Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S
2005-01-01
Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.
Dejmek, Annika; Zendehrokh, Nooreldin; Tomaszewska, Malgorzata; Edsjö, Anders
2013-07-01
Personalized oncology requires molecular analysis of tumor cells. Several studies have demonstrated that cytological material is suitable for DNA analysis, but to the authors' knowledge there are no systematic studies comparing how the yield and quality of extracted DNA is affected by the various techniques used for the preparation of cytological material. DNA yield and quality were compared using cultured human lung cancer cells subjected to different preparation techniques used in routine cytology, including fixation, mounting medium, and staining. The results were compared with the outcome of epidermal growth factor receptor (EGFR) genotyping of 66 clinical cytological samples using the same DNA preparation protocol. All tested protocol combinations resulted in fragment lengths of at least 388 base pairs. The mounting agent EcoMount resulted in higher yields than traditional xylene-based medium. Spray and ethanol fixation resulted in both a higher yield and better DNA quality than air drying. In liquid-based cytology (LBC) methods, CytoLyt solution resulted in a 5-fold higher yield than CytoRich Red. Papanicolaou staining provided twice the yield of hematoxylin and eosin staining in both liquid-based preparations. Genotyping outcome and quality control values from the clinical EGFR genotyping demonstrated a sufficient amount and amplifiability of DNA in both spray-fixed and air-dried cytological samples. Reliable clinical genotyping can be performed using all tested methods. However, in the cell line experiments, spray- or ethanol-fixed, Papanicolaou-stained slides provided the best results in terms of yield and fragment length. In LBC, the DNA recovery efficiency of the preserving medium may differ considerably, which should be taken into consideration when introducing LBC. Cancer (Cancer Cytopathol) 2013;121:344-353. © 2013 American Cancer Society. © 2013 American Cancer Society.
Agarose gel electrophoresis for the separation of DNA fragments.
Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon
2012-04-20
Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate
DNA fragmentation in spermatozoa
DEFF Research Database (Denmark)
Rex, A S; Aagaard, J.; Fedder, J
2017-01-01
Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...
Fragment Length of Circulating Tumor DNA.
Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay
2016-07-01
Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.
Fragmentation in DNA double-strand breaks
International Nuclear Information System (INIS)
Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie
2005-01-01
DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)
Supramolecular gel electrophoresis of large DNA fragments.
Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi
2017-10-01
Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Evenson, Donald P.; Wixon, Regina
2005-01-01
Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated
An improved silver staining procedure for schizodeme analysis in polyacrylamide gradient gels
Directory of Open Access Journals (Sweden)
Antonio M. Gonçalves
1990-03-01
Full Text Available A simple protocol is described for the silver staining of polyacrylamide gradient gels used for the separation of restriction fragments of kinetoplast DNA [schizodeme analysis of trypanosomatids (Morel et al., 1980]. The method overcomes the problems of non-uniform staining and strong background color which are frequently encountered when conventional protocols for silver staining of linear gels. The method described has proven to be of general applicability for DNA, RNA and protein separations in gradient gels.
Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods
Directory of Open Access Journals (Sweden)
Sedlackova Tatiana
2013-02-01
Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.
DNA fragments assembly based on nicking enzyme system.
Directory of Open Access Journals (Sweden)
Rui-Yan Wang
Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.
Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.
Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh
2016-04-01
Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.
Linkage map of the fragments of herpesvirus papio DNA.
Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H
1981-01-01
Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015
Complementary DNA-amplified fragment length polymorphism ...
African Journals Online (AJOL)
Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.
Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.
Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M
2018-02-01
To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.
High efficiency hydrodynamic DNA fragmentation in a bubbling system
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling
2017-01-01
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling
High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling
2017-01-18
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.
International Nuclear Information System (INIS)
Al-Gubory, Kais H.
2005-01-01
The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals
Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage
Directory of Open Access Journals (Sweden)
Carol Coughlan
2015-01-01
Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.
Rui, Bruno R; Angrimani, Daniel S R; Losano, João Diego A; Bicudo, Luana de Cássia; Nichi, Marcílio; Pereira, Ricardo J G
2017-12-01
Several methods have been developed to evaluate spermatozoa function in birds but many of these are sometimes complicated, costly and not applicable to field studies (i.e., performed within poultry breeding facilities). The objective was, therefore, to validate efficient, practical and inexpensive procedures to determine DNA fragmentation, acrosomal integrity, and mitochondrial activity in poultry spermatozoa. Initially, ejaculates were individually diluted and divided into control (4°C, 4h) and UV-irradiated aliquots (room temperature, 4h), and then samples containing different percentages of DNA-damaged spermatozoa (0%, 25%, 50%, 75% and 100%) were subjected to Toluidine Blue (TB) and Sperm Chromatin Dispersion assessments (SCD). Fast Green-Rose Bengal (FG-RB) and FITC-PSA staining protocols were subsequently used to assess acrosome status in aliquots comprising assorted amounts of acrosome-reacted spermatozoa. Furthermore, to validate 3,3'-diaminobenzidine (DAB) assay, ejaculates containing different gradients of spermatozoa with great amounts of mitochondrial activity were concurrently evaluated using DAB and JC-1 stains. The proportion of spermatozoa with abnormal DNA integrity when evaluated using the TB assessment correlated significantly with the expected percentages of UV-irradiated spermatozoa and with SCD results. A significant linear regression coefficient was also observed between expected amounts of acrosome-intact spermatozoa and FG-RB readings, and there was a significant correlation of the data when FG-RB and FITC-PSA were used. Likewise, the use of the DAB assay enabled for accurately ascertaining percentages of rooster spermatozoa with greater and lesser mitochondrial function, and results were highly correlated to results with staining with JC-1. Altogether, findings of the present study indicate acrosomal status, DNA integrity and mitochondrial activity in rooster spermatozoa can be easily and reliably determined using FG-RB, TB and DAB stains
New visible and selective DNA staining method in gels with tetrazolium salts.
Paredes, Aaron J; Naranjo-Palma, Tatiana; Alfaro-Valdés, Hilda M; Barriga, Andrés; Babul, Jorge; Wilson, Christian A M
2017-01-15
DNA staining in gels has historically been carried out using silver staining and fluorescent dyes like ethidium bromide and SYBR Green I (SGI). Using fluorescent dyes allows recovery of the analyte, but requires instruments such as a transilluminator or fluorimeter to visualize the DNA. Here we described a new and simple method that allows DNA visualization to the naked eye by generating a colored precipitate. It works by soaking the acrylamide or agarose DNA gel in SGI and nitro blue tetrazolium (NBT) solution that, when exposed to sunlight, produces a purple insoluble formazan precipitate that remains in the gel after exposure to light. A calibration curve made with a DNA standard established a detection limit of approximately 180 pg/band at 500 bp. Selectivity of this assay was determined using different biomolecules, demonstrating a high selectivity for DNA. Integrity and functionality of the DNA recovered from gels was determined by enzymatic cutting with a restriction enzyme and by transforming competent cells after the different staining methods, respectively. Our method showed the best performance among the dyes employed. Based on its specificity, low cost and its adequacy for field work, this new methodology has enormous potential benefits to research and industry. Copyright © 2016 Elsevier Inc. All rights reserved.
DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser
de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson
2015-03-01
Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.
A mechanism of gene amplification driven by small DNA fragments.
Directory of Open Access Journals (Sweden)
Kuntal Mukherjee
Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation
Bacterial natural transformation by highly fragmented and damaged DNA
DEFF Research Database (Denmark)
Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre
2013-01-01
for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...
DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.
García-Vilchis, David; Aranda-Anzaldo, Armando
2017-12-01
Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Gram stains: a resource for retrospective analysis of bacterial pathogens in clinical studies.
Srinivasan, Usha; Ponnaluri, Sreelatha; Villareal, Lisa; Gillespie, Brenda; Wen, Ai; Miles, Arianna; Bucholz, Brigette; Marrs, Carl F; Iyer, Ram K; Misra, Dawn; Foxman, Betsy
2012-01-01
We demonstrate the feasibility of using qPCR on DNA extracted from vaginal Gram stain slides to estimate the presence and relative abundance of specific bacterial pathogens. We first tested Gram stained slides spiked with a mix of 10(8) cfu/ml of Escherichia coli and 10(5) cfu/ml of Lactobacillus acidophilus. Primers were designed for amplification of total and species-specific bacterial DNA based on 16S ribosomal gene regions. Sample DNA was pre-amplified with nearly full length 16S rDNA ribosomal gene fragment, followed by quantitative PCR with genera and species-specific 16S rDNA primers. Pre-amplification PCR increased the bacterial amounts; relative proportions of Escherichia coli and Lactobacillus recovered from spiked slides remained unchanged. We applied this method to forty two archived Gram stained slides available from a clinical trial of cerclage in pregnant women at high risk of preterm birth. We found a high correlation between Nugent scores based on bacterial morphology of Lactobacillus, Gardenerella and Mobiluncus and amounts of quantitative PCR estimated genus specific DNA (rrn copies) from Gram stained slides. Testing of a convenience sample of eight paired vaginal swabs and Gram stains freshly collected from healthy women found similar qPCR generated estimates of Lactobacillus proportions from Gram stained slides and vaginal swabs. Archived Gram stained slides collected from large scale epidemiologic and clinical studies represent a valuable, untapped resource for research on the composition of bacterial communities that colonize human mucosal surfaces.
FragIdent--automatic identification and characterisation of cDNA-fragments.
Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin
2009-03-02
Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.
Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I
2016-01-01
Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.
S - and N-alkylating agents diminish the fluorescence of fluorescent dye-stained DNA.
Giesche, Robert; John, Harald; Kehe, Kai; Schmidt, Annette; Popp, Tanja; Balzuweit, Frank; Thiermann, Horst; Gudermann, Thomas; Steinritz, Dirk
2017-01-25
Sulfur mustard (SM), a chemical warfare agent, causes DNA alkylation, which is believed to be the main cause of its toxicity. SM DNA adducts are commonly used to verify exposure to this vesicant. However, the required analytical state-of-the-art mass-spectrometry methods are complex, use delicate instruments, are not mobile, and require laboratory infrastructure that is most likely not available in conflict zones. Attempts have thus been made to develop rapid detection methods that can be used in the field. The analysis of SM DNA adducts (HETE-G) by immunodetection is a convenient and suitable method. For a diagnostic assessment, HETE-G levels must be determined in relation to the total DNA in the sample. Total DNA can be easily visualized by the use of fluorescent DNA dyes. This study examines whether SM and related compounds affect total DNA staining, an issue that has not been investigated before. After pure DNA was extracted from human keratinocytes (HaCaT cells), DNA was exposed to different S- and N-alkylating agents. Our experiments revealed a significant, dose-dependent decrease in the fluorescence signal of fluorescent dye-stained DNA after exposure to alkylating agents. After mass spectrometry and additional fluorescence measurements ruled out covalent modifications of ethidium bromide (EthBr) by SM, we assumed that DNA crosslinks caused DNA condensation and thereby impaired access of the fluorescent dyes to the DNA. DNA digestion by restriction enzymes restored fluorescence, a fact that strengthened our hypothesis. However, monofunctional agents, which are unable to crosslink DNA, also decreased the fluorescence signal. In subsequent experiments, we demonstrated that protons produced during DNA alkylation caused a pH decrease that was found responsible for the reduction in fluorescence. The use of an appropriate buffer system eliminated the adverse effect of alkylating agents on DNA staining with fluorescent dyes. An appropriate buffer system is thus
Amplification of deoxyribonucleic acid (DNA) fragment using two ...
African Journals Online (AJOL)
user
2011-04-11
Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...
Flow cytometric detection of micronuclei by combined staining of DNA and membranes
International Nuclear Information System (INIS)
Wessels, J.M.; Nuesse, M.
1995-01-01
A new staining method is presented for flow cytometric measurement of micronuclei (MN) in cell cultures and human lymphocytes using membrane-specific fluorescent dyes in addition to DNA staining. Several combinations of fluorescent membrane and DNA dyes were studied for a better discrimination of MN from debris in a suspension of nuclei and micronuclei. For staining of membranes, the lipophilic dyes 2-hydroxyethyl-7,12,17-tris(methoxyethyl)porphycene (HEPn) and 1,6-diphenyl-1,3,5-hexatriene (DPH) were used in combination with ethidium bromide (EB), proflavine (PF), and Hoechst 33258 (HO). Due to their spectral properties, HO or EB combined with HEPn were not as suitable for the discrimination of MN from debris as was HEPn in combination with PF. With HEPn in combination with PF, however, additional noise was found at low fluorescence intensities, probably due to free fluorescent dye molecules in the solution. The optimal simultaneous staining of membranes and DNA was obtained using a combination of DPH and EB. The induction of MN in Chinese hamster and mouse NIH-3T3 cells by UV-B illumination was studied with this new staining technique. UV-B illumination (280-360 nm) induced MN in both cell lines. Chinese hamster cells were found to be more sensitive to these wavelengths. Illumination with wavelengths above 360 nm did not induce MN in either cell line. The results obtained from human lymphocytes using the combination of EB or DPH were comparable to the results obtained with the combination of EB and HO. 23 refs., 7 figs
DEFF Research Database (Denmark)
Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.
1995-01-01
Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...
Quantification of DNA fragmentation in processed foods using real-time PCR.
Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi
2017-07-01
DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Kosaka, T.; Kuwabara, M.; Koide, F.
1992-01-01
Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking
Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana
2013-04-01
An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .
Synthesis and NMR of {sup 15}N-labeled DNA fragments
Energy Technology Data Exchange (ETDEWEB)
Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)
1994-12-01
DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.
Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.
De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C
2015-03-01
Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.
Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis
International Nuclear Information System (INIS)
Lau How Mooi
1998-01-01
Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured
FragIdent – Automatic identification and characterisation of cDNA-fragments
Directory of Open Access Journals (Sweden)
Goehler Heike
2009-03-01
Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.
Cheng, Xin; Ivessa, Andreas S
2012-10-01
Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.
Real-time Tracking of DNA Fragment Separation by Smartphone.
Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori
2017-06-01
Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.
Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes
2005-10-01
1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as
Directory of Open Access Journals (Sweden)
Barbara Dariš
2018-02-01
Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))
1994-08-01
The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.
Ginsberg, Stephen D; Che, Shaoli
2004-08-01
The use of five histochemical stains (cresyl violet, thionin, hematoxylin & eosin, silver stain, and acridine orange) was evaluated in combination with an expression profiling paradigm that included regional and single cell analyses within the hippocampus of post-mortem human brains and adult mice. Adjacent serial sections of human and mouse hippocampus were labeled by histochemistry or neurofilament immunocytochemistry. These tissue sections were used as starting material for regional and single cell microdissection followed by a newly developed RNA amplification procedure (terminal continuation (TC) RNA amplification) and subsequent hybridization to custom-designed cDNA arrays. Results indicated equivalent levels of global hybridization signal intensity and relative expression levels for individual genes for hippocampi stained by cresyl violet, thionin, and hematoxylin & eosin, and neurofilament immunocytochemistry. Moreover, no significant differences existed between the Nissl stains and neurofilament immunocytochemistry for individual CA1 neurons obtained via laser capture microdissection. In contrast, a marked decrement was observed in adjacent hippocampal sections stained for silver stain and acridine orange, both at the level of the regional dissection and at the CA1 neuron population level. Observations made on the cDNA array platform were validated by real-time qPCR using primers directed against beta-actin and glyceraldehyde-3 phosphate dehydrogenase. Thus, this report demonstrated the utility of using specific Nissl stains, but not stains that bind RNA species directly, in both human and mouse brain tissues at the regional and cellular level for state-of-the-art molecular fingerprinting studies.
Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry
Energy Technology Data Exchange (ETDEWEB)
Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)
2000-06-01
We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.
Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry
International Nuclear Information System (INIS)
Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.
2000-01-01
We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America
DEFF Research Database (Denmark)
Haas, Claus; Hanson, E; Anjos, M J
2013-01-01
samples of human or non-human origin were analyzed by 20 participating laboratories using an RNA extraction or RNA/DNA co-extraction method. Two novel mRNA multiplexes were used: a saliva triplex (HTN3, STATH and MUC7) and a semen pentaplex (PRM1, PRM2, PSA, SEMG1 and TGM4). The laboratories used......A third collaborative exercise on RNA/DNA co-analysis for body fluid identification and STR profiling was organized by the European DNA Profiling Group (EDNAP). Twenty saliva and semen stains, four dilution series (10-0.01 µl saliva, 5-0.01 µl semen) and, optionally, bona fide or mock casework...... different chemistries and instrumentation and a majority (16/20) were able to successfully isolate and detect mRNA in dried stains. The simultaneous extraction of RNA and DNA from individual stains not only permitted a confirmation of the presence of saliva/semen (i.e. tissue/fluid source of origin...
Fragmentation of sperm DNA using the TUNEL method.
Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R
2014-11-01
To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.
Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.
Warwicker, J; Ollis, D; Richards, F M; Steitz, T A
1985-12-05
The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.
RNA/DNA co-analysis from blood stains--Results of a second collaborative EDNAP exercise
DEFF Research Database (Denmark)
Haas, C.; Hanson, E.; Anjos, M.J.
2012-01-01
A second collaborative exercise on RNA/DNA co-analysis for body fluid identification and STR profiling was organized by the European DNA Profiling Group (EDNAP). Six human blood stains, two blood dilution series (5-0.001 [mu]l blood) and, optionally, bona fide or mock casework samples of human or...
Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P
2013-10-01
Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The
A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food
International Nuclear Information System (INIS)
Jones, J.L.; Bulford, B.B.
1990-07-01
The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)
Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.
2015-07-01
Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.
Directory of Open Access Journals (Sweden)
Gosalvez Jaime
2009-04-01
Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.
Luciferase assay to study the activity of a cloned promoter DNA fragment.
Solberg, Nina; Krauss, Stefan
2013-01-01
Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.
DEFF Research Database (Denmark)
Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E
1995-01-01
Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...
Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao
2005-01-01
AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039
Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis
van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland
2006-01-01
We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893
Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.
Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime
2006-12-01
The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.
No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus
DEFF Research Database (Denmark)
Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens
2013-01-01
It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....
(PCR) for direct cloning of blunt-end DNA fragments
African Journals Online (AJOL)
Administrator
2011-09-19
Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).
Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.
1996-01-01
We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes
Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L
2018-04-12
Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.
1990-01-01
A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map
International Nuclear Information System (INIS)
Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge
2006-01-01
Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments
Ionization and fragmentation of DNA-RNA bases: a density functional theory study
International Nuclear Information System (INIS)
Sadr-Arani, Leila
2014-01-01
Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)
Bakshi, Hamid; Sam, Smitha; Rozati, Roya; Sultan, Phalisteen; Islam, Tajamul; Rathore, Babita; Lone, Zahoor; Sharma, Manik; Triphati, Jagrati; Saxena, Ramesh Chand
2010-01-01
Apoptosis, a widely important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus in different cancer types. The present study was designed to elucidate apoptosis induction by crocin, a main component of Crocus sativus in a human pancreatic cancer cell line (BxPC-3). Cell viability was measured by MTT assay, Hoechest33258 staining was used to detect the chromatin condensation characteristic of apoptosis, and DNA fragmentation was assessed by gel electrophoresis and cell cycle analysis by flow cytometry. Crocin induced apoptosis and G1-phase cell cycle arrest of BxPC-3 cells, while decreasing cell viability in a dose dependent and time dependent manner. Cells treated with 10μg/L crocin exhibited apoptotic morphology (brightly blue-fluorescent condensed nuclei on Hoechst 33258 staining) and reduction of volume. DNA analysis revealed typical ladders as early as 12 hours after treatment indicative of apoptosis. Our preclinical study demonstrated a pancreatic cancer cell line to be highly sensitive to crocin-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of crocin action are not yet clearly understood, it appears to have potential as a therapeutic agent.
National Oceanic and Atmospheric Administration, Department of Commerce — These are the data from a laboratory experiment in which DNA content was removed from blood smears and extracted. The blood smears were either stained with...
Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles
Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin
2010-01-01
Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be
International Nuclear Information System (INIS)
D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.
1988-01-01
cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus
The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.
2015-01-01
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667
Pîrlea, Sorina; Puiu, Mihaela; Răducan, Adina; Oancea, Dumitru
2017-03-01
In this study, it was demonstrated that the DNA Chelex extraction combined with the permanganate assisted-oxidation is highly efficient in removing the PCR inhibitors often found in clothing materials, such as phthalocyanine. The extraction assays were conducted in saliva, blood and epithelial cells samples mixed with three oxidation-resistant dye copper(II) α-phthalocyanine, copper(II) β-phthalocyanine and tetrasulfonated copper(II) β-phthalocyanine. After DNA amplification, all samples were able to provide full DNA profiles. The permanganate/Chelex system was tested further on denim-stained samples and displayed the same ability to remove the PCR inhibitors from the commercial textile materials.
Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments
International Nuclear Information System (INIS)
Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.
1979-01-01
Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)
Directory of Open Access Journals (Sweden)
Kamble R
2010-01-01
Full Text Available Abstract Identification of Mycobacterium leprae, which causes leprosy, is done by Ziehl Neelsen Carbol Fuchsin (ZNCF stained slit skin smear microscopy that aids in the diagnosis and quantification of approximate bacterial load carried by the patient. We attempted M. leprae DNA extraction from 46 stained slit skin smear negative slides, using Proteinase K and SDS lysis, followed by ethanol precipitation. M. leprae specific primers (16SrRNA were used for PCR-based amplification of DNA. We could detect M. leprae DNA in 15 (32.6% samples. The method can be useful in the diagnosis of apparently slit skin smear negative leprosy cases.
Ultrastructural and DNA damaging effects of lead nitrate in the liver.
Narayana, K; Al-Bader, Maie
2011-01-01
A ubiquitous environmental toxicant - lead is known to affect several organ systems. This study was designed to investigate the effects of lead nitrate exposure on liver structure and DNA fragmentation. Adult male Wistar rats were treated orally with lead nitrate at the dose levels of 0%, 0.5% and 1% for 60 days and sacrificed on the next day. The liver was processed for thick sections and evaluated after toludine blue staining and by electron microscopy after staining with uranyl acetate and lead citrate. The DNA damage was assessed by DNA fragmentation assay. The liver weight was not significantly affected in the experimental groups. Hepatocyte nuclei were not shrunk, instead lead was mitogenic to hepatocytes as indicated by an increase in the number of binucleated hepatocytes (Plead-treated groups, these changes were not significantly different from that in control as evaluated by optical density. In conclusion, lead induces necrotic changes with simultaneous mitogenic activity; however, it does not induce significant DNA damage in the liver. Copyright © 2009 Elsevier GmbH. All rights reserved.
The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F
2015-05-15
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet
2018-03-23
To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.
Panan Kanchanaphum
2018-01-01
This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP), and LAMP-Lateral Flow Dipstick (LFD). For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, w...
Fraser, L; Strzezek, J
2007-07-15
In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in
Energy Technology Data Exchange (ETDEWEB)
Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor
2001-09-15
We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.
Holley, W. R.; Chatterjee, A.
1996-01-01
We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the
Directory of Open Access Journals (Sweden)
José Gregorio Martínez
Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.
International Nuclear Information System (INIS)
Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.
1986-01-01
The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides
Institute of Scientific and Technical Information of China (English)
曾凡钦; 尹若菲; 谭国珍; 郭庆; 许德清
2004-01-01
Background Skin lesions are common manifestations in systemic lupus erythematosus (SLE). It is still unknown what the definite pathogenesis of skin involvement was and whether DNA participated in it. Our study was designed to explore the pathogenetic role and nature of nuclear antigen (DNA) deposited in the skin lesions of patients with SLE.Methods Thirty skin samples from patients with SLE and 2 normal skin samples were studied. Extracellular DNA was evaluated by indirect immunofluorescence methods. The deposited immune complexes were extracted by cryoprecipitation, and DNA was then isolated with phenol and chloroform. DNA fragment sizes were detected by agarose gel electrophoresis. Finally, 8 different probes were used to analyze the origin of these DNA molecules using Dot hybridization.Results Extracellular DNA staining was found only in skin lesions, mainly those located in the basement membrane zone, vascular wall, and hair follicle wall. Normal skin and non-lesion SLE skin showed no fluorescence at locations outside the nuclei. There were no differences in the rate and intensity of extracellular DNA staining when comparing active phase to remission phase patients. No relationship was found between extracellular DNA and circulating anti-dsDNA antibodies. Deposited DNA fragments clustered into four bands of somewhat discrete sizes: 20 000 bp, 1300 bp, 800-900 bp, 100-200 bp. Small sized fragments (100-200 bp) were positively correlated with disease activity (P<0.05, r=0.407). Dot hybridization showed significant homology of the various extracellular DNA fragments examined with human genomic DNA, but not with DNA from the microorganisms and viruses we examined. There were also homologies between DNA samples from different individuals.Conclusions DNA and its immune complexes may contribute to the pathogenesis of skin lesions in SLE. These DNA molecules range in size from 100 bp to 20 kb and may be endogenous in origin.
Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias
2013-09-24
Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.
[Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].
Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun
2015-08-01
To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.
Treulen, F; Uribe, P; Boguen, R; Villegas, J V
2016-02-01
Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA
International Nuclear Information System (INIS)
Yakura, Kimitaka; Tanifuji, Shigeyuki.
1983-01-01
EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)
Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.
Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F
1976-09-01
Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.
Birla, Bhagyashree S; Chou, Hui-Hsien
2015-01-01
Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
Directory of Open Access Journals (Sweden)
Bhagyashree S Birla
Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
Wehrmann, A; Eggeling, L; Sahm, H
1994-12-01
In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.
Nature of defects produced on thymine fragment by gamma irradiation of DNA
International Nuclear Information System (INIS)
Teoule, R.; Bonicel, A.
1975-01-01
A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions
A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment
Directory of Open Access Journals (Sweden)
Manesh Kumar Panner Selvam
2018-03-01
Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay
ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH
CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
International Nuclear Information System (INIS)
Jackson, Christopher B.; Gallati, Sabina; Schaller, André
2012-01-01
Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
Energy Technology Data Exchange (ETDEWEB)
Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)
2012-07-06
Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in
Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms
Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.
1987-01-01
DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers
Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua
2012-03-01
The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Beiyu Liu
2009-09-01
Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.
Directory of Open Access Journals (Sweden)
Agustín García-Peiró
2014-01-01
Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W
1991-01-01
Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.
Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M
1986-09-01
The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.
International Nuclear Information System (INIS)
Hahn, P.J.; Giddings, L.; Lane, M.J.
1989-01-01
Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes
[Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].
Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D
2011-01-01
The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.
Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins
International Nuclear Information System (INIS)
Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie
2012-01-01
Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.
Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins
Energy Technology Data Exchange (ETDEWEB)
Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)
2012-04-20
Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.
Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation
International Nuclear Information System (INIS)
Wei Kang; Liu Xueying; Zhu Xuefen
1984-01-01
The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)
Boyko, Alex; Kovalchuk, Igor
2010-01-01
Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.
Singh, Khushbu; Singh, Swati; Srivastava, Payal; Sivakumar, Sri; Patra, Ashis K
2017-06-01
Two highly luminescent water-soluble heterometallic LnPt 2 complexes, [{cis-PtCl(NH 3 ) 2 } 2 Ln(L)(H 2 O)](NO 3 ) 2 (Ln = Eu (1), Tb (2)), have been designed for their selective nucleoli staining through formation of Pt-DNA crosslinks. The complexes showed significant cellular uptake and distinctive nucleoli localization through intrinsic emission from Eu III or Tb III observed through confocal fluorescence microscopy.
International Nuclear Information System (INIS)
Zhu Shoupeng; Xiao Dong; Han Xiaofeng
1997-01-01
The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis
Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas
1996-01-01
For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.
Directory of Open Access Journals (Sweden)
Jiabing Ji
Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.
Gaur, Pankaj; Kumar, Ajay; Dey, Gourab; Kumar, Rajendra; Bhattacharyya, Shalmoli; Ghosh, Subrata
2016-05-04
Successful integration of selenium unit into a newly designed cationic chemical architecture led to the development of a highly photostable molecular maker PA5 to be used in fluorescence microscopy as cellular nucleus staining agent for longer duration imaging under continuous laser illumination. Adaptation of a targeted single-atom modification strategy led to the development of a series of proficient DNA light-up probes (PA1-PA5). Further, their comparative photophysical studies in the presence of DNA revealed the potential of electron rich heteroatoms of chalcogen family in improving binding efficiency and specificity of molecular probes toward DNA. The findings of cell studies confirmed the outstanding cell compatibility of probe PA5 in terms of cell permeability, biostability, and extremely low cytotoxicity. Moreover, the photostability experiment employing continuous laser illumination in solution phase as well as in cell assay (both fixed and live cells) revealed the admirable photobleaching resistance of PA5. Finally, while investigating the phototoxicity of PA5, the probe was found not to exhibit light-induced toxicity even when irradiated for longer duration. All these experimental results demonstrated the promising standing of PA5 as a futuristic cell compatible potential stain for bioimaging and temporal profiling of DNA.
Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments
International Nuclear Information System (INIS)
Sage, E.; Moustacchi, E.
1987-01-01
The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA
STR analysis of artificially degraded DNA-results of a collaborative European exercise
DEFF Research Database (Denmark)
Schneider, Peter M; Bender, Klaus; Mayr, Wolfgang R
2004-01-01
Degradation of human DNA extracted from forensic stains is, in most cases, the result of a natural process due to the exposure of the stain samples to the environment. Experiences with degraded DNA from casework samples show that every sample may exhibit different properties in this respect......, and that it is difficult to systematically assess the performance of routinely used typing systems for the analysis of degraded DNA samples. Using a batch of artificially degraded DNA with an average fragment size of approx. 200 bp a collaborative exercise was carried out among 38 forensic laboratories from 17 European...... countries. The results were assessed according to correct allele detection, peak height and balance as well as the occurrence of artefacts. A number of common problems were identified based on these results such as strong peak imbalance in heterozygous genotypes for the larger short tandem repeat (STR...
Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi
2008-12-15
The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.
Directory of Open Access Journals (Sweden)
S. Yu. Borovets
2017-01-01
Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level
Directory of Open Access Journals (Sweden)
Jorge A. Bertolotto
2016-06-01
Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.
Bertolotto, Jorge A.; Umazano, Juan P.
2016-06-01
In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.
Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V
2016-06-20
Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.
The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation
Directory of Open Access Journals (Sweden)
George Anifandis
2018-05-01
Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.
Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge
2017-12-01
In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.
Effect of superoxide dismutase supplementation on sperm DNA fragmentation
Directory of Open Access Journals (Sweden)
Luciano Negri
2017-10-01
Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD
Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Lieberman, Isador H; Krebs, Viktor; Togawa, Daisuke; Fujishiro, Takaaki; Procop, Gary W
2006-08-01
We have developed a combined real-time PCR and pyrosequencing assay that successfully differentiated the vast majority of gram-positive and gram-negative bacteria when bacterial isolates were tested. The purpose of this study was to evaluate this assay on clinical specimens obtained from orthopedic surgeries, and to prospectively compare the results of "molecular Gram stain" with culture and conventional direct Gram stain. Forty-five surgical specimens were obtained from patients who underwent orthopedic surgery procedures. The DNA was extracted and a set of broad-range PCR primers that targeted a part of the 16S rDNA gene was used for pan-bacterial PCR. The amplicons were submitted for pyrosequencing and the resulting molecular Gram stain characteristics were recorded. Culture and direct Gram staining were performed using standard methods for all cases. Surgical specimens were reviewed histologically for all cases that had a discrepancy between culture and molecular results. There was an 86.7% (39/45) agreement between the traditional and molecular methods. In 12/14 (85.7%) culture-proven cases of bacterial infection, molecular Gram stain characteristics were in agreement with the culture results, while the conventional Gram stain result was in agreement only for five cases (35.7%). In the 31 culture negative cases, 27 cases were also PCR negative, whereas 4 were PCR positive. Three of these were characterized as gram negative and one as gram positive by this molecular method. Molecular determination of the Gram stain characteristics of bacteria that cause orthopedic infections may be achieved, in most instances, by this method. Further studies are necessary to understand the clinical importance of PCR-positive/culture-negative results.
Directory of Open Access Journals (Sweden)
Leclerc Xavier
2009-04-01
Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.
International Nuclear Information System (INIS)
Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert
1987-01-01
The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)
International Nuclear Information System (INIS)
Holley, W.R.; Chatterjee, A.
1996-01-01
We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs
Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena
2016-09-01
Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.
Richardson, Ruth E.; Suzuki, Yo
2015-01-01
Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330
Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan
2009-02-01
To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.
Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu
2015-08-01
In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.
Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.
1974-01-01
By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397
Nagelkerke, A.P.; Span, P.N.
2016-01-01
Phospho-H2AX or gamma-H2AX- is a marker of DNA double-stranded breaks and can therefore be used to monitor DNA repair after, for example, irradiation. In addition, positive staining for phospho-H2AX may indicate genomic instability and telomere dysfunction in tumour cells and tissues. Here, we
Jenkins, J A; Draugelis-Dale, R O; Pinkney, A E; Iwanowicz, L R; Blazer, V S
2015-03-15
Declining harvests of yellow perch, Perca flavescens, in urbanized watersheds of Chesapeake Bay have prompted investigations of their reproductive fitness. The purpose of this study was to establish a flow cytometric technique for DNA analysis of fixed samples sent from the field to provide reliable gamete quality measurements. Similar to the sperm chromatin structure assay, measures were made on the susceptibility of nuclear DNA to acid-induced denaturation, but used fixed rather than live or thawed cells. Nuclei were best exposed to the acid treatment for 1 minute at 37 °C followed by the addition of cold (4 °C) propidium iodide staining solution before flow cytometry. The rationale for protocol development is presented graphically through cytograms. Field results collected in 2008 and 2009 revealed DNA fragmentation up to 14.5%. In 2008, DNA fragmentation from the more urbanized watersheds was significantly greater than from reference sites (P = 0.026) and in 2009, higher percentages of haploid testicular cells were noted from the less urbanized watersheds (P = 0.032) indicating better reproductive condition at sites with less urbanization. For both years, total and progressive live sperm motilities by computer-assisted sperm motion analysis ranged from 19.1% to 76.5%, being significantly higher at the less urbanized sites (P < 0.05). This flow cytometric method takes advantage of the propensity of fragmented DNA to be denatured under standard conditions, or 1 minute at 37 °C with 10% buffered formalin-fixed cells. The study of fixed sperm makes possible the restrospective investigation of germplasm fragmentation, spermatogenic ploidy patterns, and chromatin compaction levels from samples translocated over distance and time. The protocol provides an approach that can be modified for other species across taxa. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Cheuk-Chun Szeto
Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.
