Access Journals (Sweden)

    Yuqian Luo

    2016-11-01

    Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

  9. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    International Nuclear Information System (INIS)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet

    2014-01-01

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process

  10. Fragmentation and plasmid strand breaks in pure and gold-doped DNA irradiated by beams of fast hydrogen atoms

    Energy Technology Data Exchange (ETDEWEB)

    Wyer, J A; Latimer, C J; Shah, M B; Currell, F J [Centre for Plasma Physics, IRCEP, Queen' s University Belfast, BT7 1NN (United Kingdom); Butterworth, K T; Hirst, D G [Experimental Therapeutics Research Group, School of Pharmacy, Queen' s University Belfast, BT9 7BL (United Kingdom); Montenegro, E C [Instituto de Fisica, Universidade Federal do Rio de Janeiro, Cx. Postal 68528, Rio de Janeiro, RJ 21941-972 (Brazil)], E-mail: jeanwyer@phys.au.dk

    2009-08-07

    The results of an investigation into the damage caused to dry plasmid DNA after irradiation by fast (keV) hydrogen atoms are presented. Agarose gel electrophoresis was used to assess single and double strand break yields as a function of dose in dry DNA samples deposited on a mica substrate. Damage levels were observed to increase with beam energy. Strand break yields demonstrated a considerable dependence on sample structure and the method of sample preparation. Additionally, the effect of high-Z nanoparticles on damage levels was investigated by irradiating DNA samples containing controlled amounts of gold nanoparticles. In contrast to previous (photonic) studies, no enhancement of strand break yields was observed with the particles showing a slight radioprotective effect. A model of DNA damage as a function of dose has been constructed in terms of the probability for the creation of single and double strand breaks, per unit ion flux. This model provides quantitative conclusions about the effects of both gold nanoparticles and the different buffers used in performing the assays and, in addition, infers the proportion of multiply damaged fragments.

  11. The Effects of Melatonin on Oxidative Stress Parameters and DNA Fragmentation in Testicular Tissue of Rats Exposed to Microwave Radiation.

    Science.gov (United States)

    Sokolovic, Dusan; Djordjevic, Branka; Kocic, Gordana; Stoimenov, Tatjana J; Stanojkovic, Zoran; Sokolovic, Danka M; Veljkovic, Andrej; Ristic, Goran; Despotovic, Milena; Milisavljevic, Dusan; Jankovic, Radmilo; Binic, Ivana

    2015-01-01

    Microwaves from mobile phones are one of the environmental toxicants that are capable of compromising male fertility by inducing oxidative stress and apoptosis in the testes. Melatonin is a lipophilic tryptophan indole amine and a potent antioxidant. The aim of the study was to evaluate the effect of melatonin treatment on oxidative stress parameters and DNA fragmentation in the testicular tissue of rats exposed to microwave radiation (4 h/day). Adult Wistar rats were divided in 4 groups: I--treated with saline; II--treated with melatonin; III--exposed to microwaves; IV--exposed to microwaves and treated with melatonin. The melatonin (2 mg/kg ip) was administered daily. The animals were sacrificed after 20, 40 and 60 days. Melatonin treatment prevented previously registered increases in malondialdehyde after only 20 days. Furthermore, it reversed the effects of microwave exposure on xanthine oxidase (after 40 days) and acid-DNase activity (after 20 days). However, neither protein carbonyl content nor catalase and alkaline Dnase activity were changed due to melatonin treatment. Melatonin exerts potent antioxidant effects in the testes of rats exposed to microwaves by decreasing the intensity of oxidative stress; it also reduces DNA fragmentation.

  12. Cloned plasmid DNA fragments as calibrators for controlling GMOs: different real-time duplex quantitative PCR methods.

    Science.gov (United States)

    Taverniers, Isabel; Van Bockstaele, Erik; De Loose, Marc

    2004-03-01

    Analytical real-time PCR technology is a powerful tool for implementation of the GMO labeling regulations enforced in the EU. The quality of analytical measurement data obtained by quantitative real-time PCR depends on the correct use of calibrator and reference materials (RMs). For GMO methods of analysis, the choice of appropriate RMs is currently under debate. So far, genomic DNA solutions from certified reference materials (CRMs) are most often used as calibrators for GMO quantification by means of real-time PCR. However, due to some intrinsic features of these CRMs, errors may be expected in the estimations of DNA sequence quantities. In this paper, two new real-time PCR methods are presented for Roundup Ready soybean, in which two types of plasmid DNA fragments are used as calibrators. Single-target plasmids (STPs) diluted in a background of genomic DNA were used in the first method. Multiple-target plasmids (MTPs) containing both sequences in one molecule were used as calibrators for the second method. Both methods simultaneously detect a promoter 35S sequence as GMO-specific target and a lectin gene sequence as endogenous reference target in a duplex PCR. For the estimation of relative GMO percentages both "delta C(T)" and "standard curve" approaches are tested. Delta C(T) methods are based on direct comparison of measured C(T) values of both the GMO-specific target and the endogenous target. Standard curve methods measure absolute amounts of target copies or haploid genome equivalents. A duplex delta C(T) method with STP calibrators performed at least as well as a similar method with genomic DNA calibrators from commercial CRMs. Besides this, high quality results were obtained with a standard curve method using MTP calibrators. This paper demonstrates that plasmid DNA molecules containing either one or multiple target sequences form perfect alternative calibrators for GMO quantification and are especially suitable for duplex PCR reactions.

  13. Unusual Structures Are Present in DNA Fragments Containing Super-Long Huntingtin CAG Repeats

    Science.gov (United States)

    Duzdevich, Daniel; Li, Jinliang; Whang, Jhoon; Takahashi, Hirohide; Takeyasu, Kunio; Dryden, David T. F.; Morton, A. Jennifer; Edwardson, J. Michael

    2011-01-01

    Background In the R6/2 mouse model of Huntington's disease (HD), expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene. Methodology/Principal Findings We analysed the structure of polymerase chain reaction (PCR)-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM). As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I. Conclusions/Significance “Super-long” CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD. PMID:21347256

  14. A baculovirus alkaline nuclease knockout construct produces fragmented DNA and aberrant capsids

    International Nuclear Information System (INIS)

    Okano, Kazuhiro; Vanarsdall, Adam L.; Rohrmann, George F.

    2007-01-01

    DNA replication of bacmid-derived constructs of the Autographa californica multiple nucleocapsid nucleopolyhedrovirus (AcMNPV) was analyzed by field inversion gel electrophoresis (FIGE) in combination with digestion at a unique Eco81I restriction enzyme site. Three constructs were characterized: a parental bacmid, a bacmid deleted for the alkaline nuclease gene, and a bacmid from which the gp64 gene had been deleted. The latter was employed as a control for comparison with the alkaline nuclease knockout because neither yields infectious virus and their replication is limited to the initially transfected cells. The major difference between DNA replicated by the different constructs was the presence in the alkaline nuclease knockout of high concentrations of relatively small, subgenome length DNA in preparations not treated with Eco81I. Furthermore, upon Eco81I digestion, the alkaline nuclease knockout bacmid also yielded substantially more subgenome size DNA than the other constructs. Electron microscopic examination of cells transfected with the alkaline nuclease knockout indicated that, in addition to a limited number of normal-appearing electron-dense nucleocapsids, numerous aberrant capsid-like structures were observed indicating a defect in nucleocapsid maturation or in a DNA processing step that is necessary for encapsidation. Because of the documented role of the baculovirus alkaline nuclease and its homologs from other viruses in homologous recombination, these data suggest that DNA recombination may play a major role in the production of baculovirus genomes

  15. Pulsed field gel electrophoresis techniques for separating 1- to 50-kilobase DNA fragments.

    Science.gov (United States)

    Birren, B W; Lai, E; Hood, L; Simon, M I

    1989-03-01

    Conventional agarose gel electrophoresis separates DNA using a static electric field. The maximum size limit for separation of DNA by this method is about 20 kilobase pairs (kb). A number of new electrophoretic techniques which employ periodic reorientation of electric fields permit separation of DNA well beyond this size limit. We sought to determine whether the use of very fast (millisecond) field switching could improve separation of DNA in the size range of 1 to 50 kb. Additionally, we have compared the resolution obtained with each of the different field switching regimens for DNA in this size range. Switching intervals of from 0.2 to 900 ms were used with unidirectional pulsing of a single electric field, with pulsed field gels, and with field inversion gel electrophoresis. Plotting the mobility of DNA as a function of size demonstrates that under the conditions used, each of these techniques offers comparable resolution. We also have examined the separation obtained when field inversion gels are run with forward and reverse fields of equal voltage and different durations, versus using fields of equal duration and different voltages. Field inversion which uses forward and reverse fields of different voltages yields resolution which is superior to the other methods examined.

  16. Unusual structures are present in DNA fragments containing super-long Huntingtin CAG repeats.

    Directory of Open Access Journals (Sweden)

    Daniel Duzdevich

    2011-02-01

    Full Text Available In the R6/2 mouse model of Huntington's disease (HD, expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene.We analysed the structure of polymerase chain reaction (PCR-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM. As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I."Super-long" CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD.

  17. Linker-mediated recombinational subcloning of large DNA fragments using yeast.

    Science.gov (United States)

    Raymond, Christopher K; Sims, Elizabeth H; Olson, Maynard V

    2002-01-01

    The homologous recombination pathway in yeast is an ideal tool for the sequence-specific assembly of plasmids. Complementary 80-nucleotide oligonucleotides that overlap a vector and a target fragment were found to serve as efficient recombination linkers for fragment subcloning. Using electroporation, single-stranded 80-mers were adequate for routine plasmid construction. A cycloheximide-based counterselection was introduced to increase the specificity of cloning by homologous recombination relative to nonspecific vector background. Reconstruction experiments suggest this counterselection increased cloning specificity by 100-fold. Cycloheximide counterselection was used in conjunction with 80-bp linkers to subclone targeted regions from bacterial artificial chromosomes. This technology may find broad application in the final stages of completing the Human Genome Sequencing Project and in applications of BAC clones to the functional analysis of complex genomes.

  18. The effect of two pre-cryopreservation single layer colloidal centrifugation protocols in combination with different freezing extenders on the fragmentation dynamics of thawed equine sperm DNA.

    Science.gov (United States)

    Gutiérrez-Cepeda, Luna; Fernández, Alvaro; Crespo, Francisco; Ramírez, Miguel Ángel; Gosálvez, Jaime; Serres, Consuelo

    2012-12-05

    Variability among stallions in terms of semen cryopreservation quality renders it difficult to arrive at a standardized cryopreservation method. Different extenders and processing techniques (such us colloidal centrifugation) are used in order to optimize post-thaw sperm quality. Sperm chromatin integrity analysis is an effective tool for assessing such quality. The aim of the present study was to compare the effect of two single layer colloidal centrifugation protocols (prior to cryopreservation) in combination with three commercial freezing extenders on the post-thaw chromatin integrity of equine sperm samples at different post-thaw incubation (37°C) times (i.e., their DNA fragmentation dynamics). Post-thaw DNA fragmentation levels in semen samples subjected to either of the colloidal centrifugation protocols were significantly lower (pcentrifugation. The use of InraFreeze® extender was associated with significantly less DNA fragmentation than the use of Botu-Crio® extender at 6 h of incubation, and than the use of either Botu-Crio® or Gent® extender at 24 h of incubation (pcentrifugation performed with extended or raw semen prior to cryopreservation reduces DNA fragmentation during the first four hours after thawing. Further studies are needed to determine the influence of freezing extenders on equine sperm DNA fragmentation dynamics.

  19. Pleural fluid Gram stain

    Science.gov (United States)

    Gram stain of pleural fluid ... mixing it with a violet stain (called a Gram stain). A laboratory specialist uses a microscope to ... reveals an abnormal collection of pleural fluid. The Gram stain can help identify the bacteria that might ...

  20. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases. Conclusions/Significance This study demonstrates that DNA barcoding principles can be applied...... by plant health services and researchers for online phytoplasma identification....

  1. Isolation of rye-specific DNA fragment and genetic diversity analysis ...

    Indian Academy of Sciences (India)

    PCR-based markers are useful and convenient tools for de- tecting alien chromosome segments incorporated into wheat genomes. Some rye-specific PCR-based markers have been successfully developed by random amplified polymorphic. DNA (RAPD) analysis (Iqbal and Rayburn 1995; Katto et al. 2004; Liu et al. 2008 ...

  2. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  3. An investigation of the potential effect of sperm nuclear vacuoles in human spermatozoa on DNA fragmentation using a neutral and alkaline Comet assay.

    Science.gov (United States)

    Pastuszek, E; Kiewisz, J; Skowronska, P; Liss, J; Lukaszuk, M; Bruszczynska, A; Jakiel, G; Lukaszuk, K

    2017-03-01

    Presence of vacuoles and degree of sperm DNA damage are considered to be the basic factors used for the assessment of sperm fertilization capacity. We aimed to investigate the link between these two parameters. According to our knowledge, this is the first study where the Comet assay was used to assess the degree of DNA fragmentation of sperm categorized by Motile Sperm Organelle Morphology Examination (MSOME) Grades. Semen samples from 10 patients were assessed. Spermatozoa were graded into four MSOME groups according to the Vanderzwalmen's criteria. A total of 3930 motile spermatozoa were selected one-by-one using an inverted microscope and transferred onto two different slides. The degree of DNA fragmentation was analyzed by alkaline and neutral Comet assay. Results of the neutral Comet assay showed that Grade I spermatozoa (absence of vacuoles) presented significantly lower dsDNA fragmentation level (mean: 3.13 ± 1.17%) than Grade II (maximum of two small vacuoles; mean: 10.34 ± 2.65%), Grade III (more than two small vacuoles or at least one large vacuole; mean: 23.88 ± 8.37%), and Grade IV (large vacuoles associated with abnormal head shapes or other abnormalities; mean: 36.94 ± 7.78%; p  0.05). Probably, the vacuoles may be responsible for double strand DNA breaks rather than single strand DNA breaks (only 2.39% spermatozoa in MSOME Grade II, 1.76% in III, and 3.16% in IV has single strand breaks). The results demonstrate that lower MSOME grading correlates with lower sperm DNA fragmentation. Therefore, the observation of sperm nuclear vacuoles using real-time optical microscopy without precise DNA fragmentation examination is not sufficient for optimal sperm selection for intracytoplasmic sperm injection. © 2017 American Society of Andrology and European Academy of Andrology.

  4. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  5. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. PCR typing of DNA fragments of the two short tandem repeat (STR) systems upstream of the human myelin basic protein (MBP) gene in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Frederiksen, J; Morling, N

    1996-01-01

    the Eskimo and Danish populations. Significant differences were observed between the distribution of fragments ('alleles') in Greenland Eskimos and in Danes. The allele MBP-A7 was considerably more frequent in Eskimos (0.2214) than in Danes (0.0775) and also the allele MBP-B9 was considerably more frequent......DNA from the double short tandem repeat (STR) system MBP (locus 18q23-pter) was amplified by the polymerase chain reaction (PCR) and the two polymorphic repeat systems were separated by cutting with the restriction enzyme NlaIII. The lengths of the DNA fragments of the two MBP STR systems MBP...

  7. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  8. Historic cycles of fragmentation and expansion in Parnassius smintheus (papilionidae) inferred using mitochondrial DNA.

    Science.gov (United States)

    DeChaine, Eric G; Martini, Andrew P

    2004-01-01

    Climate oscillations of the Quaternary drove the repeated expansion and contraction of ecosystems. Alpine organisms were probably isolated in sky island refugia during warm interglacials, such as now, and expanded their range by migrating down-slope during glacial periods. We used population genetic and phylogenetic approaches to infer how paleoclimatic events influenced the distribution of genetic variation in the predominantly alpine butterfly Parnassius smintheus. We sequenced a 789 bp region of cytochrome oxidase I for 385 individuals from 20 locations throughout the Rocky Mountains, ranging from southern Colorado to northern Montana. Analyses revealed at lease two centers of diversity in the northern and southern Rocky Mountains and strong population structure. Nested clade analysis suggested that the species experienced repeated cycles of population expansion and fragmentation. The estimated ages of these events, assuming a molecular clock, corresponded with paleoclimatic data on habitat expansion and contraction over the past 400,000 years. We propose that alpine butterflies persisted in an archipelago of isolated sky islands during interglacials and that populations expanded and became more connected during cold glacial periods. An archipelago model implies that the effects of genetic drift and selection varied among populations, depending on their latitude, area, and local environment. Alpine organisms are sensitive indicators of climate change and their history can be used to predict how high-elevation ecosystems might respond to further climate warming.

  9. Episodic air pollution is associated with increased DNA fragmentation in human sperm without other changes in semen quality

    Energy Technology Data Exchange (ETDEWEB)

    Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)

    2005-10-01

    This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.

  10. Towards the onset of fruit tree growing north of the Alps: ancient DNA from waterlogged apple (Malus sp.) seed fragments.

    Science.gov (United States)

    Schlumbaum, Angela; van Glabeke, Sabine; Roldan-Ruiz, Isabel

    2012-01-20

    Wild apples (Malus sp.) have been a major food source in the northern Alpine region since prehistory and their use is well understood. The onset of deliberate fruit tree growing in the area is, however, less clear. It is generally assumed that horticulture was practised in Roman times, but it might be even earlier. In the archaeological record seed testa and pericarp remains are particularly frequent at sites with waterlogged preservation such as lakeshore settlements or wells, pits and ditches, but the distinction between wild and domestic plants is not morphologically possible. With waterlogged remains being one main source of information about past fruit cultivation, we have tested the feasibility of analysing ancient DNA from waterlogged preserved bulk samples of testa fragments. We studied apple seeds from three Neolithic and three Roman sites with waterlogged preservation in the Alpine foreland. Chloroplast markers failed in all samples, but nuclear ITS1 (internal transcribed spacer region 1) of the ribosomal DNA was successfully typed in two Roman samples from the site Oedenburg/Biesheim-Kunheim (Haut-Rhin, F). The retrieved ITS1 sequences are identical to each other and are shared with wild Malus sylvestris and Malus sieversii, and with domestic apple cultivars, supporting the potential of using waterlogged remains for identifying the genetic status of apple diachronically. Copyright © 2011 Elsevier GmbH. All rights reserved.

  11. Standardization of the Romanowsky-Giemsa stain: the influence of staining time on the RG-staining pattern.

    Science.gov (United States)

    Schulte, E

    1987-01-01

    In this paper the influence of staining time on the staining pattern of Romanowsky-Giemsa (RG) type stains is investigated. Smears of rabbit bone marrow and of human venous blood were stained with azure B-eosin Y, azure A-eosin Y and with the cationic dyes alone under varying conditions of staining time and dye concentration. The stained smears were investigated by integrating microdensitometry. DNA-polyacrylamide (PAA) model films were stained with azure A-eosin Y, the extinction of the stained model films was determined by spectrophotometry. With increasing staining time the color of the cell nuclei changed from blue to an intense purple, the texture of the nuclear chromatin became more prominent. Prolonged staining resulted in over-staining of the cell nuclei with loss of a distinct chromatin texture. Besides such factors as dye concentration and pH of the staining solution standardization of staining time may be considered necessary for the reproducibility of the RG staining pattern.

  12. Gram stains: a resource for retrospective analysis of bacterial pathogens in clinical studies.

    Science.gov (United States)

    Srinivasan, Usha; Ponnaluri, Sreelatha; Villareal, Lisa; Gillespie, Brenda; Wen, Ai; Miles, Arianna; Bucholz, Brigette; Marrs, Carl F; Iyer, Ram K; Misra, Dawn; Foxman, Betsy

    2012-01-01

    We demonstrate the feasibility of using qPCR on DNA extracted from vaginal Gram stain slides to estimate the presence and relative abundance of specific bacterial pathogens. We first tested Gram stained slides spiked with a mix of 10(8) cfu/ml of Escherichia coli and 10(5) cfu/ml of Lactobacillus acidophilus. Primers were designed for amplification of total and species-specific bacterial DNA based on 16S ribosomal gene regions. Sample DNA was pre-amplified with nearly full length 16S rDNA ribosomal gene fragment, followed by quantitative PCR with genera and species-specific 16S rDNA primers. Pre-amplification PCR increased the bacterial amounts; relative proportions of Escherichia coli and Lactobacillus recovered from spiked slides remained unchanged. We applied this method to forty two archived Gram stained slides available from a clinical trial of cerclage in pregnant women at high risk of preterm birth. We found a high correlation between Nugent scores based on bacterial morphology of Lactobacillus, Gardenerella and Mobiluncus and amounts of quantitative PCR estimated genus specific DNA (rrn copies) from Gram stained slides. Testing of a convenience sample of eight paired vaginal swabs and Gram stains freshly collected from healthy women found similar qPCR generated estimates of Lactobacillus proportions from Gram stained slides and vaginal swabs. Archived Gram stained slides collected from large scale epidemiologic and clinical studies represent a valuable, untapped resource for research on the composition of bacterial communities that colonize human mucosal surfaces.

  13. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  14. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  15. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    The purpose of this study was to evaluate fluorescent amplified fragment length polymorphism (AFLP) analysis for the inter- and intraspecies differentiation of a collection of 96 strains of Listeria monocytogenes and 10 non- L. monocytogenes strains representing six other Listeria species...... of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included....... Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  16. Development of a simple and powerful method, cDNA AFLP-SSPAG ...

    African Journals Online (AJOL)

    Differential cDNAs were easily obtained from silver stained cDNA-AFLP separated on polyacylamide gels. The cDNA was then reamplified, cloned and fragments were sequenced. Sequenced clones were used as probes in northern dot blot analyses and library screening. Full-length cDNA was cloned from a library ...

  17. Intervention improves assisted conception intracytoplasmic sperm injection outcomes for patients with high levels of sperm DNA fragmentation: a retrospective analysis.

    Science.gov (United States)

    Bradley, C K; McArthur, S J; Gee, A J; Weiss, K A; Schmidt, U; Toogood, L

    2016-09-01

    Sperm DNA fragmentation (SDF) is used in assisted reproductive technology (ART) programs as an indicator for sperm quality, although there is still a lack of consensus as to its clinical utility. In this retrospective study, we examined intracytoplasmic sperm injection (ICSI) outcomes of 1924 infertile patients who underwent SDF analysis using the sperm chromatin integrity test. ART patients were classified as having low [DNA fragmentation index (DFI) <29%] or high SDF (DFI ≥29%) and by whether or not an intervention [physiological intracytoplasmic sperm injection (PICSI), intracytoplasmic morphologically selected sperm injection (IMSI), testicular sperm extraction (TESE)/testicular sperm aspiration (TESA), frequent ejaculation] was performed. High SDF patients who did not have an intervention had a lower fertilization rate and poorer clinical outcomes from blastocyst transfers as compared with low SDF patients; the fertilization rate was 66.0% vs. 70.2% (p = 0.042), single embryo transfer (SET) fetal heart pregnancy rate was 28.5% vs. 45.2% (p = 0.042), and SET live birth rate was 24.9% vs. 40.6% (p = 0.060), respectively. Furthermore, high SDF patients who had an intervention had significantly improved blastocyst transfer outcomes, similar to those of low SDF patients; the SET live birth rate for high SDF intervention patients was 43.8% as compared with 24.9% for high SDF no intervention patients (p = 0.037) and 40.6% for low SDF patients (p = 0.446). Analysis of the three main intervention subgroups for high SDF patients revealed that TESE/TESA patients had the highest SET live birth rate; in comparison with 24.2% for high SDF patients who did not have an intervention, PICSI patients had 38.3% (p = 0.151), IMSI patients had 28.7% (p = 0.680), and TESE/TESA patients had 49.8% (p = 0.020). Our data suggest that SDF results indicate ICSI outcomes and that patients who have high SDF benefit from an intervention. © 2016 American Society of

  18. Differential staining of bacteria: gram stain.

    Science.gov (United States)

    Moyes, Rita B; Reynolds, Jackie; Breakwell, Donald P

    2009-11-01

    In 1884, Hans Christian Gram, a Danish doctor, developed a differential staining technique that is still the cornerstone of bacterial identification and taxonomic division. This multistep, sequential staining protocol separates bacteria into four groups based on cell morphology and cell wall structure: Gram-positive cocci, Gram-negative cocci, Gram-positive rods, and Gram-negative rods. The Gram stain is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures. (c) 2009 by John Wiley & Sons, Inc.

  19. An amphioxus RAG1-like DNA fragment encodes a functional central domain of vertebrate core RAG1.

    Science.gov (United States)

    Zhang, Yanni; Xu, Ke; Deng, Anqi; Fu, Xing; Xu, Anlong; Liu, Xiaolong

    2014-01-07

    The highly diversified repertoire of antigen receptors in the vertebrate immune system is generated via proteins encoded by the recombination activating genes (RAGs) RAG1 and RAG2 by a process known as variable, diversity, and joining [V(D)J] gene recombination. Based on the study of vertebrate RAG proteins, many hypotheses have been proposed regarding the origin and evolution of RAG. This issue remains unresolved, leaving a significant gap in our understanding of the evolution of adaptive immunity. Here, we show that the amphioxus genome contains an ancient RAG1-like DNA fragment (bfRAG1L) that encodes a virus-related protein that is much shorter than vertebrate RAG1 and harbors a region homologous to the central domain of core RAG1 (cRAG1). bfRAG1L also contains an unexpected retroviral type II nuclease active site motif, DXN(D/E)XK, and is capable of degrading both DNA and RNA. Moreover, bfRAG1L shares important functional properties with the central domain of cRAG1, including interaction with RAG2 and localization to the nucleus. Remarkably, the reconstitution of bfRAG1L into a cRAG1-like protein yielded an enzyme capable of recognizing recombination signal sequences and performing V(D)J recombination in the presence of mouse RAG2. Moreover, this reconstituted cRAG1-like protein could mediate the assembly of antigen receptor genes in RAG1-deficient mice. Together, our results demonstrate that amphioxus bfRAG1L encodes a protein that is functionally equivalent to the central domain of cRAG1 and is well prepared for further evolution to mediate V(D)J recombination. Thus, our findings provide unique insights into the evolutionary origin of RAG1.

  20. Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N

    2013-01-01

    The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors...... that may be co-extracted with the DNA. Using 120 forensic trace evidence samples consisting of various types of fabric, we compared three automated DNA extraction methods based on magnetic beads (PrepFiler Express Forensic DNA Extraction Kit on an AutoMate Express, QIAsyphony DNA Investigator kit either...... with the sample pre-treatment recommended by Qiagen or an in-house optimized sample pre-treatment on a QIAsymphony SP) and one manual method (Chelex) with the aim of reducing the amount of PCR inhibitors in the DNA extracts and increasing the proportion of reportable STR-profiles. A total of 480 samples were...

  1. Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning

    OpenAIRE

    Wang, Shang; Chen, Wen; Zhang, Kai; Jiao, Peng; Mo, Lihua; Yang, Xiaoxu; Hu, Xiang; Zhang, Jian; Wei, Chenxi; Xiang, Shuanglin

    2015-01-01

    Long fragment cloning is a challenge for its difficulty in accurate amplifying and tendency to get unwanted mutation. Here we discuss Restriction-based Multiple-fragment Assembly Strategy's advantages and limitations. In this strategy, rather than PCR amplifying the entire coding sequence (CDS) at one time, we amplified and sequenced smaller fragments which are shorter than 1.5kb spanning the CDS. After that, the sequence-proved fragments were assembled by digestion-ligation cloning to the ta...

  2. Port-Wine Stains

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Port-Wine Stains KidsHealth / For Parents / Port-Wine Stains What's ... Manchas de vino de oporto What Are Port-Wine Stains? A port-wine stain is a type ...

  3. Chromogenic In Situ Hybridization and p16/Ki67 Dual Staining on Formalin-Fixed Paraffin-Embedded Cervical Specimens: Correlation with HPV-DNA Test, E6/E7 mRNA Test, and Potential Clinical Applications

    Directory of Open Access Journals (Sweden)

    Roberta Zappacosta

    2013-01-01

    Full Text Available Although HPV-DNA test and E6/E7 mRNA analyses remain the current standard for the confirmation of human papillomavirus (HPV infections in cytological specimens, no universally adopted techniques exist for the detection of HPV in formalin-fixed paraffin-embedded samples. Particularly, in routine laboratories, molecular assays are still time-consuming and would require a high level of expertise. In this study, we investigated the possible use of a novel HPV tyramide-based chromogenic in situ hybridization (CISH technology to locate HPV on tissue specimens. Then, we evaluate the potential usefulness of p16INK4a/Ki-67 double stain on histological samples, to identify cervical cells expressing HPV E6/E7 oncogenes. In our series, CISH showed a clear signal in 95.2% of the specimens and reached a sensitivity of 86.5%. CISH positivity always matched with HPV-DNA positivity, while 100% of cases with punctated signal joined with cervical intraepithelial neoplasia grade 2 or worse (CIN2+. p16/Ki67 immunohistochemistry gave an interpretable result in 100% of the cases. The use of dual stain significantly increased the agreement between pathologists, which reached 100%. Concordance between dual stain and E6/E7 mRNA test was 89%. In our series, both CISH and p16INK4a/Ki67 dual stain demonstrated high grade of performances. In particular, CISH would help to distinguish episomal from integrated HPV, in order to allow conclusions regarding the prognosis of the lesion, while p16INK4a/Ki67 dual stain approach would confer a high level of standardization to the diagnostic procedure.

