Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.
Alali, Walid Q; Schaffner, Donald W
2013-07-01
The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.
Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo
2014-02-01
The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
21 CFR 866.3355 - Listeria spp. serological reagents.
2010-04-01
... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3355 Listeria spp... from clinical specimens. Additionally, some of these reagents consist of Listeria spp. antisera... clinical specimens. The identification aids in the diagnosis of listeriosis, a disease caused by bacteria...
Angelidis, Apostolos S; Kalamaki, Mary S; Georgiadou, Sofia S
2015-01-16
Agar Listeria according to Ottaviani and Agosti (ALOA) is the mandatory medium used for the detection and enumeration of Listeria monocytogenes in foods according to the official International Organization for Standardization (ISO) methods. On ALOA, Listeria spp. appear as bluish-green colonies due to the production of β-D-glucosidase, an enzyme that cleaves 5-bromo-4-chloro-3-indolyl-β-D-glucopyranoside, a chromogenic substrate included in the formulation of the medium. The present work reports on bacterial isolates (n=64) from ready-to-eat soft cheeses, which are able to grow on ALOA, forming bluish-green colonies and therefore phenotypically resemble Listeria spp. All isolates were also capable of growing on the selective media PALCAM and RAPID L'mono. The isolates were characterised with biochemical tests including those specified in the ISO standards for the confirmation of Listeria spp. and identified via partial sequencing of their 16S rRNA gene. According to sequencing results the isolates represented 12 different bacterial species or species-groups belonging to seven different genera: Bacillus spp. (B. circulans, B. clausii, B. licheniformis and B. oleronius), Cellulosimicrobium spp. (C. funkei), Enterococcus spp. (E. faecalis, E. faecium/durans), Kocuria spp. (K. kristinae), Marinilactibacillus spp. (M. psychrotolerans), Rothia spp. (R. terrae) and Staphylococcus spp. (S. sciuri and S. saprophyticus subsp. saprophyticus/xylosus). Cellulosimicrobium spp. have never been previously isolated from foods. These results significantly extend the list of bacteria previously known as capable of growing on ALOA as bluish-green colonies and suggest that there may be room for further improvement in the medium's inhibitory properties towards non-Listeria spp., Gram-positive bacteria present in foods. Copyright © 2014 Elsevier B.V. All rights reserved.
Listeria spp. in Street-Vended Ready-to-Eat Foods
El-Shenawy, Moustafa; El-Shenawy, Mohamed; Ma?es, Jordi; Soriano, Jose M.
2011-01-01
Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contamina...
Schoder, D; Schmalwieser, A; Szakmary-Brändle, K; Stessl, B; Wagner, M
2015-05-01
The aim of this study was to determine the prevalence of Listeria spp. and Listeria monocytogenes (L. monocytogenes) in urban public lavatories and on shoe soles of facility patrons in a European capital city. More than 91% of all municipal public lavatories in Vienna close to public hubs were included in this study. Overall, 373 swab samples of public lavatories and shoes of facility patrons were enriched, according to ISO 11290-1. Listeria monocytogenes isolates were subtyped using pulsed-field gel electrophoresis. A total of 24 samples were positive for Listeria spp., yielding an overall prevalence of 6.4% (24/373). Listeria monocytogenes was found in 2.1% (8/373) of all samples. Swabs from lavatories in parks, container lavatories and lavatories at markets had the highest prevalences of 20.7% (6/29), 20% (2/10) and 12.5% (1/8) Listeria spp., respectively. These detection rates were statistically significantly higher than those associated with lavatories in shopping centres (P = 0.003, P = 0.002, P = 0.02) and at public transport locations (P = 0.0004, P = 0.005, P = 0.02). Shoes sampled at Christmas markets showed the highest Listeria spp. and L. monocytogenes prevalences of 80% (4/5) and 40% (2/5), respectively. With regard to shoe type, Listeria spp. detection rates were 14.3% (3/21; winter boots), 13.3% (2/15; hiking boots), sport shoes (5.9%; 2/34) and brogues (5.1%; 4/79). No Listeria spp. were found on shoe soles that had smooth treads (0/76), while Listeria spp. were detected on 19.5% (8/41) of medium depth tread shoe types and on 9.4% (3/32) of deep tread shoes. These data suggest that soil environment is still one of the most important reservoirs for the foodborne pathogen L. monocytogenes. © 2014 Blackwell Verlag GmbH.
Contamination profile of Listeria spp. in three types of ready-to-eat chicken meat products.
Lekroengsin, Sumalin; Keeratipibul, Suwimon; Trakoonlerswilai, Kasame
2007-01-01
This study investigated contamination sources of Listeria spp. in frozen, ready-to-eat, roasted, steamed, and fried chicken meat products from a plant in Thailand, as well as the correlation between Listeria contamination in the production environment and the finished product. The cooking processes used in this factory (with a product core temperature of 80 degrees C for 1 min) were confirmed as adequate for eliminating Listeria spp. However, Listeria spp. were detected at the packing stage of roasted and steamed chicken products. An environmental swab test was conducted by means of the zone concept, whereby surfaces in the production area were divided into three zones. Zone 1 was made up of the equipment surfaces that came into direct contact with the products. Zone 2 consisted of equipment surfaces that were not in direct contact with the products, including surfaces that were difficult to be cleaned. Zone 3 included surfaces that did not come in direct contact with the products and were located far from the products. The results showed that the prevalence of Listeria spp. in roasted and steamed products was affected by the prevalence of Listeria contamination in all zones, especially zone 1, which demonstrated the highest correlation. In addition, the prevalence of Listeria contamination in zones 2 and 3 affected the prevalence of Listeria in zone 1. A correlation between Listeria on roasted chicken products and the surfaces of zone 1 at the start of production was also established.
Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F
2014-11-01
Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in
Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.
Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F
2013-04-01
Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.
Growth inhibition of Listeria spp. on Camembert cheese by bacteria producing inhibitory substances.
Sulzer, G; Busse, M
1991-12-01
Bacterial strains exhibiting antimicrobial activity towards other bacteria are quite common in nature. During the past few years several genera have been shown to exert inhibitory action against Listeria. spp. In the present work strains of Enterococcus, Lactobacillus and Lactococcus were tested for their influence on the development of Listeria spp. on Camembert cheese. Partial or complete inhibition of growth of Listeria spp. was observed using various inhibitory bacteria. Complete inhibition occurred when the inhibitory strain was used as a starter culture and there was a low level of contamination with Listeria spp. during the first stage of ripening. Very little inhibition occurred if the inhibitory strain was added together with the starter culture.
Trimoulinard, A; Beral, M; Henry, I; Atiana, L; Porphyre, V; Tessier, C; Leclercq, A; Cardinale, E
2017-06-05
One of the most popular meat products of the local "cuisine" is sausage composed with 100% chicken or 100% pork. In this study, we aimed to determine the presence of Salmonella spp., Campylobacter spp. and Listeria spp. in chicken- and pork-sausages, quantify Salmonella spp. population and identify the factors that could be associated with contamination in the outlets. Two hundred and three batches of pork and chicken sausages were randomly collected from 67 local outlets (supermarkets, groceries and butcher shops). Salmonella spp. was detected in 11.8% (95% confidence interval (CI): [10.0; 13.5]) of samples, Campylobacter spp. in 1.5% [0.7; 4.2] and Listeria monocytogenes in 5.9% [4.4; 7.3]. Most probable number of Salmonella spp. varied between 6cfu per gram to 320cfu per gram. Salmonella serotypes isolated from pork and chicken sausages were S. Typhimurium (45.8%), S. London (20.8%), S. Derby (16.7%), S. Newport (8.33%), S. Blockley (4.2%) and S. Weltevreden (4.17%). Using a logistic (mixed-effect) regression model, we found that Salmonella spp. contamination was positively associated with sausages sold in papers or plastic bags and no control of rodents. Chicken sausages were associated with a decreasing risk of Salmonella contamination. Listeria monocytogenes contamination was positively associated with the presence of fresh rodent droppings in the outlet and negatively when the staff was cleaning regularly their hands with soap and water or water only. All the sampled outlets of Reunion Island were not equivalent in terms of food safety measures. Increasing awareness of these traders remains a cornerstone to limit the presence of Salmonella spp. and Listeria spp. in sausages, particularly in a tropical context (high temperature and humidity). Copyright © 2017 Elsevier B.V. All rights reserved.
Efficacy of a variety of disinfectants against Listeria spp.
Best, M; Kennedy, M E; Coates, F
1990-01-01
The efficacy of 14 disinfectants against Listeria innocua and two strains of Listeria monocytogenes in the presence of organic matter was studied. Quantitative efficacy tests were used. Many of the disinfectants tested were not as effective on Listeria spp. when the test organisms were dried onto the surface of steel disks (carrier tests) as they were when the organisms were placed in suspension (suspension test). The presence of whole serum and milk (2% fat) further reduced the disinfectant ...
Cossu, Francesca; Spanu, Carlo; Deidda, Silvia; Mura, Erica; Casti, Daniele; Pala, Carlo; Lamon, Sonia; Spanu, Vincenzo; Ibba, Michela; Marrocu, Elena; Scarano, Christian; Piana, Andrea; De Santis, Enrico Pietro Luigi
2016-04-19
Ready-to-eat (RTE) food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5%) made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments , such as hospitals and consumed by susceptible people . Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes , more information on the risk related to RTE consumption should be provided to the hospitalised patients.
Directory of Open Access Journals (Sweden)
Francesca Cossu
2016-05-01
Full Text Available Ready-to-eat (RTE food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5% made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients.
IDENTIFIKASI Listeria spp. PADA PANGAN JAJANAN BERBASIS IKAN DI KOTA BOGOR
Directory of Open Access Journals (Sweden)
Elia Yuswita
2016-06-01
Full Text Available L. monocytogenes contamination in processed food, especially fish-based snack, may results from contaminated raw materials, underprocessed or recontamination. The aims of this study were to identify the presence of Listeria spp. especially L. monocytogenes by PCR method and biochemical methods, as well as calculate the prevalence of Listeria spp. in fish-based snack food in Bogor. This study was conducted of 4 steps: (1 determination of L. monocytogenes’s DNA limit detection, (2 sample preparation, (3 identification of L. monocytogenes with real-time PCR, and (4 identification of Listeria spp. with biochemical methods. The results showed that DNA detection limits of L. monocytogenes in fish meatball and otak-otak were at 8.3x102 and 2.9x102 CFU/g, respectively. The study on 65 samples indicated that contamination of L. monocytogenes was not observed, but other species of Listeria spp., namely L. grayi and L. innocua, were found. The prevalence of L. grayi and L. innocua in siomay was at 5.9%, while the prevalence of L. grayi in shrimp meatballs, fish meat balls, fried meatballs was at 8.3, 9.1, and 50%, respectively. Furthermore, L. innocua from takoyaki samples with a prevalence of 20% was observed.
Directory of Open Access Journals (Sweden)
Mariana Gomes Ferreira Machado de Siqueira
2017-07-01
Full Text Available Abstract The identification of Listeria spp. in food handling areas is of great concern to health surveillance agencies, and their control is often hampered by the ability of the bacteria to grow and maintain themselves even under adverse conditions. The present study aimed to isolate and identify Listeria spp. in the food handling areas of 10 retail food stores in the state of Pernambuco, Brazil. Eighty-six swab samples were collected from equipment, utensils and surfaces used for processing ready-to-eat meat products. The Dry and Wet Swabbing Methods (3M™ Quick Swabs and 3M™ Petrifilm™ Plates were used to identify Listeria spp. Contamination by Listeria monocytogenes was confirmed by the Real-time Polymerase Chain Reaction (qPCR. The hygienic and sanitary conditions of the food handling areas of each store were also assessed. Listeria spp. was isolated in eight stores (80%. Of the 86 swab samples analyzed, 27 (31.2% [confidence interval 21.81% to 42.30%] were positive for Listeria spp. and only one (3.7% was confirmed as Listeria monocytogenes. The main contamination sites were the floor (50.0%, the plastic cutting board (42.9% and the knife (40.0%. None of the hygienic and sanitary conditions assessed in the present study were associated with contamination by Listeria spp. (p = 0.700. It was concluded that Listeria spp. was widely distributed in the retail food stores studied, being a possible risk factor for public health.
Listeria spp. in Street-Vended Ready-to-Eat Foods
El-Shenawy, Moustafa; El-Shenawy, Mohamed; Mañes, Jordi; Soriano, Jose M.
2011-01-01
Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contaminated food samples (meat, poultry, seafood, dairy products, and products of plant origin). Most of the samples contaminated by L. monocytogenes had high levels of total viable bacterial counts. The results obtained may help to clarify the epidemiology of listeriosis in the country and draw the attention of the decision makers to issue hygienic regulations for food processing industries as well as street vendors in order to ensure safe street-vended ready-to-eat food. PMID:22194742
Listeria spp. in Street-Vended Ready-to-Eat Foods
Directory of Open Access Journals (Sweden)
Moustafa El-Shenawy
2011-01-01
Full Text Available Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contaminated food samples (meat, poultry, seafood, dairy products, and products of plant origin. Most of the samples contaminated by L. monocytogenes had high levels of total viable bacterial counts. The results obtained may help to clarify the epidemiology of listeriosis in the country and draw the attention of the decision makers to issue hygienic regulations for food processing industries as well as street vendors in order to ensure safe street-vended ready-to-eat food.
Prevalence of food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran.
Akya, A; Najafi, A; Moradi, J; Mohebi, Z; Adabagher, S
2013-05-01
Listeria monocytogenes is a human pathogen causing serious diseases. We aimed to determine food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran. Samples (185 dairy, 187 meat products and 158 ready-to-eat foods such as salads) were randomly collected from markets. After processing, samples were cultured in half-Fraser and Fraser broth followed by cultivation on PALCAM and Oxford media. Confirmatory tests including carbohydrate utilization were performed on isolates to determine species. Bacteria were isolated from 66/530 samples (12.5%). Meat products showed the highest (27.2%) and dairy products the lowest (3.8%) contamination rates. L. innocua was found in 56 (10.6%) samples, but L. monocytogenes was only found in 3 samples (0.6%). The results indicate that the rate of contamination with L. monocytogenes, even for ready-to-eat foods, was low but for other Listeria spp., in particular strains of L. innocua, the rate of contamination was higher, suggesting that more control on food sanitation is required.
Isolation, identification, and characterization of Listeria spp. from various animal origin foods
Nayak, Deepti N.; Savalia, C. V.; Kalyani, I. H.; Kumar, Rajeev; Kshirsagar, D. P.
2015-01-01
Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each) collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence-associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9%) were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%), Listeria innocua (5, 27.7%), Listeria welshimeri (4, 22.2%), and L. monocytogenes (3, 16.6%). The highest prevalence was observed in milk samples (8). Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk). All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200) of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest prevalence
Isolation, identification, and characterization of Listeria spp. from various animal origin foods
Directory of Open Access Journals (Sweden)
Deepti N. Nayak
2015-06-01
Full Text Available Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9% were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%, Listeria innocua (5, 27.7%, Listeria welshimeri (4, 22.2%, and L. monocytogenes (3, 16.6%. The highest prevalence was observed in milk samples (8. Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk. All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200 of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest
Jamali, Hossein; Radmehr, Behrad
2013-11-01
The aims of this study were to determine the prevalence, characteristics and antimicrobial resistance of Listeria spp. isolated from bovine clinical mastitis in Iran. Listeria spp. were detected in 21/207 bovine mastitic milk samples from dairy farms in Iran, comprising L. monocytogenes (n=17), L. innocua (n=3) and L. ivanovii (n=1). L. monocytogenes isolates were grouped into serogroups '4b, 4d, 4e', '1/2a, 3a', '1/2b, 3b, 7' and '1/2c, 3c'; all harboured inlA, inlC and inlJ virulence genes. Listeria spp. were most frequently resistant to penicillin G (14/21 isolates, 66.7%) and tetracyclines (11/21 isolates, 52.4%). Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Viviana Pamela Chiluisa-Utreras
2017-07-01
Full Text Available Background. In Ecuador, studies about bacteria genre Listeria in artisanal cheeses are scarce, and in raw milk, practically nonexistent. Milk production is one of the main livestock activities in the province of Pichincha and it is essential to study these products. Since all the cantons that make up Pichincha are milk producers, three of them, Cayambe, Quito and Pedro Moncayo were randomly sampled. Objective. To determine Listeria spp. And Listeria monocytogenes in samples of raw milk and artisanal cheeses, respectively, using Real Time PCR. Methods. The application of the qPCR technique in the detection of microorganisms and especially of bacteria in food, is based on four fundamental aspects: its sensitivity, specificity, speed and processing capacity of large sample flow. It is possible to detect small amounts of pathogenic microorganisms, such as Listeria spp in raw milk, after extraction and quantification of total DNA. Results. In this study in raw milk, one positive was determined from a total of 60 samples, representing 1.6% of Listeria spp. and 16 positive samples of 45, representing 35.6% of Listeria monocytogenes in artisanal cheeses from three farms in the province of Pichincha. Conclusions. The results, according to the statistical analyzes carried out with the Kruskal - Wallis test, show that in Pichincha the bacterium is present in raw milk, but in non - representative quantities, whereas for Listeria monocytogenes there is statistical significance in the cheeses samples
Ohshima, Chihiro; Takahashi, Hajime; Phraephaisarn, Chirapiphat; Vesaratchavest, Mongkol; Keeratipibul, Suwimon; Kuda, Takashi; Kimura, Bon
2014-01-01
Listeria monocytogenes is the causative bacteria of listeriosis, which has a higher mortality rate than that of other causes of food poisoning. Listeria spp., of which L. monocytogenes is a member, have been isolated from food and manufacturing environments. Several methods have been published for identifying Listeria spp.; however, many of the methods cannot identify newly categorized Listeria spp. Additionally, they are often not suitable for the food industry, owing to their complexity, cost, or time consumption. Recently, high-resolution melting analysis (HRMA), which exploits DNA-sequence differences, has received attention as a simple and quick genomic typing method. In the present study, a new method for the simple, rapid, and low-cost identification of Listeria spp. has been presented using the genes rarA and ldh as targets for HRMA. DNA sequences of 9 Listeria species were first compared, and polymorphisms were identified for each species for primer design. Species specificity of each HRM curve pattern was estimated using type strains of all the species. Among the 9 species, 7 were identified by HRMA using rarA gene, including 3 new species. The remaining 2 species were identified by HRMA of ldh gene. The newly developed HRMA method was then used to assess Listeria isolates from the food industry, and the method efficiency was compared to that of identification by 16S rDNA sequence analysis. The 2 methods were in coherence for 92.6% of the samples, demonstrating the high accuracy of HRMA. The time required for identifying Listeria spp. was substantially low, and the process was considerably simplified, providing a useful and precise method for processing multiple samples per day. Our newly developed method for identifying Listeria spp. is highly valuable; its use is not limited to the food industry, and it can be used for the isolates from the natural environment.
Listeria spp. e listeria monocytogenes na produção de salsichas tipo hot dog
Cesar, Alessandra Paro Rodrigues; Mesquita, Albenones José de; Prado, Cristiano Sales; Nunes, Iolanda Aparecida; Almeida Filho, Edivaldo Sampaio de
2011-01-01
v. 12, n. 2, p.339-352, abr./jun.2011. Listeria monocytogenes está amplamente distribuída no ambiente e tem sido isolada de alimentos associados a surtos de elevada letalidade, representando um risco para a saúde pública. Em alguns países, os produtos prontos para consumo, como embutidos cozidos, entre os quais as salsichas, estão associadas à listeriose humana. Considerando a relevância do tema e a necessidade de dados, analisou-se a ocorrência de Listeria spp. e L. monocytogenes na pr...
Directory of Open Access Journals (Sweden)
A. Laciar
2006-04-01
Full Text Available In this study, a total of 24 Listeria spp. strains were analyzed. Twenty-two isolates were obtained in San Luis (Argentina from human, animal, and food samples. Two types of strains, Listeria monocytogenes CLIP 22762 and Listeria innocua CLIP 74915, were included as reference strains. All isolates were biochemically identified and characterized by serotyping, phage typing, and amplification of the flaA gene by polymerase chain reaction (PCR. Repetitive intergenic consensus (ERIC sequence-based PCR was used to generate DNA fingerprints. On the basis of ERIC-PCR fingerprints, Listeria spp. strains were divided into three major clusters matching origin of isolation. ERIC-PCR fingerprints of human and animal isolates were different from those of food isolates. In addition, groups I and II included ten L. monocytogenes strains, and only one Listeria seeligeri strain. Group III included nine L. innocua strains and four L. monocytogenes strains. Computer evaluation of ERIC-PCR fingerprints allowed discrimination between the tested serotypes 1/2b, 4b, 6a, and 6b within each major cluster. The index of discrimination calculated was 0.94. This study suggests that the ERIC-PCR technique provides an alternative method for the identification of Listeria species and the discrimination of strains within one species.En este estudio se analizaron 24 cepas de Listeria spp. De ellas, 22 fueron obtenidas en San Luis (Argentina, a partir de muestras humanas, de animales y alimentos. Se incluyeron 2 cepas de referencia Listeria monocytogenes CLIP 22762 y Listeria innocua CLIP 74915. Todos los aislamientos fueron identificados bioquímicamente y caracterizados por serotipificación, fagotipificación y detección del gen flaA por reacción en cadena de la polimerasa (PCR. Se generaron perfiles de bandas de ADN mediante la amplificación de secuencias repetitivas de consenso intergénico de enterobacterias (ERIC-PCR. De acuerdo a los resultados obtenidos por ERIC
Detection of Antibiotic Resistant Listeria spp. in Beef Burgers Distributed in Ahvaz City, Iran
Directory of Open Access Journals (Sweden)
Maktabi
2016-03-01
Full Text Available Background Listeria spp. are able to be survive in many foods during frozen storage. One particular species, Listeria monocytogenes, is one of the most important food-borne pathogens globally. The antimicrobial resistance of pathogenic microorganisms is a worldwide public health concern because of increasing global trade and travel. Objectives The aim of this study was to evaluate the occurrence and antibiotic resistance of Listeria spp. in the Iranian beef burgers distributed in Ahvaz city. Materials and Methods During a five-month period, 150 frozen burgers were purchased from local markets in Ahvaz city, and tested for presence of Listeria spp. The experimental procedure consisted of a one-step enrichment in Listeria enrichment broth, followed by plating on Oxford agar. Suspected colonies were subjected to subsequent biochemical tests and a polymerase chain reaction (PCR assay. The susceptibility of the isolates to various antibiotics was investigated using the Kirby-Bauer disk diffusion method, and the results were analyzed via the chi-square test and Fisher’s exact test using SPSS 16.0 software. Results Out of 150 samples, only two were contaminated with Listeria innocua, and the statistical analysis showed no significant differences in the prevalence of Listeria between companies (P > 0.05. One of the isolates was resistant to tetracycline and the other to co-trimoxazole. Both of the isolates showed an intermediate susceptibility to chloramphenicol; however, they were sensitive to the other tested antibiotics. Conclusions L. innocua is not a pathogen, but the presence of the bacterium could be an indicator of probable contamination with L. monocytogenes. Moreover, there is a potential risk to public health from the consumption of raw or undercooked burgers, which may increase the possibility of the acquisition of resistance to antibiotics.
The prevalence of Listeria spp. food contamination in Iran: A systematic review and meta-analysis.
Hamidiyan, Negar; Salehi-Abargouei, Amin; Rezaei, Zeynab; Dehghani-Tafti, Roohollah; Akrami-Mohajeri, Fateme
2018-05-01
Listeria monocytogenes can cause circling disease, encephalitis, meningitis, septicemia, and mastitis in dairy cattle. Contamination from the environment can contaminate foods with Listeria spp. Consumption of foods containing L. monocytogenes can lead to listeriosis in susceptible people (adults with a compromised immune system), pregnant women, and infants. The objective of this study was to determine the prevalence of Listeria spp. and L. monocytogenes in various foods in Iran. We searched PubMed, Science direct, Scopus, Google scholar, and Iranian local databases including Iranian scientific information database and Magiran for relevant studies up to May 2015 using related keywords. In our preliminary search, we retrieved 1344 articles. After removing duplicates and reviewing titles/abstracts, 117 articles were considered, out of which, 75 articles had sufficient quality for inclusion in this meta-analysis. The prevalence of Listeria spp. contamination was about 18.3% in poultry, 8.5% in raw meat, 14.6% in ready-to-eat (RTE) foods, 10% in sea foods, 7.3% in traditional dairy, 3.2% in commercial dairy, and 0.1% in eggs. The findings showed that L. monocytogenes was most prevalent in ready to eat (9.2%), seafood (5.1%), poultry (5%), traditional dairy (4%), raw meat (2.6%), commercial dairy (1.4%), and egg (0.2%), respectively. Furthermore, the presence of L. monocytogenes particularly in RTE foods (that are consumed without further heat processing) and under-cooked products could be a potential risk for public health. So, contamination should be controlled at all levels of the food chain. Copyright © 2018. Published by Elsevier Ltd.
Prevalence and Antibiotic Resistance of Listeria Spp. Isolated from Ready-to-Eat Foods in Ankara
ŞİRELİ, Ufuk Tansel; GÜCÜKOĞLU, Ali
2014-01-01
In this study the presence of Listeria spp. is tested in 100 ready-to-eat food samples purchased from different stores and traditional food shops in the province of Ankara. The tested materials were 20 each of the following: mayonnaise based salad, kadınbudu köfte (fried meatball), fried liver, rice stuffed mussel, and green salad. Microbiological analyzes showed that 13 of 100 salad samples (13%) were contaminated with Listeria spp. while 10 of 100 salad samples (10%) were contaminated with ...
Hmaïed, F; Helel, S; Le Berre, V; François, J-M; Leclercq, A; Lecuit, M; Smaoui, H; Kechrid, A; Boudabous, A; Barkallah, I
2014-02-01
We aimed at evaluating the prevalence of Listeria species isolated from food samples and characterizing food and human cases isolates. Between 2005 and 2007, one hundred food samples collected in the markets of Tunis were analysed in our study. Five strains of Listeria monocytogenes responsible for human listeriosis isolated in hospital of Tunis were included. Multiplex PCR serogrouping and pulsed field gel electrophoresis (PFGE) applying the enzyme AscI and ApaI were used for the characterization of isolates of L. monocytogenes. We have developed a rapid microarray-based assay to a reliable discrimination of species within the Listeria genus. The prevalence of Listeria spp. in food samples was estimated at 14% by using classical biochemical identification. Two samples were assigned to L. monocytogenes and 12 to L. innocua. DNA microarray allowed unambiguous identification of Listeria species. Our results obtained by microarray-based assay were in accordance with the biochemical identification. The two food L. monocytogenes isolates were assigned to the PCR serogroup IIa (serovar 1/2a). Whereas human L. monocytogenes isolates were of PCR serogroup IVb, (serovars 4b). These isolates present a high similarity in PFGE. Food L. monocytogenes isolates were classified into two different pulsotypes. These pulsotypes were different from that of the five strains responsible for the human cases. We confirmed the presence of Listeria spp. in variety of food samples in Tunis. Increased food and clinical surveillance must be taken into consideration in Tunisia to identify putative infections sources. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Márcia de Aguiar Ferreira Barros
2007-12-01
Full Text Available High levels of microbial contamination, commonly found in animal origin foods and food processing environments, are able to hinder the growth of pathogens in these products and interfere in the results of laboratory analyses for detection of these pathogens. With the aim of verifying the possible interference of the autochthonous microbiota encountered in meat and meat products and processing plants over the presence of Listeria spp., 443 samples, collected from 11 meat retail establishments, were submitted to microbiological analysis to determine the levels of mesophilic aerobes, total coliforms and Escherichia coli and the presence of Listeria spp., according to the methodology proposed by the USDA. The results did not show evident interference of the autochthonous microbiota over Listeria spp., once the genus was detected even in the meat, meat products and environmental samples with high levels of contamination by mesophilic aerobes and coliforms.Altos níveis de contaminação microbiana, usualmente encontrados em alimentos de origem animal e nos ambientes de processamento, podem inibir a multiplicação de microrganismos patogênicos nesses produtos e interferir nos resultados das análises laboratoriais para o isolamento desses patógenos. Com o objetivo de verificar as possíveis interferências da microbiota autóctone encontrada na carne, produtos cárneos e plantas de processamento sobre a presença de Listeria spp., 443 amostras, coletadas em 11 estabelecimentos processadores, foram submetidas a análises microbiológicas para determinação dos níveis de contaminação por aeróbios mesófilos, coliformes totais e Escherichia coli e para verificação da presença de Listeria spp., de acordo com a metodologia proposta pelo USDA. Os resultados obtidos não mostraram uma interferência evidente da microbiota autóctone sobre Listeria spp., uma vez que esse gênero foi detectado mesmo nas amostras de carne e produtos cárneos e
Directory of Open Access Journals (Sweden)
Titik Budiati
2013-06-01
Full Text Available The aim of this study was to modify the isolation methods of Aeromonas sp., Salmonella spp., and Listeria sp. in catfish (Clarias gariepinus and tilapia (Tilapia mossambica obtained from wet markets and ponds in Malaysia by pelleting the sample. A total of 108 samples (32 catfish intestines, 32 tilapia intestines, and 44 water samples were obtained from nine wet markets and eight ponds. The modified method was employed by pelleting the samples and followed by either implementing pre-enrichment or without pre-enrichment on the isolation of Salmonella and Listeria spp. The modified method (by pelleting the sample in combination with pre-enrichment was the most efficient for Salmonella and Listeria isolation. The sensitivity of the modified Salmonella isolation method was 0.53 and 0.73 for fish and water samples, respectively. The sensitivity of the modified Listeria method was 1 and 0.92 for fish and water samples, respectively. However, the sensitivity of the method by pelleting the sample was similar to those of non-pelleting the sample on Aeromonas isolation. Five species of Aeromonas spp., seven serovars of Salmonella sp., and four species of Listeria sp. were observed in catfish, tilapia and water samples. Overall, by pelleting the sample offered the beneficial to isolate Aeromonas spp., Salmonella sp. and Listeria spp. in catfish, tilapia and water.
Growth of Listeria spp. in shredded cabbage is enhanced by a mild heat treatment.
Ells, Timothy C; Truelstrup Hansen, Lisbeth
2010-03-01
Mild thermal processing can enhance the shelf life of cut fruits and vegetables by delaying the onset of spoilage and preserving the organoleptic properties of shredded cabbage. However, food safety issues related to this process have not been fully investigated. Therefore, the survival and growth of Listeria spp. on cabbage treated in this manner was examined. Experimentally, 24 strains of Listeria spp. (including L. monocytogenes) were inoculated onto cut and intact cabbage tissues and stored at 5 degrees C. All strains on intact tissues exhibited a moderate decline in numbers (up to 1.0 log CFU/cm(2)) over the 28-day storage period. Conversely, cut tissue supported growth of most strains during the first 7 to 14 days of incubation with maximum increases of 1.2 log CFU/cm(2). Subsequently, the survival or growth on heat-treated (50 degrees C for 3 min) and untreated shredded cabbage of four L. monocytogenes and four nonpathogenic Listeria spp. strains were compared during storage for 21 days at 5 degrees C. Growth on untreated shred for all strains was similar to the results observed on cut tissue with a maximum increase of approximately 1.0 log CFU/g. However, in the heat-treated cabbage shred all strains displayed a rapid increase in growth (up to 2.5 log CFU/g) during the first 7 days of incubation, which may be indicative of the destruction of an endogenous growth-inhibiting compound within the cabbage. In conclusion, this study shows that mild thermal treatments of cut cabbage may promote pathogen growth if other inimical barriers are not implemented downstream of the thermal treatment.
FRECUENCIA DE Listeria spp., EN QUESOS COLOMBIANOS COSTEÑOS
Directory of Open Access Journals (Sweden)
Janneth Gallegos.
2007-12-01
Full Text Available Objetivo. Determinar la frecuencia de Listeria spp., en quesos frescos costeños, distribuidos en plazas de mercado populares de las ciudades de Montería y Cereté. Materiales y métodos. Teniendo en cuenta la importancia económica de esta zona ganadera para Colombia se tomaron 217 muestras entre Junio y Agosto de 2005, los aislamientos obtenidos fueron identificados por pruebas bioquímicas presuntivas, PCRMúltiple (L1-U1/LF-LR y pruebas bioquímicas para confirmación de especie. Adicionalmente, se determinó la frecuencia de las especies del género y se caracterizó la resistencia antimicrobiana de las cepas de mayor frecuencia. Resultados. Las pruebas bioquímicas y la PCR detectaron 49 aislamientos positivos para Listeria (22.58%, de los cuales 16.33% (8/49 correspondieron a Montería y 24.40% (41/168 a Cereté. La frecuencia por especies fue 14.75% para L. ivanovii, 2.30% para L. innocua, 1.84% para L. welshimeri y 1.38% para L. seeligeri, no se detectó L. monocytogenes. Sólo 3/32 cepas de L. ivanovvi (9.38% mostraron resistencia a penicilina, estreptomicina y eritromicina respectivamente. Conclusiones. Los resultados confirman que los quesos costeños están frecuentemente contaminados con Listeria spp. La presencia de L. ivanovii patógeno involucrado en algunos casos de infecciones oportunistas en humanos y L. innocua; microorganismo utilizado en muchas industrias de alimento como indicador del grado o calidad de sanitización; demuestra que las condiciones de producción y expendio no son adecuadas y que el consumo de queso costeño no es seguro. La resistencia antimicrobiana aunque baja muestra posibilidades para la transmisión horizontal y/o vertical de los genes de resistencia.
Reinhard, Robert G; Kalinowski, Robin M; Bodnaruk, Peter W; Eifert, Joseph D; Boyer, Renee R; Duncan, Susan E; Bailey, R Hartford
2018-06-07
A multiyear survey of 31 ready-to-eat (RTE) food processing plants in the United States was conducted to determine the incidence of Listeria spp. in various RTE production environments. Samples were collected from 22 RTE plants regulated by the U.S. Department of Agriculture's Food Safety and Inspection Service (FSIS) and from 9 RTE food plants regulated by the U.S. Department of Health and Human Services' Food and Drug Administration (FDA). Only nonfood contact surfaces in the RTE manufacturing areas with exposed RTE product were sampled. Each sample was individually analyzed for the presence of Listeria spp. by using a PCR-based rapid assay. In total, 4,829 samples were collected from various locations, including freezers, equipment framework, floors, walls, wall-floor junctures, drains, floor mats, doors, and cleaning tools. Nine (29%) of the facilities had zero samples positive for Listeria spp. in the production environment, whereas 22 (71%) had one or more samples positive for Listeria spp. The total incidence of Listeria spp. in all RTE food plants was 4.5%. The positive rate in plants regulated by the FSIS ranged from 0 to 9.7%, whereas the positive rate in plants regulated by the FDA ranged from 1.2 to 36%.
Efficacy of a variety of disinfectants against Listeria spp.
Best, M; Kennedy, M E; Coates, F
1990-02-01
The efficacy of 14 disinfectants against Listeria innocua and two strains of Listeria monocytogenes in the presence of organic matter was studied. Quantitative efficacy tests were used. Many of the disinfectants tested were not as effective on Listeria spp. when the test organisms were dried onto the surface of steel disks (carrier tests) as they were when the organisms were placed in suspension (suspension test). The presence of whole serum and milk (2% fat) further reduced the disinfectant capacities of most of the formulations studied. Only three disinfectants (povidone-iodine, chlorhexidine gluconate, and glutaraldehyde) were effective in the carrier test in the presence of serum; however, all three were ineffective when challenged with milk (2% fat). Only one solution, sodium dichloroisocyanurate, was effective in the presence of milk. All but four formulations (chloramine-T, phosphoric acid, an iodophor, and formaldehyde) were effective in the suspension tests, regardless of the organic load. L. monocytogenes was observed to be slightly more resistant to disinfection than L. innocua was. There was no difference in disinfectant susceptibility between the two strains of L. monocytogenes. These findings emphasize the need for caution in selecting an appropriate disinfectant for use on contaminated surfaces, particularly in the presence of organic material.