Gefrides, Lisa A; Powell, Mark C; Donley, Michael A; Kahn, Roger
2010-02-01
Laboratories employ various approaches to ensure that their consumables are free of DNA contamination. They may purchase pre-treated consumables, perform quality control checks prior to casework, and use in-house profile databases for contamination detection. It is better to prevent contamination prior to DNA typing than identify it after samples are processed. To this end, laboratories may UV irradiate or autoclave consumables prior to use but treatment procedures are typically based on killing microorganisms and not on the elimination of DNA. We report a systematic study of UV and autoclave treatments on the persistence of DNA from saliva. This study was undertaken to determine the best decontamination strategy for the removal of DNA from laboratory consumables. We have identified autoclave and UV irradiation procedures that can eliminate nanogram quantities of contaminating DNA contained within cellular material. Autoclaving is more effective than UV irradiation because it can eliminate short fragments of contaminating DNA more effectively. Lengthy autoclave or UV irradiation treatments are required. Depending on bulb power, a UV crosslinker may take a minimum of 2h to achieve an effective dose for elimination of nanogram quantities of contaminating DNA (>7250mJ/cm(2)). Similarly autoclaving may also take 2h to eliminate similar quantities of contaminating DNA. For this study, we used dried saliva stains to determine the effective dose. Dried saliva stains were chosen because purified DNA as well as fresh saliva are less difficult to eradicate than dried stains and also because consumable contamination is more likely to be in the form of a collection of dry cells.
Silver and Cyanine Staining of Oligonucleotides in Polyacrylamide Gel.
Tang, Weizhong; Zhou, Huafu; Li, Wei
2015-01-01
To explore why some oligonucleotides in denaturing polyacrylamide gel could not be silver-stained, 134 different oligonucleotides were analyzed using denaturing polyacrylamide gel electrophoresis stained with silver and asymmetric cyanine. As a result, we found that the sensitivity of oligos (dA), (dC), (dG) and (dT) to silver staining could be ranged as (dA) > (dG) > (dC) > (dT) from high to low. It was unexpected that oligo (dT) was hard to be silver-stained. Moreover, the silver staining of an oligonucleotide containing base T could be partially or completely inhibited by base T. The inhibition of silver staining by base T was a competitive inhibition which could be affected by the amounts of the argyrophil nucleobase and base T, the cis-distance between the argyrophil nucleobase and base T, and the gel concentration. The changes of the intensity of an oligonucleotide band caused by the changes of DNA base composition were diverse and interesting. The intensity of some oligonucleotide bands would significantly change when the changes of DNA base composition accumulated to a certain extent (usually ≥ 4 nt). The sensitivity of cyanine staining of ≤ 11-nt long oligonucleotides could be enhanced about 250-fold by fixing the gels with methanol fixing solution.
DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure
International Nuclear Information System (INIS)
Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo
2010-01-01
Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.
DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure
Energy Technology Data Exchange (ETDEWEB)
Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)
2010-01-05
Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.
International Nuclear Information System (INIS)
Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich
1998-01-01
The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)
Bille, Todd W; Cromartie, Carter; Farr, Matthew
2009-09-01
This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.
Directory of Open Access Journals (Sweden)
Kotoka Masuyama
Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.
DEFF Research Database (Denmark)
Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta
2012-01-01
Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...
Energy Technology Data Exchange (ETDEWEB)
Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)
2012-07-29
Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.
M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale
1994-01-01
A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....
Directory of Open Access Journals (Sweden)
Olga Makarova
Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.
Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C
2001-01-01
Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.
Association of sperm apoptosis and DNA ploidy with sperm chromatin quality in human spermatozoa.
Mahfouz, Reda Z; Sharma, Rakesh K; Said, Tamer M; Erenpreiss, Juris; Agarwal, Ashok
2009-04-01
To examine the relationship among sperm apoptosis, sperm chromatin status, and DNA ploidy in different sperm fractions. Prospective study. Reproductive research center in a tertiary care hospital. Sperm prepared by density gradient were evaluated for sperm count, motility, apoptosis, and sperm chromatin assessment. Sperm count, sperm motility, toluidine blue (TB) results, DNA fragmentation index (%DFI), high DNA stainability, DNA cytometry, and early and late apoptosis. Sperm motility was related to late apoptotic and subhaploid apoptotic sperm (r = -0.56 and -0.53, respectively). The sperm %DFI showed significant correlation with late apoptotic and subhaploid sperm (r = 0.62 and 0.68). TB-stained sperm were significantly correlated with late apoptotic sperm (r = 0.51). Significantly higher proportions of haploid sperm and light blue TB-stained sperm were seen in mature compared with immature fractions. Even in semen samples with low %DFI, semen processing results in a lower incidence of nuclear immaturity and subhaploidy, but the incidence of late apoptotic sperm remains unchanged. Therefore, simultaneous evaluation of apoptosis and sperm chromatin status is important for processing sperm in assisted reproductive procedures.
Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru
2017-01-01
Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096
Wu, Lung-Yuan; Lu, Hsu-Feng; Chou, Yu-Cheng; Shih, Yung-Luen; Bau, Da-Tian; Chen, Jaw-Chyun; Hsu, Shu-Chun; Chung, Jing-Gung
2015-01-01
Numerous evidences have shown that plant flavonoids (naturally occurring substances) have been reported to have chemopreventive activities and protect against experimental carcinogenesis. Kaempferol, one of the flavonoids, is widely distributed in fruits and vegetables, and may have cancer chemopreventive properties. However, the precise underlying mechanism regarding induced DNA damage and suppressed DNA repair system are poorly understood. In this study, we investigated whether kaempferol induced DNA damage and affected DNA repair associated protein expression in human leukemia HL-60 cells in vitro. Percentages of viable cells were measured via a flow cytometry assay. DNA damage was examined by Comet assay and DAPI staining. DNA fragmentation (ladder) was examined by DNA gel electrophoresis. The changes of protein levels associated with DNA repair were examined by Western blotting. Results showed that kaempferol dose-dependently decreased the viable cells. Comet assay indicated that kaempferol induced DNA damage (Comet tail) in a dose-dependent manner and DAPI staining also showed increased doses of kaempferol which led to increased DNA condensation, these effects are all of dose-dependent manners. Western blotting indicated that kaempferol-decreased protein expression associated with DNA repair system, such as phosphate-ataxia-telangiectasia mutated (p-ATM), phosphate-ataxia-telangiectasia and Rad3-related (p-ATR), 14-3-3 proteins sigma (14-3-3σ), DNA-dependent serine/threonine protein kinase (DNA-PK), O(6)-methylguanine-DNA methyltransferase (MGMT), p53 and MDC1 protein expressions, but increased the protein expression of p-p53 and p-H2AX. Protein translocation was examined by confocal laser microscopy, and we found that kaempferol increased the levels of p-H2AX and p-p53 in HL-60 cells. Taken together, in the present study, we found that kaempferol induced DNA damage and suppressed DNA repair and inhibited DNA repair associated protein expression in HL-60
Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra
2018-02-01
Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.
Martin-Sanchez, Pedro M; Bastian, Fabiola; Alabouvette, Claude; Saiz-Jimenez, Cesareo
2013-01-15
A real-time Polymerase Chain Reaction (PCR) assay was developed to detect and quantify Ochroconis lascauxensis in the Lascaux Cave in France. This fungus is the principal causal agent of the black stains threatening the Paleolithic paintings of this UNESCO World Heritage Site. The black stains outbreak could not be stopped in spite of using intensive biocide treatments. A sensitive and time-saving protocol is needed for determining the extent of the colonization. Sets of primers that target the ITS and RPB2 regions were designed and evaluated for specificity against O. lascauxensis. Genomic DNA extracted from five species of Ochroconis and 13 other fungal species frequently isolated from caves were used to test the specificity of each primer set. The specific and sensitive real-time PCR assay using the primers 347F/493R targeting a 147-bp fragment from the RPB2 gene was useful for quantifying the presence of O. lascauxensis in the stains on the walls, sediments and air of the cavity. The results confirmed the association of this fungus with the black stains and its wide dissemination in all cave compartments. The suitability of this method for monitoring fungal outbreaks in cave environments is discussed. Copyright © 2012 Elsevier B.V. All rights reserved.
Ottoboni, Matteo; Tretola, Marco; Cheli, Federica; Marchis, Daniela; Veys, Pascal; Baeten, Vincent; Pinotti, Luciano
2017-08-01
The aim of this study was to evaluate the use of light microscopy with differential staining techniques for the discrimination of insect material from marine arthropods - classified as fishmeal. Specifically, three samples of single-species insect material, Hermetia illucens (HI), Bombyx mori (BM) and Tenebrio molitor (TM), and two samples of marine arthropods, shrimp material and krill, were analysed and compared after staining by two reagents to enhance fragment identification. Alizarin Red (AR) and Chlorazol Black (CB), which react respectively with calcium salts and chitin, were tested for their potential efficacy in distinguishing between insect and marine materials. Results indicated that AR failed to stain HI, BM and TM materials. By contrast, the three insect species materials tested were stained by CB. When shrimp fragments and krill were considered, AR and CB stained marine materials reddish-pink and light blue to black, respectively. By combining these results, it can be suggested that CB staining may efficiently be used to mark insect materials; AR does stain shrimp fragments but does not stain the tested insect material, indicating a possible approach for discriminating between insects and marine arthropods. However, since the present study was performed on pure materials and a small set of samples, possible implementation of this technique still needs to be confirmed in complex matrices such as compound feed.
Kulstein, G; Wiegand, P
2018-01-01
Body fluids like blood and saliva are commonly encountered during investigations of high volume crimes like homicides. The identification of the cellular origin and the composition of the trace can link suspects or victims to a certain crime scene and provide a probative value for criminal investigations. To erase all traces from the crime scene, perpetrators often wash away their traces. Characteristically, items that show exposed stains like blood are commonly cleaned or laundered to free them from potential visible leftovers. Mostly, investigators do not delegate the DNA analysis of laundered items. However, some studies have already revealed that items can still be used for DNA analysis even after they have been laundered. Nonetheless, a systematical evaluation of laundered blood and saliva traces that provides a comparison of different established and newly developed methods for body fluid identification (BFI) is still missing. Herein, we present the results of a comprehensive study of laundered blood- and saliva-stained pieces of cloths that were applied to a broad range of methods for BFI including conventional approaches as well as molecular mRNA profiling. The study included the evaluation of cellular origin as well as DNA profiling of blood- and saliva-stained (synthetic fiber and cotton) pieces of cloths, which have been washed at various washing temperatures for one or multiple times. Our experiments demonstrate that, while STR profiling seems to be sufficiently sensitive for the individualization of laundered items, there is a lack of approaches for BFI with the same sensitivity and specificity allowing to characterize the cellular origin of challenging, particularly laundered, blood and saliva samples.
Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie
2017-05-11
Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.
Application of the DNA comet assay for detection of irradiated meat
International Nuclear Information System (INIS)
Kruszewski, M.; Iwanenko, T.; Wojewodzka, M.; Malec-Czechowska, K.; Dancewicz, A. M.; Szot, Z.
1998-01-01
Radiation induces damage to the DNA. This damage (fragmentation) can be assessed in the irradiated food using Single Cell Gel Electrophoresis (SCGE), known as DNA comet assay. Fragmentation of DNA may also be caused by improper storage of meat and repeated freezing and thawing. This makes identification of irradiated meat by this assay not reliable enough. In order to know the scale of the processes imitating radiation effects in DNA of the comets, their shape and lengths were examined in both irradiated and unirradiated fresh meat (D = 1.5 or 3.0 kGy) stored at 4 o C or frozen (-21 o ) up to 5 months. Comets formed upon SCGE were stained with DAPI or silver and examined in fluorescent or light microscope. They were divided arbitrarily into 4 classes. Comets of IV class were found quite often in fresh meat stored at 4 o C. In meat samples that were irradiated and stored frozen, comets of class I, II and III were observed. The negative comet test is univocal. Positive comet test, however, needs confirmation. The meat should be subjected to further analysis with other validated methods. (author)
Extended HSR/CARD domain mediates AIRE binding to DNA
Energy Technology Data Exchange (ETDEWEB)
Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt
2015-12-25
Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.
Extended HSR/CARD domain mediates AIRE binding to DNA
International Nuclear Information System (INIS)
Maslovskaja, Julia; Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt
2015-01-01
Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.
Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P
2017-10-01
A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.
Directory of Open Access Journals (Sweden)
Panan Kanchanaphum
2018-01-01
Full Text Available This study explores determining the sex of humans from blood stains taken from different surfaces and compares the time course of detection with the conventional PCR, Conventional Loop Mediated Isothermal Amplification (LAMP, and LAMP-Lateral Flow Dipstick (LFD. For the DNA templates, 7 male and 7 female blood stained samples were extracted and added to LAMP and PCR reaction solution to amplify the SRY gene. The DNA samples were extracted from the following blood stained materials: cloth, wood, clay, and tile. Then, the samples were stored at room temperature for 1, 7, 30, and 60 day(s. After the DNA amplification, the gel electrophoresis process was applied to detect LAMP product. The LFD was combined with the LAMP to detect LAMP product on the male cloth samples. For the male samples, the time course of detection on the first and seventh days indicated positive for both LAMP and PCR products on all the surfaces while no DNA amplification was found on any of the female samples. On day 30, positive LAMP product was still found on all the male samples. However, it had faded on the tiles. Moreover, all the male samples, which had tested positive for PCR product, were blurred and unclear. On day 60, LAMP product was still found on all the male samples. Conversely, the PCR method resulted in no bands showing for any of the male samples. However, the LAMP-LFD method detected product on all the male samples of cloth. The results show that the LAMP is an effective, practical, and reliable molecular-biological method. Moreover, the LFD can increase the efficiency and sensitivity of the LAMP, making it more suitable for field studies because gel electrophoresis apparatus is not required.
Rapid DNA analysis for automated processing and interpretation of low DNA content samples.
Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F
2016-01-01
Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample
Crystal structure of an Okazaki fragment at 2-A resolution
Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.
1992-01-01
In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.
Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles
2016-01-01
DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.
Directory of Open Access Journals (Sweden)
Sara Sadeghi
2016-01-01
Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.
M.T. Banik; D.L. Lindner; J. Juzwik; J.A. Glaeser
2013-01-01
An inexpensive kit was developed to collect wood samples for molecular detection of pathogenic, saprotrophic and stain fungi in declining Pinus resinosa in the Upper Midwest. The kit contained materials for "clean" collection of sapwood drill shavings, which were then subjected to PCR of the rDNA ITS region with fungal-specific primers,...
Vitrification of neat semen alters sperm parameters and DNA integrity.
Khalili, Mohammad Ali; Adib, Maryam; Halvaei, Iman; Nabi, Ali
2014-05-06
Our aim was to evaluate the effect of neat semen vitrification on human sperm vital parameters and DNA integrity in men with normal and abnormal sperm parameters. Semen samples were 17 normozoospermic samples and 17 specimens with abnormal sperm parameters. Semen analysis was performed according to World Health Organization (WHO) criteria. Then, the smear was provided from each sample and fixed for terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining. Vitrification of neat semen was done by plunging cryoloops directly into liquid nitrogen and preserved for 7 days. The samples were warmed and re-evaluated for sperm parameters as well as DNA integrity. Besides, the correlation between sperm parameters and DNA fragmentation was assessed pre- and post vitrification. Cryopreserved spermatozoa showed significant decrease in sperm motility, viability and normal morphology after thawing in both normal and abnormal semen. Also, the rate of sperm DNA fragmentation was significantly higher after vitrification compared to fresh samples in normal (24.76 ± 5.03 and 16.41 ± 4.53, P = .002) and abnormal (34.29 ± 10.02 and 23.5 ± 8.31, P < .0001), respectively. There was negative correlation between sperm motility and sperm DNA integrity in both groups after vitrification. Vitrification of neat ejaculates has negative impact on sperm parameters as well as DNA integrity, particularly among abnormal semen subjects. It is, therefore, recommend to process semen samples and vitrify the sperm pellets.
International Nuclear Information System (INIS)
Vejko, N.N.; Spitkovskij, D.M.
2000-01-01
The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru
Composition and immuno-stimulatory properties of extracellular DNA from mouse gut flora.
Qi, Ce; Li, Ya; Yu, Ren-Qiang; Zhou, Sheng-Li; Wang, Xing-Guo; Le, Guo-Wei; Jin, Qing-Zhe; Xiao, Hang; Sun, Jin
2017-11-28
To demonstrate that specific bacteria might release bacterial extracellular DNA (eDNA) to exert immunomodulatory functions in the mouse small intestine. Extracellular DNA was extracted using phosphate buffered saline with 0.5 mmol/L dithiothreitol combined with two phenol extractions. TOTO-1 iodide, a cell-impermeant and high-affinity nucleic acid stain, was used to confirm the existence of eDNA in the mucus layers of the small intestine and colon in healthy Male C57BL/6 mice. Composition difference of eDNA and intracellular DNA (iDNA) of the small intestinal mucus was studied by Illumina sequencing and terminal restriction fragment length polymorphism (T-RFLP). Stimulation of cytokine production by eDNA was studied in RAW264.7 cells in vitro . TOTO-1 iodide staining confirmed existence of eDNA in loose mucus layer of the mouse colon and thin surface mucus layer of the small intestine. Illumina sequencing analysis and T-RFLP revealed that the composition of the eDNA in the small intestinal mucus was significantly different from that of the iDNA of the small intestinal mucus bacteria. Illumina Miseq sequencing showed that the eDNA sequences came mainly from Gram-negative bacteria of Bacteroidales S24-7. By contrast, predominant bacteria of the small intestinal flora comprised Gram-positive bacteria. Both eDNA and iDNA were added to native or lipopolysaccharide-stimulated Raw267.4 macrophages, respectively. The eDNA induced significantly lower tumor necrosis factor-α/interleukin-10 (IL-10) and IL-6/IL-10 ratios than iDNA, suggesting the predominance for maintaining immune homeostasis of the gut. Our results indicated that degraded bacterial genomic DNA was mainly released by Gram-negative bacteria, especially Bacteroidales-S24-7 and Stenotrophomonas genus in gut mucus of mice. They decreased pro-inflammatory activity compared to total gut flora genomic DNA.
Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa
2014-04-01
Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.
Ruiz-Fuentes, Jenny Laura; Díaz, Alexis; Entenza, Anayma Elena; Frión, Yahima; Suárez, Odelaisy; Torres, Pedro; de Armas, Yaxsier; Acosta, Lucrecia
2015-12-01
The diagnosis of leprosy has been a challenge due to the low sensibility of the conventional methods and the impossibility of culturing the causative organism. In this study, four methods for Mycobacterium leprae nucleic-acid extraction from Ziehl-Neelsen-stained slides (ZNS slides) were compared: Phenol/chloroform, Chelex 100 resin, and two commercial kits (Wizard Genomic DNA Purification Kit and QIAamp DNA Mini Kit). DNA was extracted from four groups of slides: a high-codification-slide group (bacteriological index [BI]⩾4), a low-codification-slide group (BI=1), a negative-slide group (BI=0), and a negative-control-slide group (BI=0). Quality DNA was evidenced by the amplification of specific repetitive element present in M. leprae genomic DNA (RLEP) using a nested polymerase chain reaction. This is the first report comparing four different extraction methods for obtaining M. leprae DNA from ZNS slides in Cuban patients, and applied in molecular diagnosis. Good-quality DNA and positive amplification were detected in the high-codification-slide group with the four methods, while from the low-codification-slide group only the QIAGEN and phenol-chloroform methods obtained amplification of M. leprae. In the negative-slide group, only the QIAGEN method was able to obtain DNA with sufficient quality for positive amplification of the RLEP region. No amplification was observed in the negative-control-slide group by any method. Patients with ZNS negative slides can still transmit the infection, and molecular methods can help identify and treat them, interrupting the chain of transmission and preventing the onset of disabilities. The ZNS slides can be sent easily to reference laboratories for later molecular analysis that can be useful not only to improve the diagnosis, but also for the application of other molecular techniques. Copyright © 2015 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.
Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan
2013-01-01
A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926
Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.
2000-01-01
DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.
Directory of Open Access Journals (Sweden)
Yuming Lu
Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.
Serafini, Suellen; Santos, Maria Mercês; Aoun Tannuri, Ana Cristina; Zerbini, Maria Claudia Nogueira; de Mendonça Coelho, Maria Cecília; de Oliveira Gonçalves, Josiane; Tannuri, Uenis
2017-12-06
Hematoxylin-eosin (HE) staining of a full-thickness rectal wall fragment is classically used for the diagnosis of Hirschsprung disease (HD). However, this technique requires large fragments for a better diagnosis. Additionally, the histochemical and immunohistochemical methods of staining small fragments of rectal mucosal and submucosal biopsies are not available in all centers. Therefore, the possibility of diagnosing HD through HE staining in these biopsies could be a valuable alternative for centers that do not have more specific techniques. The objectives of the current investigation were to evaluate the concordance of the results obtained by HE staining and the calretinin method with acetylcholinesterase (AChE) activity in fragments of mucosa and submucosa in the diagnosis of HD. For this study, 50 cases from our laboratory were selected. The tissue material was embedded in paraffin. Sixty levels of each fragment were utilized for HE, and the other 3 levels were used for calretinin. These slides were analyzed under the microscope, photographed and classified as either positive for HD when no ganglion cells were found with nerve trunks present or as negative when ganglion cells were found. The results from reading the slides were compared with those of AChE. Of the 50 cases evaluated by the HE technique, only 5 contradicted the diagnosis based on AChE, with a Kappa value of 0.800 and an accuracy of 90%. In the comparison between calretinin and AChE, 8 cases were discordant, with a Kappa value of 0.676 and an accuracy of 84%. The concordance of results from AChE and HE methods was satisfactory, allowing for the potential use of the HE method for fragments of mucosa and submucosa as a valid alternative in the diagnosis of HD. The immunohistochemical technique of calretinin did not show good agreement with the AChE activity in our study.
Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.
Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F
2017-09-01
In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.
Scar-less multi-part DNA assembly design automation
Hillson, Nathan J.
2016-06-07
The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.
Santangelo, G M; Tornow, J
1997-12-01
As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.
Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás
2018-01-01
Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.
Nucleus fingerprinting for the unique identification of Feulgen-stained nuclei
Friedrich, David; Brozio, Matthias; Bell, André; Biesterfeld, Stefan; Böcking, Alfred; Aach, Til
2012-03-01
DNA Image Cytometry is a method for non-invasive cancer diagnosis which measures the DNA content of Feulgen-stained nuclei. DNA content is measured using a microscope system equipped with a digital camera as a densitometer and estimating the DNA content from the absorption of light when passing through the nuclei. However, a DNA Image Cytometry measurement is only valid if each nucleus is only measured once. To assist the user in preventing multiple measurements of the same nucleus, we have developed a unique digital identifier for the characterization of Feulgen-stained nuclei, the so called Nucleus Fingerprint. Only nuclei with a new fingerprint can be added to the measurement. This fingerprint is based on basic nucleus features, the contour of the nucleus and the spatial relationship to nuclei in the vicinity. Based on this characterization, a classifier for testing two nuclei for identity is presented. In a pairwise comparison of ~40000 pairs of mutually different nuclei, 99.5% were classified as different. In another 450 tests, the fingerprints of the same nucleus recorded a second time were in all cases judged identical. We therefore conclude that our Nucleus Fingerprint approach robustly prevents the repeated measurement of nuclei in DNA Image Cytometry.
Diagnosing periprosthetic infection: false-positive intraoperative Gram stains.
Oethinger, Margret; Warner, Debra K; Schindler, Susan A; Kobayashi, Hideo; Bauer, Thomas W
2011-04-01
Intraoperative Gram stains have a reported low sensitivity but high specificity when used to help diagnose periprosthetic infections. In early 2008, we recognized an unexpectedly high frequency of apparent false-positive Gram stains from revision arthroplasties. The purpose of this report is to describe the cause of these false-positive test results. We calculated the sensitivity and specificity of all intraoperative Gram stains submitted from revision arthroplasty cases during a 3-month interval using microbiologic cultures of the same samples as the gold standard. Methods of specimen harvesting, handling, transport, distribution, specimen processing including tissue grinding/macerating, Gram staining, and interpretation were studied. After a test modification, results of specimens were prospectively collected for a second 3-month interval, and the sensitivity and specificity of intraoperative Gram stains were calculated. The retrospective review of 269 Gram stains submitted from revision arthroplasties indicated historic sensitivity and specificity values of 23% and 92%, respectively. Systematic analysis of all steps of the procedure identified Gram-stained but nonviable bacteria in commercial broth reagents used as diluents for maceration of periprosthetic membranes before Gram staining and culture. Polymerase chain reaction and sequencing showed mixed bacterial DNA. Evaluation of 390 specimens after initiating standardized Millipore filtering of diluent fluid revealed a reduced number of positive Gram stains, yielding 9% sensitivity and 99% specificity. Clusters of false-positive Gram stains have been reported in other clinical conditions. They are apparently rare related to diagnosing periprosthetic infections but have severe consequences if used to guide treatment. Even occasional false-positive Gram stains should prompt review of laboratory methods. Our observations implicate dead bacteria in microbiologic reagents as potential sources of false-positive Gram
Izadi, Shahrokh; Mirhendi, Hossein; Jalalizand, Niloufar; Khodadadi, Hossein; Mohebali, Mehdi; Nekoeian, Shahram; Jamshidi, Ali; Ghatee, Mohammad Amin
2016-02-01
PCR has been used for confirmation of leishmaniasis in epidemiological studies, but complexity of DNA extraction and PCR approach has confined its routine use in developing countries. In this study, recent epidemiological situation of cutaneous leishmaniasis (CL) in two hyper-endemic metropolises of Shiraz and Isfahan in Iran was studied using DNA extraction by commercial FTA cards and kinetoplastid DNA (kDNA)-PCR amplification for detection/identification of Leishmania directly from stained skin scraping imprints. Fifty four and 30 samples were collected from clinically diagnosed CL patients referred to clinical laboratories of leishmaniasis control centers in Isfahan and Shiraz cities, respectively. The samples were examined by direct microscopy and then scrapings of the stained smears were applied to FTA cards and used directly as DNA source in a nested-PCR to amplify kDNA to detect and identify Leishmania species. Fifty four of 84 (64.2%) slides obtained from patients had positive results microscopically, while 79/84 (94%) of slides had positive results by FTA card-nested-PCR. PCR and microscopy showed a sensitivity of 96.4% and 64.2% and specificity of 100% and 100%, respectively. Interestingly, Leishmania major as causative agent of zoonotic CL was identified in 100% and 90.7% of CL cases from Isfahan and Shiraz cities, respectively, but L. tropica was detected from only 9.3% of cases from Shiraz city. All cases from central regions of Shiraz were L. tropica and no CL case was found in Isfahan central areas. Filter paper-based DNA extraction can facilitate routine use of PCR for diagnosis of CL in research and diagnostic laboratories in Iran and countries with similar conditions. Epidemiologic changes including dominancy of L. major in suburbs of Shiraz and Isfahan metropolises where anthroponotic CL caused by L. tropica had been established, showed necessity of precise studies on CL epidemiology in old urban and newly added districts in the suburbs.
Meamar, Mehrdad; Zribi, Nassira; Cambi, Marta; Tamburrino, Lara; Marchiani, Sara; Filimberti, Erminio; Fino, Maria Grazia; Biggeri, Annibale; Menezo, Yves; Forti, Gianni; Baldi, Elisabetta; Muratori, Monica
2012-08-01
To analyze the effect of cryopreservation on sperm DNA fragmentation (SDF) in two cytometric sperm populations, PI(brighter) and PI(dimmer), and to test the effects of Opuntia ficus-indica (OFI) extracts, which contain antioxidants and flavanoids, and of resveratrol on cryopreservation of human semen. In vitro prospective study. Institutional study. Twenty-one normozoospermic men undergoing semen analysis for couple infertility. Cryopreservation using the routine method in the presence of OFI extracts or resveratrol. Measurement of SDF by TUNEL/PI flow cytometric method to evaluate sperm motility (by automated motion analysis, CASA system) and viability (by eosin/nigrosin staining) in the two populations of sperm PI(br) and PI(dim). Cryopreservation induced an increase of SDF only in the PI(br) sperm population. The increase was negatively dependent on the basal values of SDF in the same population. Addition of OFI extracts and resveratrol to the cryopreservation medium slightly but statistically significantly reduced SDF in the PI(br) population without affecting the deleterious effect of cryopreservation on sperm motion parameters or viability. The increase of SDF in the PI(br) population, which is unrelated to semen quality, suggests that caution must be taken in using cryopreserved semen, as morphologically normal and motile sperm may be damaged. The addition of substances with multifunctional properties such as OFI extracts to cryopreservation medium is only slightly effective in preventing the dramatic effects on SDF. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.
2012-01-01
Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444
International Nuclear Information System (INIS)
Schmid, D.S.; Tite, J.P.; Ruddle, N.H.
1986-01-01
A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery
Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J
2010-08-01
In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.
International Nuclear Information System (INIS)
Tempelaar, M.J.
1980-01-01
The lC DNA-content of isolated nuclei of postembryonic stages of Tetranychus urticae stained with the classic and a modified Schiff's reagent was cytophotometrically estimated as 0.1 pg, a low value in animals. For many tissues of this arrhenotokus species the ploidy ratio between males and females is 1:2, indicating the absence of sex-related differences in ploidy. In addition, DNA measurements were performed to evaluate irradiation-experiments, starting with X-irradiation of mature sperm in males with doses known from previous work to induce chromosomal fragments that are subject to loss and missegregation in the embryonic mitotic stages of the female progeny despite the presumed holokinetic nature of the chromosomes. The DNA-content of the nuclei of the surviving postembryonic preadult stages did not indicate the occurrence of nuclei with in-between male/female values, ruling out loss and missegregation of fragments as important factors in postembryonic lethality. Abnormally low DNA-values in some adult females could be attributed to development of embryos before oviposition caused by radiation-induced effects. (orig.) [de
Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke
2013-01-01
Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972
Modified Field's staining--a rapid stain for Trichomonas vaginalis.
Afzan, M Yusuf; Sivanandam, S; Kumar, G Suresh
2010-10-01
Trichomonas vaginalis, a flagellate protozoan parasite commonly found in the human genitourinary tract, is transmitted primarily by sexual intercourse. Diagnosis is usually by in vitro culture method and staining with Giemsa stain. There are laboratories that use Gram stain as well. We compared the use of modified Field's (MF), Giemsa, and Gram stains on 2 axenic and xenic isolates of T. vaginalis, respectively. Three smears from every sediment of spun cultures of all 4 isolates were stained, respectively, with each of the stains. We showed that MF staining, apart from being a rapid stain (20 s), confers sharper staining contrast, which differentiates the nucleus and the cytoplasm of the organism when compared to Giemsa and Gram staining especially on parasites from spiked urine samples. The alternative staining procedure offers in a diagnostic setting a rapid stain that can easily visualize the parasite with sharp contrasting characteristics between organelles especially the nucleus and cytoplasm. Vacuoles are more clearly visible in parasites stained with MF than when stained with Giemsa. Copyright © 2010 Elsevier Inc. All rights reserved.
Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E
2015-08-18
The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect
Differential staining of bacteria: gram stain.
Moyes, Rita B; Reynolds, Jackie; Breakwell, Donald P
2009-11-01
In 1884, Hans Christian Gram, a Danish doctor, developed a differential staining technique that is still the cornerstone of bacterial identification and taxonomic division. This multistep, sequential staining protocol separates bacteria into four groups based on cell morphology and cell wall structure: Gram-positive cocci, Gram-negative cocci, Gram-positive rods, and Gram-negative rods. The Gram stain is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures. (c) 2009 by John Wiley & Sons, Inc.
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi
2017-04-26
We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.
Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima
2015-09-01
To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.
Fragman: an R package for fragment analysis.
Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan
2016-04-21
Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.
Barretto, Letícia Siqueira de Sá; Lessio, Camila; Sawaki e Nakamura, Ahy Natally; Lo Turco, Edson Guimarães; da Silva, Camila Gonzaga; Zambon, João Paulo; Gozzo, Fábio César; Pilau, Eduardo Jorge; de Almeida, Fernando Gonçalves
2014-10-01
Human adipose tissue has been described as a potential alternative reservoir for stem cells. Although studies have been performed in rabbits using autologous adipose-derived stem cells (ADSC), these cells have not been well characterized. The primary objectives of this study were to demonstrate the presence of adipose-derived stem cells isolated from rabbit inguinal fat pads and to characterize them through osteogenic and adipogenic in vitro differentiation and lipid fingerprinting analysis. The secondary objective was to evaluate cell behavior through growth kinetics, cell viability, and DNA integrity. Rabbit ADSCs were isolated to determine the in vitro growth kinetics and cell viability. DNA integrity was assessed by an alkaline Comet assay in passages 0 and 5. The osteogenic differentiation was evaluated by Von Kossa, and Alizarin Red S staining and adipogenic differentiation were assessed by Oil Red O staining. Lipid fingerprinting analyses of control, adipogenic, and osteogenic differentiated cells were performed by MALDI-TOF/MS. We demonstrate that rabbit ADSC have a constant growth rate at the early passages, with increased DNA fragmentation at or after passage 5. Rabbit ADSC viability was similar in passages 2 and 5 (90.7% and 86.6%, respectively), but there was a tendency to decreased cellular growth rate after passage 3. The ADSC were characterized by the expression of surface markers such as CD29 (67.4%) and CD44 (89.4%), using CD 45 (0.77%) as a negative control. ADSC from rabbits were successfully isolated form the inguinal region. These cells were capable to differentiate into osteogenic and adipogenic tissue when they were placed in inductive media. After each passage, there was a trend towards decreased cell growth. On the other hand, DNA fragmentation increased at each passage. ADSC had a different lipid profile when placed in control, adipogenic, or osteogenic media.
C. Selva Kumar
2011-01-01
Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol+1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...
The 18F-FDG uptake in non small cell lung carcinoma correlates with the DNA-grading of malignancy
International Nuclear Information System (INIS)
Wu Jinchang
2002-01-01
In order to evaluate correlation of glucose metabolism and DNA ploidity of tumors, the uptake of 18 F-Deoxyglucose (FDG) by PET prior to surgery and the DNA content and DNA-grading of malignancy (DNA-MG) of Schiff-stained nuclei obtained from fresh tumor fragments by means of image cytometry were studied, and thereafter the correlation between standardized uptake value (SUV) and (DNA-MG) was analysed in forty-nine patients with histologically proven non-small cell lung carcinoma (NSCLC). As a result of the DNA histograms of these 49 patients, 46(93.88%) were aneuploidy and only 3(6.12%) were tetraploid. A linear correlation of the SUV versus the (DNA-MG) (r=0.336, p=0.024) was found, demonstrating that 18 F-FDG PET as a non-invasive metabolic imaging technique, may also provide information correlated to malignant DNA patterns which may be valuable in malignant differentiation and prognostic prediction
Nucleic acid stains as indicators of Giardia muris viability following cyst inactivation.