  4. Chromogenic In Situ Hybridization and p16/Ki67 Dual Staining on Formalin-Fixed Paraffin-Embedded Cervical Specimens: Correlation with HPV-DNA Test, E6/E7 mRNA Test, and Potential Clinical Applications

    Science.gov (United States)

    Zappacosta, Roberta; Colasante, Antonella; Viola, Patrizia; D'Antuono, Tommaso; Lattanzio, Giuseppe; Capanna, Serena; Gatta, Daniela Maria Pia; Rosini, Sandra

    2013-01-01

    Although HPV-DNA test and E6/E7 mRNA analyses remain the current standard for the confirmation of human papillomavirus (HPV) infections in cytological specimens, no universally adopted techniques exist for the detection of HPV in formalin-fixed paraffin-embedded samples. Particularly, in routine laboratories, molecular assays are still time-consuming and would require a high level of expertise. In this study, we investigated the possible use of a novel HPV tyramide-based chromogenic in situ hybridization (CISH) technology to locate HPV on tissue specimens. Then, we evaluate the potential usefulness of p16INK4a/Ki-67 double stain on histological samples, to identify cervical cells expressing HPV E6/E7 oncogenes. In our series, CISH showed a clear signal in 95.2% of the specimens and reached a sensitivity of 86.5%. CISH positivity always matched with HPV-DNA positivity, while 100% of cases with punctated signal joined with cervical intraepithelial neoplasia grade 2 or worse (CIN2+). p16/Ki67 immunohistochemistry gave an interpretable result in 100% of the cases. The use of dual stain significantly increased the agreement between pathologists, which reached 100%. Concordance between dual stain and E6/E7 mRNA test was 89%. In our series, both CISH and p16INK4a/Ki67 dual stain demonstrated high grade of performances. In particular, CISH would help to distinguish episomal from integrated HPV, in order to allow conclusions regarding the prognosis of the lesion, while p16INK4a/Ki67 dual stain approach would confer a high level of standardization to the diagnostic procedure. PMID:24369532

  5. Calcium effect on the content of DNA and NYS-stained nuclear, nucleolar and cytoplasmic proteins in cortex cells of pea (Pisum sativum L. roots treated with heavy metals

    Directory of Open Access Journals (Sweden)

    E. Stecka

    2014-01-01

    Full Text Available Using cytophotometric procedures, following Feulgen-NYS staining, the measurements of DNA and nuclear, nucleolar and cytoplasmic protein contents in cortex cells of pea roots growing for 144 h in calcium and/or heavy metals (Cd2+, Cr3+, Pb2+ presence were made. All tested metals treatment reduced the number of nuclei in 4C DNA class and induced appearance of nuclei with DNA amount below 2C, that was expressed in diminished DNA content. The level of NYS proteins in cells underwent also reduction. In lead presence protein content diminished in nucleus. On the other hand, increased amount of nuclear, nucleolar and cytoplasmic proteins was observed in material treated with cadmium while only of nucleolar protein content in chromium presence. In root cells treated with tested metals protein content in nucleus was related with ploidy level, disturbances in this relation appeared in nucleolus and mostly in cytoplasm. Calcium added to chromium and mostly to lead solutions diminished the toxic effect of these metals that was demonstrated by an increase in DNA content, although calcium alone reduced DNA amount in nucleus due to lower number of 4C nuclei accompanied by appearance of 1C and 1-2C DNA classes. Calcium in different ways affected protein content changed by metal treatment. Present in cadmium solution it caused a further reduction in protein content in nucleus, nucleolus and cytoplasm but increased nuclear and cytoplasmic protein when added to lead, and nucleolar proteins - in chromium solution. Moreover, calcium ions presence in metal solutions did not restore the relationship between ploidy level and nucleolar and cytoplasmic NYS stained proteins and it did not disturbe the relation existing in nucleus.

  6. The mutT defect does not elevate chromosomal fragmentation in Escherichia coli because of the surprisingly low levels of MutM/MutY-recognized DNA modifications.

    Science.gov (United States)

    Rotman, Ella; Kuzminov, Andrei

    2007-10-01

    Nucleotide pool sanitizing enzymes Dut (dUTPase), RdgB (dITPase), and MutT (8-oxo-dGTPase) of Escherichia coli hydrolyze noncanonical DNA precursors to prevent incorporation of base analogs into DNA. Previous studies reported dramatic AT-->CG mutagenesis in mutT mutants, suggesting a considerable density of 8-oxo-G in DNA that should cause frequent excision and chromosomal fragmentation, irreparable in the absence of RecBCD-catalyzed repair and similar to the lethality of dut recBC and rdgB recBC double mutants. In contrast, we found mutT recBC double mutants viable with no signs of chromosomal fragmentation. Overproduction of the MutM and MutY DNA glycosylases, both acting on DNA containing 8-oxo-G, still yields no lethality in mutT recBC double mutants. Plasmid DNA, extracted from mutT mutM double mutant cells and treated with MutM in vitro, shows no increased relaxation, indicating no additional 8-oxo-G modifications. Our DeltamutT allele elevates the AT-->CG transversion rate 27,000-fold, consistent with published reports. However, the rate of AT-->CG transversions in our mutT(+) progenitor strain is some two orders of magnitude lower than in previous studies, which lowers the absolute rate of mutagenesis in DeltamutT derivatives, translating into less than four 8-oxo-G modifications per genome equivalent, which is too low to cause the expected effects. Introduction of various additional mutations in the DeltamutT strain or treatment with oxidative agents failed to increase the mutagenesis even twofold. We conclude that, in contrast to the previous studies, there is not enough 8-oxo-G in the DNA of mutT mutants to cause elevated excision repair that would trigger chromosomal fragmentation.

  7. The mutT Defect Does Not Elevate Chromosomal Fragmentation in Escherichia coli Because of the Surprisingly Low Levels of MutM/MutY-Recognized DNA Modifications▿

    Science.gov (United States)

    Rotman, Ella; Kuzminov, Andrei

    2007-01-01

    Nucleotide pool sanitizing enzymes Dut (dUTPase), RdgB (dITPase), and MutT (8-oxo-dGTPase) of Escherichia coli hydrolyze noncanonical DNA precursors to prevent incorporation of base analogs into DNA. Previous studies reported dramatic AT→CG mutagenesis in mutT mutants, suggesting a considerable density of 8-oxo-G in DNA that should cause frequent excision and chromosomal fragmentation, irreparable in the absence of RecBCD-catalyzed repair and similar to the lethality of dut recBC and rdgB recBC double mutants. In contrast, we found mutT recBC double mutants viable with no signs of chromosomal fragmentation. Overproduction of the MutM and MutY DNA glycosylases, both acting on DNA containing 8-oxo-G, still yields no lethality in mutT recBC double mutants. Plasmid DNA, extracted from mutT mutM double mutant cells and treated with MutM in vitro, shows no increased relaxation, indicating no additional 8-oxo-G modifications. Our ΔmutT allele elevates the AT→CG transversion rate 27,000-fold, consistent with published reports. However, the rate of AT→CG transversions in our mutT+ progenitor strain is some two orders of magnitude lower than in previous studies, which lowers the absolute rate of mutagenesis in ΔmutT derivatives, translating into less than four 8-oxo-G modifications per genome equivalent, which is too low to cause the expected effects. Introduction of various additional mutations in the ΔmutT strain or treatment with oxidative agents failed to increase the mutagenesis even twofold. We conclude that, in contrast to the previous studies, there is not enough 8-oxo-G in the DNA of mutT mutants to cause elevated excision repair that would trigger chromosomal fragmentation. PMID:17616589

  8. cDNA-amplified fragment length polymorphism to study the transcriptional responses of Lactobacillus rhamnosus growing in cheese-like medium.

    Science.gov (United States)

    Bove, C G; Lazzi, C; Bernini, V; Bottari, B; Neviani, E; Gatti, M

    2011-10-01

    Lactobacillus rhamnosus is a dominant species during Parmigiano Reggiano cheese ripening and exhibits a great adaptability to unfavourable growth conditions. Gene expression of a Lact. rhamnosus, isolated from Parmigiano Reggiano cheese, grown in a rich medium (MRS) and in a cheese-like medium (CB) has been compared by a novel cDNA-amplified fragment length polymorphism (cDNA-AFLP) protocol. Two techniques, capillary and gel electrophoresis cDNA-AFLP, were applied to generate unique transcript tags from reverse-transcribed messenger RNA using the immobilization of biotinylated 3'-terminal cDNA fragments on streptavidin-coated Dynabeads. The use of three pairs of primers allowed detecting 64 genes expressed in MRS and 96 in CB. Different transcripts were observed when Lact. rhamnosus was cultured on CB and MRS. The cDNA-AFLP approach proved to be able to show that Lact. rhamnosus modifies the expression of a large part of genes when cultivated in CB compared with growth under optimal conditions (MRS). In particular, the profiles of the strain grown in CB were more complex probably because the cells activate different metabolic pathways to generate energy and to respond to the environmental changes. This is the first research on Lact. rhamnosus isolated from cheese and represents one of the few concerning bacterial transcriptomic analysis towards cDNA-AFLP approaches. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  9. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  10. The influence of ginger (Zingiber officinale on human sperm quality and DNA fragmentation: A double-blind randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Jalil Hosseini

    2016-08-01

    Full Text Available Background: Although the effectiveness of ginger as an antioxidant agent has been exploited, little human research has been conducted on its activity on male reproductive functions. Objective: This study was designed to investigate the effects of ginger (Zingiber officinale on sperm DNA fragmentation (SDF in infertile men. Materials and Methods: This randomized double-blind, placebo-controlled trial with a 1:1 allocation was performed on 100 infertility treatment candidates who were admitted to Royan Institute for Reproductive Biomedicine, Tehran, Iran. Patients were randomly assigned to receive one of two treatments: ginger and placebo. Patients were given a 3-month oral treatment (members received capsules containing 250 mg of ginger powder twice a day in ginger and a placebo in other group. Before and after treatment, standardized semen samples were obtained to determine sperm concentration, motility, and SDF according to World Health Organization. Results: There was no significant difference between two groups regarding SDF at baseline (53.48. 95%CI: 37.95-69.02 in cases and (56.75, 95%CI: 40.01-73.5 in controls. The average positive percentage of SDF in patients receiving ginger (17.77, 95%CI: 6.16-29.39 was lower compared with placebo (40.54, 95%CI: 23.94-57.13 after three month of treatment (p=0.02. In multivariate analysis, SDF was significantly lower in patients receiving ginger compared with placebo (mean difference: 3.21, 95%CI: 0.78-5.63, p=0.009. There were no significant differences between two groups regarding to semen parameters. Conclusion: The present study has demonstrated that ginger in a controlled study of efficacy was effective in decreasing SDF in infertile men.

  11. Molecular characterization of a DNA fragment harboring the replicon of pBMB165 from Bacillus thuringiensis subsp. tenebrionis

    Directory of Open Access Journals (Sweden)

    Yu Ziniu

    2006-10-01

    Full Text Available Abstract Background Bacillus thuringiensis belongs to the Bacillus cereus sensu lato group of Gram-positive and spore-forming bacteria. Most isolates of B. thuringiensis can bear many endogenous plasmids, and the number and size of these plasmids can vary widely among strains or subspecies. As far as we know, the replicon of the plasmid pBMB165 is the first instance of a plasmid replicon being isolated from subsp. tenebrionis and characterized. Results A 20 kb DNA fragment containing a plasmid replicon was isolated from B. thuringiensis subsp. tenebrionis YBT-1765 and characterized. By Southern blot analysis, this replicon region was determined to be located on pBMB165, the largest detected plasmid (about 82 kb of strain YBT-1765. Deletion analysis revealed that a replication initiation protein (Rep165, an origin of replication (ori165 and an iteron region were required for replication. In addition, two overlapping ORFs (orf6 and orf10 were found to be involved in stability control of plasmid. Sequence comparison showed that the replicon of pBMB165 was homologous to the pAMβ1 family replicons, indicating that the pBMB165 replicon belongs to this family. The presence of five transposable elements or remnants thereof in close proximity to and within the replicon control region led us to speculate that genetic exchange and recombination are potentially responsible for the divergence among the replicons of this plasmid family. Conclusion The replication and stability features of the pBMB165 from B. thuringiensis subsp. tenebrionis YBT-1765 were identified. Of particular interest is the homology and divergence shared between the pBMB165 replicon and other pAMβ1 family replicons.

  12. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  13. Acid-fast stain

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003766.htm Acid-fast stain To use the sharing features on this page, please enable JavaScript. The acid-fast stain is a laboratory test that determines ...

  14. Differences in Electrostatic Potential Around DNA Fragments Containing Adenine and 8-oxo-Adenine. An Analysis Based on Regular Cylindrical Projection

    Energy Technology Data Exchange (ETDEWEB)

    Haranczyk, Maciej; Miller, John H; Gutowski, Maciej S

    2007-07-01

    Changes of electrostatic potential (EP) around the DNA molecule resulting from chemical modifications of nucleotides may play a role in enzymatic recognition of damaged sites. Effects of chemical modifications of nucleotides on the structure of DNA have been characterized through large scale density functional theory computations. Quantum mechanical structural optimizations of DNA fragments with three pairs of nucleotides and accompanying counteractions were performed with a B3LYP exchange-correlation functional and 6-31G** basis sets. The “intact” DNA fragment contained adenine in the middle layer, while the “damaged” fragment had the adenine replaced with 8-oxo-adenine. The electrostatic potential around these DNA fragments was projected on a cylindrical surface around the double helix. The two-dimensional maps of EP of the intact and damaged DNA fragments were analyzed to identify these modifications of EP that result from the occurrence of 8-oxo-adenine (8oA). It was found that distortions of a phosphate group neighboring 8oA and displacements of the accompanying countercation are clearly reflected in the EP maps. Helpful discussions Michel Dupuis are gratefully acknowledged. Authors wish to thank Marcel Swart for directing us to a compilation of van der Waals radii. This work was supported by the: (i) US DOE Office of Biological and Environmental Research, Low Dose Radiation Research Program (M.G. and M.H.), (ii) the Office of Science (BER), U. S. Department of Energy, Grant No. DE-FG03-02ER63470 (JHM), (iii) Polish State Committee for Scientific Research (KBN) Grant DS/8221-4-0140-6 (MG), (iv) European Social Funds (EFS) ZPORR/2.22/II/2.6/ARP/U/2/05 (M.H.). M.H. holds the Foundation for Polish Science (FNP) award for young scientists. The calculations were performed at the Academic Computer Center in Gdansk (TASK) and at the Molecular Science Computing Facility (MSCF) in the William R. Wiley Environmental Molecular Sciences Laboratory, a national

  15. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included...... for virulence gene allele characterization. The 96 L. monocytogenes strains were divided into two major clusters by AFLP fingerprinting at a similarity level of 82% in concordance with the results of PFGE, RAPD, and ribotyping. One main cluster consisted of all of the 24 L. monocytogenes hly allele 1 strains...

  16. Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

    DEFF Research Database (Denmark)

    Stronati, A; Manicardi, G C; Cecati, M

    2006-01-01

    Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652 ......, but not in the highly exposed Inuit men. Additional issues (genetic background, lifestyle habits and characterization of total xeno-hormonal activities) need to be investigated in order to fully assess the population variations observed........ Sperm DNA fragmentation was measured by using the TUNEL assay, whereas immunofluorescence methods were utilized for detecting pro-apoptotic (Fas) and anti-apoptotic (Bcl-xL) markers. Both TUNEL assay and apoptotic markers were statistically differed across the four populations. No correlation between...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

  17. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    Energy Technology Data Exchange (ETDEWEB)

    Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

    2012-06-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  18. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  19. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    International Nuclear Information System (INIS)

    Santiso, Rebeca; Tamayo, María; Gosálvez, Jaime; Johnston, Steve; Mariño, Alfonso; Fernández, Carlos; Losada, Carlos; Fernández, José Luis

    2012-01-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 °C and 45 °C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 °C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan–Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  20. Construction and characterization of three yeast-Escherichia coli shuttle vectors designed for rapid subcloning of yeast genes on small DNA fragments.

    Science.gov (United States)

    Ferguson, J; Groppe, J C; Reed, S I

    1981-12-01

    We have constructed three new subcloning plasmid vectors, pRC1, pRC2, and pRC3, derived from pKC7, which allow the rapid, single-step subcloning of yeast genes. Subcloning with these vectors utilizes a partial digestion with Sau3A to generate a quasi-random set of DNA fragments from the original plasmid. All three vectors contain a kanamycin resistance gene. Therefore, if the original cloned yeast DNA fragment is present in a vector that does not specify kanamycin resistance, the subclone pool can be propagated in Escherichia coli in the presence of kanamycin to select against parent plasmids that escaped restriction by Sau3A. Selection by complementation in yeast yields a collection of plasmids with smaller yeast DNA inserts containing the gene of interest. In the vectors pRC2 and pRC3, constructed from pRC1, the unique BamHI site is located within an intact tetracycline resistance gene, thus making it possible to screen bacterial transformants for those containing recombinant plasmid molecules. Vectors pRC2 and pRC3 also contain the yeast 2 micrometers DNA replication origin, and thus are more stable than plasmids carrying only the TRP1-associated replicator (ars1).

  1. Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

    Science.gov (United States)

    Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

    2014-04-01

    Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

    International Nuclear Information System (INIS)

    Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

    2008-01-01

    Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

  3. In vitro and in vivo assay of radio-induced damage in Escherichia Coli, DNA labelled on thymidilic fragment

    International Nuclear Information System (INIS)

    Bonicel, A.

    1977-01-01

    A technique of rapid assay for a particular and very important damage, N-formamido (DNA), is described. Using this technique, the importance of radio-induced DNA damage can be evaluated before the repair enzymatic system takes place [fr

  4. Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning.

    Science.gov (United States)

    Wang, Shang; Chen, Wen; Zhang, Kai; Jiao, Peng; Mo, Lihua; Yang, Xiaoxu; Hu, Xiang; Zhang, Jian; Wei, Chenxi; Xiang, Shuanglin

    2015-01-01

    Long fragment cloning is a challenge for its difficulty in accurate amplifying and tendency to get unwanted mutation. Here we discuss Restriction-based Multiple-fragment Assembly Strategy's advantages and limitations. In this strategy, rather than PCR amplifying the entire coding sequence (CDS) at one time, we amplified and sequenced smaller fragments which are shorter than 1.5kb spanning the CDS. After that, the sequence-proved fragments were assembled by digestion-ligation cloning to the target vector. We test its universality in our script programmed in Python. Our data shows that, among the entire human and mouse CDS, at least 70% of long CDS cloning will benefit from this strategy.

  5. Stabilized Romanowsky blood stain.

    Science.gov (United States)

    Gilliland, J W; Dean, W W; Stastny, M; Lubrano, G J

    1979-05-01

    It has been shown that the degradation of thiazine dyes which normally occurs in methanolic solution, as in the case of Romanowsky blood stains, can be prevented by making the solution acidic. In a certain range of acidity, the stain precipitates in the form of monothiazine eosinate, but by making the solution sufficiently acidic, eosin is protonated and the precipitate cannot form. These observations have been used to develop a blood stain which is stable, even at elevated temperatures, for several months. For use the stain is neutralized by a specially formulated fixative solution.

  6. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Bacterial 16S ribosomal DNA (rDNA amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90% were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  7. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  8. Ambivalent incorporation of the fluorescent cytosine analogues tC and tCo by human DNA polymerase alpha and Klenow fragment.

    Science.gov (United States)

    Stengel, Gudrun; Purse, Byron W; Wilhelmsson, L Marcus; Urban, Milan; Kuchta, Robert D

    2009-08-11

    We studied the incorporation of the fluorescent cytidine analogues 1,3-diaza-2-oxophenothiazine (tC) and 1,3-diaza-2-oxophenoxazine (tCo) by human DNA polymerase alpha and Klenow fragment of DNA polymerase I (Escherichia coli). These tricyclic nucleobases possess the regular hydrogen bonding interface of cytosine but are significantly expanded in size toward the major groove. Despite the size alteration, both DNA polymerases insert dtCTP and dtCoTP with remarkable catalytic efficiency. Polymerization opposite guanine is comparable to the insertion of dCTP, while the insertion opposite adenine is only approximately 4-11 times less efficient than the formation of a T-A base pair. Both enzymes readily extend the formed tC(o)-G and tC(o)-A base pairs and can incorporate at least four consecutive nucleotide analogues. Consistent with these results, both DNA polymerases efficiently polymerize dGTP and dATP when tC and tCo are in the template strand. Klenow fragment inserts dGTP with a 4-9-fold higher probability than dATP, while polymerase alpha favors dGTP over dATP by a factor of 30-65. Overall, the properties of tC(o) as a templating base and as an incoming nucleotide are surprisingly symmetrical and may be universal for A and B family DNA polymerases. This finding suggests that the aptitude for ambivalent base pairing is a consequence of the electronic properties of tC(o).

  9. Identification of DNA Fragments that Showed Linkage to the Radiation-induced Yellow Vein Mosaic Disease Resistance Mutation in Okra

    International Nuclear Information System (INIS)

    Boonsirichai, Kanokporn; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen; Puripunyavanich, Vichai

    2007-08-01

    Full text: The yellow vein mosaic disease resistant mutant of okra was crossed to Pichit 03, a susceptible variety. Their progeny showed prolonged resistance when compared with Pichit 03. DNA fingerprints of F2 and BC1F1 individuals from the cross indicated that most DNA bands did not segregate with either the resistance or the susceptible characteristics. Nonetheless, polymorphic DNA bands could be identified between the mutant and Okura, the parental variety

  10. Use of arbitrary DNA primers, polyacrylamide gel electrophoresis and silver staining for identity testing, gene discovery and analysis of gene expression

    International Nuclear Information System (INIS)

    Gresshoff, P.

    1998-01-01

    To understand chemically-induced genomic differences in soybean mutants differing in their ability to enter the nitrogen-fixing symbiosis involving Bradyrhizobium japonicum, molecular techniques were developed to aid the map-based, or positional, cloning. DNA marker technology involving single arbitrary primers was used to enrich regional RFLP linkage data. Molecular techniques, including two-dimensional pulse field gel electrophoresis, were developed to ascertain the first physical mapping in soybean, leading to the conclusion that in the region of marker pA-36 on linkage group H, 1 cM equals about 500 cM. High molecular weight DNA was isolated and cloned into yeast or bacterial artificial chromosomes (YACs/ BACs). YACs were used to analyze soybean genome structure, revealing that over half of the genome contains repetitive DNA. Genetic and molecular tools are now available to facilitate the isolation of plant genes directly involved in symbiosis. The further characterization of these genes, along with the determination of the mechanisms that lead to the mutation, will be of value to other plants and induced mutation research. (author)

  11. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  12. The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

    International Nuclear Information System (INIS)

    Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

    2011-01-01

    Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

  13. Iron Stain on Wood

    Science.gov (United States)

    Mark Knaebe

    2013-01-01

    Iron stain, an unsightly blue–black or gray discoloration, can occur on nearly all woods. Oak, redwood, cypress, and cedar are particularly prone to iron stain because these woods contain large amounts of tannin-like extractives. The discoloration is caused by a chemical reaction between extractives in the wood and iron in steel products, such as nails, screws, and...

  14. Endocervical gram stain

    Science.gov (United States)

    ... no symptoms. Alternative Names Gram stain of cervix; Gram stain of cervical secretions References Marrazzo JM, Apicella MA. Neisseria gonorrhoeae (gonorrhea). In: Bennett JE, Dolin R, Blaser MJ, eds. Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases, Updated Edition . 8th ...

  15. Dramatic Stained Glass.

    Science.gov (United States)

    Prater, Michael

    2002-01-01

    Describes an art project that is appropriate for students in fifth through twelfth grade in which they create Gothic-style stained-glass windows. Discusses how college students majoring in elementary education created stained-glass windows. Addresses how to adapt this lesson for younger students. (CMK)

  16. Profiles of fragments after pulsed-field gel electrophoresis of cleaved genomic DNA from strains of Taylorella equigenitalis isolated from horses in Norway.

    Science.gov (United States)

    Matsuda, M; Miyazawa, T; Ishida, Y; Moore, J E

    1997-07-01

    The genomic DNA of eight strains of Taylorella equigenitalis, isolated from seven Norwegian Trotters and a Norwegian pony with contagious equine metritis in Norway, was examined by pulsed-field gel electrophoresis after separate digestions with two restriction enzymes, namely, ApaI and NotI. The respective electrophoretic profiles of the fragments were essentially identical but differed from those of T. equigenitalis NCTC11184T and Kentucky 188. They also exhibited slight differences from profiles obtained from Japanese isolates. These results may possibly suggest a common genotype and a common source of infection for all these eight isolates in Norway.

  17. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...... potential for the differentiation of M. hyosynoviae isolates. Concordant results obtained with the two whole-genome fingerprinting techniques evidence the considerable intraspecies genetic heterogeneity of M. hyosynoviae . Sixteen field strains of M. hyosynoviae and the type strain S16(T) were further...

  18. Toward metrological traceability for DNA fragment ratios in GM quantification. 3. Suitability of DNA calibrants studied with a MON 810 corn model.

    Science.gov (United States)

    Charels, Diana; Broeders, Sylvia; Corbisier, Philippe; Trapmann, Stefanie; Schimmel, Heinz; Emons, Hendrik

    2007-05-02

    The quantification of GMOs by real-time PCR relies on an external calibrant. In this paper the suitability of two DNA calibrants, genomic DNA from plant leaves and plasmidic DNA, was investigated. The PCR efficiencies, the correlation coefficients of the calibration curves, and the ratios between PCR efficiencies of transgenic and endogenous sequences were compared for both calibrants using 59 data sets produced by 43 laboratories. There were no significant differences between plasmidic and genomic DNA except for the PCR efficiencies of the calibration curves for the transgene of the construct-specific real-time PCR method. In the GM system investigated, PCR efficiencies of plasmidic calibrants were slightly closer to the PCR efficiencies observed for the unknowns than those of the genomic DNA calibrant. Therefore, plasmidic DNA was the more suitable calibrant for the PCR measurements on genomic DNA extracted from MON 810 seeds. It is shown that plasmidic DNA is an appropriate choice for the calibration of measurements of MON 810 corn with respect to the DNA copy number ratio.

  19. Fluorescent SSCP of overlapping fragments (FSSCP-OF): a highly sensitive method for the screening of mitochondrial DNA variation

    DEFF Research Database (Denmark)

    Salas, A; Rasmussen, Erik Michael; Lareu, M V

    2001-01-01

    The mtDNA analysis (mtDNA) is increasingly being demanded for forensic purposes due to the fact that many times the use of standard nuclear marker fails to analyze degraded samples (such as bones) and specially for the analysis of hair shafts (a common sample in the crime scene). However, analysi...

  20. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  1. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  2. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  3. Mitochondrial DNA Fragmentation as a Molecular Tool to Monitor Thermal Processing of Plant-Derived, Low-Acid Foods, and Biomaterials.

    Science.gov (United States)

    Caldwell, Jane M; Pérez-Díaz, Ilenys M; Sandeep, K P; Simunovic, Josip; Harris, Keith; Osborne, Jason A; Hassan, Hosni M

    2015-08-01

    Cycle threshold (Ct) increase, quantifying plant-derived DNA fragmentation, was evaluated for its utility as a time-temperature integrator. This novel approach to monitoring thermal processing of fresh, plant-based foods represents a paradigm shift. Instead of using quantitative polymerase chain reaction (qPCR) to detect pathogens, identify adulterants, or authenticate ingredients, this rapid technique was used to quantify the fragmentation of an intrinsic plant mitochondrial DNA (mtDNA) gene over time-temperature treatments. Universal primers were developed which amplified a mitochondrial gene common to plants (atp1). These consensus primers produced a robust qPCR signal in 10 vegetables, 6 fruits, 3 types of nuts, and a biofuel precursor. Using sweet potato (Ipomoea batatas) puree as a model low-acid product and simple linear regression, Ct value was highly correlated to time-temperature treatment (R(2) = 0.87); the logarithmic reduction (log CFU/mL) of the spore-forming Clostridium botulinum surrogate, Geobacillus stearothermophilus (R(2) = 0.87); and cumulative F-value (min) in a canned retort process (R(2) = 0.88), all comparisons conducted at 121 °C. D121 and z-values were determined for G. stearothermophilus ATCC 7953 and were 2.71 min and 11.0 °C, respectively. D121 and z-values for a 174-bp universal plant amplicon were 11.3 min and 9.17 °C, respectively, for mtDNA from sweet potato puree. We present these data as proof-of-concept for a molecular tool that can be used as a rapid, presumptive method for monitoring thermal processing in low-acid plant products. © 2015 Institute of Food Technologists®

  4. Biological activity of cloned mammary tumor virus DNA fragments that bind purified glucocorticoid receptor protein in vitro

    International Nuclear Information System (INIS)

    Yamamoto, K.R.; Payvar, F.; Firestone, G.L.; Maler, B.A.; Wrange, O.; Carlstedt-Duke, J.; Gustafsson, J.A.; Chandler, V.L.; Karolinska Institutet, Stockholm, Sweden)

    1983-01-01

    To test whether high-affinity receptor:DNA interactions can be correlated with receptor effects on promoter function in vivo, we have mapped in greater detail the receptor-binding regions on murine mammary tumor virus DNA, using both nitrocellulose-filter binding and electron microscopy. Recombinant plasmids bearing these receptor-binding domains have been transfected into cultured cells, and the expression of the plasmid sequences has been monitored for hormonal regulation. The results are considered in terms of a speculative proposal that the glucocorticoid receptor may effect changes in promoter activity via specific alteration of chromatin and/or DNA structure. 37 references, 6 figures, 2 tables

  5. Nuclear status and DNA fragmentation of oocytes from porcine, bovine and feline ovaries stored at 4 degrees C for 5 days.

    Science.gov (United States)

    Luu, Vien Viet; Namula, Zhao; Do, Lanh Thi Kim; Sato, Yoko; Taniguchi, Masayasu; Karja, Ni Wayan Kurniani; Otoi, Takeshige

    2014-01-01

    The cooling of mammalian oocytes to sub-physiological temperatures is widely known to affect their viability through the induction of various abnormalities at all stages of meiosis. This study was to compare the kinetics of nuclear status and oocyte damage in porcine, bovine and feline ovaries stored at 4 degrees C for 5 days. The nuclear status and oocyte quality during storage were evaluated before and after maturation culture. The cold storage of ovaries decreased the proportions of porcine and bovine oocytes that remained at the germinal vesicle stage before maturation culture. The maturation rates of oocytes decreased with increasing storage time, independent of species. None of the porcine oocytes reached metaphase II (MII) after 1 day of storage. In contrast, bovine and feline oocytes from ovaries that were stored for 2 days and 3 days reached MII. DNA fragmentation in porcine oocytes from ovaries stored for 1 day was significantly higher than that in bovine and feline oocytes. The maturation competency of oocytes after the cold storage of ovaries could be related to the meiotic resumption of oocytes during storage and the occurrence of DNA fragmentation in oocytes during maturation culture.

  6. Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

    Directory of Open Access Journals (Sweden)

    Olufunmilola Ibironke

    2012-01-01

    Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

  7. Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

    Science.gov (United States)

    Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

    2010-03-31

    The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  8. Stool Gram stain

    Science.gov (United States)

    ... of stool; Feces Gram stain References Allos BM. Campylobacter infections. In: Goldman L, Schafer AI, eds. Goldman- ... Bacterial Infections Read more Foodborne Illness Read more Gastroenteritis Read more A.D.A.M., Inc. is ...