Directory of Open Access Journals (Sweden)
Trajković-Pavlović Ljiljana
2010-01-01
Full Text Available Background/Aim. According to the literature that has been published over the last two decades Campylobacter spp i Listeria monocitogens can be identified as causes of numerous diseases derived by consuming food of animal origin. The purpose of this paper was to find out how established national microbiological criteria of the Republic of Serbia on food safety in retailed food of animal origin could contribute to consumer's protection against exposition to foodborne pathogens such as Campylobacter spp. and Listeria monocytogenes. Methods. During a routine microbiological safety control of randomly selected 60 samples of fresh poultry meat, 30 samples of other fresh meat readymade for grilling, 30 samples of sausage products, 37 samples of heattreated meat, 39 samples of toppings for fast food of animal origin and 31 samples of dairy products a national food safety criteria (Escherichia coli, aerobic plate count, Salmonella spp., coagulasa positive Staphylococcus, Proteus spp., sulphitoreducting Clostridia were applied and, as well as, testing to Campylobacter spp. and Listeria monocitogens. In determination of Campylobacter spp. and Listeria monocytogenes, food quality control methods of the Food and Agriculture Organization (FAO were applied, while in determination of the other above motioned bacteria, national provisions on microbiological methods were applied who are adjusted to the FAO ones. Results. Related to the national criteria on microbiological food safety, 88 (38.8% samples, out of the total 227 tested, were rejected. When to these results, the results of laboratory tests on Listeria monocytogens were added, a terminal number of rejected samples were not changed. When to these results, the results of Campylobacter spp. testing were added, 91 (40.1% out of the 227 samples were unsatisfied. Results of logistic regression model with occurrence of Escherichia coli as dependent variable indicated that Escherichia coli was 4.5 times likely
Trajković-Pavlović, Ljiljana; Novaković, Budimka; Martinov-Cvejin, Mirjana; Gusman, Vera; Bijelović, Sanja; Dragnić, Natasa; Balać, Dragana
2010-08-01
According to the literature that has been published over the last two decades Campylobacter spp i Listeria monocitogens can be identified as causes of numerous diseases derived by consuming food of animal origin. The purpose of this paper was to find out how established national microbiological criteria of the Republic of Serbia on food safety in retailed food of animal origin could contribute to consumer's protection against exposition to foodborne pathogens such as Campylobacter spp. and Listeria monocytogenes. During a routine microbiological safety control of randomly selected 60 samples of fresh poultry meat, 30 samples of other fresh meat readymade for grilling, 30 samples of sausage products, 37 samples of heat-treated meat, 39 samples of toppings for fast food of animal origin and 31 samples of dairy products a national food safety criteria (Escherichia coli, aerobic plate count, Salmonella spp., coagulasa positive Staphylococcus, Proteus spp., sulphito-reducting Clostridia) were applied and, as well as, testing to Campylobacter spp. and Listeria monocitogens. In determination of Campylobacter spp. and Listeria monocytogenes, food quality control methods of the Food and Agriculture Organization (FAO) were applied, while in determination of the other above motioned bacteria, national provisions on microbiological methods were applied who are adjusted to the FAO ones. Related to the national criteria on microbiological food safety, 88 (38.8%) samples, out of the total 227 tested, were rejected. When to these results, the results of laboratory tests on Listeria monocytogens were added, a terminal number of rejected samples were not changed. When to these results, the results of Campylobacter spp. testing were added, 91 (40.1%) out of the 227 samples were unsatisfied. Results of logistic regression model with occurrence of Escherichia coli as dependent variable indicated that Escherichia coli was 4.5 times likely to occur among samples with Campylobacter spp
Chin, Pui San; Ang, Geik Yong; Yu, Choo Yee; Tan, Eng Lee; Tee, Kok Keng; Yin, Wai Fong; Chan, Kok Gan; Tan, Geok Yuan Annie
2018-02-01
Listeria spp. are ubiquitous in nature and can be found in various environmental niches such as soil, sewage, river water, plants, and foods, but the most frequently isolated species are Listeria monocytogenes and Listeria innocua. In this study, the presence of Listeria spp. in raw chicken meat and chicken-related products sold in local markets in Klang Valley, Malaysia was investigated. A total of 44 Listeria strains (42 L. innocua and 2 L. welshimeri) were isolated from 106 samples. Antibiotic susceptibility tests of the L. innocua strains revealed a high prevalence of resistance to clindamycin (92.9%), ceftriaxone (76.2%), ampicillin (73.8%), tetracycline (69%), and penicillin G (66.7%). Overall, 31 L. innocua and 1 L. welshimeri strain were multidrug resistant, i.e., nonsusceptible to at least one antimicrobial agent in three or more antibiotic classes. The majority of the L. innocua strains were placed into five AscI pulsogroups, and overall 26 distinct AscI pulsotypes were identified. The detection of multidrug-resistant Listeria strains from different food sources and locations warrants attention because these strains could serve as reservoirs for antimicrobial resistance genes and may facilitate the spread and emergence of other drug-resistant strains.
Radiosensitization of Salmonella spp. and Listeria spp. in ready-to-eat baby spinach leaves.
Gomes, Carmen; Moreira, Rosana G; Castell-Perez, Elena
2011-01-01
The FDA recently approved irradiation treatment of leafy greens such as spinach up to 1 kGy; however, it is important to reduce the dose required to decontaminate the produce while maintaining its quality. Thus, the objectives of this study were: (1) to assess the radiation sensitivities of Salmonella spp. and Listeria spp. inoculated in ready-to-eat baby spinach leaves under modified atmosphere packaging (MAP) and irradiated using a 1.35-MeV Van de Graff accelerator (the leaves were irradiated both at room temperature and at -5 °C); and (2) to understand and optimize the synergistic effect of MAP and irradiation by studying the radiolysis of ozone formation under different temperatures, the effect of dose rate on its formation, and its decomposition. Results showed that increased concentrations of oxygen in the packaging significantly increased the radiation sensitivity of the test organisms, ranging from 7% up to 25% reduction in D(10)-values. In particular, radiosensitization could be effected (P radiation under modified atmosphere packaging (100% O(2) and N(2):O(2)[1:1]) may be a viable tool for reducing microbial populations or eliminating Salmonella spp. and Listeria spp. from baby spinach. A suggested treatment to achieve a 5-log reduction of the test organisms would be irradiation at room temperature under 100% O(2) atmosphere at a dose level of 0.7 kGy. Practical Application: Decontamination of minimally processed fruits and vegetables from food-borne pathogens presents technical and economical challenges to the produce industry. Internalized microorganisms cannot be eliminated by the current procedure (water-washed or treated with 200-ppm chlorine). The only technology available commercially is ionizing radiation; however, the actual radiation dose required to inactivate pathogens is too high to be tolerated by the product without unwanted changes. This study shows a new approach in using MAP with 100% O(2), which is converted to ozone to radiosensitize
Non-Specific Reactions during Immunomagnetic Separation of Listeria
Directory of Open Access Journals (Sweden)
Iveta Zachová
2005-01-01
Full Text Available Problems occurring during the immunomagnetic separation (IMS of Listeria using immunomagnetic particles Dynabeads® anti-Listeria (Dynal Biotech, Norway were specified. Characteristics of these particles were compared with anti-Listeria spp. magnetite particles (Quantum Magnetics, USA. Pure cultures of Listeria innocua, Arthrobacter spp., Bacillus subtilis, Citrobacter braakii, Escherichia coli, Enterobacter aerogenes, Enterobacter cloacae and Staphylococcus aureus were used to evaluate non-specific reactions during IMS. Gram-positive microorganisms, especially Staphylococcus aureus and Arthrobacter spp., were found to be responsible for non-specific reactions in most cases. The capacity of Dynabeads® anti-Listeria particles was determined to be about 10 % of the initial pure cultures of Listeria spp., after 10 min of incubation. Non-specific reactions during IMS of Listeria were examined on the artificially inoculated food samples in which Gram-positive bacteria showed the highest percentage of capture. Influence of washing in two buffers was also studied.
Lewis, H C; Little, C L; Elson, R; Greenwood, M; Grant, K A; McLauchlin, J
2006-07-01
Two recent listeriosis outbreaks involving butter prompted this first cross-sectional study on the prevalence, levels, and types of Listeria species in 3229 samples of butter from production, retail, and catering premises in the United Kingdom during May and June 2004. When the criteria of the Microbiological Guidelines were used, 99.4% of samples were found to be of satisfactory microbiological quality, 0.5% were of acceptable quality, and 0.1% were of unsatisfactory quality as a result of high levels (>100 CFU/g) of Listeria spp. The butter samples with Listeria spp. present at more than 100 CFU/g were negative for L. monocytogenes. L. monocytogenes was detected in 0.4% (n=13) of samples, all at levels of less than 10 CFU/g, and were therefore of acceptable quality. Butter was contaminated more frequently with Listeria spp., including L. monocytogenes, when packed in plastic tubs, when in pack sizes of 500 g or less, when stored or displayed above 8 degrees C, when a hazard analysis system was not in place, and when the manager had received no food hygiene training. This study demonstrates that although butter is regarded as a low-risk product, it may provide an environment for the persistence and growth of Listeria spp., including L. monocytogenes. The control of L. monocytogenes in food processing and supply systems is critical in order to minimize the potential for this bacterium to be present in foods at the point of consumption at levels hazardous to health.
Bouayad, Leila; Hamdi, Taha M; Naim, Malek; Leclercq, Alexandre; Lecuit, Marc
2015-07-01
Products from three broiler abattoirs were sampled for Listeria species to evaluate the changes in the prevalence and contamination rates at two stages of processing. Sampling was performed at the evisceration stage and at the end of processing after packaging and refrigerating at 4°C for 24 h. A total of 212 samples were collected; 52 were from abattoir A, and 80 samples each were collected from abattoirs B and C. Among all samples, 99 (46.7%) tested positive for Listeria, including L. monocytogenes 19 (8.9%), L. innocua 69 (32.5%), L. grayi 10 (4.7%), and L. welshimeri 1 (0.5%). The L. monocytogenes contamination rate varied from 5% to 11.5% in the 3 abattoirs. L. innocua was the most common species identified and was found in 8.8% of the samples from abattoir A and 33.7% of the samples from both abattoirs B and C. Twenty-six of the L. monocytogenes isolates obtained from positive samples were subjected to serotyping by multiplex polymerase chain reaction and characterization by the pulsed-field gel electrophoresis (PFGE) method using two cutting enzymes, ApaI and AscI. Three molecular serogroups were identified: IIa, IIb, and IVb. Serogroup IIa was common to all abattoirs, and serogroups IIb and IVb were found only in abattoir C. The 10 different obtained PFGE profiles were grouped into 7 clusters; some of these clusters were common to the 3 abattoirs, and others were specific to the abattoirs in which they were identified. This study revealed a high prevalence of Listeria spp., particularly L. monocytogenes, in raw broilers. This high incidence presents a risk to consumers due to the potential occurrence of cross-contamination with other foods in domestic refrigerators and the ability of these microorganisms to survive in undercooked products.
Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn
2016-02-01
Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.
Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne
2013-08-16
Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well
Jamali, Hossein; Radmehr, Behrad; Ismail, Salmah
2014-04-01
The aims of this study were to determine the prevalence and antimicrobial resistance of Listeria, Salmonella, and Yersinia spp. isolated from duck and goose intestinal contents. A total of 471 samples, including 291 duck and 180 goose intestinal contents, were purchased from wet markets between November 2008 and July 2010. Listeria, Salmonella, and Yersinia spp. were isolated from 58 (12.3%), 107 (22.7%), and 80 (17%) of the samples, respectively. It was concluded that Listeria ivanovii, Salmonella Thompson, and Yersinia enterocolitica were the predominant serovars among Listeria, Salmonella, and Yersinia spp., respectively. Moreover, resistance to tetracycline was common in Listeria (48.3%) and Salmonella spp. (63.6%), whereas 51.3% of the Yersinia spp. isolates were resistant to cephalothin. Therefore, continued surveillance of the prevalence of the pathogens and also of emerging antibiotic resistance is needed to render possible the recognition of foods that may represent risks and also ensure the effective treatment of listeriosis, salmonellosis, and yersiniosis.
Prevalence of Listeria monocytogenes in poultry meat
Directory of Open Access Journals (Sweden)
Mehmet ELMALI
2015-01-01
Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.
Directory of Open Access Journals (Sweden)
Luís Augusto Nero
2004-05-01
Full Text Available Exopolysaccharides, biopolymers or hydrosolubles gums, are produced by a great variety of microorganisms and possess physical, structural and chemical properties quite homogeneous, in relation to derived from algae and plants. The production is relatively independent on climatic conditions, faster obtaining of the finished product and need small space. Biopolymers have been studied thoroughly in the last years. Due to wide diversity in structure and physical properties, the microbial polysaccharides possess a lot of applications in food, pharmaceutical, oil, cosmetics, textile, inks and agricultural products among others industries. Some of those applications, include uses as emulsifying, stabilizing, binding, jellifying, clotting, lubricants, film coated, thickening and suspender agents. The parameters that have most influenced the process of exopolysaccharides biosyntheses have been the microorganism, the culture medium composition, pH and temperature of incubation. The exopolysaccharide production can be developed by species of Gram-negative and Gram-positive bacteria, some microalgae and many moulds. This work discusses the influence of these parameters during the production process and exopolysaccharides biosyntheses by bacteria.O objetivo desta pesquisa foi estabelecer a ocorrência de Listeria monocytogenes em diversos pontos de plantas de processamento de carne bovina em 01 abatedouro e 05 casas de carnes localizados na região norte do Paraná. Para a detecção de Listeria spp. em 124 amostras de equipamentos/utensílios e instalações, utilizou-se a metodologia preconizada pelo United States Departament of Agriculture (USDA, com identificação das espécies por testes bioquímicos e posterior confirmação pelo API Listeria (bioMérieux. Os resultados obtidos indicaram freqüências de 6,25% de L. monocytogenes; 68,75% de L. innocua; 18,75% de L. welshimeri; 4,17% de L. seeligeri e 2,08% de L. grayi. As amostras positivas para L
Williams, Shanna K; Roof, Sherry; Boyle, Elizabeth A; Burson, Dennis; Thippareddi, Harshavardhan; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin; Nightingale, Kendra
2011-01-01
A longitudinal study was conducted to track Listeria contamination patterns in ready-to-eat meats from six small or very small meat processing plants located in three states over 1 year. A total of 688 environmental sponge samples were collected from nonfood contact surfaces during bimonthly visits to each plant. Overall, L. monocytogenes was isolated from 42 (6.1%) environmental samples, and its prevalence ranged from 1.7 to 10.8% across different plants. Listeria spp., other than L. monocytogenes, were isolated from 9.5% of samples overall, with the prevalence ranging from 1.5 to 18.3% across different plants. The prevalence of L. monocytogenes correlated well with that of other Listeria spp. for some but not all plants. One L. monocytogenes isolate representing each positive sample was characterized by molecular serotyping, EcoRI ribotyping, and pulsed-field gel electrophoresis typing. Seven sample sites tested positive for L. monocytogenes on more than one occasion, and the same ribotype was detected more than once at five of these sites. Partial sigB sequencing was used to speciate other Listeria spp. isolates and assign an allelic type to each isolate. Other Listeria spp. were isolated more than once from 14 sample sites, and the same sigB allelic type was recovered at least twice from seven of these sites. One plant was colonized by an atypical hemolytic L. innocua strain. Our findings indicate that small and very small meat processing plants that produce ready-to-eat meat products are characterized by a varied prevalence of Listeria, inconsistent correlation between contamination by L. monocytogenes and other Listeria spp., and a unique Listeria molecular ecology.
Wu, Yan; Park, Keun Cheol; Choi, Beom Geun; Park, Jin Hwa; Yoon, Ki Sun
2016-05-01
Salmonella spp. and Listeria spp. are common foodborne pathogens in poultry and have caused a large number of outbreaks worldwide. Biofilm formation is common in the food industry and is also a mechanism of antimicrobial resistance. The aim of this work was to investigate the antimicrobial effect and mechanism of Ginkgo biloba extract against the biofilm formation of Salmonella and Listeria isolates from poultry at retail markets. Bacteria detection, isolation, and enumeration were carried out on 27 chicken and 29 ducks at retail markets. The effects of temperature and G. biloba extract against biofilm formation of Salmonella and Listeria isolates were measured using the crystal violet assay and swimming and swarming motilities. The monitoring results of Salmonella and Listeria in 56 poultry carcasses at retail markets in Korea showed that the prevalence of Salmonella spp. in poultry was low (5.4%), but the prevalence of Listeria spp (78.6%) was high. L. innocua was the predominant serotype (80%) in the isolated Listeria species. Temperature, strain, and surface affected the biofilm formation of Salmonella spp. and Listeria spp. L. innocua showed the best biofilm formation ability on a 96-well plate, while Salmonella Enteritidis formed the most biofilm on a glass slide. Biofilm formation abilities of Salmonella spp. and Listeria spp. were increased with the increase of temperature. G. biloba extract at 75 μg/mL significantly inhibited biofilm formation of Salmonella spp. and Listeria spp (p Listeria, but not L. monocytogenes. The findings of this study provided the basis for the application of G. biloba extract as a food additive to promote the quality and safety of poultry products.
Directory of Open Access Journals (Sweden)
Pınar Şanlıbaba
2018-02-01
Full Text Available The objective of this study was to determine the prevalence of Listeria species, specifically Listeria monocytogenes, in raw milk, pasteurized milk, white cheese, and homemade cheese. A total of 200 food samples were collected and analyzed to examine the presence of Listeria spp. The EN ISO 11290-1 method was used for isolation of Listeria. API Listeria test kit was used for biochemically characterization. Listeria spp. were isolated in 25 of the 200 samples (12.5%. The largest number of Listeria spp. was detected in homemade cheese (24%, followed by raw milk (18%, and white cheese (8%. Listeria spp. were not isolated from the pasteurized milk. The most common species isolated were Listeria innocua (5.5%; the remaining Listeria isolates were Listeria ivanovi (3.5%, Listeria welshimeri (3%, and Listeria monocytogenes (0.5%. Listeria monocytogenes was detected in only raw milk.
Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh
2015-07-25
The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.
Listeria monocytogenes: diagnostic problems
Beumer, R.R.; Hazeleger, W.C.
2003-01-01
The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents
Babu, Dinesh; Crandall, Philip G; Johnson, Casey L; O'Bryan, Corliss A; Ricke, Steven C
2013-12-01
Growers and processors of USDA certified organic foods are in need of suitable organic antimicrobials. The purpose of the research reported here was to develop and test natural antimicrobials derived from an all-natural by-product, organic pecan shells. Unroasted and roasted organic pecan shells were subjected to solvent free extraction to produce antimicrobials that were tested against Listeria spp. and L. monocytogenes serotypes to determine the minimum inhibitory concentrations (MIC) of antimicrobials. The effectiveness of pecan shell extracts were further tested using a poultry skin model system and the growth inhibition of the Listeria cells adhered onto the skin model were quantified. The solvent free extracts of pecan shells inhibited Listeria strains at MICs as low as 0.38%. The antimicrobial effectiveness tests on a poultry skin model exhibited nearly a 2 log reduction of the inoculated cocktail mix of Listeria strains when extracts of pecan shell powder were used. The extracts also produced greater than a 4 log reduction of the indigenous spoilage bacteria on the chicken skin. Thus, the pecan shell extracts may prove to be very effective alternative antimicrobials against food pathogens and supplement the demand for effective natural antimicrobials for use in organic meat processing. © 2013 Institute of Food Technologists®
Chapin, Travis K; Nightingale, Kendra K; Worobo, Randy W; Wiedmann, Martin; Strawn, Laura K
2014-11-01
Listeria species have been isolated from diverse environments, often at considerable prevalence, and are known to persist in food processing facilities. The presence of Listeria spp. has been suggested to be a marker for Listeria monocytogenes contamination. Therefore, a study was conducted to (i) determine the prevalence and diversity of Listeria spp. in produce production and natural environments and (ii) identify geographical and/or meteorological factors that affect the isolation of Listeria spp. in these environments. These data were also used to evaluate Listeria spp. as index organisms for L. monocytogenes in produce production environments. Environmental samples collected from produce production (n = 588) and natural (n = 734) environments in New York State were microbiologically analyzed to detect and isolate Listeria spp. The prevalence of Listeria spp. was approximately 33 and 34% for samples obtained from natural environments and produce production, respectively. Co-isolation of L. monocytogenes and at least one other species of Listeria in a given sample was recorded for 3 and 9% of samples from natural environments and produce production, respectively. Soil moisture and proximity to water and pastures were highly associated with isolation of Listeria spp. in produce production environments, while elevation, study site, and proximity to pastures were highly associated with isolation of Listeria spp. in natural environments, as determined by randomForest models. These data show that Listeria spp. were prevalent in both agricultural and nonagricultural environments and that geographical and meteorological factors associated with isolation of Listeria spp. were considerably different between the two environments.
Inactivation of Salmonella and Listeria in ground chicken breast meat during thermal processing.
Murphy, R Y; Marks, B P; Johnson, E R; Johnson, M G
1999-09-01
Thermal inactivation of six Salmonella spp. and Listeria innocua was evaluated in ground chicken breast and liquid medium. Survival of Salmonella and Listeria was affected by the medium composition. Under the same thermal process condition, significantly more Salmonella and Listeria survived in chicken breast meat than in 0.1% peptone-agar solution. The thermal lethality of six tested Salmonella spp. was additive in chicken meat. Survival of Listeria in chicken meat during thermal processing was not affected by the presence of the six Salmonella spp. Sample size and shape affected the inactivation of Salmonella and Listeria in chicken meat during thermal processing.
Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.
Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin
2012-06-01
The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.
Listeria Occurrence in Poultry Flocks: Detection and Potential Implications.
Rothrock, Michael J; Davis, Morgan L; Locatelli, Aude; Bodie, Aaron; McIntosh, Tori G; Donaldson, Janet R; Ricke, Steven C
2017-01-01
Foodborne pathogens such as Salmonella, Campylobacter, Escherichia coli , and Listeria are a major concern within the food industry due to their pathogenic potential to cause infection. Of these, Listeria monocytogenes , possesses a high mortality rate (approximately 20%) and is considered one of the most dangerous foodborne pathogens. Although the usual reservoirs for Listeria transmission have been extensively studied, little is known about the relationship between Listeria and live poultry production. Sporadic and isolated cases of listeriosis have been attributed to poultry production and Listeria spp. have been isolated from all stages of poultry production and processing. Farm studies suggest that live birds may be an important vector and contributor to contamination of the processing environment and transmission of Listeria to consumers. Therefore, the purpose of this review is to highlight the occurrence, incidence, and potential systemic interactions of Listeria spp. with poultry.
Schwaiger, K; Schmied, E-M V; Bauer, J
2010-05-01
By investigating the prevalence and antimicrobial resistance characteristics of Gram-positive bacteria from organic and conventional keeping systems of laying hens, it was to be determined to what extent these properties are influenced by the different systems. For this purpose, a total of 799 cloacal swabs and 800 egg samples were examined. Prevalences for all selected bacteria from cloacal swabs were much the same for both organic and caged birds: Listeria spp.1.3%[org] versus 1.6%[con]; Enterococcus spp. 95.5%[org] versus 97.5%[con]. Egg contents and eggshells were generally contaminated to a lesser extent, primarily with Enterococcus spp. Listeria isolates were susceptible to almost all tested antibiotics, only three Listeria innocua from conventional keepings were resistant to clindamycin; one isolate additionally to imipenem. High percentages of Enterococcus faecalis were resistant to doxycycline and macrolides. Enterococcus faecium proved to have high resistance rates to clindamycin, fosfomycin and erythromycin; 9.1% were even resistant to the reserve antibiotic synercid. Further, Enterococcus spp. showed higher resistance rates to doxycycline, erythromycin, fosfomycin and rifampicin. No glycopeptide resistant enterococci were detected. A correlation between keeping system and resistance/susceptibility rates could be demonstrated. In detail, E. faecalis from organic laying hen husbandries showed significant lower resistance prevalences to tylosin, streptomycin and doxycycline; susceptibility rates were higher for enrofloxacin and ciprofloxacin. Rifampicin and imipenem were more effective in isolates from conventional keepings (P < 0.05). The amounts of resistant isolates of the Enterococcus raffinosus from organic farms were significantly lower, the amounts of sensitive isolates were significantly higher than from conventional farms concerning eight antibiotics (P < 0.05). When comparing the susceptibility/resistance rates, as well as the mean minimum
Fate of Listeria spp. on parsley leaves grown in laboratory and field cultures.
Dreux, N; Albagnac, C; Carlin, F; Morris, C E; Nguyen-The, C
2007-11-01
To investigate the population dynamics of Listeria monocytogenes and Listeria innocua on the aerial surfaces of parsley. Under 100% relative humidity (RH) in laboratory and regardless of the inoculum tested (10(3)-10(8) CFU per leaf), counts of L. monocytogenes EGDe, LO28, LmP60 and L. innocua CIP 80-12 tended towards approx. 10(5) CFU per leaf. Under low RH, Listeria spp. populations declined regardless to the inoculum size (10(4)-10(8) CFU per leaf). L. innocua CIP 80-12 survived slightly better than L. monocytogenes in the laboratory and was used in field cultures. Under field cultures, counts of L. innocua decreased more rapidly than in the laboratory, representing a decrease of 9 log(10) in 2 days in field conditions compared to a decrease of 4.5 log(10) in 8 days in the laboratory. Counts of L. innocua on tunnel parsley cultures were always higher (at least by 100 times) than those on unprotected parsley culture. Even with a high inoculum and under protected conditions (i.e. plastic tunnels), population of L. monocytogenes on the surface of parsley on the field would decrease by several log(10) scales within 2 days. Direct contamination of aerial surfaces of parsley with L. monocytogenes (i.e. through contaminated irrigation water) will not lead to contaminated produce unless it occurs very shortly before harvest.
Listeria Occurrence in Poultry Flocks: Detection and Potential Implications
Directory of Open Access Journals (Sweden)
Michael J. Rothrock
2017-08-01
Full Text Available Foodborne pathogens such as Salmonella, Campylobacter, Escherichia coli, and Listeria are a major concern within the food industry due to their pathogenic potential to cause infection. Of these, Listeria monocytogenes, possesses a high mortality rate (approximately 20% and is considered one of the most dangerous foodborne pathogens. Although the usual reservoirs for Listeria transmission have been extensively studied, little is known about the relationship between Listeria and live poultry production. Sporadic and isolated cases of listeriosis have been attributed to poultry production and Listeria spp. have been isolated from all stages of poultry production and processing. Farm studies suggest that live birds may be an important vector and contributor to contamination of the processing environment and transmission of Listeria to consumers. Therefore, the purpose of this review is to highlight the occurrence, incidence, and potential systemic interactions of Listeria spp. with poultry.
Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG
Directory of Open Access Journals (Sweden)
ALESSANDRA PARO RODRIGUES CESAR
2011-06-01
Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product
Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth
2015-06-01
Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥ 100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P monocytogenes isolates, followed by IVb (16.1%), IIb (15.8%), and IIc (0.4%). L. monocytogenes was detected in cow feces and raw sewage but not in septic tank samples. Pulsotyping of representative water (n = 54) and local human (n = 19) isolates suggested genetic similarities among some environmental and human L. monocytogenes isolates. In conclusion, temperate surface waters contain a diverse Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Ozbey, Gokben; Ertas, Hasan Basri; Kok, Filiz
2006-01-01
Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%), Listeria innocua from 14 samples (14%) and Listeria welshimeri from two samples(2%). A 701 bp fragment of listeriolysi...
Prevalence and location of Listeria monocytogenes in farmed rainbow trout.
Miettinen, Hanna; Wirtanen, Gun
2005-10-15
A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.
Jones, Ronald N; Stilwell, Matthew G
2013-06-01
Dalbavancin is an investigational lipoglycopeptide having an extended serum elimination half-life allowing once-weekly dosing. Data from testing 1357 strains of uncommonly isolated species expand the dalbavancin spectrum details as follows (MIC50/90): β-haemolytic streptococcal serogroups C, F, and G (≤0.03/≤0.03 μg/mL), 7 viridans group of streptococci (≤0.03/≤0.03-0.06 μg/mL), 5 Corynebacterium spp. (0.06/0.12 μg/mL), Listeria monocytogenes (0.06/0.12 μg/mL), and Micrococcus spp. (≤0.03/≤0.03 μg/mL). Among all reported isolates, 99.8% of tested strains were inhibited at dalbavancin MIC values at ≤0.12 μg/mL. Dalbavancin remains very potent against rarer Gram-positive pathogens, using in vitro test experience with organisms cultured through 2011. Copyright © 2013 Elsevier Inc. All rights reserved.
Multiple cortical brain abscesses due to Listeria monocytogenes in an immunocompetent patient.
Khan, Sadia; Kumar, Anil; Kale, Satyajit; Kurkure, Nitin; Nair, Gulsiv; Dinesh, Kavitha
2018-04-01
Listeria monocytogenes is an intracellular organism which is well recognised for its ability to cause meningeal infections in neonates, immunosuppressed, debilitated and elderly individuals. 1 Other less common central nervous system (CNS) infections caused by Listeria spp. include rhomboencephalitis, cerebritis and abscesses in the brain, brain stem and spinal cord. The neuroradiological appearance of Listeria brain abscesses is similar to other types and may also mimic primary or metastatic brain tumours. 2 , 3 We report a case of Listeria brain abscesses in a patient who was being treated for atypical parkinsonism. A good clinical outcome was achieved after appropriate antimicrobial therapy.
Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...
African Journals Online (AJOL)
This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...
Use of vacuum-steam-vacuum and ionizing radiation to eliminate Listeria innocua from ham.
Sommers, Christopher; Kozempel, Michael; Fan, Xuetong; Radewonuk, E Richard
2002-12-01
Listeria spp. are a frequent postprocess contaminant of ready-to-eat (RTE) meat products, including ham. Vacuum-steam-vacuum (VSV) technology has been used successfully to eliminate Listeria innocua from hot dogs. Ionizing radiation can eliminate Listeria spp. from RTE meats. However, the excessive application of either technology can cause changes in product quality, including structural changes, changes in cure color (redness), and lipid oxidation. In this study, two cycles of VSV were combined with 2.0 kGy of ionizing radiation to obtain 4.40- and 4.85-log10 reductions of L. innocua on ham meat and skin, respectively. The use of both treatments resulted in an additive, as opposed to synergistic, reduction of L. innocua on ham. The combination treatment did not cause statistically significant changes in product structure, color (redness), or lipid oxidation.
Prevalence of and risk factors for Listeria species on dairy farms.
Vilar, M J; Yus, E; Sanjuán, M L; Diéguez, F J; Rodríguez-Otero, J L
2007-11-01
This cross-sectional study determined the prevalence of Listeria spp. in bulk-tank milk on dairy farms in the region of Galicia in northwest Spain. The aim was to identify management practices associated with the presence of Listeria spp. and possible effects on milk hygienic quality. A total of 98 farms was randomly selected on the basis of an expected prevalence of 6.5% for Listeria monocytogenes from 20,107 dairy farms in the region. Bulk-tank milk samples were obtained from 98 farms, fecal samples from lactating cows from 97 farms, and silage samples from 83 farms. Listeria monocytogenes was detected in 6.1, 9.3, and 6.0% of these samples, respectively. Statistical analyses confirmed the relationship between low silage quality (as indicated by high pH) and presence of Listeria spp. in silage (29.5 vs. 6.2% for pH above or below 4.5, respectively). Only milking system [tie-stall systems (28.6%) vs. parlor milking (10%)] and inadequately controlled milking order [yes (32.0%) vs. no (10.7%)] had statistically significant effects on management practices for increasing the risk of Listeria contamination of bulk-tank milk.
Directory of Open Access Journals (Sweden)
Ozbey Gokben
2006-06-01
Full Text Available Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%, Listeria innocua from 14 samples (14% and Listeria welshimeri from two samples(2%. A 701 bp fragment of listeriolysin O sequence for L. monocytogenes was amplified using specific primers by polymerase chain reaction (PCR for confirmation of the identification. A random primer (OPA-11 was used in a random amplified polymorphic DNA (RAPD assay. This detected five different band profiles amongst the L. monocytogenes isolates, indicating a relatively large amount of genetic heterogeneity amongst the nine isolates. The study has highlighted the need for improved strategies for food safety, in particular appropriate hygienic precautions to avoid contamination of sausage during the manufacturing process and appropriate preservation techniques during storage and transport, to prevent transmission of Listeria spp to consumers at home and abroad.
Jahan, M; Holley, R A
2016-04-01
Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.
Sakaridis, I; Soultos, N; Dovas, C I; Papavergou, E; Ambrosiadis, I; Koidis, P
2012-02-01
This study was conducted to isolate psychrotrophic lactic acid bacteria (LAB) from chicken carcasses with inhibitory activity against strains of Salmonella spp. and Listeria monocytogenes. A total of 100 broiler samples were examined for the presence of LAB. Ninety-two LAB isolates that showed antimicrobial effects against Salmonella spp. and L. monocytogenes were further analysed to examine their LAB (Gram-positive, catalase negative, oxidase negative) and psychrotrophic characteristics (ability to grow at 7 °C). Fifty isolates were further selected and identified initially using standard biochemical tests in miniature (Micro-kits API CH 50) and then by sequencing of the 16s-23s rRNA gene boundary region (Intergenic Spacer Region). By molecular identification, these isolates were classified into 5 different LAB species: Lactobacillus salivarius, Lactobacillus reuteri, Lactobacillus johnsonii, Pediococcus acidilactici, and Lactobacillus paralimentarius. None of the isolates produced tyramine or histamine. Copyright © 2011 Elsevier Ltd. All rights reserved.
Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn
2017-09-01
Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.
Martínez-Gonzáles, N E; Martínez-Chávez, L; Cabrera-Díaz, E; Martínez-Cárdenas, C; Gutiérrez-González, P; Castillo, A
2016-05-01
Polymyxin Ceftazidime Oxford Medium (PCOM), a novel selective and differential plating medium for Listeria monocytogenes was compared with Modified Oxford Agar (MOX) for efficacy to isolate L. monocytogenes and other Listeria spp. naturally present in non-pasteurized Mexican-style cheese (n = 50), non-pasteurized fresh squeezed orange juice (n = 50), raw beef chunks (n = 36), and fresh cabbage (n = 125). Samples were collected from retail markets and farms in Mexico and tested following the US Department of Agriculture enrichment technique. Listeria spp. were isolated from 23.4% of analyzed samples, and from those, 75.0% corresponded to raw beef chunks, 38.0% to non-pasteurized Mexican-style cheese, and 30.0% to fresh squeezed orange juice. No Listeria spp. were isolated from fresh cabbage samples. L. monocytogenes was recovered from 15.3% of food samples analyzed. Non-pasteurized Mexican-style cheese showed the highest proportion of L. monocytogenes positive samples (36.0%), followed by orange juice (26.0%) and raw beef (25.0%). The frequency of isolation of Listeria spp. and L. monocytogenes was not different (P > 0.05) between PCOM and MOX. The advantages of using PCOM when comparing to MOX, include the easier way to identify Listeria species, the lower cost per plate and the availability of its ingredients for Latin-American countries. Copyright © 2015 Elsevier Ltd. All rights reserved.
Prevalence of Listeria species in some foods and their rapid ...
African Journals Online (AJOL)
Results: Out of 40 meat samples, 14 (35 %) samples were contaminated with Listeria spp., with the ... Conclusion: High protein foods contain different types of Listeria species; whole-cell protein ..... in meat and fermented fish in Malaysia.
Directory of Open Access Journals (Sweden)
Ebrahim Rahimi
2014-02-01
Full Text Available Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. Results: Using cultural method, 19 samples (7.3% were positive for Listeria spp. The highest prevalence of Listeria was found in raw water buffalo milk (11.8%, followed by raw bovine milk (10.6%, raw ovine milk (7.1%, and raw caprine milk (4.2% samples. All 37 camel milk samples from 20 camel breeding farms were negative for Listeria spp. The overall prevalence of Listeria was 7.3%, in which Listeria innocua was the most recovered species (4.2%; the remaining isolates were Listeria monocytogenes (1.9%, Listeria ivanovii (0.08% and Listeria seeligari (0.04%. The PCR assay could identify 8 Listeria-contaminated milk samples that were negative using the cultural method. Conclusions: The results presented in this study indicate the potential risk of infection with Listeria in people consuming raw and unpasteurized milk.
Eppert, I; Valdés-Stauber, N; Götz, H; Busse, M; Scherer, S
1997-01-01
The undefined microbial floras derived from the surface of ripe cheese which are used for the ripening of commercial red smear cheeses have a strong impact on the growth of Listeria spp. In some cases, these microbial consortia inhibit Listeria almost completely. From such undefined industrial cheese-ripening floras, linocin M18-producing (lin+) (N. Valdés-Stauber and S. Scherer, Appl. Environ. Microbiol. 60:3809-3814, 1994) and -nonproducing Brevibacterium linens strains were isolated and used as single-strain starter cultures on model red smear cheeses to evaluate their potential inhibitory effects on Listeria strains in situ. On cheeses ripened with lin+ strains, a growth reduction of L. ivanovii and L. monocytogenes of 1 to 2 log units was observed compared to cheeses ripened with lin strains. Linocin M18 activity was detected in cheeses ripened with lin+ strains but was not found in those ripened with lin strains. We suggest that production of linocin M18 contributes to the growth reduction of Listeria observed on model red smear cheeses but is unsufficient to explain the almost complete inhibition of Listeria caused by some undefined microbial floras derived from the surface of ripe cheeses. PMID:9406400
Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran
Directory of Open Access Journals (Sweden)
Ehsan Shamloo
2015-01-01
Full Text Available Aim: The study aimed to assess the prevalence of Listeria spp. in raw milk and traditional non-pasteurized dairy products in Isfahan, Iran. Materials and Methods: A total of 292 samples of raw milk and traditional dairy were examined for the presence of Listeria spp. using a two-step selective enrichment recommended by the United States Department of Agriculture. All isolates were subjected to standard biochemical tests. L. monocytogenes strains were further confirmed by polymerase chain reaction (PCR amplification. Results: Of 292 samples, 21 (7.14% and 4 (1.47% were positive for Listeria spp. and pathogenic L. monocytogenes, respectively. The prevalence of Listeria spp. in raw milk, ice cream, cream, and freni were 5.91 (5.49%, 12.63 (19.04%, 3.27 (11.11% and 1.25 (4%, respectively. Listeria was not detected from yogurt, butter, Kashk, and cheese. Listeria innocua at 16.21 (5.44% was the most prevalent species isolated, followed by L. monocytogenes at 4.21 (19% and L. seeligeri at 1.21 (4.7%. All strains of L. monocytogenes identified by biochemical tests were also confirmed by PCR. Conclusion: The study shows the prevalence of L. monocytogenes in raw milk and traditional dairy products sold in the market. Consumption of raw milk with mild heat treatment or its usage in traditional dishes could pose serious health problems due to lack of appropriate control measures. The lack of knowledge on the risks of listeriosis transmission indicates the need for implementation of a food safety education program. In addition, the Iranian food safety authorities should urgently set up an effective standard to screen all susceptible food products for the presence of Listeria.