Taghi-Kilani, R; Gyürék, L L; Millard, P J; Finch, G R; Belosevic, M
1996-06-01
A reliable viability assay for Giardia is required for the development of disinfection process design criteria and pathogen monitoring by water treatment utilities. Surveys of single-staining nucleic acid dyes (stain dead parasites only), and double-staining vital dye kits from Molecular Probes (stain live and dead parasites) were conducted to assess the viability of untreated, heat-killed, and chemically inactivated Giardia muris cysts. Nucleic acid staining results were compared to those of in vitro excystation and animal infectivity. Nucleic acid stain, designated as SYTO-9, was considered the best among the single-staining dyes for its ability to stain dead cysts brightly and its relatively slow decay rate of visible light emission following DNA binding. SYTO-9 staining was correlated to animal infectivity. A Live/Dead BacLight was found to be the better of 2 double-staining viability kits tested. Logarithmic survival ratios based on SYTO-9 and Live/Dead BacLight were compared to excystation and infectivity results for G. muris cysts exposed to ozone or free chlorine. The results indicate that SYTO-9 and Live/Dead BacLight staining is stable following treatment of cysts with chemical disinfectants.
Fragmentation of chromatin with 125I radioactive disintegrations
International Nuclear Information System (INIS)
Turner, G.N.; Nobis, P.; Dewey, W.C.
1976-01-01
The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated
Energy Technology Data Exchange (ETDEWEB)
Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu
2016-09-02
Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.
International Nuclear Information System (INIS)
Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan
2016-01-01
Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.
Directory of Open Access Journals (Sweden)
José Gregorio Martínez
2012-09-01
Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em
Polymer fragmentation in extensional flow
Energy Technology Data Exchange (ETDEWEB)
Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech
2001-06-01
In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.
Directory of Open Access Journals (Sweden)
Yuqian Luo
2016-11-01
Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.
Energy Technology Data Exchange (ETDEWEB)
Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others
1994-09-15
In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.
Energy Technology Data Exchange (ETDEWEB)
Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)
2012-06-01
Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.
Characterisation of medieval yellow silver stained glass from Convento de Cristo in Tomar, Portugal
Energy Technology Data Exchange (ETDEWEB)
Delgado, J. [Dep. de Conservacao e Restauro, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); Vilarigues, M. [Dep. de Conservacao e Restauro, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); VICARTE, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); Ruivo, A. [VICARTE, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); REQUIMTE, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); Corregidor, V.; Silva, R.C. da [Unidade de Fisica e Aceleradores, LFI, ITN, E.N.10, 2686-953 Sacavem (Portugal); CFNUL, Av., Prof. Gama Pinto n 2, 1649-003 Lisboa (Portugal); Alves, L.C., E-mail: lcalves@itn.pt [Unidade de Fisica e Aceleradores, LFI, ITN, E.N.10, 2686-953 Sacavem (Portugal); CFNUL, Av., Prof. Gama Pinto n 2, 1649-003 Lisboa (Portugal)
2011-10-15
Yellow decoration effects in stained glasses using silver staining were first applied in the beginning of the 14th century. The glass piece being decorated was usually painted on its side intended to be facing the exterior environment, and then fired to temperatures between 500 and 650 {sup o}C, resulting in colours ranging from pale lemon to deep orange. Stained glass fragments painted by this process and belonging to the Convento de Cristo, in Tomar, Portugal, were characterised using micro-PIXE, and complemented with other analytical techniques, namely UV-Vis spectroscopy and XRF. Preliminary analysis showed that a mixture of Ag and Cu was used for the production of the yellow staining. In order to understand this staining process and the influence of the firing temperature on the resulting colours, several soda and potash glasses with compositions similar to those of medieval glasses were produced and characterised. The role played by the addition of Cu in the final colours was also investigated.
Directory of Open Access Journals (Sweden)
D. Vaamonde
2014-12-01
Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Ahrens, Peter
2002-01-01
, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...
Synchronization of DNA array replication kinetics
Manturov, Alexey O.; Grigoryev, Anton V.
2016-04-01
In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.
Identification of radiation treatment of foods using novel technique of 'DNA comet assay'
International Nuclear Information System (INIS)
Khan, A.A.; Khan, H.M.; Wasim, M.A.
2005-01-01
Treatment of food using ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests and to extend shelf life thereby contributing to safer and more plentiful food supply. Food control agencies throughout the world need some reliable, simple and rapid methods for the detection foods to ensure free choice of consumer and to enforce labeling. The DNA comet assay offers great potential as a rapid tool to screen irradiated and unirradiated samples of several kinds of foods. In the present study samples of fresh and frozen beef has investigated for the detection of irradiation treatment. The samples were subjected to radiation doses of 0,4.5 and 7 KGy and were stored in freezer before analysis. The cells were extracted into cold PBS solutions, embedded into agarose gel on microscope slides, lysed and eletrophoressed at a voltage of 2V/cm for 2 minutes. The fragmented DNA as a irradiation treatment was stretched in the gel producing the dose dependent comets. These comets were visible using a simple transmission microscope after silver staining. The controlled and irradiation samples of meat were clearly distinguishable on the basis of the stained patterns of DNA in from of round or conical intact cells for unirradiated samples or in from of comets for irradiated samples. It is therefore concluded that DNA comet Assay offers a potential to screen unirradiated and irradiated meat samples. (author)
Detection of radiation treatment of meat by novel techniques of DNA comet assay
International Nuclear Information System (INIS)
Khan, A.A.; Khan, H.M.
2002-01-01
Treatment of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests and to extend shelf life; thereby contributing to safer and more plentiful food supply. Food control agencies throughout the world need some reliable, simple and rapid methods for detection of irradiated foods to ensure free choice of consumer and to enforce labeling. The DNA comet assay offers great potential as a rapid tool to screen irradiated and unirradiated samples of several kinds of foods. In the present study, frozen beef has been investigated for detection of irradiation treatment. The samples were subjected to radiation doses of 0,4,5 and 7.0 kGy and were stored in freezer before analysis. The cells were extracted into cold PBS solutions, embedded into the agarose gel on microscope slides, lysed and electrophoressed at a voltage of 2v/cm for 2 min. The fragmented DNA as a result of irradiation treatment was stretched in the gel producing the dose dependent comets. These comets were visible using a simple transmission microscope after silver staining. The controlled and irradiated samples of meat were clearly distinguishable on the basis of the stained patterns of DNA in form of round or conical intact cells for unirradiated samples or in form of comets for irradiated samples. It is therefore, concluded that 'DNA Comet Assay' offers a potential to screen unirradiated and irradiated meat samples. (author)
Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin
2017-04-15
Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.
ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping
DEFF Research Database (Denmark)
Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir
2008-01-01
A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...
Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.
2014-01-01
Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...
Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi
2011-07-15
presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.
leaves extracts as counter stain in gram staining reaction 56
African Journals Online (AJOL)
DR. AMINU
is a stain with color contrasting to the principal stain, making the stained ... technology today, the Gram's staining method remains ... was aimed at employing the use of Henna leaves extract as ... fragrant, white or rose flowers in clusters. It is.
DEFF Research Database (Denmark)
Stronati, A; Manicardi, G C; Cecati, M
2006-01-01
Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...
Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko
2008-04-01
The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.
International Nuclear Information System (INIS)
Shabon, M.H.; El-Bedewi, A.F.
2005-01-01
The delivery of active agents to the skin by liposome carriers received great interest during the last three decades. This is based on their potential to enclose various types of biological materials and to deliver them to diverse cell types. Recent work suggests that liposomes as vehicles for topical drug delivery may be superior to conventional preparations. Also, topical application of DNA repair enzymes to irradiated skin increases the rate of repair of DNA potentially damaged cells. Moreover, thymidine dinucleotide is a new skin photo-protective agent against non-ionizing radiation through induction of DNA repair. Gamma irradiation can produce DNA damage in human skin. DNA mutations have an important role in the development of skin cancer and precancerous skin lesions. Albino rats were irradiated with Cobalt-60 gamma radiation with different doses (0.5, 1.5, 3 Gy), and were treated by either thymidine dinucleotide or liposomally entrapped DNA repair enzymes topically 24 hours before irradiation. Evaluation was done histopathologically by H and E stain. Computerized image analyzer using Masson's trichrome stain was also done. Gamma radiation produced epidermal thinning and dermal inflammatory cells together with collagen fragmentation and clumping in a dose-dependent manner. Comparing between both thymidine dinucleotide and liposomally entrapped DNA repair enzymes pretreated and irradiated rats. Low dose irradiation (0.5 Gy) together with previous drugs showed preservation of epidermis with no inflammatory cells and also it maintained the normal architecture of collagen bundles. However, they were ineffective with higher doses. In conclusion our results may suggest that the effects of gamma radiation on the skin at low dose could be minimized by the use of these drugs before exposure
Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn
2014-01-01
The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.
Analysis of Cellular DNA Content by Flow Cytometry.
Darzynkiewicz, Zbigniew; Huang, Xuan; Zhao, Hong
2017-11-01
Cellular DNA content can be measured by flow cytometry with the aim of : (1) revealing cell distribution within the major phases of the cell cycle, (2) estimating frequency of apoptotic cells with fractional DNA content, and/or (3) disclosing DNA ploidy of the measured cell population. In this unit, simple and universally applicable methods for staining fixed cells are presented, as are methods that utilize detergents and/or proteolytic treatment to permeabilize cells and make DNA accessible to fluorochrome. Additionally, supravital cell staining with Hoechst 33342, which is primarily used for sorting live cells based on DNA-content differences for their subsequent culturing, is described. Also presented are methods for staining cell nuclei isolated from paraffin-embedded tissues. Available algorithms are listed for deconvolution of DNA-content-frequency histograms to estimate percentage of cells in major phases of the cell cycle and frequency of apoptotic cells with fractional DNA content. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley and Sons, Inc.
Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI
DEFF Research Database (Denmark)
Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels
1988-01-01
Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....
Electronic transport in methylated fragments of DNA
Energy Technology Data Exchange (ETDEWEB)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2015-11-16
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Electronic transport in methylated fragments of DNA
International Nuclear Information System (INIS)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.
2015-01-01
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics
... Safe Videos for Educators Search English Español Port-Wine Stains KidsHealth / For Parents / Port-Wine Stains What's ... Manchas de vino de oporto What Are Port-Wine Stains? A port-wine stain is a type ...
A flow-cytometric gram-staining technique for milk-associated bacteria.
Holm, Claus; Jespersen, Lene
2003-05-01
A Gram-staining technique combining staining with two fluorescent stains, Oregon Green-conjugated wheat germ agglutinin (WGA) and hexidium iodide (HI) followed by flow-cytometric detection is described. WGA stains gram-positive bacteria while HI binds to the DNA of all bacteria after permeabilization by EDTA and incubation at 50 degrees C for 15 min. For WGA to bind to gram-positive bacteria, a 3 M potassium chloride solution was found to give the highest fluorescence intensity. A total of 12 strains representing some of the predominant bacterial species in bulk tank milk and mixtures of these were stained and analyzed by flow cytometry. Overall, the staining method showed a clear differentiation between gram-positive and gram-negative bacterial populations. For stationary-stage cultures of seven gram-positive bacteria and five gram-negative bacteria, an average of 99% of the cells were correctly interpreted. The method was only slightly influenced by the growth phase of the bacteria or conditions such as freezing at -18 degrees C for 24 h. For any of these conditions, an average of at least 95% of the cells were correctly interpreted. When stationary-stage cultures were stored at 5 degrees C for 14 days, an average of 86% of the cells were correctly interpreted. The Gram-staining technique was applied to the flow cytometry analysis of bulk tank milk inoculated with Staphylococcus aureus and Escherichia coli. These results demonstrate that the technique is suitable for analyzing milk samples without precultivation.
DNA polymorphism in the living fossil Ginkgo biloba from the eastern United States.
Kuddus, Ruhul H; Kuddus, Nayema N; Dvorchik, Igor
2002-02-01
Random amplified polymorphic DNA (RAPD) analysis is a valuable tool in studying inter- and intra-specific genetic variations, patterns of gene expression, and for the identification of specific genes using nearly isogenic variants. Here we used RAPD analysis to study the genetic variation in Ginkgo biloba grown in the eastern United States. Our results support the evidence that Southern blot hybridization of RAPD using probes made from cloned DNA fragments allows a more accurate analysis of the RAPD pattern than dye-stained gels or Southern blot hybridization of RAPD blots using probes made from purified PCR products. Using these techniques, we observed a high degree of relatedness among plants grown in certain localities although significant genetic variation may exist in the species, and could be a possible explanation for the observed variations in the efficacy of medications derived from G. biloba extract.
International Nuclear Information System (INIS)
Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut
2011-01-01
Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.
Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei
2013-01-01
A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746
Stained glasses under the nuclear microprobe: A window into history
Energy Technology Data Exchange (ETDEWEB)
Vilarigues, M. [Dep. de Conservacao e Restauro and R and D Unit Vidro e da Ceramica Para as Artes, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal)], E-mail: mgv@fct.unl.pt; Fernandes, P. [Dep. de Conservacao e Restauro and R and D Unit Vidro e da Ceramica Para as Artes, FCT-UNL, Quinta da Torre, 2829-516 Caparica (Portugal); Alves, L.C.; Silva, R.C. da [Dep. Fisica, LFI, ITN, E.N.10, 2686-953 Sacavem (Portugal)
2009-06-15
Stained glass fragments from the 15th, 16th and 20th centuries, belonging to Mosteiro de Santa Maria da Vitoria, Batalha (Portugal), were characterised non-destructively in a nuclear microprobe. The work aimed at finding the composition of the glasses and glass paintings and relating these with the corresponding production periods. The elemental compositions of the glass fragments were obtained by means of scanning micro-beam Particle Induced X-ray Emission ({mu}-PIXE) spectrometry in selected cross-sections. These were complemented by micro X-Ray fluorescence spectrometry. Characterisation of colour was performed by optical absorption spectroscopy in the UV-vis range, while the corrosion products were identified by optical microscopy and {mu}-FTIR (Fourier Transform Infra Red) spectroscopy in combination with the data generated by {mu}-PIXE. Nuclear microprobe analysis allowed unveiling the compositions and structures, in particular of glass paintings and corrosion products. While it is not surprising that Fe, Cu and Pb were the main elements identified in the grisaille paintings of all studied periods, as well as Ag and Cu found in the glasses decorated with yellow silver painting, their distribution gave important clues on the materials and techniques used to manufacture these stained glasses. Furthermore, it allowed establishing a definite relation between the compositions found and the periods of production, with the added bonus of correctly reassigning the manufacturing period of some samples.
Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping
2004-10-01
Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.
RAPD analysis of alfalfa DNA mutation via N+ implantation
International Nuclear Information System (INIS)
Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang
2003-01-01
Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Comparison of special stains for keratin with routine hematoxylin and eosin stain.
Rao, Roopa S; Patil, Shankargouda; Majumdar, Barnali; Oswal, Rakesh G
2015-03-01
Keratins are the most abundant proteins and are characteristic findings in many epithelial pathologies, making it a diagnostically important marker, both histopathologically and immunohistochemically. Since, immunohistochemistry is an expensive diagnostic tool, special stains to detect the degree of keratinization could serve as a faster and economic option. The aim of the present study was to compare the efficacy of special stains for keratin with standard hematoxylin and eosin stain (H and E). Objectives include: (i) To subject the diagnosed cases of keratin disorders to the selected special stains: Ayoub-shklar method, Dane-Herman method, Alcian blue -periodic acid Schiff 's (PAS), rapid papanicolaou (PAP) and Gram's stain. (ii) To compare the staining specificity and staining intensity of special stains with respect to routine hematoxylin and eosin (H and E) stain. (iii) To compare the efficacy of special stains to routine H and E stain in identification of the type of keratin present in the selected cases. A total of 80 cases of known pathology for keratin were retrieved from the department archive, which included 10 each of normal gingiva, hyperkeratosis, squamous papilloma, verrucous hyperplasia, verrucous carcinoma, well-differentiated squamous cell carcinoma, orthokeratinized odontogenic cyst and keratocystic odontogenic tumors. Six sections of 4 µ each from the paraffin blocks were made, stained with H and E and the special stains and these were evaluated by 2 pathologists based on the modified scoring criteria from Rahma Al-Maaini and Philip Bryant 2008. The results were tabulated using Chi square and kappa statistics. The statistical values for identification of the type of keratinization was insignificant showing that ortho and parakeratinized epithelia could be correctly identified by both H and E as well as all the special stains. Furthermore, all the special stains showed a positive result and statistical significance (P < 0.001) with respect to
Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing
2007-05-02
An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.
Arora, Shagun; Tandon, Simran
2015-01-01
In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.
Gallo, Alessandra; Boni, Raffaele; Tosti, Elisabetta
2018-01-01
The viability of spermatozoa is a crucial parameter to evaluate their quality that is an important issue in ecotoxicological studies. Here, a new method has been developed to rapidly determine the viability of spermatozoa in three marine invertebrates: the ascidian Ciona intestinalis, the sea urchin Paracentrotus lividus and the mollusc Mytilus galloprovincialis. This method employed the dual DNA fluorescent staining coupled with spectrofluorimetric analysis. The dual fluorescent staining used the SYBR-14 stained live spermatozoa and propidium iodide stained degenerated cells that had lost membrane integrity. Stain uptake was assessed by confocal microscopy and then the percentage of live and dead spermatozoa was quantified by spectrofluorimetric analysis. The microscopic examination revealed three populations of spermatozoa: living-SYBR-14 stained, dead-PI stained, and dying-doubly stained spermatozoa. The fluorescence emission peak values recorded in a spectrofluorimeter provide the portion of live and dead spermatozoa showing a significant negative correlation. The stain combination was further validated using known ratios of live and dead spermatozoa. The present study demonstrated that the dual DNA staining with SYBR-14 and propidium iodide was effective in assessing viability of spermatozoa in marine invertebrates and that spectrofluorimetric analysis can be successfully employed to evaluate the percentage of live and dead spermatozoa. The method develop herein is simple, accurate, rapid, sensitive, and cost-effective, so it could be a useful tool by which marine pollutants may be screened for spermiotoxicity. Copyright © 2017 Elsevier Inc. All rights reserved.
A CCD-based system for the detection of DNA in electrophoresis gels by UV absorption
International Nuclear Information System (INIS)
Mahon, A.R.; MacDonald, J.H.; Mainwood, A.; Ott, R.J.
1999-01-01
A method and apparatus for the detection and quantification of large fragments of unlabelled nucleic acids in agarose gels is presented. The technique is based on ultraviolet (UV) absorption by nucleotides. A deuterium source illuminates individual sample lanes of an electrophoresis gel via an array of optical fibres. As DNA bands pass through the illuminated region of the gel the amount of UV light transmitted is reduced because of absorption by the DNA. During electrophoresis the regions of DNA are detected on-line using a UV-sensitive charge coupled device (CCD). As the absorption coefficient is proportional to the mass of DNA the technique is inherently quantitative. The mass of DNA in a region of the gel is approximately proportional to the integrated signal in the corresponding section of the CCD image. This system currently has a detection limit of less than 1.25 ng compared with 2-10 ng for the most popular conventional technique, ethidium bromide (EtBr) staining. In addition the DNA sample remains in its native state. The removal of the carcinogenic dye from the detection procedure greatly reduces associated biological hazards. (author)
Directory of Open Access Journals (Sweden)
A. Yu. Popova
2015-01-01
Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm.
Application of DNA fingerprints for cell-line individualization.
Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J
1990-01-01
DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...
Energy Technology Data Exchange (ETDEWEB)
Xiong Hairong [Institute of Molecular Medicine and Genetics, Georgia Health Sciences University, Augusta, GA (Georgia); State Key Laboratory of Virology, Institute of Medical Virology, Wuhan University School of Medicine, Wuhan (China); Lee, Robert J. [Division of Pharmaceutics, College of Pharmacy, Ohio State University, Columbus, OH (United States); Haura, Eric B. [Thoracic Oncology and Experimental Therapeutics Programs, H. Lee Moffitt Cancer Center and Research Institute, Tampa, FL (United States); Edwards, John G. [Apeliotus Technologies, Inc., Atlanta, GA (United States); Dynan, William S. [Institute of Molecular Medicine and Genetics, Georgia Health Sciences University, Augusta, GA (Georgia); Li Shuyi, E-mail: sli@georgiahealth.edu [Institute of Molecular Medicine and Genetics, Georgia Health Sciences University, Augusta, GA (Georgia); Apeliotus Technologies, Inc., Atlanta, GA (United States)
2012-07-01
Purpose: To inhibit DNA double-strand break repair in tumor cells by delivery of a single-chain antibody variable region fragment (ScFv 18-2) to the cell nucleus. ScFv 18-2 binds to a regulatory region of the DNA-dependent protein kinase (DNA-PK), an essential enzyme in the nonhomologous end-joining pathway, and inhibits DNA end-joining in a cell-free system and when microinjected into single cells. Development as a radiosensitizer has been limited by the lack of a method for intranuclear delivery to target cells. We investigated a delivery method based on folate receptor-mediated endocytosis. Methods and Materials: A recombinant ScFv 18-2 derivative was conjugated to folate via a scissile disulfide linker. Folate-ScFv 18-2 was characterized for its ability to be internalized by tumor cells and to influence the behavior of ionizing radiation-induced repair foci. Radiosensitization was measured in a clonogenic survival assay. Survival curves were fitted to a linear-quadratic model, and between-group differences were evaluated by an F test. Sensitization ratios were determined based on mean inhibitory dose. Results: Human KB and NCI-H292 lung cancer cells treated with folate-conjugated ScFv 18-2 showed significant radiosensitization (p < 0.001). Sensitization enhancement ratios were 1.92 {+-} 0.42 for KB cells and 1.63 {+-} 0.13 for NCI-H292 cells. Studies suggest that treatment inhibits repair of radiation-induced DSBs, as evidenced by the persistence of {gamma}-H2AX-stained foci and by inhibition of staining with anti-DNA-PKcs phosphoserine 2056. Conclusions: Folate-mediated endocytosis is an effective method for intranuclear delivery of an antibody-derived DNA repair inhibitor.
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C
1998-10-01
The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.
DNA AND THE FINE STRUCTURE OF SYNAPTIC CHROMOSOMES IN THE DOMESTIC ROOSTER (GALLUS DOMESTICUS)
Coleman, James R.; Moses, Montrose J.
1964-01-01
The indium trichloride method of Watson and Aldridge (38) for staining nucleic acids for electron microscopy was employed to study the relationship of DNA to the structure of the synaptinemal complex in meiotic prophase chromosomes of the domestic rooster. The selectivity of the method was demonstrated in untreated and DNase-digested testis material by comparing the distribution of indium staining in the electron microscope to Feulgen staining and ultraviolet absorption in thicker sections seen with the light microscope. Following staining by indium, DNA was found mainly in the microfibril component of the synaptinemal complex. When DNA was known to have been removed from aldehyde-fixed material by digestion with DNase, indium stainability was also lost. However, staining of the digested material with non-selective heavy metal techniques demonstrated the presence of material other than DNA in the microfibrils and showed that little alteration in appearance of the chromosome resulted from DNA removal. The two dense lateral axial elements of the synaptinemal complex, but not the central one to any extent, also contained DNA, together with non-DNA material. PMID:14228519
Immunohistochemical analysis of forensic evidence from a double homicide.
Miller, Rodney T; Grantham, Ross; Lockett, Bruce; Temple-Camp, Cynric; Pang, James
2002-12-01
We report the use of immunohistochemical staining for analysis of forensic evidence from a double homicide. A 38-year-old woman and her 7-year-old daughter were murdered by multiple blows to the head and face with a tomahawk, resulting in multiple fragments of brain tissue scattered about the murder scene. The victims' husband and father was the main suspect, who maintained that he was out of town on business during the evening of the murders. However, a shirt taken from the suspect's car on the morning after the murders (secured by the police before the suspect visited the murder scene) was found to have two small stains. DNA analysis on the stains showed the presence of the deceased wife's DNA, and immunohistochemical stains on shirt fragments conclusively documented the presence of deep central nervous system tissue, providing the critical piece of evidence needed to arrest and prosecute the suspect. This report demonstrates that shirt or similar cloth fragments can be processed into paraffin blocks and subsequently immunostained to search for and classify types of tissue fragments that may be present on the fabric.
Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A
2012-08-01
In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.
Purps, Josephine; Geppert, Maria; Nagy, Marion; Roewer, Lutz
2015-11-01
DNA testing is an established part of the investigation and prosecution of sexual assault. The primary purpose of DNA evidence is to identify a suspect and/or to demonstrate sexual contact. However, due to highly uneven proportions of female and male DNA in typical stains, routine autosomal analysis often fails to detect the DNA of the assailant. To evaluate the forensic efficiency of the combined application of autosomal and Y-chromosomal short tandem repeat (STR) markers, we present a large retrospective casework study of probative evidence collected in sexual-assault cases. We investigated up to 39 STR markers by testing combinations of the 16-locus NGMSElect kit with both the 23-locus PowerPlex Y23 and the 17-locus Yfiler kit. Using this dual approach we analyzed DNA extracts from 2077 biological stains collected in 287 cases over 30 months. To assess the outcome of the combined approach in comparison to stand-alone autosomal analysis we evaluated informative DNA profiles. Our investigation revealed that Y-STR analysis added up to 21% additional, highly informative (complete, single-source) profiles to the set of reportable autosomal STR profiles for typical stains collected in sexual-assault cases. Detection of multiple male contributors was approximately three times more likely with Y-chromosomal profiling than with autosomal STR profiling. In summary, 1/10 cases would have remained inconclusive (and could have been dismissed) if Y-STR analysis had been omitted from DNA profiling in sexual-assault cases. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Fragmentasi DNA Spermatozoa: Penyebab, Deteksi, dan Implikasinya pada Infertilitas Laki-Laki
Directory of Open Access Journals (Sweden)
Silvia W. Lestari
2015-12-01
Full Text Available Prediksi fertilitas laki-laki dapat dilakukan dengan analisis semen. Analisis semen konvensionalmerupakan pemeriksaan sederhana dan tidak mahal, tetapi memiliki variabilitas yang tinggi.Integritas DNA spermatozoa penting untuk transmisi informasi genetik. Fragmentasi DNAspermatozoa sebagai akibat gangguan spermatogenesis, maturasi spermatozoa, stres oksidatifdan infeksi, dapat menyebabkan infertilitas laki-laki, gangguan perkembangan embrio dan abortusberulang. Hubungan fragmentasi DNA spermatozoa dengan luaran teknologi reproduksi berbantu(TRB mengarahkan fragmentasi DNA spermatozoa sebagai pemeriksaan infertilitas laki-laki. Dariberbagai metode fragmentasi DNA spermatozoa yang umum dilakukan, sperm chromatin dispersion(SCD merupakan metode pemeriksaan fragmentasi DNA spermatozoa yang sederhana, akuratdan tidak mahal, sehingga dapat dilaksanakan di laboratorium andrologi. Selain menghasilkandiagnosis yang lebih baik, pemeriksaan fragmentasi DNA spermatozoa juga menggambarkanprognosis infertilitas termasuk luaran program TRB. Kata kunci: infertilitas laki-laki, fragmentasi DNA spermatozoa, SCD Sperm DNA Fragmentation: Etiology, Detection and Implicationto Male Infertility Abstract The prediction of male fertility is determined by semen analysis. The conventional semenanalysis is simple and inexpensive but prone to variability. The integrity of sperm DNA is essentialfor the transmission of genetic information. Fragmentation of sperm DNA as result of disruptionin spermatogenesis and sperm maturation, oxidative stress, and infection may lead to maleinfertility, abnormal embryonic development and recurrent abortion. The association betweensperm DNA fragmentation and diminished reproductive outcomes has led to the introduction ofsperm DNA fragmentation testing on the clinical assessment of male infertility. Of all the spermDNA fragmentation tests, sperm chromatin dispersion (SCD test is quite simple, accurate, andinexpensive to be conducted on
Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine
International Nuclear Information System (INIS)
Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.
1982-01-01
The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af
Extraction of ultrashort DNA molecules from herbarium specimens.
Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A
2017-02-01
DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.
Directory of Open Access Journals (Sweden)
Roberta Zappacosta
2013-01-01
Full Text Available Although HPV-DNA test and E6/E7 mRNA analyses remain the current standard for the confirmation of human papillomavirus (HPV infections in cytological specimens, no universally adopted techniques exist for the detection of HPV in formalin-fixed paraffin-embedded samples. Particularly, in routine laboratories, molecular assays are still time-consuming and would require a high level of expertise. In this study, we investigated the possible use of a novel HPV tyramide-based chromogenic in situ hybridization (CISH technology to locate HPV on tissue specimens. Then, we evaluate the potential usefulness of p16INK4a/Ki-67 double stain on histological samples, to identify cervical cells expressing HPV E6/E7 oncogenes. In our series, CISH showed a clear signal in 95.2% of the specimens and reached a sensitivity of 86.5%. CISH positivity always matched with HPV-DNA positivity, while 100% of cases with punctated signal joined with cervical intraepithelial neoplasia grade 2 or worse (CIN2+. p16/Ki67 immunohistochemistry gave an interpretable result in 100% of the cases. The use of dual stain significantly increased the agreement between pathologists, which reached 100%. Concordance between dual stain and E6/E7 mRNA test was 89%. In our series, both CISH and p16INK4a/Ki67 dual stain demonstrated high grade of performances. In particular, CISH would help to distinguish episomal from integrated HPV, in order to allow conclusions regarding the prognosis of the lesion, while p16INK4a/Ki67 dual stain approach would confer a high level of standardization to the diagnostic procedure.
Zappacosta, Roberta; Colasante, Antonella; Viola, Patrizia; D'Antuono, Tommaso; Lattanzio, Giuseppe; Capanna, Serena; Gatta, Daniela Maria Pia; Rosini, Sandra
2013-01-01
Although HPV-DNA test and E6/E7 mRNA analyses remain the current standard for the confirmation of human papillomavirus (HPV) infections in cytological specimens, no universally adopted techniques exist for the detection of HPV in formalin-fixed paraffin-embedded samples. Particularly, in routine laboratories, molecular assays are still time-consuming and would require a high level of expertise. In this study, we investigated the possible use of a novel HPV tyramide-based chromogenic in situ hybridization (CISH) technology to locate HPV on tissue specimens. Then, we evaluate the potential usefulness of p16INK4a/Ki-67 double stain on histological samples, to identify cervical cells expressing HPV E6/E7 oncogenes. In our series, CISH showed a clear signal in 95.2% of the specimens and reached a sensitivity of 86.5%. CISH positivity always matched with HPV-DNA positivity, while 100% of cases with punctated signal joined with cervical intraepithelial neoplasia grade 2 or worse (CIN2+). p16/Ki67 immunohistochemistry gave an interpretable result in 100% of the cases. The use of dual stain significantly increased the agreement between pathologists, which reached 100%. Concordance between dual stain and E6/E7 mRNA test was 89%. In our series, both CISH and p16INK4a/Ki67 dual stain demonstrated high grade of performances. In particular, CISH would help to distinguish episomal from integrated HPV, in order to allow conclusions regarding the prognosis of the lesion, while p16INK4a/Ki67 dual stain approach would confer a high level of standardization to the diagnostic procedure. PMID:24369532
DEFF Research Database (Denmark)
Nellemann, L J; Frederiksen, J; Morling, N
1996-01-01
-A and MBP-B were analyzed by vertical electrophoresis in polyacrylamide gels followed by silver staining. DNA samples from 112 unrelated Danes, 140 unrelated Greenland Eskimos, and 88 Danish mother/child pairs were analyzed. The distributions of MBP phenotypes were in Hardy-Weinberg equilibrium in both...
Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T
2007-08-01
The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.
International Nuclear Information System (INIS)
Wagner, R.
1982-01-01
Peripheral lymphocytes were exposed in vitro to 220 kV X-radiation, with doses of 0.05, 0.1, 0.2, 0.4, and 0.5 Gy, their culture and preparation was made under standardized conditions. The slides were stained using two different methods, namely FPG staining (fluorescence plus giemsa), and the conventional Feulgen orcein glacial acetic acid method. Compared to the conventional method, FPG staining achieved absolute yields of acentric fragments three times higher, and of dicentric chromosomes twice as high. A linear dose-response relationship in acentric fragments was found by the two staining methods alike, which agrees with the theory. Both staining methods revealed a linear-square dose-response relationship in dicentric chromosomes. Using FPG staining, preparing only M 1 cells for evaluation, the linear component was found to be dominant over the whole dose range applied. The conventional method, analysing M 1 and M 2 cells, revealed the square component to be the most important one. The dose-response relationships determined after FPG staining can be used for biological dosimetry. Calibration can be improved by increasing the number of cells analysed at doses [de
AFEAP cloning: a precise and efficient method for large DNA sequence assembly.
Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin
2017-11-14
Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.
Visualization of DNA in highly processed botanical materials.
Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary
2018-04-15
DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José
2016-12-01
The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.
Menon, Darsan B; Gopalakrishnan, V K
2015-01-01
The plant Plectranthus hadiensis is a rich source of many bioactive phytochemicals, especially terpenoids. The terpenoid fraction was isolated and phytochemical characterization was done using GC-MS. The aim of the present study was to find out the antiproliferative activity and the mechanism of cell death induction by the terpenoid fraction on human colon cancer cells (HCT-15). MTT assay was performed with different concentrations of the fraction (10, 20, and 50 µg/mL) to obtain IC50 value for 24 h to induce cell death. The induction of apoptosis were studied by Hoechst staining, acridine orange/ethidium bromide staining, Comet assay, DNA fragmentation, and caspase-3 activity assays. The mechanism of apoptosis induction was studied by expression analysis of antiapoptotic Bcl-2 and proapoptotic Bax using RT-PCR and also by Western blot analysis of proteins involved in the apoptotic pathway. The terpenoid fraction induced significant morphological changes and DNA fragmentation in the cells. Positive Hoechst staining and acridine orange/ethidium bromide staining indicated apoptosis induction by the fraction. DNA fragmentation, which is a characteristic feature of apoptosis, was also observed. Upregulation of caspase-3 activity and proapoptotic Bax, and the downregulation of antiapoptotic Bcl-2 and COX-2 confirmed that the apoptosis induction was via the mitochondria-dependent pathway.