  9. Effect of ovarian tissue storage in Morus nigra extract on the morphology and DNA fragmentation of ovine preantral follicles

    Directory of Open Access Journals (Sweden)

    Agnes Yasmin Pitombeira Cavalcante

    2017-08-01

    Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.

  10. Novel fusion proteins for the antigen-specific staining and elimination of B cell receptor-positive cell populations demonstrated by a tetanus toxoid fragment C (TTC) model antigen.

    Science.gov (United States)

    Klose, Diana; Saunders, Ute; Barth, Stefan; Fischer, Rainer; Jacobi, Annett Marita; Nachreiner, Thomas

    2016-02-17

    In an earlier study we developed a unique strategy allowing us to specifically eliminate antigen-specific murine B cells via their distinct B cell receptors using a new class of fusion proteins. In the present work we elaborated our idea to demonstrate the feasibility of specifically addressing and eliminating human memory B cells. The present study reveals efficient adaptation of the general approach to selectively target and eradicate human memory B cells. In order to demonstrate the feasibility we engineered a fusion protein following the principle of recombinant immunotoxins by combining a model antigen (tetanus toxoid fragment C, TTC) for B cell receptor targeting and a truncated version of Pseudomonas aeruginosa exotoxin A (ETA') to induce apoptosis after cellular uptake. The TTC-ETA' fusion protein not only selectively bound to a TTC-reactive murine B cell hybridoma cell line in vitro but also to freshly isolated human memory B cells from immunized donors ex vivo. Specific toxicity was confirmed on an antigen-specific population of human CD27(+) memory B cells. This protein engineering strategy can be used as a generalized platform approach for the construction of therapeutic fusion proteins with disease-relevant antigens as B cell receptor-binding domains, offering a promising approach for the specific depletion of autoreactive B-lymphocytes in B cell-driven autoimmune diseases.

  11. Ambivalent Incorporation of the Fluorescent Cytosine Analogues tC and tCo by Human DNA Polymerase α and Klenow Fragment #

    Science.gov (United States)

    Stengel, Gudrun; Purse, Byron W.; Wilhelmsson, L. Marcus; Urban, Milan; Kuchta, Robert D.

    2009-01-01

    We studied the incorporation of the fluorescent cytidine analogues 1, 3-diaza-2-oxo-phenothiazine (tC) and 1, 3-diaza-2-oxo-phenoxazine (tCo) by human DNA polymerase α and Klenow fragment of DNA polymerase I (E. coli). These tricyclic nucleobases possess the regular hydrogen bonding interface of cytosine but are significantly size expanded toward the major groove. Despite the size alteration both DNA polymerases insert dtCTP and dtCoTP with remarkable catalytic efficiency. Polymerization opposite guanine is comparable to the insertion of dCTP, while the insertion opposite adenine is only ∼4-11 times less efficient than the formation of a T-A base pair. Both enzymes readily extend the formed tC(o)-G and tC(o)-A base pairs, and can incorporate at least 4 consecutive nucleotide analogues. Consistent with these results, both DNA polymerases efficiently polymerize dGTP and dATP when tC and tCo are in the template strand. KF inserts dGTP with a 4- to 9-fold higher probability than dATP, while pol α favors dGTP over dATP by a factor of 30-65. Overall, the properties of tC(o) as templating base and as incoming nucleotide are surprisingly symmetrical and may be universal for A and B family DNA polymerases. This finding suggests that the aptitude for ambivalent base pairing is a consequence of the electronic properties of tC(o). PMID:19580325

  12. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  13. An analysis on DNA fingerprints of thirty papaya cultivars (Carica papaya L.), grown in Thailand with the use of amplified fragment length polymorphisms technique.

    Science.gov (United States)

    Ratchadaporn, Janthasri; Sureeporn, Katengam; Khumcha, U

    2007-09-15

    The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP) technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top) were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC) of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1) Kaeg Dum and Malador (2) Kaeg Nuan (3) Pakchong and Solo (4) Taiwan (5) Co Coa Hai Nan and (6) Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found.

  14. Quality, oxidative markers and DNA damage (DNA) fragmentation of red deer thawed spermatozoa after incubation at 37 °C in presence of several antioxidants.

    Science.gov (United States)

    Mata-Campuzano, M; Alvarez-Rodríguez, M; del Olmo, E; Fernández-Santos, M R; Garde, J J; Martínez-Pastor, F

    2012-09-15

    Antioxidants may be useful for supplementing sperm extenders. We have tested dehydroascorbic acid (DHA), TEMPOL, N-acetyl-cysteine (NAC) and rutin on epididymal spermatozoa from red deer, during incubation at 37 °C. Cryopreserved spermatozoa were thawed, washed and incubated with 1 mM or 0.1 mM of each antioxidant, including oxidative stress (Fe(2+)/ascorbate). Motility (CASA and clustering of subpopulations), viability, mitochondrial membrane potential, and acrosomal status were assessed at 2 and 4 h. Lipoperoxidation, intracellular reactive oxygen species (ROS) and DNA damage (DNA) status (TUNEL) were checked at 4 h. Oxidative stress increased ROS, lipoperoxidation and DNA damage. Overall, antioxidants negatively affected motility and physiological parameters. Only DHA 1 mm protected motility, increasing the fast and progressive subpopulation. However, it had a detrimental effect on acrosomal and DNA status, in absence of oxidative stress. Tempol and rutin efficiently reduced lipoperoxidation, ROS, and DNA damage in presence of oxidative stress. NAC was not as efficient as TEMPOL or rutin reducing lipoperoxidation or protecting DNA, and did not reduce ROS, but its negative effects were lower than the other antioxidants when used at 1 mm, increasing the subpopulation of hyperactivated-like spermatozoa at 2 h. Our results show that these antioxidants have mixed effects when spermatozoa are incubated at physiological temperatures. DHA may not be suitable because of prooxidant effects, but TEMPOL, NAC and rutin may be considered for cryopreservation trials. In general, exposure of red deer spermatozoa to these antioxidants should be limited to low temperatures, when only protective effects may develop. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

    International Nuclear Information System (INIS)

    Ermolaeva, N.V.; Vodolazskaya, N.A.

    1978-01-01

    It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

  16. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Science.gov (United States)

    Després, V. R.; Nowoisky, J. F.; Klose, M.; Conrad, R.; Andreae, M. O.; Pöschl, U.

    2007-12-01

    This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA) particles in the atmosphere. Samples of fine particulate matter (PM2.5) and total suspended particulates (TSP) have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze). From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP) were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses. Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m-3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively). Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42) and some from Actinobacteria (10) and Firmicutes (1). The fungal sequences were characteristic for Ascomycota (3) and Basidiomycota (1), which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2) and moss spores (2), while animal DNA was found only for one unicellular eukaryote (protist). Over 80% of the 53 bacterial sequences could be matched to one of the 19 T-RF peaks found in the PM2.5 samples, but only 40% of the T-RF peaks

  17. Electrochemical sensors based on stationary electrodes and immobilized DNA or its fragments and the assessment of their analytical potentials

    Czech Academy of Sciences Publication Activity Database

    Babkina, S. S.; Paleček, Emil; Jelen, František; Fojta, Miroslav

    2005-01-01

    Roč. 60, č. 6 (2005), s. 567-572 ISSN 1061-9348. [VII All-Russia Conference (with international participation) on Electrochemical Methods of Analysis. Ufa, 23.05.2004-27.05.2004] R&D Projects: GA MPO(CZ) 1H-PK/42 Institutional research plan: CEZ:AV0Z50040507 Keywords : electrochemical biosensor * DNA imobilization * nitrocellulose matrix Subject RIV: BO - Biophysics Impact factor: 0.496, year: 2005

  18. Guanine quadruplex formation by RNA/DNA hybrid analogs of Oxytricha telomere G4T4G4 fragment

    Czech Academy of Sciences Publication Activity Database

    Vondrušková, Jitka; Kypr, Jaroslav; Kejnovská, Iva; Fialová, Markéta; Vorlíčková, Michaela

    2008-01-01

    Roč. 89, č. 10 (2008), s. 797-806 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : RNA/DNA hybrids * guanine quadruplex * circular dichroism spectroscopy Subject RIV: BO - Biophysics Impact factor: 2.823, year: 2008

  19. Identity of victims from fragmented and decomposed remnants by DNA profiling in a case of serial killings.

    Science.gov (United States)

    Raina, Anupuma; Dogra, T D; Leenaars, Antoon A; Yadav, Bhuvnesh; Bhera, C; Lalwani, Sanjeev; Leenaars, Lindsey

    2010-10-01

    A 28-year-old man, Surinder Koli, from a Nithari village adjoining Delhi, India committed serial murder. This case was of paramount importance in medico-legal investigations, as it was a landmark case of a serial killer reported from India. The skeletal remains (627 pieces) including skull/skull portions (19) were recovered from the nearby sewer drain, sump and the backyard of the house in which this man was residing. In addition, soft tissues (51) were also recovered from the same sewer drain. The victims were killed over a two-year period. The establishment of identity of the victims was crucial to prove the case in the court of law as well as for the claimants. Nineteen sets were prepared by radiology/anatomical examination from the exhibits recovered. DNA profiling confirmed the correctness of these sets and also short tandem repeat typing of nuclear DNA successfully identified eight individuals. Both DNA profiling and radiography/anatomical examination played an important role in solving this complicated case.

  20. Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

    Science.gov (United States)

    Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

    1992-01-01

    Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

  1. A homicide in the Ukraine: DNA-based identification of a boiled, skeletonized, and varnished human skull, and of bone fragments found in a fireplace.

    Science.gov (United States)

    Sivolap, Y; Krivda, G; Kozhuhova, N; Chebotar, S; Benecke, M

    2001-12-01

    In an apartment, bone fragments were found in a fireplace. Furthermore, a varnished skull was found elsewhere in the same apartment. The tenant confessed to a murder and stated that the head of a victim, a girl, was boiled for 12 hours. He stated that the soft tissue was then removed and the skull was varnished. Other parts of the body were burned to ashes in an open field. Comparison of loci D19S252, CD4, CYAR04, TII01, F13A01, F13B, and D6S366 from the skull and the bone remains to loci of the mother of a missing girl showed that the skull came from that missing child. Biological maternity was calculated as 99.99%. The bone pieces were DNA typed as male and did not share alleles with the mother in several systems. Therefore, they belonged to a different (human) victim.

  2. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  3. [Values of the sperm deformity index, acrosome abnormity rate, and sperm DNA fragmentation index of optimized sperm in predicting IVF fertilization failure].

    Science.gov (United States)

    Jiang, Wei-jie; Jin, Fan; Zhou, Li-ming

    2016-02-01

    To investigate the values of the sperm deformity index (SDI), acrosome abnormity rate (AAR), and DNA fragmentation index (DFI) of optimized sperm in the prediction of fertilization failure (fertilization rate fertilization (IVF). We selected 695 cycles of conventional IVF for pure oviductal infertility in this study, including 603 cycles of normal fertilization and 92 cycles of fertilization failure. On the day of oocyte retrieval, we examined sperm morphology, acrosome morphology, and DNA fragmentation using the Diff-Quik, PSA-FITC and SCD methods. We established the joint predictor (JP) by logistic equation and analyzed the values of different parameters in predicting fertilization failure with the receiver operating characteristic (ROC) curve. The fertilization rate was negatively correlated with SDI (r = - 0.07; P = 0.03), AAR (r = -0.49; P fertilization group were 1.24 ± 0.20, (7.75 ± 2.28)%, and (7.87 ± 3.15)%, and those in the fertilization failure group were 1.42 ± 0.15, (12.02 ± 3.06)%, and (13.32 ± 4.13)%, respectively, all with statistically significant differences between the two groups (P fertilization failure ( OR = 2.68, 14.11, and 3.85; P = 0.01, fertilization failure were approximately 1.45, 10%, and 12%. The SDI, AAR and DFI of optimized sperm are closely associated with the fertilization rate, and all have the value for predicting fertilization failure in IVF. The AAR is more valuable than the other single predictors, but JP is more effective than the AAR.

  4. "Stained Glass" Landscape Windows

    Science.gov (United States)

    Vannata, Janine

    2008-01-01

    Both adults and children alike marvel at the grand vivid stained-glass windows created by American artist Louis Comfort Tiffany. Today he is commonly recognized as one of America's most influential designers and artists throughout the last nineteenth and early twentieth century. In the lesson described in this article, students created their own…

  5. Stained Glass and Flu

    Centers for Disease Control (CDC) Podcasts

    2017-02-01

    Dr. Robert Webster, an Emeritus member of the Department of Infectious Diseases at St. Jude Children's Research Hospital, discusses his cover art story on stained glass and influenza.  Created: 2/1/2017 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 2/1/2017.

  6. Port-wine stain

    Science.gov (United States)

    ... About MedlinePlus Show Search Search MedlinePlus GO GO About MedlinePlus Site Map FAQs Customer Support Health Topics Drugs & Supplements Videos & Tools Español You Are Here: Home → Medical Encyclopedia → Port-wine stain URL of this page: //medlineplus.gov/ency/ ...

  7. Microdissection of stained archival tissue.

    Science.gov (United States)

    Gupta, S K; Douglas-Jones, A G; Morgan, J M

    1997-08-01

    In many tissues the preinvasive stage of neoplastic progression can be identified histologically as dysplasia or in situ disease. There is much interest in defining the molecular events associated with the early stages of neoplasia. Retrieval of histologically recognisable preinvasive neoplastic tissue uncontaminated by inflammatory or stromal cells is important for genetic studies using polymerase chain reaction (PCR) assay. A novel method for microdissection is described in which 10 microns sections are dewaxed, stained with haematoxylin and eosin, dried, covered with Sellotape, and the tissue cut out using a scalpel blade under direct visual control. The method is quick, eliminates problems of operator tremor, preserves the architecture of the micro-dissected tissue (for photographic documentation) and requires no special equipment. The presence of Sellotape and adhesive in the reaction mixture has no detrimental effect on the ability to extract DNA or to perform PCR.

  8. Nested PCRs and sequencing of nuclear ITS-rDNA fragments detect three Leishmania species of gerbils in sandflies from Iranian foci of zoonotic cutaneous leishmaniasis.

    Science.gov (United States)

    Parvizi, P; Ready, P D

    2008-09-01

    To identify and understand the natural transmission cycles of Leishmania in Iranian sandflies. Nested PCR protocols were developed to amplify two regions of the ribosomal RNA amplicon of Leishmania (ITS1-5.8S rRNA gene, and a microsatellite DNA region of ITS2), which were species-specific by DNA sequence or fragment size. The PCR assays detected in Iranian sandflies not only Leishmania major but also for the first time L. turanica and L. gerbilli sensu lato, two other parasites of the great gerbil. All three parasites were found in the northeast and centre of Iran, in two foci of rural Zoonotic Cutaneous Leishmaniasis (ZCL) caused by L. major. Fifty infections were detected in common sandfly species: at least six geographically differentiated haplotypes of L. major in four to five sandfly species; one strain of L. gerbilli s.l. in five to six sandfly species and one strain of L. turanica in one sandfly species. Past conclusions about the transmission cycles of L. major in Iran should be treated with caution. Careful molecular eco-epidemiological investigations are essential for modelling the roles of different sandfly species in maintaining and spreading ZCL foci. Even if non-pathogenic to humans, frequent inoculations of L. turanica by sandflies might alter the efficacy of vaccines against L. major. Phlebotomus papatasi is probably the key vector in many ZCL foci because of its abundance and high infection rates with both L. major and L. turanica.

  9. The virome of the arbuscular mycorrhizal fungus Gigaspora margarita reveals the first report of DNA fragments corresponding to replicating non-retroviral RNA viruses in fungi.

    Science.gov (United States)

    Turina, Massimo; Ghignone, Stefano; Astolfi, Nausicaa; Silvestri, Alessandro; Bonfante, Paola; Lanfranco, Luisa

    2018-02-02

    Arbuscular Mycorrhizal Fungi (AMF) are key components of the plant microbiota. AMF genetic complexity is increased by the presence of endobacteria, which live inside many species. A further component of such complexity is the virome associated to AMF, whose knowledge is still very limited. Here, by exploiting transcriptomic data we describe the virome of Gigaspora margarita. A BLAST search for viral RNA-dependent RNA polymerases sequences allowed the identification of four mitoviruses, one Ourmia-like narnavirus, one Giardia-like virus, and two sequences related to Fusarium graminearum mycoviruses. Northern blot and RT-PCR confirmed the authenticity of all the sequences with the exception of the F. graminearum-related ones. All the mitoviruses are replicative and functional since both positive strand and negative strand RNA are present. The abundance of the viral RNA molecules is not regulated by the presence or absence of Candidatus Glomeribacter gigasporarum, the endobacterium hosted by G. margarita, with the exception of the Ourmia-like sequence which is absent in bacteria-cured spores. In addition, we report, for the first time, DNA fragments corresponding to mitovirus sequences associated to the presence of viral RNA. These sequences are not integrated in the mitochondrial DNA and preliminary evidence seems to exclude integration in the nuclear genome. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

  10. Maternal exposure to a mixture of persistent organic pollutants (POPs) affects testis histology, epididymal sperm count and induces sperm DNA fragmentation in mice.

    Science.gov (United States)

    Khezri, Abdolrahman; Lindeman, Birgitte; Krogenæs, Anette K; Berntsen, Hanne F; Zimmer, Karin E; Ropstad, Erik

    2017-08-15

    Persistent organic pollutants (POPs) are widespread throughout the environment and some are suspected to induce reproductive toxicity. As animals and humans are exposed to complex mixtures of POPs, it is reasonable to assess how such mixtures could interact with the reproductive system. Our aim is to investigate how maternal exposure to a mixture of 29 different persistent organic pollutants, formulated to mimic the relative POP levels in the food basket of the Scandinavian population, could alter reproductive endpoints. Female mice were exposed via feed from weaning, during pregnancy and lactation in 3 exposure groups (control (C), low (L) and high (H)). Testicular morphometric endpoints, epididymal sperm concentration and sperm DNA integrity were assessed in adult male offspring. We found that the number of tubules, proportion of tubule compartments and epididymal sperm concentration significantly decreased in both POP exposed groups. Epididymal sperm from both POP exposed groups showed increased DNA fragmentation. It is concluded that maternal exposure to a defined POP mixture relevant to human exposure can affect testicular development, sperm production and sperm chromatin integrity. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Antigenotoxic and Apoptotic Activity of Green Tea Polyphenol Extracts on Hexavalent Chromium-Induced DNA Damage in Peripheral Blood of CD-1 Mice: Analysis with Differential Acridine Orange/Ethidium Bromide Staining

    Directory of Open Access Journals (Sweden)

    María del Carmen García-Rodríguez

    2013-01-01

    Full Text Available This study was conducted to investigate the modulating effects of green tea polyphenols on genotoxic damage and apoptotic activity induced by hexavalent chromium [Cr (VI] in CD-1 mice. Animals were divided into the following groups: (i injected with vehicle; (ii treated with green tea polyphenols (30 mg/kg via gavage; (iii injected with CrO3 (20 mg/kg intraperitoneally; (iv treated with green tea polyphenols in addition to CrO3. Genotoxic damage was evaluated by examining micronucleated polychromatic erythrocytes (MN-PCEs obtained from peripheral blood at 0, 24, 48, and 72 h after treatment. Induction of apoptosis and cell viability were assessed by differential acridine orange/ethidium bromide (AO/EB staining. Treatment of green tea polyphenols led to no significant changes in the MN-PCEs. However, CrO3 treatment significantly increased MN-PCEs at 24 and 48 h after injection. Green tea polyphenols treatment prior to CrO3 injection led to a decrease in MN-PCEs compared to the group treated with CrO3 only. The average of apoptotic cells was increased at 48 h after treatment compared to control mice, suggesting that apoptosis could contribute to eliminate the DNA damaged cells induced by Cr (VI. Our findings support the proposed protective effects of green tea polyphenols against the genotoxic damage induced by Cr (VI.

  12. Authentication of medicinal plant botanical identity by amplified fragmented length polymorphism dominant DNA marker: inferences from the Plectranthus genus.

    Science.gov (United States)

    Passinho-Soares, Helna; Felix, Durvalina; Kaplan, Maria Auxiliadora; Margis-Pinheiro, Marcia; Margis, Rogério

    2006-08-01

    In Brazil, Plectranthus species are known as "boldo" and have been used in popular medicine for analgesic and dyspeptic purposes. Plectranthus need to be well identified in order to be used as commercially genuine medicinal plants. Here we describe AFLP DNA patterns able to distinguish among different Pectranthus species. The genetic variability of P. grandis Cramer, P. barbatus Andr. and P. ornatus Codd was analyzed with two sets of AFLP primers allowing detection of 241 loci. A total of 22 monomorphic loci were identified in P. barbatus, 15 in P. grandis and 30 in P. ornatus. Among these, 5 loci were informative and species-specific to P. barbatus, 3 to P. grandis and 2 loci were unique to P. ornatus. The AFLP pattern analyzed by different clustering methods assembled individuals according to their species. So far, AFLP represents a genuine and strong method to certify medicinal plant materials.

  13. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    Science.gov (United States)

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  14. Can DNA fragmentation of neat or swim-up spermatozoa be used to predict pregnancy following ICSI of fertile oocyte donors?

    Science.gov (United States)

    Gosálvez, Jaime; Caballero, Pedro; López-Fernández, Carmen; Ortega, Leonor; Guijarro, José Andrés; Fernández, José Luís; Johnston, Stephen D; Nuñez-Calonge, Rocío

    2013-11-01

    This study compared the potential of assessing sperm DNA fragmentation (SDF) from neat semen and the subsequent swim-up (SU) procedure to predict pregnancy when conducting ICSI of fertile donor oocytes. Infertile females (n=81) were transferred embryos resulting from intracytoplasmic sperm injection (ICSI) of their partner's spermatozoa and proven donor oocytes. This model normalized the impact of female factor in putative sperm DNA repair. Semen was blindly assessed for SDF using Halosperm immediately following ejaculation (NS) and after swim-up at the time of ICSI fertilisation. There was a decrease in SDF values of the ejaculated semen sample following the swim-up protocol (P=0.000). Interestingly, pregnancy could be equally predicted from SDF values derived from either neat or swim-up semen samples. Receiver operator curves and the derived Youden's indices determined SDF cutoff values for NS and SU of 24.8% and 17.5%, respectively. Prediction of pregnancy from NS SDF had a sensitivity of 75% and a specificity of 69%, whereas for SU SDF was 78% and 73%, respectively. While increased levels of SDF negatively impact reproductive outcome, we have shown that a reduction in SDF following sperm selection using ICSI with proven donor oocytes is not mandatory for achieving pregnancy. This suggests that a certain level of DNA damage that is not detectable using current technologies could be impacting on the relative success of assisted reproductive technology (ART) procedures. Consequently, we propose a modification of the so called 'iceberg model' as a possible rationale for understanding the role of SDF in reproductive outcome.

  15. Internalization of Staphylococcus aureus in Lymphocytes Induces Oxidative Stress and DNA Fragmentation: Possible Ameliorative Role of Nanoconjugated Vancomycin

    Directory of Open Access Journals (Sweden)

    Subhankari Prasad Chakraborty

    2011-01-01

    Full Text Available Staphylococcus aureus is the most frequently isolated pathogen causing bloodstream infections, skin and soft tissue infections and pneumonia. Lymphocyte is an important immune cell. The aim of the present paper was to test the ameliorative role of nanoconjugated vancomycin against Vancomycin-sensitive Staphylococcus aureus (VSSA and vancomycin-resistant Staphylococcus aureus (VRSA infection-induced oxidative stress in lymphocytes. VSSA and VRSA infections were developed in Swiss mice by intraperitoneal injection of 5×106 CFU/mL bacterial solutions. Nanoconjugated vancomycin was adminstrated to VSSA- and VRSA-infected mice at its effective dose for 10 days. Vancomycin was adminstrated to VSSA- and VRSA-infected mice at a similar dose, respectively, for 10 days. Vancomycin and nanoconjugated vancomycin were adminstrated to normal mice at their effective doses for 10 days. The result of this study reveals that in vivo VSSA and VRSA infection significantly increases the level of lipid peroxidation, protein oxidation, oxidized glutathione level, nitrite generation, nitrite release, and DNA damage and decreases the level of reduced glutathione, antioxidant enzyme status, and glutathione-dependent enzymes as compared to control group, which were increased or decreased significantly near to normal in nanoconjugated vancomycin-treated group. These findings suggest the potential use and beneficial role of nanoconjugated vancomycin against VSSA and VRSA infection-induced oxidative stress in lymphocytes.

  16. Forebrain Ischemia-Reperfusion Simulating Cardiac Arrest in Mice Induces Edema and DNA Fragmentation in the Brain

    Directory of Open Access Journals (Sweden)

    Christina H. Liu

    2007-05-01

    Full Text Available Brain injury affects one-third of persons who survive after heart attack, even with restoration of spontaneous circulation by cardiopulmonary resuscitation. We studied brain injury resulting from transient bilateral carotid artery occlusion (BCAO and reperfusion by simulating heart attack and restoration of circulation, respectively, in live C57Black6 mice. This model is known to induce neuronal death in the hippocampus, striatum, and cortex. We report the appearance of edema after transient BCAO of 60 minutes and 1 day of reperfusion. Hyperintensity in diffusion-weighted magnetic resonance imaging (MRI was detectable in the striatum, thalamus, and cortex but not in the hippocampus. To determine whether damage to the hippocampus can be detected in live animals, we infused a T2 susceptibility magnetic resonance contrast agent (superparamagnetic iron oxide nanoparticles [SPIONs] that was linked to single-stranded deoxyribonucleic acid (DNA complementary in sequence to c-fos messenger ribonucleic acid (SPION-cfos; we acquired in vivo T2*-weighted MRI 3 days later. SPION retention was measured as T2* (milliseconds signal reduction or R2* value (s−1 elevation. We found that animals treated with 60-minute BCAO and 7-day reperfusion exhibited significantly less SPION retention in the hippocampus and cortex than sham-operated animals. These findings suggest that brain injury induced by cardiac arrest can be detected in live animals.

  17. Identification of medically important Candida species by polymerase chain reaction-restriction fragment length polymorphism analysis of the rDNA ITS1 and ITS2 regions

    Directory of Open Access Journals (Sweden)

    Suphi Bayraktar

    2017-01-01

    Full Text Available Aim: We aimed to identify the distribution of species in candidal strains isolated from clinical samples and restriction fragment length polymorphism (RFLP method based on Msp I and Bln I restrictive enzyme cuts of polymerase chain reaction (PCR products after the amplification of ITS1 and ITS2 regions of rDNA genotypically. Materials and Methods: One hundred and fifty candidal strains isolated from various clinical samples were studies/ included. Phenotypic species assessment was performed using automated VITEK-2 system and kit used with the biochemical tests. Common genomic region amplification peculiar to candidal strains was carried out using ITS1 and ITS2 primer pairs. After the amplification, PCR products were cut with Msp I and Bln I restriction enzymes for species identification. Results: The majority of Candida isolates were isolated from urine (78.6% while other isolates were composed of strains isolated from swab, wound, blood and other samples by 11.3%, 3.3%, 2% and 4.7%, respectively. The result of RFLP analysis carried out with Msp I and Bln I restriction enzymes showed that candidal strains were Candida albicans by 45.3%, Candida glabrata by 19.3%, Candida tropicalis by 14.6%, Candida parapsilosis by 5.3%, Candida krusei by 5.3%, Candida lusitaniae by 0.6% and other candidal strains by 9.3%. Conclusion: When the ability to identify Candida to species level of phenotypic and PCR-RFLP methods was assessed, a great difference was found between these two methods. It may be argued that Msp I and Bln I restriction enzyme fragments can be used in the identification of medically important Candida species. Further studies are needed to develop this kind of restriction profile to be used in the identification of candidal strains.

  18. DNA fragmentation and cell death mediated by T cell antigen receptor/CD3 complex on a leukemia T cell line.

    Science.gov (United States)

    Takahashi, S; Maecker, H T; Levy, R

    1989-10-01

    An anti-T cell receptor (TcR) monoclonal antibody (mAb), LC4, directed against a human leukemic T cell line, SUP-T13, caused DNA fragmentation ("apoptosis") and cell death upon binding to this cell line. Cross-linking of receptor molecules was necessary for this effect since F(ab')2, but not Fab', fragments of LC4 could induce cell death. Five anti-CD3 mAb tested also caused apoptosis, but only when they were presented on a solid phase. Interestingly, soluble anti-CD3 mAb induced calcium flux and had an additive effect on the calcium flux and interleukin 2 receptor expression induced by LC4, but these anti-CD3 mAb reversed the growth inhibition and apoptosis caused by LC4. The calcium ionophore A23187, but not the protein kinase C activator phorbol 12-myristate 13-acetate (PMA), also induced apoptosis, suggesting that protein kinase C activation alone does not cause apoptosis, although PMA is growth inhibitory. These results suggest that two distinct biological phenomena can accompany stimulation of the TcR/CD3 complex. In both cases, calcium flux and interleukin 2 receptor expression is induced, but only in one case is apoptosis and cell death seen. The signal initiating apoptosis can be selectively prevented by binding CD3 portion of the receptor in this cell line. This difference in signals mediated by the TcR/CD3 complex may be important in explaining the process of thymic selection, as well as in choosing anti-TcR mAb for therapeutic use.

  19. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios

    Science.gov (United States)

    Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-01-01

    Background Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. Methods A search of papers published in response to the CPG entitled “Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios” was performed within the Translational Andrology and Urology (TAU) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as “supportive without reservation”, “supportive with reservation”, “not supportive” or “neutral”. We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the ‘Strengths-Weaknesses-Opportunities-Threats’ (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Results Fifty-eight fertility experts from six

  20. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios.

    Science.gov (United States)

    Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-09-01

    Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed

  1. A Luminex-based single DNA fragment amplification assay as a practical tool for detecting and serotyping dengue virus.