Pava-Ripoll, Monica; Pearson, Rachel E Goeriz; Miller, Amy K; Ziobro, George C
2012-11-01
Although flies are important vectors of food-borne pathogens, there is little information to accurately assess the food-related health risk of the presence of individual flies, especially in urban areas. This study quantifies the prevalence and the relative risk of food-borne pathogens associated with the body surfaces and guts of individual wild flies. One hundred flies were collected from the dumpsters of 10 randomly selected urban restaurants. Flies were identified using taxonomic keys before being individually dissected. Cronobacter spp., Salmonella spp., and Listeria monocytogenes were detected using the PCR-based BAX system Q7. Positive samples were confirmed by culture on specific media and through PCR amplification and sequencing or ribotyping. Among collected flies were the housefly, Musca domestica (47%), the blowflies, Lucilia cuprina (33%) and Lucilia sericata (14%), and others (6%). Cronobacter species were detected in 14% of flies, including C. sakazakii, C. turicensis, and C. universalis, leading to the proposal of flies as a natural reservoir of this food-borne pathogen. Six percent of flies carried Salmonella enterica, including the serovars Poona, Hadar, Schwarzengrund, Senftenberg, and Brackenridge. L. monocytogenes was detected in 3% of flies. Overall, the prevalence of food-borne pathogens was three times greater in the guts than on the body surfaces of the flies. The relative risk of flies carrying any of the three pathogens was associated with the type of pathogen, the body part of the fly, and the ambient temperature. These data enhance the ability to predict the microbiological risk associated with the presence of individual flies in food and food facilities.
Weller, Daniel; Wiedmann, Martin; Strawn, Laura K
2015-06-01
Environmental (i.e., meteorological and landscape) factors and management practices can affect the prevalence of foodborne pathogens in produce production environments. This study was conducted to determine the prevalence of Listeria monocytogenes, Listeria species (including L. monocytogenes), Salmonella, and Shiga toxin-producing Escherichia coli (STEC) in produce production environments and to identify environmental factors and management practices associated with their isolation. Ten produce farms in New York State were sampled during a 6-week period in 2010, and 124 georeferenced samples (80 terrestrial, 33 water, and 11 fecal) were collected. L. monocytogenes, Listeria spp., Salmonella, and STEC were detected in 16, 44, 4, and 5% of terrestrial samples, 30, 58, 12, and 3% of water samples, and 45, 45, 27, and 9% of fecal samples, respectively. Environmental factors and management practices were evaluated for their association with terrestrial samples positive for L. monocytogenes or other Listeria species by univariate logistic regression; analysis was not conducted for Salmonella or STEC because the number of samples positive for these pathogens was low. Although univariate analysis identified associations between isolation of L. monocytogenes or Listeria spp. from terrestrial samples and various water-related factors (e.g., proximity to wetlands and precipitation), multivariate analysis revealed that only irrigation within 3 days of sample collection was significantly associated with isolation of L. monocytogenes (odds ratio = 39) and Listeria spp. (odds ratio = 5) from terrestrial samples. These findings suggest that intervention at the irrigation level may reduce the risk of produce contamination.
Little, C L; Taylor, F C; Sagoo, S K; Gillespie, I A; Grant, K; McLauchlin, J
2007-01-01
As part of the European Commission (EC) co-ordinated programme for 2005, a study of pre-packaged ready-to-eat (RTE) mixed salads containing meat or seafood ingredients from retail premises was undertaken in the UK to determine the frequency and level of Listeria monocytogenes in these products. Almost all (99.8%; 2682/2686) samples were of satisfactory/acceptable microbiological quality. Two (0.1%) samples exceeded EC legal food safety criteria due to the presence of L. monocytogenes in excess of 100 cfu g(-1) (1.7 x 10(2), 9.9 x 10(2)cfu g(-1)) while another two (0.1%) were unsatisfactory due to L. welshimeri levels over 100 cfu g(-1) (1.2 x 10(3), 6.0 x 10(3) cfu g(-1)). Overall contamination of Listeria spp. and L. monocytogenes found in samples of mixed salads in the UK was 10.8% and 4.8%, respectively. Almost twice as many salad samples with meat ingredients were contaminated with Listeria spp. and L. monocytogenes (14.7% and 6.0%, respectively) compared to samples with seafood ingredients (7.4% and 3.8%, respectively). Pre-packaged mixed salads were contaminated with Listeria spp. and L. monocytogenes more frequently when: collected from sandwich shops; not packaged on the premises; stored or displayed above 8 degrees C. This study demonstrates that the control of L. monocytogenes in food manufacturing and at retail sale is essential in order to minimize the potential for this bacterium to be present in mixed salads at the point of consumption at levels hazardous to health.
Weller, Daniel; Andrus, Alexis; Wiedmann, Martin; den Bakker, Henk C
2015-01-01
Sampling of seafood and dairy processing facilities in the north-eastern USA produced 18 isolates of Listeria spp. that could not be identified at the species-level using traditional phenotypic and genotypic identification methods. Results of phenotypic and genotypic analyses suggested that the isolates represent two novel species with an average nucleotide blast identity of less than 92% with previously described species of the genus Listeria. Phylogenetic analyses based on whole genome sequences, 16S rRNA gene and sigB gene sequences confirmed that the isolates represented by type strain FSL M6-0635(T) and FSL A5-0209 cluster phylogenetically with Listeria cornellensis. Phylogenetic analyses also showed that the isolates represented by type strain FSL A5-0281(T) cluster phylogenetically with Listeria riparia. The name Listeria booriae sp. nov. is proposed for the species represented by type strain FSL A5-0281(T) ( =DSM 28860(T) =LMG 28311(T)), and the name Listeria newyorkensis sp. nov. is proposed for the species represented by type strain FSL M6-0635(T) ( =DSM 28861(T) =LMG 28310(T)). Phenotypic and genotypic analyses suggest that neither species is pathogenic. © 2015 IUMS.
Directory of Open Access Journals (Sweden)
Atefeh Taherkhani
2013-01-01
Full Text Available Aims: The objective of this study was to evaluate the prevalence of Listeria spp. in the river water before and after discharge of the effluent of the municipal wastewater treatment plant (WWTP in Isfahan, Iran. Materials and Methods: A total of 66 samples were collected bi-weekly over 4 months from eleven discrete sampling locations in Zayandehrood River, Iran. Three sampling sites were located above the discharge point and five sites were located after the discharge point of WWTP. Samples were also collected from the influent and the effluent of WWTP. Listeria spp. were isolated using a selective enrichment procedure and a subculture onto polymyxin-acriflavine-lithium chloride-ceftazidime-esculin-mannitol Agar. All isolates were subjected to standard biochemical tests. Results: L. monocytogenes was isolated from influent (83%, effluent (50% and (18.5% river water. Listeria spp. was not found before the discharge point in river water. However, L. monocytogenes was isolated in samples collected from 200 m (33%, 500 m (33%, 2 km (16.5%, 5 km (16.5% and 10 km (16.5% downstream from the WWTP. Listeria innocua (9% and Listeria seeligeri (10% were the second most frequently isolated species. Conclusion: During the wastewater treatment, Listeria spp. is not removed completely. L. monocytogenes is widely distributed in the Zayandehrood river. L. monocytogenes released into surface water demonstrates a potential risk for public health. These results indicate the need for appropriate water management in order to reduce human and animal exposure to such pathogens.
DEFF Research Database (Denmark)
Møller, Cleide Oliveira de Almeida; Hansen, Tina Beck; Aabo, Søren
2015-01-01
Introduction: The cross contamination model (Møller et al. 2012) was evaluated to investigate its capability of describing transfer of Salmonella spp. and Listeria monocytogenes during grinding of pork and beef of varying sizes (50 – 324 g) and numbers of pieces to be ground (10 – 100), in two...... processing. QMRA risk estimates and TTP both revealed that risk attribution from grinding was mainly influenced by sharpness of grinder knife > specific grinder > grinding temperature whereas the specific pathogen was of minor importance....
Risk analysis of Listeria spp. contamination in two types of ready-to-eat chicken meat products.
Keeratipibul, Suwimon; Lekroengsin, Sumalin
2009-01-01
This study was conducted to determine the risk of Listeria contamination in frozen ready-to-eat roasted and steamed chicken meat in a chicken plant in Thailand. Environmental surfaces were divided into three zones. Zone 1 included surfaces in direct contact with products. Zones 2 and 3 included indirect contact surfaces; zone 2 was next to zone 1, and zone 3 was located next to zone 2 and relatively far from the product. A mathematical model for the probability of product contamination after contact with contaminated zone 1 surfaces was established. This model was augmented by an already established model for the probability of Listeria contamination on zone 1 surfaces. Sensitivity analysis revealed that the prevalence of Listeria on zone 1 surfaces before cleaning and sanitizing, production time, and concentration and contact time of sanitizer were correlated with contamination of both products. Alternative risk management measures for reducing the risk of Listeria contamination were developed using sanitizer concentrations of 0.25 to 1.25% (vol/vol), sanitizer contact times of 5 to 20 min, and production times of 5 to 20 h. The plant's risk manager chose a 0.25% (vol/vol) sanitizer concentration, a contact time of 20 min, and a production time of 20 h. After implementation of the selected risk management option, the prevalence of Listeria on roasted and steamed products was reduced by 2.19 and 2.01%, respectively. The prevalence of Listeria in zones 1, 2, and 3 was also reduced by 3.13, 11.24, and 25.66%, respectively.
Listeria monocytogenes - Danger for health safety vegetable production.
Kljujev, Igor; Raicevic, Vera; Jovicic-Petrovic, Jelena; Vujovic, Bojana; Mirkovic, Milica; Rothballer, Michael
2018-04-22
The microbiologically contaminated vegetables represent a risk for consumers, especially vegetables without thermal processing. It is known that human pathogen bacteria, such as Listeria monocytogenes, could exist on fresh vegetables. The fresh vegetables could become Listeria-contaminated if they come in touch with contaminated soil, manure, irrigation water. The aim of this work was to investigate the presence of Listeria spp. and L. monocytogenes in different kind of vegetables grown in field and greenhouse condition as well as surface and endophytic colonization plant roots of different vegetables species by L. monocytogenes in laboratory conditions. The detection of Listeria spp. and L. monocytogenes in vegetable samples was done using ISO and PCR methods. The investigation of colonization vegetable roots and detection Listeria-cells inside plant root tissue was done using Fluorescence in situ hybridization (FISH) method in combination with confocal laser scanning microscopy (CLSM). The results showed that 25.58% vegetable samples were positive for Listeria spp. and only one sample (carrot) was positive for L. monocytogenes out of 43 samples in total collected from field and greenhouse. The strain L. monocytogenes EGD-E surface and endophytic colonized carrot root in highest degree while strain L. monocytogenes SV4B was the most represented at leafy vegetable plants, such at lettuce (1.68 × 10 6 cells/mm 3 absolutely dry root) and spinach (1.39 × 10 6 cells/mm 3 absolutely dry root) root surface. The cells of L. monocytogenes SV4B were visible as single cells in interior tissue of plant roots (celery and sweet corn roots) as well as in the interior of the plant root cell at sweet corn root. The cells of L. monocytogenes EGD-E bind to the surface of the plant root and they were less commonly found out on root hair. In the inner layers of the root, those bacterial cells were inhabited intercellular spaces mainly as single cells very close to the
Directory of Open Access Journals (Sweden)
Farid Khalili Borujeni
2013-06-01
Full Text Available Background and objectives: Listeria monocytogenes and Listeria ivanovii are two pathogenic species of Listeria. The role of Listeria ivanovii is important in abortion, stillbirth, septicemia in animals and this bacterium sometimes is pathogenic in humans. Contamination of ovine carcasses during the slaughter and processing can cause foodborne infections in humans. In this study we examined the contamination of sheep meat in slaughter house of Shahrekord city to Listeria ivanovii and determined its antibiotic resistance pattern.Material and Methods: A total 200 samples of sheep meat were collected from abattoir and processed by use of two enrichment method. After doing specific biochemical tests and PCR, Listeria spp was identified and antibiotic resistance of isolated Listeria were tested by the agar disc diffusion method. Results: The contamination of sheep carcasses with listeria was 2.5% (5 out of 200 samples. All five isolates (2.5% were recognized as Listeria ivanovii and were resistant to four antibiotics, sensitive to six antibiotics and intermediate to other antibiotics. Conclusion: According to the contamination rate in sheep carcasses with Listeria ivanovii and the relatively high antibiotic resistance specified in this bacteria, the role of red meat in transmission of Listeria spp. and appropriate use of antibiotics against this bacteria should be considered.
International Nuclear Information System (INIS)
Hmaied, Fatma; Helel, Salma; Barkallah, Insaf; Leberre, V.; Francois, J.M.; Kechrid, A.
2008-01-01
Microarray-based assay is a new molecular approach for genetic screening and identification of microorganisms. We have developed a rapid microarray-based assay for the reliable detection and discrimination of Listeria spp. in food and clinical isolates from Tunisia. The method used in the present study is based on the PCR amplification of a virulence factor gene (iap gene). the PCR mixture contained cyanine Cy5labeled dCTP. Therefore, The PCR products were fluorescently labeled. The presence of multiple species-specific sequences within the iap gene enabled us to design different oligoprobes per species. The species-specific sequences of the iap gene used in this study were obtained from genBank and then aligned for phylogenetic analysis in order to identify and retrieve the sequences of homologues of the amplified iap gene analysed. 20 probes were used for detection and identification of 22 food isolates and clinical isolates of Listeria spp (L. monocytogenes, L. ivanovi), L. welshimeri, L. seeligeri, and L. grayi). Each bacterial gene was identified by hybridization to oligoprobes specific for each Listeria species and immobilized on a glass surface. The microarray analysis showed that 5 clinical isolates and 2 food isolates were identified listeria monocytogenes. Concerning the remaining 15 food isolates; 13 were identified listeria innocua and 2 isolates could not be identified by microarray based assay. Further phylogenetic and molecular analysis are required to design more species-specific probes for the identification of Listeria spp. Microarray-based assay is a simple and rapid method used for Listeria species discrimination
Evaluation of the MIT RMID 1000 system for the identification of Listeria species.
Ricardi, John; Haavig, David; Cruz, Lasaunta; Paoli, George; Gehring, Andrew
2010-01-01
The Micro Imaging Technology (MIT) 1000 Rapid Microbial Identification (RMID) System is a device that uses the principles of light scattering coupled with proprietary algorithms to identify bacteria after being cultured and placed in a vial of filtered water. This specific method is for pure culture identification of Listeria spp. A total of 81 microorganisms (55 isolates) were tested by the MIT 1000 System, of which 25 were Listeria spp. and 30 a variety of other bacterial species. In addition, a total of 406 tests over seven different ruggedness parameters were tested by the MIT 1000 System to determine its flexibility to the specifications stated in the MIT 1000 System User Guide in areas where they might be deviated by a user to shorten the test cycle. Overall, MIT concluded that the MIT 1000 System had an accuracy performance that should certify this Performance Test Method for the identification of Listeria spp. This report discusses the tests performed, results achieved, and conclusions, along with several reference documents to enable a higher understanding of the technology used by the MIT 1000 System.
Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe
2015-11-30
Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.
Directory of Open Access Journals (Sweden)
Wanda Moscalewski Abrahão
2008-06-01
Full Text Available The occurrence of Listeria monocytogenes in Brazilian ice cream and in some soft and semi-soft cheeses produced and sold in the State of Paraná, Brazil was evaluated. Ninety samples of cheese and sixty samples of ice creams were analyzed following the guidelines outlined by the official institutes, AOAC and FDA. In the ice cream samples no isolation of Listeria spp. was found. The percentage of these ninety samples of cheeses positive for Listeria spp. was 12.20%. Listeria monocytogenes was detected in six (6.70% of the same samples. The presence of Listeria innocua was five (5.50% in the samples analyzed was also observed. According to the results of the work it is possible to presume that there is a potential health risk to the brazilian population, heightened by aging and the increase in immunodepressed. These results indicate the need for the implementation of monitoring of these microorganisms as much by producers as by health inspectors. The results also show that the VIP (visual immunoprecipitation assay is a viable triage method of contaminated samples for the liberation of products for commercialization, as it is quick, reliable and does not require additional equipment other than that normally found in production labs, while presenting reliable results.A ocorrência de Listeria monocytogenes em sorvetes e alguns tipos de queijos macios e semi-macios produzidos e vendidos no Estado do Paraná Brasil foram avaliados. Noventa amostras de queijo e sessenta amostras de sorvete foram analisadas seguindo os protocolos da AOAC e FDA. Nas amostras de sorvete, não ocorreu o isolamento de Listeria spp. Foi detectada Listeria spp em 12,20% de amostras de queijo, das quais 6 (6,70% foram positivas para Listeria monocytogenes. Foi também observada a presença de Listeria innocua em 5 amostras (5,50% das mesmas amostras. Pelos resultados deste trabalho pode-se pressupor que existe um risco potencial à saúde da população brasileira com o
Escolar, Cristina; Gómez, Diego; Del Carmen Rota García, María; Conchello, Pilar; Herrera, Antonio
2017-06-01
The objective of this work was to investigate the antimicrobial resistance in Listeria spp. isolated from food of animal origin. A total of 50 Listeria strains isolated from meat and dairy products, consisting of 7 Listeria monocytogenes and 43 Listeria innocua strains, were characterized for antimicrobial susceptibility against nine antimicrobials. The strains were screened by real-time PCR for the presence of antimicrobial resistance genes: tet M, tet L, mef A, msr A, erm A, erm B, lnu A, and lnu B. Multidrug resistance was identified in 27 Listeria strains, 4 belonging to L. monocytogenes. Resistance to clindamycin was the most common resistance phenotype and was identified in 45 Listeria strains; the mechanisms of resistance are still unknown. A medium prevalence of resistance to tetracycline (15 and 9 resistant and intermediate strains) and ciprofloxacin (13 resistant strains) was also found. Tet M was detected in Listeria strains with reduced susceptibility to tetracycline, providing evidence that both L. innocua and L. monocytogenes displayed acquired resistance. The presence of antimicrobial resistance genes in L. innocua and L. monocytogenes indicates that these genes may be transferred to commensal and pathogenic bacteria via the food chain; besides this, antibiotic resistance in L. monocytogenes could compromise the effective treatment of listeriosis in humans.
Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein
2012-12-01
Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.
Prevalence of Listeria Species in Ice Creams Sold in The Cities of Kahramanmaraş and Adana
AKMAN, Deniz; DURAN, Nizami; DIĞRAK, Metin
2004-01-01
In this study, the prevalence of Listeria spp. was investigated in the ice cream samples collected from the downtown stores of Kahramanmaras (28 samples) and Adana (30 samples). A total of 58 ice cream samples were analysed by the Food and Drug Administration (FDA) two-stage enrichment techniques. Growth of Listeria spp. was determined in 14 (24.1%) of the samples collected from Kahramanmaras and 10 (17.2%) samples from Adana. The results of the biochemical tests revealed that the bacterial g...
Specific biological properties of Listeria innocua spp. isolated in Primorye Territory
Directory of Open Access Journals (Sweden)
E. A. Zaitseva
2017-01-01
Full Text Available Rationale: Most cases of listeriosis are caused by the pathogenic Listeria monocytogenes. Some cases of isolation of L. innocua with pathogenicity factors from foods have been published, as well as on the cases of the disease in humans caused by this species. Aim: To assess biological properties including potential pathogenicity of L. innocua, isolated from food and environmental objects. Materials and methods: We performed microbiological study of L. innocua cultures isolated from foods (n = 35 and environmental objects (n = 15 on the territory of Primorye Territory (Russian Federation, as well as assessment of their sensitivity to antibiotics. Results: The studied L. innocua cultures showed stable phenotypic features of their biological properties, such as morphology, typical colony growth on the medium with characteristic odor of fermented milk, blue or blue-green luminescence induced by inclined light, presence of catalase activity and absence of the oxidase activity. Only 38 ± 6.9% of L. innocua demonstrated movements at T 22 °С. L. innocua cultures did not ferment mannitol (100% of cultures; they degraded ramnose to its acid without gas (70 ± 6.5% and degraded xylose (42.8 ± 7%. Listeria isolated from vegetables and environmental objects could ferment ramnose (92.8 ± 7.2% of the studied cultures and xylose (28.5 ± 12.5% more frequently than L. innocua isolated from meat and fish foods. L. innocua demonstrated variable biochemical activities towards mannose (92 ± 3.8%, saccharose (85.7 ± 7.8% and melesitose (76.2 ± 9.5%. L. innocua cultures with hemolytic activity (34 ± 6.7% (α or β type were isolated, more commonly from fish products. All Listeria irrespective of their isolation source showed lipase activity. L. innocua cultures from foods and environmental objects were highly sensitive to antimicrobials from the following classes: penicillins (ampicillin, carbenicillin, combined amoxicillin and clavulanic
Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes
Directory of Open Access Journals (Sweden)
nahid Navijouy
2013-08-01
Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.
Barre, Léna; Angelidis, Apostolos S; Boussaid, Djouher; Brasseur, Emilie Decourseulles; Manso, Eléonore; Gnanou Besse, Nathalie
2016-12-05
During the past six years, new species of the genus Listeria have been isolated from foods and other environmental niches worldwide. The Standard method EN ISO 11290-1 that is currently under revision will include in its scope all Listeria species in addition to L. monocytogenes. The objective of this project was to evaluate the ability of the Standard EN ISO 11290-1 method to detect and identify the newly discovered Listeria spp., and to assess potential over-growth effects of the new species in mixed cultures with L. monocytogenes during each step of the enrichment process. This objective was addressed by the generation of necessary data on the behavior of the new species during the pre-enrichment and the enrichment steps of the reference method as well as data on their phenotypic characteristics on rich and selective media used for isolation and identification. Most of the new Listeria species developed well on selective agar media for Listeria, however the recovery of some species was difficult due to poor growth in Half Fraser and Fraser broth. Good results (consistently positive) were obtained for confirmation at the genus level via the catalase test, the Gram test and the blueish appearance test on non-selective medium, but not with the VP test, as most of the new species yielded a negative result. In the light of results obtained in co-culture experiments and inhibition tests, and considering the growth rates in Half Fraser and Fraser broths, the new species do not seem to interfere with the detection of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua
DEFF Research Database (Denmark)
Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit
2000-01-01
A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....
Prevalence of listeria, Aeromonas, and Vibrio species in fish used for human consumption in Turkey.
Yücel, Nihal; Balci, Senay
2010-02-01
A total of 78 raw retail fish samples from 30 freshwater and 48 marine fish were examined for the presence of Listeria, Aeromonas, and Vibrio species. The overall incidence of Listeria spp. was 30% in freshwater samples and 10.4% in marine fish samples. Listeria monocytogenes (44.5%) was the most commonly isolated species in freshwater fish, and Listeria murrayi (83.5%) was the most commonly isolated species in marine fish samples. Motile aeromonads were more common in marine fish samples (93.7%) than in freshwater fish samples (10%). Vibrio alginolyticus, Vibrio fluvialis, and Vibrio damsela were isolated only in marine fish samples, representing 40.9, 38.6, and 36.3% of Vibrio isolates, respectively. In freshwater and marine fish, the highest incidences of Listeria and Aeromonas were found in skin samples; the highest incidence of Vibrio in marine fish was found in gill samples. The location of Listeria spp. and L. monocytogenes in a fish was significantly different among freshwater fish. A high incidence of these bacterial pathogens was found in the brown trout (Salmo trutta) and horse mackerel (Trachurus trachurus). Handling of contaminated fish, cross-contamination, or eating raw fish might pose a health hazard, especially in immunosuppressed individuals, elderly people, and children. This study highlights the importance of bacterial pathogens in fish intended for human consumption, but more study is needed.
Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P
2011-06-01
This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.
Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin
2011-06-01
The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.
Directory of Open Access Journals (Sweden)
CATÃO Raïssa Mayer Ramalho
2001-01-01
Full Text Available Investigou-se a qualidade microbiológica do leite in natura e na linha de produção (leite recém-pasteurizado e leite ensacado, de uma usina de beneficiamento em Campina Grande-PB. Foi pesquisada a presença de Listeria spp. e sua diversidade de espécies, os níveis de coliformes totais (CT, coliformes fecais (CF e Escherichia coli. Analisou-se um total de 75 amostras de leite, sendo 45 de leite cru, 15 de leite recém-pasteurizado e 15 de leite ensacado. Os resultados foram reunidos em dois grupos segundo o período de monitoramento: antes e após mudanças no processo de higienização da usina. Foi evidenciada elevada contaminação nas amostras de leite cru nas duas épocas. Na primeira (março-abril/1998, todas as amostras de leite beneficiado estiveram fora dos padrões da legislação vigente para CT e CF; na segunda (maio-agosto/1998, houve acentuada redução dos níveis destas bactérias indicadoras, porém as melhorias na higienização não foram suficientes para solucionar este problema, visto que 11,1% das amostras recém-pasteurizadas estavam fora dos padrões para CT e 33,3% para CF. Das amostras ensacadas, 22,2% estavam fora dos padrões para CT e 44,4% para CF. Comparando-se os resultados de CT, CF, e E.coli nas amostras de leite recém-pasteurizado e não ensacado com as amostras de leite ensacado, foi verificado que as amostras após serem pasteurizadas e ensacadas apresentaram valores de CT e CF levemente mais elevados, sugerindo contaminação durante o processo de ensacamento ou falhas na armazenagem. Observou-se que 33 (73,3% das amostras de leite cru e 9 (30% das de leite pasteurizado estavam contaminadas com Listeria spp., sendo identificadas L. monocytogenes em 17 (51,5% amostras de leite cru e em 9 (100% de leite beneficiado (4 recém-pasteurizadas e 5 ensacadas. Em relação à diversidade de espécies, nas amostras de leite cru foram encontradas: L. monocytogenes (66,6%, L. innocua (25,3%, L. ivanovii (3,9%, L
Directory of Open Access Journals (Sweden)
Realpe-Delgado, María Elena
2016-10-01
Full Text Available Salmonella spp., Campylobacter spp., and L. monocytogenes are zoonotic foodborne pathogens, associated with the consumption of contaminated foods of animal origin. In this study we determined the prevalence and risk factors associated with the presence of these microorganisms at all stages of the production system, in two Colombian poultry companies (EI-EI-I and II. In EI-I, Campylobacter spp., and Salmonella spp., were isolated from 10 % and 4.4 % of the specimens, and S. Heidelberg was the predominant serotype. Salmonella spp., was found in 6 % of hands and stool samples of workers. S. Saphra was the most prevalent serotype. In EI-II, the prevalence of Campylobacter spp., and Salmonella spp., from animal specimens was 7 % and 17 %, respectively. L. monocytogenes was not detected. This study established the prevalence of these zoonotic pathogens through the production chain and showed the presence of pathogen carriers among workers/food handlers. “Lack of medical examination of employees in the previous year” was found to be a possible risk factor for carriage of Salmonella spp.
Osman, Kamelia M; Samir, Ahmed; Orabi, Ahmed; Zolnikov, Tara Rava
2014-02-01
She-camel milk is an alternative solution for people allergic to milk; unfortunately, potential harmful bacteria have not been tested in she-camel milk. Listeria monocytogenes is one harmful bacterium that causes adverse health effects if chronically or acutely ingested by humans. The purpose of this study was to estimate the prevalence, characterize the phenotypic, genetic characterization, virulence factors, and antibiopotential harmful bacteria resistance profile of Listeria isolated from the milk of she-camel. Udder milk samples were collected from 100 she-camels and screened for mastitis using the California mastitis test (46 healthy female camels, 24 subclinical mastitic animals and 30 clinical mastitic animals). Samples were then examined for the presence of pathogenic Listeria spp; if located, the isolation of Listeria was completed using the International Organization for Standards technique to test for pathogenicity. The isolates were subjected to PCR assay for virulence-associated genes. Listeria spp. were isolated from 4% of samples and only 1.0% was confirmed as L. monocytogenes. The results of this study provide evidence for the low prevalence of intramammary Listeria infection; additionally, this study concludes she-camel milk in healthy camels milked and harvested in proper hygienic conditions may be used as alternative milk for human consumption. Copyright © 2013 Elsevier B.V. All rights reserved.
The use of Fourier Transform-Infrared Spectroscopy (FT-IR) in conjunction with Artificial Neural Network software, NeuroDeveloper™ was examined for the rapid identification and classification of Listeria species and serotyping of Listeria monocytogenes. A spectral library was created for 245 strains...
Caggiano, Giuseppina; De Giglio, Osvalda; Lovero, Grazia; Rutigliano, Serafina; Diella, Giusy; Balbino, Stella; Napoli, Christian; Montagna, Maria Teresa
2015-01-01
Listeria monocytogenes is currently considered a relevant emerging food-borne pathogen. In particular, the European Centre for Disease Prevention and Control (ECDC) illustrates its widespread presence in different foods. In the present article, L. monocytogenes prevalence was estimated in cooked ready-to-eat foods sampled from a catering service in a Apulia city, southern Italy. The study was carried out from January to June 2014 in according to Regulation (EC) No. 852/2004, and ISO 11290-1:1996/Amd.1:2004 methods. Listeria spp. was isolated in 8.3% of the samples: L. monocytogenes was identified with the highest prevalence in potato gateau (66.6%), followed by rice dishes (11.1%), Listeria innocua was isolated from potato purea (11.1%) and cooked vegetables (11.1%). These preliminary results confirm the diffusion of the microorganism in ready-to-eat products; therefore, strategies aimed at protecting the consumers should be adopted. First of all, correct hygiene procedures should be followed and then microbiological tests should be implemented in order to early detect Listeria spp. (not only LM) contamination in cooked foods.
Isolation of Cronobacter spp. (Enterobacter sakazakii from artisanal mozzarella
Directory of Open Access Journals (Sweden)
Francesco Casalinuovo
2014-02-01
Full Text Available Cronobacter spp. (Enterobacter sakazakii is an opportunistic bacterial pathogen capable of causing disease and even fatalities in newborn infants within the first weeks of life if consumed as part of the diet. Premature and immunocompromised newborn infants are at particular risk. The microorganism has been isolated from a variety of foods including contaminated infant milk formula powder and milk powder substitute. The study aimed to evaluate the level of microbiological contamination in 47 samples of mozzarella cheese made with cow’s milk collected from artisan cheese producers in Southern Italy. Samples were collected from commercial sales points and underwent qualitative and quantitative microbiological analyses to test for the bacterial contaminants most commonly found in milk and cheese products. The 47 samples underwent qualitative and quantitative microbiological tests according to ISO UNI EN standards. Analyses focused on Staphylococcus aures, Salmonella spp., Listeria monocytogenes, Pseudomonas spp., E. coli, Yersinia spp., total coliforms and Cronobacter sakazakii. The ISO/TS 22964:2006 method was used to investigate possible contamination by C. sakazakii. Biochemical identification was carried out using an automated system for identification and susceptibility tests. None of the samples examined resulted positive for Salmonella spp. or Listeria spp. Only one sample resulted positive for Staphylococcus aureus. Pseudomonas spp. was isolated in 10 (21% of 47 samples. High levels of total coliforms were found in 10 of 47 samples. Cronobacter spp. (Enterobacter sakazakii was isolated in one sample. This is the first study to confirm isolation of C. sakazakii in artisan mozzarella cheese made from cow’s milk. The presence of C. sakazakii could be related to external contamination during the phases of production or to the use of contaminated milk. Since mozzarella is recommended in the diet of children and adults of all ages, this
Directory of Open Access Journals (Sweden)
Luís Augusto Nero
2004-09-01
Full Text Available Fluctuations in the Brazilian milk market force small milk producers to find temporary trade alternatives, which include selling raw milk to people who prefer this type of milk rather than heat-processed milk. Considering the importance of these small milk producers to the market and the well-known health risks associated to consumption of raw milk, this study evaluated the microbiological quality and the presence of Listeria monocytogenes, Salmonella spp., chlorine, antimicrobials and insecticides (organophosphates and carbamates in raw milk produced in 210 small and medium farms located in four important milk-producing Brazilian states (Paraná, São Paulo, Minas Gerais and Rio Grande do Sul. In 66% of the selected farms the milking was manual. In 33% of them, the milking was semi-automatic, and only 1% were equipped with fully automatic milking systems. All raw milk samples were negative for L. monocytogenes, Salmonella spp and chlorine. Mesophilic aerobes counts were higher than 10(5 CFU/ml in 75.7% of the samples. In 80.4%, coliforms were over 10² CFU/ml. Escherichia coli was detected in 36.8% of the samples. Insecticides and antimicrobial residues were observed in 74.4% and 11.5% of the samples, respectively. The presence of unacceptable levels of hygiene indicators, insecticides and antimicrobial residues were considered more important risk factors than the two pathogens.A instabilidade do mercado de leite no Brasil força pequenos produtores de leite a procurar alternativas de comércio de sua produção, o que inclui a venda de leite cru para indivíduos que dão preferência a esse tipo de leite. Considerando a importância desse mercado e os conhecidos riscos à saúde que o consumo de leite cru pode representar, este estudo avaliou a qualidade microbiológica e a presença de Listeria monocytogenes, Salmonella spp., resíduos de cloretos, antimicrobianos e inseticidas (organofosforados e carbamatos em leite cru produzido em 210
Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA
Directory of Open Access Journals (Sweden)
Yolanda Albarracín C
2008-08-01
Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.
Baquero Acu?a, Deissy Milena; Bernal Gonz?lez, Astrid Marcela; Campuzano, Silvia
2006-01-01
Las intoxicaciones alimentar?as son un problema de salud p?blica, ya que estas se presentan en cualquier tipo de poblaci?n aumentando la prevalencia en personas inmunosuprimidas, mujeres embarazadas y personas de edad avanzada. Seg?n los datos obtenidos, el 80% de las muestras positivas para Listeria spp presentaron Listeria monocytogenes y el 20% Listeria innocua, indicando una prevalencia de la especie pat?gena para los humanos, aumentando el riesgo en la poblaci?n de padecer enfermedades g...
Zarei, Mehdi; Maktabi, Siavash; Ghorbanpour, Masoud
2012-02-01
Although several etiological agents can be transmitted through seafood consumption, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella spp. are considered among the most important pathogens in terms of public health and disease. In this study, multiplex polymerase chain reaction (PCR), as a rapid and cost-effective method, was used to determine the prevalence of these pathogens in 245 samples of raw/fresh, frozen, and ready-to-eat (RTE) seafood products marketed in Iran. The prevalence of L. monocytogenes in raw/fresh fish and shrimp samples was 1.4%, whereas 2.9% of the raw/fresh fish and 7.1% of the shrimp samples were contaminated with V. parahaemolyticus. No contamination with L. monocytogenes and V. parahaemolyticus was found in frozen and RTE seafood products. The prevalence of S. aureus was found to be higher than other investigated pathogens. S. aureus was detected in 5% of the raw/fresh samples of fish and shrimp, 17.5% of the frozen, and 12.3% of the RTE samples. Further, our findings indicate that 2.9% of the fish samples, 4.3% of the shrimp samples, and 1.5% of the RTE samples were contaminated with Salmonella spp. Owing to the potential hazard of these pathogenic bacteria, multiplex PCR can provide a rapid and cost-effective method for the surveillance of these pathogens in seafood products.
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R
2017-01-01
Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study.
Bacteriophage amplification assay for detection of Listeria spp. using virucidal laser treatment
Directory of Open Access Journals (Sweden)
I.C. Oliveira
2012-09-01
Full Text Available A protocol for the bacteriophage amplification technique was developed for quantitative detection of viable Listeria monocytogenes cells using the A511 listeriophage with plaque formation as the end-point assay. Laser and toluidine blue O (TBO were employed as selective virucidal treatment for destruction of exogenous bacteriophage. Laser and TBO can bring a total reduction in titer phage (ca. 10(8 pfu/mL without affecting the viability of L. monocytogenes cells. Artificially inoculated skimmed milk revealed mean populations of the bacteria as low as between 13 cfu/mL (1.11 log cfu/mL, after a 10-h assay duration. Virucidal laser treatment demonstrated better protection of Listeria cells than the other agents previously tested. The protocol was faster and easier to perform than standard procedures. This protocol constitutes an alternative for rapid, sensitive and quantitative detection of L. monocytogenes.