Ultraviolet absorption detection of DNA in gels
International Nuclear Information System (INIS)
Mahon, A.R.
1998-01-01
A method and apparatus for the detection and quantification of large fragments of unlabelled deoxyribonucleic acid (DNA) in agarose gels is presented. The technique is based on ultra-violet (UV) absorption by nucleotides. A deuterium lamp was used to illuminate regions of an electrophoresis gel. As DNA bands passed through the illuminated region of the gel the amount of UV light transmitted was reduced due to DNA absorption. Two detection systems were investigated. In the first system, synthetic chemical vapour deposition (CVD) diamond strip detectors were used to locate regions of DNA in the gels by detecting the transmitted light. CVD diamond has a high indirect band gap of 5.45 eV and is therefore sensitive to UV photons of wavelengths < 224 nm. A number of CVD diamond samples were characterised to investigate their suitability as detectors for this application. The detectors' quantum efficiency, UV response and time response were measured. DNA bands containing as little as 20 ng were detected by the diamond. In a second system, a deuterium lamp was used to illuminate individual sample lanes of an electrophoresis gel via an array of optical fibres. During electrophoresis the regions of DNA were detected with illumination at 260 nm, using a UV-sensitive charge coupled device (CCD). As the absorption coefficient of a DNA sample is approximately proportional to its mass, the technique is inherently quantitative. This system had a detection limit of 0.25 ng compared with 2-10 ng for the most popular conventional technique, ethidium bromide (EtBr) staining. Using this detection technique, the DNA sample remains in its native state. The removal of carcinogenic dyes from the detection procedure greatly reduces associated biological hazards. (author)
Bone fragments a body can make
Energy Technology Data Exchange (ETDEWEB)
Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))
1991-05-01
Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.
Sequence specificity of DNA cleavage by Micrococcus luteus γ endonuclease
International Nuclear Information System (INIS)
Hentosh, P.; Henner, W.D.; Reynolds, R.J.
1985-01-01
DNA fragments of defined sequence have been used to determine the sites of cleavage by γ-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus γ endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to γ radiation
Comparison of algorithms for blood stain detection applied to forensic hyperspectral imagery
Yang, Jie; Messinger, David W.; Mathew, Jobin J.; Dube, Roger R.
2016-05-01
Blood stains are among the most important types of evidence for forensic investigation. They contain valuable DNA information, and the pattern of the stains can suggest specifics about the nature of the violence that transpired at the scene. Early detection of blood stains is particularly important since the blood reacts physically and chemically with air and materials over time. Accurate identification of blood remnants, including regions that might have been intentionally cleaned, is an important aspect of forensic investigation. Hyperspectral imaging might be a potential method to detect blood stains because it is non-contact and provides substantial spectral information that can be used to identify regions in a scene with trace amounts of blood. The potential complexity of scenes in which such vast violence occurs can be high when the range of scene material types and conditions containing blood stains at a crime scene are considered. Some stains are hard to detect by the unaided eye, especially if a conscious effort to clean the scene has occurred (we refer to these as "latent" blood stains). In this paper we present the initial results of a study of the use of hyperspectral imaging algorithms for blood detection in complex scenes. We describe a hyperspectral imaging system which generates images covering 400 nm - 700 nm visible range with a spectral resolution of 10 nm. Three image sets of 31 wavelength bands were generated using this camera for a simulated indoor crime scene in which blood stains were placed on a T-shirt and walls. To detect blood stains in the scene, Principal Component Analysis (PCA), Subspace Reed Xiaoli Detection (SRXD), and Topological Anomaly Detection (TAD) algorithms were used. Comparison of the three hyperspectral image analysis techniques shows that TAD is most suitable for detecting blood stains and discovering latent blood stains.
RNA/DNA co-analysis from human menstrual blood and vaginal secretion stains
DEFF Research Database (Denmark)
Haas, Claus; Hanson, E; Anjos, M J
2014-01-01
housekeeping genes for their suitability as reference genes. Six menstrual blood and six vaginal secretion stains, two dilution series (1/4-1/64 pieces of a menstrual blood/vaginal swab) and, optionally, bona fide or mock casework samples of human or non-human origin were analyzed by 24 participating...
Directory of Open Access Journals (Sweden)
Erwan Quéméré
Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the
Haas, Jan M. de; Hille, Jacques; Kors, Frank; Meer, Bert van der; Kool, Ad J.; Folkerts, Otto; Nijkamp, H. John J.
1991-01-01
Four Petunia hybrida mitochondrial (mt) DNA fragments have been isolated, sequenced, localized on the physical map and analyzed for their ability to initiate specific DNA synthesis. When all four mtDNA fragments were tested as templates in an in vitro DNA synthesizing lysate system, developed from
Halogen-containing thiazole orange analogues – new fluorogenic DNA stains
Directory of Open Access Journals (Sweden)
Aleksey A. Vasilev
2017-12-01
Full Text Available Novel asymmetric monomeric monomethine cyanine dyes 5a–d, which are analogues of the commercial dsDNA fluorescence binder thiazole orange (TO, have been synthesized. The synthesis was achieved by using a simple, efficient and environmetally benign synthetic procedure to obtain these cationic dyes in good to excellent yields. Interactions of the new derivatives of TO with dsDNA have been investigated by absorption and fluorescence spectroscopy. The longest wavelength absorption bands in the UV–vis spectra of the target compounds are in the range of 509–519 nm and these are characterized by high molar absorptivities (63000–91480 L·mol−1·cm−1. All investigated dyes from the series are either not fluorescent or their fluorescence is quite low, but they become strongly fluorescent after binding to dsDNA. The influence of the substituents attached to the chromophores was investigated by combination of spectroscopic (UV–vis and fluorescence spectroscopy and theoretical (DFT and TDDFT calculations methods.
International Nuclear Information System (INIS)
Ermolaeva, N.V.; Vodolazskaya, N.A.
1978-01-01
It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation
Bacterial DNA in water and dialysate: detection and significance for patient outcomes.
Handelman, Garry J; Megdal, Peter A; Handelman, Samuel K
2009-01-01
The fluid used for hemodialysis may contain DNA fragments from bacteria, which could be harmful for patient outcomes. DNA fragments from bacteria, containing the nonmethylated CpG motif, can trigger inflammation through the monocyte and lymphocyte Toll-like receptor 9, and these DNA fragments have been observed in dialysate. The fragments may transfer across the dialyzer into the patient's bloodstream during hemodialysis treatment. During hemodiafiltration, the fragments would be introduced directly into the bloodstream. The DNA fragments may arise from biofilm in the pipes of the water system, from growth of bacteria in the water, or as contaminants in the bicarbonate and salt mixture used for preparation of dialysate. Current filtration methods, such as Diasafe filters, are not able to remove these fragments. It would be prudent to seek to reduce or eliminate these contaminants. However, the cost and effort of decreasing bacterial DNA content may ultimately require substantial facility improvements; we therefore need to fund research studies to determine if modifications to reduce bacterial DNA content are clinically warranted. This research will require methods to accurately determine the species of bacteria that contribute the DNA, since this information will allow the source to be established as biofilm, bicarbonate mixtures, or other problems in the dialysis system such as bacterial growth or leakage during water preparation. In this review, the evidence for bacterial DNA fragments will be examined and suggestions for further studies will be described.
Goto, N
1987-09-01
This paper describes a new series of staining methods which can discriminatively demonstrate every structure of the nervous system, including axons and capillaries, in animal and human materials. Methods described in this paper consist of one primary stain, luxol fast blue-periodic acid Schiff-hematoxylin (LPH) and six different subsidiary staining methods. The LPH triple stain can precisely differentiate the following structures: neurons (Nissl bodies, cytoplasm, nuclear membrane and nucleolus), various kinds of nuclei (glia, ependyma, endothelium, leucocyte, connective tissue, etc.), myelin sheaths, neuronal processes (axons and dendrites), reacted glial cell bodies (protoplasmic astrocytes, foamy cells, etc.), blood vessels (arteries, veins and capillaries), meninges, intervening connective tissue, erythrocytes, lipofuscin granules, amyloid bodies, and others. Subsidiary staining methods are also described briefly. Applications are discussed in the context of staining technology and neuromorphological research.
DNA based radiological dosimetry technology
International Nuclear Information System (INIS)
Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin
2008-01-01
Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)
DNA polymerase beta participates in mitochondrial DNA repair
DEFF Research Database (Denmark)
Sykora, P; Kanno, S; Akbari, M
2017-01-01
We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...
Coico, Richard
2005-10-01
Named after Hans Christian Gram who developed the method in 1884, the Gram stain allows one to distinguish between Gram-positive and Gram-negative bacteria on the basis of differential staining with a crystal violet-iodine complex and a safranin counterstain. The cell walls of Gram-positive organisms retain this complex after treatment with alcohol and appear purple, whereas gram-negative organisms decolorize following such treatment and appear pink. The method described here is useful for assessing bacterial contamination of tissue culture samples or for examining the Gram stain status and morphological features of bacteria isolated from mixed or isolated bacterial cultures.
Telomere Restriction Fragment (TRF) Analysis.
Mender, Ilgen; Shay, Jerry W
2015-11-20
While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of
Heat degradation of eukaryotic and bacterial DNA: an experimental model for paleomicrobiology
Directory of Open Access Journals (Sweden)
Nguyen-Hieu Tung
2012-09-01
Full Text Available Abstract Background Theoretical models suggest that DNA degradation would sharply limit the PCR-based detection of both eukaryotic and prokaryotic DNA within ancient specimens. However, the relative extent of decay of eukaryote and prokaryote DNA over time is a matter of debate. In this study, the murine macrophage cell line J774, alone or infected with Mycobacterium smegmatis bacteria, were killed after exposure to 90°C dry heat for intervals ranging from 1 to 48 h in order to compare eukaryotic cells, extracellular bacteria and intracellular bacteria. The sizes of the resulting mycobacterial rpoB and murine rpb2 homologous gene fragments were then determined by real-time PCR and fluorescent probing. Findings The cycle threshold (Ct values of PCR-amplified DNA fragments from J774 cells and the M. smegmatis negative controls (without heat exposure varied from 26–33 for the J774 rpb2 gene fragments and from 24–29 for M. smegmatis rpoB fragments. After 90°C dry heat incubation for up to 48 h, the Ct values of test samples increased relative to those of the controls for each amplicon size. For each dry heat exposure time, the Ct values of the 146-149-bp fragments were lower than those of 746-747-bp fragments. During the 4- to 24-h dry heat incubation, the non-infected J774 cell DNA was degraded into 597-bp rpb2 fragments. After 48 h, however, only 450-bp rpb2 fragments of both non-infected and infected J774 cells could be amplified. In contrast, the 746-bp rpoB fragments of M. smegmatis DNA could be amplified after the 48-h dry heat exposure in all experiments. Infected and non-infected J774 cell DNA was degraded more rapidly than M. smegmatis DNA after dry heat exposure (ANOVA test, p Conclusion In this study, mycobacterial DNA was more resistant to dry-heat stress than eukaryotic DNA. Therefore, the detection of large, experimental, ancient mycobacterial DNA fragments is a suitable approach for paleomicrobiological studies.
Sequence analysis of mitochondrial DNA hypervariable region III of ...
African Journals Online (AJOL)
The aims of this research were to study mitochondrial DNA hypervariable region III and establish the degree of variation characteristic of a fragment. The mitochondrial DNA (mtDNA) is a small circular genome located within the mitochondria in the cytoplasm of the cell and a smaller 1.2 kb pair fragment, called the control ...
Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika
2018-03-12
Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death
Wood, S; Starr, T V; Shukin, R J
1986-01-01
We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441
Homology of yeast photoreactivating gene fragment with human genomic digests
International Nuclear Information System (INIS)
Meechan, P.J.; Milam, K.M.; Cleaver, J.E.
1984-01-01
Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes
Directory of Open Access Journals (Sweden)
Yoon Kun-Ho
2002-04-01
Full Text Available Abstract Background It has become increasingly clear that β-cell failure plays a critical role in the pathogenesis of type 2 diabetes. Free-radical mediated β-cell damage has been intensively studied in type 1 diabetes, but not in human type 2 diabetes. Therefore, we studied the protein expression of the DNA repair enzyme Ogg1 in pancreases from type 2 diabetics. Ogg1 was studied because it is the major enzyme involved in repairing 7,8-dihydro-8-oxoguanosine DNA adducts, a lesion previously observed in a rat model of type 2 diabetes. Moreover, in a gene expression screen, Ogg1 was over-expressed in islets from a human type 2 diabetic. Methods Immunofluorescent staining of Ogg1 was performed on pancreatic specimens from healthy controls and patients with diabetes for 2–23 years. The intensity and islet area stained for Ogg1 was evaluated by semi-quantitative scoring. Results Both the intensity and the area of islet Ogg1 staining were significantly increased in islets from the type 2 diabetic subjects compared to the healthy controls. A correlation between increased Ogg1 fluorescent staining intensity and duration of diabetes was also found. Most of the staining observed was cytoplasmic, suggesting that mitochondrial Ogg1 accounts primarily for the increased Ogg1 expression. Conclusion We conclude that oxidative stress related DNA damage may be a novel important factor in the pathogenesis of human type 2 diabetes. An increase of Ogg1 in islet cell mitochondria is consistent with a model in which hyperglycemia and consequent increased β-cell oxidative metabolism lead to DNA damage and the induction of Ogg1 expression.
Directory of Open Access Journals (Sweden)
Jingfeng Gao
Full Text Available In this study, GelGreen™ was investigated as a replacement for SYBR® Safe to stain DNA in cesium chloride (CsCl density gradients for DNA-stable isotope probing (SIP experiments. Using environmental DNA, the usage of GelGreen™ was optimized for sensitivity compared to SYBR® Safe, its optimal concentration, detection limit for environmental DNA and its application in environmental DNA-SIP assay. Results showed that GelGreen™ was more sensitive than SYBR® Safe, while the optimal dosage (15X concentration needed was approximately one-third of SYBR® Safe, suggesting that its sensitivity was three times more superior than SYBR® Safe. At these optimal parameters, the detection limit of GelGreen™-stained environmental DNA was as low as 0.2 μg, but the usage of 0.5 μg environmental DNA was recommended to produce a more consistent DNA band. In addition, a modified needle extraction procedure was developed to withdraw DNA effectively by fractionating CsCl density gradients into four or five fractions. The successful application of GelGreen™ staining with 13C-labeled DNA from enriched activated sludge suggests that this stain was an excellent alternative of SYBR® Safe in CsCl density gradients for DNA-SIP assays.
Directory of Open Access Journals (Sweden)
Olufunmilola Ibironke
2012-01-01
Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.
Investigation of DNA double strand breaks induced by α particle and 7Li ions
International Nuclear Information System (INIS)
Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong
2006-01-01
α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)
Beware of the possibility of fingerprinting techniques transferring DNA.
van Oorschot, Roland A H; Treadwell, Sally; Beaurepaire, James; Holding, Nicole L; Mitchell, Robert J
2005-11-01
Fingerprinting brushes have the potential to collect and transfer DNA during powdering. Squirrel-hair fingerprint brushes exposed to specific sets of saliva stains and brushes used in routine casework were tested for their ability to collect and transfer DNA containing material using standard DNA extraction procedures and AmpFlSTR Profiler Plus amplification and typing procedures. The tests found that the risk of transferring DNA during powdering and having a detrimental impact on the analysis increases if the examiner powders over either biological stains (such as blood or saliva) or very fresh prints and uses more sensitive PCR amplification and typing procedures. We advocate caution when powdering prints from which DNA may also be collected and provide options for consideration to limit the risk of transferred DNA contamination while fingerprinting.
Methods of introducing nucleic acids into cellular DNA
Energy Technology Data Exchange (ETDEWEB)
Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.
2017-06-27
A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.
DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA
DEFF Research Database (Denmark)
Christensen, H.; Angen, Øystein; Mutters, R.
2000-01-01
The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...
Cut-and-Paste of DNA Using an Artificial Restriction DNA Cutter
Directory of Open Access Journals (Sweden)
Makoto Komiyama
2013-02-01
Full Text Available DNA manipulations using a completely chemistry-based DNA cutter (ARCUT have been reviewed. This cutter, recently developed by the authors, is composed of Ce(IV/EDTA complex and two strands of pseudo-complementary peptide nucleic acid. The site-selective scission proceeds via hydrolysis of targeted phosphodiester linkages, so that the resultant scission fragments can be easily ligated with other fragments by using DNA ligase. Importantly, scission-site and site-specificity of the cutter are freely tuned in terms of the Watson–Crick rule. Thus, when one should like to manipulate DNA according to the need, he or she does not have to think about (1 whether appropriate “restriction enzyme sites” exist near the manipulation site and (2 whether the site-specificity of the restriction enzymes, if any, are sufficient to cut only the aimed position without chopping the DNA at non-targeted sites. Even the human genome can be manipulated, since ARCUT can cut the genome at only one predetermined site. Furthermore, the cutter is useful to promote homologous recombination in human cells, converting a site to desired sequence. The ARCUT-based DNA manipulation should be promising for versatile applications.
Piñar, Guadalupe; Garcia-Valles, Maite; Gimeno-Torrente, Domingo; Fernandez-Turiel, Jose Luis; Ettenauer, Jörg; Sterflinger, Katja
2013-10-01
We investigated the decayed historical church window glasses of two Catalonian churches, both under Mediterranean climate. Glass surfaces were studied by scanning electron microscopy (SEM), energy dispersive spectrometry (EDS), and X-ray diffraction (XRD). Their chemical composition was determined by wavelength-dispersive spectrometry (WDS) microprobe analysis. The biodiversity was investigated by molecular methods: DNA extraction from glass, amplification by PCR targeting the16S rRNA and ITS regions, and fingerprint analyses by denaturing gradient gel electrophoresis (DGGE). Clone libraries containing either PCR fragments of the bacterial 16S rDNA or the fungal ITS regions were screened by DGGE. Clone inserts were sequenced and compared with the EMBL database. Similarity values ranged from 89 to 100% to known bacteria and fungi. Biological activity in both sites was evidenced in the form of orange patinas, bio-pitting, and mineral precipitation. Analyses revealed complex bacterial communities consisting of members of the phyla Proteobacteria, Bacteroidetes, Firmicutes, and Actinobacteria. Fungi showed less diversity than bacteria, and species of the genera Cladosporium and Phoma were dominant. The detected Actinobacteria and fungi may be responsible for the observed bio-pitting phenomenon. Moreover, some of the detected bacteria are known for their mineral precipitation capabilities. Sequence results also showed similarities with bacteria commonly found on deteriorated stone monuments, supporting the idea that medieval stained glass biodeterioration in the Mediterranean area shows a pattern comparable to that on stone.
Jorgez, Carolina J; Bischoff, Farideh Z
2009-01-01
Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.
A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.
Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang
2005-12-01
The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.
Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika
2014-08-01
This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.
Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio
2010-03-31
The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.
Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra
2016-12-01
The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.
Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.
Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi
2017-01-01
Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.
Stain Deconvolution Using Statistical Analysis of Multi-Resolution Stain Colour Representation.
Directory of Open Access Journals (Sweden)
Najah Alsubaie
Full Text Available Stain colour estimation is a prominent factor of the analysis pipeline in most of histology image processing algorithms. Providing a reliable and efficient stain colour deconvolution approach is fundamental for robust algorithm. In this paper, we propose a novel method for stain colour deconvolution of histology images. This approach statistically analyses the multi-resolutional representation of the image to separate the independent observations out of the correlated ones. We then estimate the stain mixing matrix using filtered uncorrelated data. We conducted an extensive set of experiments to compare the proposed method to the recent state of the art methods and demonstrate the robustness of this approach using three different datasets of scanned slides, prepared in different labs using different scanners.
Origin of DNA in human serum and usefulness of serum as a material for DNA typing.
Takayama, T; Yamada, S; Watanabe, Y; Hirata, K; Nagai, A; Nakamura, I; Bunai, Y; Ohya, I
2001-06-01
The aims of this study were to clarify the origin of DNA in human serum and to investigate whether serum is a material available for DNA typing in routine forensic practice. Blood was donated from 10 healthy adult volunteers and stored for up to 8 days, at 4 degrees C and at room temperature. The serum DNA concentration at zero time was in the range of 5.6 to 21.8 ng/ml with a mean of 12.2+/-1.6 ng/ml. The concentrations increased with storage time. On agarose gel electrophoresis, all serum samples showed ladder patterns and the size of each band was an integer multiple of approximately 180 bp considered to be characteristic of apoptosis. DNA typing from DNA released by apoptosis was possible. Exact DNA typing of D1S80, HLA DQA1, PM, CSF1PO, TPOX, TH01 and vWA was possible for each sample. These results indicate that serum contains fragmented DNA derived from apoptosis of leukocytes, especially neutrophils, and that fragmented DNA is an appropriate material for DNA typing.
Early colonic dysplasia: comparison of differential mucin staining and tritiated thymidine labeling
International Nuclear Information System (INIS)
Chabot, J.A.; Colacchio, T.A.
1985-01-01
Controversy has arisen regarding the interpretation and significance of histochemical changes in the mucin produced by the globlet cells in colonic mucosa. The shift from sulfomucin to sialomucin, which is readily identified utilizing high iron diamine-alcian blue staining techniques, has been alternately interpreted as a specific, early dysplastic and premalignant change or a nonspecific generalized response to trauma and inflammation, among others. An attempt to clarify this issue was made by comparing mucin changes identified by high iron diamine-alcian blue staining techniques with increases in DNA synthetic activity identified utilizing autoradiographic analysis of tritiated thymidine uptake. Male Holtzman rats were treated with 15 weekly subcutaneous injections of dimethylhydrazine (30 mg/kg per week) (10 rats) or placebo (10 rats). The colons were prepared and fixed, sequential sections were stained with hematoxylin-eosin or high iron diamine-alcian blue, autoradiography was performed. Analyses of labeling index showed no difference in normal background crypts between the control and treatment groups nor in crypts adjacent to those displaying abnormal mucin staining. Crypts with abnormal mucin production (sialomucin dominant) had significantly higher labeling indexes when compared with those of control animals (p less than 0.005). These findings indicate that the shifts in mucin production identified with high iron diamine-alcian blue staining represent crypts with increased and abnormally distributed mitotic activity that is an early dysplastic response to the carcinogenic stimulus
Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples
Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel
2017-01-01
Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837
The Y4-RNA fragment, a potential diagnostic marker, exists in saliva
Directory of Open Access Journals (Sweden)
Tatsuya Ishikawa
2017-06-01
Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon
On some surprising statistical properties of a DNA fingerprinting technique called AFLP
Gort, G.
2010-01-01
AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary
Srinivasan, Krishnamoorthy; Sharma, Shyam S
2011-11-20
Endoplasmic reticulum (ER) stress has been postulated to play a crucial role in the pathophysiology of cerebral ischemic/reperfusion (I/R) injury and diabetes. Diabetes is a major risk factor and also common amongst the people who suffer from stroke. In this study, we have investigated the neuroprotective potential of sodium 4-phenylbutyrate (SPB; 30-300mg/kg), a chemical chaperone by targeting ER stress in a rat model of transient focal cerebral ischemia associated with comorbid type 2 diabetes. Intraperitoneal treatment with SPB (100 and 300mg/kg) significantly ameliorated brain I/R damage as evidenced by reduction in cerebral infarct and edema volume. It also significantly improved the functional recovery of various neurobehavioral impairments (neurological deficit score, grip strength and rota rod) evoked by I/R compared with vehicle-treatment. Further, SPB (100mg/kg) significantly reduced the DNA fragmentation as shown by prominent reduction in terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells. This effect was observed concomitantly with significant attenuation in upregulation of 78kDa glucose regulated protein (GRP78), CCAAT/enhancer binding protein homologous protein or growth arrest DNA damage-inducible gene 153 (CHOP/GADD153) and activation of caspase-12, specific markers of ER stress/apoptosis. The neuroprotection observed with SPB was independent of its effect on cerebral blood flow and blood glucose. In conclusion, this study demonstrates the neuroprotective effect of SPB owing to amelioration of ER stress and DNA fragmentation. It also suggest that targeting ER stress might offer a promising therapeutic approach and benefits against ischemic stroke associated with comorbid type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.
Multiple tag labeling method for DNA sequencing
Mathies, R.A.; Huang, X.C.; Quesada, M.A.
1995-07-25
A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.
Effect of Cisplatin on the Flexibility of Linear DNA
International Nuclear Information System (INIS)
Ji Chao; Zhang Ling-Yun; Hou Xi-Miao; Dou Shuo-Xing; Wang Peng-Ye
2011-01-01
With the aid of an atomic force microscope (AFM), we study the interaction between linear DNA fragment and cisplatin. For different cisplatin concentrations, the AFM used to observe the conformation of DNA has a gradual change. The contour length, the end-to-end distance and the local bend angles of the linear DNA fragment can be accurately measured. The persistence length of DNA interacting with cisplatin is decreased with the increasing cisplatin concentration. Furthermore, it is demonstrated that the local bend angles of DNA chains are increased by the binding interaction of cisplatin. (cross-disciplinary physics and related areas of science and technology)
International Nuclear Information System (INIS)
Eisen, L.P.; Reichman, M.E.; Thompson, E.B.; Gametchu, B.; Harrison, R.W.; Eisen, H.J.
1985-01-01
The region of the glucocorticoid receptor that reacted with a monoclonal antibody (BUGR-1) was identified. In order to identify the immunoreactive region, the rat liver glucocorticoid receptor was subjected to limited proteolysis; immunoreactive fragments were identified by Western blotting. The monoclonal antibody reacted with both the undigested Mr approximately 97,000 receptor subunit and a Mr approximately 45,000 fragment containing the steroid-binding and DNA-binding domains. Digestion by trypsin also produced two steroid-binding fragments of Mr approximately 27,000 and 31,000 which did not react with the antibody and an immunoreactive Mr approximately 16,000 fragment. This Mr approximately 16,000 fragment was shown to bind to DNA-cellulose, indicating that it contained a DNA-binding domain of the receptor. The undigested receptor must have steroid associated with it to undergo activation to a DNA-binding form. However, the Mr approximately 16,000 immunoreactive fragment binds to DNA-cellulose even if it is obtained by digestion of the steroid-free holoreceptor which does not itself bind to DNA
Peterson, Tracy S.; Spitsbergen, Jan M.; Feist, Stephen W.; Kent, Michael L.
2014-01-01
Microsporidia in histologic sections are most often diagnosed by observing spores in host tissues. Spores are easy to identify if they occur in large aggregates or xenomas when sections are stained with hematoxylin and eosin (H&E). However, individual spores are not frequently detected in host tissues with conventional H&E staining, particularly if spores are scattered within the tissues, areas of inflammation or small spores in nuclei (i.e., Nucleospora salmonis). Hence, a variety of selective stains that enhance visualization of spores are recommended. We discovered that the Luna stain, used to highlight eosinophils, red blood cells and chitin in arthropods and other invertebrates, also stains spores of Pseudoloma neurophilia. We compared this stain to the Gram, Fite’s acid fast, Giemsa, and H&E stains on eight aquatic microsporidian organisms that were readily available in our two laboratories: Loma salmonae, Glugea anomala, Pseudoloma neurophilia, Pleistophora hyphessobryconis, Pleistophora vermiformis, Glugea sp., Steinhausia mytilovum and an unidentified microsporidian from E. sinensis, UK. Based on tinctorial properties and background staining, the Luna stain performed better for detection of 6 of the 8 microsporidia. Gram stain was superior for the two microsporidia from invertebrates, Steinhausia mytilovum and the unidentified microsporidian from E. sinensis. PMID:21848126
International Nuclear Information System (INIS)
Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen
2008-01-01
Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins
Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries
Energy Technology Data Exchange (ETDEWEB)
Pröpper, Kevin [University of Göttingen, (Germany); Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Meindl, Kathrin; Sammito, Massimo [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Dittrich, Birger; Sheldrick, George M. [University of Göttingen, (Germany); Pohl, Ehmke, E-mail: ehmke.pohl@durham.ac.uk [Durham University, (United Kingdom); Usón, Isabel, E-mail: ehmke.pohl@durham.ac.uk [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Institucio Catalana de Recerca i Estudis Avancats (ICREA), (Spain); University of Göttingen, (Germany)
2014-06-01
The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite the fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.
International Nuclear Information System (INIS)
Lee, Deok Hee; Hwang, Jae Cheol; Lim, Soo Mee; Yoon, Hyun-Ki; Sung, Kyu-Bo; Song, Ho-Young
2000-01-01
Purpose: To describe the findings of pleural and pulmonary staining of the inferior phrenic artery, which can be confused with tumor staining during transarterial chemoembolization (TACE) of hepatoma.Methods: Fifteen patients who showed pleural and pulmonary staining without relationship to hepatic masses at inferior phrenic arteriography were enrolled. The staining was noted at initial TACE (n = 8), at successive TACE (n = 5), and after hepatic surgery (n = 2). The angiographic pattern, the presence of pleural change on computed tomography (CT), and clinical history were evaluated.Results: Draining pulmonary veins were seen in all cases. The lower margin of the staining corresponded to the lower margin of the pleura in 10 patients. CT showed pleural and/or pulmonary abnormalities in all cases. After embolization of the inferior phrenic artery, the accumulation of iodized oil in the lung was noted.Conclusion: Understanding the CT and angiographic findings of pleural and pulmonary staining during TACE may help differentiate benign staining from tumor staining
Influence of DNA conformation on radiation-induced single-strand breaks
International Nuclear Information System (INIS)
Barone, F.; Belli, M.; Mazzei, F.
1994-01-01
We performed experiments on two DNA fragments of about 300 bp having different conformation to test whether radiation-induced single-strand breakage is dependent on DNA conformation. Breakage analysis was carried out by denaturing polyacrylamide gel electrophoresis, which allows determination of the broken site at single nucleotide resolution. We found uniform cutting patterns in B-form regions. On the contrary, X- or γ-irradiation of curved fragments of kinetoplast DNA showed that the distribution of single-strand breaks was not uniform along the fragment, as the cleavage pattern was modulated in phase with the runs of A-T pairs. This modulation likely reflected the reduced accessibility of the sites which on hydroxyl-radical attack give rise to strand breaks. The cleavage pattern was phased with the runs of A-T pairs. Moreover, the overall yield of strand breaks was considerably lower in curved DNA fragments than in those with extended straight regions. The conformation effect found here indicates that the cleavage pattern reflects the fine structural features of DNA. (orig./MG)
DNA hybridization sensing for cytogenetic analysis
DEFF Research Database (Denmark)
Kwasny, Dorota; Dapra, Johannes; Brøgger, Anna Line
2013-01-01
are rearrangements between two chromosome arms that results in two derivative chromosomes having a mixed DNA sequence. The current detection method is a Fluorescent In situ Hybridization, which requires a use of expensive, fluorescently labeled probes that target the DNA sequences of two chromosomes involved...... in the translocation (Kwasny et al., 2012). We have developed a new double hybridization assay that allows for sorting of the DNA chromosomal fragments into separate compartment, moreover allowing for detection of the translocation. To detect the translocation it is necessary to determine that the two DNA sequences...... forming a derivative chromosome are connected, which is achieved by two subsequent hybridization steps. The first example of the translocation detection was presented on lab-on-a-disc using fluorescently labeled DNA fragments, representing the derivative chromosome (Brøgger et al., 2012). To allow...
Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI
DEFF Research Database (Denmark)
Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels
1988-01-01
Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....
Niu, Junfei; Li, Chunman; Wu, Haihui; Feng, Xianling; Su, Qingning; Li, Shihe; Zhang, Lihong; Yew, David Tai Wai; Cho, Eric Yu Pang; Sha, Ou
2015-03-01
Propidium iodide (PI) reacts with both DNA and RNA and is a commonly used fluorescent reagent for nucleic acid staining. The aim of the study was to compare the cellular staining patterns of PI with that of Nissl staining in rat nervous tissues and to report a modified staining method that selectively labels Nissl bodies in neurons. Cryosections and paraffin sections of different tissues of normal Sprague-Dawley rats, including trigeminal ganglia, dorsal root ganglia, spinal cord, liver, and small intestine, were stained by either PI or the hematoxylin and eosin method. Some sections were treated with RNase or DNase before the above staining, and some were double stained with PI and a Nissl stain. The sections were observed by light, fluorescence or confocal microscopy. Results showed strong PI signals detected as patterns of granules in the neuronal cytoplasm of all nervous tissues, whereas the staining of neuronal nuclei was weaker. In contrast, nuclei of neuroglial cells were strongly stained by PI, while the cytoplasm was not obviously stained. Pretreatment of the neural tissue with RNase abolished the PI signals. Furthermore, the PI positive granules in neuronal cytoplasm co-localized with Nissl bodies stained by the fluorescent Nissl stain. When the tissue was pretreated with DNase, PI only stained the cytoplasmic granules of neurons, but not that of glial cells. Our results show that PI stains Nissl bodies and may serve as an economical and convenient neuron marker for neuronal cell counting when specific neural markers such as antibodies are not readily available. Copyright © 2015. Published by Elsevier GmbH.
Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions.
Nakayama, Yuki; Yamaguchi, Hiromi; Einaga, Naoki; Esumi, Mariko
2016-01-01
The Qubit fluorometer is a DNA quantification device based on the fluorescence intensity of fluorescent dye binding to double-stranded DNA (dsDNA). Qubit is generally considered useful for checking DNA quality before next-generation sequencing because it measures intact dsDNA. To examine the most accurate and suitable methods for quantifying DNA for quality assessment, we compared three quantification methods: NanoDrop, which measures UV absorbance; Qubit; and quantitative PCR (qPCR), which measures the abundance of a target gene. For the comparison, we used three types of DNA: 1) DNA extracted from fresh frozen liver tissues (Frozen-DNA); 2) DNA extracted from formalin-fixed, paraffin-embedded liver tissues comparable to those used for Frozen-DNA (FFPE-DNA); and 3) DNA extracted from the remaining fractions after RNA extraction with Trizol reagent (Trizol-DNA). These DNAs were serially diluted with distilled water and measured using three quantification methods. For Frozen-DNA, the Qubit values were not proportional to the dilution ratio, in contrast with the NanoDrop and qPCR values. This non-proportional decrease in Qubit values was dependent on a lower salt concentration, and over 1 mM NaCl in the DNA solution was required for the Qubit measurement. For FFPE-DNA, the Qubit values were proportional to the dilution ratio and were lower than the NanoDrop values. However, electrophoresis revealed that qPCR reflected the degree of DNA fragmentation more accurately than Qubit. Thus, qPCR is superior to Qubit for checking the quality of FFPE-DNA. For Trizol-DNA, the Qubit values were proportional to the dilution ratio and were consistently lower than the NanoDrop values, similar to FFPE-DNA. However, the qPCR values were higher than the NanoDrop values. Electrophoresis with SYBR Green I and single-stranded DNA (ssDNA) quantification demonstrated that Trizol-DNA consisted mostly of non-fragmented ssDNA. Therefore, Qubit is not always the most accurate method for
Gram staining with an automatic machine.