    Science.gov (United States)

    Cabral-Castro, Mauro Jorge; Peralta, Regina Helena Saramago; Cavalcanti, Marta Guimarães; Puccioni-Sohler, Marzia; Carvalho, Valéria Lima; da Costa Vasconcelos, Pedro Fernando; Peralta, José Mauro

    2016-10-01

    Dengue is a mosquito-borne viral infection that can evolve from subclinical to severe forms of disease. Early recognition during initial primary and secondary infections correlates with a reduced case-fatality rate in susceptible groups. The aim of this study was to standardize a DNA hybridization assay based on the Luminex technology for detecting and serotyping dengue virus (DENV). Reference DENVs representing the four different serotypes were used as controls to standardize the test. For validation, 16 DENV isolates obtained from a reference laboratory were analyzed in a double-blind manner to validate the test. Sixty blood samples from patients suspected of having dengue fever were used to evaluate the methodology after the validation step, and the results were compared with the reference semi-nested RT-PCR. Additionally, five human samples of each Zika and Chikungunya confirmed patients were used for specificity analysis. The Luminex-based assay correctly identified all 16 DENV isolates. In the evaluation step, the results of the RT-PCR/Luminex assay showed a concordance of 86.7% with those of the semi-nested RT-PCR. None of other virus infection samples was amplified. This is the first description of a hybridization assay that can discriminate the four DENV serotypes using probes against a single DENV sequence. The results indicated that the RT-PCR/Luminex DENV assay designed and evaluated in this study is a valuable additional tool for the early and rapid detection and serotyping of DENV, which could, in the future, be applied to new targets such as the Zika and Chikungunya viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Directory of Open Access Journals (Sweden)

    V. R. Després

    2007-12-01

    Full Text Available This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA particles in the atmosphere. Samples of fine particulate matter (PM2.5 and total suspended particulates (TSP have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze.

    From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses.

    Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m−3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively.

    Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42 and some from Actinobacteria (10 and Firmicutes (1. The fungal sequences were characteristic for Ascomycota (3 and Basidiomycota (1, which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2 and moss spores (2, while animal DNA was found only for one unicellular eukaryote (protist.

  3. Ghost mycobacteria on Gram stain.

    Science.gov (United States)

    Trifiro, S; Bourgault, A M; Lebel, F; René, P

    1990-01-01

    The Gram stain is a key tool in diagnostic microbiology. Its usefulness with respect to mycobacteria is undefined. The neutrality of mycobacteria other than Mycobacterium tuberculosis on Gram staining of various clinical specimens is described. Images PMID:1688872

  4. Ghost mycobacteria on Gram stain.

    OpenAIRE

    Trifiro, S; Bourgault, A M; Lebel, F; René, P

    1990-01-01

    The Gram stain is a key tool in diagnostic microbiology. Its usefulness with respect to mycobacteria is undefined. The neutrality of mycobacteria other than Mycobacterium tuberculosis on Gram staining of various clinical specimens is described.

  5. Gram stain of urethral discharge

    Science.gov (United States)

    Urethral discharge Gram stain; Urethritis - Gram stain ... Augenbraun MH, McCormack WM. Urethritis. In: Bennett JE, Dolin R, Blaser MJ, eds. Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases, Updated Edition . ...

  6. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  7. Analysis of mitochondrial DNA for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon) by polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Fajardo, Violeta; González, Isabel; López-Calleja, Inés; Martin, Irene; Rojas, Maria; Pavón, Miguel Angel; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2007-01-01

    The prevention of fraudulent labeling of game meat constitutes an important part of food regulatory control and quality assurance systems. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis based on mitochondrial deoxyribonucleic acid (DNA) was developed for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon). Amplification and restriction site analysis of a DNA fragment about 720 base pairs (bp) from the mitochondrial 12S rRNA gene of all analyzed species permitted the selection of Msel and Apol endonucleases for meat speciation. The 12S rRNA restriction profiles obtained allowed the unequivocal identification of chamois, pyrenean ibex, and mouflon/sheep and their differentiation from meats of domestic species such as cattle, goat, and swine. The highly variable mitochondrial D-loop gene was also targeted to attempt discrimination between mouflon and sheep meats. A D-loop region (700-1000 bp) was amplified and sequenced in all game and domestic species analyzed, and a primer set was designed for the selective amplification of a 370 bp DNA fragment from mouflon and sheep. PCR-RFLP analysis with the selected Maell enzyme generated a single electrophoretic profile characteristic for sheep, whereas 3 different fragment patterns were obtained for mouflon meats. Consequently, the PCR-RFLP technique developed can be routinely applied in inspection programs in order to verify the correct labeling of game species.

  8. An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

    Science.gov (United States)

    Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

    2017-04-15

    Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Polymer fragmentation in extensional flow

    International Nuclear Information System (INIS)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-01-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments

  10. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  11. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  12. Hoffman's violet and dahlia as specific stains for animal chromosomes.

    Science.gov (United States)

    Dutt, M K

    1979-03-01

    The paper deals with staining of the chromosomes of animal testicular materials with two basic dyes, Hoffman's violet and dahlia of the triphenylmethane group, following iodine-dye procedure. The important finding, as presented herein, is that iodinated alcohol after staining can be substituted with various acids, both organic as well as inorganic, all of which act as trapping agent preventing leaching of the dye that binds with the chromosomal DNA. It is clear from this study that RNA is not involved by this process of staining, since treatment of stained sections with cold phosphoric acid at 5 degrees C for 20--25 min and then stained also reveals perfect colouration of the chromosomes without any cytoplasmic staining. The in vitro absorption properties of Hoffman's violet have also been presented herein. The probable mechanism of action of these dyes has been suggested.

  13. Staining properties and stability of a standardised Romanowsky stain.

    Science.gov (United States)

    Marshall, P N; Bentley, S A; Lewis, S M

    1978-03-01

    An evaluation of the standardised Romanowsky stain of Marshall et al. has been made in a routine haematology laboratory. It was noted that this stain had several advantages over the May-Grünwald Giemsa stain used in most British laboratories. These advantages include ease and speed of preparation, a shorter staining time, and reproducibility of results. These results are described in detail. The stability of the stock stain solution and of the 'working' stain (stock + buffer) has been studied by, respectively, thin-layer chromatography and visible spectroscopy. No change was detected in the composition of the stock solution at ambient temperature over a period of six months. Stability was unaffected by the composition of the container (polyethylene, PyrexTM, or soda-glass) or by daylight. The 'working' solution was stable for 3 hours. Thereafter a precipitate is formed, consisting of thiazine dyes and eosin in a molar ratio of approximately 2:1.

  14. The impact of coexisting sperm DNA fragmentation and seminal oxidative stress on the outcome of varicocelectomy in infertile patients: A prospective controlled study.

    Science.gov (United States)

    Abdelbaki, Shabieb A; Sabry, Jehan H; Al-Adl, Ahmed M; Sabry, Hanan H

    2017-06-01

    To study the relationship between sperm DNA fragmentation (SDF) and reactive oxygen species (ROS) levels in infertile patients with varicocele, and to examine the beneficial effect of varicocelectomy and elucidate predictors of improvement after repair. We prospectively studied 60 patients with varicocele and abnormal semen variables who attended the outpatient clinic complaining of infertility for ≥12 months. In all, 25 patients (41.7%) had bilateral varicoceles and 35 (58.3%) had left varicoceles. The DNA fragmentation index (DFI%, percentage of sperm with denatured nuclei), ROS and total non-enzymatic antioxidant capacity (TAC) were measured. Inguinal varicocelectomy was performed in all patients. At 3-6 months postoperatively, all measurements were repeated. A control group, comprised of 20 normozoospermic fertile men, was included. Regression analysis was used to examine predictors of improvement. The mean (SD) DFI% in the 60 infertile patients with varicocele was 29.9 (8.3) and 7.56 (2.84)% in the controls; ROS levels were 4.49 (0.9) in patients and 2.62 (0.8) photons/min in controls; and the TAC was 0.97 (0.4) in patients and 1.5 (0.5) mM in controls; with highly significant differences between the patients and controls. The DFI% showed a positive correlation with ROS levels, whilst the total motile sperm count (TMSC) had a significant negative correlation with DFI%, ROS levels and grade of varicocele, whilst there was significant positive correlation with TAC. The grade of varicocele and duration of infertility were related to the presence of higher levels of ROS and increased of DFI%. Postoperatively, improvement (measured as a >50% increase in TMSC) occurred in 40 of 55 (73%) patients available at follow-up, with a significant reduction in the mean (SD) DFI% from 29.49 (8.58) to 18.78 (7.23)%, ROS levels from 4.49 (0.88) to 3.27 (1.3) photons/min (both P  < 0.001), and a significant increase in the mean (SD) TAC from 1.01 (0.44) to 2.05 (0.51)

  15. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

    Science.gov (United States)

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

    2015-06-01

    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  16. Identification of human papillomavirus type 156, the prototype of a new human gammapapillomavirus species, by a generic and highly sensitive PCR strategy for long DNA fragments.

    Science.gov (United States)

    Chouhy, Diego; Bolatti, Elisa M; Piccirilli, Gustavo; Sánchez, Adriana; Fernandez Bussy, Ramón; Giri, Adriana A

    2013-03-01

    This study developed a hanging-droplet long PCR, a generic and highly sensitive strategy to facilitate the identification of new human papillomavirus (HPV) genomes. This novel procedure used for the first time the hanging-droplet PCR technique for the amplification of long DNA fragments with generic primers targeting the L1 and E1 regions. It was first applied to the amplification of types belonging to the highly divergent genus Gammapapillovirus (γ-PV). The hanging-droplet long PCR was 100-fold more sensitive than a simple long PCR procedure, detecting as few as ten copies of HPV-4. Nineteen skin samples, potentially containing putative HPV types from the γ-PV genus, were also screened. The method identified four γ-PV genomic halves from new and previously described putative types, and made the full characterization of HPV-156 possible. This novel virus meets the criteria for a new species within the γ-PV genus, with nucleotide identities in the L1 ORF ranging from 58.3 to 67.3 % compared with representative types of the current γ-PV species. HPV-156 showed the highest identity to HPV-60 (67.3 %) from species γ-4, and was consistently closely related to it in both late- and early-gene-derived phylogenies. In conclusion, this report provides a versatile and highly sensitive approach that allowed identification of the prototype of a new species within the γ-PV genus. Its application with primers targeting the different genera in which both human and non-human PVs are distributed may facilitate characterization of the missing members of the family Papillomaviridae.

  17. Simulation study of natural UV-B radiation on Catla catla and its impact on physiology, oxidative stress, Hsp 70 and DNA fragmentation.

    Science.gov (United States)

    Singh, Moirangthem Kameshwor; Sharma, Jai Gopal; Chakrabarti, Rina

    2015-08-01

    UV-B radiation is a potential stressor to the aquacultural species. Catla catla, catla larvae (1.08±0.065g) were exposed to different doses of UV-B radiation, 0 (control), 504, 1008, 1512 and 2016mJ/cm(2) at a mean radiant energy of 80μW/cm(2) for 21days. The dose of UV-B radiation was selected on the basis of the field study conducted in Lake Naini, Delhi, India (Latitude: 28°41'26″N and Longitude: 77°12″37″E). Significantly (PUV-B irradiated larvae compared to the control one. Food conversion ratio was 1.5-4-fold higher in UV-B treated larvae compared to the control one. The carbonyl protein (CP), thiobarbituric acid reactive substances (TBARS), superoxide dismutase (SOD) levels were significantly (P UV-B irradiated larvae compared to the control group. Among the treated larvae, CP and SOD were significantly (P UV-B. A correlation was found between the CP and SOD (R(2)=0.834). Highest TBARS level was found in 2016mJ/cm(2) UV-B exposed catla. Nitric oxide synthase level was significantly (P UV-B exposed larvae compared to the control one. A 3-fold increased Hsp 70 level was recorded in UV-B irradiated catla compared to the control larvae. Comet assay analysis indicated that UV-B irradiation enhanced DNA fragmentation. Tail extent moment and the olive tail moment were significantly (P UV-B exposed catla compared to others. The tail length was significantly (P UV-B exposed larvae compared to the other doses. The present study suggests that the catla is a useful species for the biomonitoring of stress in the aquatic environment. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Melatonin sensitizes human cervical cancer HeLa cells to cisplatin-induced cytotoxicity and apoptosis: effects on oxidative stress and DNA fragmentation.

    Science.gov (United States)

    Pariente, Roberto; Pariente, José A; Rodríguez, Ana B; Espino, Javier

    2016-01-01

    Melatonin has antitumor activity via several mechanisms including its antiproliferative and pro-apoptotic effects as well as its potent antioxidant actions, although recent evidence has indicated that melatonin may perform pro-oxidant actions in tumor cells. Therefore, melatonin may be useful in the treatment of tumors in association with chemotherapy drugs. This study was intended to evaluate the in vitro effect of melatonin on the cytotoxic and pro-apoptotic actions of various chemotherapeutic agents in cervical cancer HeLa cells. Herein, we found that both melatonin and three of the chemotherapeutic drugs tested, namely cisplatin (CIS), 5-fluorouracil (5-FU), and doxorubicin, induced a decrease in HeLa cell viability. Furthermore, melatonin significantly increased the cytotoxic effect of such chemotherapeutic agents. Consistently, costimulation of HeLa cells with any chemotherapeutic agent in the presence of melatonin further increased caspase-3 activation, particularly in CIS- and 5-FU-challenged cells. Likewise, concomitant treatments with melatonin and CIS significantly enhanced the ratio of cells entering mitochondrial apoptosis due to reactive oxygen species (ROS) overproduction, substantially augmented the population of apoptotic cells, and markedly enlarged DNA fragmentation compared to the treatments with CIS alone. Nonetheless, melatonin only displayed moderate chemosensitizing effects in 5-FU-stimulated HeLa cells, as suggested by slight increments in the percentage of cells stimulated for ROS production and in the proportion of early apoptotic cells compared to the treatments with 5-FU alone. In summary, our findings provided evidence that in vitro melatonin strongly enhances CIS-induced cytotoxicity and apoptosis in HeLa cells and, hence, the indoleamine could be potentially applied to cervical cancer treatment as a powerful synergistic agent. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting).

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Trościańczyk, Aleksandra; Zięba, Przemysław; Gnat, Sebastian

    2017-03-01

    In this study, we analysed phenotypic resistance profiles and their reflection in the genomic profiles of Enterococcus spp. strains isolated from pigs raised on different farms. Samples were collected from five pig farms (n=90 animals) and tested for Enterococcus. MICs of 12 antimicrobials were determined using the broth microdilution method, and epidemiological molecular analysis of strains belonging to selected species (faecalis, faecium and hirae) was performed using the ADSRRS-fingerprinting (amplification of DNA fragments surrounding rare restriction sites) method with a few modifications. The highest percentage of strains was resistant to tetracycline (73.4 %), erythromycin and tylosin (42.5 %) and rifampin (25.2 %), and a large number of strains exhibited high-level resistance to both kanamycin (25.2 %) and streptomycin (27.6 %). The strains of E. faecalis, E. faecium and E. hirae (n=184) revealed varied phenotypic resistance profiles, among which as many as seven met the criteria for multidrug resistance (30.4 % of strains tested). ADSRRS-fingerprinting analysis produced 17 genotypic profiles of individual strains which were correlated with their phenotypic resistance profiles. Only E. hirae strains susceptible to all of the chemotherapeutics tested had two different ADSRRS profiles. Moreover, eight animals were carriers of more than one genotype belonging to the same Enterococcus spp., mainly E. faecalis. Given the possibility of transmission to humans of the high-resistance/multidrug resistance enterococci and the significant role of pigs as food animals in this process, it is necessary to introduce a multilevel control strategy by carrying out research on the resistance and molecular characteristics of indicator bacterial strains isolated from animals on individual farms.

  20. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    OpenAIRE

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  1. A generalized method of subcloning DNA fragments by restriction site reconstruction: application to sequencing the amino-terminal coding region of the transforming gene of Gazdar murine sarcoma virus.

    Science.gov (United States)

    Donoghue, D J; Hunter, T

    1982-01-01

    The technique of restriction site reconstruction was generalized so as to allow the subcloning of any DNA fragment and its subsequent reexcision with EcoRI, XbaI, XhoI or HindIII. After excision, the 3' terminus of each strand will be derived from the starting nucleic acid, permitting the use of such fragments as primers for nucleotide sequencing by primer extension methods. The technique was used to subclone a 56 base pair BstNI-DdeI fragment of Moloney murine sarcoma virus (Mo-MSV) as a unique HindIII-HindIII fragment. This fragment then served as a primer to sequence a portion of the RNA genome of Gazdar murine sarcoma virus (Gz-MSV). The nucleotide sequence which was obtained indicated that the transforming gene of Gz-MSV arose by at least two recombination events involving murine leukemia virus (MLV) and the cellular homologue c-mos. This analysis suggests that a virus indistinguishable from Mo-MSV was an intermediate in the formation of Gz-MSV. Images PMID:6281735

  2. A new bacterial staining method involving Gram stain with theoretical considerations of the staining mechanism.

    Science.gov (United States)

    Noda, Y; Tôei, K

    1992-01-01

    In order to investigate the mechanism of Gram staining of bacteria, tests with anionic dyes followed by treatment with cationic octyltrimethylammonium (OTMA) were carried out. The study revealed that tetrabromophenolphthalein ethylester (TBPE) gave the most reliable staining of Gram-negative bacteria with negative staining of Gram-positive bacteria. Tests on many species of bacteria showed that TBPE positive bacteria were Gram-negative and vice versa, without exception.

  3. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  4. Differentiation of Candida glabrata, C. nivariensis and C. bracarensis based on fragment length polymorphism of ITS1 and ITS2 and restriction fragment length polymorphism of ITS and D1/D2 regions in rDNA

    DEFF Research Database (Denmark)

    Mirhendi, H; Bruun, B; Schønheyder, H C

    2011-01-01

    Different molecular methods for the discrimination of Candida glabrata, C. bracarensis and C. nivariensis were evaluated and the prevalence of these species among Danish blood isolates investigated. Control strains were used to determine fragment length polymorphism in the ITS1, ITS2, ITS1-5.8S...... enzymes were suitable for RFLP differentiation of the species. Enzymatic digestion of the D1/D2 domain with TatI produced unique band sizes for each of the three species. PCR-RFLP and PNA-FISH were in agreement for all of the isolates tested. None of the 133 Danish blood isolates were C. nivariensis or C....... bracarensis. Fragment size polymorphism of ITS1 and RFLP of the D1/D2 domain or the ITS region are useful methods for the differentiation of the species within the C. glabrata group. C. bracarensis and C. nivariensis are rare among Danish C. glabrata blood isolates....

  5. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  6. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  7. Real-time PCR detection of Ochroconis lascauxensis involved in the formation of black stains in the Lascaux Cave, France.

    Science.gov (United States)

    Martin-Sanchez, Pedro M; Bastian, Fabiola; Alabouvette, Claude; Saiz-Jimenez, Cesareo

    2013-01-15

    A real-time Polymerase Chain Reaction (PCR) assay was developed to detect and quantify Ochroconis lascauxensis in the Lascaux Cave in France. This fungus is the principal causal agent of the black stains threatening the Paleolithic paintings of this UNESCO World Heritage Site. The black stains outbreak could not be stopped in spite of using intensive biocide treatments. A sensitive and time-saving protocol is needed for determining the extent of the colonization. Sets of primers that target the ITS and RPB2 regions were designed and evaluated for specificity against O. lascauxensis. Genomic DNA extracted from five species of Ochroconis and 13 other fungal species frequently isolated from caves were used to test the specificity of each primer set. The specific and sensitive real-time PCR assay using the primers 347F/493R targeting a 147-bp fragment from the RPB2 gene was useful for quantifying the presence of O. lascauxensis in the stains on the walls, sediments and air of the cavity. The results confirmed the association of this fungus with the black stains and its wide dissemination in all cave compartments. The suitability of this method for monitoring fungal outbreaks in cave environments is discussed. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  9. Diagnosing periprosthetic infection: false-positive intraoperative Gram stains.

    Science.gov (United States)

    Oethinger, Margret; Warner, Debra K; Schindler, Susan A; Kobayashi, Hideo; Bauer, Thomas W

    2011-04-01

    Intraoperative Gram stains have a reported low sensitivity but high specificity when used to help diagnose periprosthetic infections. In early 2008, we recognized an unexpectedly high frequency of apparent false-positive Gram stains from revision arthroplasties. The purpose of this report is to describe the cause of these false-positive test results. We calculated the sensitivity and specificity of all intraoperative Gram stains submitted from revision arthroplasty cases during a 3-month interval using microbiologic cultures of the same samples as the gold standard. Methods of specimen harvesting, handling, transport, distribution, specimen processing including tissue grinding/macerating, Gram staining, and interpretation were studied. After a test modification, results of specimens were prospectively collected for a second 3-month interval, and the sensitivity and specificity of intraoperative Gram stains were calculated. The retrospective review of 269 Gram stains submitted from revision arthroplasties indicated historic sensitivity and specificity values of 23% and 92%, respectively. Systematic analysis of all steps of the procedure identified Gram-stained but nonviable bacteria in commercial broth reagents used as diluents for maceration of periprosthetic membranes before Gram staining and culture. Polymerase chain reaction and sequencing showed mixed bacterial DNA. Evaluation of 390 specimens after initiating standardized Millipore filtering of diluent fluid revealed a reduced number of positive Gram stains, yielding 9% sensitivity and 99% specificity. Clusters of false-positive Gram stains have been reported in other clinical conditions. They are apparently rare related to diagnosing periprosthetic infections but have severe consequences if used to guide treatment. Even occasional false-positive Gram stains should prompt review of laboratory methods. Our observations implicate dead bacteria in microbiologic reagents as potential sources of false-positive Gram

  10. An evaluation of some commerical Romanowsky stains.

    Science.gov (United States)

    Marshall, P N; Bentley, S A; Lewis, S M

    1975-08-01

    The staining properties of 43 commerical Romanowsky-type stains have been studied. Considerable differences in the appearance of stained blood films were observed with different batches of these stains, the staining of red cells being particularly variable. Attempts have been made to correlate staining patterns with stain composition as revealed by thin-layer chromatography and sulphated ash analyses. In this way it has been possible to define some essential requirements for satisfactory staining.

  11. Silver and Cyanine Staining of Oligonucleotides in Polyacrylamide Gel.

    Science.gov (United States)

    Tang, Weizhong; Zhou, Huafu; Li, Wei

    2015-01-01

    To explore why some oligonucleotides in denaturing polyacrylamide gel could not be silver-stained, 134 different oligonucleotides were analyzed using denaturing polyacrylamide gel electrophoresis stained with silver and asymmetric cyanine. As a result, we found that the sensitivity of oligos (dA), (dC), (dG) and (dT) to silver staining could be ranged as (dA) > (dG) > (dC) > (dT) from high to low. It was unexpected that oligo (dT) was hard to be silver-stained. Moreover, the silver staining of an oligonucleotide containing base T could be partially or completely inhibited by base T. The inhibition of silver staining by base T was a competitive inhibition which could be affected by the amounts of the argyrophil nucleobase and base T, the cis-distance between the argyrophil nucleobase and base T, and the gel concentration. The changes of the intensity of an oligonucleotide band caused by the changes of DNA base composition were diverse and interesting. The intensity of some oligonucleotide bands would significantly change when the changes of DNA base composition accumulated to a certain extent (usually ≥ 4 nt). The sensitivity of cyanine staining of ≤ 11-nt long oligonucleotides could be enhanced about 250-fold by fixing the gels with methanol fixing solution.

  12. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... an inverse correlation between anti-dsDNA antibodies and the DNA concentration in the circulation in both murine and human serum samples. High titer of anti-DNA antibodies in human sera correlated with reduced levels of circulating chromatin, and in lupus prone mice with deposition within glomeruli....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...

  13. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    ‘Engaging Through Architecture’ in 2015 by Aarhus School of Architecture as a part of the Ventura Lambrate Milan Design Week, where it was exhibited under the name Concrete. The fundamental pool of techniques and knowledge that set the agenda for the fragment was established before the intentions...

  14. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    to create architectural meaning and give character to an architecture of fragmentation. Layers are both seen as conceptual as well as material frames which define certain strong properties or meanings in the architectural work. Defining layers is a way of separating and organizing; it both defines...

  15. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  16. Image-based stained glass.

    Science.gov (United States)

    Brooks, Stephen

    2006-01-01

    We present a method of restyling an image so that it approximates the visual appearance of a work of stained glass. To this end, we develop a novel approach which involves image warping, segmentation, querying, and colorization along with texture synthesis. In our method, a given input image is first segmented. Each segment is subsequently transformed to match real segments of stained glass queried from a database of image exemplars. By using real sources of stained glass, our method produces high quality results in this nascent area of nonphotorealistic rendering. The generation of the stained glass requires only modest amounts of user interaction. This interaction is facilitated with a unique region-merging tool.

  17. Genetic investigations in immigration cases and frequencies of DNA fragments of the VNTR systems D2S44, D5S43, D7S21, D7S22, and D12S11 in Turks

    DEFF Research Database (Denmark)

    Hansen, Hanna Elsebeth; Morling, N

    1993-01-01

    We have included investigations of the DNA polymorphism of variable numbers of tandem repeat (VNTR) regions with restriction fragment length polymorphism (RFLP) in the genetic evaluations in immigrant cases. HinfI-digested DNA was separated by electrophoresis in agarose gels and hybridized...... with radiolabelled probes detecting the VNTR systems D2S44 (YNH24), D5S43 (MS8), D7S21 (MS31), D7S22 (g3), and D12S11 (MS43a). We used the matching criterion for paternity testing for the parent/child comparisons, i.e. non-match if the intra gel difference exceeded 1.25 mm. A total of 43 immigration cases involving...... putative father/child pairs. In a putative father/child combination with non-exclusion in 18 genetic systems, a single genetic inconsistency ('exclusion') in D7S21 (MS31) was observed. The frequency distributions of HinfI digested DNA fragments of the five VNTR systems in 105 Turks are presented....

  18. Fragmented Authoritarianism or Integrated Fragmentation

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    or from a position as business leader to a position in the state apparatus or in the Party and vice versa. To conceptualize the coexistence of the contradicting forces for further enterprise autonomy and continued central control that characterizes the evolving relationship between business groups...... and the Party-state, I suggest the notion of integrated fragmentation....

  19. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...... the development of lupus nephritis at an early stage....

  20. Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

    Science.gov (United States)

    Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

    2018-03-12

    Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

  1. Optimization of separation and detection schemes for DNA with pulsed field slab gel and capillary electrophoresis

    Energy Technology Data Exchange (ETDEWEB)

    McGregor, David A. [Iowa State Univ., Ames, IA (United States)

    1993-07-01

    The purpose of the Human Genome Project is outlined followed by a discussion of electrophoresis in slab gels and capillaries and its application to deoxyribonucleic acid (DNA). Techniques used to modify electroosmotic flow in capillaries are addressed. Several separation and detection schemes for DNA via gel and capillary electrophoresis are described. Emphasis is placed on the elucidation of DNA fragment size in real time and shortening separation times to approximate real time monitoring. The migration of DNA fragment bands through a slab gel can be monitored by UV absorption at 254 nm and imaged by a charge coupled device (CCD) camera. Background correction and immediate viewing of band positions to interactively change the field program in pulsed-field gel electrophoresis are possible throughout the separation. The use of absorption removes the need for staining or radioisotope labeling thereby simplifying sample preparation and reducing hazardous waste generation. This leaves the DNA in its native state and further analysis can be performed without de-staining. The optimization of several parameters considerably reduces total analysis time. DNA from 2 kb to 850 kb can be separated in 3 hours on a 7 cm gel with interactive control of the pulse time, which is 10 times faster than the use of a constant field program. The separation of ΦX174RF DNA-HaeIII fragments is studied in a 0.5% methyl cellulose polymer solution as a function of temperature and applied voltage. The migration times decreased with both increasing temperature and increasing field strength, as expected. The relative migration rates of the fragments do not change with temperature but are affected by the applied field. Conditions were established for the separation of the 271/281 bp fragments, even without the addition of intercalating agents. At 700 V/cm and 20°C, all fragments are separated in less than 4 minutes with an average plate number of 2.5 million per meter.

  2. The influence of Romanowsky-Giemsa type of stains on the nuclear texture of desoxyribonuclease-treated cytological preparations.

    Science.gov (United States)

    Wittekind, D; Schulte, E; Kretschmer, V

    1989-01-01

    It had been observed that cell films where DNA had been partially digested by DNase stained differentially by the standard RG stain and a representative commercial Giemsa mixture. The reasons for this divergence were experimentally investigated. The lower concentration of Azure B in the commercial Giemsa mixture as compared with the standard RG stain emerged as the most likely factor causing the divergence of staining behaviour. A correlation of this assumption to the theory of the RG stain is tentatively suggested.

  3. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  4. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    the photographs as a starting point for a series of paintings. This way of creating representations of something that already exists is for me to see a way forward in the "decoding" of my own models into other depictions. The models are analyzed through a series of representations in different types of drawings....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...

  5. [Enrichment of extracellular DNA from the cultivation medium of human peripheral blood mononuclears with genomic CpG rich fragments results in increased cell production of IL-6 and TNF-a via activation of the NF-kB signaling pathway].

    Science.gov (United States)

    Speranskii, A I; Kostyuk, S V; Kalashnikova, E A; Veiko, N N

    2016-03-01

    Previously, it was found that blood plasma extracellular DNA (ecDNA) of patients with rheumatoid arthritis (RA) is enriched with CpG-rich genomic DNA fragments, which contain TLR9 ligands (Veiko et al., 2006). In this study we have demonstrated that ecDNA of a RA patient and model fragments added to a cultivation medium of peripheral blood mononuclear cells (PBMC) of healthy donors stimulate expression of genes for the TLR9-MyD88-NF-kB signaling pathway; this leads to a significant increase in concentrations of the proinflammatory cytokines IL-6 and TNF-a in the cultivation medium. Human genomic DNA non-enriched with the CpG sequences did not stimulate IL-6 and TNF-a synthesis in PBMC. A scheme explaining the potential role ecDNA in the induction and maintenance of increased levels of the proinflammatory cytokines under conditions damaging the human cells has been proposed.

  6. Methyl green-pyronin Y staining of nucleic acids: studies on the effects of staining time, dye composition and diffusion rates

    DEFF Research Database (Denmark)

    Prentø, P; Lyon, H O

    2003-01-01

    of hypotheses have been put forward concerning kinetics and binding mechanisms. Using both filter paper models containing DNA, RNA or heparin and histological sections, we have attempted to evaluate the kinetics of staining and the role of staining time for methyl green and pyronin Y by applying the dyes...