Directory of Open Access Journals (Sweden)
Dean Jankuloski
2007-11-01
Full Text Available Listeria monocytogenes contamination of the environment and surfaces of the equipment was examined in seven meat processing facilities. Up to date prevalence of this foodborn pathogen in meat processing facilities facilities in Republic of Macedonia was unknown. Biofilms are composed from food spoilage microorganisms and food born pathogens. They are located on the surfaces of the equipment that come in contact with food and in facilities environment. Microorganisms in biofilm presenting micro eco system and are source of dissemination and contamination of food born pathogens in final meat products. During the preparation of this study we have covered a 7 meat processing facilities and we took a total of 39 swabs from surfaces that come in direct or indirect contact with food. Listeria monocytogenes was discovered in 10 (25,64% swabs (locations. Prevalence of other Listeria spp. compared with total number of taken samples was 15 (38,46% Listeria innocua, 3 (7,69% Listeria welshimeri and 1 (2,65% isolate Listeria seeligeri.
Mukhopadhyay, Sudarsan; Sokorai, Kimberly; Ukuku, Dike; Fan, Xuetong; Juneja, Vijay; Sites, Joseph; Cassidy, Jennifer
2016-10-17
The objective of this research was to evaluate and develop a method for inactivation of Salmonella enterica and Listeria monocytogenes in cantaloupe puree (CP) by high hydrostatic pressure (HHP). Cantaloupe being the most netted varieties of melons presents a greater risk of pathogen transmission. Freshly prepared CP with or without 0.1% ascorbic acid (AA) was inoculated with a bacterial cocktail composed of a three serotype mixture of S. enterica (S. Poona, S. Newport H1275 and S. Stanley H0558) and a mixture of three strains of L. monocytogenes (Scott A, 43256 and 51742) to a population of ca. 10(8)CFU/g. Double sealed and double bagged inoculated CP (ca. 5g) were pressure treated at 300, 400 and 500MPa at 8°C and 15°C for 5min. Data indicated increased inactivation of both Salmonella and Listeria spp. with higher pressure. Log reduction for CP at 300MPa, 8°C for 5min was 2.4±0.2 and 1.6±0.5logCFU/g for Salmonella and Listeria, respectively. Survivability of the pathogens was significantly compromised at 400MPa and 8°C, inactivating 4.5±0.3logCFU/g of Salmonella and 3.0±0.4logCFU/g of Listeria spp. Complete inactivation of the pathogens in the puree (log reduction >6.7logCFU/g), with or without AA, was achieved when the pressure was further increased to 500MPa, except that for Listeria containing no AA at 8°C. Listeria presented higher resistance to pressure treatment compared to Salmonella spp. Initial temperatures (8 and 15°C) had no significant influence on Salmonella log reductions. Log reduction of pathogens increased but not significantly with increase of temperature. AA did not show any significant antimicrobial activity. Viable counts were about 0.2-0.4logCFU/g less in presence of 0.1% AA. These data validate that HHP can be used as an effective method for decontamination of cantaloupe puree. Published by Elsevier B.V.
Verdin, Sylvia Elisa Frizzo; Silva, Silvia Regina Pavan da; Pereira, Dariane Castro; Schatkoski, Aline Modelski; Corção, Gertrudes
2007-01-01
Minimally processed vegetables go through many steps before they are refrigerated, selection, washing, peeling, cutting, disinfection and finally packaging. However, if no care is taken at the origin of the raw materials and in the processing stages, there is a chance of finding pathogenic bacteria, such as Listeria monocytogenes, which are able to grow at low temperatures. The aim of this research was to verify the occurrence of Listeria sp. in minimally processed vegetables sold in Porto Al...
Locatelli, Aude; Lewis, Micah A.; Rothrock, Michael J.
2017-01-01
The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (102 or 105 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes. However, cocultures in UVM for high inoculum concentration did not show preferential growth of L. innocua
Locatelli, Aude; Lewis, Micah A; Rothrock, Michael J
2017-01-01
The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes , in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (10 2 or 10 5 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes . However, cocultures in UVM for high inoculum concentration did not show preferential growth of L
A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.
Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan
2016-04-01
A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.
Carrier status for Listeria monocytogenes and other Listeria species ...
African Journals Online (AJOL)
Background: Listeria organisms are documented to be zoonotic; one of the sources of infection is the domestic fowl where it could occur as in apparent infection. The carriage of Listeria monocytogenes and other Listeria in indigenous birds has not been documented in Kenya. Objective: To establish whether healthy looking ...
Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung
2010-08-01
Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.
[Survey of the presence of Listeria monocytogenes in meat products sold in retail].
Langiano, E; Lanni, L; Atrei, P; De Vito, E
2007-01-01
The present study evaluates the presence of Listeria spp and particularly of L. monocytogenes in bovine, pork and poultry meats sold by retail in supermarkets and butchers in the city of Cassino. The sensibility to the antibiotics mostly used in the veterinary practice has been tested on the isolated strains. The different species of Listeria have shown a considerable variation of isolation based on the meat's typology and on the different store's provenance. Moreover our results show greater degree of contamination than the data currently available the Italian literature. In our study poultry meat is the most contaminated one. We can assert that omissions and poor caring errors in the manipulation and conservation of meat expose the customer to an even higher risk of infection.
Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike
2015-04-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.
Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike
2016-01-01
The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325
... Events Advocacy For Patients About ACOG Listeria and Pregnancy Home For Patients Search FAQs Listeria and Pregnancy ... Pregnancy PFS013, January 2017 PDF Format Listeria and Pregnancy Fact Sheets Food Poisoning in Pregnant Women The ...
Listeria species in retail smoked fish at Jos, Nigeria | Chukwu ...
African Journals Online (AJOL)
The prevalence of Listeria species in 65 samples of smoked fish at the retail markets in Jos, Nigeria, is reported. The experimental samples which included 30 catfish (Clarias species) and 35 Tilapia were screened for Listeria monocytogenes and other Listeria species using a two-step enrichment method. Total Listeria ...
Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier
2014-09-01
A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.
Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.
Directory of Open Access Journals (Sweden)
Mira Rakic Martinez
Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in
Forney, Charles F; Fan, Lihua; Bezanson, Gregory S; Ells, Timothy C; LeBlanc, Denyse I; Fillmore, Sherry
2018-04-01
spp. and therefore cannot be used as a definitive indicator of Listeria contamination. © 2018 Institute of Food Technologists®.
Martin, Belen; Garriga, Margarita; Aymerich, Teresa
2011-05-01
The manufacturing of fermented sausages is subject to natural contamination processes that can potentially carry foodborne pathogens along the process chain and result in contamination of the final product. The aim of this study was to evaluate the occurrence of Salmonella spp. and Listeria monocytogenes at different sampling points during the manufacturing process of fuet, a type of traditional fermented sausage, at 10 small-scale Spanish factories. The presence of both pathogens was studied in the raw materials (19 casings and 19 meat batters), the final products (19 fermented sausages), and the factory equipment (12 mincing, 12 mixing, and 19 stuffing machines, 19 cutting tables, 11 knives, and 12 cold rooms) by using classical microbiological techniques and real-time PCR. Salmonella was not detected in the equipment analyzed or in the final products, but it was detected in the raw materials (23.7% of samples). L. monocytogenes showed higher incidence than Salmonella and was detected in the equipment (11.8% of samples), the raw materials (28.9%), and the final products (15.8%), confirming its ubiquity throughout the manufacturing process of fermented sausages. Five factories were further investigated to study the changes in the distribution of pathogens in the fuet production process over a period of either 2 or 3 years. There was considerable variation in the incidence of both pathogens at different sampling periods, and there was no relation between seasonal variations or geographic location of the factories.
Aerosol studies with Listeria innocua and Listeria monocytogenes.
Zhang, Guodong; Ma, Li; Oyarzabal, Omar A; Doyle, Michael P
2007-08-01
Aerosol studies of Listeria monocytogenes in food processing plants have been limited by lack of a suitable surrogate microorganism. The objective of this study was to investigate the potential of using green fluorescent protein-labeled strains of Listeria innocua as a surrogate for L. monocytogenes for aerosol studies. These studies were conducted in a laboratory bioaerosol chamber and a pilot food-processing facility. Four strains of L. innocua and five strains of L. monocytogenes were used. In the laboratory chamber study, Listeria cells were released into the environment at two different cell numbers and under two airflow conditions. Trypticase soy agar (TSA) plates and oven-roasted breasts of chicken and turkey were placed in the chamber to monitor Listeria cell numbers deposited from aerosols. A similar experimental design was used in the pilot plant study; however, only L. innocua was used. Results showed that L. monocytogenes and L. innocua survived equally well on chicken and turkey breast meats and TSA plates. No-fan and continuous fan applications, which affected airflow, had no significant effect on settling rates of aerosolized L. monocytogenes and L. innocua in the bioaerosol chamber or L. innocua in the pilot plant study. Listeriae cell numbers in the air decreased rapidly during the first 1.5 h following release, with few to no listeriae detected in the air at 3 h. Aerosol particles with diameters of 1 and 2 microM correlated directly with the number of Listeria cells in the aerosol but not with particles that were 0.3, 0.5, and 5 microM in diameter. Results indicate that L. innocua can be used as a surrogate for L. monocytogenes in an aerosol study.
Behaviour of Listeria monocytogenes in packaged fresh mushrooms (Agaricus bisporus).
González-Fandos, E; Olarte, C; Giménez, M; Sanz, S; Simón, A
2001-11-01
The aim of this study was to evaluate the potential of Listeria monocytogenes to grow in mushrooms packaged in two different types of PVC films when stored at 4 degrees C and 10 degrees C. Mushrooms were packed in two polymeric films (perforated and nonperforated PVC) and stored at 4 degrees C and 10 degrees C. The carbon dioxide and oxygen content inside the packages, aerobic mesophiles, psychrotrophs, Pseudomonas spp., Listeria monocytogenes, faecal coliforms, Escherichia coli, anaerobic spores and major sensory factors were determined. The mushrooms packaged in nonperforated film and stored at 4 degrees C had the most desirable quality parameters (texture, development stage and absence of moulds). Listeria monocytogenes was able to grow at 4 degrees C and 10 degrees C in inoculated mushrooms packaged in perforated and nonperforated films between 1 and 2 log units during the first 48 h. After 10 d of storage, the populations of L. monocytogenes were higher in mushrooms packaged in nonperforated film and stored at 10 degrees C. MAP followed by storage at 4 degrees C or 10 degrees C extends the shelf life by maintaining an acceptable appearance, but allows the growth and survival of L. monocytogenes. According to this study additional hurdles must be studied in order to prevent the growth of L. monocytogenes.
Directory of Open Access Journals (Sweden)
Aneta Nowakiewicz
Full Text Available The objective of the study was to examine a population of free-living carnivorous mammals most commonly found in Poland (red fox, beech marten, and raccoon for the occurrence of bacteria that are potentially pathogenic for humans and other animal species and to determine their virulence potential (the presence of selected virulence genes. From the total pool of isolates obtained (n = 328, we selected 90 belonging to species that pose the greatest potential threat to human health: Salmonella spp. (n = 19; 4.51%, Yersinia enterocolitica (n = 10; 2.37%, Listeria monocytogenes and L. ivanovii (n = 21, and Staphylococcus aureus (n = 40; 9.5%. The Salmonella spp. isolates represented three different subspecies; S. enterica subsp. enterica accounted for a significant proportion (15/19, and most of the serotypes isolated (S. Typhimurium, S. Infantis, S. Newport and S. Enteritidis were among the 10 non-typhoidal Salmonella serotypes that are most often responsible for infections in Europe, including Poland. Y. enterococlitica was detected in the smallest percentage of animals, but 60% of strains among the isolates tested possessed the ail gene, which is responsible for attachment and invasion. Potentially pathogenic Listeria species were isolated from approx. 5% of the animals. The presence of all tested virulence genes was shown in 35% of L. monocytogenes strains, while in the case of the other strains, the genes occurred in varying numbers and configurations. The presence of the inlA, inlC, hlyA, and iap genes was noted in all strains, whereas the genes encoding PI-PLC, actin, and internalin Imo2821 were present in varying percentages (from 80% to 55%. S. aureus was obtained from 40 individuals. Most isolates possessed the hla, hld (95% for each, and hlb (32.5% genes encoding hemolysins as well as the gene encoding leukotoxin lukED (70%. In a similar percentage of strains (77.5%, the presence of at least one gene encoding enterotoxin was found, with 12
Nowakiewicz, Aneta; Zięba, Przemysław; Ziółkowska, Grażyna; Gnat, Sebastian; Muszyńska, Marta; Tomczuk, Krzysztof; Majer Dziedzic, Barbara; Ulbrych, Łukasz; Trościańczyk, Aleksandra
2016-01-01
The objective of the study was to examine a population of free-living carnivorous mammals most commonly found in Poland (red fox, beech marten, and raccoon) for the occurrence of bacteria that are potentially pathogenic for humans and other animal species and to determine their virulence potential (the presence of selected virulence genes). From the total pool of isolates obtained (n = 328), we selected 90 belonging to species that pose the greatest potential threat to human health: Salmonella spp. (n = 19; 4.51%), Yersinia enterocolitica (n = 10; 2.37%), Listeria monocytogenes and L. ivanovii (n = 21), and Staphylococcus aureus (n = 40; 9.5%). The Salmonella spp. isolates represented three different subspecies; S. enterica subsp. enterica accounted for a significant proportion (15/19), and most of the serotypes isolated (S. Typhimurium, S. Infantis, S. Newport and S. Enteritidis) were among the 10 non-typhoidal Salmonella serotypes that are most often responsible for infections in Europe, including Poland. Y. enterococlitica was detected in the smallest percentage of animals, but 60% of strains among the isolates tested possessed the ail gene, which is responsible for attachment and invasion. Potentially pathogenic Listeria species were isolated from approx. 5% of the animals. The presence of all tested virulence genes was shown in 35% of L. monocytogenes strains, while in the case of the other strains, the genes occurred in varying numbers and configurations. The presence of the inlA, inlC, hlyA, and iap genes was noted in all strains, whereas the genes encoding PI-PLC, actin, and internalin Imo2821 were present in varying percentages (from 80% to 55%). S. aureus was obtained from 40 individuals. Most isolates possessed the hla, hld (95% for each), and hlb (32.5%) genes encoding hemolysins as well as the gene encoding leukotoxin lukED (70%). In a similar percentage of strains (77.5%), the presence of at least one gene encoding enterotoxin was found, with 12
Guévremont, Evelyne; Lamoureux, Lisyanne; Généreux, Mylène; Côté, Caroline
2017-07-01
Irrigation water has been identified as a possible source of vegetable contamination by foodborne pathogens. Risk management for pathogens such as Campylobacter spp. and Listeria monocytogenes in fields can be influenced by the source of the irrigation water and the time interval between last irrigation and harvest. Plots of romaine lettuce were irrigated with manure-contaminated water or aerated pond water 21, 7, or 3 days prior to harvesting, and water and muck soil samples were collected at each irrigation treatment. Lettuce samples were collected at the end of the trials. The samples were tested for the presence of Campylobacter spp. and L. monocytogenes. Campylobacter coli was isolated from 33% of hog manure samples (n = 9) and from 11% of the contaminated water samples (n = 27), but no lettuce samples were positive (n = 288). L. monocytogenes was not found in manure, and only one sample of manure-contaminated irrigation water (n = 27) and one lettuce sample (n = 288) were positive. No Campylobacter or L. monocytogenes was recovered from the soil samples (n = 288). Because of the low incidence of pathogens, it was not possible to link the contamination of either soil or lettuce with the type of irrigation water. Nevertheless, experimental field trials mimicking real conditions provide new insights into the survival of two significant foodborne pathogens on romaine lettuce.
Directory of Open Access Journals (Sweden)
Arianna Corda
2014-04-01
Full Text Available With this study, 28 pools of snails of the genus Helix, respectively Helix aspersa (n=24 and Helix vermiculata (n=4 were analysed. They were taken from snail farming and stores. The snails were from Sardinia, other regions of Italy, and from abroad. All the samples were examined as pool looking for these microbiological target: Salmonella spp., Listeria monocytogenes, Escherichia coli O157, Clostridium perfringens, Norovirus and Hepatitis A Virus (HAV. In the same pools, the concentration of cadmium and lead by inductively coupled plasma mass spectrometry was also determined. The levels of these heavy metals were quite high, especially for cadmium. Two samples were positive for Salmonella spp., while no sample was positive for Escherichia coli O157, HAV and Norovirus. Two samples were positive for Clostridium perfringens and 8 for Listeria monocytogenes. The microrganisms related to Listeria monocytogenes were identified using biochemical techniques, then serotyped and gene sequenced by multiple loci sequence typing technique. Furthermore, antimicrobial restistence was tested on the same samples.
Osman, Kamelia M; Zolnikov, Tara Rava; Samir, Ahmed; Orabi, Ahmed
2014-01-01
Goat and sheep milk is consumed by human populations throughout the world; as a result, it has been proposed as an alternative, nutrient-rich milk to feed infants allergic to cow's milk. Unfortunately, potentially harmful bacteria have not been thoroughly tested in goat or sheep milk. Listeria monocytogenes is a harmful bacterium that causes adverse health effects if ingested by humans. The purpose of this study was to estimate the prevalence and characterize the phenotype, genotype, virulence factors, biofilm formation, and antibiopotential of Listeria isolated from the milk of goat and sheep. Udder milk samples were collected from 107 goats and 102 sheep and screened for mastitis using the California mastitis test (CMT). Samples were then examined for the presence of pathogenic Listeria spp; if detected, the isolation of pathogenic Listeria (L. monocytogenes and Listeria ivanovii) was completed using isolation and identification techniques recommended by the International Organization for Standards (ISO 11290-1, 1996), in addition to serological, in vitro and in vivo pathogenicity tests. The isolates were subjected to PCR assay for virulence associated genes (hlyA, plcA, actA, and iap). Pathogenic Listeria spp. were isolated from 5·6% of goat and 3·9% sheep milk samples, with 33·3 and 25% of these selected samples respectively containing L. monocytogenes. The results of this study provide evidence of the low-likelihood of contamination leading to the presence of L. monocytogenes in raw goat and sheep milk; however, this study also confirmed a strong in vitro ability for biofilm formation and pathogenic capability of L. monocytogenes if discovered in the milk. L. monocytogenes may be present in goat and sheep milk and in order to reduce the exposure, hygienic milking conditions must be employed for the milk to be considered a safe alternative for human consumption.
Guerini, Michael N; Brichta-Harhay, Dayna M; Shackelford, T Steven D; Arthur, Terrance M; Bosilevac, Joseph M; Kalchayanand, Norasak; Wheeler, Tommy L; Koohmaraie, Mohammad
2007-11-01
Listeria monocytogenes, the causative agent of epidemic and sporadic listeriosis, is routinely isolated from many sources, including cattle, yet information on the prevalence of Listeria in beef processing plants in the United States is minimal. From July 2005 through April 2006, four commercial cow and bull processing plants were sampled in the United States to determine the prevalence of Listeria and the serovar diversity of L. monocytogenes. Samples were collected during the summer, fall, winter, and spring. Listeria prevalence on hides was consistently higher during cooler weather (28 to 92% of samples) than during warmer weather (6 and 77% of samples). The Listeria prevalence data collected from preevisceration carcass ranged from undetectable in some warm season samples to as high as 71% during cooler weather. Listeria on postintervention carcasses in the chill cooler was normally undetectable, with the exception of summer and spring samples from one plant where > 19% of the carcasses were positive for Listeria. On hides, L. monocytogenes serovar 1/2a was the predominant serovar observed, with serovars 1/2b and 4b present 2.5 times less often and serovar 1/2c not detected on any hides sampled. L. monocytogenes serovars 1/2a, 1/2c, and 4b were found on postintervention carcasses. This prevalence study demonstrates that Listeria species are more prevalent on hides during the winter and spring and that interventions being used in cow and bull processing plants appear to be effective in reducing or eliminating Listeria contamination on carcasses.
Kovačević, Mira; Burazin, Jelena; Pavlović, Hrvoje; Kopjar, Mirela; Piližota, Vlasta
2013-04-01
Minimally processed and refrigerated vegetables can be contaminated with Listeria species bacteria including Listeria monocytogenes due to extensive handling during processing or by cross contamination from the processing environment. The objective of this study was to examine the microbiological quality of ready-to-eat minimally processed and refrigerated vegetables from supermarkets in Osijek, Croatia. 100 samples of ready-to-eat vegetables collected from different supermarkets in Osijek, Croatia, were analyzed for presence of Listeria species and Listeria monocytogenes. The collected samples were cut iceberg lettuces (24 samples), other leafy vegetables (11 samples), delicatessen salads (23 samples), cabbage salads (19 samples), salads from mixed (17 samples) and root vegetables (6 samples). Listeria species was found in 20 samples (20 %) and Listeria monocytogenes was detected in only 1 sample (1 %) of cut red cabbage (less than 100 CFU/g). According to Croatian and EU microbiological criteria these results are satisfactory. However, the presence of Listeria species and Listeria monocytogenes indicates poor hygiene quality. The study showed that these products are often improperly labeled, since 24 % of analyzed samples lacked information about shelf life, and 60 % of samples lacked information about storage conditions. With regard to these facts, cold chain abruption with extended use after expiration date is a probable scenario. Therefore, the microbiological risk for consumers of ready-to-eat minimally processed and refrigerated vegetables is not completely eliminated.
Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG E HÁBITOS DE CONSUMO
CESAR, Alessandra Paro Rodrigues
2008-01-01
Listeria monocytogenes é uma bactéria Gram-positiva, anaeróbia facultativa, que se multiplica sob temperatura de refrigeração e pode causar listeriose em humanos e outros animais. Amplamente distribuída no ambiente, tem sido isolada de alimentos de origem animal e vegetal associados a surtos de elevada letalidade em diversos países, representando, portanto um patógeno importante para a saúde pública. Produtos prontos para consumo, como embutidos cozidos, entre os quais as salsichas, estão ass...
Introduction: Enterohemorrhagic Escherichia coli and Listeria monocytogenes can contaminate leafy greens through inappropriately managed raw manure applied to soils. Current FDA guidance includes calling for additional scientific data to determine the appropriate interval between application of man...
... The Listeria Initiative The Listeria Whole Genome Sequencing Project Publications Language: English (US) Español (Spanish) File Formats Help: How do I view different file formats (PDF, DOC, PPT, MPEG) on this site? Adobe PDF file Microsoft PowerPoint file Microsoft Word file Microsoft Excel file ...
Camembert, Listeria and the immunocompromised patient.
Ries, F; Dicato, M; Hemmer, R; Arendt, F
1990-01-01
Listeriosis is a rare but well known infectious complication in pregnant women and immunocompromised patients. Epidemiological studies have shown an association between listeriosis and alimentary contamination by listeria of a variety of foodstuff including soft, ripened cheeses. We describe two case-reports of listeria meningitis with high evidence of food-related illness due to the consumption of contaminated camembert. These observations urged our State Department of Health to formulate a communication about alimentary listeriosis at the intent of all health care professionals, including recommendations for patients at risk.
Schirmer, B C T; Heir, E; Møretrø, T; Skaar, I; Langsrud, S
2013-10-01
The background microbiota of 5 Norwegian small-scale cheese production sites was examined and the effect of the isolated strains on the growth and survival of Listeria monocytogenes was investigated. Samples were taken from the air, food contact surfaces (storage surfaces, cheese molds, and brine) and noncontact surfaces (floor, drains, and doors) and all isolates were identified by sequencing and morphology (mold). A total of 1,314 isolates were identified and found to belong to 55 bacterial genera, 1 species of yeast, and 6 species of mold. Lactococcus spp. (all of which were Lactococcus lactis), Staphylococcus spp., Microbacterium spp., and Psychrobacter sp. were isolated from all 5 sites and Rhodococcus spp. and Chryseobacterium spp. from 4 sites. Thirty-two genera were only found in 1 out of 5 facilities each. Great variations were observed in the microbial background flora both between the 5 producers, and also within the various production sites. The greatest diversity of bacteria was found in drains and on rubber seals of doors. The flora on cheese storage shelves and in salt brines was less varied. A total of 62 bacterial isolates and 1 yeast isolate were tested for antilisterial activity in an overlay assay and a spot-on-lawn assay, but none showed significant inhibitory effects. Listeria monocytogenes was also co-cultured on ceramic tiles with bacteria dominating in the cheese production plants: Lactococcus lactis, Pseudomonas putida, Staphylococcus equorum, Rhodococcus spp., or Psychrobacter spp. None of the tested isolates altered the survival of L. monocytogenes on ceramic tiles. The conclusion of the study was that no common background flora exists in cheese production environments. None of the tested isolates inhibited the growth of L. monocytogenes. Hence, this study does not support the hypothesis that the natural background flora in cheese production environments inhibits the growth or survival of L. monocytogenes. Copyright © 2013 American
Human Listeriosis Presenting as Breast Abscess: Report of a Rare Case.
Kandi, Venkataramana
2017-02-01
An abscess is defined as a collection of pus in various tissues of the body including skin and other organs. Abscesses most commonly are formed on the skin under the armpits, groin areas, and rectal areas. Most abscesses involve microbial infections with few remaining sterile. The treatment of abscesses includes both medical and surgical intervention. In the era of multidrug resistance, isolation and identification of the causative microbe and testing for antimicrobial susceptible patterns assume greater significance for the better management of patients, thereby reducing the resultant morbidity and mortality. Listeria spp. are a group of aerobic and non-spore forming gram-positive bacilli. They are present in the environment, soil, and water. Listeria spp. have also been noted to be present as a normal intestinal flora of animals. They are known for their ability to thrive under both cold and hot environmental conditions. Human infections with Listeria spp. have not been frequently reported, mostly because of the difficulty in laboratory identification and complex clinical presentations. In humans, Listeria spp. have been frequently responsible for food poisoning and neonatal meningitis. Although not considered as a classic pathogen, Listeria spp. are associated with infections in elderly people, pregnant women, newborns, and persons with weakened immune systems. This report presents a case of breast abscess caused by Listeria spp. in a young lactating female belonging to rural India.
Directory of Open Access Journals (Sweden)
Erica Tirloni
2017-12-01
Full Text Available Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP-based method for the detection of Listeria monocytogenes, with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32 of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3- 0.7 Log CFU/g was also evaluated, in duplicate, in pasteurised milk (whole and skimmed and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola. The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.
Linares, María Belén; Garrido, María Dolores; Martins, Conceição; Patarata, Luis
2013-05-01
Chouriço de vinho is made from roughly minced (10 to 30 mm) pork and fat, seasoned with a marinade made from wine, salt, garlic, and other facultative seasonings used according to the recipe of each producer. The batter is maintained at 4 to 7 ºC for 24 to 48 h. It is then stuffed into natural thin pork gut, cold smoked and matured at a low temperature for 1 to 4 wk. The effect of garlic used in wine-based marinade and a starter culture of indigenous Lactobacillus sakei on the behavior of Listeria monocytogenes and Salmonella spp. in the processing of chouriço was investigated. The garlic (as powder and fresh juice) was found to contribute (P < 0.05) to the control of both pathogens in broth. Garlic dose, as tested within the usual limits used for seasoning, did not impact the reduction of pathogens. Garlic-wine-based marinade and a starter culture of indigenous L. sakei contribute to controlling L. monocytogenes and Salmonella spp. in the processing of chouriço. Their presence was responsible for the loss of viability of L. monocytogenes and Salmonella spp. following 5 d of drying, even sooner than situations where no garlic was used. The results of the present work show that the use of a wine-based marinade with garlic has an important role in ensuring the safety of the product. © 2013 Institute of Food Technologists®
Prevalence of Listeria monocytogenes in raw milk in North Lebanon
International Nuclear Information System (INIS)
Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.
2016-01-01
Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)
Czech Academy of Sciences Publication Activity Database
Tonk, Miray; Cabezas-Cruz, A.; Valdés, James J.; Rego, Ryan O. M.; Chrudimská, Tereza; Strnad, Martin; Šíma, Radek; Bell-Sakyi, L.; Franta, Z.; Vilcinskas, A.; Grubhoffer, Libor; Rahnamaeian, M.
2014-01-01
Roč. 7, DEC 3 2015 (2014), s. 554 ISSN 1756-3305 R&D Projects: GA ČR(CZ) GAP302/11/1901; GA MŠk(CZ) EE2.3.30.0032; GA ČR GP13-12816P Institutional support: RVO:60077344 Keywords : Antimicrobial peptide * Defensin * Listeria grayi * Fusarium spp * Ixodes scapularis * Tick cell line Subject RIV: EE - Microbiology, Virology Impact factor: 3.430, year: 2014
Gormley, F J; Little, C L; Grant, K A; de Pinna, E; McLauchlin, J
2010-04-01
From 2359 specialty meats (continental sausages, cured/fermented, dried meats) sampled from markets and specialty food shops, 98.9% of samples were of satisfactory or acceptable microbiological quality. However, 16 (0.7%) were unsatisfactory as a result of Escherichia coli, Staphylococcus aureus or Listeria spp. contamination (>or=10(2) CFU/g), and nine (0.4%) were unacceptable due to presence of Salmonella spp. or Listeria monocytogenes (>10(2) CFU/g). Meats with unacceptable levels of L. monocytogenes were within shelf life (range: 8-143 days remaining). Nine different subtypes of L. monocytogenes were detected with sero/AFLP type 1/2c VII predominating (37%), although this subtype was not overrepresented in any particular meat type (P > 0.05). Ninety-six percent of continental sausages and cured/fermented products were stored at potential for L. monocytogenes to be present at levels hazardous to health at the point of sale.
NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES
The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...
Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina
2010-02-01
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.
Two cases of listeria rhombencephalitis
Directory of Open Access Journals (Sweden)
Christopher Thomas Mansbridge
2018-01-01
Full Text Available Listeria rhombencephalitis (LRE is a rare encephalitis of the hindbrain that can present with a variety of neurological symptoms. It is a diagnostic challenge, but prompt antimicrobial therapy is important to prevent high rates of mortality and morbidity. We report two cases of LRE, with several contrasting clinical features and different disease courses. Despite being rare, it is important to consider listeria in patients with possible meningoencephalitis, even if cultures are negative. Empirical treatment of meningoencephalitis should provide coverage for listeria, especially if the patient is at risk of listeriosis or there is a potential history of listeria exposure.
Occurrence of Listeria spp. in retail meat and dairy products in the area of Addis Ababa, Ethiopia.
Derra, Firehiwot Abera; Karlsmose, Susanne; Monga, Dharam P; Mache, Abebe; Svendsen, Christina Aaby; Félix, Benjamin; Granier, Sophie A; Geyid, Abera; Taye, Girum; Hendriksen, Rene S
2013-06-01
Listeriosis, a bacterial disease in humans and animals, is mostly caused by ingestion of Listeria monocytogenes via contaminated food and/or water, or by a zoonotic infection. Globally, listeriosis has in general a low incidence but a high case fatality rate. The objective of this study was to investigate the occurrence, antimicrobial profiles, and genetic relatedness of L. monocytogenes from raw meat and dairy products (raw milk, cottage cheese, cream cake), collected from the capital and five neighboring towns in Ethiopia. Two hundred forty food samples were purchased from July to December 2006 from food vendors, shops, and supermarkets, using a cross-sectional study design. L. monocytogenes were isolated and subjected to molecular serotyping. The genetic relatedness and antimicrobial susceptibility patterns were investigated using pulsed-field gel electrophoresis (PFGE) and minimum inhibitory concentration determinations. Of 240 food samples tested, 66 (27.5%) were positive for Listeria species. Of 59 viable isolates, 10 (4.1%) were L. monocytogenes. Nine were serotype 4b and one was 2b. Minimum inhibitory concentration determination and PFGE of the 10 L. monocytogenes isolates showed low occurrence of antimicrobial resistance among eight different PFGE types. The findings in this study correspond to similar research undertaken in Ethiopia by detecting L. monocytogenes with similar prevalence rates. Public education is crucial as regards the nature of this organism and relevant prevention measures. Moreover, further research in clinical samples should be carried out to estimate the prevalence and carrier rate in humans, and future investigations on foodborne outbreaks must include L. monocytogenes.
Listeria monocytogenes: Overview and Targeting Advances
Directory of Open Access Journals (Sweden)
Mostafa F.N. Abushahba
2016-04-01
Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.
Soto Beltran, Marcela; Gerba, Charles P; Porto Fett, Anna; Luchansky, John B; Chaidez, Cristobal
2015-01-01
Queso fresco (QF) is a handmade cheese consumed and produced in Latin America. In Mexico, QF production is associated with a microbiological risk. The aim of the study was to determine the incidence and characterization of Listeria monocytogenes, Salmonella spp., and Shiga toxin-producing Escherichia coli (STEC) in QF from retail markets of the north-western State of Sinaloa, Mexico, and to assess the effect of physicochemical parameters on Listeria presence. A total of 75 QF samples were obtained. L. monocytogenes, E. coli, and coliforms were detected in 9.3, 94, and 100%, respectively. Salmonella was not detected. STEC isolates showed virulence genes. Microbial loads were above the maximum values recommended by the Official Mexican Standards. Physicochemical parameters such as water activity (aw), moisture content, pH, and salinity played a role in Listeria prevalence in QF. Rigorous control in QF made in Culiacan, Mexico is needed to reduce the risk of foodborne pathogens.
2014-07-01
include: 1) Listeria infection, including that mediated by attenuated strains, induces moDC, DDC , and LC maturation and activation. 2) Listeria...2f) Flow cytometry analysis of DCs for co-stimulatory and maturation markers (months 3-12) Result/status: Listeria-treated DDC -IDCs and LCs were...for moDCs, infection of DDC -IDCs and LCs with wild-type, LLO-deficient, and ActA- deficient Listeria induces the activation and maturation of DDC
Directory of Open Access Journals (Sweden)
Luisa Zanolli Moreno
2014-01-01
Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.
Directory of Open Access Journals (Sweden)
Sebastião Timo Iaria
2007-09-01
Full Text Available
Com vistas ao isolamento, à identificação e à caracterização sorológica de bactérias do gênero Listeria, foram colhidas em um matadouro-frigorífico de grande porte, sob inspeção federal, 70 amostras de tecido muscular bovino e 30 amostras de água residuária oriunda da lavagem de meias-carcaças. Nenhuma cepa de Listeria foi isolada a partir das amostras de carne bovina, mas uma amostra de água residuária (3,33% revelou-se positiva, sendo a cepa identificada bioquímica e sorologicamente como L. innocua 6a. Foram também analisadas 50 amostras de carne bovina moída, adquiridas no mercado varejista de Goiânia - GO, das quais 24 (48% mostraram-se positivas para Listeria spp. Destas amostras positivas foram isoladas 24 cepas, sendo 22 (91,8% de L. innocua 6a, uma (4,1% de L. innocua não tipável sorologicamente e uma (4,41% de L. monocytogenes 1/2b.
PALAVRAS-CHAVE: Listeria; carne; carne moída; carcaça.
With the aim to isolate, identify and carry out serological characterization of’ bacteria of the genus Listeria, 70 samples of bovine muscle tissue and 30 samples of residual washing water of halves carcasses were collected in a large slaughterhouse, under Federal Inspection. No Listeria strain was isolated from samples of bovine meat, but one sample of residual water (3.33% was positive, being the strain identified biochemical and serologically as L. innocua 6a. Fifty samples were also analysed of bovine minced meat acquired in the market of Goiânia - GO, from which 24 (48% showed positive for Listeria spp. From these positive samples 24 strains were isolated, being 22 (91.8% of L. innocua 6a, one (4.1% of L. innocua not tipable and one (4.1% of
Isolation and biochemical and molecular characterization of Listeria monocytogenes in food
International Nuclear Information System (INIS)
Helel, Salma
2008-01-01
monocytogenes is a Gram-positive bacteria, saprophytic, non-spore. This is an extremely resistant seeds to environmental conditions outside, especially since the cold psychrotrophic. It can contaminate raw vegetables, cooked meals ready for consumption or foods to be stored in the refrigerator, such as cheese or meat. It is the bacteria responsible for listeriosis. It threatens first unborn children, infants, pregnant women, the elderly and people whose immune system is weakened. Strains of Listeria spp isolated from foods (seafood, meat, meat) were first identified at the stage of the genus by classical tests (Gram staining, catalase test, oxidase test and mobility) and stage of the test case by hemolysis, CAMP test and the gallery Api Listeria. Biochemical characterization allowed after a numerical analysis, to assign 100% of isolates to the genus Listeria. Molecular characterization was performed by PCR amplification of genes coding for protein p60 (iap), the listeriolysine O (hly), the Phosphatidylinositol Phospholipase C (PI-PLC plca) Phosphatidylcholine Phospholipase C (plcB). The result showed an amplification of the iap gene of 100% of the hly gene, plca, plcB of 31.81%. This characterization represents an identification of the collection on the genetic level and shows that 31.81% of isolates, is likely to express the genes responsible for virulence factors of L. monocytogenes, to produce listeriolysine O, phospholipase C and Lecithinase. The molecular identification was performed by microarray technique and identified isolates L. September monocytogenes (five original clinical isolates and two food-borne), fourteen L. innocua (of food) and a strain not identified by DNA chip.. (Author)
Pizarro-Cerdá, Javier; Charbit, Alain; Enninga, Jost; Lafont, Frank; Cossart, Pascale
2016-12-01
Bacterial pathogens display an impressive arsenal of molecular mechanisms that allow survival in diverse host niches. Subversion of plasma membrane and cytoskeletal functions are common themes associated to infection by both extracellular and intracellular pathogens. Moreover, intracellular pathogens modify the structure/stability of their membrane-bound compartments and escape degradation from phagocytic or autophagic pathways. Here, we review the manipulation of host membranes by Listeria monocytogenes, Francisella tularensis, Shigella flexneri and Yersinia spp. These four bacterial model pathogens exemplify generalized strategies as well as specific features observed during bacterial infection processes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook
2014-07-01
A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.