Felek, S; Arslan, A
1999-01-01
This study was undertaken to develop a new Gram-staining machine controlled by a micro-controller and to investigate the quality of slides that were stained in the machine. The machine was designed and produced by the authors. It uses standard 220 V AC. Staining, washing, and drying periods are controlled by a timer built in the micro-controller. A software was made that contains a certain algorithm and time intervals for the staining mode. One-hundred and forty smears were prepared from Escherichia coli, Staphylococcus aureus, Neisseria sp., blood culture, trypticase soy broth, direct pus and sputum smears for comparison studies. Half of the slides in each group were stained with the machine, the other half by hand and then examined by four different microbiologists. Machine-stained slides had a higher clarity and less debris than the hand-stained slides (p stained slides, some Gram-positive organisms showed poor Gram-positive staining features (p Gram staining with the automatic machine increases the staining quality and helps to decrease the work load in a busy diagnostic laboratory.
Gene prediction in metagenomic fragments: A large scale machine learning approach
Directory of Open Access Journals (Sweden)
Morgenstern Burkhard
2008-04-01
Full Text Available Abstract Background Metagenomics is an approach to the characterization of microbial genomes via the direct isolation of genomic sequences from the environment without prior cultivation. The amount of metagenomic sequence data is growing fast while computational methods for metagenome analysis are still in their infancy. In contrast to genomic sequences of single species, which can usually be assembled and analyzed by many available methods, a large proportion of metagenome data remains as unassembled anonymous sequencing reads. One of the aims of all metagenomic sequencing projects is the identification of novel genes. Short length, for example, Sanger sequencing yields on average 700 bp fragments, and unknown phylogenetic origin of most fragments require approaches to gene prediction that are different from the currently available methods for genomes of single species. In particular, the large size of metagenomic samples requires fast and accurate methods with small numbers of false positive predictions. Results We introduce a novel gene prediction algorithm for metagenomic fragments based on a two-stage machine learning approach. In the first stage, we use linear discriminants for monocodon usage, dicodon usage and translation initiation sites to extract features from DNA sequences. In the second stage, an artificial neural network combines these features with open reading frame length and fragment GC-content to compute the probability that this open reading frame encodes a protein. This probability is used for the classification and scoring of gene candidates. With large scale training, our method provides fast single fragment predictions with good sensitivity and specificity on artificially fragmented genomic DNA. Additionally, this method is able to predict translation initiation sites accurately and distinguishes complete from incomplete genes with high reliability. Conclusion Large scale machine learning methods are well-suited for gene
Age Estimation with DNA: From Forensic DNA Fingerprinting to Forensic (Epi)Genomics: A Mini-Review.
Parson, Walther
2018-01-23
Forensic genetics developed from protein-based techniques a quarter of a century ago and became famous as "DNA fingerprinting," this being based on restriction fragment length polymorphisms (RFLPs) of high-molecular-weight DNA. The amplification of much smaller short tandem repeat (STR) sequences using the polymerase chain reaction soon replaced RFLP analysis and advanced to become the gold standard in genetic identification. Meanwhile, STR multiplexes have been developed and made commercially available which simultaneously amplify up to 30 STR loci from as little as 15 cells or fewer. The enormous information content that comes with the large variety of observed STR genotypes allows for genetic individualisation (with the exception of identical twins). Carefully selected core STR loci form the basis of intelligence-led DNA databases that provide investigative leads by linking unsolved crime scenes and criminals through their matched STR profiles. Nevertheless, the success of modern DNA fingerprinting depends on the availability of reference material from suspects. In order to provide new investigative leads in cases where such reference samples are absent, forensic scientists started to explore the prediction of phenotypic traits from the DNA of the evidentiary sample. This paradigm change now uses DNA and epigenetic markers to forecast characteristics that are useful to triage further investigative work. So far, the best investigated externally visible characteristics are eye, hair and skin colour, as well as geographic ancestry and age. Information on the chronological age of a stain donor (or any sample donor) is elemental for forensic investigations in a number of aspects and has, therefore, been explored by researchers in some detail. Among different methodological approaches tested to date, the methylation-sensitive analysis of carefully selected DNA markers (CpG sites) has brought the most promising results by providing prediction accuracies of ±3-4 years
DNA Sequences of RAPD Fragments in the Egyptian cotton ...
African Journals Online (AJOL)
Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...
DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line
Directory of Open Access Journals (Sweden)
Saeed Samarghandian
2013-01-01
Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 0.07 and 6.4 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.
Molecular markers. Amplified fragment length polymorphism
Directory of Open Access Journals (Sweden)
Pržulj Novo
2005-01-01
Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.
Trapping and breaking of in vivo nicked DNA during pulsed-field gel electrophoresis
Khan, Sharik R.; Kuzminov, Andrei
2013-01-01
Pulsed field gel electrophoresis (PFGE) offers a high-resolution approach to quantify chromosomal fragmentation in bacteria, measured as percent of chromosomal DNA entering the gel. The degree of separation in PFG depends upon the size of DNA, as well as various conditions of electrophoresis, such as electric field strength (FS), time of electrophoresis, switch time and buffer composition. Here we describe a new parameter, the structural integrity of the sample DNA itself, that influences its migration through PFGs. We show that sub-chromosomal fragments containing both spontaneous and DNA damage-induced nicks are prone to breakage during PFGE. Such breakage at single strand interruptions results in artefactual decrease in molecular weight of linear DNA making accurate determination of the number of double strand breaks difficult. While breakage of nicked sub-chromosomal fragments is FS-independent, some high molecular weight sub-chromosomal fragments are also trapped within wells under the standard PFGE conditions. This trapping can be minimized by lowering the field strength and increasing the time of electrophoresis. We discuss how breakage of nicked DNA may be mechanistically linked to trapping. Our results suggest how to optimize conditions for PFGE when quantifying chromosomal fragmentation induced by DNA damage. PMID:23770235
Parodi, S; Balbi, C; Abelmoschi, M L; Pala, M; Russo, P; Santi, L
1983-12-01
Alkaline elution is a well-known method for detecting DNA damage. Recently we have developed a viscosimetric method that is even more sensitive than alkaline elution. Here we report that the two methods, although apparently both revealing alkaline DNA fragmentation, can give dramatically different results for a significant series of compounds. We suspect that alkaline elution might reveal not only DNA fragmentation but also the extent of disentanglement of chromatin structure, whereas this DNA disentanglement rate, when evaluated viscosimetrically , is more strictly correlated with the initiation of DNA unwinding.
Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.
Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D
2004-11-01
Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.
Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens.
Weiß, Clemens L; Schuenemann, Verena J; Devos, Jane; Shirsekar, Gautam; Reiter, Ella; Gould, Billie A; Stinchcombe, John R; Krause, Johannes; Burbano, Hernán A
2016-06-01
Herbaria archive a record of changes of worldwide plant biodiversity harbouring millions of specimens that contain DNA suitable for genome sequencing. To profit from this resource, it is fundamental to understand in detail the process of DNA degradation in herbarium specimens. We investigated patterns of DNA fragmentation and nucleotide misincorporation by analysing 86 herbarium samples spanning the last 300 years using Illumina shotgun sequencing. We found an exponential decay relationship between DNA fragmentation and time, and estimated a per nucleotide fragmentation rate of 1.66 × 10(-4) per year, which is six times faster than the rate estimated for ancient bones. Additionally, we found that strand breaks occur specially before purines, and that depurination-driven DNA breakage occurs constantly through time and can to a great extent explain decreasing fragment length over time. Similar to what has been found analysing ancient DNA from bones, we found a strong correlation between the deamination-driven accumulation of cytosine to thymine substitutions and time, which reinforces the importance of substitution patterns to authenticate the ancient/historical nature of DNA fragments. Accurate estimations of DNA degradation through time will allow informed decisions about laboratory and computational procedures to take advantage of the vast collection of worldwide herbarium specimens.
Institute of Scientific and Technical Information of China (English)
范惠玲; 白生文; 李华清; 孙万仓
2016-01-01
Yunjie is closely related to important vegetables an d oil seed crops,and can be considered a genetic resource for all Brassiceae crops.Self compatibility is an important variant traits to Yunjie.This study aimed to probe the expression organ of self-compatible gene and isolate cDNA fragments related to self-compatibility of Yunjie. Leaf,anther and stigma from self-incompatible (SI)and self-compatible (SC)lines of Yunjie were examined by DDRT-PCR.The results showed that the amplification pattern of leaves and anthers were the same in SI and SC lines.However,different bands were obtained in stigmas of SI and SC lines before and after flowering.SC gene of E. sativa was not showing constitutive expression but showed tissue-specific expression in stigma.Only two fragments were amplified in SC lines before flowering,the one was less than 100 bp,the other was 750 -1 000 bp.A 300 bp fragment was found unique to self-compatible line after flowering.These three cDNA fragments might be closely re-lated to the self-compatibility in Yunjie.In addition,two cDNA fragments were generated in SI line before flowering, one was 500 bp,the other was 750 bp.One band of 500 -600 bp was identified in SI line after flowering.These cDNA fragments could efficiently distinguish self-compatible and self-incompatible lines,and could also be useful for cloning self-compatible gene of Yunjie.%芸芥与芸薹属植物具有亲缘关系,也是芸薹属植物的重要育种资源。自交亲和性是芸芥的一种重要变异性状。为了探明芸芥自交亲和基因的表达器官,并分离与自交亲和性有关的 cDNA 片段,以芸芥的一对近等基因系,自交亲和系(SC)与自交不亲和系(SI)为试材,利用差异显示 RT-PCR
Directory of Open Access Journals (Sweden)
Leterrier Christine
2010-07-01
Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.
DNA strand breakage by 125I-decay in oligoDNA
International Nuclear Information System (INIS)
Lobachevsky, P.; Martin, R.F.
1996-01-01
Full text: A double-stranded oligodeoxynucleotide containing 125 I-dC in a defined location, with 5'- or 3'- 32 P-end-labelling of either strand, was used to investigate DNA strand breakage resulting from 125 I decay. Samples of the 32 P-end-labelled and 125 I-dC containing oligoDNA were incubated in 20 mM phosphate buffer (PB), or PB + 2 M dimethylsulphoxide (DMSO) at 4 deg during 18-20 days. The 32 P-end-labelled DNA fragments produced by 125 I decays were separated on denaturing polyacrylamide gels, and the 3P activity in each fragment was determined by scintillation counting after elution from the gel. The fragment size distribution was then converted to a distribution of single stranded break probabilities at each nucleotide position. The results indicate that each 125 I decay event produces at least one break in the 125 I-dC containing strand, and causes breakage of the opposite strand in 75-80% of events. Thus, the double stranded break is produced by 125 I decay with probability ∼0.8. Most of single stranded breaks (around 90%) occurred within 5-6 nucleotides of the 125 I-dC, however DNA breaks were detected up to 18-20 nucleotides from the decay site. The average numbers of single stranded breaks per decay are 3.7 (PB) and 3.3 (PB+DMSO) in 125 I-dC containing strand, and 1.5 (PB) and 1.3 (PB+DMSO) in the opposite strand. Deconvolution of strand break probabilities as a function of separation from the 125 I, in terms of both distance (to target deoxyribosyl carbon atoms, in B-DNA) and nucleotide number, show that the latter is an important parameter for the shorter-range damage. This could indicate a role for attenuation/dissipation of damage through the stacked bases. In summary, the results represent a much more extensive set of data than available from earlier experiments on DNA breakage from l25 I-decay, and may provide new mechanistic insights
Directory of Open Access Journals (Sweden)
Mauro Nirchio
2007-01-01
Full Text Available The karyotype and chromosomal characteristics of the characid fish Triportheus venezuelensis were investigated using differential staining techniques (C-banding, Ag-NOR staining and fluorescent in situ hybridization (FISH with an 18S rDNA probe. The diploid chromosome number (2n = 52, karyotype composition and sex chromosome determination system of the ZZ/ZW type were the same as previously described in other species of the genus Triportheus. However, extensive variation regarding nucleolus organizer regions (NOR different from other species was observed. 18S rDNA sequences were distributed on nine chromosome pairs, but the number of chromosomes with Ag-NORs was usually lower, reaching a maximum of four chromosomes. When sequential staining experiments were performed, it was demonstrated that: 1. active NORs usually corresponded to segments with 18S rDNA genes identified in FISH experiments; 2. several 18S rDNA sequences were not silver-stained, suggesting that they do not correspond to active NORs; and 3. some chromosomes with silver-stained regions did not display any 18S rDNA signals. These findings characterize an extensive polymorphism associated with the NOR-bearing chromosomes of T. venezuelensis and emphasize the importance of combining traditional and molecular techniques in chromosome studies.
Carbon ion induced DNA double-strand breaks in melanophore B16
International Nuclear Information System (INIS)
Wei Zengquan; Zhou Guangming; Wang Jufang; He Jing; Li Qiang; Li Wenjian; Xie Hongmei; Cai Xichen; Tao Huang; Dang Bingrong; Han Guangwu
1997-01-01
DNA double-strand breaks (DSBs) in melanophore B 16 induced by plateau and extended Bragg peak of 75 MeV/u 12 C 6+ ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B 16 . Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau ∝85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)
Application of DNA fingerprints for cell-line individualization.
Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J
1990-09-01
DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they differ. The average percent difference (APD) among pairwise combinations from the population of 33 unrelated cell lines was 76.9%, compared with the APD in band sharing among cell lines derived from the same individual (less than or equal to 1.2%). Included in this survey were nine additional cell lines previously implicated as HeLa cell derivatives, and these lines were clearly confirmed as such by DNA fingerprints (APD less than or equal to 0.6%). On the basis of fragment frequencies in the tested cell line population, a simple genetic model was developed to estimate the frequencies of each DNA fingerprint in the population. The median incidence was 2.9 X 10(-17), and the range was 2.4 X 10(-21) to 6.6 X 10(-15). This value approximates the probability that a second cell line selected at random from unrelated individuals will match a given DNA fingerprint. Related calculations address the chance that any two DNA fingerprints would be identical among a large group of cell lines. This estimate is still very slight; for example, the chance of two or more common DNA fingerprints among 1 million distinct individuals is less than .001. The procedure provides a straightforward, easily interpreted, and statistically robust method for identification and individualization of human cells.
Improved production and function of llama heavy chain antibody fragments by molecular evolution
Linden, van der R.H.; Geus, de B.; Frenken, G.J.; Peters, H.; Verrips, C.T.
2000-01-01
The aim of this study was to improve production level of llama heavy chain antibody fragments (V (HH)) in Saccharomyces cerevisiae while retaining functional characteristics. For this purpose, the DNA shuffling technique was used on llama V (HH) fragments specific for the azo-dye reactive red-6. In
International Nuclear Information System (INIS)
Dallas, J.F.
1988-01-01
A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species
Construction of recombinant DNA clone for bovine viral diarrhea virus
International Nuclear Information System (INIS)
Yeo, S.G.; Cho, H.J.; Masri, S.A.
1992-01-01
Molecular cloning was carried out on the Danish strain of bovine viral diarrhea virus (BVDV) to construct strategy for the diagnostic tools and effective vaccine of BVD afterwards. A recombinant DNA clone (No. 29) was established successfully from cDNA for viral RNA tailed with adenine homopolymer at 3 -end. 32 P-labeled DNA probes of 300~1, 800bp fragments, originating from the clone 29, directed specific DNA-RNA hybridization results with BVDV RNA. Recombinant DNA of the clone 29 was about 5,200bp representing 41.6% of the full length of Danish strain's RNA, and restriction sites were recognized for EooR I, Sst I, Hind III and Pst I restriction enzymes in the DNA fragment
Accelerated staining technique using kitchen microwave oven
Directory of Open Access Journals (Sweden)
Archana Mukunda
2015-01-01
Full Text Available Introduction: Histopathological diagnosis of specimens is greatly dependent on good sample preparation and staining. Both of these processes is governed by diffusion of fluids and dyes in and out of the tissue, which is the key to staining. Diffusion of fluids can be accelerated by the application of heat that reduces the time of staining from hours to the minute. We modified an inexpensive model of kitchen microwave oven for staining. This study is an attempt to compare the reliability of this modified technique against the tested technique of routine staining so as to establish the kitchen microwave oven as a valuable diagnostic tool. Materials and Methods: Sixty different tissue blocks were used to prepare 20 pairs of slides for 4 different stains namely hematoxylin and eosin, Van Gieson′s, 0.1% toluidine blue and periodic acid-Schiff. From each tissue block, two bits of tissues were mounted on two different slides. One slide was stained routinely, and the other stained inside a microwave. A pathologist evaluated the stained slides and the results so obtained were analyzed statistically. Results: Microwave staining considerably cut down the staining time from hours to seconds. Microwave staining showed no loss of cellular and nuclear details, uniform-staining characteristics and was of excellent quality. Interpretation and Conclusion: The cellular details, nuclear details and staining characteristics of microwave stained tissues were better than or equal to the routine stained tissue. The overall quality of microwave-stained sections was found to be better than the routine stained tissue in majority of cases.
Size distribution of DNA molecules recovered from non-denaturing filter elution
International Nuclear Information System (INIS)
Bloecher, D.; Iliakis, G.
1991-01-01
DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)
Amplification of a transcriptionally active DNA sequence in the human brain
International Nuclear Information System (INIS)
Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.
1986-01-01
The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days
Blood extracellular DNA after irradiation
International Nuclear Information System (INIS)
Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.
1993-01-01
It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action
Directory of Open Access Journals (Sweden)
Takashi Kubota
2015-08-01
Full Text Available The sliding clamp PCNA is a crucial component of the DNA replication machinery. Timely PCNA loading and unloading are central for genome integrity and must be strictly coordinated with other DNA processing steps during replication. Here, we show that the S. cerevisiae Elg1 replication factor C-like complex (Elg1-RLC unloads PCNA genome-wide following Okazaki fragment ligation. In the absence of Elg1, PCNA is retained on chromosomes in the wake of replication forks, rather than at specific sites. Degradation of the Okazaki fragment ligase Cdc9 leads to PCNA accumulation on chromatin, similar to the accumulation caused by lack of Elg1. We demonstrate that Okazaki fragment ligation is the critical prerequisite for PCNA unloading, since Chlorella virus DNA ligase can substitute for Cdc9 in yeast and simultaneously promotes PCNA unloading. Our results suggest that Elg1-RLC acts as a general PCNA unloader and is dependent upon DNA ligation during chromosome replication.
International Nuclear Information System (INIS)
Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.
1989-01-01
Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes
Directory of Open Access Journals (Sweden)
Eveson J Paige
2006-08-01
Full Text Available Abstract Background Poorly preserved biological tissues have become an important source of DNA for a wide range of zoological studies. Measuring the quality of DNA obtained from these samples is often desired; however, there are no widely used techniques available for quantifying damage in highly degraded DNA samples. We present a general method that can be used to determine the frequency of polymerase blocking DNA damage in specific gene-regions in such samples. The approach uses quantitative PCR to measure the amount of DNA present at several fragment sizes within a sample. According to a model of random degradation the amount of available template will decline exponentially with increasing fragment size in damaged samples, and the frequency of DNA damage (λ can be estimated by determining the rate of decline. Results The method is illustrated through the analysis of DNA extracted from sea lion faecal samples. Faeces contain a complex mixture of DNA from several sources and different components are expected to be differentially degraded. We estimated the frequency of DNA damage in both predator and prey DNA within individual faecal samples. The distribution of fragment lengths for each target fit well with the assumption of a random degradation process and, in keeping with our expectations, the estimated frequency of damage was always less in predator DNA than in prey DNA within the same sample (mean λpredator = 0.0106 per nucleotide; mean λprey = 0.0176 per nucleotide. This study is the first to explicitly define the amount of template damage in any DNA extracted from faeces and the first to quantify the amount of predator and prey DNA present within individual faecal samples. Conclusion We present an approach for characterizing mixed, highly degraded PCR templates such as those often encountered in ecological studies using non-invasive samples as a source of DNA, wildlife forensics investigations and ancient DNA research. This method will
Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M
2006-05-01
The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic
Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena
2015-01-01
Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and
Dna fingerprinting - review paper
Blundell, Renald
2006-01-01
Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.
PCR-based detection of a rare linear DNA in cell culture
Directory of Open Access Journals (Sweden)
Saveliev Sergei V.
2002-01-01
Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-based detection of a rare linear DNA in cell culture.
Saveliev, Sergei V.
2002-11-11
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
DNA polymorphism of HLA class II genes in pauciarticular juvenile rheumatoid arthritis
DEFF Research Database (Denmark)
Morling, N; Friis, J; Fugger, L
1991-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) class II genes: HLA-DRB, -DQA, -DQB, DPA, and -DPB in 54 patients with pauciarticular juvenile rheumatoid arthritis (PJRA) and in healthy Danes. The frequencies of DNA fragments a...
Fregene, M A; Vargas, J; Ikea, J; Angel, F; Tohme, J; Asiedu, R A; Akoroda, M O; Roca, W M
1994-11-01
Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability.
International Nuclear Information System (INIS)
Smith, A.C.; Harmon, J.M.
1987-01-01
The structural organization of the steroid-binding protein of the IM-9 cell glucocorticoid receptor was investigated by using one- and two-dimensional gel electrophoresis of proteolytic receptor fragments. One-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of receptor fragments isolated after trypsin digestion of immunopurified [ 3 H]dexamethasone 21-mesylate ([ 3 H]DM-) labeled receptor revealed the presence of a stable 26.5-kilodalton (kDa) steroid-containing non-DNA-binding fragment, derived from a larger, less stable, 29-kDa fragment. The 26.5-kDa tryptic fragment appeared to be completely contained within a 41-kDa, steroid-containing, DNA-binding species isolated after chymotrypsin digestion of the intact protein. Two-dimensional electrophoretic analysis of the [ 3 H]DM-labeled tryptic fragments resolved two 26.5-kDa and two 29-kDa components. This was the same number of isoforms seen in the intact protein, indicating that the charge heterogeneity of the steroid-binding protein is the result of modification within the steroid-containing, non-DNA-binding, 26.5-kDa tryptic fragment. Two-dimensional analysis of the 41-kDa [ 3 H]DM-labeled chymotryptic species revealed a pattern of isoforms more complex than that seen either in the intact protein or in the steroid-containing tryptic fragments. These results suggest that the 41-kDa [ 3 H]DM-labeled species resolved by one-dimensional SDS-PAGE after chymotrypsin digestion may be composed of several distinct proteolytic fragments
Rapid transfer of DNA from agarose gels to nylon membranes.
Reed, K C; Mann, D A
1985-01-01
The unique properties of nylon membranes allow for dramatic improvement in the capillary transfer of DNA restriction fragments from agarose gels (Southern blotting). By using 0.4 M NaOH as the transfer solvent following a short pre-treatment of the gel in acid, DNA is depurinated during transfer. Fragments of all sizes are eluted and retained quantitatively by the membrane; furthermore, the alkaline solvent induces covalent fixation of DNA to the membrane. The saving in time and materials aff...
Directory of Open Access Journals (Sweden)
N K Panicker
2012-01-01
Conclusion : Intracytoplasmic PAS-D-positive globules may be useful in differentiating benign and malignant lesions of breast. The presence of PAS-D positive granules are useful in differentiating various lesions of salivary glands. AB staining of stromal fragments in pleomorphic adenoma is useful in differentiating it from basal cell adenoma.
Bergesch, Vania; Baggio Aguiar, Flávio Henrique; Turssi, Cecilia Pedroso; Gomes França, Fabiana Mantovani; Basting, Roberta Tarkany; Botelho Amaral, Flávia Lucisano
2017-01-01
This study evaluated the effectiveness of toothbrushing with whitening toothpaste in altering the shade of stained human enamel. Thirty fragments of human enamel, stained with chlorhexidine/black tea underwent 1000 and 5000 brushing cycles (BC) with ( n = 10): PLS (Gel Dental Day, Bitufo), Close Up White Now, Unilever (COVB) and regular (Gel Dental Night, Bitufo) toothpaste. Images were taken before staining (baseline), after staining (STN) and following 1000 and 5000 BC and were analyzed using the CIELAB parameters (ΔE, Δb and ΔL). Data were submitted to two-way ANOVA (α = 0.05). ΔE was higher from STN to baseline; 1000 BC to STN and 5000 BC to STN ( P < 0.001). Significant differences in Δb values were found from 1000 BC to STN and 5000 BC to STN. For COVB, greater ΔL was observed from 1000 BC to STN, what differed statistically from the regular toothpaste ( P < 0.05). There was no difference between toothpaste when ΔL was calculated from 5000 CB to STN. Toothpaste containing COVB or PLS in association with 5000 BCs showed similar effectiveness in changing enamel shade; but after the first 1000 toothbrushing cycles, the use of COVB toothpaste promoted higher lightness in stained enamel.
Wang, Hongyang; Owens, James D; Shih, Joanna H; Li, Ming-Chung; Bonner, Robert F; Mushinski, J Frederic
2006-04-27
Gene expression profiling by microarray analysis of cells enriched by laser capture microdissection (LCM) faces several technical challenges. Frozen sections yield higher quality RNA than paraffin-imbedded sections, but even with frozen sections, the staining methods used for histological identification of cells of interest could still damage the mRNA in the cells. To study the contribution of staining methods to degradation of results from gene expression profiling of LCM samples, we subjected pellets of the mouse plasma cell tumor cell line TEPC 1165 to direct RNA extraction and to parallel frozen sectioning for LCM and subsequent RNA extraction. We used microarray hybridization analysis to compare gene expression profiles of RNA from cell pellets with gene expression profiles of RNA from frozen sections that had been stained with hematoxylin and eosin (H&E), Nissl Stain (NS), and for immunofluorescence (IF) as well as with the plasma cell-revealing methyl green pyronin (MGP) stain. All RNAs were amplified with two rounds of T7-based in vitro transcription and analyzed by two-color expression analysis on 10-K cDNA microarrays. The MGP-stained samples showed the least introduction of mRNA loss, followed by H&E and immunofluorescence. Nissl staining was significantly more detrimental to gene expression profiles, presumably owing to an aqueous step in which RNA may have been damaged by endogenous or exogenous RNAases. RNA damage can occur during the staining steps preparatory to laser capture microdissection, with the consequence of loss of representation of certain genes in microarray hybridization analysis. Inclusion of RNAase inhibitor in aqueous staining solutions appears to be important in protecting RNA from loss of gene transcripts.
Biological activity of SV40 DNA
International Nuclear Information System (INIS)
Abrahams, P.J.
1978-01-01
This thesis deals with a study on the biological activity of SV40 DNA. The transforming activity of SV40 DNA and DNA fragments is investigated in order to define as precisely as possible the area of the viral genome that is involved in the transformation. The infectivity of SV40 DNA is used to study the defective repair mechanisms of radiation damages of human xeroderma pigmentosum cells. (C.F.)
DNA-incorporated 125I induces more than one double-strand break per decay in mammalian cells.
Elmroth, Kecke; Stenerlöw, Bo
2005-04-01
The Auger-electron emitter 125I releases cascades of 20 electrons per decay that deposit a great amount of local energy, and for DNA-incorporated 125I, approximately one DNA double-strand break (DSB) is produced close to the decay site. To investigate the potential of 125I to induce additional DSBs within adjacent chromatin structures in mammalian cells, we applied DNA fragment-size analysis based on pulsed-field gel electrophoresis (PFGE) of hamster V79-379A cells exposed to DNA-incorporated 125IdU. After accumulation of decays at -70 degrees C in the presence of 10% DMSO, there was a non-random distribution of DNA fragments with an excess of fragments even higher. In contrast, using a conventional low-resolution assay without measurement of smaller DNA fragments, the yield was close to one DSB/decay. We conclude that a large fraction of the DSBs induced by DNA-incorporated 125I are nonrandomly distributed and that significantly more than one DSB/decay is induced in an intact cell. Thus, in addition to DSBs produced close to the decay site, DSBs may also be induced within neighboring chromatin fibers, releasing smaller DNA fragments that are not detected by conventional DSB assays.
Natural transformation of bacteria by fragmented, damaged and ancient DNA
DEFF Research Database (Denmark)
Overballe-Petersen, Søren
with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...... transfer playing an important role early in the evolution of life. The published article explains the chemical structure behind an observed degradation difference between the two purine-nucleotides guanosine and adenosine in ancient DNA. We also point at new uses for high-through-put DNA sequencing...
Carbon ion induced DNA double-strand breaks in melanophore B{sub 16}
Energy Technology Data Exchange (ETDEWEB)
Zengquan, Wei; Guangming, Zhou; Jufang, Wang; Jing, He; Qiang, Li; Wenjian, Li; Hongmei, Xie; Xichen, Cai; Huang, Tao; Bingrong, Dang; Guangwu, Han [Chinese Academy of Sciences, Lanzhou (China). Inst. of Modern Physics; Qingxiang, Gao [Lanzhou Univ. (China)
1997-09-01
DNA double-strand breaks (DSBs) in melanophore B{sub 16} induced by plateau and extended Bragg peak of 75 MeV/u {sup 12}C{sup 6+} ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B{sub 16}. Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau {proportional_to}85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)
How to open the treasure chest? Optimising DNA extraction from herbarium specimens.
Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T
2012-01-01
Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.
A characterization of DNA release in Pseudomonas aeruginosa cultures and biofilms
DEFF Research Database (Denmark)
Allesen-Holm, Marie; Barken, Kim Bundvig; Yang, Liang
2006-01-01
-type P. aeruginosa biofilms stained with different DNA stains suggested that the extracellular DNA is located primarily in the stalks of mushroom-shaped multicellular structures, with a high concentration especially in the outer part of the stalks forming a border between the stalk-forming bacteria...... to whole-genome DNA. Evidence that the extracellular DNA in P. aeruginosa biofilms and cultures is generated via lysis of a subpopulation of the bacteria was obtained through experiments where extracellular beta-galactosidase released from lacZ-containing P. aeruginosa strains was assessed. Experiments...... and the cap-forming bacteria. Biofilms formed by lasIrhlI, pqsA and fliMpilA mutants contained less extracellular DNA than biofilms formed by the wild type, and the mutant biofilms were more susceptible to treatment with sodium dodecyl sulphate than the wild-type biofilm....
Hair Dye–DNA Interaction: Plausible Cause of Mutation
Directory of Open Access Journals (Sweden)
Swati Maiti
2015-09-01
Full Text Available Hair dye is one of the most popular cosmetic products which are used more widely and frequently to improve an individual’s appearance. Although the genotoxic effects of dye ingredients are widely reported, hair dye in its usable form is not reported extensively. In this contribution, we report the possible mode of interaction of hair dye with DNA which leads to genotoxicity. The effect of dye DNA interaction was studied on the most popular and globally used hair dye with Calf Thymus DNA and plasmid DNA. This interaction of dye DNA was studied by spectroscopic analyses and gel electrophoresis. The result had shown positive interaction of dye with DNA. Gel electrophoresis study confirms the binding of dye with DNA which results in linearization and fragmentation of the plasmid DNA. Dye–DNA interaction causes fragmentation and oxidation of DNA in absence of any catalyst, implies high toxicity of commercial hair dyes. Thus, it can be deduced from the present studies that hair dye in its usable form may lead to its penetration through skin affecting genomic DNA possesses genotoxic property and can be treated as one of the most common mutagen.
Use of RAPD and PCR double amplification in the study of ancient DNA
Directory of Open Access Journals (Sweden)
F. Balzano
2011-01-01
Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.
Accurate phylogenetic classification of DNA fragments based onsequence composition
Energy Technology Data Exchange (ETDEWEB)
McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore
2006-05-01
Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.
High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.
Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie
2015-06-17
High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This
Comparison of Suitability of the Most Common Ancient DNA Quantification Methods.
Brzobohatá, Kristýna; Drozdová, Eva; Smutný, Jiří; Zeman, Tomáš; Beňuš, Radoslav
2017-04-01
Ancient DNA (aDNA) extracted from historical bones is damaged and fragmented into short segments, present in low quantity, and usually copurified with microbial DNA. A wide range of DNA quantification methods are available. The aim of this study was to compare the five most common DNA quantification methods for aDNA. Quantification methods were tested on DNA extracted from skeletal material originating from an early medieval burial site. The tested methods included ultraviolet (UV) absorbance, real-time quantitative polymerase chain reaction (qPCR) based on SYBR ® green detection, real-time qPCR based on a forensic kit, quantification via fluorescent dyes bonded to DNA, and fragmentary analysis. Differences between groups were tested using a paired t-test. Methods that measure total DNA present in the sample (NanoDrop ™ UV spectrophotometer and Qubit ® fluorometer) showed the highest concentrations. Methods based on real-time qPCR underestimated the quantity of aDNA. The most accurate method of aDNA quantification was fragmentary analysis, which also allows DNA quantification of the desired length and is not affected by PCR inhibitors. Methods based on the quantification of the total amount of DNA in samples are unsuitable for ancient samples as they overestimate the amount of DNA presumably due to the presence of microbial DNA. Real-time qPCR methods give undervalued results due to DNA damage and the presence of PCR inhibitors. DNA quantification methods based on fragment analysis show not only the quantity of DNA but also fragment length.
DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...
African Journals Online (AJOL)
We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...
Introducing Human Population Biology through an Easy Laboratory Exercise on Mitochondrial DNA
Pardinas, Antonio F.; Dopico, Eduardo; Roca, Agustin; Garcia-Vazquez, Eva; Lopez, Belen
2010-01-01
This article describes an easy and cheap laboratory exercise for students to discover their own mitochondrial haplogroup. Students use buccal swabs to obtain mucosa cells as noninvasive tissue samples, extract DNA, and with a simple polymerase chain reaction-restriction fragment length polymorphism analysis they can obtain DNA fragments of…
Participation of ATM in cellular response to DNA damage induced by ionizing radiation
International Nuclear Information System (INIS)
Meng Xiangbing; Song Yi; Mao Jianping; Gong Bo; Dong Yan; Liu Bin; Sun Zhixian
2000-01-01
Objective: To clone ATM full length cDNA and cDNA fragments containing some functional domains and to identify proteins that interact with ATM and mediate DNA damage signal transduction in cellular response to DNA damage. Methods: ATM cDNA was amplified from MarthomTM-Ready cDNA kit of human leukocytes by LD-PCR. ATM-interacting proteins were screened by yeast two hybrid system. Results: ATM full-length cDNA and cDNA fragments containing PI3K kinase domain, leucine zipper and proline rich region were amplified from human cDNAs. Several candidate clones that interacted with ATM PI3K domain were identified. Conclusion: ATM mediates DNA damage signal transduction by interacting with many proteins
Energy Technology Data Exchange (ETDEWEB)
Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)
2005-10-01
This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.