  7. Assessment of nucleic acid modification induced by amotosalen and ultraviolet A light treatment of platelets and plasma using real-time polymerase chain reaction amplification of variable length fragments of mitochondrial DNA.

    Science.gov (United States)

    Bakkour, Sonia; Chafets, Daniel M; Wen, Li; Dupuis, Kent; Castro, Grace; Green, Jennifer M; Stassinopoulos, Adonis; Busch, Michael P; Lee, Tzong-Hae

    2016-02-01

    Pathogen inactivation methods are increasingly used to reduce the risk of infections after transfusion of blood products. Photochemical treatment (PCT) of platelets (PLTs) and plasma with amotosalen and ultraviolet A (UVA) light inactivates pathogens and white blood cells through formation of adducts between amotosalen and nucleic acid that block replication, transcription, and translation. The same adducts block the amplification of nucleic acids using polymerase chain reaction (PCR) in a manner that correlates with the number of adducts formed, providing a direct quality control (QC). Current QC measures for PCT rely on indirect methods that measure the delivered UVA dose or percent residual amotosalen after illumination, rather than directly measuring nucleic acid modification. Endogenous mitochondrial DNA (mtDNA), which is detectable in PLT and plasma units, was chosen as a target for the quantification of photochemically induced modifications. DNA was extracted from untreated or amotosalen and UVA-treated PLTs or plasma, and mtDNA fragments of variable lengths were quantified using a real-time PCR inhibition assay. PCT induced increasing real-time PCR inhibition of mtDNA amplification for larger amplicon sizes. Amplification was unaffected by treatment with amotosalen or UVA alone, whereas up to 3 log inhibition was observed after PCT. Blinded PCR testing of a panel of 110 samples each, from PLT or plasma components prepared for routine use within a blood center, allowed 100% discrimination between untreated and treated units. Our initial findings indicate that an adequately sensitive, quantitative real-time PCR inhibition assay targeting mtDNA could provide a valuable tool to confirm and monitor PCT. © 2015 The Authors. Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

  8. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Science.gov (United States)

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Application of the DNA ''comet assay'' to detect irradiation treatment of foods

    International Nuclear Information System (INIS)

    Delincee, H.

    1996-01-01

    Since treatment with ionising radiation causes DNA fragmentation, microgel electrophoresis of single cells (''comet assay'') offers a simple and rapid tool for identification of irradiated foods. The principle is based on migration of DNA in an agarose gel exposed to an electric field. Single cells or nuclei are embedded in the agarose and after lysis, intact DNA will virtually not move out of the cell upon electrophoresis, whereas if DNA has been fragmented, the fragments are able to migrate and ''comets'' following the cells become visible after staining. The advantages of this test, however, for foods not exposed to heat are its speed and simplicity, as the electrophoretic separation only requires a few minutes. DNA is visualised by silver staining, avoiding the need for a fluorescence microscope. Thus the method requires only relatively cheap equipment - in contrast to other methods for identification of irradiated food such as electron spin resonance (ESR) spectroscopy or gas chromatography/mass spectrometry (GC/MS). The DNA ''comet assay'' , therefore, seems suitable as a pre-screening test to detect whether food has been radiation processed. Suspected samples may subsequently be analysed by established, but more expensive techniques. (author)

  10. Salt stains from evaporating droplets

    NARCIS (Netherlands)

    Shahidzadeh, N.; Schut, M.F.L.; Desarnaud, J.; Prat, M.; Bonn, D.

    2015-01-01

    The study of the behavior of sessile droplets on solid substrates is not only associated with common everyday phenomena, such as the coffee stain effect, limescale deposits on our bathroom walls, but also very important in many applications such as purification of pharmaceuticals, deicing of

  11. DNA staining with the fluorochromes EtBr, DAPI and YOYO-1 in the comet assay with tobacco plants after treatment with ethyl methanesulphonate, hyperthermia and DNase-I

    Czech Academy of Sciences Publication Activity Database

    Gichner, Tomáš; Mukherjee, A.; Velemínský, Jiří

    2006-01-01

    Roč. 605, 1-2 (2006), s. 17-21 ISSN 1383-5718 R&D Projects: GA ČR GA521/05/0500 Institutional research plan: CEZ:AV0Z50380511 Keywords : DNA migration * Nicotiana tabacum * Single-cell gel electrophoresis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2006

  12. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  13. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    Science.gov (United States)

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  14. Extended HSR/CARD domain mediates AIRE binding to DNA

    Energy Technology Data Exchange (ETDEWEB)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt

    2015-12-25

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.

  15. STR analysis of artificially degraded DNA-results of a collaborative European exercise

    DEFF Research Database (Denmark)

    Schneider, Peter M; Bender, Klaus; Mayr, Wolfgang R

    2004-01-01

    Degradation of human DNA extracted from forensic stains is, in most cases, the result of a natural process due to the exposure of the stain samples to the environment. Experiences with degraded DNA from casework samples show that every sample may exhibit different properties in this respect......, and that it is difficult to systematically assess the performance of routinely used typing systems for the analysis of degraded DNA samples. Using a batch of artificially degraded DNA with an average fragment size of approx. 200 bp a collaborative exercise was carried out among 38 forensic laboratories from 17 European...... countries. The results were assessed according to correct allele detection, peak height and balance as well as the occurrence of artefacts. A number of common problems were identified based on these results such as strong peak imbalance in heterozygous genotypes for the larger short tandem repeat (STR...

  16. A Simple Procedure for the Evaluation of Bone Vitality by Staining with a Tetrazolium Salt

    Directory of Open Access Journals (Sweden)

    René Schiffner

    2017-07-01

    Full Text Available Presently, no intra-operative method for a direct assessment of bone vitality exists. Therefore, we set out to test the applicability of tetrazolium-based staining on bone samples. The explanted femoral heads of 37 patients were used to obtain either cancellous bone fragments or bone slices. Samples were stained with 2,3,5-triphenyl-2H-tetrazolium chloride (TTC or 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (thiazolyl blue, MTT at different times (one to twelve hours after explantation. Staining was quantified either spectrophotometrically after extraction of the dyes or by densitometric image analysis. TTC-staining of cancellous bone fragments and bone slices, respectively, indicated the detectability of vital cells in both types of samples in a window of up to six hours after explantation. Staining intensity at later time-points was indistinguishable from the staining of untreated samples or sodium azide treated samples, which represent dead cells. In contrast, MTT-staining of bone slices revealed intense unspecific staining, which obscured the evaluation of the vitality of the samples. The lack of a detectable increase of colour intensity in TTC-stained bone samples, which were treated more than six hours after explantation, corresponds to reduced fracture healing. The described simple procedure could provide a basis for an intraoperative decision by the orthopaedic surgeon.

  17. Fragmented Authoritarianism or Integrated Fragmentation

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    proved their influence by obstructing the creation of new ministries and regulatory commissions that would limit their powers. The heads of these business groups often outrank their counterparts in state administrative organs and bureaus that are supposed to regulate their activities. The increased role...... of these business leaders prompts the question of whether we are seeing the development of distinct interest groups that could challenge Party and state authority and create a fragmented polity. However, through the nomenklatura system the Party has an important instrument of control to wield over business groups....... Through this system the Party controls the appointment and promotion of the heads of the most important state-owned enterprises. The nomenklatura system also enables the Party to rotate leaders in big business from a position as CEO in one company to a similar position in another state-owned company...

  18. The potential of platinum-DNA adduct determination in ex vivo treated tumor fragments for the prediction of sensitivity to cisplatin chemotherapy

    NARCIS (Netherlands)

    Welters, M.J.P.; Braakhuis, B.J.M.; Jacobs-Bergmans, A.J.; Kegel, A.; Baan, R.A.; Vijgh, W.J.F. van der; Fichtinger-Schepman, A.M.J.

    1999-01-01

    Background: Response to cisplatin-therapy is assumed to be related to the formation of platinum (Pt)-DNA adducts. Measurement of these adducts prior to therapy could be of value to improve cisplatin based cancer therapy. Materials and methods: We determined Pt-GG and Pt-AG adduct levels by use of

  19. Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

    Science.gov (United States)

    A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

  20. Analysis of endophytic bacterial communities of potato by plating and denaturing gradient gel electrophoresis (DGGE) of 16S rDNA based PCR fragments

    NARCIS (Netherlands)

    Garbeva, P.; Overbeek, van L.S.; Vuurde, van J.W.L.; Elsas, van J.D.

    2001-01-01

    The diversity of endophytic bacterial populations of potato (Solanum tuberosum cv Desiree) was assessed using a combination of dilution plating of plant macerates followed by isolation and characterization of isolates, and direct PCR-DGGE on the basis of DNA extracted from plants. The culturable

  1. Etika Berbusana Mahasiswa Stain Samarinda

    Directory of Open Access Journals (Sweden)

    Ida Suryani Wijaya

    2012-06-01

    Full Text Available Ethics is about behavior of human being, such as which one is right or wrong. The ethics is always affecting the human life. The ethics gives people orientation how he/she do manything every time every day. Islamic ethics consists of the way how someone interact each other; how someone should do or not to do, how to sit, how to walk, how to eat or drink, how to sleep, or how to get dressed. Al-Qur’an uses three terms to define about dressing, they are: libas, tsiyah, and sarahi. Dressing has a function as covering the body, as assessoris, as the way to do Islamic taqwa, and as an identiy. Dressing ethics of the female students of STAIN Samarinda has been regulated by the rector regulation No 19 of the year 2002 about relation and dressing ethics for the students of STAIN Samarinda.

  2. Method to Assemble Genomic DNA Fragments or Genes on Human Artificial Chromosome with Regulated Kinetochore Using a Multi-Integrase System.

    Science.gov (United States)

    Lee, Nicholas C O; Kim, Jung-Hyun; Petrov, Nikolai S; Lee, Hee-Sheung; Masumoto, Hiroshi; Earnshaw, William C; Larionov, Vladimir; Kouprina, Natalay

    2018-01-19

    The production of cells capable of carrying multiple transgenes to Mb-size genomic loci has multiple applications in biomedicine and biotechnology. In order to achieve this goal, three key steps are required: (i) cloning of large genomic segments; (ii) insertion of multiple DNA blocks at a precise location and (iii) the capability to eliminate the assembled region from cells. In this study, we designed the iterative integration system (IIS) that utilizes recombinases Cre, ΦC31 and ΦBT1, and combined it with a human artificial chromosome (HAC) possessing a regulated kinetochore (alphoid tetO -HAC). We have demonstrated that the IIS-alphoid tetO -HAC system is a valuable genetic tool by reassembling a functional gene from multiple segments on the HAC. IIS-alphoid tetO -HAC has several notable advantages over other artificial chromosome-based systems. This includes the potential to assemble an unlimited number of genomic DNA segments; a DNA assembly process that leaves only a small insertion (system that also changes cell color, and counter-selection markers at each DNA insertion step, simplifying selection of correct clones; and presence of an error proofing mechanism to remove cells with misincorporated DNA segments, which improves the integrity of assembly. In addition, the IIS-alphoid tetO -HAC carrying a locus of interest is removable, offering the unique possibility to revert the cell line to its pretransformed state and compare the phenotypes of human cells with and without a functional copy of a gene(s). Thus, IIS-alphoid tetO -HAC allows investigation of complex biomedical pathways, gene(s) regulation, and has the potential to engineer synthetic chromosomes with a predetermined set of genes.

  3. Development of PCR primers based on a fragment from randomly amplified polymorphic DNA for the detection of Escherichia coli O157:H7/NM.

    Science.gov (United States)

    Lin, Chien-Ku; Lin, Jia-Chi

    2007-06-01

    Serotype O157:H7 of EHEC is by far the most prevalent serotype associated with haemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS). Although PCR methods aimed on the detection of genes associated with the pathogenicity of Escherichia coli O157:H7 have been reported, tests allowing the direct identification of this serotype are rare. In this study, we used RAPD-PCR tests to analyze strains of E. coli O157:H7 serotype, strains of non-pathogenic E. coli, and strains of other pathotypes, including enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), and enteroaggregation E. coli (EAggEC). One RAPD fragment co-shared by serotype O157:H7 strains was observed when 10-mer primer termed as OPQ3 was used. After sequencing this fragment, three primers were designed and combined to form two PCR primer pairs. These two primer pairs were highly specific to the strains belonging to E. coli O157:H7/NM (non-motile).

  4. Microwave-stimulated staining of plastic embedded bone marrow sections with the Romanowsky-Giemsa stain: improved staining patterns.

    Science.gov (United States)

    Boon, M E; Kok, L P; Moorlag, H E; Gerrits, P O; Suurmeijer, A J

    1987-07-01

    Staining plastic sections with the Romanowsky-Giemsa method is both time-consuming and difficult. This paper reports how the staining time can be reduced to 25 min using microwave irradiation of the staining solution. It is shown that staining results depend on the fixative used, staining temperature, dye concentration and pH of the staining solution as well as on several parameters of the microwave irradiation technique. The staining patterns are improved when compared with those obtained by conventional staining of plastic sections. The colors are more brilliant and greater contrasts are observed. Basophilia, polychromasia, and orthochromasia accompanying red cell maturation are more pronounced. For white cell maturation the initial appearance of specific granules (neutrophil, basophil, and eosinophil) is more evident. Thus, cell classification is easily accomplished using the described technique. It is suggested that microwave-stimulated staining be considered for routine use.

  5. The analysis of chromatin remodeling and the staining for DNA methylation and histone acetylation do not provide definitive indicators of the developmental ability of inter-species cloned embryos.

    Science.gov (United States)

    Lee, Eugine; Kim, Ji Hye; Park, Seon Mi; Jeong, Yeon Ik; Lee, Jong Yun; Park, Sun Woo; Choi, Jiho; Kim, Huen Suk; Jeong, Yeon Woo; Kim, Sue; Hyun, Sang Hwan; Hwang, Woo Suk

    2008-05-01

    The restricted supply of oocytes in the domestic dog limits the development of reproductive biotechnologies in this species. Inter-species somatic cell nuclear transfer could be an alternative for cloning animals whose oocytes are difficult to obtain. In this study, the possibility of cloning dog embryos using pig oocytes was investigated by evaluating nuclear remodeling. Chromatin remodeling, assessed by premature chromosome condensation, pseudo-pronuclei formation, DNA methylation and histone acetylation, along with the developmental ability was compared between intra- and inter-species cloned embryos. The incidence of premature chromosome condensation was significantly higher in intra-species cloned embryos relative to inter-species cloned embryos (87.2% vs. 61.7%; Pcloned embryos developed beyond the 8-cell stage while 18.3% of intra-species cloned embryos developed to the blastocyst stage. The relative level of both DNA methylation and histone acetylation was similar between intra- and inter-species cloned embryos at all times examined. These results suggest that although partial chromatin remodeling occurs, further investigation is needed to be able to use pig oocytes as recipient oocytes in dog cloning.

  6. Genetic evidence for the existence of cryptic species in the Anopheles albitarsis complex in Brazil: allozymes and mitochondrial DNA restriction fragment length polymorphisms.

    Science.gov (United States)

    Narang, S K; Klein, T A; Perera, O P; Lima, J B; Tang, A T

    1993-02-01

    Allozyme and mitochondrial DNA (mtDNA) restriction studies were undertaken to determine the extent of genetic divergence among field populations of Anopheles albitarsis in Brazil. Two sympatric species, An. deaneorum and An. marajoara, were identified in collections from Costa Marques (CM), Rondonia. Genetic evidence includes (1) the presence of two types of individuals, each with diagnostic allelic clusters (for Had-1, Pgi-1, Pep-1, Mpi-1, and Idh-1), (2) a deficiency of heterozygotes, and (3) characteristic mtDNA haplotypes. In addition, two allopatric cryptic species of An. marajoara were identified, one from Iguape (An. marajoara form IG), Sao Paulo state, and the other from the Island of Marajo (An. marajoara form MA). Though form IG and form-MA resemble form CM in wing spot morphology, they differ from it in diagnostic allozymes and mtDNA haplotypes. An. marajoara form CM had a higher variability (mean heterozygosity, H = 0.22, and percentage of polymorphic loci, P = 66.7) than did form IG and form MA (H = 0.08 in both, and P = 25.0 and 33.3, respectively). Form MA and form IG are genetically more similar to each other than both are to form CM. Based on wing morphology, estimates of F statistics, and genetic similarities, we propose that An. albitarsis in Brazil is a species complex. It comprises at least two morphologically distinguishable species: (1) An. deaneorum (currently one taxon) and (2) the An. marajoara species complex, which further consists of at least three cryptic forms, marajoara form MA, marajoara form IG, and marajoara form CM.

  7. A mouse variable gene fragment binds to DNA independently of the BCR context: a possible role for immature B-cell repertoire establishment.

    Directory of Open Access Journals (Sweden)

    Andrea Queiroz Maranhão

    Full Text Available B-cell maturation occurs in several steps and requires constant stimulus for its continuing development. From the emergence of the pre-B-cell receptor, signal transduction stimulates and supports B-cell development. Current viewpoints indicate that both positive selection pressure for autoantigens and tonic signaling constitutively stimulate B-cell maturation. In this work, we tested for the presence of a putative DNA binding site in a variable gene segment in a germline configuration, independently of VDJ recombination. After a survey of the public antibody databases, we chose a single mouse heavy variable gene segment that is highly represented in anti-nucleic acid antibodies and tested it for ssDNA binding. A phage display approach was used to search for intrinsic binding to oligo deoxythymidine. The results revealed that binding to an antigen can be influenced by the use of a specific DNA binding V[Formula: see text] gene segment. Our data support the idea that some variable genes have intrinsic reactivity towards specific types of endogenous autoantigens, and this property may contribute to the establishment of the immature B-cell repertoire.

  8. An Intrabody Drug (rAAV6-INT41 Reduces the Binding of N-Terminal Huntingtin Fragment(s to DNA to Basal Levels in PC12 Cells and Delays Cognitive Loss in the R6/2 Animal Model

    Directory of Open Access Journals (Sweden)

    I. Alexandra Amaro

    2016-01-01

    Full Text Available Huntington’s disease (HD is a fatal progressive disease linked to expansion of glutamine repeats in the huntingtin protein and characterized by the progressive loss of cognitive and motor function. We show that expression of a mutant human huntingtin exon-1-GFP fusion construct results in nonspecific gene dysregulation that is significantly reduced by 50% due to coexpression of INT41, an intrabody specific for the proline-rich region of the huntingtin protein. Using stable PC12 cell lines expressing either inducible human mutant huntingtin (mHtt, Q73 or normal huntingtin (nHtt, Q23, we investigated the effect of rAAV6-INT41, an adeno-associated virus vector with the INT41 coding sequence, on the subcellular distribution of Htt. Compartmental fractionation 8 days after induction of Htt showed a 6-fold increased association of a dominate N-terminal mHtt fragment with DNA compared to N-terminal nHtt. Transduction with rAAV6-INT41 reduced DNA binding of N-terminal mHtt 6.5-fold in the nucleus and reduced nuclear translocation of the detected fragments. Subsequently, when rAAV6-INT41 is delivered to the striatum in the R6/2 mouse model, treated female mice exhibited executive function statistically indistinguishable from wild type, accompanied by reductions in Htt aggregates in the striatum, suggesting that rAAV6-INT41 is promising as a gene therapy for Huntington’s disease.

  9. Binary and ternary binding affinities between exonuclease-deficient Klenow fragment (Kf-exo(-)) and various arylamine DNA lesions characterized by surface plasmon resonance.

    Science.gov (United States)

    Vaidyanathan, V G; Xu, Lifang; Cho, Bongsup P

    2012-08-20

    We used surface plasmon resonance (SPR) to characterize the binding interactions between the exonulease-free Klenow fragment (Kf-exo(-)) and unmodified and modified dG adducts derived from arylamine carcinogens: fluorinated 2-aminofluorene (FAF), 2-acetylaminofluorene (FAAF), and 4-aminobiphenyl (FABP). Tight polymerase binding was detected with unmodified dG and the correct dCTP. The discrimination of correct versus incorrect nucleotides was pronounced with K(D) values in the order of dCTP ≪ dTTP Kf-exo(-) binding tighter to the FAAF (k(off): 0.02 s(-1)) and FABP (k(off): 0.01 s(-1)) lesions than to FAF (k(off): 0.04 s(-1)).

  10. Flow cytometric method for measuring chromatin fragmentation in fixed sperm from yellow perch (Perca flavescens)

    Science.gov (United States)

    Jenkins, Jill A.; Draugelis-Dale, Rassa O.; Pinkney, Alfred E.; Iwanowicz, Luke R.; Blazer, Vicki

    2015-01-01

    Declining harvests of yellow perch, Perca flavescens, in urbanized watersheds of Chesapeake Bay have prompted investigations of their reproductive fitness. The purpose of this study was to establish a flow cytometric technique for DNA analysis of fixed samples sent from the field to provide reliable gamete quality measurements. Similar to the sperm chromatin structure assay, measures were made on the susceptibility of nuclear DNA to acid-induced denaturation, but used fixed rather than live or thawed cells. Nuclei were best exposed to the acid treatment for 1 minute at 37 °C followed by the addition of cold (4 °C) propidium iodide staining solution before flow cytometry. The rationale for protocol development is presented graphically through cytograms. Field results collected in 2008 and 2009 revealed DNA fragmentation up to 14.5%. In 2008, DNA fragmentation from the more urbanized watersheds was significantly greater than from reference sites (P = 0.026) and in 2009, higher percentages of haploid testicular cells were noted from the less urbanized watersheds (P = 0.032) indicating better reproductive condition at sites with less urbanization. For both years, total and progressive live sperm motilities by computer-assisted sperm motion analysis ranged from 19.1% to 76.5%, being significantly higher at the less urbanized sites (P chromatin compaction levels from samples translocated over distance and time. The protocol provides an approach that can be modified for other species across taxa.

  11. Accelerated staining technique using kitchen microwave oven

    Directory of Open Access Journals (Sweden)

    Archana Mukunda

    2015-01-01

    Full Text Available Introduction: Histopathological diagnosis of specimens is greatly dependent on good sample preparation and staining. Both of these processes is governed by diffusion of fluids and dyes in and out of the tissue, which is the key to staining. Diffusion of fluids can be accelerated by the application of heat that reduces the time of staining from hours to the minute. We modified an inexpensive model of kitchen microwave oven for staining. This study is an attempt to compare the reliability of this modified technique against the tested technique of routine staining so as to establish the kitchen microwave oven as a valuable diagnostic tool. Materials and Methods: Sixty different tissue blocks were used to prepare 20 pairs of slides for 4 different stains namely hematoxylin and eosin, Van Gieson′s, 0.1% toluidine blue and periodic acid-Schiff. From each tissue block, two bits of tissues were mounted on two different slides. One slide was stained routinely, and the other stained inside a microwave. A pathologist evaluated the stained slides and the results so obtained were analyzed statistically. Results: Microwave staining considerably cut down the staining time from hours to seconds. Microwave staining showed no loss of cellular and nuclear details, uniform-staining characteristics and was of excellent quality. Interpretation and Conclusion: The cellular details, nuclear details and staining characteristics of microwave stained tissues were better than or equal to the routine stained tissue. The overall quality of microwave-stained sections was found to be better than the routine stained tissue in majority of cases.

  12. Hyperspectral imaging of the crime scene for detection and identification of blood stains

    Science.gov (United States)

    Edelman, G. J.; van Leeuwen, T. G.; Aalders, M. C. G.

    2013-05-01

    Blood stains are an important source of information in forensic investigations. Extraction of DNA may lead to the identification of victims or suspects, while the blood stain pattern may reveal useful information for the reconstruction of a crime. Consequently, techniques for the detection and identification of blood stains are ideally non-destructive in order not to hamper both DNA and the blood stain pattern analysis. Currently, forensic investigators mainly detect and identify blood stains using chemical or optical methods, which are often either destructive or subject to human interpretation. We demonstrated the feasibility of hyperspectral imaging of the crime scene to detect and identify blood stains remotely. Blood stains outside the human body comprise the main chromophores oxy-hemoglobin, methemoglobin and hemichrome. Consequently, the reflectance spectra of blood stains are influenced by the composite of the optical properties of the individual chromophores and the substrate. Using the coefficient of determination between a non-linear least squares multi-component fit and the measured spectra blood stains were successfully distinguished from other substances visually resembling blood (e.g. ketchup, red wine and lip stick) with a sensitivity of 100 % and a specificity of 85 %. The practical applicability of this technique was demonstrated at a mock crime scene, where blood stains were successfully identified automatically.

  13. Mouse zygotes respond to severe sperm DNA damage by delaying paternal DNA replication and embryonic development.

    Directory of Open Access Journals (Sweden)

    Joanna E Gawecka

    Full Text Available Mouse zygotes do not activate apoptosis in response to DNA damage. We previously reported a unique form of inducible sperm DNA damage termed sperm chromatin fragmentation (SCF. SCF mirrors some aspects of somatic cell apoptosis in that the DNA degradation is mediated by reversible double strand breaks caused by topoisomerase 2B (TOP2B followed by irreversible DNA degradation by a nuclease(s. Here, we created zygotes using spermatozoa induced to undergo SCF (SCF zygotes and tested how they responded to moderate and severe paternal DNA damage during the first cell cycle. We found that the TUNEL assay was not sensitive enough to identify the breaks caused by SCF in zygotes in either case. However, paternal pronuclei in both groups stained positively for γH2AX, a marker for DNA damage, at 5 hrs after fertilization, just before DNA synthesis, while the maternal pronuclei were negative. We also found that both pronuclei in SCF zygotes with moderate DNA damage replicated normally, but paternal pronuclei in the SCF zygotes with severe DNA damage delayed the initiation of DNA replication by up to 12 hrs even though the maternal pronuclei had no discernable delay. Chromosomal analysis of both groups confirmed that the paternal DNA was degraded after S-phase while the maternal pronuclei formed normal chromosomes. The DNA replication delay caused a marked retardation in progression to the 2-cell stage, and a large portion of the embryos arrested at the G2/M border, suggesting that this is an important checkpoint in zygotic development. Those embryos that progressed through the G2/M border died at later stages and none developed to the blastocyst stage. Our data demonstrate that the zygote responds to sperm DNA damage through a non-apoptotic mechanism that acts by slowing paternal DNA replication and ultimately leads to arrest in embryonic development.

  14. RAPD Profiling, DNA Fragmentation, and Histomorphometric Examination in Brains of Wistar Rats Exposed to Indoor 2.5 Ghz Wi-Fi Devices Radiation.

    Science.gov (United States)

    Ibitayo, A O; Afolabi, O B; Akinyemi, A J; Ojiezeh, T I; Adekoya, K O; Ojewunmi, O O

    2017-01-01

    The advent of Wi-Fi connected high technology devices in executing day-to-day activities is fast evolving especially in developing countries of the world and hence the need to assess its safety among others. The present study was conducted to investigate the injurious effect of radiofrequency emissions from installed Wi-Fi devices in brains of young male rats. Animals were divided into four equal groups; group 1 served as control while groups 2, 3, and 4 were exposed to 2.5 Ghz at intervals of 30, 45, and 60 consecutive days with free access to food and water ad libitum. Alterations in harvested brain tissues were confirmed by histopathological analyses which showed vascular congestion and DNA damage in the brain was assayed using agarose gel electrophoresis. Histomorphometry analyses of their brain tissues showed perivascular congestion and tissue damage as well.

  15. Comparison of immunohistochemical and modified Giemsa stains ...

    African Journals Online (AJOL)

    In 2 cases immunostain could not demonstrate the bacteria but they were identified with modified Giemsa stain while in 5 cases the bacteria were identified by immunostain but not with modified Giemsa stain. The sensitivity of modified Giemsa stain was 85% (CI 66.5-98.8) while the specificity was 89% (CI 60.4 – 97.8).

  16. [Diagnostic stain of helminth eggs (author's transl)].

    Science.gov (United States)

    Cerva, L

    1976-12-01

    A description is given of a diagnostic method for the staining of eggs and larvae of intestinal helminth in smears of both fresh and fixed stool samples. The contents of the eggs and larvae stain red, the background various shades of blue. The most contrasting staining was obtained with thin-walled eggs.

  17. Theoretical performance of non-invasive prenatal testing for chromosome imbalances using counting of cell-free DNA fragments in maternal plasma.

    Science.gov (United States)

    Benn, Peter; Cuckle, Howard

    2014-08-01

    The aim of this study was to calculate the theoretical performance of non-invasive prenatal testing based on counting methods. The calculations were based on Gaussian distributions of the percent cell-free DNA from selected chromosome regions in affected and normal pregnancies. The means were derived from the relative genomic size of the chromosome region and the fetal fraction. The standard deviations were derived from the bivariate distributions of proportional counts. Depth of sequencing was varied from 50,000,000 to 100,000 and fetal fraction from 20% to 3%. Detection rate was estimated for a fixed 0.13% false-positive rate. When either depth or fetal fraction is high, expected Down syndrome screening detection rates are high. However, when fetal fraction is low, deeper sequencing is required to obtain high detection rates. For microdeletion and microduplication screening, deeper sequencing is routinely required to consistently achieve high detection rates. There are small differences in the ability to detect a microdeletion compared with a duplication of the same size. While the theoretical calculations do not necessarily reflect the performance of currently available non-invasive prenatal testing tests, it confirms that fetal fraction is a key factor. Efficacy can be substantially altered depending on the abnormality under investigation and the depth of sequencing. © 2014 John Wiley & Sons, Ltd.

  18. Molecular phylogeny and systematics of the banana family (Musaceae) inferred from multiple nuclear and chloroplast DNA fragments, with a special reference to the genus Musa.

    Science.gov (United States)

    Li, Lin-Feng; Häkkinen, Markku; Yuan, Yong-Ming; Hao, Gang; Ge, Xue-Jun

    2010-10-01

    Musaceae is a small paleotropical family. Three genera have been recognised within this family although the generic delimitations remain controversial. Most species of the family (around 65 species) have been placed under the genus Musa and its infrageneric classification has long been disputed. In this study, we obtained nuclear ribosomal ITS and chloroplast (atpB-rbcL, rps16, and trnL-F) DNA sequences of 36 species (42 accessions of ingroups representing three genera) together with 10 accessions of ingroups retrieved from GenBank database and 4 accessions of outgroups, to construct the phylogeny of the family, with a special reference to the infrageneric classification of the genus Musa. Our phylogenetic analyses elaborated previous results in supporting the monophyly of the family and suggested that Musella and Ensete may be congeneric or at least closely related, but refuted the previous infrageneric classification of Musa. None of the five sections of Musa previously defined based on morphology was recovered as monophyletic group in the molecular phylogeny. Two infrageneric clades were identified, which corresponded well to the basic chromosome numbers of x=11 and 10/9/7, respectively: the former clade comprises species from the sections Musa and Rhodochlamys while the latter contains sections of Callimusa, Australimusa, and Ingentimusa. Copyright 2010 Elsevier Inc. All rights reserved.