Blazkova, M.; Koets, M.; Rauch, P.; Amerongen, van A.
2009-01-01
We present a new nucleic acid lateral flow immunoassay (NALFIA) for the assessment of listeria contamination. The detection procedure starts with enrichment of sample in Half Fraser broth (24 h). Following isolation of DNA, a duplex PCR is performed with two labelled primer sets, one generic and
Alles, Susan; Peng, Linda X; Mozola, Mark A
2009-01-01
A modification to Performance-Tested Method 010403, GeneQuence Listeria Test (DNAH method), is described. The modified method uses a new media formulation, LESS enrichment broth, in single-step enrichment protocols for both foods and environmental sponge and swab samples. Food samples are enriched for 27-30 h at 30 degrees C, and environmental samples for 24-48 h at 30 degrees C. Implementation of these abbreviated enrichment procedures allows test results to be obtained on a next-day basis. In testing of 14 food types in internal comparative studies with inoculated samples, there were statistically significant differences in method performance between the DNAH method and reference culture procedures for only 2 foods (pasteurized crab meat and lettuce) at the 27 h enrichment time point and for only a single food (pasteurized crab meat) in one trial at the 30 h enrichment time point. Independent laboratory testing with 3 foods showed statistical equivalence between the methods for all foods, and results support the findings of the internal trials. Overall, considering both internal and independent laboratory trials, sensitivity of the DNAH method relative to the reference culture procedures was 90.5%. Results of testing 5 environmental surfaces inoculated with various strains of Listeria spp. showed that the DNAH method was more productive than the reference U.S. Department of Agriculture-Food Safety and Inspection Service (USDA-FSIS) culture procedure for 3 surfaces (stainless steel, plastic, and cast iron), whereas results were statistically equivalent to the reference method for the other 2 surfaces (ceramic tile and sealed concrete). An independent laboratory trial with ceramic tile inoculated with L. monocytogenes confirmed the effectiveness of the DNAH method at the 24 h time point. Overall, sensitivity of the DNAH method at 24 h relative to that of the USDA-FSIS method was 152%. The DNAH method exhibited extremely high specificity, with only 1% false
Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi
2016-11-16
Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes
Disinfectant effect of Methylated Ethanol against Listeria species
Directory of Open Access Journals (Sweden)
Y Yakubu
2012-04-01
Full Text Available This study was carried out in order to determine the disinfectant effect of Methylated spirit® (95% methanol and 5% ethanol as a teat dip against Listeria species. Hand milking was employed to collect 576 (288 x 2 raw milk samples from different lactating cows within Sokoto metropolis (Nigeria. 288 samples were collected before disinfecting the udder teats with Methylated spirit®, while the other 288 were collected after disinfection with Methylated spirit®. The samples were analyzed using selective culture and isolation technique in which the 288 samples collected before disinfection, 114 (39.6% were positive for Listeria species. Among the positive samples 44 (38.6% were Listeria innocua, 16 (14.0% Listeria ivanovii, 36 (31.6% Listeria monocytogenes, 11 (9.6% Listeria welshimeri and 7 (6.1% Listeria seeligeri, while none of the 288 samples collected after disinfection was positive. The study has shown high prevalence of Listeria species in milk collected without washing/disinfecting the teats and has also established the sensitivity of Listeria species to methylated ethanol which can be used as dip for disinfecting udder teats before milking in order to prevent contamination with Listeria species and other methylated spirit-sensitive organisms. This study is essential to educate Fulani herdsmen and other milk handlers on the importance of disinfecting udder teats before milking. [Vet. World 2012; 5(2.000: 91-93
Directory of Open Access Journals (Sweden)
Rossella Lelli
2011-09-01
Full Text Available È stato standardizzato e validato un dosaggio immunoenzimatico capture ELISA per l’identificazione di Listeria monocytogenes negli alimenti. Il dosaggio è stato messo a punto analizzando campioni di prodotti carnei, ittici e lattiero-caseari, pasta di semola e di farina di grano. Il metodo è risultato specifico al 100% per Listeria spp., con limite di rivelazione di 6,6 × 10(3 cfu/ml. Il metodo L. monocytogenes capture ELISA è stato confrontato con il metodo ufficiale ISO 11290-1:1996 per l’isolamento e l’identificazione di L. monocytogenes in matrici alimentari ottenendo un indice di concordanza significativo. Il dosaggio è stato validato in base alle indicazioni della norma ISO 16140:2003 relativamente ai metodi di analisi qualitativi. Il dosaggio è risultato accurato, specifico, sensibile, selettivo, riproducibile e rapido da eseguire, consentendo nello screening degli alimenti la riduzione di tempi e costi dell’indagine microbiologica.
Prevalence of Listeria Species in Ready-to-Eat Food in Shahrekord Restaurants
Rahimi, E; Shakerian, A. (PhD
2014-01-01
Background and Objective: Listeria bacteria with worldwide widespread are commonly found in soil, sewage, dust and water. Among which,Listeria monocytogenes can cause a serious food-borne disease. The objective of this study was to investigate the prevalence of Listeria species in ready-to-eat foods. Material and Methods: The samples (n=235) including oloveyh salad (n = 64), Yogurt stew (n= 35), vegetable salad (n=52), macaroni salad (n= 48) and meat salad (n =36) were collected from the rest...
Keep Listeria Out of Your Kitchen
... Listeria has been linked to a variety of ready-to-eat foods, including deli meats, hot dogs, smoked seafood and ... to check the temperature there. Use precooked and ready-to-eat foods as soon as you can. The longer they ...
Methods for detecting pathogens in the beef food chain: detecting particular pathogens
The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...
Detection of Listeria in raw milk in Syria
International Nuclear Information System (INIS)
Al-Mariri, A.; Abou-Younes, A.
2010-01-01
The 66 milk collected from all province of Syria, were examined for the presence of Listeria sp. using a several technique, and L. monocytogenes serotypes associated with human listeriosis were also identified in the product. The PCR based method identified 117 strains of Listeria, L. monocytogenes, L. innocua, L. ivanovii, L. gravi, and L. welshimeri. The API Listeria system identified 94% of the isolates whereas FTIR identification was 98% for all Listeria species. (author)
International Nuclear Information System (INIS)
Acevedo Gonzalez, Claudia Jose
2004-01-01
In the markets of many countries, including Chile, a wide variety of minimally processed or fourth sort vegetables are offered. Nevertheless, recent studies have reported that some of these products could be a potential risk to the public health due, to microbiological contamination. As a feasible treatment to solve this problem, irradiation of this kind of vegetable products is proposed. The natural microbiological contamination of two minimally processed mixed salads Toscana (iceberg lettuce ( Lactuca sativa var. capita), red cabbage (Brassica oleraceae var. rubra) and shredded carrot (Dacus carota L.)) and Four Seasons (romaine lettuce (Lactuca sativa var. longifolia), iceberg lettuce (lactuca sativa var. capitata), lollo rossa lettuce (Lactuca sativa var. acephala) and spinach (Spinacia oleraceae), was assayed controlling the total plate count (TPC), the Enterobacteriaceae count (EC) and the presence or absence of Listeria spp.in 25 g. Inoculating both salads with Listeria innocua, as surrogate microorganism for a possible contamination with Listeria monocytogenes, the D 10 value was determined. The effect of irradiating the vegetables with 5 D 10 doses, on the initial microflora and the evaluation of possible changes in the microbiological and sensory quality during a 7 days refrigerated storage, was carried out. The effect on the sensory quality was evaluated by a 10 judges trained panel, through a triangular test at day 0 and day 7, in order to determine possible significantly differences between the no irradiated and the irradiated samples. A test for quality descriptors was performed at 0, 3 and 7 days, to compare the irradiated salads with the no irradiated control. The evaluated sensory attributes were appearance, color, flavor, sweetness, bitterness, texture and total quality. The levels of the initial microflora ranged for TPC between 10 6 cfu/g and 10 8 cfu/g in Toscana salad and 10 4 cfu/g and 10 8 cfu/g in Four Seasons salad. The EC initial levels
Díez, J García; Patarata, L
2013-04-01
Portuguese chouriço de vinho is made by drying coarsely minced meat and fat that has been previously marinated with wine (usually red), salt, and garlic for 1 to 2 days at a low temperature (4 to 8 °C). This procedure may improve the microbiological safety of the product. The aim of this study was to evaluate the behavior of three pathogens in this product, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus, to establish the minimum period of drying and maturation necessary to render safe products. The pathogens were inoculated in the chouriço de vinho batter. A factorial design was used to study the following variables in the fermentation process: (i) the presence or absence of an indigenous Lactobacillus sakei starter culture; (ii) the presence or absence of fermentable carbohydrates; and (iii) the salt level (1.5 or 3%). The samples were analyzed 24 h after the preparation of the batter (at stuffing); after 7, 15, and 30 days of drying; and after 30 days of storage at 4 °C under vacuum. Under all of the conditions studied, the levels of the three pathogens decreased during the drying period. In the early stages of drying, the addition of L. sakei starter culture and/or carbohydrates resulted in lower levels of gram-positive pathogens. After 15 days of drying, populations of all pathogens decreased by ca. 2 log in all samples. At that sampling time, L. monocytogenes was undetectable in the chouriço de vinho with L. sakei starter culture and carbohydrates. The mean count of S. aureus after 15 days of drying was below 1 log CFU/g. After 30 days of drying, no pathogens were detected. The drying period could be shortened to 15 days when considering only the gram-positive pathogens studied and the use of a starter culture and carbohydrates. Due to the low infective dose of Salmonella spp., the product should be considered safe after 30 days, when this pathogen became undetectable.
The search of Listeria and Salmonella in different food matrices
International Nuclear Information System (INIS)
Ben Saad, Emna
2010-01-01
The foods safety and security does not cease to be a priority. Although foods contaminants generate changes in the sensory characteristics, they may cause diseases and pose a risk to human health. This study includes a targeted search of two food borne pathogens Listeria and Salmonella responsible respectively of two serious infections listeriosis and salmonellosis. 100 Food samples taken from the market for public consumption are analyzed in the CNSTN laboratory of microbiology and molecular biology. Once isolated (eight strains of Listeria and one of Salmonella), the strains were identified by Api (Listeria and 20E) and PCR. The results obtained show the ability of our products to be contaminated which arise the importance of strengthening measures of prevention and health control.
PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD
Directory of Open Access Journals (Sweden)
Imad al Kassaa
2016-06-01
Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.
LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION
Directory of Open Access Journals (Sweden)
S. Colombo
2012-08-01
Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.
Application of heat in postcook meat chillers reduces Listeria.
Eglezos, Sofroni; Dykes, Gary A
2011-06-01
Electrical air-blowing heaters were used to heat and dry out holding chillers used for postcook commercial processed meats in an attempt to control the presence of Listeria. A baseline study of the prevalence of Listeria in holding chillers in seven facilities was undertaken. Listeria was detected in four of the seven chillers, and swab samples showed Listeria prevalence ranging from 7 (7.8%) of 90 to 6 (20%) of 30, depending on the facility. Two of the facilities with established Listeria contamination (A and E) were chosen for further studies. The heating trials consisted of three individual heating interventions at each of the two facilities, with 2 weeks of postintervention sampling after each treatment. The initial Listeria prevalence in chiller A was 19 (10.6%) of 180, and treatment at 37°C for 36 h reduced prevalence to 3 (1.7%) of 180. The initial Listeria prevalence in chiller E was 7 (7.8%) of 90, and treatment at 50°C for 2 h reduced prevalence to 0 of 90. Both reductions were statistically significant at P prevalence of Listeria in chillers.
Gelbíčová, T; Pantůček, R; Karpíšková, R
2016-08-01
The aim of this study was to assess the potential risk posed to the human population by the presence of Listeria monocytogenes serotype 1/2c in food based on the characterization of virulence factors of Listeria involved in the invasion of host cells and sensitivity to antimicrobial agents. In addition to sequencing of the inlA and inlB genes, the presence of genes lapB, aut, fbpA, ami, vip and llsX was tested. A premature stop codon (PMSC) in the inlA gene was detected in all tested strains of serotype 1/2c and, concurrently, two novel PMSC mutation types were identified. However, neither PMSC in the inlB gene nor deletion of the lapB, aut, fbpA, ami and vip genes were found in any of the strains. The presence of the llsX gene was not confirmed. Even though all L. monocytogenes strains showed sensitivity to the tested antimicrobials on the basis of their phenotype, sequencing revealed the presence of IS1542 insertion in the inlA gene, indicating the possibility of sharing of mobile genetic elements associated with antimicrobial resistance among strains. Other than the presence of PMSCs in the inlA gene, no PMSC in inlB or deletion of other factors linked to the invasiveness of listeria were detected. Tested strains showed sensitivity to antibiotics used in the therapy of listeriosis. Strains of L. monocytogenes serotype 1/2c typically carry a PMSC in the inlA gene, but these strains still represent a potential threat to public health. The possibility of transfer of IS1542, associated with resistance to vancomycin, between enterococci and Listeria spp. was revealed. © 2016 The Society for Applied Microbiology.
Control options for Listeria monocytogenes in seafoods
DEFF Research Database (Denmark)
Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech
2000-01-01
At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...
Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.
2017-09-01
Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.
Control of Listeria species food safety at a poultry food production facility.
Fox, Edward M; Wall, Patrick G; Fanning, Séamus
2015-10-01
Surveillance and control of food-borne human pathogens, such as Listeria monocytogenes, is a critical aspect of modern food safety programs at food production facilities. This study evaluated contamination patterns of Listeria species at a poultry food production facility, and evaluated the efficacy of procedures to control the contamination and transfer of the bacteria throughout the plant. The presence of Listeria species was studied along the production chain, including raw ingredients, food-contact, non-food-contact surfaces, and finished product. All isolates were sub-typed by pulsed-field gel electrophoresis (PFGE) to identify possible entry points for Listeria species into the production chain, as well as identifying possible transfer routes through the facility. The efficacy of selected in-house sanitizers against a sub-set of the isolates was evaluated. Of the 77 different PFGE-types identified, 10 were found among two or more of the five categories/areas (ingredients, food preparation, cooking and packing, bulk packing, and product), indicating potential transfer routes at the facility. One of the six sanitizers used was identified as unsuitable for control of Listeria species. Combining PFGE data, together with information on isolate location and timeframe, facilitated identification of a persistent Listeria species contamination that had colonized the facility, along with others that were transient. Copyright © 2015 Elsevier Ltd. All rights reserved.
Institute of Scientific and Technical Information of China (English)
无
2007-01-01
Listeria monocytogene is a well-recognized cause of bacteremia in immunocompromised individuals, including solid organ transplant recipients, but has been rarely reported following orthotopic liver transplantation. We describe a case of listeria meningitis that occurred within a week after liver transplantation. The patient developed a severe headache that mimicked tacrolimus encephalopathy, and was subsequently diagnosed with listeria meningitis by cerebrospinal fluid culture. The infection was successfully treated with three-week course of intravenous ampicillin. Recurrent hepatitis C followed and was successfully treated with interferon alfa and ribavirin. Fourteen cases of listeriosis after orthotopic liver transplantation have been reported in the English literature. Most reported cases were successfully treated with intravenous ampicillin. There were four cases of listeria meningitis, and the mortality of them was 50%.Early detection and treatment of listeria meningitis are the key to obtaining a better prognosis.
DEFF Research Database (Denmark)
Roed, Casper; Engsig, Frederik Neess; Omland, Lars Haukali
2012-01-01
OBJECTIVES: To determine the long-term mortality, the causes of death and the incidence of cancer in listeria meningitis patients. METHODS: Nationwide, population-based cohort study including all adult patients diagnosed with listeria meningitis from 1977 to 2006 and alive 1 year after diagnosis......, and an age-and gender-matched, population control cohort. Kaplan-Meier tables, Cox regression analysis and cumulative incidence function were used as outcome analyses. RESULTS: We identified 114 listeria meningitis patients and 1026 population controls. The adjusted mortality rate ratio (MRR) for listeria...... meningitis patients the first 5 years of follow-up was 2.35(95% confidence interval (CI) 1.60-3.45) thereafter the MRR was 0.93(95% CI: 0.56-1.55). Listeria meningitis patients had an increased risk of death due to cancer the first 5 years of follow-up, and in the same period patients above 50 years of age...
Directory of Open Access Journals (Sweden)
Analía L. Laciar
2000-03-01
Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.
Directory of Open Access Journals (Sweden)
Shahin Gaini
2015-01-01
Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.
DEFF Research Database (Denmark)
Gaini, Shahin
2015-01-01
A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....
Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.
Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo
2014-12-01
This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.
Occurrence of Listeria spp. in retail meat and dairy products in the area of Addis Ababa, Ethiopia
DEFF Research Database (Denmark)
Derra, F. A.; Karlsmose, Susanne; Monga, D. P.
2013-01-01
Background. Listeriosis, a bacterial disease in humans and animals, is mostly caused by ingestion of Listeria monocytogenes via contaminated food and/or water, or by a zoonotic infection. Globally, listeriosis has in general a low incidence but a high case fatality rate. Objective. The objective...... of this study was to investigate the occurrence, antimicrobial profiles, and genetic relatedness of L. monocytogenes from raw meat and dairy products (raw milk, cottage cheese, cream cake), collected from the capital and five neighboring towns in Ethiopia. Methods. Two hundred forty food samples were purchased...
Evaluation of the Thermo Scientific™ SureTect™ Listeria species Assay.
Cloke, Jonathan; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko
2014-03-01
The Thermo Scientific™ SureTect™ Listeria species Assay is a new real-time PCR assay for the detection of all species of Listeria in food and environmental samples. This validation study was conducted using the AOAC Research Institute (RI) Performance Tested MethodsSM program to validate the SureTect Listeria species Assay in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996 including amendment 1:2004 in a variety of foods plus plastic and stainless steel. The food matrixes validated were smoked salmon, processed cheese, fresh bagged spinach, cantaloupe, cooked prawns, cooked sliced turkey meat, cooked sliced ham, salami, pork frankfurters, and raw ground beef. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, fresh bagged spinach, and stainless steel surface samples) were analyzed independently as part of the AOAC-RI-controlled independent laboratory study by the University of Guelph, Canada. Using probability of detection statistical analysis, a significant difference in favour of the SureTect assay was demonstrated between the SureTect and reference method for high level spiked samples of pork frankfurters, smoked salmon, cooked prawns, stainless steel, and low-spiked samples of salami. For all other matrixes, no significant difference was seen between the two methods during the study. Inclusivity testing was conducted with 68 different isolates of Listeria species, all of which were detected by the SureTect Listeria species Assay. None of the 33 exclusivity isolates were detected by the SureTect Listeria species Assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside of the recommended parameters open to variation, which demonstrated that the assay gave reliable performance. Accelerated stability testing was additionally conducted, validating the
Clinical Case of Listeria Meningitis
Directory of Open Access Journals (Sweden)
V.O. Kuzmina
2014-09-01
Full Text Available This article describes a case of listeria meningitis in a 41-year-old man. At the time of admission to hospital, the patient complained of fever, headache, vomiting, general weakness. An objective examination revealed cervical lymphadenopathy, meningeal signs (positive Kernig’s sign and doubtful rigidity of occipitals, with no focal symptoms. On the right hand it was revealed an abscess in the stage of healing. In the liquor we have detected: pleocytosis — 222 cells with a predominance of neutrophils — 73 %, рrotein — 0.49 g/l, the sugar level in the liquor is slightly reduced. During the bacteriological study of liquor we have isolated Listeria monocytogenes. Serological survey of blood serum using passive hemagglutination test and indirect hemagglutination test revealed levels of antibodies to Listeria monocytogenes — 1 : 800 and 3 (+, respectively.
Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V
2016-01-01
Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.
Stalling autophagy: a new function for Listeria phospholipases
Directory of Open Access Journals (Sweden)
Ivan Tattoli
2014-01-01
Full Text Available Listeria monocytogenes is a Gram-positive bacterial pathogen that induces its own uptake in non-phagocytic cells. Following invasion, Listeria escapes from the entry vacuole through the secretion of a pore-forming toxin, listeriolysin O (LLO that acts to damage and disrupt the vacuole membrane. Listeria then replicates in the cytosol and is able to spread from cell-to-cell using actin-based motility. In addition to LLO, Listeria produces two phospholipase toxins, a phosphatidylinositol-specific phospholipase C (PI-PLC, encoded by plcB and a broad-range phospholipase C (PC-PLC, encoded by plcA, which contribute to bacterial virulence. It has long been recognized that secretion of PI- and PC-PLC enables the disruption of the double membrane vacuole during cell-to-cell spread, and those phospholipases have also been shown to augment LLO-dependent escape from the entry endosome. However, a specific role for Listeria phospholipases during the cytosolic stage of infection has not been previously reported. In a recent study, we demonstrated that Listeria PI-PLC and PC-PLC contribute to the bacterial escape from autophagy through a mechanism that involves direct inhibition of the autophagic flux in the infected cells [Tattoli et al. EMBO J (2013, 32, 3066-3078].
Investigating Listeria Outbreaks
Centers for Disease Control (CDC) Podcasts
Dr. Emily Cartwright, Infectious Disease fellow at Emory University and former EIS Officer with CDCâs Division of Foodborne, Waterborne, and Environmental Diseases discusses foodborne Listeria outbreaks.
Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A
2014-05-01
The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.
Resistance of Listeria monocytogenes biofilms to sanitizing agents
Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...
Listeria Endocarditis: A Diagnostic Challenge
Directory of Open Access Journals (Sweden)
Wilhelmina J. A. R. M. Valckx MD
2017-04-01
Full Text Available A 74-year-old hemodialysis patient with a history of an atrial septum defect closure, coronary bypass surgery, and a St. Jude aortic prosthetic valve was diagnosed with pneumonia and volume overload. Blood cultures were positive for Listeria monocytogenes, and amoxicillin was given for 2 weeks. Immediately after discontinuation of amoxicillin, fever relapsed. Transthoracic and transesophageal echocardiography showed no sign of endocarditis. Given the fever relapse and 3 positive minor Duke criteria, an 18F-FDG PET-CT scan (18F-fluorodeoxyglucose-positron emission tomography-computed tomography scan was performed. This scan showed activity at the aortic root, proximal ascending aorta, and inferior wall of the heart, making Listeria monocytogenes endocarditis a likely explanation. Amoxicillin was given for 6 weeks with good clinical result. Diagnosing a life-threatening Listeria monocytogenes endocarditis can be challenging and an 18F-FDG PET-CT scan can be helpful.
Microbial quality and prevalence of Salmonella and Listeria in eggs
Directory of Open Access Journals (Sweden)
Manijeh Mahdavi
2012-01-01
Full Text Available Aims: This study was undertaken to determine the microbial quality and the prevalence of Salmonella and Listeria in table eggs in Isfahan, Iran. Materials and Methods: A total of 525 samples were randomly collected from various shops in Isfahan, Iran. Microbial quality of eggs evaluated by coliform count and total bacterial viable counts. Also, detection of Listeria and Salmonella in egg contents and on eggs shells was performed. Results: The mean of total viable bacteria and coliform counts in the egg contents were 3.95 × 10 4 CFU/g and 4.94 × 10 3 CFU/g, respectively. Salmonella and Listeria were not found on the shell or content of eggs. Enterobacteriaceae families were found in 357 of 525 (68.28% and 276 of 525 (52.44% of egg shell and egg content samples, respectively. Moreover, Pseudomonas aeruginosa was isolated from 175 (33.41% and 144 (25.37% of egg shell and egg content, respectively. The isolated Enterobacteriaceae were included: Enterobacter aerogenes, Escherichia coli, Klebsiella pneumoniae, Buttiauxella agrestis, Cedecea lapagei, Cedecea davisae and Erwinia herbicola. Conclusion: The findings of the present study indicate although Salmonella and Listeria were not found in egg samples; however, there is an urgent need to improve the hygienic level of consumed eggs.
Directory of Open Access Journals (Sweden)
Mahling Monia
2011-07-01
Full Text Available Abstract Background Only limited information is available about the occurrence of ticks and tick-borne pathogens in public parks, which are areas strongly influenced by human beings. For this reason, Ixodes ricinus were collected in public parks of different Bavarian cities in a 2-year survey (2009 and 2010 and screened for DNA of Babesia spp., Rickettsia spp. and Bartonella spp. by PCR. Species identification was performed by sequence analysis and alignment with existing sequences in GenBank. Additionally, coinfections with Anaplasma phagocytophilum were investigated. Results The following prevalences were detected: Babesia spp.: 0.4% (n = 17, including one pool of two larvae in 2009 and 0.5 to 0.7% (n = 11, including one pool of five larvae in 2010; Rickettsia spp.: 6.4 to 7.7% (n = 285, including 16 pools of 76 larvae in 2009. DNA of Bartonella spp. in I. ricinus in Bavarian public parks could not be identified. Sequence analysis revealed the following species: Babesia sp. EU1 (n = 25, B. divergens (n = 1, B. divergens/capreoli (n = 1, B. gibsoni-like (n = 1, R. helvetica (n = 272, R. monacensis IrR/Munich (n = 12 and unspecified R. monacensis (n = 1. The majority of coinfections were R. helvetica with A. phagocytophilum (n = 27, but coinfections between Babesia spp. and A. phagocytophilum, or Babesia spp. and R. helvetica were also detected. Conclusions I. ricinus ticks in urban areas of Germany harbor several tick-borne pathogens and coinfections were also observed. Public parks are of particularly great interest regarding the epidemiology of tick-borne pathogens, because of differences in both the prevalence of pathogens in ticks as well as a varying species arrangement when compared to woodland areas. The record of DNA of a Babesia gibsoni-like pathogen detected in I. ricinus suggests that I. ricinus may harbor and transmit more Babesia spp. than previously known. Because of their high recreational value for human beings, urban green
Schorn, Sabine; Pfister, Kurt; Reulen, Holger; Mahling, Monia; Silaghi, Cornelia
2011-07-15
Only limited information is available about the occurrence of ticks and tick-borne pathogens in public parks, which are areas strongly influenced by human beings. For this reason, Ixodes ricinus were collected in public parks of different Bavarian cities in a 2-year survey (2009 and 2010) and screened for DNA of Babesia spp., Rickettsia spp. and Bartonella spp. by PCR. Species identification was performed by sequence analysis and alignment with existing sequences in GenBank. Additionally, coinfections with Anaplasma phagocytophilum were investigated. The following prevalences were detected: Babesia spp.: 0.4% (n = 17, including one pool of two larvae) in 2009 and 0.5 to 0.7% (n = 11, including one pool of five larvae) in 2010; Rickettsia spp.: 6.4 to 7.7% (n = 285, including 16 pools of 76 larvae) in 2009. DNA of Bartonella spp. in I. ricinus in Bavarian public parks could not be identified. Sequence analysis revealed the following species: Babesia sp. EU1 (n = 25), B. divergens (n = 1), B. divergens/capreoli (n = 1), B. gibsoni-like (n = 1), R. helvetica (n = 272), R. monacensis IrR/Munich (n = 12) and unspecified R. monacensis (n = 1). The majority of coinfections were R. helvetica with A. phagocytophilum (n = 27), but coinfections between Babesia spp. and A. phagocytophilum, or Babesia spp. and R. helvetica were also detected. I. ricinus ticks in urban areas of Germany harbor several tick-borne pathogens and coinfections were also observed. Public parks are of particularly great interest regarding the epidemiology of tick-borne pathogens, because of differences in both the prevalence of pathogens in ticks as well as a varying species arrangement when compared to woodland areas. The record of DNA of a Babesia gibsoni-like pathogen detected in I. ricinus suggests that I. ricinus may harbor and transmit more Babesia spp. than previously known. Because of their high recreational value for human beings, urban green areas are likely to remain in the research focus on
Pritchard, T J; Flanders, K J; Donnelly, C W
1995-08-01
This study was undertaken to compare the incidence of Listeria contamination of processing equipment with that of the general dairy processing environment. A total of 378 sponge samples obtained from 21 dairy plants were analyzed for Listeria using three different enrichment media. Use of extended microbiological analysis allowed us to identify 26 Listeria positive sites which would have not been identified had a single test format been employed. Eighty (80) of 378 sites (21.2%) were identified as Listeria positive. Listeria innocua was isolated from 59 of the 80 (73.8%) positive samples, L. monocytogenes was identified in 35 (43.8%) of the positive samples, and L. seeligeri was isolated from 5 (6.3%) of the Listeria positive samples. Positive equipment samples were obtained from 6 of the 21 (28.6%) plants and 19 of the 21 (90.5%) plants had positive environmental sites. Seventeen of the 215 (7.9%) samples from equipment were positive for Listeria species. Eleven of these sites, including 3 holding tanks, 2 table tops, 3 conveyor/chain systems, a pasta filata wheel, a pint milk filler and a brine pre-filter machine, were positive for L. monocytogenes. Nineteen of the 21 (90.5%) plants had positive environmental sites. Sixty-three of the 163 (41.1%) samples from environmental sites were Listeria positive and 24 were positive for L. monocytogenes. Two-tailed student t-test analysis of the mean frequencies indicated that the level of contamination was significantly higher (p plant, and that greater emphasis needs to be placed on the cleaning and sanitizing of the plant environment.
OrfX, a Nucleomodulin Required for Listeria monocytogenes Virulence
Directory of Open Access Journals (Sweden)
Andrzej Prokop
2017-10-01
Full Text Available Listeria monocytogenes is a bacterial pathogen causing severe foodborne infections in humans and animals. Listeria can enter into host cells and survive and multiply therein, due to an arsenal of virulence determinants encoded in different loci on the chromosome. Several key Listeria virulence genes are clustered in Listeria pathogenicity island 1. This important locus also contains orfX (lmo0206, a gene of unknown function. Here, we found that OrfX is a small, secreted protein whose expression is positively regulated by PrfA, the major transcriptional activator of Listeria virulence genes. We provide evidence that OrfX is a virulence factor that dampens the oxidative response of infected macrophages, which contributes to intracellular survival of bacteria. OrfX is targeted to the nucleus and interacts with the regulatory protein RybP. We show that in macrophages, the expression of OrfX decreases the level of RybP, which controls cellular infection. Collectively, these data reveal that Listeria targets RybP and evades macrophage oxidative stress for efficient infection. Altogether, OrfX is after LntA, the second virulence factor acting directly in the nucleus.
McEgan, Rachel; Danyluk, Michelle D
2015-05-01
This study evaluated the efficacy of aqueous (aQUAT) and isopropyl alcohol-based quaternary ammonium (ipQUAT) sanitizers for reducing Salmonella spp., Escherichia coli O157:H7, or Listeria monocytogenes populations on peanut and pistachio shell pieces. Inoculated nutshells were mixed with QUAT sanitizers, water, or 70% ethanol and enumerated immediately or after incubation at 30 °C for 48 h. None of the treatments had any immediate effect on Salmonella or E. coli O157:H7 populations on the peanut or pistachio shells. L. monocytogenes populations declined immediately on the peanut and pistachio shells treated with aQUAT or ipQUAT. After incubation, Salmonella and E. coli O157:H7 populations increased significantly on the water- or aQUAT-treated peanut and pistachio shells. L. monocytogenes populations also increased significantly on the water- or aQUAT-treated peanut shells, but levels did not change on the water-treated pistachio shells and levels were just above the limit of detection on the aQUAT-treated pistachio shells. After treatment with ipQUAT and 48-h incubation, Salmonella and E. coli O157:H7 populations decreased to or below the limit of detection on both shell types; L. monocytogenes populations remained at or below the limit of detection on both shell types. Copyright © 2014 Elsevier Ltd. All rights reserved.
Taguchi, Masumi; Kanki, Masashi; Yamaguchi, Yuko; Inamura, Hideichi; Koganei, Yosuke; Sano, Tetsuya; Nakamura, Hiromi; Asakura, Hiroshi
2017-03-01
Incidences of food poisoning traced to nonanimal food products have been increasingly reported. One of these was a recent large outbreak of Shiga toxin-producing Escherichia coli (STEC) O157 infection from the consumption of lightly pickled vegetables, indicating the necessity of imposing hygienic controls during manufacturing. However, little is known about the bacterial contamination levels in these minimally processed vegetables. Here we examined the prevalence of STEC, Salmonella spp., and Listeria monocytogenes in 100 lightly pickled vegetable products manufactured at 55 processing factories. Simultaneously, we also performed quantitative measurements of representative indicator bacteria (total viable counts, coliform counts, and β-glucuronidase-producing E. coli counts). STEC and Salmonella spp. were not detected in any of the samples; L. monocytogenes was detected in 12 samples manufactured at five of the factories. Microbiological surveillance at two factories (two surveys at factory A and three surveys at factory B) between June 2014 and January 2015 determined that the areas predominantly contaminated with L. monocytogenes included the refrigerators and packaging rooms. Genotyping provided further evidence that the contaminants found in these areas were linked to those found in the final products. Taken together, we demonstrated the prevalence of L. monocytogenes in lightly pickled vegetables sold at the retail level. Microbiological surveillance at the manufacturing factories further clarified the sources of the contamination in the retail products. These data indicate the necessity of implementing adequate monitoring programs to minimize health risks attributable to the consumption of these minimally processed vegetables.
Møller, C O A; Sant'Ana, A S; Hansen, S K H; Nauta, M J; Silva, L P; Alvarenga, V O; Maffei, D; Silva, F F P; Lopes, J T; Franco, B D G M; Aabo, S; Hansen, T B
2016-06-02
In a previous study, a model was developed to describe the transfer and survival of Salmonella during grinding of pork (Møller, C.O.A., Nauta, M.J., Christensen, B.B., Dalgaard, P., Hansen, T.B., 2012. Modelling transfer of Salmonella typhimurium DT104 during simulation of grinding of pork. Journal of Applied Microbiology 112 (1), 90-98). The robustness of this model is now evaluated by studying its performance for predicting the transfer and survival of Salmonella spp. and Listeria monocytogenes during grinding of different types of meat (pork and beef), using two different grinders, different sizes and different numbers of pieces of meats to be ground. A total of 19 grinding trials were collected. Acceptable Simulation Zone (ASZ), visual inspection of the data, Quantitative Microbiological Risk Assessment (QMRA), as well as the Total Transfer Potential (TTP) were used as approaches to evaluate model performance and to access the quality of the cross contamination model predictions. Using the ASZ approach and considering that 70% of the observed counts have to be inside a defined acceptable zone of ±0.5 log10CFU per portion, it was found that the cross contamination parameters suggested by Møller et al. (2012) were not able to describe all 19 trials. However, for each of the collected grinding trials, the transfer event was well described when fitted to the model structure proposed by Møller et al. (2012). Parameter estimates obtained by fitting observed trials performed at different conditions, such as size and number of pieces of meat to be ground, may not be applied to describe cross contamination of unlike processing. Nevertheless, the risk estimates, as well as the TTP, revealed that the risk of disease may be reduced when the grinding of meat is performed in a grinder made of stainless steel (for all surfaces in contact with the meat), using a well-sharpened knife and holding at room temperatures lower than 4°C. Copyright © 2016 Elsevier B.V. All
Directory of Open Access Journals (Sweden)
Ana Camejo
2009-05-01
Full Text Available Listeria monocytogenes is a human intracellular pathogen able to colonize host tissues after ingestion of contaminated food, causing severe invasive infections. In order to gain a better understanding of the nature of host-pathogen interactions, we studied the L. monocytogenes genome expression during mouse infection. In the spleen of infected mice, approximately 20% of the Listeria genome is differentially expressed, essentially through gene activation, as compared to exponential growth in rich broth medium. Data presented here show that, during infection, Listeria is in an active multiplication phase, as revealed by the high expression of genes involved in replication, cell division and multiplication. In vivo bacterial growth requires increased expression of genes involved in adaptation of the bacterial metabolism and stress responses, in particular to oxidative stress. Listeria interaction with its host induces cell wall metabolism and surface expression of virulence factors. During infection, L. monocytogenes also activates subversion mechanisms of host defenses, including resistance to cationic peptides, peptidoglycan modifications and release of muramyl peptides. We show that the in vivo differential expression of the Listeria genome is coordinated by a complex regulatory network, with a central role for the PrfA-SigB interplay. In particular, L. monocytogenes up regulates in vivo the two major virulence regulators, PrfA and VirR, and their downstream effectors. Mutagenesis of in vivo induced genes allowed the identification of novel L. monocytogenes virulence factors, including an LPXTG surface protein, suggesting a role for S-layer glycoproteins and for cadmium efflux system in Listeria virulence.
Day, J B; Basavanna, U
2015-04-01
Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h. Published by Elsevier Ltd.
Incidence of Listeria monocytogenes and Other Bacteria in ...
African Journals Online (AJOL)
Prof. Ogunji
Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...