Comparison of five DNA quantification methods
DEFF Research Database (Denmark)
Nielsen, Karsten; Mogensen, Helle Smidt; Hedman, Johannes
2008-01-01
Six commercial preparations of human genomic DNA were quantified using five quantification methods: UV spectrometry, SYBR-Green dye staining, slot blot hybridization with the probe D17Z1, Quantifiler Human DNA Quantification kit and RB1 rt-PCR. All methods measured higher DNA concentrations than...... Quantification kit in two experiments. The measured DNA concentrations with Quantifiler were 125 and 160% higher than expected based on the manufacturers' information. When the Quantifiler human DNA standard (Raji cell line) was replaced by the commercial human DNA preparation G147A (Promega) to generate the DNA...... standard curve in the Quantifiler Human DNA Quantification kit, the DNA quantification results of the human DNA preparations were 31% higher than expected based on the manufacturers' information. The results indicate a calibration problem with the Quantifiler human DNA standard for its use...
Model for how type I restriction enzymes select cleavage sites in DNA
International Nuclear Information System (INIS)
Studier, F.W.; Bandyopadhyay, P.K.
1988-01-01
Under appropriate conditions, digestion of phage T7 DNA by the type I restriction enzyme EcoK produces an orderly progression of discrete DNA fragments. All details of the fragmentation pattern can be explained on the basis of the known properties of type I enzymes, together with two further assumptions: (i) in the ATP-stimulated translocation reaction, the enzyme bound at the recognition sequence translocates DNA toward itself from both directions simultaneously; and (ii) when translocation causes neighboring enzymes to meet, they cut the DNA between them. The kinetics of digestion at 37 degree C indicates that the rate of translocation of DNA from each side of a bound enzyme is about 200 base pairs per second, and the cuts are completed within 15-25 sec of the time neighboring enzymes meet. The resulting DNA fragments each contain a single recognition site with an enzyme (or subunit) remaining bound to it. At high enzyme concentrations, such fragments can bu further degraded, apparently by cooperation between the specifically bound and excess enzymes. This model is consistent with a substantial body of previous work on the nuclease activity of EcoB and EcoK, and it explains in a simple way how cleavage sites are selected
Netuschil, Lutz; Auschill, Thorsten M; Sculean, Anton; Arweiler, Nicole B
2014-01-11
There is confusion over the definition of the term "viability state(s)" of microorganisms. "Viability staining" or "vital staining techniques" are used to distinguish live from dead bacteria. These stainings, first established on planctonic bacteria, may have serious shortcomings when applied to multispecies biofilms. Results of staining techniques should be compared with appropriate microbiological data. Many terms describe "vitality states" of microorganisms, however, several of them are misleading. Authors define "viable" as "capable to grow". Accordingly, staining methods are substitutes, since no staining can prove viability.The reliability of a commercial "viability" staining assay (Molecular Probes) is discussed based on the corresponding product information sheet: (I) Staining principle; (II) Concentrations of bacteria; (III) Calculation of live/dead proportions in vitro. Results of the "viability" kit are dependent on the stains' concentration and on their relation to the number of bacteria in the test. Generally this staining system is not suitable for multispecies biofilms, thus incorrect statements have been published by users of this technique.To compare the results of the staining with bacterial parameters appropriate techniques should be selected. The assessment of Colony Forming Units is insufficient, rather the calculation of Plating Efficiency is necessary. Vital fluorescence staining with Fluorescein Diacetate and Ethidium Bromide seems to be the best proven and suitable method in biofilm research.Regarding the mutagenicity of staining components users should be aware that not only Ethidium Bromide might be harmful, but also a variety of other substances of which the toxicity and mutagenicity is not reported. - The nomenclature regarding "viability" and "vitality" should be used carefully.- The manual of the commercial "viability" kit itself points out that the kit is not suitable for natural multispecies biofilm research, as supported by an
Release of 3-methyladenine from linker and core DNA of chromatin by a purified DNA glycosylase
International Nuclear Information System (INIS)
Heller, E.P.; Goldthwait, D.A.
1983-01-01
Oligonucleosomes were isolated from [ 14 C]thymidine-labeled HeLa cells by digestion of the nuclei with micrococcal nuclease and were then alkylated with [ 3 H]methylnitrosourea. Nucleosome core particles were also prepared by further digestion of the oligonucleosomes. The distribution of 3 H-labeled methyl groups in the linker versus the core DNA was established by a determination of 3 H: 14 C ratios in oligonucleosome and core DNA. The ratios in the core DNA of 145 and 165 base pair DNA fragments were 5.2 and 5.4, respectively, while the ratio in the oligonucleosomal DNA was 8.2. Assuming an equal mixture (as determined) of 145 and 165 base pair fragments of DNA in the 185 base pair repeat, the relative concentration of 3 H methyl groups in the linker versus the core DNA was 4.2. Thus, 45% of the 3 H methyl groups were in the linker DNA, and 55% were in the core DNA. Some shielding of the DNA was evident during alkylation. The concentrations of alkyl groups on the linker and core DNA were 67 and 12% of that found on free DNA alkylated under comparable conditions. No evidence for preferential shielding of the major or minor groove was observed. The purified 3-methyladenine DNA glycosylase I of Escherichia coli released approximately 37% of the 3-methyladenine from the linker DNA and 13% from the core DNA. The limited enzymatic removal of 3-methyladenine in vitro compared to the efficient removal in vivo suggests that conformational changes of the oligonucleosome and core structure must occur for total repair
Synthesis, Characterization and DNA Cleavage of Copper(II ...
African Journals Online (AJOL)
Keywords: DNA shearing, Copper(II) complex, Dithiothreitol, Attenuated total reflectance-Fourier transform .... confirm the fragmentation of DNA by the newly .... sperm. Biochem Biophys Acta 1986; 884: 124-134. 7. Cornell NW, Crivaro KE.
Safety assessment of sodium acetate, sodium diacetate and potassium sorbate food additives.
Mohammadzadeh-Aghdash, Hossein; Sohrabi, Yousef; Mohammadi, Ali; Shanehbandi, Dariush; Dehghan, Parvin; Ezzati Nazhad Dolatabadi, Jafar
2018-08-15
Cytotoxicity and genotoxicity of sodium acetate (SA), sodium diacetate (SDA), and potassium sorbate (PS) was tested on Human Umbilical Vein Endothelial Cells (HUVEC). Cytotoxicity was investigated by MTT assay and flow cytometry analysis, while genotoxicity was evaluated using DNA fragmentation and DAPI staining assays. The growth of treated HUVECs with various concentrations of SA, SDA and PS decreased in a dose-and time-dependent manner. The IC50 of 487.71, 485.82 and 659.96 µM after 24 h and IC50 of 232.05, 190.19 and 123.95 µM after 48 h of treatment were attained for SA, SDA and PS, respectively. Flow cytometry analysis showed that early and late apoptosis percentage in treated cells was not considerable. Also neither considerable DNA fragmentation nor DNA smear was observed using DAPI staining and DNA ladder assays. Overall, it can be concluded that the aforementioned food additives can be used as safe additives at low concentration in food industry. Copyright © 2018 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Li Ming-Chung
2006-04-01
Full Text Available Abstract Background Gene expression profiling by microarray analysis of cells enriched by laser capture microdissection (LCM faces several technical challenges. Frozen sections yield higher quality RNA than paraffin-imbedded sections, but even with frozen sections, the staining methods used for histological identification of cells of interest could still damage the mRNA in the cells. To study the contribution of staining methods to degradation of results from gene expression profiling of LCM samples, we subjected pellets of the mouse plasma cell tumor cell line TEPC 1165 to direct RNA extraction and to parallel frozen sectioning for LCM and subsequent RNA extraction. We used microarray hybridization analysis to compare gene expression profiles of RNA from cell pellets with gene expression profiles of RNA from frozen sections that had been stained with hematoxylin and eosin (H&E, Nissl Stain (NS, and for immunofluorescence (IF as well as with the plasma cell-revealing methyl green pyronin (MGP stain. All RNAs were amplified with two rounds of T7-based in vitro transcription and analyzed by two-color expression analysis on 10-K cDNA microarrays. Results The MGP-stained samples showed the least introduction of mRNA loss, followed by H&E and immunofluorescence. Nissl staining was significantly more detrimental to gene expression profiles, presumably owing to an aqueous step in which RNA may have been damaged by endogenous or exogenous RNAases. Conclusion RNA damage can occur during the staining steps preparatory to laser capture microdissection, with the consequence of loss of representation of certain genes in microarray hybridization analysis. Inclusion of RNAase inhibitor in aqueous staining solutions appears to be important in protecting RNA from loss of gene transcripts.
International Nuclear Information System (INIS)
Jacob, R.J.
1984-01-01
Human embryonic lung cells were pre-equilibrated with phosphonoacetate and 32 P orthophosphate label, then infected with phosphonoacetate-sensitive herpes simplex virus (HSV) type 1. Analyses of viral DNA produced in these cells showed the following. i) Viral DNA was synthesized in infected cells exposed to 100 μg of the drug per ml of medium but not in cells exposed to four-fold higher concentrations of the drug. ii) At 300 μg/ml a region of the DNA between 0.58 and 0.69 map units became transiently labeled, but the restriction endonuclease fragment containing these sequences migrated more slowly than the corresponding fragment from virion DNA. iii) Viral DNA extracted from infected cells 1.5 hours post drug withdrawal (300 μg/ml) was preferentially labeled in 2 regions of the genome mapping between 0.17 and 0.23 and 0.58-0.69 map units. This finding is in agreement with a report of Friedman et al. suggesting that HSV DNA contains two different sites if initiation. In addition a 4.8 x 10 6 molecular weight fragment was also preferentially labeled. This fragment could represent a smaller, aberrantly migrating fragment from the 0.17-0.27 map unit region of the DNA. iv) Viral DNA extracted from infected cells at longer intervals after drug withdrawal showed an increasing gradient of radioactivity progressively labeling the genome. These results are consistent with the hypothesis that viral DNA has at least two sites of initiation of DNA synthesis and that both sites are within the L component of the DNA. Alternatively, the results could be interpreted as two sites of localized synthesis (repair) that are detected at high concentrations of phosphonoacetate and immediately following reversal of inhibition of DNA synthesis. The results do not exclude the possibility that secondary sites in both L and S are utilized late in infection or in untreated cells. (Author)
Qiu, Qiyu; Domarkas, Juozas; Banerjee, Ranjita; Merayo, Nuria; Brahimi, Fouad; McNamee, James P; Gibbs, Bernard F; Jean-Claude, Bertrand J
2007-01-01
JDA58 (NSC 741282), a "combi-molecule" optimized in the context of the "combi-targeting concept," is a nitrosourea moiety tethered to an anilinoquinazoline. Here, we sought to show its binary epidermal growth factor receptor (EGFR)/DNA targeting property and to study its fragmentation in vitro and in vivo. The fragmentation of JDA58 was detected in cells in vitro and in vivo by fluorescence microscopy and tandem mass spectrometry. EGFR phosphorylation and DNA damage were determined by Western blotting and comet assay, respectively. Tumor data were examined for statistical significance using the Student's t test. JDA58 inhibited EGFR tyrosine kinase (IC(50), 0.2 micromol/L) and blocked EGFR phosphorylation in human DU145 prostate cancer cells. It induced significant levels of DNA damage in DU145 cells in vitro or in vivo and showed potent antiproliferative activity both in vitro and in a DU145 xenograft model. In cell-free medium, JDA58 was hydrolyzed to JDA35, a fluorescent amine that could be observed in tumor cells both in vitro and in vivo. In tumor cells in vitro or in vivo, or in plasma collected from mice, the denitrosated species JDA41 was the predominant metabolite. However, mass spectrometric analysis revealed detectable levels of the hydrolytic product JDA35 in tumor cells both in vitro and in vivo. The results in toto suggest that growth inhibition in vitro and in vivo may be sustained by the intact combi-molecule plus JDA35 plus JDA41, three inhibitors of EGFR, and the concomitantly released DNA-damaging species. This leads to a model wherein a single molecule carries a complex multitargeted-multidrug combination.
Interactions of tetracationic porphyrins with DNA and their effects on DNA cleavage
Lebedeva, Natalya Sh.; Yurina, Elena S.; Gubarev, Yury A.; Syrbu, Sergey A.
2018-06-01
The interaction of tetracationic porphyrins with DNA was studied using UV-Vis absorption, fluorescence spectroscopy and viscometry, and the particle sizes were determined. Аs cationic porphyrins, two isomer porphyrins, 3,3‧,3″,3‴-(5,10,15,20-Porphyrintetrayl)tetrakis(1-methylpyridinium) (TMPyP3) and 4,4‧,4″,4‴-(5,10,15,20-Porphyrintetrayl)tetrakis(1-methylpyridinium) (TMPyP4), were studied. They differ in the position of NCH3+ group in phenyl ring of the porphyrins and hence, in degree of freedom of rotation of the phenyl rings about the central macrocycle. It was found that intercalated complexes are formed at DNA/porphyrin molar ratios (R) of 2.2 and 3.9 for TMPyP3 и TMPyP4, respectively. Decreasing R up to 0.4 and 0.8 for TMPyP3 и TMPyP4, respectively, leads mainly to formation of outside complexes due to π-π stacking between the porphyrin chromophores interacting electrostatically with phosphate framework of DNA. Each type of the obtained complexes was characterized using Scatchard approach. It was ascertained that the affinity of TMPyP4 to DNA is stronger than TMPyP3, meanwhile the wedge effect of the latter is higher. The differences between the porphyrin isomers become more evident at irradiation of their complexes with DNA. It was established that irradiation of the intercalated complexes results in DNA fragmentation. In the case of TMPyP4, DNA fragments of different size are formed. The irradiation of the outside DNA/porphyrin complexes leads to cleavage of DNA (TMPyP3 and TMPyP4) and partial destruction of the complex due to photolysis of the porphyrin (TMPyP3).
Directory of Open Access Journals (Sweden)
Gusti Ngurah Permana
2016-11-01
The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.
LINKAGE ANALYSIS BY 2-DIMENSIONAL DNA TYPING
MEERMAN, GJT; MULLAART, E; VANDERMEULEN, MA; DENDAAS, JHG; MOROLLI, B; UITTERLINDEN, AG; VIJG, J
1993-01-01
In two-dimensional (2-D) DNA typing, genomic DNA fragments are separated, first according to size by electrophoresis in a neutral polyacrylamide gel and second according to sequence by denaturing gradient gel electrophoresis, followed by hybridization analysis using micro- and minisatellite core
Linkage analysis by two-dimensional DNA typing
te Meerman, G J; Mullaart, E; Meulen ,van der Martin; den Daas, J H; Morolli, B; Uitterlinden, A G; Vijg, J
1993-01-01
In two-dimensional (2-D) DNA typing, genomic DNA fragments are separated, first according to size by electrophoresis in a neutral polyacrylamide gel and second according to sequence by denaturing gradient gel electrophoresis, followed by hybridization analysis using micro- and minisatellite core
Bezerra, Maria É S; Barberino, Ricássio S; Menezes, Vanúzia G; Gouveia, Bruna B; Macedo, Taís J S; Santos, Jamile M S; Monte, Alane P O; Barros, Vanessa R P; Matos, Maria H T
2018-05-30
We investigated the effects of insulin-like growth factor 1 (IGF-1) on the morphology and follicular activation of ovine preantral follicles cultured in situ and whether the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway is involved in IGF-1 action in the sheep ovary. Ovine ovarian fragments were fixed for histological and terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) analyses (fresh control) or cultured in supplemented alpha-minimum essential medium (α-MEM+; control) or α-MEM+ with IGF-1 (1, 10, 50, 100 or 200ngmL-1) for 7 days. Follicles were classified as normal or atretic, primordial or growing and the oocyte and follicle diameters were measured. DNA fragmentation was evaluated by TUNEL assay. Proliferating cell nuclear antigen (PCNA) immunohistochemistry was performed on the fresh control, α-MEM+ and 100ngmL-1 IGF-1 samples. Inhibition of PI3K activity was performed through pretreatment with the PI3K inhibitor LY294002 and phosphorylated AKT (pAKT) expression was analysed after culture in the absence or presence of LY294002. IGF-1 at 100ngmL-1 increased (PIGF-1. LY294002 significantly inhibited follicular activation stimulated by α-MEM+ and 100ngmL-1 IGF-1 and reduced pAKT expression in follicles. Overall, IGF-1 at 100ngmL-1 promoted primordial follicle activation, cell proliferation and reduced DNA fragmentation after in situ culture through the PI3K/AKT pathway.
Chromatin Constrains the Initiation and Elongation of DNA Replication.
Devbhandari, Sujan; Jiang, Jieqing; Kumar, Charanya; Whitehouse, Iestyn; Remus, Dirk
2017-01-05
Eukaryotic chromosomal DNA is faithfully replicated in a complex series of cell-cycle-regulated events that are incompletely understood. Here we report the reconstitution of DNA replication free in solution with purified proteins from the budding yeast Saccharomyces cerevisiae. The system recapitulates regulated bidirectional origin activation; synthesis of leading and lagging strands by the three replicative DNA polymerases Pol α, Pol δ, and Pol ε; and canonical maturation of Okazaki fragments into continuous daughter strands. We uncover a dual regulatory role for chromatin during DNA replication: promoting origin dependence and determining Okazaki fragment length by restricting Pol δ progression. This system thus provides a functional platform for the detailed mechanistic analysis of eukaryotic chromosome replication. Copyright © 2017 Elsevier Inc. All rights reserved.
Eukaryotic transcriptomics in silico: Optimizing cDNA-AFLP efficiency
Stölting, K.N.; Gort, G.; Wüst, C.; Wilson, A.B.
2009-01-01
Background - Complementary-DNA based amplified fragment length polymorphism (cDNA-AFLP) is a commonly used tool for assessing the genetic regulation of traits through the correlation of trait expression with cDNA expression profiles. In spite of the frequent application of this method, studies on
Recurrence plot analysis of DNA sequences
Energy Technology Data Exchange (ETDEWEB)
Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn
2004-11-15
Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.
Soares, Marcelo B.; Efstratiadis, Argiris
1997-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
International Nuclear Information System (INIS)
Pramanik, P.; Kanhouwa, N.; Kan, L.
1988-01-01
Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported
Improved DNA electrophoresis in conditions favoring polyborates and lewis acid complexation.
Directory of Open Access Journals (Sweden)
Hari Singhal
2010-06-01
Full Text Available Spatial compression among the longer DNA fragments occurs during DNA electrophoresis in agarose and non-agarose gels when using certain ions in the conductive buffer, impairing the range of fragment sizes resolved well in a single gel. Substitutions using various polyhydroxyl anions supported the underlying phenomenon as the complexation of Lewis acids to DNA. We saw significant improvements using conditions (lithium borate 10 mM cations, pH 6.5 favoring the formation of borate polyanions and having lower conductance and Joule heating, delayed electrolyte exhaustion, faster electrophoretic run-speed, and sharper separation of DNA bands from 100 bp to 12 kb in a single run.
Akiyoshi, Takeshi; Matzno, Sumio; Sakai, Mika; Okamura, Noboru; Matsuyama, Kenji
2009-12-01
We tried to clarify the cytotoxic mechanism of VK(3) using the breast cancer cell line MCF-7. Cytotoxicity was measured via intracellular esterase activity. DNA fragmentation was assessed by agarose gel electrophoresis. JC-1 staining was applied to measure mitochondrial dysfunction. Caspase activation and reactive oxidative species (ROS) generation were also measured. VK(3) exhibited cytotoxicity that caused DNA fragmentation in MCF-7 cells with an IC(50) of 14.2 microM. JC-1 staining revealed that VK(3) caused mitochondrial dysfunction including a disappearance of mitochondrial membrane potential. Additional investigation showed that the mitochondrial damage was induced by the generation of ROS and the subsequent activation of caspase-7 and -9. Our findings demonstrate that VK(3)-induced apoptosis is selectively initiated by the mitochondria-related pathway and might be useful in breast cancer chemotherapy.
Mark Knaebe
2013-01-01
Iron stain, an unsightly blueâblack or gray discoloration, can occur on nearly all woods. Oak, redwood, cypress, and cedar are particularly prone to iron stain because these woods contain large amounts of tannin-like extractives. The discoloration is caused by a chemical reaction between extractives in the wood and iron in steel products, such as nails, screws, and...
Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1
International Nuclear Information System (INIS)
Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui
2011-01-01
Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)
Terr, L I
1986-09-01
This paper presents two simple, reliable methods for identification of lipofuscin and Nissl bodies in the same section. One method shows that lipofuscin stained with crystal violet retains its ability to fluoresce and can be observed under the fluorescence microscope after the stain has faded. Fading is accompanied by a gradual increase in the intensity of the fluorescence and is complete in about 5 min. Exciting illumination from this part of the spectrum also substantially fades staining of other autofluorescing tissue elements, such as lipids. Nonfluorescing structures, such as Nissl bodies, remain stained. By changing from transillumination with tungsten light to epifluorescent illumination and vice versa, both types of structures--Nissl bodies and lipofuscin--can be identified in the same section. The second technique uses pyronin Y for staining Nissl bodies in preparations previously stained with crystal violet. Nissl bodies are stained pink but lipofuscin remains violet. Lipofuscin in these sections also remains autofluorescent after the crystal violet stain has faded under violet or near-UV light.
Histological Stains: A Literature Review and Case Study.
Alturkistani, Hani A; Tashkandi, Faris M; Mohammedsaleh, Zuhair M
2015-06-25
The history of histology indicates that there have been significant changes in the techniques used for histological staining through chemical, molecular biology assays and immunological techniques, collectively referred to as histochemistry. Early histologists used the readily available chemicals to prepare tissues for microscopic studies; these laboratory chemicals were potassium dichromate, alcohol and the mercuric chloride to harden cellular tissues. Staining techniques used were carmine, silver nitrate, Giemsa, Trichrome Stains, Gram Stain and Hematoxylin among others. The purpose of this research was to assess past and current literature reviews, as well as case studies, with the aim of informing ways in which histological stains have been improved in the modern age. Results from the literature review has indicated that there has been an improvement in histopathology and histotechnology in stains used. There has been a rising need for efficient, accurate and less complex staining procedures. Many stain procedures are still in use today, and many others have been replaced with new immunostaining, molecular, non-culture and other advanced staining techniques. Some staining methods have been abandoned because the chemicals required have been medically proven to be toxic. The case studies indicated that in modern histology a combination of different stain techniques are used to enhance the effectiveness of the staining process. Currently, improved histological stains, have been modified and combined with other stains to improve their effectiveness.
Development of biometric DNA ink for authentication security.
Hashiyada, Masaki
2004-10-01
Among the various types of biometric personal identification systems, DNA provides the most reliable personal identification. It is intrinsically digital and unchangeable while the person is alive, and even after his/her death. Increasing the number of DNA loci examined can enhance the power of discrimination. This report describes the development of DNA ink, which contains synthetic DNA mixed with printing inks. Single-stranded DNA fragments encoding a personalized set of short tandem repeats (STR) were synthesized. The sequence was defined as follows. First, a decimal DNA personal identification (DNA-ID) was established based on the number of STRs in the locus. Next, this DNA-ID was encrypted using a binary, 160-bit algorithm, using a hashing function to protect privacy. Since this function is irreversible, no one can recover the original information from the encrypted code. Finally, the bit series generated above is transformed into base sequences, and double-stranded DNA fragments are amplified by the polymerase chain reaction (PCR) to protect against physical attacks. Synthesized DNA was detected successfully after samples printed in DNA ink were subjected to several resistance tests used to assess the stability of printing inks. Endurance test results showed that this DNA ink would be suitable for practical use as a printing ink and was resistant to 40 hours of ultraviolet exposure, performance commensurate with that of photogravure ink. Copyright 2004 Tohoku University Medical Press
Eukaryotic DNA Replication Fork.
Burgers, Peter M J; Kunkel, Thomas A
2017-06-20
This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.
Use of DNA markers in forest tree improvement research
D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall
1992-01-01
DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...
International Nuclear Information System (INIS)
Hammad, A.A.; Abo El Nour, S.A.; Ibrahim, H.M.; Osman, M.E.; Abo El- Nasr, A.
2014-01-01
In the present study the microgel electrophoresis of single cells (DNA Comet Assay), and changes in microflora load were applied to detect irradiation treatment of strawberries and fresh-deboned chicken produced in Egypt. Strawberry samples were irradiated at 1.0, 2.0, 3.0 and 4.0 kGy, stored at 4 degree C±1 and analyzed at 0 and 7 days post.-irradiation. Fresh- deboned chicken meat samples were exposed to 2.0, 3.0, 4.0 and 5.0 kGy, stored at 4 degree C±1 and analyzed at 0, 7, 14 and 21 days post-irradiation. After electrophoresis performance, the accridine orange stain slides were seen under fluorescent microscope and the DNA comets were evaluated by photographic and image analysis. Changes in microflora load of irradiated samples were also evaluated. In all irradiated samples, the DNA fragments stretched or migrated out of the cells towards the anode of the agrose gel and appeared as a “comets” with tail. Whereas, DNA comets of all non-irradiated samples were almost intact, round without tail or had very short tail. Values of DNA % in tails and the tail length increased with increasing irradiation dose and storage times. The DNA comet assay could successfully be used to detect radiation treatment of strawberry and deboned-chicken meat samples up to 7 and 21 days post-irradiation, respectively. The absence of gram-negative bacteria and enterobacteriaceae group as well as the very low count of fungi (mostly yeasts) might be considered another evidence of radiation treatment of strawberries and fresh-deboned chicken.
Copani, Agata; Hoozemans, Jeroen J. M.; Caraci, Filippo; Calafiore, Marco; van Haastert, Elise S.; Veerhuis, Robert; Rozemuller, Annemieke J. M.; Aronica, Eleonora; Sortino, Maria Angela; Nicoletti, Ferdinando
2006-01-01
Cultured neurons exposed to synthetic beta-amyloid (Abeta) fragments reenter the cell cycle and initiate a pathway of DNA replication that involves the repair enzyme DNA polymerase-beta (DNA pol-beta) before undergoing apoptotic death. In this study, by performing coimmunoprecipitation experiments
In vivo imaging of cell nuclei by photoacoustic microscopy without staining
Yao, Da-Kang; Chen, Ruimin; Maslov, Konstantin; Zhou, Qifa; Wang, Lihong V.
2012-02-01
Ultraviolet photoacoustic microscopy (UVPAM) can image cell nuclei in vivo with high contrast and resolution noninvasively without staining. Here, we used UV light at wavelengths of 210-310 nm for excitation of DNA and RNA to produce photoacoustic waves. We applied the UVPAM to in vivo imaging of cell nuclei in mouse skin, and obtained UVPAM images of the unstained cell nuclei at wavelengths of 245-282 nm as ultrasound gel was used for acoustic coupling. The largest ratio of contrast to noise was found for the images of cell nuclei at a 250 nm wavelength.
DNA polymorphism of HLA class II genes in systemic lupus erythematosus
DEFF Research Database (Denmark)
Cowland, J B; Andersen, V; Halberg, P
1994-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) genes: HLA-DRB, -DQA, -DQB, -DPB in 24 Danish patients with systemic lupus erythematosus (SLE) and in 102 healthy Danes. A highly significant increase of the frequency of the DR3......- and DRw6-associated 7.00 kb DRB TaqI DNA fragment was found in SLE patients compared to normal controls (83.3% vs 35.5%; RR = 9.1, p 1*0501-associated 4.56 kb DQA TaqI fragment and the DRB3*01/03-associated 9.79 kb TaqI fragment were also found to be significantly...... increased in SLE patients (70.8% vs 29.7%; RR = 5.8, p 1%; RR = 4.3, p
Centrifuge-operated specimen staining method and apparatus
Clarke, Mark S. F. (Inventor); Feeback, Daniel L. (Inventor)
1999-01-01
A method of staining preselected, mounted specimens of either biological or nonbiological material enclosed within a staining chamber where the liquid staining reagents are applied and removed from the staining chamber using hypergravity as the propelling force. In the preferred embodiment, a spacecraft-operated centrifuge and method of diagnosing biological specimens while in orbit, characterized by hermetically sealing a shell assembly. The assembly contains slide stain apparatus with computer control therefor, the operative effect of which is to overcome microgravity, for example on board an International Space Station.
DNA fingerprinting of pearls to determine their origins.
Directory of Open Access Journals (Sweden)
Joana B Meyer
Full Text Available We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay in the internal transcribed spacer (ITS region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.
Directory of Open Access Journals (Sweden)
Itai Gat
Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.
Genetic transformation of watermelon with pumpkin DNA by low energy ion beam-mediated introduction
International Nuclear Information System (INIS)
Wang Haobo; Guo Jinhua; Huang Qunce; Yu Zengliang
2002-01-01
The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N + implantation at the dosage of 7.8 x 10 16 ions/cm 2 . After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 degree C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor
Genetic Transformation of Watermelon with Pumpkin DNA by Low Energy Ion Beam-Mediated Introduction
Wang, Hao-bo; Gao, Xiu-wu; Guo, Jin-hua; Huang, Qun-ce; Yu, Zeng-liang
2002-12-01
The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N+ implantation at the dosage of 7.8 × 1016 ions/cm2. After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 °C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor.
Inhibition of DNA topoisomerase I activity and induction of apoptosis by thiazacridine derivatives
Energy Technology Data Exchange (ETDEWEB)
Barros, Francisco W.A. [Department of Physiology and Pharmacology, School of Medicine, Federal University of Ceará, Fortaleza, Ceará (Brazil); Bezerra, Daniel P., E-mail: danielpbezerra@gmail.com [Department of Physiology, Federal University of Sergipe, São Cristóvão, Sergipe (Brazil); Ferreira, Paulo M.P. [Department of Biological Sciences, Federal University of Piauí, Picos, Piauí (Brazil); Cavalcanti, Bruno C. [Department of Physiology and Pharmacology, School of Medicine, Federal University of Ceará, Fortaleza, Ceará (Brazil); Silva, Teresinha G.; Pitta, Marina G.R.; Lima, Maria do C.A. de; Galdino, Suely L.; Pitta, Ivan da R. [Department of Antibiotics, Federal, University of Pernambuco, Recife, Pernembuco (Brazil); Costa-Lotufo, Letícia V.; Moraes, Manoel O. [Department of Physiology and Pharmacology, School of Medicine, Federal University of Ceará, Fortaleza, Ceará (Brazil); Burbano, Rommel R. [Institute of Biological Sciences, Federal University of Pará, Belém, Pará (Brazil); Guecheva, Temenouga N.; Henriques, João A.P. [Biotechnology Center, Federal University of Rio Grande do Sul, Porto Alegre, Rio Grande do Sul (Brazil); Pessoa, Cláudia, E-mail: cpessoa@ufc.br [Department of Physiology and Pharmacology, School of Medicine, Federal University of Ceará, Fortaleza, Ceará (Brazil)
2013-04-01
Thiazacridine derivatives (ATZD) are a novel class of cytotoxic agents that combine an acridine and thiazolidine nucleus. In this study, the cytotoxic action of four ATZD were tested in human colon carcinoma HCT-8 cells: (5Z)-5-acridin-9-ylmethylene-3-(4-methylbenzyl)-thiazolidine-2,4-dione — AC-4; (5ZE)-5-acridin-9-ylmethylene-3-(4-bromo-benzyl)-thiazolidine-2,4-dione — AC-7; (5Z)-5-(acridin-9-ylmethylene)-3-(4-chloro-benzyl) -1,3-thiazolidine-2,4-dione — AC-10; and (5ZE)-5-(acridin-9-ylmethylene)-3-(4-fluoro-benzyl)-1,3-thiazolidine-2, 4-dione — AC-23. All of the ATZD tested reduced the proliferation of HCT-8 cells in a concentration- and time-dependent manner. There were significant increases in internucleosomal DNA fragmentation without affecting membrane integrity. For morphological analyses, hematoxylin–eosin and acridine orange/ethidium bromide were used to stain HCT-8 cells treated with ATZD, which presented the typical hallmarks of apoptosis. ATZD also induced mitochondrial depolarisation and phosphatidylserine exposure and increased the activation of caspases 3/7 in HCT-8 cells, suggesting that this apoptotic cell death was caspase-dependent. In an assay using Saccharomyces cerevisiae mutants with defects in DNA topoisomerases 1 and 3, the ATZD showed enhanced activity, suggesting an interaction between ATZD and DNA topoisomerase enzyme activity. In addition, ATZD inhibited DNA topoisomerase I action in a cell-free system. Interestingly, these ATZD did not cause genotoxicity or inhibit the telomerase activity in human lymphocyte cultures at the experimental levels tested. In conclusion, the ATZD inhibited the DNA topoisomerase I activity and induced tumour cell death through apoptotic pathways. - Highlights: ► Thiazacridine derivatives induce mitochondrial-dependent apoptotic cell death. ► Thiazacridine derivatives inhibit DNA topoisomerase I action. ► Thiazacridine derivatives failed to cause genotoxicity on human lymphocytes.