  19. Histological stain evaluation for machine learning applications

    Directory of Open Access Journals (Sweden)

    Jimmy C Azar

    2013-01-01

    Full Text Available Aims: A methodology for quantitative comparison of histological stains based on their classification and clustering performance, which may facilitate the choice of histological stains for automatic pattern and image analysis. Background: Machine learning and image analysis are becoming increasingly important in pathology applications for automatic analysis of histological tissue samples. Pathologists rely on multiple, contrasting stains to analyze tissue samples, but histological stains are developed for visual analysis and are not always ideal for automatic analysis. Materials and Methods: Thirteen different histological stains were used to stain adjacent prostate tissue sections from radical prostatectomies. We evaluate the stains for both supervised and unsupervised classification of stain/tissue combinations. For supervised classification we measure the error rate of nonlinear support vector machines, and for unsupervised classification we use the Rand index and the F-measure to assess the clustering results of a Gaussian mixture model based on expectation-maximization. Finally, we investigate class separability measures based on scatter criteria. Results: A methodology for quantitative evaluation of histological stains in terms of their classification and clustering efficacy that aims at improving segmentation and color decomposition. We demonstrate that for a specific tissue type, certain stains perform consistently better than others according to objective error criteria. Conclusions: The choice of histological stain for automatic analysis must be based on its classification and clustering performance, which are indicators of the performance of automatic segmentation of tissue into morphological components, which in turn may be the basis for diagnosis.

  20. Diphtheria toxin- and Pseudomonas A toxin-mediated apoptosis. ADP ribosylation of elongation factor-2 is required for DNA fragmentation and cell lysis and synergy with tumor necrosis factor-alpha.

    Science.gov (United States)

    Morimoto, H; Bonavida, B

    1992-09-15

    We have reported that diphtheria toxin (DTX) mediates target cell lysis and intranucleosomal DNA fragmentation (apoptosis) and also synergizes with TNF-alpha. In this paper, we examined which step in the pathway of DTX-mediated inhibition of protein synthesis was important for induction of cytolytic activity and for synergy. Using a DTX-sensitive tumor cell line, we first examined the activity of the mutant CRM 197, which does not catalyze the ADP ribosylation of elongation factor-2 (EF-2). CRM 197 was not cytolytic for target cells and did not mediate intranucleosomal DNA fragmentation of viable cells. The failure of CRM 197 to mediate target cell lysis suggested that the catalytic activity of DTX is prerequisite for target cell lysis. This was corroborated by demonstrating that MeSAdo, which blocks the biosynthesis of diphthamide, inhibited DTX-mediated protein synthesis inhibition and also blocked target cell lysis. Furthermore, the addition of nicotinamide, which competes with NAD+ on the DTX action site of EF-2, also blocked DTX-mediated lysis. These findings suggest that ADP-ribosylation of EF-2 may be a necessary step in the pathway leading to target cell lysis. In contrast to the sensitive line, the SKOV-3 tumor cell line is sensitive to protein synthesis inhibition by DTX but is not susceptible to cytolysis and apoptosis by DTX. Thus, protein synthesis inhibition by DTX is not sufficient to mediate target cell lysis. The synergy in cytotoxicity obtained with the combination of DTX and TNF-alpha was examined in order to determine the pathway mediated by DTX in synergy. Like the direct lysis by DTX, synergy was significantly reduced by MeSAdo and by nicotinamide. Furthermore, synergy was not observed with combination of CRM 197 and TNF-alpha. These results demonstrate that, in synergy, DTX may utilize the same pathway required for its cytolytic activity. Pseudomonas aeruginosa exotoxin shared most the properties shown for DTX. Altogether, these findings

  1. Standardization of Romanowsky stains. The relationship between stain composition and performance.

    Science.gov (United States)

    Marshall, P N; Bentley, S A; Lewis, S M

    1978-03-01

    A panel of 17 eminent haematologists has assessed the performance of 5 Romanowsky stains prepared from pure component dyes, comparing the suitability and acceptability of these stains for the preparation of routine blood and bone-marrow films. It was found that the results obtained using the stain described by Marshall et al (1975) were comparable to those obtained using a modification of the stain described by Wittekind et al (1976). The performance of the 3 other stains was less acceptable. Variations in stain formulation have been correlated with stain performance.

  2. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  3. Light microscopy with differential staining techniques for the characterisation and discrimination of insects versus marine arthropods processed animal proteins.

    Science.gov (United States)

    Ottoboni, Matteo; Tretola, Marco; Cheli, Federica; Marchis, Daniela; Veys, Pascal; Baeten, Vincent; Pinotti, Luciano

    2017-08-01

    The aim of this study was to evaluate the use of light microscopy with differential staining techniques for the discrimination of insect material from marine arthropods - classified as fishmeal. Specifically, three samples of single-species insect material, Hermetia illucens (HI), Bombyx mori (BM) and Tenebrio molitor (TM), and two samples of marine arthropods, shrimp material and krill, were analysed and compared after staining by two reagents to enhance fragment identification. Alizarin Red (AR) and Chlorazol Black (CB), which react respectively with calcium salts and chitin, were tested for their potential efficacy in distinguishing between insect and marine materials. Results indicated that AR failed to stain HI, BM and TM materials. By contrast, the three insect species materials tested were stained by CB. When shrimp fragments and krill were considered, AR and CB stained marine materials reddish-pink and light blue to black, respectively. By combining these results, it can be suggested that CB staining may efficiently be used to mark insect materials; AR does stain shrimp fragments but does not stain the tested insect material, indicating a possible approach for discriminating between insects and marine arthropods. However, since the present study was performed on pure materials and a small set of samples, possible implementation of this technique still needs to be confirmed in complex matrices such as compound feed.

  4. Crystal structure of an Okazaki fragment at 2-A resolution

    Science.gov (United States)

    Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

    1992-01-01

    In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

  5. Stained glasses under the nuclear microprobe: A window into history

    Energy Technology Data Exchange (ETDEWEB)

    Vilarigues, M. [Dep. de Conservacao e Restauro and R and D Unit Vidro e da Ceramica Para as Artes, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal)], E-mail: mgv@fct.unl.pt; Fernandes, P. [Dep. de Conservacao e Restauro and R and D Unit Vidro e da Ceramica Para as Artes, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); Alves, L.C.; Silva, R.C. da [Dep. Fisica, LFI, ITN, E.N.10, 2686-953 Sacavem (Portugal)

    2009-06-15

    Stained glass fragments from the 15th, 16th and 20th centuries, belonging to Mosteiro de Santa Maria da Vitoria, Batalha (Portugal), were characterised non-destructively in a nuclear microprobe. The work aimed at finding the composition of the glasses and glass paintings and relating these with the corresponding production periods. The elemental compositions of the glass fragments were obtained by means of scanning micro-beam Particle Induced X-ray Emission ({mu}-PIXE) spectrometry in selected cross-sections. These were complemented by micro X-Ray fluorescence spectrometry. Characterisation of colour was performed by optical absorption spectroscopy in the UV-vis range, while the corrosion products were identified by optical microscopy and {mu}-FTIR (Fourier Transform Infra Red) spectroscopy in combination with the data generated by {mu}-PIXE. Nuclear microprobe analysis allowed unveiling the compositions and structures, in particular of glass paintings and corrosion products. While it is not surprising that Fe, Cu and Pb were the main elements identified in the grisaille paintings of all studied periods, as well as Ag and Cu found in the glasses decorated with yellow silver painting, their distribution gave important clues on the materials and techniques used to manufacture these stained glasses. Furthermore, it allowed establishing a definite relation between the compositions found and the periods of production, with the added bonus of correctly reassigning the manufacturing period of some samples.

  6. Distribution of two DNA restriction fragment length polymorphisms (RFLPs) corresponding to Ag(c/g) and Ag(al/d) of the apo B gene in the Orang Asli (aborigines) of West Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Candlish, J.K.; Gajra, B; Saha, N. [National Univ. of Singapore, Kuala Lumpur (Malaysia)] [and others

    1994-09-01

    One hundred and ninety five subjects of the Semai group of Orang Asli in peninsular Malaysia were examined for the distribution of Ag(c/g) and Ag(al/d) RFLPs of the apoB gene. Regions of apoB gene corresponding to nt 421 and 1981 representing these two Ags were amplified by polymerase chain reaction using primers of published sequences. Thr{sub 71} to Ile (Ag c/g) was detected as an ApaL I RFLP and Val{sub 591} to Ala (Ag al/d) by Alu I RFLP. DNA fragments were separated by 4% agarose gel electrophoresis and photographed over a UV transilluminator. The frequencies of Ag(d) (absence of ApaL I site) and Ag(d) (presence of Alu I site) were found to be 0.13 and 0.14, respectively, in the Orang Asli compared to frequencies of 0.30 and 0.45 in the Caucasian population. Distribution of the genotypes of these two polymorphisms was at Hardy-Weinberg equiilibrium.

  7. Indirect immunofluorescence staining of cultured neural cells.

    Science.gov (United States)

    Barbierato, Massimo; Argentini, Carla; Skaper, Stephen D

    2012-01-01

    Immunofluorescence is a technique allowing the visualization of a specific protein or antigen in cells or tissue sections by binding a specific antibody chemically conjugated with a fluorescent dye such as fluorescein isothiocyanate. There are two major types of immunofluorescence staining methods: (1) direct immunofluorescence staining in which the primary antibody is labeled with fluorescence dye and (2) indirect immunofluorescence staining in which a secondary antibody labeled with fluorochrome is used to recognize a primary antibody. This chapter describes procedures for the application of indirect immunofluorescence staining to neural cells in culture.

  8. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  9. UV irradiation and autoclave treatment for elimination of contaminating DNA from laboratory consumables.

    Science.gov (United States)

    Gefrides, Lisa A; Powell, Mark C; Donley, Michael A; Kahn, Roger

    2010-02-01

    Laboratories employ various approaches to ensure that their consumables are free of DNA contamination. They may purchase pre-treated consumables, perform quality control checks prior to casework, and use in-house profile databases for contamination detection. It is better to prevent contamination prior to DNA typing than identify it after samples are processed. To this end, laboratories may UV irradiate or autoclave consumables prior to use but treatment procedures are typically based on killing microorganisms and not on the elimination of DNA. We report a systematic study of UV and autoclave treatments on the persistence of DNA from saliva. This study was undertaken to determine the best decontamination strategy for the removal of DNA from laboratory consumables. We have identified autoclave and UV irradiation procedures that can eliminate nanogram quantities of contaminating DNA contained within cellular material. Autoclaving is more effective than UV irradiation because it can eliminate short fragments of contaminating DNA more effectively. Lengthy autoclave or UV irradiation treatments are required. Depending on bulb power, a UV crosslinker may take a minimum of 2h to achieve an effective dose for elimination of nanogram quantities of contaminating DNA (>7250mJ/cm(2)). Similarly autoclaving may also take 2h to eliminate similar quantities of contaminating DNA. For this study, we used dried saliva stains to determine the effective dose. Dried saliva stains were chosen because purified DNA as well as fresh saliva are less difficult to eradicate than dried stains and also because consumable contamination is more likely to be in the form of a collection of dry cells.

  10. The nucleotide sequence of two restriction fragments located in the gene AB region of bacteriophage S13.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); J.H. Spencer

    1977-01-01

    textabstractThe nucleotide sequence of a double stranded DNA fragment from the gene AB region of bacteriophage S13 DNA has been determined. The fragment was isolated as two adjacent shorter fragments by cleavage of S13 replicative form (RF) DNA with restriction endonuclease III from Hemophilus

  11. Kaempferol induces DNA damage and inhibits DNA repair associated protein expressions in human promyelocytic leukemia HL-60 cells.

    Science.gov (United States)

    Wu, Lung-Yuan; Lu, Hsu-Feng; Chou, Yu-Cheng; Shih, Yung-Luen; Bau, Da-Tian; Chen, Jaw-Chyun; Hsu, Shu-Chun; Chung, Jing-Gung

    2015-01-01

    Numerous evidences have shown that plant flavonoids (naturally occurring substances) have been reported to have chemopreventive activities and protect against experimental carcinogenesis. Kaempferol, one of the flavonoids, is widely distributed in fruits and vegetables, and may have cancer chemopreventive properties. However, the precise underlying mechanism regarding induced DNA damage and suppressed DNA repair system are poorly understood. In this study, we investigated whether kaempferol induced DNA damage and affected DNA repair associated protein expression in human leukemia HL-60 cells in vitro. Percentages of viable cells were measured via a flow cytometry assay. DNA damage was examined by Comet assay and DAPI staining. DNA fragmentation (ladder) was examined by DNA gel electrophoresis. The changes of protein levels associated with DNA repair were examined by Western blotting. Results showed that kaempferol dose-dependently decreased the viable cells. Comet assay indicated that kaempferol induced DNA damage (Comet tail) in a dose-dependent manner and DAPI staining also showed increased doses of kaempferol which led to increased DNA condensation, these effects are all of dose-dependent manners. Western blotting indicated that kaempferol-decreased protein expression associated with DNA repair system, such as phosphate-ataxia-telangiectasia mutated (p-ATM), phosphate-ataxia-telangiectasia and Rad3-related (p-ATR), 14-3-3 proteins sigma (14-3-3σ), DNA-dependent serine/threonine protein kinase (DNA-PK), O(6)-methylguanine-DNA methyltransferase (MGMT), p53 and MDC1 protein expressions, but increased the protein expression of p-p53 and p-H2AX. Protein translocation was examined by confocal laser microscopy, and we found that kaempferol increased the levels of p-H2AX and p-p53 in HL-60 cells. Taken together, in the present study, we found that kaempferol induced DNA damage and suppressed DNA repair and inhibited DNA repair associated protein expression in HL-60

  12. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  13. Vitrification of neat semen alters sperm parameters and DNA integrity.

    Science.gov (United States)

    Khalili, Mohammad Ali; Adib, Maryam; Halvaei, Iman; Nabi, Ali

    2014-05-06

    Our aim was to evaluate the effect of neat semen vitrification on human sperm vital parameters and DNA integrity in men with normal and abnormal sperm parameters. Semen samples were 17 normozoospermic samples and 17 specimens with abnormal sperm parameters. Semen analysis was performed according to World Health Organization (WHO) criteria. Then, the smear was provided from each sample and fixed for terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining. Vitrification of neat semen was done by plunging cryoloops directly into liquid nitrogen and preserved for 7 days. The samples were warmed and re-evaluated for sperm parameters as well as DNA integrity. Besides, the correlation between sperm parameters and DNA fragmentation was assessed pre- and post vitrification. Cryopreserved spermatozoa showed significant decrease in sperm motility, viability and normal morphology after thawing in both normal and abnormal semen. Also, the rate of sperm DNA fragmentation was significantly higher after vitrification compared to fresh samples in normal (24.76 ± 5.03 and 16.41 ± 4.53, P = .002) and abnormal (34.29 ± 10.02 and 23.5 ± 8.31, P neat ejaculates has negative impact on sperm parameters as well as DNA integrity, particularly among abnormal semen subjects. It is, therefore, recommend to process semen samples and vitrify the sperm pellets.

  14. Evaluation of gram stain as an alternative in the assessment of human spermatozoa quality.

    Science.gov (United States)

    Mantas, D; Msaouel, P; Angelopoulou, R

    2006-01-01

    During spermiogenesis, protaminosis and sperm chromatin condensation are important prerequisites for the preservation of DNA integrity in spermatozoa. The aim of this study is to assess Gram stain as an alternative technique for the evaluation of human sperm chromatin condensation status. Aniline blue and Gram staining were applied to semen samples from 34 donors in order to determine the relationship between sperm chromatin condensation and infertility. In addition, the possible correlation between morphology and vitality (eosin-Y staining) of spermatozoa compared with their nuclear status (aniline blue and Gram staining) was studied. Chromatin condensation and sperm vitality were significantly higher in fertile men compared to the subfertile. A significant correlation was found between chromatin condensation and (a) sperm vitality (p Gram staining may be used as a routine method in assisted reproduction laboratories and could assist in the evaluation of sperm quality as well as in the selection of the appropriate fertilization technique.

  15. Standard specimens for stain calibration: application to Romanowsky-Giemsa staining.

    Science.gov (United States)

    Turner, J N; Weir, B; Collins, D N

    1990-01-01

    Standardized specimens with reproducible staining properties were fabricated from extracts of biological objects (bovine liver, nucleoprotamine and defatted muscle). The standard specimens were stained with two formulations of the Romanowsky-Giemsa stain (RG), using the same azure B and eosin Y. One formulation used methanol and Sorensen's buffer and the other DMSO and Hepes buffer as solvents. The standard specimens were stained either in the composite stain or in the individual dyes dissolved in the same solvents and at the same concentration as the composite stain. Solution spectroscopy demonstrated different spectra for the two formulations with some wavelength regions varying by more than an order of magnitude. The RG spectra were also very different from those of the individual dyes dissolved at the RG concentration in the respective solvents. The stained standard specimens were analyzed by microspectrophotometry and were found to have spectra similar to those of cell smears. Furthermore, the standard specimens were shown to be a repeatable substrate for stain uptake. The transmitted light intensity from random fields of the same standardized specimen varied +/- 5%. When specimens were stained at the same time, the specimen-to-specimen variation depended on preparation conditions and the measurement wavelength, but was as good as +/- 5% for some conditions. The quantitative stain performance of both formulations was studied and compared. The standardized specimens provide a tool for the quantitative study of staining processes and specimen preparation procedures and for stain calibration.

  16. Multicenter Assessment of Gram Stain Error Rates.

    Science.gov (United States)

    Samuel, Linoj P; Balada-Llasat, Joan-Miquel; Harrington, Amanda; Cavagnolo, Robert

    2016-06-01

    Gram stains remain the cornerstone of diagnostic testing in the microbiology laboratory for the guidance of empirical treatment prior to availability of culture results. Incorrectly interpreted Gram stains may adversely impact patient care, and yet there are no comprehensive studies that have evaluated the reliability of the technique and there are no established standards for performance. In this study, clinical microbiology laboratories at four major tertiary medical care centers evaluated Gram stain error rates across all nonblood specimen types by using standardized criteria. The study focused on several factors that primarily contribute to errors in the process, including poor specimen quality, smear preparation, and interpretation of the smears. The number of specimens during the evaluation period ranged from 976 to 1,864 specimens per site, and there were a total of 6,115 specimens. Gram stain results were discrepant from culture for 5% of all specimens. Fifty-eight percent of discrepant results were specimens with no organisms reported on Gram stain but significant growth on culture, while 42% of discrepant results had reported organisms on Gram stain that were not recovered in culture. Upon review of available slides, 24% (63/263) of discrepant results were due to reader error, which varied significantly based on site (9% to 45%). The Gram stain error rate also varied between sites, ranging from 0.4% to 2.7%. The data demonstrate a significant variability between laboratories in Gram stain performance and affirm the need for ongoing quality assessment by laboratories. Standardized monitoring of Gram stains is an essential quality control tool for laboratories and is necessary for the establishment of a quality benchmark across laboratories. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  17. Analysis of the utility of stone gram stain in urolithiasis treated with percutaneous nephrolithotomy.

    Science.gov (United States)

    Cockerill, Patrick A; Rivera, Marcelino E; Krambeck, Amy E

    2014-06-01

    To define the sensitivity and specificity of stone gram stain for infected urolithiasis treated with percutaneous nephrolithotomy (PCNL). PCNL procedures performed at our institution were analyzed between January 2009 and May 2013. Stone fragments were sent in a sterile fashion for aerobic and fungal cultures. A gram stain and fungal smear were performed on the stones and reported within 24 hours of collection. A total of 228 patients underwent 248 PCNLs. Of the 248 stones, 81 (33%) had a positive stone culture. Stone gram stain was positive in 31 cases and negative in 50. There were 167 negative stone cultures, and in these cases, gram stain was positive in 5 and negative in 162. The calculated sensitivity and specificity of stone gram stain were 38% and 97%. The positive and negative predictive values were 86% and 76%, respectively. In the subset of 16 patients with positive stone fungal cultures, fungal smear was performed in 12 and was positive in 4, giving fungal smear a sensitivity of 33%. The results of this study suggest that stone gram stain cannot be relied on to detect a positive stone culture and may fail to detect up to 62% of infected stones. However, when positive, gram stain accurately predicts a positive stone culture in 86% of cases. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. DNA-electrophoresis of single cells - a method to screen for irradiated foodstuffs

    International Nuclear Information System (INIS)

    Leffke, A.; Helle, N.; Boegl, K.W.; Schreiber, G.A.

    1993-01-01

    Microelectrophoresis of single cells can be used to detect γ-irradiation over a wide dose range and for a variety of products. It is a simple and rapid test for DNA damages and can be used for screening. The method was tested on cell suspensions of bone marrow and muscle cells from frozen chicken legs, chicken heart, turkey liver, beef and pork irradiated with doses up to 3 kGy. Cell suspensions were prepared by incubation of tissues in EDTA-SDS-buffer at pH 8. Single cell electrophoresis was performed in 0.75% agarose gel. DNA was visualised by silver staining. In unirradiated samples no or only a small amount of DNA penetrated the cell membranes. Cells of irradiated samples appeared like a ''comet'' due to to migration of DNA-fragments out of cell. (orig.)

  19. Sperm viability assessment in marine invertebrates by fluorescent staining and spectrofluorimetry: A promising tool for assessing marine pollution impact.

    Science.gov (United States)

    Gallo, Alessandra; Boni, Raffaele; Tosti, Elisabetta

    2018-01-01

    The viability of spermatozoa is a crucial parameter to evaluate their quality that is an important issue in ecotoxicological studies. Here, a new method has been developed to rapidly determine the viability of spermatozoa in three marine invertebrates: the ascidian Ciona intestinalis, the sea urchin Paracentrotus lividus and the mollusc Mytilus galloprovincialis. This method employed the dual DNA fluorescent staining coupled with spectrofluorimetric analysis. The dual fluorescent staining used the SYBR-14 stained live spermatozoa and propidium iodide stained degenerated cells that had lost membrane integrity. Stain uptake was assessed by confocal microscopy and then the percentage of live and dead spermatozoa was quantified by spectrofluorimetric analysis. The microscopic examination revealed three populations of spermatozoa: living-SYBR-14 stained, dead-PI stained, and dying-doubly stained spermatozoa. The fluorescence emission peak values recorded in a spectrofluorimeter provide the portion of live and dead spermatozoa showing a significant negative correlation. The stain combination was further validated using known ratios of live and dead spermatozoa. The present study demonstrated that the dual DNA staining with SYBR-14 and propidium iodide was effective in assessing viability of spermatozoa in marine invertebrates and that spectrofluorimetric analysis can be successfully employed to evaluate the percentage of live and dead spermatozoa. The method develop herein is simple, accurate, rapid, sensitive, and cost-effective, so it could be a useful tool by which marine pollutants may be screened for spermiotoxicity. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Ultraviolet absorption detection of DNA in gels

    International Nuclear Information System (INIS)

    Mahon, A.R.

    1998-01-01

    A method and apparatus for the detection and quantification of large fragments of unlabelled deoxyribonucleic acid (DNA) in agarose gels is presented. The technique is based on ultra-violet (UV) absorption by nucleotides. A deuterium lamp was used to illuminate regions of an electrophoresis gel. As DNA bands passed through the illuminated region of the gel the amount of UV light transmitted was reduced due to DNA absorption. Two detection systems were investigated. In the first system, synthetic chemical vapour deposition (CVD) diamond strip detectors were used to locate regions of DNA in the gels by detecting the transmitted light. CVD diamond has a high indirect band gap of 5.45 eV and is therefore sensitive to UV photons of wavelengths < 224 nm. A number of CVD diamond samples were characterised to investigate their suitability as detectors for this application. The detectors' quantum efficiency, UV response and time response were measured. DNA bands containing as little as 20 ng were detected by the diamond. In a second system, a deuterium lamp was used to illuminate individual sample lanes of an electrophoresis gel via an array of optical fibres. During electrophoresis the regions of DNA were detected with illumination at 260 nm, using a UV-sensitive charge coupled device (CCD). As the absorption coefficient of a DNA sample is approximately proportional to its mass, the technique is inherently quantitative. This system had a detection limit of 0.25 ng compared with 2-10 ng for the most popular conventional technique, ethidium bromide (EtBr) staining. Using this detection technique, the DNA sample remains in its native state. The removal of carcinogenic dyes from the detection procedure greatly reduces associated biological hazards. (author)

  1. Purified azure B as a reticulocyte stain.

    Science.gov (United States)

    Marshall, P N; Bentley, S A; Lewis, S M

    1976-01-01

    A comparison has been made between reticulocyte preparations stained with purified azure B and with several commerically available batches of brilliant cresyl blue and new methylene blue. Marked variations were observed in the composition and staining performances of the various batches of the two commerically available dyes. Although there were no significant differences in reticulocyte counts obtained with these two dyes, varying amounts of an extraneous, particulate dye deposit were present in these preparations, making accuracte counting both tedious and timeconsuming. Purified azure B, on the other hand, gave reproducibly stained, deposit-free preparations. Reticulocyte counts obtained from azure B preparations correlated almost exactly with those determined using new methylene blue. Purified azure B is therefore recommended as a convenient reticulocyte stain for routine use. Images PMID:64475

  2. Research on pre-staining gel electrophoresis

    International Nuclear Information System (INIS)

    Zhong Ruibo; Liu Yushuang; Zhang Ping; Liu Jingran; Zhao Guofen; Zhang Feng

    2014-01-01

    Background: Gel electrophoresis is a powerful biochemical separation technique. Most biological molecules are completely transparent in the visible region of light, so it is necessary to use staining to show the results after gel electrophoresis, and the general steps of conventional staining methods are time-consuming. Purpose: We try to develop a novel approach to simplify the gel electrophoresis: Pre-Staining Gel Electrophoresis (PSGE), which can make the gel electrophoresis results monitored in real time. Methods: Pre-stain the protein samples with Coomassie Brilliant Blue (CBB) for 30 min before loading the sample into the gel well. Results and Conclusion: PSGE can be successfully used to analyze the binding efficiency of Bovine Serum Albumin (BSA) and amphiphilic polymer via chemical coupling and physical absorption, and the double PSGE also shows a great potential in bio-analytical chemistry. (authors)

  3. Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

    Science.gov (United States)

    Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

    2016-01-01

    Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample

  4. New restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus.

    Science.gov (United States)

    Semighini, C P; Delmas, G; Park, S; Amstrong, D; Perlin, D; Goldman, G H

    2001-07-01

    In this study, we isolated and tested restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus based on PCR products amplified by the random amplified polymorphic DNA (RAPD) primer R108. Four DNA fragments, Afd, Af5, Af4, and Af4A, were amplified. Fragments Afd and Af5 were 85% and 88% identical at the DNA level to part of the Afut1 retrotransposon from A. fumigatus. Fragment Af4A is a duplication of fragment Af4 and both showed similarity at the amino acid level with endonucleases from other fungal retrotransposons. We used both RAPD with primer R108 and RFLP assays with Afut1, Afd, and Af4A, to determine the genetic relatedness of clinical isolates of A. fumigatus isolated sequentially from four patients colonized with A. fumigatus. The combination of these different methods suggested that the isolates infecting the four patients were not identical.

  5. Comparison of algorithms for blood stain detection applied to forensic hyperspectral imagery

    Science.gov (United States)

    Yang, Jie; Messinger, David W.; Mathew, Jobin J.; Dube, Roger R.

    2016-05-01

    Blood stains are among the most important types of evidence for forensic investigation. They contain valuable DNA information, and the pattern of the stains can suggest specifics about the nature of the violence that transpired at the scene. Early detection of blood stains is particularly important since the blood reacts physically and chemically with air and materials over time. Accurate identification of blood remnants, including regions that might have been intentionally cleaned, is an important aspect of forensic investigation. Hyperspectral imaging might be a potential method to detect blood stains because it is non-contact and provides substantial spectral information that can be used to identify regions in a scene with trace amounts of blood. The potential complexity of scenes in which such vast violence occurs can be high when the range of scene material types and conditions containing blood stains at a crime scene are considered. Some stains are hard to detect by the unaided eye, especially if a conscious effort to clean the scene has occurred (we refer to these as "latent" blood stains). In this paper we present the initial results of a study of the use of hyperspectral imaging algorithms for blood detection in complex scenes. We describe a hyperspectral imaging system which generates images covering 400 nm - 700 nm visible range with a spectral resolution of 10 nm. Three image sets of 31 wavelength bands were generated using this camera for a simulated indoor crime scene in which blood stains were placed on a T-shirt and walls. To detect blood stains in the scene, Principal Component Analysis (PCA), Subspace Reed Xiaoli Detection (SRXD), and Topological Anomaly Detection (TAD) algorithms were used. Comparison of the three hyperspectral image analysis techniques shows that TAD is most suitable for detecting blood stains and discovering latent blood stains.