Directory of Open Access Journals (Sweden)
Albenones José de Mesquita
2007-09-01
Full Text Available
In this paper it was observed the efficiency of enrichment brothes for Listeria (LEB1 and LEB2, associated to the passage of the culture through a 0.25% potassium hidroxide solution, verifying that the secondary enrichment broth (LEB2 and LEB2KOH was better than the primary enrichment broth (LEB1KOH for this purpose. On the other hand, lithium chloride-phenylethanol-moxalactam agar and the selective Listeria agar base, supplemented with cicloheximide, acriflavine and nalidixic acid (LSAIB-CAN showed equivalency, at the statistic point of view (p=0.l442, in relation to the number of positive samples for Listeria spp., although the LSAB-CAN agar had given the greatest number of bacteria isolated from this genus.
KEY-WORDS: Listeria; enrichment broth; selective agar.
No presente trabalho verificou-se a eficiência dos caldos de enriquecimento para Listeria (LEB1 e LEB 2 associados à passagem da cultura por uma solução de hidróxido de potássio a 0,25%, constatando-se que o caldo de enriquecimento secundário (LEB2 e LEB2KOH foi superior ao caldo de enriquecimento primário (LEB1KOH. Por outro lado, o ágar cloreto de lítio-feniletanol-moxalactam (LPM e o ágar base seletivo para Listeria, suplementado com cicloheximida, acriflavina e ácido nalidíxico (LSAB-CAN equivaleram-se estatisticamente (p= 0,l442 em relação ao número de amostras positivas para Listeria, embora o ágar LSAB-CAN tenha proporcionado um maior número de isolamentos da bactéria.
PALAVRAS-CHAVE: Caldo de enriquecimento; ágar seletivo; Listeria.
Incidence of Listeria monocytogenes and Other Bacteria in ...
African Journals Online (AJOL)
The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...
McLAUCHLIN, J; Jørgensen, F; Aird, H; Charlett, A; Elviss, N; Fenelon, D; Fox, A; Willis, C; Amar, C F L
2017-06-01
The purpose of this study was to investigate the microbiological quality of liver pâté. During 2012-13, a total of 870 samples, unrelated to the investigation of food-poisoning outbreaks, were collected either at retail (46%), catering (53%) or the point of manufacture (1%) and were tested using standard methods to detect Salmonella spp. or Campylobacter spp., and to enumerate for Listeria spp., including Listeria monocytogenes, Clostridium perfringens, coagulase-positive staphylococci including Staphylococcus aureus, Bacillus spp., including Bacillus cereus, Escherichia coli, Enterobacteriaceae, and aerobic colony counts (ACCs). Seventy-three percent of samples were of satisfactory microbiological quality, 18% were borderline and 9% unsatisfactory. Salmonella spp. or Campylobacter spp. was not recovered from any sample. The most common causes of unsatisfactory results were elevated ACCs (6% of the samples) and high Enterobacteriaceae counts (4% of samples). The remaining unsatisfactory results were due to elevated counts of: E. coli (three samples); B. cereus (one sample at 2·6 × 105 cfu/g); or L. monocytogenes (one sample at 2·9 × 103 cfu/g). Pâté from retail was less likely to be contaminated with L. monocytogenes than samples collected from catering and samples from supermarkets were of significantly better microbiological quality than those from catering establishments.
Microbiological quality of selected spices and herbs including the presence of Cronobacter spp.
Garbowska, M; Berthold-Pluta, A; Stasiak-Różańska, L
2015-08-01
The cultivation of spices and herbs in parts of the world characterized by warm climate and high humidity provides excellent conditions for the development of microorganisms, including the undesirable ones. The aim of this study was to determine the microbiological quality of spices and herbs available on the Polish market, considering the occurrence of Cronobacter species bacteria. Analyses covered 60 samples of commercial spices and herbs, including 38 samples of dried herbs (basil, bay leaves, thyme, oregano, tarragon, marjoram, dill, parsley, rosemary, lovage) and 16 samples of seasoning blends as well as 6 samples of spices seeds and fruits (pimento, black pepper, coriander). All samples were tested for the total count of aerobic mesophilic bacteria (TAMB) and for the presence of Cronobacter spp. In most of the samples of spices and herbs (60.0%), the TAMB did not exceed 10(4) CFU/g, and the level regarded as unacceptable (>10(6) CFU/g) was not identified in any of the samples. The presence of Cronobacter spp. was demonstrated in 10 (16.7%) samples of the analyzed products, however these were mainly samples of herbs (basil, tarragon, parsley) and one sample of a seasoning blend (Provence herbs). The highest microbiological contamination (TAMB) was found in samples of herbs (oregano, tarragon, basil) and in ready seasoning blends, in 21.1% and 25.0% of which the total count of aerobic mesophiles was in the range of 10(5)-10(6) CFU/g. In all samples of spices seeds and fruits (coriander, black pepper and pimento), the total count of aerobic bacteria reached spices and herbs available on the Polish market. The study demonstrated also that dried spices and herbs may be carriers of Cronobacter species bacteria, though their presence in not often detected in products of this type. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kwang-Pyo Kim
2015-09-01
Full Text Available The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634 encoding alcohol acetaldehyde dehydrogenase (Aad, previously designated as Listeria adhesion protein (LAP, and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology. PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL.
REALIS: Postgenomic Analysis of Listeria Monocytogenes
Directory of Open Access Journals (Sweden)
The REALIS Consortium
2006-04-01
Full Text Available Listeria monocytogenes is a remarkably successful food-borne pathogen. It is capable a of surviving and proliferating under conditions that exist within the food chain, such as at low temperatures, high salt and low pH and b of colonizing animal host tissues after ingestion of contaminated food, causing opportunistic infections mainly, but not exclusively, in immunocompromised hosts. The ultimate goals of REALIS are two fold: Firstly, it aims to completely decipher all genes required for survival in and adaptation of Listeria monocytogenes to two very different environments, ie., the infected host and the external environment. Secondly, using genomics and postgenomic tools, REALIS seeks to precisely address fundamental questions regarding evolutionary relationships between pathogenic and non-pathogenic Listeria and to define qualities of particularly successful clonal pathovariants in causing disease. This project will provide both industry and health care managers with rational approaches to curbing food-borne contamination, minimising risks of infection and providing novel pharmacological approaches for halting the fulminant course of infection.
Klu, Y A K; Chen, J
2016-04-01
This study observed the behaviour of probiotics and selected bacterial pathogens co-inoculated into peanut butter during gastrointestinal simulation. Peanut butter homogenates co-inoculated with Salmonella/Listeria strains (5 log CFU ml(-1) ) and lyophilized or cultured probiotics (9 log CFU ml(-1) ) were exposed to simulated gastrointestinal conditions for 24 h at 37°C. Sample pH, titratable acidity and pathogen populations were determined. Agar diffusion assay was performed to assess the inhibitory effect of probiotic culture supernatants with either natural (3·80 (Lactobacillus), 3·78 (Bifidobacteirum) and 5·17 (Streptococcus/Lactococcus)) or neutralized (6·0) pH. Antibacterial effect of crude bacteriocin extracts were also evaluated against the pathogens. After 24 h, samples with probiotics had lower pH and higher titratable acidity than those without probiotics. The presence of probiotics caused a significant reduction (P Probiotics in 'peanut butter' survived simulated gastrointestinal conditions and inhibited the growth of Salmonella/Listeria. Peanut butter is a plausible carrier to deliver probiotics to improve the gastrointestinal health of children in developing countries. © 2016 The Society for Applied Microbiology.
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
STORAGESEVER
2008-09-03
Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...
Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions
Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...
Prevalence of the pathogen microorganisms in raw cow milk
Directory of Open Access Journals (Sweden)
Angelovski Ljupco
2009-11-01
Full Text Available The aim of this study was to study the prevalence of Salmonella spp., Listeria spp., Staphylococcus spp. and E. coli in the raw cow milk. In this study 133 milk-tank samples from several milk collecting points were analysed. After the tests the following prevalence was detected: for Listeria spp. 13 positive samples (9.77%, with 9 Listeria monocytogenes samples confirmed (6.76%. Salmonella spp. was not detected in any of the the samples. The biggest presence was detected for Staphylococcus spp. with 113 positive samples (85.0%. Further testes has shown prevalence of coagulase-positive staphylococci of 73% (97 positive samples. Escherichia coli was confirmed in 57 samples (46.0%. The results from this study clearly indicate that pathogen microorganisms which are important for the human health can be found in the raw cow milk and their presence can be potential hazard for contamination of the milk-processing establishments.
Occurrence of Listeria monocytogens in raw milk of ruminants in Basrah province
Directory of Open Access Journals (Sweden)
B. A. Abbas
2012-01-01
Full Text Available The present study was performed on three hundred raw milk samples, 100 each from cows, sheep and buffaloes were collected from different places of Basrah city. 7.3 % of the samples were found to be positive for Listeria spp. Cow's milk was found to be more infected than other animals milk with this bacteria. All bacterial isolates were confirmed as L. monocytogens by colony characteristics, beta haemolysis, cold enrichment procedure, selective media, Anton test, tumbling and inverted pine tree motility and sugar fermentation tests. Most isolates were found to be sensitive to cefotaxine, sulfamethoxazol, chloramphenical and tobramycin. rifampicin was found to have less effect on these isolates. Effects of pH and temperature on bacterial growth were also studied to test the ability of this microorganism to survive in milk under severe conditions. The pH range for growth was from 4 to 9.5. The temperature range was between 4 – 45 ºC.
Ojima-Kato, Teruyo; Yamamoto, Naomi; Takahashi, Hajime; Tamura, Hiroto
2016-01-01
The genetic lineages of Listeria monocytogenes and other species of the genus Listeria are correlated with pathogenesis in humans. Although matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has become a prevailing tool for rapid and reliable microbial identification, the precise discrimination of Listeria species and lineages remains a crucial issue in clinical settings and for food safety. In this study, we constructed an accurate and reliable MS database to discriminate the lineages of L. monocytogenes and the species of Listeria (L. monocytogenes, L. innocua, L. welshimeri, L. seeligeri, L. ivanovii, L. grayi, and L. rocourtiae) based on the S10-spc-alpha operon gene encoded ribosomal protein mass spectrum (S10-GERMS) proteotyping method, which relies on both genetic information (genomics) and observed MS peaks in MALDI-TOF MS (proteomics). The specific set of eight biomarkers (ribosomal proteins L24, L6, L18, L15, S11, S9, L31 type B, and S16) yielded characteristic MS patterns for the lineages of L. monocytogenes and the different species of Listeria, and led to the construction of a MS database that was successful in discriminating between these organisms in MALDI-TOF MS fingerprinting analysis followed by advanced proteotyping software Strain Solution analysis. We also confirmed the constructed database on the proteotyping software Strain Solution by using 23 Listeria strains collected from natural sources.
Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo
2015-07-02
Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.
ISG15 counteracts Listeria monocytogenes infection
Radoshevich, Lilliana; Impens, Francis; Ribet, David; Quereda, Juan J; Nam Tham, To; Nahori, Marie-Anne; Bierne, Hélène; Dussurget, Olivier; Pizarro-Cerdá, Javier; Knobeloch, Klaus-Peter; Cossart, Pascale
2015-01-01
ISG15 is an interferon-stimulated, linear di-ubiquitin-like protein, with anti-viral activity. The role of ISG15 during bacterial infection remains elusive. We show that ISG15 expression in nonphagocytic cells is dramatically induced upon Listeria infection. Surprisingly this induction can be type I interferon independent and depends on the cytosolic surveillance pathway, which senses bacterial DNA and signals through STING, TBK1, IRF3 and IRF7. Most importantly, we observed that ISG15 expression restricts Listeria infection in vitro and in vivo. We made use of stable isotope labeling in tissue culture (SILAC) to identify ISGylated proteins that could be responsible for the protective effect. Strikingly, infection or overexpression of ISG15 leads to ISGylation of ER and Golgi proteins, which correlates with increased secretion of cytokines known to counteract infection. Together, our data reveal a previously uncharacterized ISG15-dependent restriction of Listeria infection, reinforcing the view that ISG15 is a key component of the innate immune response. DOI: http://dx.doi.org/10.7554/eLife.06848.001 PMID:26259872
Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis
DEFF Research Database (Denmark)
Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper
2017-01-01
dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...
Investigating Listeria Outbreaks
Centers for Disease Control (CDC) Podcasts
2013-01-04
Dr. Emily Cartwright, Infectious Disease fellow at Emory University and former EIS Officer with CDCâs Division of Foodborne, Waterborne, and Environmental Diseases discusses foodborne Listeria outbreaks. Created: 1/4/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID). Date Released: 1/8/2013.
Directory of Open Access Journals (Sweden)
L.N. Sarangi
2013-01-01
Full Text Available Listeria species were isolated from faecal samples collected from different captive wild animals of Nandankanan Zoo, Baranga, Odisha, using selective enrichment medium. The isolates were characterized based on their cell morphology, biochemical and sugar fermentation characteristics as well as culture morphology. Further, in vitro and in vivo pathogenicity tests were carried out to assess the pathogenic potential of the isolates. Listeria were found in 24 (23.07% of the total 104 faecal samples. Listeria were isolated from the samples of tiger, bear, hyena, leopard, zebra, elephant, jackal, lion, barking deer, porcupine, chital, monkey and wild boar. Out of the 24 Listeria isolates 11 were confirmed as L. monocytogenes. The other 13 isolates included L. innocua, L. seeligeri, L. welshimeri and L. ivanovii. The pathogenicity study revealed that only four isolates were pathogenic. Three of these were L. monocytogenes isolated from tiger, hyena and elephant and one was L. ivanovii isolated from leopard. Antibiotic sensitivity of the 24 isolates was high towards ciprofloxacin, levofloxacin, amoxicillin, azithromycin and enrofloxacin. The isolates showed resistance towards oxytetracyclin, gentamicin, cephadroxil, penicillin- G and nalidixic acid.
78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes
2013-05-13
... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli... Scott, V.N., Survey of Listeria monocytogenes in ready-to-eat foods. Journal of Food Protection, 2003... monocytogenes in ready-to-eat processed meat and poultry collected in four FoodNet states in International...
Research and identification of pathogenic bacteria 'Salmonella and Listeria' in food
International Nuclear Information System (INIS)
Harizi Khalil
2009-01-01
The sums propose to evaluate the bacterial contamination of certain food taken randomly by two pathogenic bacteria (Salmonella and Listeria) considering the evolution of the diseases of food oignon. For that 78 food samples of different origins were analysed. 2 stocks of the Listeria kind and 3 stocks of the salmonella kind were insulated and identified by biochemical and molecular tests. The pathogenic isolates were identified by coloration gram, test catalase, insulation on specific culture media and Api (20 E for Salmonella and Api listeria. At the end, the PCR were realized to amplify the gene iap which codes for the protein p60 at listeria as well as a sequence clonee randomly specific of Salmonella.
Anti-Listeria starters: in vitro selection and production plant evaluation.
Raimondi, Stefano; Popovic, Mina; Amaretti, Alberto; Di Gioia, Diana; Rossi, Maddalena
2014-05-01
Anti-Listeria bacterial starters are highly demanded by the meat industry. Novel bioprotective anti-Listeria starters were searched among Lactobacillus species strains isolated from artisanal sausages. The screening confirmed that anti-Listeria activity is a strain-specific property and yielded only 1 strain (of 36) exhibiting a satisfactory level of inhibition, L. delbrueckii WC0286. This strain was compared with two commercial bioprotective starters, SafePro B-SF-43 and SafePro B-LC-20, in a model simulating in vitro the first step of the fermentation process. The presence of the bioprotective starters did not modify the pH in such a way that could affect the safety or organoleptic properties of the product. Both SafePro B-SF-43 and SafePro B-LC-20 effected an important reduction of Listeria counts (0.56 and 0.72 log CFU g(-1), respectively, in 72 h), while the anti-Listeria effect of L. delbrueckii WC0286 was minor (0.15 log CFU g(-1)). These results discouraged the utilization of L. delbrueckii WC0286 for a challenge test in a pilot salami production, in favor of the best-performing bioprotective starter, SafePro B-LC-20. The test confirmed that SafePro B-LC-20 did not alter the acidification trend of sausages and was capable of inhibiting Listeria, which decreased by 1.21 log CFU g(-1). This information is relevant to address research activity toward the development of new bioprotective starters. The data herein presented demonstrate that the efficacy in Listeria control of potentially bioprotective bacterial starters requires further validation in real meat matrixes, possibly by using in vitro meat fermentation experiments to narrow down the list of candidates before pilot scale challenge tests.
Epidemiological surveillance, virulence and public health ...
African Journals Online (AJOL)
All isolates of Listeria spp. were haemolytic on 5% sheep blood agar and positive for congo dye uptake and showed multiple drug resistance, multiple antibiotic resistance (MAR) indices of 0.86 (> 0.2). One isolate of Listeria spp. was molecularly identified by sequencing of 16S rRNA gene, and its gene sequence was ...
[Prevalence of emerging foodborne pathogens and illness: Campylobacter and Listeria].
Ferriero, Anna Maria; Damiani, Gianfranco; Neve, Caterina Bianca; Bianchi, Aurora; Ronconi, Alessandra; Laurenti, Patrizia
2011-01-01
This study evaluated the proportion of food samples, examined by the Italian Istituti Zooprofilattici Sperimentali (Experimental Zooprophylactic Institutes) in the years 2000-2005, positive for Campylobacter and Listeria. A correlation was found between food samples found positive for Listeria in the years 2002-2005 and the number of hospitalisations for Listeria illness in the same years (as reported in hospital discharge abstract forms). This confirms that attention should be given in the evaluation of phenomena known to be under reported and for which data are collected and analysed by different methods.
Effekt av ulike desinfeksjonsstrategier mot Listeria monocytogenes
Fossmo, Sabine
2013-01-01
Kontroll med bakterier som Listeria utgjør en stor utfordring for mange matprodusenter. Listeria monocytogenes er hovedsakelig et produksjonshygienisk problem, forbedret hygiene kan derfor være tiltak for å redusere overlevelse og smitteoverføring av bakterien i produksjonsmiljø. Hensikten med forsøkene i oppgaven var å undersøke effekten av ulike desinfeksjonsstrategier på drap av L. monocytogenes, både når bakteriene var i biofilm og i suspensjon. Dette inkluderte bruk av tradisjonelle desi...
Bajor, Anna; Luhr, Anke; Brockmann, Dorothee; Suerbaum, Sebastian; Framme, Carsten; Sedlacek, Ludwig
2016-07-16
The majority of cases of endophthalmitis are caused by exogenous pathogens; only 5-10 % are of endogenous origin. One cause of these rare cases of endogenous endophthalmitis is Listeria monocytogenes. Twenty-six cases of endophthalmitis due to this pathogen have been published over the last twenty years. The aim of this review is to summarize the main risk factors and common clinical findings of endogenous endophthalmitis due to Listeria monocytogenes. We report on a 62-year-old female presenting with a sterile hypopyon iritis with secondary glaucoma and an underlying rheumatoid disease. In microbiological analysis we identified Listeria monocytogenes. Further we searched through all published cases for typical signs, risk factors, details of medical and surgical treatment and outcome of endogenous endophthalmitis due to this rare pathogen. Ocular symptoms in almost all of these published cases included pain, redness of the eye, and decreased vision. Main clinical features included elevated intraocular pressure and fibrinous anterior chamber reaction, as well as a dark hypopyon. While the infection is typically spread endogenously, neither an exogenous nor endogenous source of infection could be identified in most cases. Immunocompromised patients are at higher risk of being infected than immunocompetent patients. The clinical course of endophthalmitis caused by Listeria monocytogenes had different visual outcomes. In some cases, the infection led to enucleation, blindness, or strong visual loss, whereas most patients showed a tendency of visual improvement during therapy. Early diagnosis and treatment initiation are crucial factors in the outcome of endogenous endophthalmitis caused by Listeria monocytogenes. This possible differential diagnosis should be kept in mind while treating patients with presumable sterile hypopyon and anterior uveitis having a high intraocular pressure. A bacterial source should be considered with a prompt initiation of systemic
Berthold-Pluta, Anna; Garbowska, Monika; Stefańska, Ilona; Pluta, Antoni
2017-08-01
Bacteria of the genus Cronobacter are emerging food-borne pathogens. Foods contaminated with Cronobacter spp. may pose a risk to infants or adults with suppressed immunity. This study was aimed at determining the microbiological quality of ready-to-eat (RTE) plant-origin food products available on the Polish market with special emphasis on the prevalence of Cronobacter genus bacteria. Analyses were carried out on 60 samples of commercial RTE type plant-origin food products, including: leaf vegetables (20 samples), sprouts (20 samples) and non-pasteurized vegetable, fruit and fruit-vegetable juices (20 samples). All samples were determined for the total count of aerobic mesophilic bacteria (TAMB) and for the presence of Cronobacter spp. The isolates of Cronobacter spp. were subjected to genetic identification and differentiation by 16S rDNA sequencing, PCR-RFLP analysis and RAPD-PCR and evaluation of antibiotic susceptibility by the disk diffusion assay. The TAMB count in samples of lettuces, sprouts and non-pasteurized fruit, vegetable and fruit-vegetable juices was in the range of 5.6-7.6, 6.7-8.4 and 2.9-7.7 log CFU g -1 , respectively. The presence of Cronobacter spp. was detected in 21 (35%) samples of the products, including in 6 (30%) samples of leaf vegetables (rucola, lamb's lettuce, endive escarola and leaf vegetables mix) and in 15 (75%) samples of sprouts (alfalfa, broccoli, small radish, lentil, sunflower, leek and sprout mix). No presence of Cronobacter spp. was detected in the analyzed samples of non-pasteurized fruit, vegetable and fruit-vegetable juices. The 21 strains of Cronobacter spp. isolated from leaf vegetable and sprouts included: 13 strains of C. sakazakii, 4 strains of C. muytjensii, 2 strains of C. turicensis, one strain of C. malonaticus and one strain of C. condimenti. All isolated C. sakazakii, C. muytjensii, C. turicensis and C. malonaticus strains were sensitive to ampicillin, cefepime, chloramphenicol, gentamycin
Transfer of microorganisms, including Listeria monocytogenes, from various materials to beef.
Midelet, Graziella; Carpentier, Brigitte
2002-08-01
The quantity of microorganisms that may be transferred to a food that comes into contact with a contaminated surface depends on the density of microorganisms on the surface and on the attachment strengths of the microorganisms on the materials. We made repeated contacts between pieces of meat and various surfaces (stainless steel and conveyor belt materials [polyvinyl chloride and polyurethane]), which were conditioned with meat exudate and then were contaminated with Listeria monocytogenes, Staphylococcus sciuri, Pseudomonas putida, or Comamonas sp. Attachment strengths were assessed by the slopes of the two-phase curves obtained by plotting the logarithm of the number of microorganisms transferred against the order number of the contact. These curves were also used to estimate the microbial population on the surface by using the equation of A. Veulemans, E. Jacqmain, and D. Jacqmain (Rev. Ferment. Ind. Aliment. 25:58-65, 1970). The biofilms were characterized according to their physicochemical surface properties and structures. Their exopolysaccharide-producing capacities were assessed from biofilms grown on polystyrene. The L. monocytogenes biofilms attached more strongly to polymers than did the other strains, and attachment strength proved to be weaker on stainless steel than on the two polymers. However, in most cases, it was the population of the biofilms that had the strongest influence on the total number of CFU detached. Although attachment strengths were weaker on stainless steel, this material, carrying a smaller population of bacteria, had a weaker contaminating capacity. In most cases the equation of Veulemans et al. revealed more bacteria than did swabbing the biofilms, and it provided a better assessment of the contaminating potential of the polymeric materials studied here.
Generation of airborne Listeria innocua from model floor drains.
Berrang, Mark E; Frank, Joseph F
2012-07-01
Listeria monocytogenes can colonize floor drains in poultry processing and further processing facilities, remaining present even after cleaning and disinfection. Therefore, during wash down, workers exercise caution to avoid spraying hoses directly into drains in an effort to prevent the escape and transfer of drain microflora to food contact surfaces. The objective of this study was to examine the extent to which an inadvertent water spray into a colonized floor drain can cause the spread of airborne Listeria. Listeria innocua was used to inoculate a polyvinyl chloride model floor drain, resulting in approximately 10(8) cells per ml of phosphate-buffered saline and 10(4) attached cells per square centimeter of inner surface. Each model drain was subjected to a 2-s spray of tap water at 68.9 kPa from a distance of 1 m. Drains were sprayed while filled and again after emptying. Airborne cells were collected by using sedimentation plates containing Listeria selective agar which were placed on the floor and walls of a contained room at incremental horizontal and vertical distances of 0.6, 1.2, 2.4, or 4.0 m from the drain. Sedimentation plates were exposed for 10 min. A mechanical sampler was used to also collect air by impaction on the surface of Listeria selective agar to determine the number of cells per liter of air. The experiment was conducted in triplicate rooms for each of four replications. L. innocua was detected on sedimentation plates on the floor as far as 4.0 m from the drain and on walls as high as 2.4 m above the floor and 4 m from the drain. A 2-s spray with a water hose into a contaminated drain can cause airborne spread of Listeria, resulting in the potential for cross-contamination of food contact surfaces, equipment, and exposed product.
DEFF Research Database (Denmark)
Petersen, Line Hedegård; Madsen, Mogens
2000-01-01
The occurrence of Listeria monocytogenes in samples from broiler houses and cloacal swabs taken at the abattoir was investigated. An automated immunobased method (EiaFoss) was used, and 42 samples were also analysed by conventional culture; both methods were based on a two-step selective enrichment....... monocytogenes in enrichment broths may lead to an underestimation of the prevalence of L. monocytogenes. Furthermore, as L. inocua was also detected by the EiaFoss method, a significant amount of bacterial confirmation work had to be done. Of 42 samples analysed by conventional culture, four yielded L. inocua......, of which two were not positive by EiaFoss....
Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael
2014-01-01
L. monocytogenes strains that encompassed 13 serotypes across the various lineages and none of the 30 exclusive organisms, including seven other Listeria species. The product consistency and kit stability studies revealed no statistical differences between the three lots tested or to the term of the shelf life. Finally, the robustness study demonstrated no statistical differences when samples were incubated at 33 ± 2°C or 37 ± 2°C, when enrichment aliquots were 1.3 mL or 1.7 mL, or when the samples were analyzed the same day or five days later. Overall the Atlas Listeria monocytogenes LmG2 Detection Assay is statistically equivalent to or better than the reference methods and is robust to the tested variations.
Linezolid and dexamethasone experience in a serious case of listeria rhombencephalitis.
Yılmaz, Pakize Ö; Mutlu, Nevzat M; Sertçelik, Ahmet; Baştuğ, Aliye; Doğu, Cihangir; Kışlak, Sümeyye
2016-01-01
Listeria rhombencephalitis is a rare cause of brain stem encephalitis. We report a case with a history of immunosupressive therapy due to Takayasu's arteritis that was treated with corticosteroids and linezolid for Listeria rhombencephalitis. A 63-year-old woman was admitted to the hospital with fever, headache, nausea, and vomiting. The patient's body temperature was 38°C, and she had a stiff neck. Listeria monocytogenes was isolated from the cerebrospinal fluid (CSF), and penicillin G and gentamicin treatment was initiated. Linezolid and dexamethasone were added. Due to hematuria and thrombocytopenia, the linezolid was discontinued. In immunocompromised patients with CNS infections, Listeria rhombencephalitis should be suspected. Linezolid can be used in combination with dexamethasone. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
Nobmann, Patricia; Smith, Aoife; Dunne, Julie; Henehan, Gary; Bourke, Paula
2009-01-15
Novel mono-substituted carbohydrate fatty acid (CFA) esters and ethers were investigated for their antibacterial activity against a range of pathogenic and spoilage bacteria focussing on Listeria monocytogenes. Carbohydrate derivatives with structural differences enable comparative studies on the structure/activity relationship for antimicrobial efficacy and mechanism of action. The antimicrobial efficacy of the synthesized compounds was compared with commercially available compounds such as monolaurin and monocaprylin, as well as the pure free fatty acids, lauric acid and caprylic acid, which have proven antimicrobial activity. Compound efficacy was compared using an absorbance based broth microdilution assay to determine the minimum inhibitory concentration (MIC), increase in lag phase and decrease in maximum growth rate. Among the carbohydrate derivatives synthesized, lauric ether of methyl alpha-d-glucopyranoside and lauric ester of methyl alpha-d-mannopyranoside showed the highest growth-inhibitory effect with MIC values of 0.04 mM, comparable to monolaurin. CFA derivatives were generally more active against Gram positive bacteria than Gram negative bacteria. The analysis of both ester and ether fatty acid derivatives of the same carbohydrate, in tandem with alpha and beta configuration of the carbohydrate moiety suggest that the carbohydrate moiety is involved in the antimicrobial activity of the fatty acid derivatives and that the nature of the bond also has a significant effect on efficacy, which requires further investigation. This class of CFA derivatives has great potential for developing antibacterial agents relevant to the food industry, particularly for control of Listeria or other Gram-positive pathogens.
Recombinant phage probes for Listeria monocytogenes
Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.
2007-10-01
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
Barbiroli, Alberto; Musatti, Alida; Capretti, Giorgio; Iametti, Stefania; Rollini, Manuela
2017-02-01
Minimally processed ready-to-eat products are considered a high-risk food because of the possibility of contamination with pathogenic bacteria, including Listeria monocytogenes from the animal reservoir, and the minimal processing they undergo. In this study, a sakacin-A anti-Listeria active package was developed and tested on thin-cut veal meat slices (carpaccio). Enriched food-grade sakacin-A was obtained from a cell-free supernatant of a Lactobacillus sakei culture and applied (0.63 mg cm -2 ) onto the surface of polyethylene-coated paper sheets to obtain an active antimicrobial package. The coating retained antimicrobial features, indicating that the process did not affect sakacin-A functionality, as evidenced in tests carried out in vitro. Thin-cut veal meat slices inoculated with Listeria innocua (a surrogate of pathogenic L. monocytogenes) were laid on active paper sheets. After 48 h incubation at 4 °C, the Listeria population was found to be 1.5 log units lower with respect to controls (3.05 vs 4.46 log colony-forming units (CFU) g -1 ). This study demonstrates the possibility of using an antimicrobial coating containing sakacin-A to inhibit or decrease the Listeria population in ready-to-eat products, thus lowering the risk of food-related diseases. © 2016 The Authors. Journal of The Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. © 2016 The Authors. Journal of The Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.
Small molecules targeting LapB protein prevent Listeria attachment to catfish muscle.
Directory of Open Access Journals (Sweden)
Ali Akgul
Full Text Available Listeria monocytogenes is a Gram-positive foodborne pathogen and the causative agent of listeriosis. L. monocytogenes lapB gene encodes a cell wall surface anchor protein, and mutation of this gene causes Listeria attenuation in mice. In this work, the potential role of Listeria LapB protein in catfish fillet attachment was investigated. To achieve this, boron-based small molecules designed to interfere with the active site of the L. monocytogenes LapB protein were developed, and their ability to prevent L. monocytogenes attachment to fish fillet was tested. Results indicated that seven out of nine different small molecules were effective in reducing the Listeria attachment to catfish fillets. Of these, three small molecules (SM3, SM5, and SM7 were highly effective in blocking Listeria attachment to catfish fillets. This study suggests an alternative strategy for reduction of L. monocytogenes contamination in fresh and frozen fish products.
Safety assessment of greenhouse hydroponic tomatoes irrigated with reclaimed and surface water.
Lopez-Galvez, Francisco; Allende, Ana; Pedrero-Salcedo, Francisco; Alarcon, Juan Jose; Gil, Maria Isabel
2014-11-17
The impact of reclaimed and surface water on the microbiological safety of hydroponic tomatoes was assessed. Greenhouse tomatoes were irrigated with reclaimed and surface water and grown on two hydroponic substrates (coconut fiber and rock wool). Water samples (n=208) were taken from irrigation water, with and without the addition of fertilizers and drainage water, and hydroponic tomatoes (n=72). Samples were analyzed for indicator microorganisms, generic Escherichia coli and Listeria spp., and pathogenic bacteria such as Salmonella spp. and Shiga-toxigenic E. coli (STEC), using multiplex real-time PCR (RT-PCR) after enrichment. The correlation between climatological parameters such as temperature and the levels of microorganisms in water samples was also determined. In irrigation water, generic E. coli counts were higher in reclaimed than in surface water whereas Listeria spp. numbers increased after adding the fertilizers in both water sources. In drainage water, no clear differences in E. coli and Listeria numbers were observed between reclaimed and surface water. No positive samples for STEC were found in irrigation water. Presumptive positives for Salmonella spp. were found in 7.7% of the water samples and 62.5% of these samples were reclaimed water. Salmonella-positive samples by RT-PCR could not be confirmed by conventional methods. Higher concentrations of E. coli were associated with Salmonella-presumptive positive samples. Climatological parameters, such as temperature, were not correlated with the E. coli and Listeria spp. counts. Tomato samples were negative for bacterial pathogens, while generic E. coli and Listeria spp. counts were below the detection limit. The prevalence of presumptive Salmonella spp. found in irrigation water (reclaimed and surface water) was high, which might present a risk of contamination. The absence of pathogens on greenhouse hydroponic tomatoes indicates that good agricultural practices (GAP) were in place, avoiding the
Fouad, A F; Kum, K-Y; Clawson, M L; Barry, J; Abenoja, C; Zhu, Q; Caimano, M; Radolf, J D
2003-08-01
Eubacterium spp. and Streptococcus spp. are virulent, commonly identified microorganisms in endodontic infections. The purpose of this study was to use molecular methods to identify these organisms in 22 infected root canals that include eight cases with preoperative clinical symptoms and five cases with a history of diabetes mellitus. The presence of Streptococcus spp. and Eubacterium spp. was examined using two sets of PCR primers specific with multiple species within the respective genera. Positive specimens had their PCR products sequenced and phylogenetically analyzed to identify the specific species. Sixteen specimens (73%) contained Eubacterium spp. and nine (41%) were positive for Streptococcus spp. Eubacterium infirmum was the most prevalent Eubacterium sp. This organism was significantly associated with a history of diabetes (OR = 9.6; P = 0.04). Streptococcus anginosus was the most common Streptococcus sp., but neither it nor any of the other streptococci were significantly associated with the clinical parameters evaluated.
Cloke, Jonathan; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron
2014-01-01
The Thermo Scientific SureTect Listeria species Assay is a new real-time PCR assay for the detection of all species of Listeria in food and environmental samples. This validation study was conducted using the AOAC Research Institute (RI) Performance Tested Methods program to validate the SureTect Listeria species Assay in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996 including amendment 1:2004 in a variety of foods plus plastic and stainless steel. The food matrixes validated were smoked salmon, processed cheese, fresh bagged spinach, cantaloupe, cooked prawns, cooked sliced turkey meat, cooked sliced ham, salami, pork frankfurters, and raw ground beef. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, fresh bagged spinach, and stainless steel surface samples) were analyzed independently as part of the AOAC-RI-controlled independent laboratory study by the University ofGuelph, Canada. Using probability of detection statistical analysis, a significant difference in favour of the SureTect assay was demonstrated between the SureTect and reference method for high level spiked samples of pork frankfurters, smoked salmon, cooked prawns, stainless steel, and low-spiked samples of salami. For all other matrixes, no significant difference was seen between the two methods during the study. Inclusivity testing was conducted with 68 different isolates of Listeria species, all of which were detected by the SureTect Listeria species Assay. None of the 33 exclusivity isolates were detected by the SureTect Listeria species Assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside of the recommended parameters open to variation, which demonstrated that the assay gave reliable performance. Accelerated stability testing was additionally conducted, validating the assay
Directory of Open Access Journals (Sweden)
Ok Kyung Koo
Full Text Available BACKGROUND: Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. METHODOLOGY/PRINCIPAL FINDINGS: The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (Lbp(LAP to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to Lbp(LAP for 1, 4, 15, or 24 h significantly (P<0.05 reduced adhesion, invasion, and transepithelial translocation of L. monocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, Lbp(LAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. Lbp(LAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, Lbp(LAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. CONCLUSIONS/SIGNIFICANCE: Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, Lbp(LAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise
Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen.
Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed
2016-12-15
Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Negar Hamidian
2017-07-01
in raw milk and traditional dairy products in Isfahan, Iran[persian]. International Journal of Environmental Health Engineering 2015;4(1:1-5. 22-Rahimi E, Momtaz H, Sharifzadeh A, Behzadnia A, Ashtari MS, Zandi Esfahani S, et al. Prevalence and antimicrobial resistance of Listeria species iIsolated from traditional dairy products in chahar Mahal & Bakhtiyari, Iran. Bulgarian Journal of Veterinary Medicine 2012;15(2:115-22. 23-Shakrian A, Karim G, Tajbakhsh E, Shfei M. Investigating the microbial contamination of traditional ice creams in Shahrakord[persian]. Journal of Food Science and Technology 2007;2(4:21-7. 24-Karim G, Razavilar V, Akhonndzade A. Investigating the contamination of Iranian traditional ice cream to important bacterial infections and food poisoning[persian]. Tehran University Faculty of Veterinary Medicine 1374;50:71-8. 25-Pacini R, Galleschi G, Tozzi E, Malloggi L, Galassi R, Quagli E. Biological hazards connected with consumption of animal origin foods. 1. Pathogenic bacteria. Industrie Alimentari 1996;35(344:27-32. 26-Rola J, Kwiatek K, Wojton B, Michalski M. Incidence of Listeria monocytogenes in raw milk and dairy products. Medycyna Weterynaryjna (Poland 1994;50(7:323-5. 27-Warke R, Kamat A, Kamat M, Thomas P. Incidence of pathogenic psychrotrophs in ice creams sold in some retail outlets in Mumbai, India. Food Control 2000;11(2:77-83. 28-Molla B, Yilma R, Alemayehu D. Listeria monocytogenes and other Listeria species in retail meat and milk products in Addis Ababa, Ethiopia. Ethiopian Journal of Health Development 2004;18(3:208-12. 29-Salehian M, Salehifar E, Esfahanizadeh M, Karimzadeh L, Rezaei R, Molanejad M. Microbial contamination in traditional ice cream and effective factors, Sari 2012[persian]. Journal of Mazandaran University of Medical Sciences 2013;23(99:28-33. 30-Akya A, Najafi F, Moradi J, Mohebi Z, Adabagher S. Prevalence of food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran. Eastern Mediterranean
Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph
2016-01-01
Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.