Inhibition of DNA topoisomerase I activity and induction of apoptosis by thiazacridine derivatives
International Nuclear Information System (INIS)
Barros, Francisco W.A.; Bezerra, Daniel P.; Ferreira, Paulo M.P.; Cavalcanti, Bruno C.; Silva, Teresinha G.; Pitta, Marina G.R.; Lima, Maria do C.A. de; Galdino, Suely L.; Pitta, Ivan da R.; Costa-Lotufo, Letícia V.; Moraes, Manoel O.; Burbano, Rommel R.; Guecheva, Temenouga N.; Henriques, João A.P.; Pessoa, Cláudia
2013-01-01
Thiazacridine derivatives (ATZD) are a novel class of cytotoxic agents that combine an acridine and thiazolidine nucleus. In this study, the cytotoxic action of four ATZD were tested in human colon carcinoma HCT-8 cells: (5Z)-5-acridin-9-ylmethylene-3-(4-methylbenzyl)-thiazolidine-2,4-dione — AC-4; (5ZE)-5-acridin-9-ylmethylene-3-(4-bromo-benzyl)-thiazolidine-2,4-dione — AC-7; (5Z)-5-(acridin-9-ylmethylene)-3-(4-chloro-benzyl) -1,3-thiazolidine-2,4-dione — AC-10; and (5ZE)-5-(acridin-9-ylmethylene)-3-(4-fluoro-benzyl)-1,3-thiazolidine-2, 4-dione — AC-23. All of the ATZD tested reduced the proliferation of HCT-8 cells in a concentration- and time-dependent manner. There were significant increases in internucleosomal DNA fragmentation without affecting membrane integrity. For morphological analyses, hematoxylin–eosin and acridine orange/ethidium bromide were used to stain HCT-8 cells treated with ATZD, which presented the typical hallmarks of apoptosis. ATZD also induced mitochondrial depolarisation and phosphatidylserine exposure and increased the activation of caspases 3/7 in HCT-8 cells, suggesting that this apoptotic cell death was caspase-dependent. In an assay using Saccharomyces cerevisiae mutants with defects in DNA topoisomerases 1 and 3, the ATZD showed enhanced activity, suggesting an interaction between ATZD and DNA topoisomerase enzyme activity. In addition, ATZD inhibited DNA topoisomerase I action in a cell-free system. Interestingly, these ATZD did not cause genotoxicity or inhibit the telomerase activity in human lymphocyte cultures at the experimental levels tested. In conclusion, the ATZD inhibited the DNA topoisomerase I activity and induced tumour cell death through apoptotic pathways. - Highlights: ► Thiazacridine derivatives induce mitochondrial-dependent apoptotic cell death. ► Thiazacridine derivatives inhibit DNA topoisomerase I action. ► Thiazacridine derivatives failed to cause genotoxicity on human lymphocytes
International Nuclear Information System (INIS)
Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet
2004-01-01
The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component of oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication
International Nuclear Information System (INIS)
Miyachi, Yukihisa; Kanao, Tomoko; Okamoto, Takehito
2005-01-01
We examined whether background radiation, or radiation at a slightly higher level, plays a role in the reproduction of a terrestrial earthworm. Enchytraeus japonensis a recently described terrestrial oligochaete, reproduces asexually by fragmentation and subsequent regeneration. Following radiation exposure in which the worms were subjected to a 32 P β-emitter source at 15 times the background dose rate (4.5 μGy/h), a statistically significant decrease in the number of fragmentations was observed as compared with the sham controls. At that time, in a stained preparation with haematoxylin and eosin (HE), sexual reproduction occurred instead of asexual fragmentation, and mature oocytes were observed in the body of grown worms. However, increasing the radiation dose rate by 30 μGy/h resulted in the complete disappearance of the radiation-induced effects, i.e., fragmentation again occurred after 14 h. The results of this study indicate that a lower dose of radiation may be essential to achieve sexual reproduction, inducing an inhibition of fragmentation (asexual reproduction), but at higher, more cytotoxic doses of radiation these effects are negated
RAD51 interconnects between DNA replication, DNA repair and immunity.
Bhattacharya, Souparno; Srinivasan, Kalayarasan; Abdisalaam, Salim; Su, Fengtao; Raj, Prithvi; Dozmorov, Igor; Mishra, Ritu; Wakeland, Edward K; Ghose, Subroto; Mukherjee, Shibani; Asaithamby, Aroumougame
2017-05-05
RAD51, a multifunctional protein, plays a central role in DNA replication and homologous recombination repair, and is known to be involved in cancer development. We identified a novel role for RAD51 in innate immune response signaling. Defects in RAD51 lead to the accumulation of self-DNA in the cytoplasm, triggering a STING-mediated innate immune response after replication stress and DNA damage. In the absence of RAD51, the unprotected newly replicated genome is degraded by the exonuclease activity of MRE11, and the fragmented nascent DNA accumulates in the cytosol, initiating an innate immune response. Our data suggest that in addition to playing roles in homologous recombination-mediated DNA double-strand break repair and replication fork processing, RAD51 is also implicated in the suppression of innate immunity. Thus, our study reveals a previously uncharacterized role of RAD51 in initiating immune signaling, placing it at the hub of new interconnections between DNA replication, DNA repair, and immunity. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
González-Andrade, Fabricio; Sánchez, Dora
2005-10-01
We present individual body identification efforts, to identify skeletal remains and relatives of missing persons of an explosion took place inside one of the munitions recesses of the Armoured Brigade of the Galapagos Armoured Cavalry, in the city of Riobamba, Ecuador, on Wednesday, November 20, 2002. Nineteen samples of bone remains and two tissue samples (a blood stain on a piece of fabric) from the zero zone were analysed. DNA extraction was made by Isoamilic Phenol-Chloroform-Alcohol, and proteinase K. We increased PCR cycles to identify DNA from bones to 35 cycles in some cases. An ABI 310 sequencer was used. Determination of the fragment size and the allelic designation of the different loci was carried out by comparison with the allelic ladders of the PowerPlex 16 kit and Gene Scan Analysis Software programme. Five possible family groups were established and were compared with the profiles found. Classical Bayesian methods were used to calculate the Likelihood Ratio and it was possible to identify five different genetic profiles in our country. This paper is important because is a novel experience for our forensic services, because this was the first time DNA had been used as an identification method in disasters, and it was validated by Ecuadorian justice like a very effective method.
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Random amplified polymorphic DNA based genetic characterization ...
African Journals Online (AJOL)
DIRECTOR
2013-07-10
Jul 10, 2013 ... Electrophoresis) buffer, 2 µl of SYBR-safe (DNA staining dye) was added to it, mixed properly, ..... tools in plant genetic resources conservation: a guide to the technologies. IPGRI. Rome ... Creating Capital. Seethalakshmi KK ...
Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M
1996-05-16
A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.
Selection and application of exterior stains for wood
R. Sam. Williams; William C. Feist
1999-01-01
Exterior stains for wood protect the wood surface from sunlight and moisture. Because stains are formulated to penetrate the wood surface, they are not prone to crack or peel as can film-forming finishes, such as paints. This publication describes the properties of stains and wood, methods for applying stains, and the expected service life of stains.
X-ray sensitization of chromatids with unifilarly and bifilarly substituted DNA
International Nuclear Information System (INIS)
Wolff, S.
1981-01-01
When cells are grown for two rounds of DNA replication in the presence of the thymidine analogue 5-bromodeoxyuridine, chromosomes containing one chromatid with unifilarly substituted DNA and one with bifilarly substituted DNA are found. These can be distinguished by harlequin staining techniques that stain one chromatid dark and one light. When the degree of substitution is 60% or greater, 3 times as many X-ray-induced chromatid breaks are produced as in unsubstituted chromatids. This represents maximal sensitization. The unifilarly substituted (dark) chromatid is as sensitive as its bifilarly substituted (light) sister chromatid. If cells are grown in low concentrations of 5-bromodeoxyuridine (BrdUrd), then the amount of substitution is less and the bifilarly substituted chromatic is more sensitive than the unifilarly substituted one. When large numbers of cells are grown in very low concentrations of BrdUrd, the analogue is almost completely depleted during the first round of replication leading to harlequin chromosomes containing one unsubstituted (dark) and one unifilarly substituted (light) chromatid. Under these conditions a maximal sensitization between light-staining and dark-staining chromatids can occur. This can be confused with the differential sensitivity between unifilarly and bifilarly substituted chromatids. The apparent discrepant results obtained by different investigators are most likely caused by the use of very low levels of BrdUrd in some of the experiments. (orig.)
Differential staining of bacteria: acid fast stain.
Reynolds, Jackie; Moyes, Rita B; Breakwell, Donald P
2009-11-01
Acid-fastness is an uncommon characteristic shared by the genera Mycobacterium (Section 10A) and Nocardia. Because of this feature, this stain is extremely helpful in identification of these bacteria. Although Gram positive, acid-fast bacteria do not take the crystal violet into the wall well, appearing very light purple rather than the deep purple of normal Gram-positive bacteria. (c) 2009 by John Wiley & Sons, Inc.
Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad
2017-09-01
Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed
Metagenome Fragment Classification Using -Mer Frequency Profiles
Directory of Open Access Journals (Sweden)
Gail Rosen
2008-01-01
Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.
Evaluation of irradiation in foods using DNA comet assay
International Nuclear Information System (INIS)
Khawar, Affaf; Bhatti, Ijaz Ahmad; Khan, Q.M.; Ali, T.; Khan, A.I.; Asi, M.R.
2011-01-01
Comet assay is a rapid, inexpensive and sensitive biological technique to detect DNA damage in food stuffs by irradiation. In this study the Comet assay is applied on foods of plant and animal origins. Samples were irradiated by using 60 Co gamma-radiation source. The applied doses were 2, 6 and 10 kGy for food of plant origin and 0.5, 1 and 2 kGy for meat items. The un-irradiated and irradiated samples were clearly differentiated on the basis of DNA fragmentation. During the electrophoresis study, it was found that in un-irradiated cells DNA remained intact and appeared as Comets without tail whereas in irradiated cells Comets with tails were visible due to stretching of fragmented DNA. Moreover, it was also revealed that the DNA tail length was dose dependent. Dry food stuffs (seeds) showed good results as compared to moist foods (meat, fruits and vegetables) due to the absence of background damage. (author)
Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).
Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J
2014-01-01
DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic
Note: Primer Amysat 001; Fragment size is 211bp
Indian Academy of Sciences (India)
Renuka
Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.
Isolation of a sex-linked DNA sequence in cranes.
Duan, W; Fuerst, P A
2001-01-01
A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.
Distortion of DNA Origami on Graphene Imaged with Advanced TEM Techniques.
Kabiri, Yoones; Ananth, Adithya N; van der Torre, Jaco; Katan, Allard; Hong, Jin-Yong; Malladi, Sairam; Kong, Jing; Zandbergen, Henny; Dekker, Cees
2017-08-01
While graphene may appear to be the ultimate support membrane for transmission electron microscopy (TEM) imaging of DNA nanostructures, very little is known if it poses an advantage over conventional carbon supports in terms of resolution and contrast. Microscopic investigations are carried out on DNA origami nanoplates that are supported onto freestanding graphene, using advanced TEM techniques, including a new dark-field technique that is recently developed in our lab. TEM images of stained and unstained DNA origami are presented with high contrast on both graphene and amorphous carbon membranes. On graphene, the images of the origami plates show severe unwanted distortions, where the rectangular shape of the nanoplates is significantly distorted. From a number of comparative control experiments, it is demonstrated that neither staining agents, nor screening ions, nor the level of electron-beam irradiation cause this distortion. Instead, it is suggested that origami nanoplates are distorted due to hydrophobic interaction of the DNA bases with graphene upon adsorption of the DNA origami nanoplates. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Differential expression analysis of genic male sterility by cDNA-AFLP in maize
International Nuclear Information System (INIS)
Zhang Linbi; Rong Tingzhao; Pan Guangtang; Cao Moju
2009-01-01
The differential expression of male sterility induced by space flight with male fertility was studied using cDNA-AFLP technology. Total RNA was isolated from anther of male sterility and male fertility. Nine differential expression cDNA fragments were obtained with 16 primer combinations. The differential cDNA fragments were eluted, cloned and sequenced. Then half-quantitative RT-PCR was used to stuy the differential expressions of 4 development stages between sterility and fertility. Sequencing analysis shown 2 fragments from male sterility might be novel genes. Four fragments from male fertility were homology as chalcone and stilbene synthases, putative acyl CoA dehydrogenase, putative protein kinases and putative glycine decarboxylase. All these proteins might participate in the energy metabolisms, substance metabolisms or signal pollen development, Z8 took on increasing expression during the middle period of pollen development. These results just met the demand of more energy and more substance during the pollen development. (authors)
Kostetskiĭ, P V; Dobrova, I E
1988-04-01
An algorithm for reconstructing long DNA sequences, i.e. arranging all overlapping gel readings in the contigs, and the corresponding BASIC programme for personal computer "Iskra-226" (USSR) are described. The contig construction begins with the search for all fragments overlapping the basic (longest) one follower by determination of coordinates of 5' ends of the overlapping fragments. Then the gel reading with minimal 5' end coordinate and the gel reading with maximal 3' end coordinate are selected and used as basic ones at the next assembly steps. The procedure is finished when no gel reading overlapping the basic one can be found. All gel readings entered the contig are ignored at the next steps of the assembly. Finally, one or several contigs consisted of DNA fragments are obtained. Effectiveness of the algorithm was tested on a model based on the multiple assembly of the nucleotide sequence, encoding the Na, K-ATPase alpha-subunit of pig kidney. The programme does not call for user's participation and can comprise contigs up to 10,000 nucleotides long.
Automation of a single-DNA molecule stretching device
DEFF Research Database (Denmark)
Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels
2015-01-01
We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...
Tarcz, Sebastian; Potekhin, Alexey; Rautian, Maria; Przyboś, Ewa
2012-05-01
This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p=0.025/0.082 (rDNA/COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens. Copyright © 2012 Elsevier Inc. All rights reserved.
Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight
Shi, Jinming
In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.
Directory of Open Access Journals (Sweden)
Daniel S Yuan
Full Text Available Auxotrophic marker genes such as URA3, LEU2, and HIS3 in Saccharomyces cerevisiae have long been used to select cells that have been successfully transformed with recombinant DNA. A longstanding challenge in working with these genes is that counterselection procedures are often lacking. This paper describes the unexpected discovery of a simple plate assay that imparts a bright red stain to cells experiencing nutritional stress from the lack of a marker gene. The procedure specifically stains a zinc-rich vesicular compartment analogous to the zinc-rich secretory vesicles found in insulin-secreting pancreatic islet cells and glutamate-secreting neurons. Staining was greatly diminished in zap1 mutants, which lack a homeostatic activator of zinc uptake, and in cot1 zrc1 double mutants, which lack the two yeast homologs of mammalian vesicle-specific zinc export proteins. Only one of 93 strains with temperature-sensitive alleles of essential genes exhibited an increase in dithizone staining at its non-permissive temperature, indicating that staining is not simply a sign of growth-arrested or dying cells. Remarkably, the procedure works with most commonly used marker genes, highlights subtle defects, uses no reporter constructs or expensive reagents, requires only a few hours of incubation, yields visually striking results without any instrumentation, and is not toxic to the cells. Many potential applications exist for dithizone staining, both as a versatile counterscreen for auxotrophic marker genes and as a powerful new tool for the genetic analysis of a biomedically important vesicular organelle.
Roodbari, Fatemeh; Abedi, Nahid; Talebi, Ali Reza
2015-11-01
There are few studies indicating the detrimental effects of ibuprofen on sperm fertility potential and DNA integrity. To determine the effects of Ibuprofen on sperm parameters, chromatin condensation and DNA integrity of mice. In this experimental study, 36 adult male mice with average weight 37 gr were divided into three groups, including control (group I, n=12), normal dosage of ibuprofen (group II, n=12) and high dosage (group III, n=12). Ibuprofen with different doses was dissolved in daily water of animals. After 35, 70 and 105 days, the cauda epididymis of mice were cut and incubated in Ham's F10 media. Sperm samples were analyzed for parameters (motility, morphology and count), DNA integrity (SCD test) and chromatin condensation (chromomycin A3 and Aniline blue staining). After 35 days, in addition to above mentioned sperm parameters, all of the treated mice showed statistically significant increase in spermatozoa with immature chromatin (Psperm DNA fragmentation assessed by SCD was increased in group II (66.5±0.7) and the percentage of immature spermatozoa (AB(+) and CMA3(+)) was higher in group III (77.5±0.7 and 49.5±6.3 respectively) than other groups. After 105 days, the AB(+) spermatozoa were increased in both normal dose and high dose groups. Ibuprofen may cause a significant reduction in sperm parameters and sperm chromatin/DNA integrity in mice. It should be noted that these deleterious effects are dose-dependent and can be seen in early and late stage of drug treatments.
Eral, Burak; van den Ende, Henricus T.M.; Mugele, Friedrich Gunther
2012-01-01
Discussing ideas over a mug of coffee or tea is the lifeblood of science, but have you ever thought about the stains that can be inadvertently left behind? H Burak Eral, Dirk van den Ende and Frieder Mugele explain how these stains, which can be a major annoyance in some biology techniques, can be
[Single-molecule detection and characterization of DNA replication based on DNA origami].
Wang, Qi; Fan, Youjie; Li, Bin
2014-08-01
To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.
Labelling of Cells Engaged in DNA Synthesis: Autoradiography and BrdU Staining
DEFF Research Database (Denmark)
Madsen, Peder Søndergaard
2010-01-01
The cell cycle is divided in four phases: G1 phase, S phase (DNA-synthesis), G2 phase (together termed interphase) and M phase (mitosis). Cells that have ceased proliferation enter a state of quiescence called G0. M phase is itself composed of two tightly coupled processes: mitosis, in which...
Histopathological evaluation of ocular microsporidiosis by different stains
Directory of Open Access Journals (Sweden)
Sharma Savitri
2006-06-01
Full Text Available Abstract Background There is limited data on comparing stains in the detection of microsporidia in corneal biopsies. Hence we wanted to evaluate various stains for their ability to detect microsporidia in corneal tissue sections. Methods Four cases diagnosed with microsporidiosis on Hematoxylin and Eosin and Periodic Acid Schiff's stained sections of the corneal button between January 2002 and December 2004, were included. Further sections were prospectively stained with calcofluor white, Gram, Giemsa, Masson's trichrome, acridine orange, Gomori's methenamine silver, Gram's chromotrope and modified acid fast stain. The stained sections were analyzed for the spore characteristics in terms of size, shape, color contrast, cell wall morphology, waist band in cytoplasm and ease of detection. Results All sections showed microsporidial spores as 3 – 5 μm, oval bodies. 1% acid fast, Gram's chromotrope and GMS stains provided a reliable diagnosis of microsporidia as diagnostic waist band could be identified and good contrast helped distinguish the spores from inflammatory debris. Conclusion Considering the ease of performance, cost effectiveness and rapidity of the technique, 1% acid fast stain and Gram's chromotrope stain are ideal for the detection of microsporidia.
Khezri, Abdolrahman; Lindeman, Birgitte; Krogenæs, Anette K; Berntsen, Hanne F; Zimmer, Karin E; Ropstad, Erik
2017-08-15
Persistent organic pollutants (POPs) are widespread throughout the environment and some are suspected to induce reproductive toxicity. As animals and humans are exposed to complex mixtures of POPs, it is reasonable to assess how such mixtures could interact with the reproductive system. Our aim is to investigate how maternal exposure to a mixture of 29 different persistent organic pollutants, formulated to mimic the relative POP levels in the food basket of the Scandinavian population, could alter reproductive endpoints. Female mice were exposed via feed from weaning, during pregnancy and lactation in 3 exposure groups (control (C), low (L) and high (H)). Testicular morphometric endpoints, epididymal sperm concentration and sperm DNA integrity were assessed in adult male offspring. We found that the number of tubules, proportion of tubule compartments and epididymal sperm concentration significantly decreased in both POP exposed groups. Epididymal sperm from both POP exposed groups showed increased DNA fragmentation. It is concluded that maternal exposure to a defined POP mixture relevant to human exposure can affect testicular development, sperm production and sperm chromatin integrity. Copyright © 2017 Elsevier Inc. All rights reserved.
DNA repair in proteus mirabilis. 5
International Nuclear Information System (INIS)
Hofemeister, J.; Boehme, H.; Fleischhacker, M.; Adler, B.; Eitner, G.; Steinborn, G.
1979-01-01
Inducible cell lysis in UV-irradiated cultures of Proteus mirabilis PG VI rec + derivatives is due to the induction of a defective prophage dP VI. This lytic response is found to account for the extraordinary high UV sensitivity of P. mirabilis rec + strains. Lysis of cells after UV or mitomycin C treatment is accompanied by the release of various defective phage particles including head-tail, tail and polysheath structures. Survival of P. mirabilis is shown to be strongly affected by the plating procedure. It is supposed that plating of UV-irradiated rec + cells after a distinct time of growth in liquid medium some how enhances the efficiency of repair activities rather than to prevent inducible cell lysis in P. mirabilis from occurring. The resident defective prophage interferes with the multiplication of infectious temperate phages (π1) as indicated by the efficiency of plating and plaque size. The extent of host-controlled reactivation of UV-irradiated phages, however, was not influenced by the lysogenic state of the host bacteria. The derepression of the resident prophage is thought to correlate with the appearence after UV exposure of a distinct and relatively stable low molecular weight DNA which is assumed to originate from enzymatic fragmentation rather than postmortal nicking of chromosomal DNA in P. mirabilis. Mutants are described which lost the inducible cell lysis response and, in case of PG 1300- also lost the immunity for bacteriolytic activities formed by PG VI strains after lysogenic induction. Whilst this derivative of P. mirabilis might either be cured for the defective prophage or rendered noninducible by mutation this substrain lost also both the extrasensitivity against UV and the chromosomal DNA fragmentation. The extent of the UV-induced DNA degradation response seems not to be markedly affected by these DNA fragmentations. (author)
DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present
Directory of Open Access Journals (Sweden)
Cheng-Yao eChen
2014-06-01
Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.
Directory of Open Access Journals (Sweden)
Zhenping Liu
2015-01-01
Full Text Available The aims of this study are to use quantitative analysis of the prostate-specific antigen (PSA in the seminal stain examination and to explore the practical value of this analysis in forensic science. For a comprehensive analysis, vaginal swabs from 48 rape cases were tested both by a PSA fluorescence analyzer (i-CHROMA Reader and by a conventional PSA strip test. To confirm the results of these PSA tests, seminal DNA was tested following differential extraction. Compared to the PSA strip test, the PSA rapid quantitative fluorescence analyzer provided the more accurate and sensitive results. More importantly, individualized schemes based on quantitative PSA results of samples can be developed to improve the quality and procedural efficiency in the forensic seminal inspection of samples prior to DNA analysis.
Kawasaki, M; Sasaki, K; Satoh, T; Kurose, A; Kamada, T; Furuya, T; Murakami, T; Todoroki, T
1997-01-01
We have demonstrated a method for the in situ determination of the cell cycle phases of TIG-7 fibroblasts using a laser scanning cytometer (LSC) which has not only a function equivalent to flow cytometry (FCM) but also has a capability unique in itself. LSC allows a more detailed analysis of the cell cycle in cells stained with propidium iodide (PI) than FCM. With LSC it is possible to discriminate between mitotic cells and G2 cells, between post-mitotic cells and G1 cells, and between quiescent cells and cycling cells in a PI fluorescence peak (chromatin condensation) vs. fluorescence value (DNA content) cytogram for cells stained with PI. These were amply confirmed by experiments using colcemid and adriamycin. We were able to identify at least six cell subpopulations for PI stained cells using LSC; namely G1, S, G2, M, postmitotic and quiescent cell populations. LSC analysis facilitates the monitoring of effects of drugs on the cell cycle.
Energy Technology Data Exchange (ETDEWEB)
Morand, Patrice [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France); Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble (France); Budayova-Spano, Monika [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France); Perrissin, Monique [Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble (France); Müller, Christoph W., E-mail: mueller@embl-grenoble.fr; Petosa, Carlo [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France)
2006-03-01
A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiation (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.
A new location to split Cre recombinase for protein fragment complementation.
Rajaee, Maryam; Ow, David W
2017-11-01
We have previously described a recombinase-mediated gene stacking system in which the Cre recombinase is used to remove lox-site flanked DNA no longer needed after each round of Bxb1 integrase-mediated site-specific integration. The Cre recombinase can be conveniently introduced by hybridization with a cre-expressing plant. However, maintaining an efficient cre-expressing line over many generations can be a problem, as high production of this DNA-binding protein might interfere with normal chromosome activities. To counter this selection against high Cre activity, we considered a split-cre approach, in which Cre activity is reconstituted after separate parts of Cre are brought into the same genome by hybridization. To insure that the recombinase-mediated gene stacking system retains its freedom to operate, we tested for new locations to split Cre into complementing fragments. In this study, we describe testing four new locations for splitting the Cre recombinase for protein fragment complementation and show that the two fragments of Cre split between Lys244 and Asn245 can reconstitute activity that is comparable to that of wild-type Cre. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Tweedie, John W.; Stowell, Kathryn M.
2005-01-01
A two-session laboratory exercise for advanced undergraduate students in biochemistry and molecular biology is described. The first session introduces students to DNA quantification by ultraviolet absorbance and agarose gel electrophoresis followed by ethidium bromide staining. The second session involves treatment of various topological forms of…
A new model for ancient DNA decay based on paleogenomic meta-analysis.
Kistler, Logan; Ware, Roselyn; Smith, Oliver; Collins, Matthew; Allaby, Robin G
2017-06-20
The persistence of DNA over archaeological and paleontological timescales in diverse environments has led to a revolutionary body of paleogenomic research, yet the dynamics of DNA degradation are still poorly understood. We analyzed 185 paleogenomic datasets and compared DNA survival with environmental variables and sample ages. We find cytosine deamination follows a conventional thermal age model, but we find no correlation between DNA fragmentation and sample age over the timespans analyzed, even when controlling for environmental variables. We propose a model for ancient DNA decay wherein fragmentation rapidly reaches a threshold, then subsequently slows. The observed loss of DNA over time may be due to a bulk diffusion process in many cases, highlighting the importance of tissues and environments creating effectively closed systems for DNA preservation. This model of DNA degradation is largely based on mammal bone samples due to published genomic dataset availability. Continued refinement to the model to reflect diverse biological systems and tissue types will further improve our understanding of ancient DNA breakdown dynamics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Katrin Carow
2017-09-01
Full Text Available The development of cervical cancer is frequently accompanied by the integration of human papillomaviruses (HPV DNA into the host genome. Viral-cellular junction sequences, which arise in consequence, are highly tumor specific. By using these fragments as markers for tumor cell origin, we examined cervical cancer clonality in the context of intra-tumor heterogeneity. Moreover, we assessed the potential of these fragments as molecular tumor markers and analyzed their suitability for the detection of circulating tumor DNA in sera of cervical cancer patients. For intra-tumor heterogeneity analyses tumors of 8 patients with up to 5 integration sites per tumor were included. Tumor islands were micro-dissected from cryosections of several tissue blocks representing different regions of the tumor. Each micro-dissected tumor area served as template for a single junction-specific PCR. For the detection of circulating tumor-DNA (ctDNA junction-specific PCR-assays were applied to sera of 21 patients. Samples were collected preoperatively and during the course of disease. In 7 of 8 tumors the integration site(s were shown to be homogenously distributed throughout different tumor regions. Only one tumor displayed intra-tumor heterogeneity. In 5 of 21 analyzed preoperative serum samples we specifically detected junction fragments. Junction-based detection of ctDNA was significantly associated with reduced recurrence-free survival. Our study provides evidence that HPV-DNA integration is as an early step in cervical carcinogenesis. Clonality with respect to HPV integration opens new perspectives for the application of viral-cellular junction sites as molecular biomarkers in a clinical setting such as disease monitoring.
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
International Nuclear Information System (INIS)
Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.
1987-01-01
The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens
DNA methylation alteration is a major consequence of genome doubling in autotetraploid Brassica rapa
Directory of Open Access Journals (Sweden)
Xu Yanhao
2017-01-01
Full Text Available Polyploids are typically classified as autopolyploids or allopolyploids based on the origin of their chromosome sets. Autopolyploidy is much more common than traditionally believed. Allopolyploidization, accompanied by genomic and transcriptomic changes, has been well investigated. In this study, genetic, DNA methylation and gene expression changes in autotetraploid Brassica rapa were investigated. No genetic alteration was detected using an amplified fragment length polymorphism (AFLP approach. Using a cDNA-AFLP approach, approximately 0.58% of fragments showed changes in gene expression in autotetraploid B. rapa. The methylation-sensitive amplification polymorphism (MSAP analysis showed that approximately 1.7% of the fragments underwent DNA methylation changes upon genome doubling, with hypermethylation and demethylation changes equally affected. Fragments displaying changes in gene expression and methylation status were isolated and then sequenced and characterized, respectively. This study showed that variation in cytosine methylation is a major consequence of genome doubling in autotetraploid Brassica rapa.
Multicenter Assessment of Gram Stain Error Rates.
Samuel, Linoj P; Balada-Llasat, Joan-Miquel; Harrington, Amanda; Cavagnolo, Robert
2016-06-01
Gram stains remain the cornerstone of diagnostic testing in the microbiology laboratory for the guidance of empirical treatment prior to availability of culture results. Incorrectly interpreted Gram stains may adversely impact patient care, and yet there are no comprehensive studies that have evaluated the reliability of the technique and there are no established standards for performance. In this study, clinical microbiology laboratories at four major tertiary medical care centers evaluated Gram stain error rates across all nonblood specimen types by using standardized criteria. The study focused on several factors that primarily contribute to errors in the process, including poor specimen quality, smear preparation, and interpretation of the smears. The number of specimens during the evaluation period ranged from 976 to 1,864 specimens per site, and there were a total of 6,115 specimens. Gram stain results were discrepant from culture for 5% of all specimens. Fifty-eight percent of discrepant results were specimens with no organisms reported on Gram stain but significant growth on culture, while 42% of discrepant results had reported organisms on Gram stain that were not recovered in culture. Upon review of available slides, 24% (63/263) of discrepant results were due to reader error, which varied significantly based on site (9% to 45%). The Gram stain error rate also varied between sites, ranging from 0.4% to 2.7%. The data demonstrate a significant variability between laboratories in Gram stain performance and affirm the need for ongoing quality assessment by laboratories. Standardized monitoring of Gram stains is an essential quality control tool for laboratories and is necessary for the establishment of a quality benchmark across laboratories. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently
Yu, Chuanhe; Gan, Haiyun
2017-01-01
ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720
Mitogenomic analyses from ancient DNA
DEFF Research Database (Denmark)
Paijmans, Johanna L. A.; Gilbert, Tom; Hofreiter, Michael
2013-01-01
The analysis of ancient DNA is playing an increasingly important role in conservation genetic, phylogenetic and population genetic analyses, as it allows incorporating extinct species into DNA sequence trees and adds time depth to population genetics studies. For many years, these types of DNA...... analyses (whether using modern or ancient DNA) were largely restricted to the analysis of short fragments of the mitochondrial genome. However, due to many technological advances during the past decade, a growing number of studies have explored the power of complete mitochondrial genome sequences...... yielded major progress with regard to both the phylogenetic positions of extinct species, as well as resolving population genetics questions in both extinct and extant species....
Fertilization capacity with rainbow trout DNA-damaged sperm and embryo developmental success.
Pérez-Cerezales, S; Martínez-Páramo, S; Beirão, J; Herráez, M P
2010-06-01
Mammalian spermatozoa undergo a strong selection process along the female tract to guarantee fertilization by good quality cells, but risks of fertilization with DNA-damaged spermatozoa have been reported. In contrast, most external fertilizers such as fish seem to have weaker selection procedures. This fact, together with their high prolificacy and external embryo development, indicates that fish could be useful for the study of the effects of sperm DNA damage on embryo development. We cryopreserved sperm from rainbow trout using egg yolk and low-density lipoprotein as additives to promote different rates of DNA damage. DNA fragmentation and oxidization were analyzed using comet assay with and without digestion with restriction enzymes, and fertilization trials were performed. Some embryo batches were treated with 3-aminobenzamide (3AB) to inhibit DNA repair by the poly (ADP-ribose) polymerase, which is an enzyme of the base excision repair pathway. Results showed that all the spermatozoa cryopreserved with egg yolk carried more than 10% fragmented DNA, maintaining fertilization rates of 61.1+/-2.3 but a high rate of abortions, especially during gastrulation, and only 14.5+/-4.4 hatching success. Furthermore, after 3AB treatment, hatching dropped to 3.2+/-2.2, showing that at least 10% DNA fragmentation was repaired. We conclude that trout sperm maintains its ability to fertilize in spite of having DNA damage, but that embryo survival is affected. Damage is partially repaired by the oocyte during the first cleavage. Important advantages of using rainbow trout for the study of processes related to DNA damage and repair during development have been reported.
Mitochondrial mosaics in the liver of 3 infants with mtDNA defects
Directory of Open Access Journals (Sweden)
Scalais Emmanuel
2009-06-01
Full Text Available Abstract Background In muscle cytochrome oxidase (COX negative fibers (mitochondrial mosaics have often been visualized. Methods COX activity staining of liver for light and electron microscopy, muscle stains, blue native gel electrophoresis and activity assays of respiratory chain proteins, their immunolocalisation, mitochondrial and nuclear DNA analysis. Results Three unrelated infants showed a mitochondrial mosaic in the liver after staining for COX activity, i.e. hepatocytes with strongly reactive mitochondria were found adjacent to cells with many negative, or barely reactive, mitochondria. Deficiency was most severe in the patient diagnosed with Pearson syndrome. Ragged-red fibers were absent in muscle biopsies of all patients. Enzyme biochemistry was not diagnostic in muscle, fibroblasts and lymphocytes. Blue native gel electrophoresis of liver tissue, but not of muscle, demonstrated a decreased activity of complex IV; in both muscle and liver subcomplexes of complex V were seen. Immunocytochemistry of complex IV confirmed the mosaic pattern in two livers, but not in fibroblasts. MRI of the brain revealed severe white matter cavitation in the Pearson case, but only slight cortical atrophy in the Alpers-Huttenlocher patient, and a normal image in the 3rd. MtDNA in leucocytes showed a common deletion in 50% of the mtDNA molecules of the Pearson patient. In the patient diagnosed with Alpers-Huttenlocher syndrome, mtDNA was depleted for 60% in muscle. In the 3rd patient muscular and hepatic mtDNA was depleted for more than 70%. Mutations in the nuclear encoded gene of POLG were subsequently found in both the 2nd and 3rd patients. Conclusion Histoenzymatic COX staining of a liver biopsy is fast and yields crucial data about the pathogenesis; it indicates whether mtDNA should be assayed. Each time a mitochondrial disorder is suspected and muscle data are non-diagnostic, a liver biopsy should be recommended. Mosaics are probably more frequent
Radiation chemistry of the base components of DNA and related substances
International Nuclear Information System (INIS)
Teoule, R.