  6. New Grocott Stain without Using Chromic Acid

    International Nuclear Information System (INIS)

    Shiogama, Kazuya; Kitazawa, Kayo; Mizutani, Yasuyoshi; Onouchi, Takanori; Inada, Ken-ichi; Tsutsumi, Yutaka

    2015-01-01

    We established a new “ecological” Grocott stain for demonstrating fungi, based upon a 4R principle of refusal, reduction, reuse, and recycle of waste management. Conventional Grocott stain employs environmentally harsh 5% chromic acid for oxidization. Initially, we succeeded in reducing the concentration of chromic acid from 5% to 1% by incubating the solution at 60°C and using five-fold diluted chromic acid solution at which point it was reusable. Eventually, we reached the refusal level where 1% periodic acid oxidization was efficient enough, when combined with preheating of sections in the electric jar, microwave oven, or pressure pan. For convenience sake, we recommend pressure pan heating in tap water for 10 min. Stainability of fungi in candidiasis and aspergillosis was comparable with conventional Grocott stain, while Mucor hyphae showed enhanced staining. The modified sequence was further applicable to detecting a variety of mycotic pathogens in paraffin sections. Our environmentally-friendly Grocott stain also has the advantage of avoiding risk of human exposure to hexavalent chromium solution in the histopathology laboratory. The simple stain sequence is can be easily applied worldwide

  7. Stain Removal Assessment of Two Manual Toothbrushes with an Interproximal Tooth Stain Index.

    Science.gov (United States)

    Farrell, Svetlana; Grender, Julie M; Terézhalmy, Geza; Archila, Luis R

    2015-01-01

    To assess a newly developed index to measure interproximal stain and evaluate the stain removal efficacy of two commercially available manual toothbrushes. This was a randomized, examiner-blind, parallel-group, two-treatment clinical trial of two weeks' duration. Subjects qualified for the study if they had an average Modified Lobene Stain Index of ≥ 1.5 from two anterior teeth. At baseline, subjects brushed in front of a mirror for one minute under supervision. All subjects were provided with a standard 0.243% sodium fluoride dentifrice and were randomly assigned either an Oral-B Pulsar manual brush (OBP) or a Colgate Whitening manual brush (CW) to use for two weeks. Stain was reassessed after two weeks of product use. Stain measurements were conducted using the Modified Lobene Stain Index and the new Interproximal Modified Lobene Stain Index, which allows for assessment of stain in hard-to-reach areas using the same area and intensity scales as the Modified Lobene Stain Index. Use of the two manual brushes resulted in statistically significant reductions in surface stain relative to baseline after two weeks of use. Median stain reductions were 78% and 60% for the OBP and CW, respectively, as measured by the Modified Lobene Stain Index. The mean changes in the composite scores from baseline to week two were 1.85 and 1.57 for the two treatment groups, respectively. Statistically significant reductions from baseline were also found for the intensity and extent of stain measures (p brush and 83% reduction with the CW brush. For the gingival sites, the median stain removal percentages were 83% and 50%, respectively For the body region, a median stain removal of 100% was found for both treatment groups. No statistically significant differences were found between the two groups for the mean composite scores for either index. Both manual brushes showed effective stain removal, including interproximal hard-to-reach sites. The Interproximal Modified Lobene Stain Index

  8. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  9. A Study on Campylobacter jejuni and Campylobacter coli through Commercial Broiler Production Chains in Thailand: Antimicrobial Resistance, the Characterization of DNA Gyrase Subunit A Mutation, and Genetic Diversity by Flagellin A Gene Restriction Fragment Length Polymorphism.

    Science.gov (United States)

    Thomrongsuwannakij, Thotsapol; Blackall, Patrick J; Chansiripornchai, Niwat

    2017-06-01

    Contaminated poultry meat is regarded as the main source of human campylobacteriosis. During September 2014 and February 2015, breeder flocks, hatcheries, and broiler farms from two chicken production chains were investigated chronologically. Five commercial breeder flocks (Breeder Flocks 1-5), two hatcheries (Hatcheries A and B), and five broiler flocks (Broiler Flocks 1-5) were sampled in this study. Campylobacter colonization of both breeder and broiler flocks was determined from cloacal swabs and environmental samples (pan feeders, footwear, darkling beetles, flies, feed, and water). The eggs from the breeder flocks were followed to hatcheries. At the hatcheries, early embryonic deaths, egg trays, eggshells, hatchers, and water were investigated. Cloacal swabs were taken from broilers at Days 1, 14, and 28 (all broiler flocks), and either 35 (Broiler Flocks 1 and 2) or 43 (Broiler Flocks 3-5). Thirty-six Campylobacter jejuni and 94 Campylobacter coli isolates collected through two broiler production chains were tested by twofold agar dilution for their susceptibility to antimicrobial agents. Most Campylobacter isolates were multidrug resistant (MDR), defined as being resistant to three or more antimicrobial classes ( C. jejuni : 100%; C. coli : 98.9%), and exhibited high resistance to enrofloxacin ( C. jejuni : 100%; C. coli : 98.9%). The vast majority of C. coli were resistant to tetracycline (97.9%), trimethoprim-sulfamethoxazole (81.9%), and doxycycline (79.8%), but only 55.6%, 36.1%, and 50% of C. jejuni isolates revealed resistance to these antimicrobial agents, respectively. A selected subset of 24 C. jejuni and 24 C. coli were characterized for their mutations in the quinolone resistance determining region of the DNA gyrase subunit A gene by nucleotide sequence analysis. The Thr-86-Ile substitution (ACA-ATA in C. jejuni or ACT-ATT in C. coli ) was found in all isolates. Moreover, a total of 130 Campylobacter isolates were typed with the use of polymerase

  10. Potential Value of YAP Staining in Rhabdomyosarcoma.

    Science.gov (United States)

    Ahmed, Atif A; Habeebu, Sultan S; Sherman, Ashley K; Ye, Shui Q; Wood, Nicole; Chastain, Katherine M; Tsokos, Maria G

    2018-03-01

    Rhabdomyosarcoma (RMS) is a common malignancy of soft tissue, subclassified as alveolar (ARMS), pleomorphic (PRMS), spindle cell/sclerosing (SRMS), and embryonal (ERMS) types. The Yes-associated protein (YAP) is a member of the Hippo pathway and a transcriptional regulator that controls cell proliferation. We have studied the immunohistochemical expression of YAP in different RMSs, arranged in tissue microarray (TMA) and whole slide formats. Pertinent clinical data including patient age, gender, tumor location, and clinical stage were collected. Out of 96 TMA cases, 30 cases (31%) were pleomorphic, 27 (28%) were embryonal, 24 (25%) alveolar, and 15 (16%) spindle cell. Positive nuclear YAP staining was seen in the PRMS (17/30, 56.7%), SRMS (7/15, 46.7%), ERMS (19/27 or 70%), and less in ARMS (37.5%). YAP nuclear staining was significantly more prevalent in ERMS than ARMS ( p=0.02). Of the 41 whole slide cases, nuclear staining was detected in all ARMS but was restricted in distribution to 30% staining. These results highlight the role of YAP in RMS tumorigenesis, a fact that can be useful in engineering targeted therapy. Restricted nuclear YAP staining (<30% of cells) may be of value in the diagnosis of ARMS.

  11. Detection of the irradiation treatment of foods using micro gel electrophoresis of DNA

    International Nuclear Information System (INIS)

    Delincee, H.

    1993-01-01

    Ionizing radiation has profound effects on nucleic acids, reflected by e.g. base damage and strandbreaks. These effects of radiation contribute to the aim of food irradiation: undesirable microorganisms are inactivated, insect infestation eliminated, sprouting inhibited or ripening delayed. It is, therefore, conceivable that methods of detection of a radiation treatment could be based on changes in DNA, either in microbes or insects or in the food itself. A promising method of detecting DNA fragments in irradiated food is the microelectrophoresis of single cells. Advantages of the method are its simplicity and its speed, the electrophoretic separation only requiring 2.5-5 minutes. The principle is based on migration of DNA in an agarose gel exposed to an electric field. Single cells or nuclei are embedded in the agarose and after lysis intact DNA will practically not move upon electrophoresis, due to the gel strains, whereas if DNA fragmentation has occurred, the DNA is able to migrate and ''comets'' following the cells or nuclei become visible after staining. This paper describes our experience obtained by analyzing chicken, beef and pork meat, shrimps and mushrooms. The method therefore has its limitations, although good results both from frozen and fresh meats, fresh fish, onions and potatoes have been reported. Also strawberries have been identified using this technique. Further experience may strengthen the evidence that this simple and cheap technique may have its place among the battery of tests to detect the radiation treatment of foods. (orig./vhe)

  12. Adversarial Stain Transfer for Histopathology Image Analysis.

    Science.gov (United States)

    Bentaieb, Aicha; Hamarneh, Ghassan

    2018-03-01

    It is generally recognized that color information is central to the automatic and visual analysis of histopathology tissue slides. In practice, pathologists rely on color, which reflects the presence of specific tissue components, to establish a diagnosis. Similarly, automatic histopathology image analysis algorithms rely on color or intensity measures to extract tissue features. With the increasing access to digitized histopathology images, color variation and its implications have become a critical issue. These variations are the result of not only a variety of factors involved in the preparation of tissue slides but also in the digitization process itself. Consequently, different strategies have been proposed to alleviate stain-related tissue inconsistencies in automatic image analysis systems. Such techniques generally rely on collecting color statistics to perform color matching across images. In this work, we propose a different approach for stain normalization that we refer to as stain transfer. We design a discriminative image analysis model equipped with a stain normalization component that transfers stains across datasets. Our model comprises a generative network that learns data set-specific staining properties and image-specific color transformations as well as a task-specific network (e.g., classifier or segmentation network). The model is trained end-to-end using a multi-objective cost function. We evaluate the proposed approach in the context of automatic histopathology image analysis on three data sets and two different analysis tasks: tissue segmentation and classification. The proposed method achieves superior results in terms of accuracy and quality of normalized images compared to various baselines.

  13. Detection Of Concrete Deterioration By Staining

    Science.gov (United States)

    Guthrie, Jr., George D.; Carey, J. William

    1999-09-21

    A method using concentrated aqueous solutions of sodium cobaltinitrite and a rhodamine dye is described which can be used to identify concrete that contains gels formed by the alkali-silica reaction (ASR), and to identify degraded concrete which results in a porous or semi-permeable paste due to carbonation or leaching. These solutions present little health or environmental risk, are readily applied, and rapidly discriminate between two chemically distinct gels; K-rich, Na--K--Ca--Si gels are identified by yellow staining, and alkali-poor, Ca--Si gels are identified by pink staining.

  14. News from the biological stain commission

    DEFF Research Database (Denmark)

    Kiernan, J.A.; Lyon, Hans Oluf

    2008-01-01

    In the three earlier editions of News from the Biological Stain Commission (BSC), under the heading of "Regulatory affairs," the BSC's International Affairs Committee reported on the work of Technical Committee 212, Clinical Laboratory Testing and in Vitro Diagnostic Test Systems of the Internati......In the three earlier editions of News from the Biological Stain Commission (BSC), under the heading of "Regulatory affairs," the BSC's International Affairs Committee reported on the work of Technical Committee 212, Clinical Laboratory Testing and in Vitro Diagnostic Test Systems...

  15. Identification of Cyclospora cayetanensis in stool using different stains.

    Science.gov (United States)

    Negm, A Y

    1998-08-01

    Cyclospora cayetanensis, a newly emerging coccidian protozoa is world-wide in distribution. In the present study, different concentrations and staining techniques were used for identification of Cyclospora. Formol-ether sedimentation and Sheather's sugar flotation were used as concentration techniques and the different stains used were: the modified Ziehl-Neelsen, Giemsa, safranin-methylene blue, modifications of trichrome stain, calcoflour white and finally phenol-auramine. The safranin stain was the best, as it stained all the oocysts of Cyclospora uniformly, besides being rapid and easily applicable in the laboratories. Phenol-auramine stained the oocysts well, where both the wall and internal contents fluoresced brightly. With the calcoflour white stain, only the wall of oocysts took that fluorescent stain. The modified Ziehl-Neelsen stained some of the oocysts well, yet great variability in the staining pattern was noticed. Cyclospora oocysts were not efficiently stained with either trichrome modifications or Giemsa stains.

  16. Simple and cost effective apparatus for silver staining of polyacrylamide gels with sequential reagents addition and real time monitoring.

    Science.gov (United States)

    Maurye, Praveen; Basu, Arpita; Gupta, Angshuman

    2014-06-01

    Highly reproducible results in molecular biology depend a lot on effective staining and destaining methods. Silver staining of polyacrylamide DNA and protein gel has been adopted widely in the molecular biology laboratories for detecting a very low nanogram range of sample. An efficient staining of a polyacrylamide gel requires a number of well controlled and highly sensitive steps that often becomes tiresome when done manually or when there are a number of gels to be stained simultaneously. Since, silver staining is a multistep procedure that requires proper fixation and exchange of substance, a reliable protocol is necessary and a simple apparatus may be an added advantage to carry out the steps with ease and safety. Here, we describe a simple and cost effective device made from off-the-shelf components for some established silver staining protocols. Staining is done on a tray while six graduated bottles with a liquid delivery stopcock each, is connected to the tray through silicon tubing. The used up solution is drained off completely from the staining tray through a liquid outlet stopcock using vacuum pressure. The system is fixed with a camera connected to a computer for effective control of the staining process in each step. The apparatus provides the researchers with efficient staining and real time monitoring of gels without the need for handling toxic chemicals. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  18. Composition and immuno-stimulatory properties of extracellular DNA from mouse gut flora.

    Science.gov (United States)

    Qi, Ce; Li, Ya; Yu, Ren-Qiang; Zhou, Sheng-Li; Wang, Xing-Guo; Le, Guo-Wei; Jin, Qing-Zhe; Xiao, Hang; Sun, Jin

    2017-11-28

    To demonstrate that specific bacteria might release bacterial extracellular DNA (eDNA) to exert immunomodulatory functions in the mouse small intestine. Extracellular DNA was extracted using phosphate buffered saline with 0.5 mmol/L dithiothreitol combined with two phenol extractions. TOTO-1 iodide, a cell-impermeant and high-affinity nucleic acid stain, was used to confirm the existence of eDNA in the mucus layers of the small intestine and colon in healthy Male C57BL/6 mice. Composition difference of eDNA and intracellular DNA (iDNA) of the small intestinal mucus was studied by Illumina sequencing and terminal restriction fragment length polymorphism (T-RFLP). Stimulation of cytokine production by eDNA was studied in RAW264.7 cells in vitro . TOTO-1 iodide staining confirmed existence of eDNA in loose mucus layer of the mouse colon and thin surface mucus layer of the small intestine. Illumina sequencing analysis and T-RFLP revealed that the composition of the eDNA in the small intestinal mucus was significantly different from that of the iDNA of the small intestinal mucus bacteria. Illumina Miseq sequencing showed that the eDNA sequences came mainly from Gram-negative bacteria of Bacteroidales S24-7. By contrast, predominant bacteria of the small intestinal flora comprised Gram-positive bacteria. Both eDNA and iDNA were added to native or lipopolysaccharide-stimulated Raw267.4 macrophages, respectively. The eDNA induced significantly lower tumor necrosis factor-α/interleukin-10 (IL-10) and IL-6/IL-10 ratios than iDNA, suggesting the predominance for maintaining immune homeostasis of the gut. Our results indicated that degraded bacterial genomic DNA was mainly released by Gram-negative bacteria, especially Bacteroidales-S24-7 and Stenotrophomonas genus in gut mucus of mice. They decreased pro-inflammatory activity compared to total gut flora genomic DNA.

  19. Photoacoustic imaging of port-wine stains

    NARCIS (Netherlands)

    Kolkman, Roy G. M.; Mulder, Miranda J.; Glade, Conrad P.; Steenbergen, Wiendelt; van Leeuwen, Ton G.

    2008-01-01

    BACKGROUND AND OBJECTIVE: To optimize laser therapy of port-wine stains (PWSs), information about the vasculature as well as lesion depth is valuable. In this study we investigated the use of photoacoustic imaging (PAI) to obtain this information. STUDY DESIGN/MATERIALS AND METHODS: PAI uses pulsed

  20. Photoacoustic Imaging of Port-Wine Stains

    NARCIS (Netherlands)

    Kolkman, R.G.M.; Mulder, M.J.; Mulder, Miranda J.; Glade, Conrad P.; Steenbergen, Wiendelt; van Leeuwen, Ton

    2008-01-01

    Background and Objective: To optimize laser therapy of port-wine stains (PWSs), information about the vasculature as well as lesion depth is valuable. In this study we investigated the use of photoacoustic imaging (PAI) to obtain this information. - Study Design/Materials and Methods: PAI uses

  1. A comparative assessment of commonly employed staining ...

    African Journals Online (AJOL)

    Following an increase in the number of reports of Cryptosporidium infections and the problems encountered in detecting these organisms in faecal smears, a comparative assessment of a modification of the Sheather's flotation technique and other commonly employed staining procedures proved the modified Sheather's ...

  2. A comparative assessment of commonly employed staining ...

    African Journals Online (AJOL)

    1991-03-16

    Mar 16, 1991 ... methylene blue;8 fluorescence (auramine-phenoI9 and direct immunofluorescence1o. • ll. ); negative staining (periodic acid-. Schiff12. ); and flotation (Sheather's ..... using a direct immunofluorescence assay. Pediatr Infect Dis 1986; 5: 139-142. 12. Horen WP. Detection of Cryptosporidium in human faecal ...

  3. The Language of Stained-Glass Windows

    Science.gov (United States)

    Brew, Charl Anne

    2010-01-01

    The splendor and beauty of stained glass punctuates any room. In this article, the author describes a cross-curriculum project which incorporated the French classes' research and written study of France in the Middle Ages. For the project the author suggested Sainte-Chapelle which is considered a reliquary and was built by Louis IX to house the…

  4. Corneal staining after treatment with topical tetracycline

    NARCIS (Netherlands)

    Lapid-Gortzak, Ruth; Nieuwendaal, Carla P.; Slomovic, Allan R.; Spanjaard, Lodewijk

    2006-01-01

    PURPOSE: The purpose of this paper is to report a case of corneal staining after treatment with topical tetracycline. METHODS: A patient with crystalline keratopathy caused by Streptococcus viridans after corneal transplantation was treated topically with tetracycline eye drops, based on results of

  5. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  6. Fragmented Work Stories

    DEFF Research Database (Denmark)

    Humle, Didde Maria; Reff Pedersen, Anne

    2015-01-01

    , edited and performed by the storyteller in an ongoing process allowing tensions, discontinuities and editing between failures and achievements, between dreams and work realities and between home and work life. We argue that by including different types of fragmentation, we offer a new type......Following a strand of narrative studies pointing to the living conditions of storytelling and the micro-level implications of working within fragmented narrative perspectives, this article contributes to narrative research on work stories by focusing on how meaning is created from fragmented...... stories. We argue that meaning by story making is not always created by coherence and causality; meaning is created by different types of fragmentation: discontinuities, tensions and editing. The objective of this article is to develop and advance antenarrative practice analysis of work stories...

  7. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  8. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  9. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  10. Application of DNA comet assay for detection of radiation treatment of grams and pulses.

    Science.gov (United States)

    Khan, Hasan M; Khan, Ashfaq A; Khan, Sanaullah

    2011-12-01

    Several types of whole pulses (green lentils, red lentils, yellow lentils, chickpeas, green peas, cowpeas and yellow peas) and grams (black grams, red grams and white grams) have been investigated for the identification of radiation treatment using microgel electrophoresis of single cells (DNA comet assay). Pulses and grams were exposed to the radiation doses of 0.5, 1.0 and 5 kGy covering the legalized commercial dose range for protection from insect/pest infestations. All irradiated samples showed comet like stretching of fragmented DNA toward anode, which is expected for irradiated samples. Unirradiated samples showed many intact cells/nuclei in form of round stains or with short faint tails, which is typical for unirradiated food samples. The study shows that DNA comet assay can be used as a rapid, inexpensive and highly effective screening test for the detection of radiation treatment of foods, like pulses and grams.

  11. Fragment Length Distributions and Collision Probabilities for AFLP Markers

    NARCIS (Netherlands)

    Gort, G.; Koopman, W.J.M.; Stein, A.

    2006-01-01

    AFLP is a DNA fingerprinting technique frequently used in plant and animal sciences. A drawback of the technique is the occurrence of multiple DNA fragments of the same length in a single AFLP lane, which we name a collision. In this article we quantify the problem. The well-known birthday problem

  12. Histological staining methods preparatory to laser capture microdissection significantly affect the integrity of the cellular RNA

    Directory of Open Access Journals (Sweden)

    Li Ming-Chung

    2006-04-01

    Full Text Available Abstract Background Gene expression profiling by microarray analysis of cells enriched by laser capture microdissection (LCM faces several technical challenges. Frozen sections yield higher quality RNA than paraffin-imbedded sections, but even with frozen sections, the staining methods used for histological identification of cells of interest could still damage the mRNA in the cells. To study the contribution of staining methods to degradation of results from gene expression profiling of LCM samples, we subjected pellets of the mouse plasma cell tumor cell line TEPC 1165 to direct RNA extraction and to parallel frozen sectioning for LCM and subsequent RNA extraction. We used microarray hybridization analysis to compare gene expression profiles of RNA from cell pellets with gene expression profiles of RNA from frozen sections that had been stained with hematoxylin and eosin (H&E, Nissl Stain (NS, and for immunofluorescence (IF as well as with the plasma cell-revealing methyl green pyronin (MGP stain. All RNAs were amplified with two rounds of T7-based in vitro transcription and analyzed by two-color expression analysis on 10-K cDNA microarrays. Results The MGP-stained samples showed the least introduction of mRNA loss, followed by H&E and immunofluorescence. Nissl staining was significantly more detrimental to gene expression profiles, presumably owing to an aqueous step in which RNA may have been damaged by endogenous or exogenous RNAases. Conclusion RNA damage can occur during the staining steps preparatory to laser capture microdissection, with the consequence of loss of representation of certain genes in microarray hybridization analysis. Inclusion of RNAase inhibitor in aqueous staining solutions appears to be important in protecting RNA from loss of gene transcripts.

  13. [Construction of large fragment metagenome library of natural mangrove soil].

    Science.gov (United States)

    Jiang, Yun-Xia; Zheng, Tian-Ling

    2007-11-01

    Applying our optimized direct extraction method, the percentage of large fragment DNA in the total extracted mangrove soil DNA was significant increased. The large fragment metagenome library derived from natural mangrove soil over four seasons was successfully constructed by the optimized DNA extraction and electro elution purification method. All of the clones had recombinant Cosmids and each differed in their fragment profiles when Cosmid DNA was extracted from 12 randomly picked colonies and digested with BamHI. The average insert size for this library was larger than 35 kbp. This culturing-independent library at least encompassed 335 Mbp valuable genetic information of mangrove soil microbes. It allowed mining of valuable intertidal microbial resource to become a reality. It is a recommended method for those researchers who have still not circumvented the large insert environmental libraries or for those beginning research in this field, so as to avoid them attempting repetitive, fussy work.

  14. Rapid expression cloning of human immunoglobulin Fab fragments for the analysis of antigen specificity of B cell lymphomas and anti-idiotype lymphoma vaccination.

    Science.gov (United States)

    Osterroth, F; Alkan, O; Mackensen, A; Lindemann, A; Fisch, P; Skerra, A; Veelken, H

    1999-10-29

    An expression system for rapid and standardized production of human recombinant immunoglobulin Fab fragments in E. coli was developed. Functional folding of the Fab fragments was accomplished by the dicistronic expression vector pFab.gammakappa containing specialized leader sequences to direct the immunoglobulin heavy and light chains to the periplasmic bacterial space. A C-terminal hexahistidine tag of the Fd chain facilitated metal affinity chromatography and purification to homogeneity as assessed by SDS PAGE and silver staining. Specific antigen recognition by a hybridoma-derived Fab fragment was indistinguishable from that of the corresponding monoclonal antibody. This protocol may be useful for analysis of the antigen specificity of human B cells and for convenient production of lymphoma-derived idiotype protein for vaccination strategies. To obtain unmodified immunoglobulin cDNA sequences from small human biopsies for insertion into pFab.gammakappa, oligo(dG)-tailed cDNA was amplified with an oligo(dC)- and nested mu or kappa constant region-specific primers. Using single sets of primers for each class of immunoglobulin transcripts, the products of this anchored PCR reflected the relative abundance of the starting cell population and permitted reliable identification of clonal, lymphoma-derived sequences for subsequent expression cloning.

  15. Membrane vesicles in sea water: heterogeneous DNA content and implications for viral abundance estimates

    Science.gov (United States)

    Biller, Steven J; McDaniel, Lauren D; Breitbart, Mya; Rogers, Everett; Paul, John H; Chisholm, Sallie W

    2017-01-01

    Diverse microbes release membrane-bound extracellular vesicles from their outer surfaces into the surrounding environment. Vesicles are found in numerous habitats including the oceans, where they likely have a variety of functional roles in microbial ecosystems. Extracellular vesicles are known to contain a range of biomolecules including DNA, but the frequency with which DNA is packaged in vesicles is unknown. Here, we examine the quantity and distribution of DNA associated with vesicles released from five different bacteria. The average quantity of double-stranded DNA and size distribution of DNA fragments released within vesicles varies among different taxa. Although some vesicles contain sufficient DNA to be visible following staining with the SYBR fluorescent DNA dyes typically used to enumerate viruses, this represents only a small proportion (vesicles. Thus DNA is packaged heterogeneously within vesicle populations, and it appears that vesicles are likely to be a minor component of SYBR-visible particles in natural sea water compared with viruses. Consistent with this hypothesis, chloroform treatment of coastal and offshore seawater samples reveals that vesicles increase epifluorescence-based particle (viral) counts by less than an order of magnitude and their impact is variable in space and time. PMID:27824343

  16. 21 CFR 864.1850 - Dye and chemical solution stains.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Dye and chemical solution stains. 864.1850 Section... (CONTINUED) MEDICAL DEVICES HEMATOLOGY AND PATHOLOGY DEVICES Biological Stains § 864.1850 Dye and chemical solution stains. (a) Identification. Dye and chemical solution stains for medical purposes are mixtures of...

  17. Characterisation of medieval yellow silver stained glass from Convento de Cristo in Tomar, Portugal

    Energy Technology Data Exchange (ETDEWEB)

    Delgado, J. [Dep. de Conservacao e Restauro, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); Vilarigues, M. [Dep. de Conservacao e Restauro, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); VICARTE, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); Ruivo, A. [VICARTE, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); REQUIMTE, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); Corregidor, V.; Silva, R.C. da [Unidade de Fisica e Aceleradores, LFI, ITN, E.N.10, 2686-953 Sacavem (Portugal); CFNUL, Av., Prof. Gama Pinto n 2, 1649-003 Lisboa (Portugal); Alves, L.C., E-mail: lcalves@itn.pt [Unidade de Fisica e Aceleradores, LFI, ITN, E.N.10, 2686-953 Sacavem (Portugal); CFNUL, Av., Prof. Gama Pinto n 2, 1649-003 Lisboa (Portugal)

    2011-10-15

    Yellow decoration effects in stained glasses using silver staining were first applied in the beginning of the 14th century. The glass piece being decorated was usually painted on its side intended to be facing the exterior environment, and then fired to temperatures between 500 and 650 {sup o}C, resulting in colours ranging from pale lemon to deep orange. Stained glass fragments painted by this process and belonging to the Convento de Cristo, in Tomar, Portugal, were characterised using micro-PIXE, and complemented with other analytical techniques, namely UV-Vis spectroscopy and XRF. Preliminary analysis showed that a mixture of Ag and Cu was used for the production of the yellow staining. In order to understand this staining process and the influence of the firing temperature on the resulting colours, several soda and potash glasses with compositions similar to those of medieval glasses were produced and characterised. The role played by the addition of Cu in the final colours was also investigated.

  18. Laser Treatment of Port Wine Stains

    Science.gov (United States)

    Majaron, Boris; Nelson, J. Stuart

    Port wine stain (PWS), also called nevus flammeus, is a congenital, cutaneous vascular malformation involving post-capillary venules which produce a light pink to red to dark-red-violet discoloration of human skin [1]. PWS occurs in an estimated 3 children per 1000 live births, affecting males and females and all racial groups equally [2]. There appears to be no hereditary predilection for PWS within families. There are no known risk factors or ways to prevent PWS.

  19. Diagnosis of Blastocystis hominis by different staining techniques.

    Science.gov (United States)

    Khalifa, A M

    1999-01-01

    One hundred and fifty stool samples were collected from diarrheic patients of different ages, and examined for Blastocystis hominis by direct smears and concentrated by Sheather's sugar flotation. Staining was done by: Giemsa, two modifications of trichrome stain, modified Ziehl-Neelsen, safranin-methylene blue and two-auramine stains. Out of the 150 cases nine were positive for blastocystosis. The best stains were safranin-methylene blue and modified Ziehl-Neelsen stains. They had the advantage of staining cysts and amoeboid forms besides being rapid and easy to perform. The modified trichrome stains identified 8 ie, less specific and were time consuming. The auramine dyes stained the cyst, both the wall and internal body fluoresced brightly. Giemsa stain was not an efficient stain. Scanning and transmission electron microscopy (SEM, TEM) were performed to study the fine ultrastructure.

  20. Brilliant cresyl blue staining negatively affects mitochondrial functions in porcine oocytes.

    Science.gov (United States)

    Santos, E C S; Sato, D; Lucia, T; Iwata, H

    2015-06-01

    The aim of the present study was to examine the effects of brilliant cresyl blue (BCB) staining on mitochondrial functions in porcine oocytes. Cumulus-oocyte complexes (COCs) collected from slaughterhouse-derived porcine ovaries were cultured with (13 μM) or without (0 μM, control) BCB for 60 min. Mitochondrial functions in oocytes were examined immediately after staining or after in vitro maturation. The BCB-stained oocytes produced reactive oxygen species (ROS) at higher levels than control oocytes immediately after staining (2.2-fold, P BCB-treated oocytes than in the control (2.18 versus 2.83 pM and 0.82 versus 1.0, respectively). There was no difference in mitochondrial DNA copy number between the two groups after maturation. The ATP content in early developmental stage embryos (3 days after parthenogenetic activation) was lower in the BCB-stained group than that in the control group but the difference was not significant. In conclusion, BCB staining of oocytes at the immature stage compromises mitochondrial functions throughout oocyte maturation, but function is restored during early embryo development.

  1. Feulgen type staining of mammalian tissues with Dahlia-SO2.

    Science.gov (United States)

    Dutt, M K

    1977-01-01

    The use of the basic dye, Dahlia, which belongs to triphenylmethane group but without a primary amino group in its molecule has been described as useful in the staining of aldehyde groups of acid hydrolysed DNA in tissue sections following the conventional Feulgen procedure. Dahlia-SO2 prepared with sodium hydrosulphite is highly suitable when used at pH 4-0 to 5-0. The absorption characteristics of the stained nuclei indicate on the peak of maximum absorption at 560 nm, whereas, that of the aqueous dye solution is at 590 nm.

  2. Microspectrophotometric studies of Romanowsky stained blood cells. II. Comparison of the performance of two standardized stains.