Listeria arpJ gene modifies T helper type 2 subset differentiation.
Kanoh, Makoto; Maruyama, Saho; Shen, Hua; Matsumoto, Akira; Shinomiya, Hiroto; Przybilla, Karin; Gouin, Edith; Cossart, Pascale; Goebel, Werner; Asano, Yoshihiro
2015-07-15
Although the T-cell subset differentiation pathway has been characterized extensively from the view of host gene regulation, the effects of genes of the pathogen on T-cell subset differentiation during infection have yet to be elucidated. Especially, the bacterial genes that are responsible for this shift have not yet been determined. Utilizing a single-gene-mutation Listeria panel, we investigated genes involved in the host-pathogen interaction that are required for the initiation of T-cell subset differentiation in the early phase of pathogen infection. We demonstrate that the induction of T helper types 1 and 2 (Th1 and Th2) subsets are separate phenomena and are mediated by distinct Listeria genes. We identified several candidate Listeria genes that appear to be involved in the host-Listeria interaction. Among them, arpJ is the strongest candidate gene for inhibiting Th2 subset induction. Furthermore, the analysis utilizing arpJ-deficient Listeria monocytogenes (Lm) revealed that the tumor necrosis factor (TNF) superfamily (Tnfsf) 9-TNF receptor superfamily (Tnfrsf) 9 interaction inhibits the Th2 response during Lm infection. arpJ is the candidate gene for inhibiting Th2 T-cell subset induction. The arpJ gene product influences the expression of Tnfsf/Tnfrsf on antigen-presenting cells and inhibits the Th2 T-cell subset differentiation during Listeria infection. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
DEFF Research Database (Denmark)
Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.
1996-01-01
Listeria monocytogenes was isolated from 11/236 (4 . 7%) caecal samples from parent flocks, providing broilers to the abattoirs investigated. Caecal samples from 2078 broilers representing 90 randomly selected broiler flocks were negative for L. monocytogenes. A total of 3080 samples from seven...... abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... isolates of L. monocytogenes since only 120/247 (48 . 6%) isolates were typable by phage typing and 230/247 (93 . 1%) L. monocytogenes belonged to serotype 01 while 6/247 (2 . 4%) belonged to 04. The discovery of a few dominating clones in each abattoir might indicate an endemic occurrence of L...
Rezai, Ramin; Ahmadi, Elham; Salimi, Behnam
2018-05-01
Listeria species are important foodborne pathogens, among which L. monocytogenes and L. ivanovii cause human listeriosis. The purpose of this study was to evaluate the incidence and antimicrobial resistance profiles of Listeria species in farmed and on-sale rainbow trout ( Oncorhynchus mykiss) in Kurdistan province, western Iran. A total of 240 fresh rainbow trout fish (120 samples from farms and 120 samples from retail outlets) were collected and analyzed phenotypically for the presence of Listeria. All Listeria isolates were differentiated with molecular techniques, and L. monocytogenes strains were identified to serotype. The antibiotic susceptibility of all Listeria isolates also was determined. Among the 240 samples, 86 (35.83%) were contaminated with Listeria: 32 samples of farmed fish and 54 samples of on-sale fish. The prevalence among the 240 samples was 9.16% (22 samples) for L. monocytogenes, 6.66% (16 samples) for L. ivanovii, 3.75% (9 samples) for L. welshimeri, 4.99% (12 samples) for L. grayi, 7.5% (18 samples) for L. innocua, and 3.75% (9 samples) for L. seeligeri. The prevalences of the human pathogenic strains L. monocytogenes and L. ivanovii were 4.16% (5 samples) and 14.16% (17 samples) in farmed fish and 5.83% (7 samples) and 7.5% (9 samples) in on-sale fish, respectively. Of the 22 L. monocytogenes isolates, 15, 3, and 4 were identified as serotypes 4b, 1/2a, and 1/2b, respectively. The highest rates of antibiotic resistance among the 86 Listeria isolates was observed against tetracycline (62.79% of all isolates), enrofloxacin (56.97%), and ciprofloxacin (38.37%). Very high resistance was also detected against penicillin (36.04%) and ampicillin (34.88%). These results highlight the potential public health threat posed by fish contaminated with Listeria species, including L. monocytogenes, in the west of Iran. Regular monitoring of Listeria contamination, upgrading of sanitary conditions in the fish industry, and prudent use of antibiotics is
Recombinant phage probes for Listeria monocytogenes
Energy Technology Data Exchange (ETDEWEB)
Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)
2007-10-03
Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.
A multiplex PCR for detection of Listeria monocytogenes and its lineages.
Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B
2016-11-01
A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
[Risk assessment of Listeria monocytogenes in deli meats and vegetable salads].
Tian, Jing; Liu, Xiu-mei
2009-09-01
To analysis risk from Listeria monocytogenes in deli meats and vegetable salads. Use Risk Ranger which is a software programme developed by the University of Hobart, Australia and answer 11 questions on affecting the risk from hazards in the specific foods by combining data from national foodborne diseases surveillance network and some references to make semi-quantitative risk assessment for the specific food. Relative risk from Listeria monocytogenes in deli meats and vegetable salads is 61 and 52, respectively. Incidence of listeriosis caused by deli meats-Listeria monocytogenes pairs and vegetable salads-Listeria monocytogenes pairs is 5.4 and 0.2 cases per million people, respectively. Risk from the former is 32 times than that from the latter. By changing the selection for some risk factors in the model, it was known that the risks from two food-hazard combinations could decrease 10 times, if taking necessary actions after processing. Deli meats is a kind of high risk food for listeriosis.
Thermal resistance of Listeria monocytogenes in sausage meat.
Farber, J M; Hughes, A; Holley, R; Brown, B
1989-01-01
The heat resistance of a mixture of 10 different strains of Listeria monocytogenes inoculated into ground meat and ground meat plus cure was examined. D-values for ground meat ranged from 1.01 min at 62 degrees C to 13.18 min at 56 degrees C. The D-values obtained for ground meat plus cure were approximately 5-8 fold times higher than those for ground meat alone. These results imply that rare meats and possibly some cooked fermented meats may not be heated adequately to inactivate Listeria.
First Trimester Listeria monocytogenes Septicemia
Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.
1997-01-01
Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This
GROWTH OF NATURALLY OCCURING Listeria innocua IN COPPA DI TESTA
Directory of Open Access Journals (Sweden)
G. Merialdi
2010-06-01
Full Text Available Coppa di testa is a traditional cooked pork salami produced in different Italian regions. The main raw material is deboned meat of pork head with the addition of tongue and rind. After a long (3-5 h high temperature (97°C cooking, additives and flavourings are added and the salami is prepared. After cooling the salami is often portioned and vacuum- packaged. In this study the growth of naturally occurring contamination of Listeria innocua in three batches of vacuum packaged Coppa di testa, stored at 4°C for 80 days, is described. The average max was 0.24 (days-1 and the average doubling time was 2.87 days. The maximum growth level ranged from 4.90 to 8.17 (log10 cfu/g. These results indicate that Coppa di testa definitely supports the growth of Listeria innocua in the considered storage conditions. Taking into account that at 4°C Listeria monocytogenes strains are associated with higher grow rates than L. innocua, these results emphasize the importance of preventing Listeria monocytogenes contamination in the production stages following cooking.
A PNPase Dependent CRISPR System in Listeria
Sesto, Nina; Touchon, Marie; Andrade, José Marques; Kondo, Jiro; Rocha, Eduardo P. C.; Arraiano, Cecilia Maria; Archambaud, Cristel; Westhof, Éric; Romby, Pascale; Cossart, Pascale
2014-01-01
The human bacterial pathogen Listeria monocytogenes is emerging as a model organism to study RNA-mediated regulation in pathogenic bacteria. A class of non-coding RNAs called CRISPRs (clustered regularly interspaced short palindromic repeats) has been described to confer bacterial resistance against invading bacteriophages and conjugative plasmids. CRISPR function relies on the activity of CRISPR associated (cas) genes that encode a large family of proteins with nuclease or helicase activities and DNA and RNA binding domains. Here, we characterized a CRISPR element (RliB) that is expressed and processed in the L. monocytogenes strain EGD-e, which is completely devoid of cas genes. Structural probing revealed that RliB has an unexpected secondary structure comprising basepair interactions between the repeats and the adjacent spacers in place of canonical hairpins formed by the palindromic repeats. Moreover, in contrast to other CRISPR-Cas systems identified in Listeria, RliB-CRISPR is ubiquitously present among Listeria genomes at the same genomic locus and is never associated with the cas genes. We showed that RliB-CRISPR is a substrate for the endogenously encoded polynucleotide phosphorylase (PNPase) enzyme. The spacers of the different Listeria RliB-CRISPRs share many sequences with temperate and virulent phages. Furthermore, we show that a cas-less RliB-CRISPR lowers the acquisition frequency of a plasmid carrying the matching protospacer, provided that trans encoded cas genes of a second CRISPR-Cas system are present in the genome. Importantly, we show that PNPase is required for RliB-CRISPR mediated DNA interference. Altogether, our data reveal a yet undescribed CRISPR system whose both processing and activity depend on PNPase, highlighting a new and unexpected function for PNPase in “CRISPRology”. PMID:24415952
Pine, L; Kathariou, S; Quinn, F; George, V; Wenger, J D; Weaver, R E
1991-01-01
We have developed a simple test that differentiates between virulent and avirulent Listeria species as defined by the mouse 50% lethal doses (LD50S). The assay is based on trypan blue-revealed cytopathogenic effects that are produced during the infection of the human enterocytelike cell line Caco-2. These effects were elicited only by Listeria strains that had an intraperitoneal mouse LD50 less than 10(8) and were not produced by nonhemolytic, avirulent strains of Listeria monocytogenes gener...
Uji Infeksi Mycosphaerella spp Terhadap Bibit Eucalyptus spp
Lidya Morita Sondang
2009-01-01
Tujuan penelitian ini adalah untuk mengetahui tingkat ketahanan 2 klon Eucalyptus spp yaitu Eucalyptus grandis x Eucalyptus pellita dan Eucalyptus grandis x Eucalyptus urophylla terhadap Mycosphaerella spp serta mengetahui virulensi Mycospaherella spp pada 2 kelas umur (2 dan 3 bulan) pada tanaman Eucalyptus spp. Penelitian ini dilaksanakan dengan pengambilan sampel bibit tanaman Eucalyptus grandis x Eucalyptus pellita dan Eucalyptus grandis x Eucalyptus urophylla dari pembibitan PT.Toba Pulp...
Sampers, Imca; Jacxsens, Liesbeth; Luning, Pieternel A; Marcelis, Willem J; Dumoulin, Ann; Uyttendaele, Mieke
2010-08-01
A diagnostic instrument comprising a combined assessment of core control and assurance activities and a microbial assessment instrument were used to measure the performance of current food safety management systems (FSMSs) of two poultry meat preparation companies. The high risk status of the company's contextual factors, i.e., starting from raw materials (poultry carcasses) with possible high numbers and prevalence of pathogens such as Campylobacter spp., requires advanced core control and assurance activities in the FSMS to guarantee food safety. The level of the core FSMS activities differed between the companies, and this difference was reflected in overall microbial quality (mesophilic aerobic count), presence of hygiene indicators (Enterobacteriaceae, Staphylococcus aureus, and Escherichia coli), and contamination with pathogens such as Salmonella, Listeria monocytogenes, and Campylobacter spp. The food safety output expressed as a microbial safety profile was related to the variability in the prevalence and contamination levels of Campylobacter spp. in poultry meat preparations found in a Belgian nationwide study. Although a poultry meat processing company could have an advanced FSMS in place and a good microbial profile (i.e., lower prevalence of pathogens, lower microbial numbers, and less variability in microbial contamination), these positive factors might not guarantee pathogen-free products. Contamination could be attributed to the inability to apply effective interventions to reduce or eliminate pathogens in the production chain of (raw) poultry meat preparations.
COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES
Directory of Open Access Journals (Sweden)
G. Tantillo
2013-02-01
Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.
Garedew, Legesse; Taddese, Ayele; Biru, Tigist; Nigatu, Seleshe; Kebede, Elias; Ejo, Mebrat; Fikru, Abraham; Birhanu, Tamiru
2015-05-12
Listeriosis, mostly caused by Listeria monocytogenes species, has become a major concern to public health authorities due to its clinical severity and high mortality rate, particularly in high risk groups. Currently, there is limited information regarding the prevalence and antimicrobial susceptibility profiles of listeria species in ready-to-eat foods of animal origin in Gondar town, Ethiopia. The aim of this study was to determine the prevalence and antimicrobial susceptibility pattern of Listeria species isolated from ready-to-eat food of animal origin from public dinning places in Gondar town, Ethiopia. A cross sectional study on ready-toeat foods of animal origin sampled from major supermarkets, butcher shops, pastry shops, restaurants and hotels was carried out. Culture, biochemical and sugar tests were conducted for listeria species identification and disc diffusion test was performed to study the antimicrobial susceptibility profiles of the isolates. Out of 384 food samples examined, 96 (25%) were positive for Listeria species. Listeria monocytogenes was detected in 24 (6.25%) of the samples. Listeria monocytogenes was isolated from cake, raw meat, ice cream, minced beef, fish, unpasteurized milk and pizza in that order from higher to lower rate. Assessment of antimicrobial susceptibility profile of L. monocytogenes revealed the presence of four multi-drug resistant isolates. The higher resistance rate was recorded for penicillin, nalidixic acid, tetracycline and chloramphenicol, in decreasing order. All L. monocytogenes identified in the current study were sensitive to amoxicillin, cephalothin, cloxacillin, sulfamethoxazole, gentamicin and vancomycin. The presence of L. monocytogenes including drug resistant and multidrug resistant isolates in some ready-to-eat food items is an indicator of the presence of public health hazards to the consumer, particularly to the high-risk groups. Hence awareness creation on food safety and implementation of regulations
The Presence and Prevalence of Listeria Species in Milk and Herby Cheese in and Around Van
SAĞUN, Emrullah; SANCAK, Yakup Can; İŞLEYİCİ, Özgür; EKİCİ, Kamil
2014-01-01
In this study 250 raw milk and 254 herby cheese samples collected from Van city center and neighboring villages were investigated in terms of Listeria species. For Listeria isolation,the method recommended by the FDA was used.Of the raw milk samples,6 (2.40 %)were found to be positive with regard to Listeria; 3 (1.20 %)had L.monocytogenes, 1 (0.40 %)L.innocua and 1 (0.40 %)L.welshimeri. Of the herby cheese samples,13 (5.11 %)were found to be positive with regard to Listeria;10 (3.93 %)had...
Lu, J; Struewing, I; Vereen, E; Kirby, A E; Levy, K; Moe, C; Ashbolt, N
2016-02-01
This study investigated waterborne opportunistic pathogens (OPs) including potential hosts, and evaluated the use of Legionella spp. for indicating microbial water quality for OPs within a full-scale operating drinking water distribution system (DWDS). To investigate the occurrence of specific microbial pathogens within a major city DWDS we examined large volume (90 l drinking water) ultrafiltration (UF) concentrates collected from six sites between February, 2012 and June, 2013. The detection frequency and concentration estimates by qPCR were: Legionella spp. (57%/85 cell equivalent, CE l(-1) ), Mycobacterium spp. (88%/324 CE l(-1) ), Pseudomonas aeruginosa (24%/2 CE l(-1) ), Vermamoeba vermiformis (24%/2 CE l(-1) ) and Acanthamoeba spp. (42%/5 cyst equivalent, CE l(-1) ). There was no detection of the following microorganisms: human faecal indicator Bacteroides (HF183), Salmonella enterica, Campylobacter spp., Escherichia coli O157:H7, Giardia intestinalis, Cryptosporidium spp. or Naegleria fowleri. There were significant correlations between the qPCR signals of Legionella spp. and Mycobacterium spp., and their potential hosts V. vermiformis and Acanthamoeba spp. Sequencing of Legionella spp. demonstrated limited diversity, with most sequences coming from two dominant groups, of which the larger dominant group was an unidentified species. Other known species including Legionella pneumophila were detected, but at low frequency. The densities of Legionella spp. and Mycobacterium spp. were generally higher (17 and 324 folds, respectively) for distal sites relative to the entry point to the DWDS. Legionella spp. occurred, had significant growth and were strongly associated with free-living amoebae (FLA) and Mycobacterium spp., suggesting that Legionella spp. could provide a useful DWDS monitoring role to indicate potential conditions for non-faecal OPs. The results provide insight into microbial pathogen detection that may aid in the monitoring of microbial water
Occurrence of Campylobacter spp. and Cryptosporidium spp. in seagulls (Larus spp.).
Moore, John E; Gilpin, Deidre; Crothers, Elizabeth; Canney, Anne; Kaneko, Aki; Matsuda, Motoo
2002-01-01
An investigation was carried out into the prevalence of thermophilic Campylobacter subspecies (spp.) and Cryptosporidium spp. in fresh fecal specimens collected from members of the gull family (Larus spp.) from three coastal locations of Northern Ireland. A total of 205 fresh fecal specimens were collected from gulls, of which 28 of 205 (13.7%) were positive for Campylobacter spp. and none of 205 for Cryptosporidium spp. Of these campylobacters, 21 of 28 (75%) isolates obtained belonged to the urease-positive thermophilic Campylobacter (UPTC) taxon, followed by five of 28 (17.9%) Campylobacter lari and 2/28 (7.1%) Campylobacter jejuni. It is significant that seagulls are the sole warm-blooded animal host of this bacterial taxon in Northern Ireland. It is proposed that physiological adaptation to starvation by gulls may lead to increased concentrations of urea through energy production from protein, yielding increased levels of urea for metabolism by UPTC organisms. In general, the possibility exists that environmental contamination of surface waters with campylobacters might be mediated by wild birds (such as gulls), where such waters are used for recreational purposes or where such waters are consumed untreated, might represent a risk to public health.
[Listeria monocytogenes nosocomial infection in the maternity ward].
Jean, D; Croize, J; Hirtz, P; Legeais, C; Pelloux, I; Favier, M; Mallaret, M R; Le Noc, P; Rambaud, P
1991-01-01
Nosocomial infection with Listeria monocytogenes 4b occurred in January 1990 in a maternity hospital in Grenoble. The 3 patients involved were born within a 24 hour-interval. The premature newborn responsible for contamination was asymptomatic. Two other newborns without any perinatal infectious risk presented with meningitis, one on the 5th day of life in the maternity hospital, the other one on the 11th day while already at home. The 3 strains of Listeria had the same serovar and lysovar. Epidemiologic investigations led to suspect a contamination in the delivery room and during the care of the children. Strict respect of hygiene orders is imperative to avoid nosocomial infections.
Pérez-Rodríguez, F; Castro, R; Posada-Izquierdo, G D; Valero, A; Carrasco, E; García-Gimeno, R M; Zurera, G
2010-10-01
Cooked meat ready-to-eat products are recognized to be contaminated during slicing which, in the last years, has been associated with several outbreaks. This work aimed to find out possible relation between the hygiene practice taking place at retail point during slicing of cooked meat products in small and medium-sized establishments (SMEs) and large-sized establishments (LEs) and the microbiological quality of sliced cooked meat products. For that, a checklist was drawn up and filled in based on scoring handling practice during slicing in different establishments in Cordoba (Southern Spain). In addition, sliced cooked meats were analyzed for different microbiological indicators and investigated for the presence of Listeria spp. and Listeria monocytogenes. Results indicated that SMEs showed a more deficient handling practices compared to LEs. In spite of these differences, microbiological counts indicated similar microbiological quality in cooked meat samples for both types of establishments. On the other hand, Listeria monocytogenes and Listeria inocua were isolated from 7.35% (5/68) and 8.82% (6/68) of analyzed samples, respectively. Positive samples for Listeria spp. were found in establishments which showed acceptable hygiene levels, though contamination could be associated to the lack of exclusiveness of slicers at retail points. Moreover, Listeria spp presence could not be statistically linked to any microbiological parameters; however, it was observed that seasonality influenced significantly (Phygiene practices, focused specially on SMEs. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Clouser, C S; Doores, S; Mast, M G; Knabel, S J
1995-04-01
This study was undertaken to determine whether the incidence of either Salmonella spp. or Listeria monocytogenes on turkeys at three commercial processors could be related to the type of defeathering system: 1) conventional, 58 C common bath scald; 2) kosher, 7 C common bath scald; or 3) steam-spray, 62 C nonimmersion scald. Flocks were sampled before defeathering, after defeathering, and after chill at each facility. The incidence of Salmonella-positive turkeys significantly increased subsequent to conventional defeathering (10 positive out of 14) as compared with before defeathering (3/14). The number of Salmonella-positive carcasses following kosher (0/14) and steam-spray (2/14) defeathering were similar to the number of Salmonella-positive carcasses found prior to defeathering (1/14 and 3/14, respectively). The incidence of Salmonella-positive carcasses following chill was slightly lower, but not significantly different than the number of Salmonella-positive carcasses found immediately following defeathering at all processors (8/14, 0/14, 1/14 for conventional, kosher, and steam-spray processors, respectively). Although L. monocytogenes was detected on turkeys sampled before chilling (2/10, kosher) and after chilling (8/14, kosher; 1/14, conventional), no L. monocytogenes was detected on turkeys at any of the processors prior to the evisceration process. Flocks with high aerobic plate counts prior to processing were more likely to contain Salmonella-positive birds throughout processing. Aerobic plate counts of all flocks were similar after chill whether or not Salmonella spp. and L. monocytogenes were detected.
Rahimi, Ebrahim; Momtaz, Hassan; Behzadnia, Asma; Baghbadorani, Zeinab Torki
2014-01-01
Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. R...
Lebow, Noelle K; DesRocher, Lisa D; Younce, Frank L; Zhu, Mei-Jun; Ross, Carolyn F; Smith, Denise M
2017-12-01
Cold-smoked salmon (CSS) production lacks a validated kill step for Listeria monocytogenes. Although Listeria spp. are reduced by nisin or high-pressure processing (HPP), CSS muscle discoloration is often observed after HPP. Effects of nisin and low-temperature HPP on L. innocua survival (nonpathogenic surrogate for L. monocytogenes), spoilage organism growth, color, and sensory preference and peelability of CSS were studied. Cold-smoked sockeye salmon (Oncorhynchus nerka) fillets ± nisin (10 μg/g) were inoculated with a 3-strain L. innocua cocktail, vacuum-packaged, frozen at - 30 °C, and high-pressure processed in an ice slurry within an insulated sleeve. Initial experiments indicated that nisin and HPP for 120 s at 450 MPa (N450) and 600 MPa (N600) were most effective against L. innocua, and thus were selected for further storage studies. L. innocua in N450 and N600-treated CSS was reduced 2.63 ± 0.15 and 3.99 ± 0.34 Log CFU/g, respectively, immediately after HPP. L. innocua and spoilage growth were not observed in HPP-treated CSS during 36 d storage at 4 °C. Low-temperature HPP showed a smaller increase in lightness of CSS compared to ambient-temperature HPP performed in previous studies. Sensory evaluation indicated that overall liking of CSS treated with N450 and N600 were preferred over the control by 61% and 62% of panelists, respectively (P high-risk ready-to-eat product that may be contaminated with L. monocytogenes. Results showed that nisin combined with high-pressure processing at low temperature, reduced the population of Listeria and controlled the spoilage organisms during storage. As an added benefit, high-pressure processing at low temperature may reduce lightening of the salmon flesh, leading to enhanced consumer preference. © 2017 Institute of Food Technologists®.
Plazomicin is a next-generation aminoglycoside with a potentially improved safety profile compared to other aminoglycosides. This study assessed plazomicin MICs and MBCs in four Brucella spp. reference strains. Like other aminoglycosides and aminocyclitols, plazomicin MBC values equaled MIC values ...
Methods for detecting pathogens in the beef food chain: an overview
The main food-borne pathogens of concern in the beef chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella. Other pathogens, including Listeria monocytogenes and Campylobacter spp. may also be present and pose contamination concerns in both the cattle production environment and bee...
Sant'Ana, Anderson S.; Barbosa, Matheus S.; Destro, Maria Teresa; Landgraf, Mariza; Franco, Bernadette D. G. M.
2012-01-01
Growth potential (delta) is defined as the difference between the population of a microorganism at the end of shelf-life of specific food and its initial population. The determination of 6 of Salmonella and Listeria monocytogenes in RTE vegetables can be very useful to determine likely threats to food safety. However, little is known on the behavior of these microorganisms in several RTE vegetables. Therefore, the aim of this study was to determine the delta of both pathogens in nine differen...
Directory of Open Access Journals (Sweden)
Luján Roca DA
2013-01-01
Full Text Available INFECTION - LIMA, PERU Introduction: Urinary tract infection (UTI is one of the most common infections in clinical practice. Gram negative bacteria as Klebsiella pneumoniae, Serratia spp. and Acinetobacter spp. can cause UTI. Objective: To study antibiotic resistance in K. pneumoniae, Serratia spp. and Acinetobacter spp. strains isolated from UTI Material and methods: Urine cultures were collected from January 2003 to December 2003. Identification of isolated bacteria included biochemical characteristics. Bauer-Kirby disc diffusion test was performed. Results: A total of 106 strains were evaluated (41 of K. pneumoniae, 28 of Serratia spp. and 37 of Acinetobacter spp.. Among K. pneumoniae isolates resistance to ampicillin (83% was remarkable. The Serratia spp. isolates displayed a high level of resistance to nalidixic acid (79% and gentamicin (75%. In Acinetobacter spp. isolates high resistance rates were observed against amikacin (81%, gentamicin (67% and trimethoprim/sulfamethoxazole(71%. Conclusions: In general, antibiotic resistance patterns were high. Acinetobacter spp. showed elevated resistance rates (>50% against antibiotics included.
Enterocin CRL35 inhibits Listeria monocytogenes in a murine model.
Salvucci, Emiliano; Saavedra, Lucila; Hebert, Elvira Maria; Haro, Cecilia; Sesma, Fernando
2012-01-01
Listeria monocytogenes is a foodborne pathogen causative of opportunistic infections. Listeriosis is associated with severe infections in pregnant women causing abortion or neonatal listeriosis. An alternative to antibiotics are safe novel bacteriocins peptides such as enterocin CRL35 with strong antilisterial activity produced by Enterococcus mundtii CRL35. In the present paper, our goal is to study the effectiveness of this peptide and the producer strain in a murine model of pregnancy-associated listeriosis. A single dose of 5×10(9) colony-forming unit of L. monocytogenes FBUNT (Faculty of Biochemistry-University of Tucumán) resulted in translocation of pathogen to liver and spleen of BALB/c pregnant mice. The maximum level of Listeria was observed on day 3 postinfection. Interestingly, the intragastric administration of enterocin CRL35 significantly reduced the translocation of the pathogen to vital organs. On the other hand, the preadministration of E. mundtii CRL35 slightly inhibited this translocation. Listeria infection caused a significant increase in polymorphonuclear leukocytes at day 3 postinfection compared to the noninfected group. This value was reduced after the administration of enterocin CRL35. No significant changes were observed in either white blood cells or lymphocytes counts. Based on the data presented in the present work enterocin CRL35 would be a promising alternative for the prevention of Listeria infections.
Listeria monocytogenes infection of HD11, chicken macrophage-like cells.
Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G
2017-04-01
Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.
Prevalence, antimicrobial resistance profiles of Listeria ...
African Journals Online (AJOL)
Listeria monocytogenes is known to cause epidemic and sporadic cases of listeriosis. The present study investigated the occurrence, antibiograms and molecular serotypes of the organism in various retail outlets in Gaborone, Botswana. Food samples were obtained randomly from selected supermarkets and street vendors ...
Listeria monocytogenes : nog steeds een probleem?
Beumer, R.R.
2011-01-01
Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,
Wild birds and silage as reservoirs of Listeria in the agricultural environment.
Fenlon, D R
1985-12-01
A method for the isolation of listeria which enabled a more rapid detection of the organism was used to examine samples of silage and bird faeces. Faecal samples indicated that seagulls feeding at sewage works had a higher rate of carriage than those elsewhere. Faecal samples from rooks generally suggested a low incidence of listeria except on one occasion when eight of twenty samples contained Listeria monocytogenes: this coincided with the nesting season and the peak period for listeriosis in sheep. The incidence of L. monocytogenes in clamp silages ranged from 2.5-5.9%, but in samples of big bale silages the incidence was 22.2% and, when mouldy samples were selected, 44%.
Culturing Stool Specimens for Campylobacter spp., Pennsylvania, USA
M’ikanatha, Nkuchia M.; Dettinger, Lisa A.; Perry, Amanda; Rogers, Paul; Reynolds, Stanley M.
2012-01-01
In 2010, we surveyed 176 clinical laboratories in Pennsylvania regarding stool specimen testing practices for enteropathogens, including Campylobacter spp. Most (96.3%) routinely test for Campylobacter spp. In 17 (15.7%), a stool antigen test is the sole method for diagnosis. We recommend that laboratory practice guidelines for Campylobacter spp. testing be developed. PMID:22377086
Novel Cadmium Resistance Determinant in Listeria monocytogenes.
Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia
2017-03-01
Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and
Aouaj, Y.; Spanjaard, L.; van Leeuwen, N.; Dankert, J.
2002-01-01
Two hundred and seven cases of listeria meningitis that occurred in The Netherlands over 20 years were reviewed to study associations between Listeria monocytogenes serotype, age, underlying disease, and outcome. The mean annual incidence per 100000 population was 0.12 in 1981-90, decreasing to 0.07
Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages
Directory of Open Access Journals (Sweden)
Hristo Daskalov
2014-03-01
Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.
Directory of Open Access Journals (Sweden)
Tian Ding
2017-05-01
Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.
Identification of Listeria monocytogenes on Green Mussels and Cockle Shell
Directory of Open Access Journals (Sweden)
Winiati Puji Rahayu
2017-02-01
Full Text Available AbstractGreen mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animal protein which is many cultivated in Indonesia because their price is relatively affordable. This study was conducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samples of cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. The target gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant of virulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTG CCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescence signals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeria monocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminated by Listeria welshimeri.
[Analysis of antibiotic susceptibility of foodborne Listeria monocytogenes in China].
Yang, Yang; Fu, Ping; Guo, Yunchang; Liu, Xiurmei
2008-03-01
To study the antibiotic susceptibility of foodborne Listeria monocytogenes in China. The susceptibilities of 476 strains of foodborne Listeria monocytogenes to antibiotics were determined in Broth Microdilution Susceptibility Testing in Clinical and Laboratory Standards Institute. The antibiotics of gentamicin, ampicillin, penicillin, tetracycline, doxycycline, imipenem, erythromycin, ciprofloxacin, levofloxacin, cephalothin, rifampin, vancomycin, chloramphenicol, Trimethoprim-sulfamethoxazole, ampicillin-sulbactam were used. The rates of antibiotic resistance in 467 is olates were 4.5%. Tetracycline resistance was most prevalent, accouting for 4.07% . The foods that the rates of antibiotic resistance were highest were vegetable (10%). Among 14 provinces, Jilin, Hubei and Hebei were the third top, the rate of which were 19.6% and 9.1% and 8%, respectively. It was suggested that antibiotic resistance exists in foodborne Listeria monocytogenes to a certain extent in China. It should pay more attention to the use of drugs in prevention and clinic treatment to reduce the antibiotic resistant strains.
The presence of Listeria monocytogenes on the surfaces of equipment and workers' hands during different production stages, as well as on fish skin and meat during processing and storage of cold-smoked trout, was investigated. Listeria monocytogenes was recovered from 10 (6.06%) of a total 165 cotto...
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
Directory of Open Access Journals (Sweden)
César Augusto Garcia
2007-09-01
Full Text Available
140 amostras de afluentes e efluentes de matadouros frigoríficos da cidade de Goiânia - GO, foram analisados com vistas a avaliar o grau de eficiência dos sistemas de tratamento de efluentes, tomando como referência o microrganismo Listeria sp., além de se quantificar este microrganismo. Através da técnica de NMP (Número Mais Provável concluiu-se que as indústrias já captavam água contaminada por Listeria sp. e que o sistema de tratamento de efluentes utilizado não demonstrou eficiência com relação a este microrganismo.
One hundred and forty portions of slaughterhouses wastewaters in Goiânia-GO, BRAZIL, were analysed for efficacy of effluents treatment system to Listeria sp. and to count this microorganism. With NMP method were concluded, between others answers, that slaughterhouses received water with Listeria sp., and that effluents treatment system doesn’t had efficacy to these bacteria.
Listeria monocytogenes and Shigella flexneri Activate the NLRP1B Inflammasome.
Neiman-Zenevich, Jana; Stuart, Sarah; Abdel-Nour, Mena; Girardin, Stephen E; Mogridge, Jeremy
2017-11-01
Activation of the innate immune receptor NLRP1B leads to the formation of an inflammasome, which induces autoproteolytic processing of pro-caspase-1, and ultimately to the release of inflammatory cytokines and to the execution of pyroptosis. One of the signals to which NLRP1B responds is metabolic stress that occurs in cells deprived of glucose or treated with metabolic inhibitors. NLRP1B might therefore sense microbial infection, as intracellular pathogens such as Listeria monocytogenes and Shigella flexneri cause metabolic stress as a result of nutrient scavenging and host cell damage. Here we addressed whether these pathogens activate the NLRP1B inflammasome. We found that Listeria infection activated the NLRP1B inflammasome in a reconstituted fibroblast model. Activation of NLRP1B by Listeria was diminished in an NLRP1B mutant shown previously to be defective at detecting energy stress and was dependent on the expression of listeriolysin O (LLO), a protein required for vacuolar escape. Infections of either Listeria or Shigella activated NLRP1B in the RAW264.7 murine macrophage line, which expresses endogenous NLRP1B. We conclude that NLRP1B senses cellular infection by distinct invasive pathogens. Copyright © 2017 American Society for Microbiology.
Molecular detection of Bartonella spp. and Rickettsia spp. in bat ectoparasites in Brazil.
do Amaral, Renan Bressianini; Lourenço, Elizabete Captivo; Famadas, Kátia Maria; Garcia, Amanda Barbosa; Machado, Rosangela Zacarias; André, Marcos Rogério
2018-01-01
The family Streblidae comprises a monophyletic group of Hippoboscoidea, hematophagous dipterans that parasitize bats. Bartonella spp. and Rickettsia spp. have been reported in bats sampled in Europe, Africa, Asia, North, Central and South America. However, there are few reports on the Bartonella and Rickettsia bacteria infecting Hippoboscoidea flies and mites. While Spinturnicidae mites are ectoparasites found only in bats, those belonging to the family Macronyssidae comprise mites that also parasitize other mammal species. This study investigates the occurrence and assesses the phylogenetic positioning of Bartonella spp. and Rickettsia spp. found in Streblidae flies and Spinturnicidae and Macronyssidae mites collected from bats captured in Brazil. From May 2011 to April 2012 and September 2013 to December 2014, 400 Streblidae flies, 100 Macronyssidaes, and 100 Spinturnicidae mites were collected from bats captured in two sites in northeastern Nova Iguaçu, Rio de Janeiro, southeastern Brazil. Forty (19.8%) out of 202 Streblidae flies were positive for Bartonella spp. in qPCR assays based on the nuoG gene. Among the flies positive for the bacterium, six (18%) were Paratrichobius longicrus, seven (29%) Strebla guajiro, two (40%) Aspidoptera phyllostomatis, five (11%) Aspidoptera falcata, one (10%) Trichobius anducei, one (25%) Megistopoda aranea, and 18 (32%) Trichobius joblingi, and collected from bats of the following species: Artibeus lituratus, Carollia perspicillata, Artibeus planirostris, Sturnira lilium, and Artibeus obscurus. Six sequences were obtained for Bartonella (nuoG [n = 2], gltA [n = 2], rpoB [n = 1], ribC = 1]). The phylogenetic analysis based on gltA (750pb) gene showed that the Bartonella sequences clustered with Bartonella genotypes detected in bats and ectoparasites previously sampled in Latin America, including Brazil. Only one sample (0.49%) of the species Trichobius joblingi collected from a specimen of Carollia perspicillata was positive
IDENTIFICATION OF DIFFERENT FUSARIUM SPP. IN ALLIUM SPP. IN GERMANY.