1979-01-01
The loss of UV absorption may be considered as a useful index to evaluate the extent of base destruction. The variations observed reflect the sum of different phenomena: the modification of base stacking, hydrogen bond rupture between DNA bases and the saturation of conjugated double bonds of heterocycles. Another way to measure the base degradation is by formic acid hydrolysis. Radiation products are very sensitive to the formic acid hydrolysis performed at 180 deg C. In aerated solutions, an important event responsible for the degradation of pyrimidine bases is the formation of hydroperoxide. This review consists of the following subheadings: identification of the DNA base damages; thymine fragment in aerated solutions and in deaerated solutions; adenine fragment; and cytosine fragment. The review concludes with the remarks: one has to be very cautious in the extrapolation of the results obtained by the gamma irradiation of free bases in solution to DNA. Free bases are liberated but no nucleoside during irradiation. (Yamashita, S.)
Study in mutation of alfalfa genome DNA due to low energy N+ implantation using RAPD
International Nuclear Information System (INIS)
Chen Roulei; Song Daojun; Yu Zengliang; Li Yufeng; Liang Yunzhang
2001-01-01
After implanted by various dosage N + beams, germination rate of alfalfa seeds appears to be saddle line with dosage increasing. The authors have studied in mutation of genome DNA due to low energy N + implantation, and concluded that 30 differential DNA fragments have been amplified by 8 primers (S 41 , S 42 , S 45 , S 46 , S 50 , S 52 , S 56 , S 58 ) in 100 primers, moreover, number of differential DNA fragments between CK and treatments increases with dosage. Consequently, low energy ion implantation can cause mutation of alfalfa genome DNA. The more dosage it is, the more mutation alfalfa will be
Modeling the integration of bacterial rRNA fragments into the human cancer genome.
Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C
2016-03-21
Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.
Research on pre-staining gel electrophoresis
International Nuclear Information System (INIS)
Zhong Ruibo; Liu Yushuang; Zhang Ping; Liu Jingran; Zhao Guofen; Zhang Feng
2014-01-01
Background: Gel electrophoresis is a powerful biochemical separation technique. Most biological molecules are completely transparent in the visible region of light, so it is necessary to use staining to show the results after gel electrophoresis, and the general steps of conventional staining methods are time-consuming. Purpose: We try to develop a novel approach to simplify the gel electrophoresis: Pre-Staining Gel Electrophoresis (PSGE), which can make the gel electrophoresis results monitored in real time. Methods: Pre-stain the protein samples with Coomassie Brilliant Blue (CBB) for 30 min before loading the sample into the gel well. Results and Conclusion: PSGE can be successfully used to analyze the binding efficiency of Bovine Serum Albumin (BSA) and amphiphilic polymer via chemical coupling and physical absorption, and the double PSGE also shows a great potential in bio-analytical chemistry. (authors)
Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process
International Nuclear Information System (INIS)
Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet
2014-01-01
Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process
Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process
Energy Technology Data Exchange (ETDEWEB)
Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet, E-mail: ahmetkoc@iyte.edu.tr
2014-02-07
Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process.
Sporbert, Anje; Domaing, Petra; Leonhardt, Heinrich; Cardoso, M. Cristina
2005-01-01
In DNA replication, the leading strand is synthesized continuously, but lagging strand synthesis requires the complex, discontinuous synthesis of Okazaki fragments, and their subsequent joining. We have used a combination of in situ extraction and dual color photobleaching to compare the dynamic properties of three proteins essential for lagging strand synthesis: the polymerase clamp proliferating cell nuclear antigen (PCNA) and two proteins that bind to it, DNA Ligase I and Fen1. All three proteins are localized at replication foci (RF), but in contrast to PCNA, Ligase and Fen1 were readily extracted. Dual photobleaching combined with time overlays revealed a rapid exchange of Ligase and Fen1 at RF, which is consistent with de novo loading at every Okazaki fragment, while the slow recovery of PCNA mostly occurred at adjacent, newly assembled RF. These data indicate that PCNA works as a stationary loading platform that is reused for multiple Okazaki fragments, while PCNA binding proteins only transiently associate and are not stable components of the replication machinery. PMID:15972794
Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata
2017-08-01
Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.
Surface staining of small intestinal biopsies
DEFF Research Database (Denmark)
Poulsen, Steen Seier
1977-01-01
Small intestinal biopsies are most often by routine examined under a stereo-microscope, prior to embedding for histological examination. This is done in order to get a view of the appearance of the mucosal pattern, especially villus configuration. The distinctness of the surface pattern however......, is improved considerably if the biopsies are stained with Alcian Green and/or PAS before they are examined. In the present paper a detailed description is given of staining of small intestinal biopsies as whole mounts. The difference between the unstained and the stained biopsies is illustrated by a few...
Nakata, A; Yoshimura, A; Kuro-o, M; Obara, Y
2005-01-01
The karyological relationship and organization of highly repetitive DNA sequences in Japanese shrew-moles were studied by zoo-blot hybridization and fluorescence in situ hybridization (FISH). When the genomic DNA of the eastern race of Urotrichus talpoides was digested with PstI, three fragments of highly repetitive DNA sequences, approximately 0.7, 0.9, and 1.4 kb in length, were observed as distinct bands. The results of FISH in the eastern race of U. talpoides using these three fragments separately as probes showed that the 0.7-kb PstI fragment was distributed in the centromeric regions of most chromosomes, and that the 0.9- and 1.4-kb fragments were predominantly located in the C-heterochromatin region of chromosome 13p. Although the western race of U. talpoides also had three PstI fragments, 0.9- and 1.4-kb PstI fragments were more ambiguous than those of the eastern race. The PstI- digested genomic DNA in Dymecodonpilirostris produced only a faint 0.9-kb band, and its signal patterns obtained by zoo-blot hybridization were clearly different from those of U. talpoides. The 0.7-kb fragment of U. talpoides hybridized strongly with the 0.9-kb fragment of D. pilirostris. In a FISH analysis, the 0.9-kb fragment of D. pilirostris hybridized with highly repetitive DNA in the centromeric regions of most chromosomes from both D. pilirostris and U. talpoides. Zoo-blot hybridization and FISH analyses suggest that the 0.9- and 1.4-kb PstI fragments were generated specifically in the genome of U. talpoides after the common ancestor differentiated into two extant shrew-mole species. A difference in the length of the centromeric elements between U. talpoides and D. pilirostris might be observed due to certain modifications of the repeating unit.
Directory of Open Access Journals (Sweden)
Daria Tashyreva
Full Text Available Bacterial populations display high heterogeneity in viability and physiological activity at the single-cell level, especially under stressful conditions. We demonstrate a novel staining protocol for multiparameter assessment of individual cells in physiologically heterogeneous populations of cyanobacteria. The protocol employs fluorescent probes, i.e., redox dye 5-cyano-2,3-ditolyl tetrazolium chloride, 'dead cell' nucleic acid stain SYTOX Green, and DNA-specific fluorochrome 4',6-diamidino-2-phenylindole, combined with microscopy image analysis. Our method allows simultaneous estimates of cellular respiration activity, membrane and nucleoid integrity, and allows the detection of photosynthetic pigments fluorescence along with morphological observations. The staining protocol has been adjusted for, both, laboratory and natural populations of the genus Phormidium (Oscillatoriales, and tested on 4 field-collected samples and 12 laboratory strains of cyanobacteria. Based on the mentioned cellular functions we suggest classification of cells in cyanobacterial populations into four categories: (i active and intact; (ii injured but active; (iii metabolically inactive but intact; (iv inactive and injured, or dead.
Forensic use of Y-chromosome DNA: a general overview
M.H. Kayser (Manfred)
2017-01-01
textabstractThe male-specific part of the human Y chromosome is widely used in forensic DNA analysis, particularly in cases where standard autosomal DNA profiling is not informative. A Y-chromosomal gene fragment is applied for inferring the biological sex of a crime scene trace donor. Haplotypes
DNA Repair Biomarkers Predict Response to Neoadjuvant Chemoradiotherapy in Esophageal Cancer
International Nuclear Information System (INIS)
Alexander, Brian M.; Wang Xiaozhe; Niemierko, Andrzej; Weaver, David T.; Mak, Raymond H.; Roof, Kevin S.; Fidias, Panagiotis; Wain, John; Choi, Noah C.
2012-01-01
Purpose: The addition of neoadjuvant chemoradiotherapy prior to surgical resection for esophageal cancer has improved clinical outcomes in some trials. Pathologic complete response (pCR) following neoadjuvant therapy is associated with better clinical outcome in these patients, but only 22% to 40% of patients achieve pCR. Because both chemotherapy and radiotherapy act by inducing DNA damage, we analyzed proteins selected from multiple DNA repair pathways, using quantitative immunohistochemistry coupled with a digital pathology platform, as possible biomarkers of treatment response and clinical outcome. Methods and Materials: We identified 79 patients diagnosed with esophageal cancer between October 1994 and September 2002, with biopsy tissue available, who underwent neoadjuvant chemoradiotherapy prior to surgery at the Massachusetts General Hospital and used their archived, formalin-fixed, paraffin-embedded biopsy samples to create tissue microarrays (TMA). TMA sections were stained using antibodies against proteins in various DNA repair pathways including XPF, FANCD2, PAR, MLH1, PARP1, and phosphorylated MAPKAP kinase 2 (pMK2). Stained TMA slides were evaluated using machine-based image analysis, and scoring incorporated both the intensity and the quantity of positive tumor nuclei. Biomarker scores and clinical data were assessed for correlations with clinical outcome. Results: Higher scores for MLH1 (p = 0.018) and lower scores for FANCD2 (p = 0.037) were associated with pathologic response to neoadjuvant chemoradiation on multivariable analysis. Staining of MLH1, PARP1, XPF, and PAR was associated with recurrence-free survival, and staining of PARP1 and FANCD2 was associated with overall survival on multivariable analysis. Conclusions: DNA repair proteins analyzed by immunohistochemistry may be useful as predictive markers for response to neoadjuvant chemoradiotherapy in patients with esophageal cancer. These results are hypothesis generating and need
International Nuclear Information System (INIS)
Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.
2007-01-01
Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)
Utility of Modified Ultrafast Papanicolaou Stain in Cytological Diagnosis.
Sinkar, Prachi; Arakeri, Surekha Ulhas
2017-03-01
Need for minimal turnaround time for assessing Fine Needle Aspiration Cytology (FNAC) has encouraged innovations in staining techniques that require lesser staining time with unequivocal cell morphology. The standard protocol for conventional Papanicolaou (PAP) stain requires about 40 minutes. To overcome this, Ultrafast Papanicolaou (UFP) stain was introduced which reduces staining time to 90 seconds and also enhances the quality. However, reagents required for this were not easily available hence, Modified Ultrafast Papanicolaou (MUFP) stain was introduced subsequently. To assess the efficacy of MUFP staining by comparing the quality of MUFP stain with conventional PAP stain. FNAC procedure was performed by using 10 ml disposable syringe and 22-23 G needle. Total 131 FNAC cases were studied which were lymph node (30), thyroid (38), breast (22), skin and soft tissue (24), salivary gland (11) and visceral organs (6). Two smears were prepared and stained by MUFP and conventional PAP stain. Scores were given on four parameters: background of smears, overall staining pattern, cell morphology and nuclear staining. Quality Index (QI) was calculated from ratio of total score achieved to maximum score possible. Statistical analysis using chi square test was applied to each of the four parameters before obtaining the QI in both stains. Students t-test was applied to evaluate the efficacy of MUFP in comparison with conventional PAP stain. The QI of MUFP for thyroid, breast, lymph node, skin and soft tissue, salivary gland and visceral organs was 0.89, 0.85, 0.89, 0.83, 0.92, and 0.78 respectively. Compared to conventional PAP stain QI of MUFP smears was better in all except visceral organ cases and was statistically significant. MUFP showed clear red blood cell background, transparent cytoplasm and crisp nuclear features. MUFP is fast, reliable and can be done with locally available reagents with unequivocal morphology which is the need of the hour for a cytopathology set-up.
Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage.
Suspène, Rodolphe; Mussil, Bianka; Laude, Hélène; Caval, Vincent; Berry, Noémie; Bouzidi, Mohamed S; Thiers, Valérie; Wain-Hobson, Simon; Vartanian, Jean-Pierre
2017-04-07
Foreign and self-cytoplasmic DNA are recognized by numerous DNA sensor molecules leading to the production of type I interferons. Such DNA agonists should be degraded otherwise cells would be chronically stressed. Most human APOBEC3 cytidine deaminases can initiate catabolism of cytoplasmic mitochondrial DNA. Using the human myeloid cell line THP-1 with an interferon inducible APOBEC3A gene, we show that cytoplasmic DNA triggers interferon α and β production through the RNA polymerase III transcription/RIG-I pathway leading to massive upregulation of APOBEC3A. By catalyzing C→U editing in single stranded DNA fragments, the enzyme prevents them from re-annealing so attenuating the danger signal. The price to pay is chromosomal DNA damage in the form of CG→TA mutations and double stranded DNA breaks which, in the context of chronic inflammation, could drive cells down the path toward cancer. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
The etiologies of sperm DNA abnormalities in male infertility: An assessment and review
Directory of Open Access Journals (Sweden)
Soheila Pourmasumi
2017-07-01
Full Text Available The sperm DNA damage may occur in testis, genital ducts, and also after ejaculation. Mechanisms altering chromatin remodeling are abortive apoptosis and oxidative stress resulting from reactive oxygen species. Three classifications of intratesticular, post-testicular, and external factors have been correlated with increased levels of sperm DNA damage which can affect the potential of fertility. Alcohol consumption may not increase the rate of sperm residual histones and protamine deficiency; however, it causes an increase in the percentage of spermatozoa with DNA fragmentation and apoptosis. In a medical problem as spinal cord injury, poor semen parameters and sperm DNA damage were reported. Infection induces reactive oxygen species production, decreases the total antioxidant capacity and sperm DNA fragmentation or antigen production that lead to sperm dysfunctions and DNA fragmentation. While reactive oxygen species generation increases with age, oxidative stress may be responsible for the age-dependent sperm DNA damage. The exposing of reproductive organs in older men to oxidative stress for a long time may produce more DNA-damaged spermatozoa than youngers. Examining the sperm chromatin quality in testicular cancer and Hodgkin’s lymphoma patients prior to chemotherapy demonstrated the high incidence of DNA damage and low compaction in spermatozoa at the time of diagnosis. In chemotherapy cycles with genotoxic agents in cancer patients, an increase in sperm DNA damage was shown after treatment. In overall, those factors occurring during the prenatal or the adult life alter the distribution of proteins associated with sperm chromatin induce changes in germ cells which can be detected in infertile patients.
Higgins, Denice; Rohrlach, Adam B.; Kaidonis, John; Townsend, Grant; Austin, Jeremy J.
2015-01-01
Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Futhermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard
Behera, B; Mathur, P; Gupta, B
2010-01-01
The purpose of this study was to ascertain if the simple practice of Gram stain, acridine orange stain and direct sensitivity determination of positive blood culture bottles could be used to guide early and appropriate treatment in trauma patients with clinical suspicion of sepsis. The study also aimed to evaluate the error in interpreting antimicrobial sensitivity by direct method when compared to standard method and find out if specific antibiotic-organism combination had more discrepancies. Findings from consecutive episodes of blood stream infection at an Apex Trauma centre over a 12-month period are summarized. A total of 509 consecutive positive blood cultures were subjected to Gram staining. AO staining was done in BacT/ALERT-positive Gram-stain negative blood cultures. Direct sensitivity was performed from 369 blood culture broths, showing single type of growth in Gram and acridine orange staining. Results of direct sensitivity were compared to conventional sensitivity for errors. No 'very major' discrepancy was found in this study. About 5.2 and 1.8% minor error rates were noted in gram-positive and gram-negative bacteria, respectively, while comparing the two methods. Most of the discrepancies in gram-negative bacteria were noted in beta lactam - beta lactamase inhibitor combinations. Direct sensitivity testing was not reliable for reporting of methicillin and vancomycin resistance in Staphylococci. Gram stain result together with direct sensitivity testing is required for optimizing initial antimicrobial therapy in trauma patients with clinical suspicion of sepsis. Gram staining and AO staining proved particularly helpful in the early detection of candidaemia.
Influence of LET on repair of DNA damages in Deinococcus radiodurans
Energy Technology Data Exchange (ETDEWEB)
Kobayashi, Y; Tanaka, A; Kikuchi, M; Shimizu, T; Watanabe, H [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment; Cao, J P; Taucher-Scholz, G
1997-03-01
Inactivation caused by heavy ions was studied in dry cells of radioresistant bacterium Deinococcus radiodurans. All survival curves were characterized by a large shoulder of the curves. No final slopes of the exponential part of survival curves for heavy ion irradiation were steeper than that for 2.0 MeV electron irradiation. The plots of RBE versus LET showed no obvious peaks, suggesting that this bacterium can repair not only DNA double strand breaks (DSBs) but also clustered damage in DNA which may be induced by heavy ions. The genomic DNA of D. radiodurans was cleaved into large fragments with restriction enzyme Not I after post-irradiation incubation and the fragments were separated using pulsed-field gel electrophoresis (PFGE). DSBs induction and rejoining process were analyzed by detection of the reappearance of ladder pattern of DNA fragments. The required repair time after heavy ions irradiation was longer than the repair time for electrons at the same dose of irradiation, however, the rate of repair enzyme induction was almost similar to each other between electrons and heavy ions, suggesting that the same repair system is likely to be used after both low and high LET irradiations. (author)
Schlumbaum, Angela; van Glabeke, Sabine; Roldan-Ruiz, Isabel
2012-01-20
Wild apples (Malus sp.) have been a major food source in the northern Alpine region since prehistory and their use is well understood. The onset of deliberate fruit tree growing in the area is, however, less clear. It is generally assumed that horticulture was practised in Roman times, but it might be even earlier. In the archaeological record seed testa and pericarp remains are particularly frequent at sites with waterlogged preservation such as lakeshore settlements or wells, pits and ditches, but the distinction between wild and domestic plants is not morphologically possible. With waterlogged remains being one main source of information about past fruit cultivation, we have tested the feasibility of analysing ancient DNA from waterlogged preserved bulk samples of testa fragments. We studied apple seeds from three Neolithic and three Roman sites with waterlogged preservation in the Alpine foreland. Chloroplast markers failed in all samples, but nuclear ITS1 (internal transcribed spacer region 1) of the ribosomal DNA was successfully typed in two Roman samples from the site Oedenburg/Biesheim-Kunheim (Haut-Rhin, F). The retrieved ITS1 sequences are identical to each other and are shared with wild Malus sylvestris and Malus sieversii, and with domestic apple cultivars, supporting the potential of using waterlogged remains for identifying the genetic status of apple diachronically. Copyright © 2011 Elsevier GmbH. All rights reserved.
International Nuclear Information System (INIS)
Li Jianxiang; Nie Jihua; Tong Jian; Fu Chunling; Zhou Jianwei
2008-01-01
Objective: To construct and identify subtracted cDNA library in bone marrow cells of mice exposed to radon inhalation. Methods: Adult male BALB/c mice, weighing 18-22 g, were placed in a multi- functional radon chamber. One group of mice was exposed to radon up to the accumulative dose of 105 work level month (WLM). The control group of mice was housed in a room with an accumulative dose of 1 WLM. To construct a subtracted cDNA library enriched with differentially expressed genes, the SMART technique and the suppression subtractive hybridization were performed. The obtained forward and reverse cDNA fragments were directly inserted into pMD18-T vector and transformed into E. coli JM109. The inserting cDNA fragments were screened by the blue-and-white blot screening and nested PCR of bacterium liquid. Results: The 244 of 285 white bacteria clones obtained randomly were positive clones contained 100-1100 bp inserted cDNA fragments. Conclusions: The forward and reverse subtracted cDNA library in bone marrow cells of mice exposed to radon inhalation is successfully constructed. (authors)
Isolation and characterization of microsatellite DNA loci from Sillago ...
Indian Academy of Sciences (India)
A diluted digestion–ligation mixture (1:10) was amplified with adaptor-specific primers (MSEP: 5 -GAT GAG TCC. TGA GTA A-3 ). Amplified DNA fragments, with a size range of 200–1000 bp, were enriched for repeats by mag- netic bead selection with a 5 -biotinylated (AC)15 probes, respectively. Enriched fragments were ...
Al-Attas, Asmaa; Assidi, Mourad; Al-Maghrabi, Jaudah; Dallol, Ashraf; Schulten, Hans-Juergen; Abu-Elmagd, Muhammad; Chaudhary, Adeel; Abuzenadah, Adel; Budowle, Bruce; Buhmeida, Abdelbaset; Al-Qahtani, Mohammed
To date, the conventional formalin-fixed, paraffin-embedded (FFPE) technique is the gold-standard for preserving histomorphology. Once FFPE tissues are stained, slides are routinely archived along with their blocks at biobanks/hospitals. However, the reuse of fixed and stained biospecimens as DNA source is not a common routine practice worldwide and, thus, indicates the need of studies to investigate the feasibility of extracting DNA from already immunohistochemistry (IHC) FFPE-stained slides and its possible reuse in subsequent downstream molecular analyses. FFPE IHC slides from colorectal cancer (CRC) patients were prepared and stored in the CEGMR Biobank. The workflow consists of digitalization of IHC stained slide's image, removing the slide cover-slip, crude dissection and DNA extraction. Following DNA quality assessment, mutation analysis of CTNNB1 and methylation profile of CDH1 were performed. High-quality DNA was obtained allowing 60% concordance between CDH1 methylation and membranous E-cadherin expression pattern. Clean CTNNB1 DNA chromatograms with evenly-spaced peaks were observed. This study is a proof of concept to recycle and reuse DNA from IHC stained slides with suitable concentration and integrity for further downstream molecular applications. These findings will enhance the pathologists' knowledge, attitudes and practices (KAP) towards the use of these biospecimens and support the implementation of this approach in clinical pathology practice. Therefore, the scientific community will benefit from the largest comprehensive database of human fully annotated FFPE biospecimens already available at their disposal in order to demystify the complexity and the heterogeneity of many challenging diseases and foster the transition towards precision medicine. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.
Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats
DEFF Research Database (Denmark)
Kastern, W.; Dyrberg, T.; Scholler, J.
1984-01-01
DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...
Validation study of HPV DNA detection from stained FNA smears by polymerase chain reaction
DEFF Research Database (Denmark)
Channir, Hani Ibrahim; Larsen, Christian Grønhøj; Ahlborn, Lise Barlebo
2016-01-01
and corresponding surgical specimens were collected from 71 patients with known HPV-positive OPSCC, 12 patients with oral squamous cell carcinoma (OSCC), 20 patients with branchial cleft cysts, and 20 patients with Warthin tumors. Thirty-eight patients with OPSCC and 7 patients with OSCC had FNA smears available...... was detected in 68 of the 71 FNA smears from OPSCC metastases. All corresponding surgical specimens from primary tumors (n = 71) and metastases (n = 38) were p16- and HPV DNA-positive. All the surgical specimens and corresponding FNA smears from OSCCs, Warthin tumors, and branchial cleft cysts were HPV DNA...
Qian, Yong; Wang, Chunyan; Gao, Fenglei
2015-01-15
A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.
New Grocott Stain without Using Chromic Acid
International Nuclear Information System (INIS)
Shiogama, Kazuya; Kitazawa, Kayo; Mizutani, Yasuyoshi; Onouchi, Takanori; Inada, Ken-ichi; Tsutsumi, Yutaka
2015-01-01
We established a new “ecological” Grocott stain for demonstrating fungi, based upon a 4R principle of refusal, reduction, reuse, and recycle of waste management. Conventional Grocott stain employs environmentally harsh 5% chromic acid for oxidization. Initially, we succeeded in reducing the concentration of chromic acid from 5% to 1% by incubating the solution at 60°C and using five-fold diluted chromic acid solution at which point it was reusable. Eventually, we reached the refusal level where 1% periodic acid oxidization was efficient enough, when combined with preheating of sections in the electric jar, microwave oven, or pressure pan. For convenience sake, we recommend pressure pan heating in tap water for 10 min. Stainability of fungi in candidiasis and aspergillosis was comparable with conventional Grocott stain, while Mucor hyphae showed enhanced staining. The modified sequence was further applicable to detecting a variety of mycotic pathogens in paraffin sections. Our environmentally-friendly Grocott stain also has the advantage of avoiding risk of human exposure to hexavalent chromium solution in the histopathology laboratory. The simple stain sequence is can be easily applied worldwide
Complementing nuclear techniques with DNA vaccine technologies for improving animal health
International Nuclear Information System (INIS)
Relucio, J.L.V.; Dacanay, M.E.K.; Maligalig, A.C.S.; Ramos, E.A.; Santos, A.D.; Torres-Villanueva, C.A.T.; Osorio, R.G.; Deocaris, C.C.
2005-01-01
The use of nuclear methods can enhance several features of DNA vaccines in protecting livestock against pathogens. While DNA vaccines already have several advantages over their traditional predecessors (e.g. cheap production, stability over a wide range of temperature, amenability to genetic manipulation, and no risk of reversion to pathogenicity), conventional gene delivery systems make immunization of livestock and aquaculture populations tedious. For this reason, we are developing radiation-synthesized intelligent delivery systems for DNA vaccines. We encapsulated a reporter construct pCMV·SPORT-β-gal in radiation-synthesized κ-carrageenan-polyvinylpyrrolidone microspheres IP20 (for stomach release) and IP18 (for intestinal release). The DNA-loaded polymers were orally administered to Oreochromis niloticus (black Nile tilapia), and whole organs were stained with X-gal to observe β-galactosidase activity. Intense staining was observed in the stomach regions with IP20, while minimal staining was observed with IP18. The gills, in contrast, did not express β-galactosidase activity. Our results show evidence of the successful gene delivery capabilities of radiation-synthesized microspheres. When monitoring the progress of an animal's immune response after DNA immunization, non-invasive and sensitive methods are preferred. We also evaluated chicken egg-yolk polyclonal antibody response (chIgY) after direct intramuscular inoculation of the Hepatitis B Surface antigen expression vector pRc/CMV-HBs(S). Radioimmunoassay (RIA) was done to maximize sensitivity for determining antibody levels. Polyclonal antibody titres were observed to have increased after six weeks. Results of the RIA using the chIgY were comparable to that of immunized sera. Our findings indicate that chIgY could offer a cheaper and more animal-friendly antibody source and could be derived with the advantage of epitope specificity through DNA vaccination. (author)
Distant homology between yeast photoreactivating gene fragment and human genomic digests
International Nuclear Information System (INIS)
Meechan, P.J.; Milam, K.M.; Cleaver, J.E.
1985-01-01
Hybridization of DNA coding for the yeast DNA photolyase to human genomic DNA appears to allow one to determine whether a conserved enzyme is coded for in human cells. Under stringent conditions (68 0 C), hybridization is not found between the cloned yeast fragment (YEp13-phr1) and human or chick genomic digests. At less stringent conditions (60 0 C), hybridization is observed with chick digests, indicating evolutionary divergence even among organisms capable of photo-reactivation. At 50 0 C, weak hybridization with human digests was observed, indicating further divergence from the cloned gene. Data concerning the precise extent of homology and methods to clone the chick gene for use as another probe are discussed
Amplified-fragment length polymorphism fingerprinting of Mycoplasma species
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Jensen, J.S.
1999-01-01
Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...
Gram staining apparatus for space station applications
Molina, T. C.; Brown, H. D.; Irbe, R. M.; Pierson, D. L.
1990-01-01
A self-contained, portable Gram staining apparatus (GSA) has been developed for use in the microgravity environment on board the Space Station Freedom. Accuracy and reproducibility of this apparatus compared with the conventional Gram staining method were evaluated by using gram-negative and gram-positive controls and different species of bacteria grown in pure cultures. A subsequent study was designed to assess the performance of the GSA with actual specimens. A set of 60 human and environmental specimens was evaluated with the GSA and the conventional Gram staining procedure. Data obtained from these studies indicated that the GSA will provide the Gram staining capability needed for the microgravity environment of space.
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing
Computational analyses of ancient pathogen DNA from herbarium samples: challenges and prospects.
Yoshida, Kentaro; Sasaki, Eriko; Kamoun, Sophien
2015-01-01
The application of DNA sequencing technology to the study of ancient DNA has enabled the reconstruction of past epidemics from genomes of historically important plant-associated microbes. Recently, the genome sequences of the potato late blight pathogen Phytophthora infestans were analyzed from 19th century herbarium specimens. These herbarium samples originated from infected potatoes collected during and after the Irish potato famine. Herbaria have therefore great potential to help elucidate past epidemics of crops, date the emergence of pathogens, and inform about past pathogen population dynamics. DNA preservation in herbarium samples was unexpectedly good, raising the possibility of a whole new research area in plant and microbial genomics. However, the recovered DNA can be extremely fragmented resulting in specific challenges in reconstructing genome sequences. Here we review some of the challenges in computational analyses of ancient DNA from herbarium samples. We also applied the recently developed linkage method to haplotype reconstruction of diploid or polyploid genomes from fragmented ancient DNA.
Termination of DNA synthesis in vitro at apurinic sites but not at ethyl adducts of the template
Energy Technology Data Exchange (ETDEWEB)
Lockhart, M.L.; Deutsch, J.F.; Yamaura, I.; Cavalieri, L.F.; Rosenberg, B.H.
1982-01-01
The effects of DNA lesions produced by the carcinogenic alkylating agents ethylnitrosourea and diethylsulfate on the extent of DNA synthesis have been studied in a system utilizing circular single-stranded phi X174 DNA as template and a 392-base restriction fragment as primer with E. coli polymerase I (Klenow fragment). Apurinic sites produced by loss of unstable ethylated bases from the template terminate DNA synthesis at the first such site encountered, but ethyl adducts at most, if not all, locations permit readthrough. 22 references, 3 figures, 1 table.
Efficacy of in-house fluorescent stain for fungus
Directory of Open Access Journals (Sweden)
K. R. L. Surya Kirani
2017-01-01
Full Text Available Context: Mycotic infections are gaining importance in the present day medicine, and definite demonstration of fungus is essential for diagnosis. Small numbers of organisms in the smear can be identified by fluorescence microscopy. Calcofluor white (CFW fluorescent stain is a textile brightener mixed with Evans blue. It is expensive and not easily available. Aims: (1 To assess the efficacy of in-house CFW fluorescent stain for fungus in relation to conventional CFW stain, histopathology, and culture. (2 To determine sensitivity, specificity, negative predictive value (NPV, and positive predictive value (PPV with culture as gold standard. Settings and Design: One hundred cases of suspected dermatophytosis and 15 cases of systemic mycosis were included in the study. Subjects and Methods: The local whitener Ranipal is added with Robin blue, another brightener, and was used to stain teased fungal cultures. Skin, hair, and nails require pretreatment with potassium hydroxide (KOH. Biopsy slides require deparaffinization and pretreatment with KOH before staining. Conventional calcofluor stain, histopathology, and culture were done. Statistical Analysis Used: Statistical analysis was performed using sensitivity, specificity, NPV, and PPV. Results: The results are consistently comparable with conventional stain. The sensitivity was 100%, specificity was 93.3%, NPV was 100%, and PPV was 85.7%. It is also cost effective when compared to commercial stains. Conclusions: In-house stain can be used for screening of fungus in direct samples, biopsies as alternative in resource-constrained laboratories.
Investigation of DNA strand breaks induced by 7Li and 12C ions
International Nuclear Information System (INIS)
Sui Li; Zhao Kui; Ni Meinan; Guo Jiyu; Luo Hongbing; Mei Junping; Lu Xiuqin; Zhou Ping
2004-01-01
Deoxyribonucleic acid (DNA) is an important biomacromolecule. It is a carrier of genetic information and a critical target for radiobiological effects. Numerous lesions have been identified in irradiated DNA. DNA double strand breaks (DSBs) are considered as the most important initial damage of all biological effects induced by ionizing radiation. In this experiment, DNA DSBs induced by heavy ions in the early period were investigated with atomic force microscopy (AFM). Choosing 7 Li and 12 C heavy ions with different LET values delivered by HI-13 tandem accelerator respectively, purified plasmid DNA samples in aqueous solution were irradiated at different doses. AFM was used for nanometer-level-structure analysis of DNA damage induced by these two kinds of heavy ions. Measurement of the DNA fragment lengths was accomplished with the Scion Image analyzed soft-ware. Change laws of three forms of DNA, supercoils, open circular and linear form as dose increased were obtained. Distributed function of DNA fragment length was also obtained, and fitted with Tsallis entropy statistical theory. (author)
Modified Genta triple stain for identifying Helicobacter pylori.
el-Zimaity, H M; Wu, J; Graham, D Y
1999-01-01
AIM: To evaluate whether lead nitrate could replace uranyl nitrate in the Genta stain for H pylori without sacrificing the advantages of the triple stain (Steiner silver impregnation combined with Alcian blue and haematoxylin/eosin (H&E)). METHODS: A comparison was made in 16 specimens between the original triple stain and the revised version. One pathologist evaluated all sections. RESULTS: Direct substitution of lead nitrate for uranium nitrate produced well stained organisms without interf...
Evaluation of oxidative DNA damage promoted by storage in sperm from sex-reversed rainbow trout.
Pérez-Cerezales, S; Martínez-Páramo, S; Cabrita, E; Martínez-Pastor, F; de Paz, P; Herráez, M P
2009-03-01
Short-term storage and cryopreservation of sperm are two common procedures in aquaculture, used for routine practices in artificial insemination reproduction and gene banking, respectively. Nevertheless, both procedures cause injuries affecting sperm motility, viability, cell structure and DNA stability, which diminish reproductive success. DNA modification is considered extremely important, especially when sperm storage is carried out with gene banking purposes. DNA damage caused by sperm storage is not well characterized and previous studies have reported simple and double strand breaks that have been attributed to oxidative events promoted by the generation of free radicals during storage. The objective of this study was to reveal DNA fragmentation and to explore the presence of oxidized bases that could be produced by oxidative events during short-term storage and cryopreservation in sex-reversed rainbow trout (Oncorhynchus mykiss) spermatozoa. Sperm from six males was analyzed separately. Different aliquots of the samples were stored 2h (fresh) or 5 days at 4 degrees C or were cryopreserved. Then spermatozoa were analyzed using the Comet assay, as well as combining this method with digestion with two endonucleases from Escherichia coli (Endonuclease III, that cut in oxidized cytosines, and FPG, cutting in oxidized guanosines). Both storage procedures yielded DNA fragmentation, but only short-term storage oxidative events were clearly detected, showing that oxidative processes affect guanosines rather than cytosines. Cryopreservation increases DNA fragmentation but the presence of oxidized bases was not noticed, suggesting that mechanisms other than oxidative stress could be involved in DNA fragmentation promoted by freezing.
Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.
Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo
2017-06-19
Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.
A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.
Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P
2015-11-01
Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.