    Science.gov (United States)

    Marshall, P N; Galbraith, W; Navarro, E F; Bacus, J W

    1981-11-01

    This paper describes a comparison of the performance of two standardized Romanowsky blood stains, namely those of Marshall et al. and Wittekind et al., both containing azure B and eosin alone. Stain performance is assessed objectively by the use of three complementary techniques, all based on the visible absorbance spectra of stained cellular substrates. The first of these techniques is a simple comparison of the shapes and heights of the absorbance spectra. The second technique uses the CIE Colorimetric System, and thus permits the quantitation of colour in a manner that agrees with human observation. CIE co-ordinates (chromaticity points, luminance) are calculated directly from absorbance spectra. The third technique is that of spectral subtraction, which yields a set of factors which describe the quantities of component dyes which are bound by the object. This technique, unlike the other two, requires a priori knowledge of the dyes used in the stains, and their spectra when bound to cellular substrates. Although the differences between the two methods are subtle, and hard for the subjective observer to define, the objective methods described here do show statistically significant differences. Wittekind's stain produces less intense staining, except for lymphocyte and monocyte cytoplasms. To the human eye, the differential coloration of these two substrates is more pronounced, but the difference between all nuclei and cytoplasm is less marked. The major difference in the uptake of dye components is in the small quantities of eosin dimer that are bound in this technique.

  3. Comparison of methylene blue/gentian violet stain to Gram's stain for the rapid diagnosis of gonococcal urethritis in men.

    Science.gov (United States)

    Taylor, Stephanie N; DiCarlo, Richard P; Martin, David H

    2011-11-01

    We compared a simple, one-step staining procedure using a mixture of methylene blue and gentian violet to Gram stain for the detection of gonococcal urethritis. The sensitivity and specificity of both Gram stain and methylene blue/gentian violet stain were 97.3% and 99.6%, respectively. There was a 100% correlation between the 2 methods.

  4. Fragmentation of kidney stones

    International Nuclear Information System (INIS)

    Kovacs, K.; Kun, F.; Vertse, T.

    2005-01-01

    Complete text of publication follows. Fragmentation, i.e. the breaking of particulate materials into smaller pieces is abundant in nature and underlies several industrial processes, which attracted a continuous interest in scientific and engineering research over the past decades. In industrial applications, fragmentation processes are mostly used for the comminution of ores in various types of mills. Kidney stone is a well known human dis- ease which embitters the life of many people (in a country like the USA about 10 6 cases are registered yearly). In order to extract large kidney stones (diameter ≥ 1 cm) from the human body without operation, one of the most efficient treatment is the fragmentation of kidney stones by the so-called extracorporal shock wave lithography method: a shock wave penetrating the human body is generated by an electric pulse. The repeated application of the shock wave gradually fragments the stones into pieces of size ≤ 2 mm which then leave the body through the urine system. Recently, a novel type of lithographic method has been suggested by using widely focused shock waves which fragment the stones by a squeezing mechanism. Laboratory experiments showed that the widely focused squeezing waves achieve a higher fragmentation efficiency than the frequently used shock waves of sharp focus. Based on this method a novel medical treatment can be introduced which is less demanding for the patients. Before the application of the method in the clinical practice a detailed understanding of the fragmentation mechanism of kidney stones due to shock waves is required. Since analytic theoretical methods have serious limitations in this field, we develop a realistic model of the mechanical behavior of kidney stones and a simulation code which makes possible to study the mechanism of breakup under various external conditions. Computer simulations in two dimensions have revealed a peculiar way of crack formation, i.e. the crack which finally breaks

  5. Decondensation of chromosomal 45S rDNA sites in Lolium and Festuca genotypes does not result in karyotype instability.

    Science.gov (United States)

    Rocha, Laiane Corsini; Jankowska, Maja; Fuchs, Joerg; Mittelmann, Andréa; Techio, Vânia Helena; Houben, Andreas

    2017-01-01

    Fragile sites (FSs) in plants have been described for species like Lolium and other grasses. Whereas in humans FSs were shown to be involved in genome instabilities; the consequences of FSs expression in plants are not known yet. To evaluate whether FSs cause karyotype instabilities, we assessed the frequency of micronuclei and lagging chromosomes in meristematic cells, the stability of the DNA content, and the occurrence of neocentromeres in the presumed chromosomal fragments of Lolium perenne, Lolium multiflorum, Festuca arrundinacea, and two Festulolium hybrids. The cell cycle analysis along with flow cytometric genome size measurements showed high stability in all genomes evaluated. Neocentromeric activity was neither observed in the presumed fragments nor in any other chromosomal region, then this is not the mechanism responsible by the stability. However, Fluorescence in situ hybridization (FISH) with a 45S ribosomal DNA (rDNA) probe in combination with YOYO staining of metaphasic chromosomes showed that many extended nucleolus organizing region (NOR) form very thin YOYO-positive chromatin fibers connecting the acentric 'fragment' with the centromere-containing chromosome region. The obtained data indicate that the expression of FSs does not result in genome instabilities or neocentromere formation. The FS-containing 45S rDNA carrying chromatin fibers undergo a cell cycle and gene activity-dependent dynamic decondensation process.

  6. A new DNA band display technology of microsatellite DNA ...

    African Journals Online (AJOL)

    This study proposes a new DNA band display technology of microsatellite DNA called Fluorescent Imaging Technology. In comparison with Silver Stain Technology, this technology is worth popularizing in the laboratory because of its high resolution, efficiency, simplicity and clear background. Key words: Microsatellite DNA ...

  7. Blood extracellular DNA after irradiation

    International Nuclear Information System (INIS)

    Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.

    1993-01-01

    It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action

  8. Fragments of the Past

    OpenAIRE

    Peter Szende; Annie Holcombe

    2016-01-01

    With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  9. Picking Up (On) Fragments

    NARCIS (Netherlands)

    Ellis, Phil

    2015-01-01

    abstractThis article discusses the implications for archival and media archaeological research and reenactment artwork relating to a recent arts practice project: reenacttv: 30 lines / 60 seconds. It proposes that archival material is unstable but has traces and fragments that are full of creative

  10. Fragments of Time

    DEFF Research Database (Denmark)

    Christiansen, Steen Ledet

    Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...

  11. Wildlife habitat fragmentation.

    Science.gov (United States)

    John. Lehmkuhl

    2005-01-01

    A primary issue in forest wildlife management is habitat fragmentation and its effects on viability, which is the "bottom line" for plant and animal species of conservation concern. Population viability is the likelihood that a population will be able to maintain itself (remain viable) over a long period of time-usually 100 years or more. Though it is true...

  12. Fragments of the Past

    Directory of Open Access Journals (Sweden)

    Peter Szende

    2016-10-01

    Full Text Available With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  13. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Some delicate nerves and fibres in the surrounding areas of the stones present in the kidney are also damaged by high ultrasonic intensity used in such systems. In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavitation bubbles are found to implode faster, with more ...

  14. Synthesis of arabinoxylan fragments

    DEFF Research Database (Denmark)

    Underlin, Emilie Nørmølle; Böhm, Maximilian F.; Madsen, Robert

    , or production of commercial chemicals which are mainly obtained from fossil fuels today.The arbinoxylan fragments have a backbone of β-1,4-linked xylans with α-L-arabinose units attached at specific positions. The synthesis ultilises an efficient synthetic route, where all the xylan units can be derived from D...

  15. [Detection and documentation of masked blood stains with infrared technique].

    Science.gov (United States)

    Du Chesne, A; Bajanowski, T; Brinkmann, B

    1993-01-01

    On dark textiles the visualization of blood stains with the naked eye is either difficult or impossible. In experimental stains and in case work stains we have applied an infrared (IR) video camera in combination with a video printer. As an alternative, an IR goggle was used which could also be connected with a video printer. The results obtained on a variety of different stains and stain carriers are encouraging. Stains showing poor contrast usually become more contrasted. Stains which are partly masked can become complete. Masked stains can become visible. The system is not effective in all combinations of stains and carriers. But it solves a great proportion of formerly problematic cases. Documentation of results is quite easy if a videoprinter is used.

  16. Fetal Outcome in Meconium Stained Deliveries

    Science.gov (United States)

    Mundhra, Rajlaxmi; Agarwal, Manika

    2013-01-01

    Objective: To evaluate the foetal outcome in Meconium Stained Amniotic Fluid (MSAF). Material and Methods: This prospective observational study was carried out in the Department of Obstetrics and Gynaecology, North Eastern Indira Gandhi Regional Institute of Health And Medical Sciences, Shillong, India, over a period of eighteen months, from January 2010 to June 2011. A total of 355 pregnant women who had completed more than 37 weeks of gestation, with singleton pregnancies and cephalic presentations were included in this study. One hundred and sixty five cases with MSAF, were thus selected and they were compared with 190 randomly selected controls. Results: Among 165 cases, 27.88 % of the cases had regular visits to the Institute at least 3 times previously, 72.12% cases had no previous visit at all. Primigravidas accounted for a majority of cases and approximately 50% cases had gestational ages of more than 40 weeks Pregnancies complicated with pregnancy induced hypertension had statistically significant higher rates of meconium staining among cases (16.97%), as compared to those among controls (7.89%). 21.81% cases had foetal heart rate abnormalities, as were detected by electronic foetal monitoring and presence of foetal bradycardia was statistically higher in cases compared to that in controls. Casearean section rates were nearly double in cases (49.09%). Neonatal outcome was poor in terms of low Apgar score at birth, birth asphyxia, Meconium Aspiration Syndrome (MAS) and increased neonatal admission among cases as compared to that among controls. Conclusion: Meconium stained amniotic fluid is really worrisome from both, obstetrician’s and paediatrician’s points of view, as it increases the caesarean rates, causes birth asphyxia, MAS and increases neonatal intensive care unit admissions. PMID:24551662

  17. Robust fadeout profile of an evaporation stain

    Science.gov (United States)

    Witten, T. A.

    2009-06-01

    We propose an explanation for the commonly seen fading in the density of a stain remaining after a droplet has dried on a surface. The density decreases as a power p of the distance from the edge. For thin, dilute drops of general shape this power is determined by a flow stagnation point in the distant interior of the drop. The power p depends on the local evaporation rate J(0) at the stagnation point and the liquid depth h(0) there: p = 1 - 2~ (h(0)/\\bar h)(\\bar J/J(0)) , where \\bar h and \\bar J are averages over the drop surface.

  18. Nucleus fingerprinting for the unique identification of Feulgen-stained nuclei

    Science.gov (United States)

    Friedrich, David; Brozio, Matthias; Bell, André; Biesterfeld, Stefan; Böcking, Alfred; Aach, Til

    2012-03-01

    DNA Image Cytometry is a method for non-invasive cancer diagnosis which measures the DNA content of Feulgen-stained nuclei. DNA content is measured using a microscope system equipped with a digital camera as a densitometer and estimating the DNA content from the absorption of light when passing through the nuclei. However, a DNA Image Cytometry measurement is only valid if each nucleus is only measured once. To assist the user in preventing multiple measurements of the same nucleus, we have developed a unique digital identifier for the characterization of Feulgen-stained nuclei, the so called Nucleus Fingerprint. Only nuclei with a new fingerprint can be added to the measurement. This fingerprint is based on basic nucleus features, the contour of the nucleus and the spatial relationship to nuclei in the vicinity. Based on this characterization, a classifier for testing two nuclei for identity is presented. In a pairwise comparison of ~40000 pairs of mutually different nuclei, 99.5% were classified as different. In another 450 tests, the fingerprints of the same nucleus recorded a second time were in all cases judged identical. We therefore conclude that our Nucleus Fingerprint approach robustly prevents the repeated measurement of nuclei in DNA Image Cytometry.

  19. Identification of radiation treatment of foods using novel technique of 'DNA comet assay'

    International Nuclear Information System (INIS)

    Khan, A.A.; Khan, H.M.; Wasim, M.A.

    2005-01-01

    Treatment of food using ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests and to extend shelf life thereby contributing to safer and more plentiful food supply. Food control agencies throughout the world need some reliable, simple and rapid methods for the detection foods to ensure free choice of consumer and to enforce labeling. The DNA comet assay offers great potential as a rapid tool to screen irradiated and unirradiated samples of several kinds of foods. In the present study samples of fresh and frozen beef has investigated for the detection of irradiation treatment. The samples were subjected to radiation doses of 0,4.5 and 7 KGy and were stored in freezer before analysis. The cells were extracted into cold PBS solutions, embedded into agarose gel on microscope slides, lysed and eletrophoressed at a voltage of 2V/cm for 2 minutes. The fragmented DNA as a irradiation treatment was stretched in the gel producing the dose dependent comets. These comets were visible using a simple transmission microscope after silver staining. The controlled and irradiation samples of meat were clearly distinguishable on the basis of the stained patterns of DNA in from of round or conical intact cells for unirradiated samples or in from of comets for irradiated samples. It is therefore concluded that DNA comet Assay offers a potential to screen unirradiated and irradiated meat samples. (author)

  20. Detection of radiation treatment of meat by novel techniques of DNA comet assay

    International Nuclear Information System (INIS)

    Khan, A.A.; Khan, H.M.

    2002-01-01

    Treatment of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests and to extend shelf life; thereby contributing to safer and more plentiful food supply. Food control agencies throughout the world need some reliable, simple and rapid methods for detection of irradiated foods to ensure free choice of consumer and to enforce labeling. The DNA comet assay offers great potential as a rapid tool to screen irradiated and unirradiated samples of several kinds of foods. In the present study, frozen beef has been investigated for detection of irradiation treatment. The samples were subjected to radiation doses of 0,4,5 and 7.0 kGy and were stored in freezer before analysis. The cells were extracted into cold PBS solutions, embedded into the agarose gel on microscope slides, lysed and electrophoressed at a voltage of 2v/cm for 2 min. The fragmented DNA as a result of irradiation treatment was stretched in the gel producing the dose dependent comets. These comets were visible using a simple transmission microscope after silver staining. The controlled and irradiated samples of meat were clearly distinguishable on the basis of the stained patterns of DNA in form of round or conical intact cells for unirradiated samples or in form of comets for irradiated samples. It is therefore, concluded that 'DNA Comet Assay' offers a potential to screen unirradiated and irradiated meat samples. (author)

  1. Indentification of radiation treatment of frozen chicken and fresh turkey using DNA comet assay

    International Nuclear Information System (INIS)

    Khan, H.M.; Khan, A.A.

    2009-01-01

    DNA comet assay was applied to check the detection of radiation treatment of frozen chicken and fresh turkey. The cells from unirradiated and irradiated samples of chicken and turkey were extracted in cold PBS, embedded in agarose on microscope slides, lysed for 15 minutes in 2.5 % SDS and subjected to electrophoresis at a rate of 2V/cm for 2 minutes. After silver staining these slides were evaluated through an ordinary transmission microscope. In irradiated samples, fragmented DNA (due to radiation treatment) stretched towards the anode and cells appear as comets. The density of DNA material in the tails increased with increasing radiation dose. However in case of unirradiated samples, the large molecule of DNA remained relatively intact and there was only minor or no migration of DNA; thus cells were round or had very short tails. Therefore, clear discrimination between unirradiated and irradiated food samples is possible. Hence, DNA comet assay provides an inexpensive and quick screening method for several kinds of foods containing DNA including frozen chicken and fresh turkey. (author)

  2. Romanowsky staining in cytopathology: history, advantages and limitations.

    Science.gov (United States)

    Krafts, K P; Pambuccian, S E

    2011-04-01

    If the entire discipline of diagnostic cytopathology could be distilled into a single theme, it would be the Papanicolaou stain. Yet it was the Romanowsky stain upon which the discipline of cytopathology was founded. Both stains are used today in the cytopathology laboratory, each for a different and complementary purpose. We trace the history of cytopathological stains and discuss the advantages and limitations of Romanowsky-type stains for cytological evaluation. We also provide suggestions for the advantageous use of Romanowsky-type stains in cytopathology.

  3. The Serendipity of Fragmentation

    DEFF Research Database (Denmark)

    Leixnering, Stephan; Meyer, Renate E.

    , it was the central government’s task to coordinate, steer and control the newly emerged decentralized organizations. This raises questions about the overall design of the public sector at present. Our paper engages with the prevalent public governance phenomenon of fragmentation from a design perspective in order......Reform approaches in the public sector led to significant changes in the sector’s design. Especially NPM-inspired reform measures which had largely aimed at organizational disaggregation created pluriform landscapes of public sector organizations (PSOs). Following a core public governance principle...... form of organizing between networks and formal organization: lacking a single center and featuring multiplex and multifaceted relations within the politico-administrative apparatus and between government and PSOs, high fragmentation, local and robust action, but latent structures of significant formal...

  4. Laser therapy in plastic surgery: decolorization in port wine stains

    Science.gov (United States)

    Peszynski-Drews, Cezary; Wolf, Leszek

    1996-03-01

    For the first time laserotherapy is described as a method of port wine stain decolorization in plastic surgery. The authors present their 20-year experience in the treatment of port wine stains with the argon laser and dye laser.

  5. Port wine stain on a child's face (image)

    Science.gov (United States)

    Port wine stains are always present at birth. In an infant, they are flat, pink, vascular lesions. Common locations ... may be present anywhere on the body. Port wine stains may appear in association with other syndromes.

  6. The degradation of Romanowsky-type blood stains in methanol.

    Science.gov (United States)

    Dean, W W; Stastny, M; Lubrano, G J

    1977-01-01

    The oxidative demethylation of Romanowsky-type stains in methanol has been examined quantitatively with respect to its effect upon the staining of blood smears. Spectral changes in bound dye, observed through two color filters, have been measured for the nuclei and cytoplasm of segmented neutrophils and monocytes utilizing the LARC automated differential analyzer. Stain decomposition in methanol results in a large loss in staining intensity with little change in color. The loss in intensity has been correlated with the observed spectral changes in the degraded stain. High-performance liquid chromatographic analysis of degraded stain samples has shown the products of methanolic degradation to be different from those obtained in aqueous polychroming reactions. To maintain a stain of defined thiazine dye composition and thus defined staining properties, refrigeration is recommended.

  7. A Flow-Cytometric Gram-Staining Technique for Milk-Associated Bacteria

    Science.gov (United States)

    Holm, Claus; Jespersen, Lene

    2003-01-01

    A Gram-staining technique combining staining with two fluorescent stains, Oregon Green-conjugated wheat germ agglutinin (WGA) and hexidium iodide (HI) followed by flow-cytometric detection is described. WGA stains gram-positive bacteria while HI binds to the DNA of all bacteria after permeabilization by EDTA and incubation at 50°C for 15 min. For WGA to bind to gram-positive bacteria, a 3 M potassium chloride solution was found to give the highest fluorescence intensity. A total of 12 strains representing some of the predominant bacterial species in bulk tank milk and mixtures of these were stained and analyzed by flow cytometry. Overall, the staining method showed a clear differentiation between gram-positive and gram-negative bacterial populations. For stationary-stage cultures of seven gram-positive bacteria and five gram-negative bacteria, an average of 99% of the cells were correctly interpreted. The method was only slightly influenced by the growth phase of the bacteria or conditions such as freezing at −18°C for 24 h. For any of these conditions, an average of at least 95% of the cells were correctly interpreted. When stationary-stage cultures were stored at 5°C for 14 days, an average of 86% of the cells were correctly interpreted. The Gram-staining technique was applied to the flow cytometry analysis of bulk tank milk inoculated with Staphylococcus aureus and Escherichia coli. These results demonstrate that the technique is suitable for analyzing milk samples without precultivation. PMID:12732558

  8. Several staining techniques to enhance the visibility of Acanthamoeba cysts.

    Science.gov (United States)

    El-Sayed, Nagwa Mostafa; Hikal, Wafaa Mohamed

    2015-03-01

    Acanthamoeba is one of the most common free-living amoebae. It is widespread in the environment and can infect humans causing keratitis. Delayed diagnosis or misdiagnosis leads to extensive corneal inflammation and profound visual loss. Therefore, accurate and rapid diagnosis of Acanthamoeba keratitis is essential for successful treatment and good prognosis. This study was designed to use different staining techniques to facilitate the identification of Acanthamoeba cysts. Acanthamoeba cysts were isolated by cultivation of either corneal scraping specimens or tap water samples onto non-nutrient agar plates seeded with Escherichia coli. Subcultures were done from positive cultures until unique cysts were isolated. Acanthamoeba cysts were stained temporarily using iodine, eosin, methylene blue, and calcofluor white (CFW) stains and as permanent slides after processing for mounting using modified trichrome, Gimenez and Giemsa staining. These stains were compared on the basis of staining quality including clarity of morphological details, differentiation between cytoplasm and nuclei, color and contrast, and also other characteristics of the staining techniques, including ease of handling, time taken for the procedure, and cost effectiveness. The cysts of Acanthamoeba were recognized in the form of double-walled cysts: the outer wall (ectocyst) that was being differentiated from the variably stained surrounding background and the inner wall (endocyst) that was sometimes stellated, polygonal, round, or oval and visualized as separate from the spherical, sometimes irregular, outline of the ectocyst. Regarding the temporary stains, it was found that they were efficient for visualizing the morphological details of Acanthamoeba cysts. In CFW staining, Acanthamoeba cysts appeared as bluish-white or turquoise oval halos although the internal detail was not evident. On the other hand, the results of permanent-stained slides showed the most consistent stain for identification of

  9. Dye purity and dye standardization for biological staining

    DEFF Research Database (Denmark)

    Lyon, H O

    2002-01-01

    for separating, identifying and assaying dye components. In the second part of the review, descriptions are given of the standardized staining method approach using standard staining methods for assessing stains, and practical responses to stain impurity including commercial quality control, third-party quality...... control and standardization of reagents, protocols and documentation. Finally, reference is made to the current state of affairs in the dye field....

  10. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  11. Automatic analysis of silver-stained comets by CellProfiler software.

    Science.gov (United States)

    González, J E; Romero, I; Barquinero, J F; García, O

    2012-10-09

    The comet assay is one of the most widely used methods to evaluate DNA damage and repair in eukaryotic cells. The comets can be measured by software, in a semi-automatic or automatic process. In this paper, we apply the CellProfiler open-source software for automatic analysis of comets from digitized images, reporting the percentage of tail DNA. A side-by-side comparison of CellProfiler with CASP software demonstrated good agreement between the two packages. Our work demonstrates that automatic measurement of silver-stained comets with open-source software is possible, providing significant time savings. © 2012 Elsevier B.V. All rights reserved.

  12. Comparison between Giemsa and Van Geison stains in ...

    African Journals Online (AJOL)

    Trichrome stain (such as Van Geison) is usually used in histopathology laboratory for demonstration of collagenic fibers. Lack of selectivity and tendency of stain to fade makes van Gieson not ideal for collagen demonstration. This study was aimed to compare between Giemsa's and van Gieson's stains in collagen fibers ...

  13. Modified ultrafast Papanicolaou staining technique: A comparative study

    Science.gov (United States)

    Thakur, Moni; Guttikonda, Venkateswara Rao

    2017-01-01

    Introduction: Ultrafast Papanicolaou stain (UFP) was introduced as a hybrid of Romanowsky and Papanicolaou (PAP) stain. It enhances the quality and reduces the time. In the present study, a modified staining technique was adapted where Gill's Hematoxylin was replaced by Harris Hematoxylin. Aims: The aim of the study was to assess the use of the modified ultrafast Papanicolaou (MUFP) stain for fine needle aspiration cytology (FNAC) of head and neck swellings in comparison with the routine PAP stain, hematoxylin and eosin (H and E), and Giemsa. Materials and Methods: Forty FNACs of head and neck swellings were collected. FNAC procedure was performed by standard method; two smears were fixed in 95% propanol and stained with PAP and H and E. Two smears were air dried, 1 was stained with Giemsa, and 1 was rehydrated with normal saline, fixed in alcoholic formalin, and stained with MUFP. Four parameters were considered and scored background, cell morphology, nuclear staining, and overall staining pattern). Results: The quality of MUFP smears were better when compared to routine PAP, H and E, and Giemsa, and was statistically significant by Wilcoxon matched pair test. Conclusions: MUFP stain in comparison to routine PAP, H and E, and Giemsa provides an excellent and suitable alterative in cytological staining for the study of various organs. PMID:28701828

  14. Modified ultrafast Papanicolaou staining technique: A comparative study

    Directory of Open Access Journals (Sweden)

    Moni Thakur

    2017-01-01

    Full Text Available Introduction: Ultrafast Papanicolaou stain (UFP was introduced as a hybrid of Romanowsky and Papanicolaou (PAP stain. It enhances the quality and reduces the time. In the present study, a modified staining technique was adapted where Gill's Hematoxylin was replaced by Harris Hematoxylin. Aims: The aim of the study was to assess the use of the modified ultrafast Papanicolaou (MUFP stain for fine needle aspiration cytology (FNAC of head and neck swellings in comparison with the routine PAP stain, hematoxylin and eosin (H and E, and Giemsa. Materials and Methods: Forty FNACs of head and neck swellings were collected. FNAC procedure was performed by standard method; two smears were fixed in 95% propanol and stained with PAP and H and E. Two smears were air dried, 1 was stained with Giemsa, and 1 was rehydrated with normal saline, fixed in alcoholic formalin, and stained with MUFP. Four parameters were considered and scored background, cell morphology, nuclear staining, and overall staining pattern. Results: The quality of MUFP smears were better when compared to routine PAP, H and E, and Giemsa, and was statistically significant by Wilcoxon matched pair test. Conclusions: MUFP stain in comparison to routine PAP, H and E, and Giemsa provides an excellent and suitable alterative in cytological staining for the study of various organs.

  15. Comparison between Giemsa and Van Geison stains in ...

    African Journals Online (AJOL)

    Rukevwe S. Abraka

    2016-09-14

    Sep 14, 2016 ... Trichrome stain (such as Van Geison) is usually used in histopathology laboratory for demonstration of collagenic fibers. Lack of selectivity and tendency of stain to fade makes van Gieson not ideal for collagen demonstration. This study was aimed to compare between Giemsa's and van Gieson's stains.

  16. 7 CFR 28.442 - Middling Yellow Stained Color.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Middling Yellow Stained Color. 28.442 Section 28.442... Stained Color. Middling Yellow Stained Color is American Upland cotton which in color is deeper than Middling Tinged Color. [57 FR 34498, Aug. 5, 1992] below color grade cotton ...

  17. 7 CFR 28.441 - Strict Middling Yellow Stained Color.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Strict Middling Yellow Stained Color. 28.441 Section... Strict Middling Yellow Stained Color. Strict Middling Yellow Stained Color is color which is deeper than that of Strict Middling Tinged Color. [57 FR 34498, Aug. 5, 1992] ...

  18. Comparative Study between topical applications liposomally entrapped DNA repair enzymes and thymidine dinucleotide as radioprotectors

    International Nuclear Information System (INIS)

    Shabon, M.H.; El-Bedewi, A.F.

    2005-01-01

    The delivery of active agents to the skin by liposome carriers received great interest during the last three decades. This is based on their potential to enclose various types of biological materials and to deliver them to diverse cell types. Recent work suggests that liposomes as vehicles for topical drug delivery may be superior to conventional preparations. Also, topical application of DNA repair enzymes to irradiated skin increases the rate of repair of DNA potentially damaged cells. Moreover, thymidine dinucleotide is a new skin photo-protective agent against non-ionizing radiation through induction of DNA repair. Gamma irradiation can produce DNA damage in human skin. DNA mutations have an important role in the development of skin cancer and precancerous skin lesions. Albino rats were irradiated with Cobalt-60 gamma radiation with different doses (0.5, 1.5, 3 Gy), and were treated by either thymidine dinucleotide or liposomally entrapped DNA repair enzymes topically 24 hours before irradiation. Evaluation was done histopathologically by H and E stain. Computerized image analyzer using Masson's trichrome stain was also done. Gamma radiation produced epidermal thinning and dermal inflammatory cells together with collagen fragmentation and clumping in a dose-dependent manner. Comparing between both thymidine dinucleotide and liposomally entrapped DNA repair enzymes pretreated and irradiated rats. Low dose irradiation (0.5 Gy) together with previous drugs showed preservation of epidermis with no inflammatory cells and also it maintained the normal architecture of collagen bundles. However, they were ineffective with higher doses. In conclusion our results may suggest that the effects of gamma radiation on the skin at low dose could be minimized by the use of these drugs before exposure

  19. DNA polymorphism in the living fossil Ginkgo biloba from the eastern United States.

    Science.gov (United States)

    Kuddus, Ruhul H; Kuddus, Nayema N; Dvorchik, Igor

    2002-02-01

    Random amplified polymorphic DNA (RAPD) analysis is a valuable tool in studying inter- and intra-specific genetic variations, patterns of gene expression, and for the identification of specific genes using nearly isogenic variants. Here we used RAPD analysis to study the genetic variation in Ginkgo biloba grown in the eastern United States. Our results support the evidence that Southern blot hybridization of RAPD using probes made from cloned DNA fragments allows a more accurate analysis of the RAPD pattern than dye-stained gels or Southern blot hybridization of RAPD blots using probes made from purified PCR products. Using these techniques, we observed a high degree of relatedness among plants grown in certain localities although significant genetic variation may exist in the species, and could be a possible explanation for the observed variations in the efficacy of medications derived from G. biloba extract.

  20. Fragment-fragment correlations in near-binary fragmentation of C60

    International Nuclear Information System (INIS)

    Vandenbosch, R.; Henry, B.; Cooper, C.H.; Liang, J.F.; Will, D.I.

    1997-01-01

    The collision dynamics of C 60 with H 2 and He gas has been studied using reverse kinematics. A beam of C 60 - is obtained by electron attachment to neutral molecules exiting an oven and then accelerated to energies between 75 and 150 keV. The collisions take place in a windowless gas cell. We energy analyze the products in a pair of electrostatic analyzers which are oriented so that coincidences between light and heavy fragments can be observed. Our energy, and hence mass, resolution is sufficient to uniquely identify all C n clusters between n=1 and 60. The principal question we are addressing is whether heavy products in the mass range C 34 to C 56 are produced solely by sequential emission of C 2 fragments, or whether longer chains (and possibly rings) compete with C 2 emission. From our coincidence studies we have conclusive evidence that fragments such as C 8 are fragmentation partners to heavy fragments. In general we find that the products of a binary fragmentation are sufficiently excited that sequential decay follows the initial fragmentation. Although only even-n heavy fragments are observed, the