Boehnke, B; Karlovsky, P; Pfohl, K; Gamliel, A; Isack, Y; Dehne, H W
2015-01-01
In 2013 Allium cepa bulbs from different fields in Northern and Southern Germany, seeds and sets from onion breeders were analysed for infestation with Fusarium species. The same investigation was done in 2014 with different edible Allium spp. from local markets. Different Fusarium spp. were isolated and identified by morphological characterisation. 24 different Fusarium spp. were identified. The diversity of Fusarium spp. and the intensity of infestation was higher on edible bulbs compared to the younger sets and seeds. The analysed onions and other edible Allium spp. from local markets showed also high contents of different Fusarium species. The most prevalent identified Fusarium sp. in the analysed Allium spp. in Germany was Fusarium oxysporum which can cause the Fusarium Basal Rot, followed by Fusarium solani. Fusarium proliferatum, which can cause the Fusarium Salmon Blotch in onions, could be detected in about half of the sampled onion fields and in approximately 10% of all analysed onions from fields. Also in the onion sets, on the surface of the seeds and in other edible Allium spp. F. proliferatum could be identified. Besides F. proliferatum, further mycotoxin producing Fusarium spp. like Fusarium equiseti or Fusarium tricinctum were identified. Other Fusarium spp. like Fusarium sporotrichioides and Fusarium poae were first described in Allium sp. in this study. The two most prevalent Fusarium spp. F. oxysporum and F. solani are able to produce mycotoxins like enniatins, fumonisins, moniliformin and T-2 toxins. Fusarium sp. like F. proliferatum, F. equiseti and F. tricinctum are able to produce additional toxins like beauvericins, zearalenone and diacetoscirpenol. This high number of Fusarium spp., which are able to produce a broad spectrum of different mycotoxins, could be a potential health risk for human beings and livestock.
2007-04-01
Escherichia coli, pathogenic Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Campylobacter jejuni and Yersinia enterocolitica...Marburg virus V12. Monkey pox virus V13. Rift Valley fever virus V14. Tick-borne...Burkholderia pseudomallei (Pseudomonas pseudomallei) B10. Salmonella typhi B11. Shigella dysenteriae B12
Szymczak, Barbara; Dąbrowski, Waldemar
2015-05-01
The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P monocytogenes in meat dumplings. In contrast, the microwave heating applied for 2 min at 600 W only reduced the count of L. monocytogenes by 1 to 2 logs. Hence, the microwave heating failed to reduce the risk of infection with this pathogen below the level permissible in the EU regulation, especially in the most contaminated samples. In this case, the efficacy of microwave heating was significantly (P monocytogenes (rho = 0.626), then by meat content in the stuffing (0.476), and to the lowest extent--by the type of meat (0.415 to 0.425). However, no Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries). © 2015 Institute of Food Technologists®
Directory of Open Access Journals (Sweden)
Chris Henning
2015-02-01
Full Text Available Twenty-two bacteriocin-producing Enterococcus isolates obtained from food and animal sources, and demonstrating activity against Listeria monocytogenes, were screened for bacteriocin-related genes using a bacteriocin PCR array based on known enterococcal bacteriocin gene sequences in the NCBI GenBank database. The 22 bacteriocin-positive (Bac+ enterococci included En. durans (1, En. faecalis (4, En. faecium (12, En. hirae (3, and En. thailandicus (2. Enterocin A (entA, enterocins mr10A and mr10B (mr10AB, and bacteriocin T8 (bacA were the most commonly found structural genes in order of decreasing prevalence. Forty-five bacteriocin genes were identified within the 22 Bac+ isolates, each containing at least one of the screened structural genes. Of the 22 Bac+ isolates, 15 possessed two bacteriocin genes, seven isolates contained three different bacteriocins, and three isolates contained as many as four different bacteriocin genes. These results may explain the high degree of bactericidal activity observed with various Bac+ Enterococcus spp. Antimicrobial activity against wild-type L. monocytogenes and a bacteriocin-resistant variant demonstrated bacteriocins having different modes-of-action. Mixtures of bacteriocins, especially those with different modes-of-action and having activity against foodborne pathogens, such as L. monocytogenes, may play a promising role in the preservation of food.
Biotechnical paving of recombinant enterocin A as the candidate of anti-Listeria agent.
Hu, Xiaoyuan; Mao, Ruoyu; Zhang, Yong; Teng, Da; Wang, Xiumin; Xi, Di; Huang, Jianzhong; Wang, Jianhua
2014-08-28
Enterocin A is a classic IIa bacteriocin isolated firstly from Enterococcus faecium CTC492 with selective antimicrobial activity against Listeria strains. However, the application of enterocin A as an anti-Listeria agent has been limited due to its very low native yield. The present work describes high production of enterocin A through codon optimization strategy and its character study. The gene sequence of enterocin A was optimized based on preferential codon usage in Pichia pastoris to increase its expression efficiency. The highest anti-Listeria activity reached 51,200 AU/ml from 180 mg/l of total protein after 24 h of induction in a 5-L fermenter. Recombinant enterocin A (rEntA), purified by gel filtration chromatography, showed very strong activity against Listeria ivanovii ATCC 19119 with a low MIC of 20 ng/ml. In addition, the rEntA killed over 99% of tested L. ivanovii ATCC19119 within 4 h when exposed to 4 × MIC (80 ng/ml). Moreover, it showed high stability under a wide pH range (2-10) and maintained full activity after 1 h of treatment at 80°C within a pH range of 2-8. Its antimicrobial activity was enhanced at 25 and 50 mM NaCl, while 100-400 mM NaCl had little effect on the bactericidal ability of rEntA. The EntA was successfully expressed in P. pastoris, and this feasible system could pave the pre-industrial technological path of rEntA as a competent candidate as an anti-Listeria agent. Furthermore, it showed high stability under wide ranges of conditions, which could be potential as the new candidate of anti-Listeria agent.
Host resistance of CD18 knockout mice against systemic infection with Listeria monocytogenes
Wu, Huaizhu; Prince, Joseph E.; Brayton, Cory F.; Shah, Chirayu; Zeve, Daniel; Gregory, Stephen H.; Smith, C. Wayne; Ballantyne, Christie M.
2003-01-01
Mice with targeted mutations of CD18, the common beta2 subunit of CD11/CD18 integrins, have leukocytosis, impaired transendothelial neutrophil emigration, and reduced host defense to Streptococcus pneumoniae, a gram-positive extracellular bacterium. Previous studies using blocking monoclonal antibodies suggested roles for CD18 and CD11b in hepatic neutrophil recruitment and host innate response to Listeria monocytogenes, a gram-positive intracellular bacterium. We induced systemic listeriosis in CD18 knockout (CD18-ko) and wild-type (WT) mice by tail vein injection with Listeria. By 14 days postinjection (dpi), 8 of 10 WT mice died, compared with 2 of 10 CD18-ko mice (P Listeria organisms in livers and spleens were similar in both groups at 20 min postinfection. By 3, 5, and 7 dpi, however, numbers of Listeria organisms were significantly lower in livers and spleens of CD18-ko mice than in WT mice. Histopathology showed that following Listeria infection, CD18-ko mice had milder inflammatory and necrotizing lesions in both spleens and livers than did WT mice. Cytokine assays indicated that baseline interleukin-1beta and granulocyte colony-stimulating factor (G-CSF) levels were higher in CD18-ko mice than in WT mice and that CD18-ko splenocytes produced higher levels of interleukin-1beta and G-CSF than WT splenocytes under the same amount of Listeria stimulation. These findings show that CD18 is not an absolute requirement for antilisterial innate immunity or hepatic neutrophil recruitment. We propose that the absence of CD18 in the mice results in the priming of innate immunity, as evidenced by elevated cytokine expression, and neutrophilic leukocytosis, which augments antilisterial defense.
Duplan, Florent; Davies, Saran; Filler, Serina; Abdullah, Swaid; Keyte, Sophie; Newbury, Hannah; Helps, Chris R; Wall, Richard; Tasker, Séverine
2018-03-20
Ticks derived from cats have rarely been evaluated for the presence of pathogens. The aim of this study was to determine the prevalence of Anaplasma phagocytophilum, Bartonella spp., haemoplasma species and Hepatozoon spp. in ticks collected from cats in the UK. Five hundred and forty DNA samples extracted from 540 ticks collected from cats presenting to veterinarians in UK practices were used. Samples underwent a conventional generic PCR assay for detection of Hepatozoon spp. and real-time quantitative PCR assays for detection of Anaplasma phagocytophilum and three feline haemoplasma species and a generic qPCR for detection of Bartonella spp. Feline 28S rDNA served as an endogenous internal PCR control and was assessed within the haemoplasma qPCR assays. Samples positive on the conventional and quantitative generic PCRs were submitted for DNA sequencing for species identification. Feline 28S rDNA was amplified from 475 of the 540 (88.0%) ticks. No evidence of PCR inhibition was found using an internal amplification control. Of 540 ticks, 19 (3.5%) contained DNA from one of the tick-borne pathogens evaluated. Pathogens detected were: A. phagocytophilum (n = 5; 0.9%), Bartonella spp. (n = 7; 1.3%) [including Bartonella henselae (n = 3; 0.6%) and Bartonella clarridgeiae (n = 1; 0.2%)], haemoplasma species (n = 5; 0.9%), "Candidatus Mycoplasma haemominutum" (n = 3; 0.6%), Mycoplasma haemofelis (n = 1; 0.2%), "Candidatus Mycoplasma turicensis" (n = 1; 0.2%), Hepatozoon spp. (n = 2; 0.4%), Hepatozoon felis (n = 1; 0.2%) and Hepatozoon silvestris (n = 1; 0.2%). These data provide important information on the prevalence of tick-borne pathogens in ticks infesting cats, with the identification of haemoplasma species, A. phagocytophilum, H. felis and Bartonella spp. (including B. henselae and B. clarridgeiae). This study also documents the first report of H. silvestris in ticks collected from domestic cats.
The response of foodborne pathogens to osmotic and desiccation stresses in the food chain
DEFF Research Database (Denmark)
Burgess, Catherine M.; Gianotti, Andrea; Gruzdev, Nadia
2016-01-01
In combination with other strategies, hyperosmolarity and desiccation are frequently used by the food processing industry as a means to prevent bacterial proliferation, and particularly that of foodborne pathogens, in food products. However, it is increasingly observed that bacteria, including...... human pathogens, encode mechanisms to survive and withstand these stresses. This review provides an overview of the mechanisms employed by Salmonella spp., Shiga toxin producing E. coli, Cronobacter spp., Listeria monocytogenes and Campylobacter spp. to tolerate osmotic and desiccation stresses...... and identifies gaps in knowledge which need to be addressed to ensure the safety of low water activity and desiccated food products....
REAL-TIME PCR DETECTION OF LISTERIA MONOCYTOGENES IN FOOD SAMPLES OF ANIMAL ORIGIN
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-02-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
Listeria monocytogenes Identification in Food of Animal Origin Used with Real Time PCR
Directory of Open Access Journals (Sweden)
Jaroslav Pochop
2013-10-01
Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (RT PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 20 samples of food of animal origin with incubation were detected strains of Listeria monocytogenes in 9 samples (swabs. Eleven samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.
African Journals Online (AJOL)
Nakaguchi, Y. Vol 9, No 2S (2017): Special Issue - Articles Detection of Listeria Spp. and Listeria monocytogenes in vegetables by Loop-Mediated Isothermal Amplifcation (LAMP) and multiplex Polymerase Chain Reaction (PCR) Abstract PDF. ISSN: 1112-9867. AJOL African Journals Online. HOW TO USE AJOL.
A survey of Babesia spp. and Hepatozoon spp. in wild canids in Israel.
Margalit Levi, Maayan; Nachum-Biala, Yaarit; King, Roni; Baneth, Gad
2018-03-20
Babesia spp. and Hepatozoon spp. are apicomplexan parasites that infect a variety of animals, including canids. Their life-cycle includes an invertebrate hematophagous vector as a definitive host and vertebrates as intermediate hosts. The aims of this study were to investigate the prevalence and risk factors for Babesia spp. and Hepatozoon spp. infections in wild golden jackals (Canis aureus) and red foxes (Vulpes vulpes) in Israel and to compare spleen with blood sample polymerase chain reaction (PCR) for the detection of infection. Blood and spleen samples from 109 golden jackals and 21 red foxes were tested by PCR for the detection of Babesia spp. and Hepatozoon spp. using primers for the 18S ribosomal (r) RNA gene. Hepatozoon canis was detected in 50/109 (46%) of the jackals and 9/21 (43%) of the foxes. "Babesia vulpes" (the Babesia microti-like piroplasm) was detected in 4/21 (19%) of the foxes and in none of the jackals. A previously unknown genotype termed Babesia sp. MML related to Babesia lengau (96-97% identity) was detected in 1/109 (1%) of the jackals and 4/21 (19%) of the foxes. Further characterization of this genotype carried out by PCR of the rRNA internal transcribed spacer 2 (ITS2) indicated that it had only 87% identity with the B. lengau ITS2. Sex (male or female), age (juvenile or adult) and geographic zone (North, Central or South Israel) were not found to be significant risk factors for these protozoan infections. The prevalence of "B. vulpes" and Babesia sp. MML infections was significantly higher in foxes compared to jackals (χ 2 = 15.65, df = 1, P < 0.005), while there was no statistically significant difference in the rate of H. canis infection between these two canid species. A fair agreement beyond chance between identification in the blood and spleen of H. canis was found in 21 animals from which both blood and spleen samples were available (k = 0.33). This study describes a high prevalence of H. canis infection in
The effect of centaurein on interferon-γ expression and Listeria infection in mice
International Nuclear Information System (INIS)
Chang, S.-L.; Yeh, H.-H.; Lin, Y.-S.; Chiang, Y.-M.; Wu, T.-K.; Yang, W.-C.
2007-01-01
We previously found that centaurein enhanced IFN-γ transcription in T cells. Here, we demonstrate that centaurein increased the IFN-γ expression in T and NK cells and the serum IFN-γ level in mice. Centaurein elevated the transcription of T-bet but not GATA-3, which is consistent with its effect on that of IFN-γ but not IL-4. Additionally, centaurein effectively protected mice against Listeria infection. Moreover, centaurein per se or in combination with antibiotics could treat Listeria infection. Our mechanistic studies suggest that centaurein augments IFN-γ expression via a transcriptional up-regulation of T-bet and that centaurein protects against or treats Listeria infection via a modulation of IFN-γ expression
DEFF Research Database (Denmark)
Larsen, Charlotte Nexmann; Nørrung, Birgit; Sommer, Helle Mølgaard
2002-01-01
The virulence of different pulsed-field gel electrophoresis (PFGE) types of Listeria monocytogenes was examined by monitoring their ability to invade Caco-2 cells. Strains belonging to seven different PFGE types originating from both foods and humans were included. No significant differences...
Raeisi, Mojtaba; Tabaraei, Alijan; Hashemi, Mohammad; Behnampour, Nasser
2016-12-05
The present study was conducted to preserve the microbial quality of chicken meat fillets during storage time by using sodium alginate active coating solutions incorporated with different natural antimicrobials including nisin, Cinnamomum zeylanicum (cinnamon), and rosemary essential oils (EOs) which were added individually and in combination. The samples were stored in refrigeration condition for 15days and were analyzed for total viable count, Enterobacteriaceae count, lactic acid bacteria count, Pseudomonas spp. count, psychrotrophic count, and yeast and mold count, as well as fate of inoculated Listeria monocytogenes at 3-day intervals. Results indicated that values of tested microbial indicators in all samples increased during storage. Antimicrobial agents, when used in combination, had stronger effect in preserving the microbial quality of chicken meat samples rather than their individual use and the strongest effect was observed in samples coated with alginate solution containing both cinnamon and rosemary EOs (CEO+REO). However, all treatments significantly inhibited microbial growth when compared to the control (Ppreservatives is recommended in meat products especially in chicken meats. Copyright © 2016. Published by Elsevier B.V.
Commensal microbes provide first line defense against Listeria monocytogenes infection
Littmann, Eric R.; Kim, Sohn G.; Morjaria, Sejal M.; Ling, Lilan; Gyaltshen, Yangtsho; Taur, Ying; Leiner, Ingrid M.
2017-01-01
Listeria monocytogenes is a foodborne pathogen that causes septicemia, meningitis and chorioamnionitis and is associated with high mortality. Immunocompetent humans and animals, however, can tolerate high doses of L. monocytogenes without developing systemic disease. The intestinal microbiota provides colonization resistance against many orally acquired pathogens, and antibiotic-mediated depletion of the microbiota reduces host resistance to infection. Here we show that a diverse microbiota markedly reduces Listeria monocytogenes colonization of the gut lumen and prevents systemic dissemination. Antibiotic administration to mice before low dose oral inoculation increases L. monocytogenes growth in the intestine. In immunodeficient or chemotherapy-treated mice, the intestinal microbiota provides nonredundant defense against lethal, disseminated infection. We have assembled a consortium of commensal bacteria belonging to the Clostridiales order, which exerts in vitro antilisterial activity and confers in vivo resistance upon transfer into germ free mice. Thus, we demonstrate a defensive role of the gut microbiota against Listeria monocytogenes infection and identify intestinal commensal species that, by enhancing resistance against this pathogen, represent potential probiotics. PMID:28588016
Hua, Yang; Kaplan, Shannon; Reshatoff, Michael; Hu, Ernie; Zukowski, Alexis; Schweis, Franz; Gin, Cristal; Maroni, Brett; Becker, Michael; Wisniewski, Michele
2012-01-01
The Roka Listeria Detection Assay was compared to the reference culture methods for nine select foods and three select surfaces. The Roka method used Half-Fraser Broth for enrichment at 35 +/- 2 degrees C for 24-28 h. Comparison of Roka's method to reference methods requires an unpaired approach. Each method had a total of 545 samples inoculated with a Listeria strain. Each food and surface was inoculated with a different strain of Listeria at two different levels per method. For the dairy products (Brie cheese, whole milk, and ice cream), our method was compared to AOAC Official Method(SM) 993.12. For the ready-to-eat meats (deli chicken, cured ham, chicken salad, and hot dogs) and environmental surfaces (sealed concrete, stainless steel, and plastic), these samples were compared to the U.S. Department of Agriculture/Food Safety and Inspection Service-Microbiology Laboratory Guidebook (USDA/FSIS-MLG) method MLG 8.07. Cold-smoked salmon and romaine lettuce were compared to the U.S. Food and Drug Administration/Bacteriological Analytical Manual, Chapter 10 (FDA/BAM) method. Roka's method had 358 positives out of 545 total inoculated samples compared to 332 positive for the reference methods. Overall the probability of detection analysis of the results showed better or equivalent performance compared to the reference methods.
CELLULAR VACCINES IN LISTERIOSIS: ROLE OF THE LISTERIA ANTIGEN GAPDH.
Directory of Open Access Journals (Sweden)
Ricardo eCalderon-Gonzalez
2014-02-01
Full Text Available The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH, and several epitopes such as the LLO peptides, LLO189–201 and LLO91–99 and the GAPDH peptide, GAPDH1–22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1–22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91–99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1–22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes.
Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH
Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M. Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L.; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Álvarez-Domínguez, Carmen
2014-01-01
The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189−201 and LLO91−99 and the GAPDH peptide, GAPDH1−22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1−22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91−99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1−22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes. PMID:24600592
African Journals Online (AJOL)
Tang, J.Y.H.. Vol 9, No 2S (2017): Special Issue - Articles Detection of Listeria Spp. and Listeria monocytogenes in vegetables by Loop-Mediated Isothermal Amplifcation (LAMP) and multiplex Polymerase Chain Reaction (PCR) Abstract PDF. ISSN: 1112-9867. AJOL African Journals Online. HOW TO USE AJOL.
African Journals Online (AJOL)
Razali, N.A.S.. Vol 9, No 2S (2017): Special Issue - Articles Detection of Listeria Spp. and Listeria monocytogenes in vegetables by Loop-Mediated Isothermal Amplifcation (LAMP) and multiplex Polymerase Chain Reaction (PCR) Abstract PDF. ISSN: 1112-9867. AJOL African Journals Online. HOW TO USE AJOL.
Investigation of Listeria, Salmonella, and toxigenic Escherichia coli in various pet foods.
Nemser, Sarah M; Doran, Tara; Grabenstein, Michael; McConnell, Terri; McGrath, Timothy; Pamboukian, Ruiqing; Smith, Angele C; Achen, Maya; Danzeisen, Gregory; Kim, Sun; Liu, Yong; Robeson, Sharon; Rosario, Grisel; McWilliams Wilson, Karen; Reimschuessel, Renate
2014-09-01
The Veterinary Laboratory Investigation and Response Network (Vet-LIRN), in collaboration with the Food Emergency Response Network (FERN) and its Microbiology Cooperative Agreement Program (MCAP) laboratories, conducted a study to evaluate the prevalence of selected microbial organisms in various types of pet foods. The goal of this blinded study was to help the Center for Veterinary Medicine prioritize potential future pet food-testing efforts. The study also increased the FERN laboratories' screening capabilities for foodborne pathogens in animal feed matrices, since such pathogens may also be a significant health risk to consumers who come into contact with pet foods. Six U.S. Food and Drug Administration FERN MCAP laboratories analyzed approximately 1056 samples over 2 years. Laboratories tested for Salmonella, Listeria, Escherichia coli O157:H7 enterohemorrhagic E. coli, and Shiga toxin-producing strains of E. coli (STEC). Dry and semimoist dog and cat foods purchased from local stores were tested during Phase 1. Raw dog and cat foods, exotic animal feed, and jerky-type treats purchased through the Internet were tested in Phase 2. Of the 480 dry and semimoist samples, only 2 tested positive: 1 for Salmonella and 1 for Listeria greyii. However, of the 576 samples analyzed during Phase 2, 66 samples were positive for Listeria (32 of those were Listeria monocytogenes) and 15 samples positive for Salmonella. These pathogens were isolated from raw foods and jerky-type treats, not the exotic animal dry feeds. This study showed that raw pet foods may harbor food safety pathogens, such as Listeria monocytogenes and Salmonella. Consumers should handle these products carefully, being mindful of the potential risks to human and animal health.
SABIL, SYAHRIANA
2015-01-01
2015 SYAHRIANA SABIL (I 111 11 273). Pasteurisasi High Temperature Short Time (HTST) Susu terhadap Listeria monocytogenes pada Penyimpanan Refrigerator. Dibimbing oleh RATMAWATI MALAKA dan FARIDA NUR YULIATI. Pasteurisasi High Temperature Short Time (HTST) merupakan proses pemanasan susu di bawah titik didih yang diharapkan dapat membunuh Listeria monocytogenes (L. monocytogenes) karena bersifat patogen dan mengakibatkan listeriosis yang merupakan penyakit zoonosis. Tu...
Directory of Open Access Journals (Sweden)
Daniel R. Rissi
2010-01-01
Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been
Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal
2012-01-01
The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.
Activation of bovine neutrophils by Brucella spp.
Keleher, Lauren L; Skyberg, Jerod A
2016-09-01
Brucellosis is a globally important zoonotic infectious disease caused by gram negative bacteria of the genus Brucella. While many species of Brucella exist, Brucella melitensis, Brucella abortus, and Brucella suis are the most common pathogens of humans and livestock. The virulence of Brucella is largely influenced by its ability to evade host factors, including phagocytic killing mechanisms, which are critical for the host response to infection. The aim of this study was to characterize the bovine neutrophil response to virulent Brucella spp. Here, we found that virulent strains of smooth B. abortus, B. melitensis, B. suis, and virulent, rough, strains of Brucella canis possess similar abilities to resist killing by resting, or IFN-γ-activated, bovine neutrophils. Bovine neutrophils responded to infection with a time-dependent oxidative burst that varied little between Brucella spp. Inhibition of TAK1, or SYK kinase blunted the oxidative burst of neutrophils in response to Brucella infection. Interestingly, Brucella spp. did not induce robust death of bovine neutrophils. These results indicate that bovine neutrophils respond similarly to virulent Brucella spp. In addition, virulent Brucella spp., including naturally rough strains of B. canis, have a conserved ability to resist killing by bovine neutrophils. Copyright © 2016 Elsevier B.V. All rights reserved.
Microbiological Survey of Packaged Ready-to-Eat Red Meats at Retail in New Zealand.
Rivas, Lucia; Horn, Beverley; Cook, Roger; Castle, Marion
2017-10-04
A microbiological survey was undertaken on packaged ready-to-eat red meats available at retail in New Zealand. A total of 1,485 samples (297 lots of five samples each) were collected according to a sampling plan based on market share and regulatory regimes (Animal Products Act 1999 and Food Act 1981) and were tested against the microbiological limits specified in Food Standards Code (FSC) 1.6.1 applicable at the time of sampling. Each lot was tested as a composite for the presence or absence of Salmonella spp., coagulase-producing staphylococci, Listeria monocytogenes, and other Listeria spp. at the end of the manufacturer's stated shelf life. Individual samples within a positive lot were subsequently enumerated for L. monocytogenes. None of the samples contained Salmonella spp. or had coagulase-producing staphylococci counts above the acceptable level specified in FSC 1.6.1 (>100 CFU/g). Data showed that 93.6% (278 of 297 lots) of ready-to-eat red meat complied with the FSC 1.6.1 criteria applicable at the time of the survey. The failure of 19 lots (6.4%) was due to the presence of L. monocytogenes from product obtained from 8 of 33 producers tested. Thirteen samples of 95 positive samples were found to contain between 50 and 500 CFU/g L. monocytogenes, but all of these samples were manufactured by the same operator. Pulsed-field gel electrophoresis typing of all of the L. monocytogenes isolates obtained from the survey identified 12 different pulsotypes. Different pulsotypes were often identified in samples from the same operator sampled on separate occasions. A total of 46 lots (15.5%) contained Listeria spp. (including L. monocytogenes). The detection of Listeria in samples may highlight the existence of problems in operator processing and/or packaging processes and suggests that improvements in good hygienic practice and implementation of more effective risk mitigation strategies are needed.
Lu, Chunye; Marjanovic, Olivera; Kiang, David
2017-01-01
ABSTRACT Listeria monocytogenes is an important foodborne pathogen. Here, we present the annotated whole genome of Listeria monocytogenes strains F14M01297-C2 and F14M01297-C4, isolated from nectarines distributed by a packing facility in California during an investigation of listeriosis associated with stone fruit in 2014. PMID:28729255
Directory of Open Access Journals (Sweden)
N. Soultos
2014-11-01
Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.
A role for host cell exocytosis in InlB-mediated internalisation of Listeria monocytogenes.
Van Ngo, Hoan; Bhalla, Manmeet; Chen, Da-Yuan; Ireton, Keith
2017-11-01
The bacterial surface protein InlB mediates internalisation of Listeria monocytogenes into human cells through interaction with the host receptor tyrosine kinase, Met. InlB-mediated entry requires localised polymerisation of the host actin cytoskeleton. Apart from actin polymerisation, roles for other host processes in Listeria entry are unknown. Here, we demonstrate that exocytosis in the human cell promotes InlB-dependent internalisation. Using a probe consisting of VAMP3 with an exofacial green fluorescent protein tag, focal exocytosis was detected during InlB-mediated entry. Exocytosis was dependent on Met tyrosine kinase activity and the GTPase RalA. Depletion of SNARE proteins by small interfering RNA demonstrated an important role for exocytosis in Listeria internalisation. Depletion of SNARE proteins failed to affect actin filaments during internalisation, suggesting that actin polymerisation and exocytosis are separable host responses. SNARE proteins were required for delivery of the human GTPase Dynamin 2, which promotes InlB-mediated entry. Our results identify exocytosis as a novel host process exploited by Listeria for infection. © 2017 John Wiley & Sons Ltd.
Methylobacterium spp. as an indicator for the presence or absence of Mycobacterium spp.
Falkinham III, Joseph O.; Williams, Myra D.; Kwait, Rebecca; Lande, Leah
2016-01-01
Objective/Background: A published survey of bacteria in showerhead biofilm samples revealed that Methylobacterium spp. and Mycobacterium spp. seldom coexisted in biofilms. Method: To confirm that information, biofilm samples were collected from household plumbing of Mycobacterium avium patients and Methylobacterium spp. and M. avium numbers were measured by direct colony counts. Results: The results demonstrated that if Methylobacterium spp. were present, Mycobacterium spp. were absent,...
Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina
2009-02-15
The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.
Coupling conducting polymers and mediated electrochemical responses for the detection of Listeria
International Nuclear Information System (INIS)
Minett, A.I.; Barisci, J.N.; Wallace, G.G.
2003-01-01
Different signal generation techniques were investigated for the development of a biosensor for Listeria monocytogenes. Conventional amperometry at an antibody-containing polypyrrole film electrode was found to be unsuccessful in detecting levels below 10 6 cells ml -1 . More successful was the coupling of a covalently modified film with the use of electron mediators in a single device. This sensor was capable of reproducibly detecting Listeria at levels of 10 5 cells ml -1 in 30 min
Bialvaei, Abed Zahedi; Kafil, Hossein Samadi; Asgharzadeh, Mohammad; Aghazadeh, Mohammad; Yousefi, Mehdi
2016-01-01
This study was conducted in Iran in order to assess the distribution of CTX-M type ESBLs producing Enterobacteriaceae. From January 2012 to December 2013, totally 198 E. coli, 139 Klebsiella spp, 54 Salmonella spp and 52 Shigella spp from seven hospitals of six provinces in Iran were screened for resistance to extended-spectrum cephalosporins. After identification and susceptibility testing, isolates presenting multiple-drug resistance (MDR) were evaluated for ESBL production by the disk combination method and by Etest using (cefotaxime and cefotaxime plus clavulanic acid). All isolates were also screened for blaCTX-M using conventional PCR. A total of 42.92%, 33.81%, 14.81% and 7.69% of the E. coli, Klebsiella spp, Salmonella spp and Shigella spp isolates were MDR, respectively. The presence of CTX-M enzyme among ESBL-producing isolates was 85.18%, 77.7%, 50%, and 66.7%, in E. coli, Klebsiella spp, Salmonella spp and Shigella spp respectively. The overall presence of CTX-M genes in Enterobacteriaceae was 15.4% and among the resistant isolates was 47.6%. This study indicated that resistance to β-lactams mediated by CTX-M enzymes in Iran had similar pattern as in other parts of the world. In order to control the spread of resistance, comprehensive studies and programs are needed. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Skinner, Delaina; Mitcham, Jessica R; Starkey, Lindsay A; Noden, Bruce H; Fairbanks, W Sue; Little, Susan E
2017-10-01
American black bears (Ursus americanus) are commonly infested with ticks throughout their range, but there are few surveys for tick-borne disease agents in bears. To characterize tick infestations and determine the prevalence of current infection with Babesia spp. and past or current infection with Ehrlichia spp. in newly re-established populations of black bears in east central and southeastern Oklahoma, US, we identified adult (n=1,048) and immature (n=107) ticks recovered from bears (n=62). We evaluated serum and whole blood samples from a subset (n=49) for antibodies reactive to, and characteristic DNA fragments of, Ehrlichia spp., as well as characteristic DNA fragments of Babesia spp. Amblyomma americanum, the most common tick identified, was found on a majority (56/62; 90%) of bears and accounted for 697/1,048 (66.5%) of all ticks recovered. Other ticks included Dermacentor variabilis (338/1,048; 32.3%) from 36 bears, Amblyomma maculatum (9/1,048; 0.9%) from three bears, and Ixodes scapularis (4/1,048; 0.4%) from three bears. Antibodies reactive to Ehrlichia spp. were detected in every bear tested (49/49; 100%); maximum inverse titers to Ehrlichia chaffeensis ranged from 64-4,096 (geometric mean titer 1,525). However, PCR failed to identify active infection with E. chaffeensis, Ehrlichia ewingii, or an Ehrlichia ruminantium-like agent. Infection with Babesia spp. was detected by PCR in 3/49 (6%) bears. Together these data confirm that tick infestations and infection with tick-borne disease agents are common in bears in the southern US. The significance of these infestations and infections to the health of bears, if any, and the identity of the Ehrlichia spp. responsible for the antibody reactivity seen, warrant further evaluation.
Han, Xuelin; Yu, Rentao; Ji, Lei; Zhen, Dongyu; Tao, Sha; Li, Shuai; Sun, Yansong; Huang, Liuyu; Feng, Zhe; Li, Xianping; Han, Gaige; Schmidt, Martina; Han, Li
Internalization of Listeria monocytogenes into non-phagocytic cells is tightly controlled by host cell actin dynamics and cell membrane alterations. However, knowledge about the impact of phosphatidylcholine cleavage driven by host cell phospholipase D (PLD) on Listeria internalization into
INK128 Exhibits Synergy with Azoles against Exophiala spp. and Fusarium spp.
Gao, Lujuan; Sun, Yi; He, Chengyan; Li, Ming; Zeng, Tongxiang; Lu, Qiaoyun
2016-01-01
Infections of Exophiala spp. and Fusarium spp. are often chronic and recalcitrant. Systemic disseminations, which mostly occur in immunocompromised patients, are often refractory to available antifungal therapies. The conserved target of rapamycin (TOR) orchestrates cell growth and proliferation in response to nutrients and growth factors, which are important for pathogenicity and virulence. INK128 is a second-generation ATP-competitive TOR inhibitor, which binds the TOR catalytic domain and selectively inhibits TOR. In the present study, we investigated the in vitro activities of INK128 alone and the interactions of INK128 with conventional antifungal drugs including itraconazole, voriconazole, posaconazole, and amphotericin B against 18 strains of Exophiala spp. and 10 strains of Fusarium spp. via broth microdilution checkerboard technique system adapted from Clinical and Laboratory Standards Institute broth microdilution method M38-A2. INK128 alone was inactive against all isolates tested. However, favorable synergistic effects between INK128 and voriconazole were observed in 61% Exophiala strains and 60% Fusarium strains, despite Fusarium strains exhibited high MIC values (4-8 μg/ml) against voriconazole. In addition, synergistic effects of INK128/itraconazole were shown in 33% Exophiala strains and 30% Fusarium strains, while synergy of INK128/posaconazole were observed in 28% Exophiala strains and 30% Fusarium strains. The effective working ranges of INK128 were 0.125-2 μg/ml and 1-4 μg/ml against Exophiala isolates and Fusarium isolates, respectively. No synergistic effect was observed when INK128 was combined with amphotericin B. No antagonism was observed in all combinations. In conclusion, INK128 could enhance the in vitro antifungal activity of voriconazole, itraconazole and posaconazole against Exophiala spp. and Fusarium spp., suggesting that azoles, especially voriconazole, combined with TOR kinase inhibitor might provide a potential strategy to
A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.
LENUS (Irish Health Repository)
van Pijkeren, Jan Peter
2012-01-31
Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.
Occurrence of Pasteuria spp. in Florida
Hewlett, T. E.; Cox, R.; Dickson, D. W.; Dunn, R. A.
1994-01-01
Two years of data collected from the Florida Nematode Assay Laboratory of the Florida Cooperative Extension Service and 4 years of data from the Florida Department of Agriculture and Consumer Services, Division of Plant Industry, were compiled to find out the distribution of Pasteuria spp. on nematodes in Florida soils. Information recorded came from 335 samples and included nematode genera with Pasteuria endospores attached, host plants associated with the samples, and the origins of the samples. Pasteuria spp. were detected on 14 different plant-parasitic nematode genera in 41 Florida counties and associated with over 39 different plant species and in seven fallow fields. Pasteuria-infected nematodes were associated with a wide range of plant hosts, although frequency of associations with these hosts reflected the sample bias of the laboratories involved. Meloidogyne and Hoplolaimus spp. were the two nematode genera most frequently associated with Pasteuria. Pasteuria spp. were observed attached to members of these two genera in 176 and 59 soil samples, respectively. PMID:19279936
Listeria monocytogenes associated kerato-conjunctivitis in four horses in Norway.
Revold, Tobias; Abayneh, Takele; Brun-Hansen, Hege; Kleppe, Signe L; Ropstad, Ernst-Otto; Hellings, Robert A; Sørum, Henning
2015-11-09
Listeria monocytogenes has been reported to cause various infectious diseases in both humans and animals. More rarely, ocular infections have been reported. To our knowledge, only two cases of Listeria keratitis have been described in horses. We report kerato-conjunctivitis in four Norwegian horses associated with L. monocytogenes. Clinically, all cases were presented with recurrent unilateral kerato-conjunctivitis. L. monocytogenes bacteria were isolated from swab samples from all cases, and cytology carried out in 3 cases was indicative of L. monocytogenes infection. The present report describes the first known cases in which L. monocytogenes has been isolated from keratitic lesions in horses in Norway. A potential risk factor may be feeding of silage or haylage, but other sources of infection cannot be ruled out. The phenotypic features including antimicrobial susceptibility and serotype of the isolates are described. Laboratory detection of L. monocytogenes demands extra caution since only low numbers of bacteria were detected in the eye-swabs, probably due to the low volume of sample material and the intracellular niche of the bacterium. A general poor response to treatment in all these cases indicates that clinicians should pay extra attention to intensity and duration of treatment if L. monocytogenes is identified in connection with equine kerato-conjunctivitis.
Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products.
Harakeh, Steve; Saleh, Imane; Zouhairi, Omar; Baydoun, Elias; Barbour, Elie; Alwan, Nisreen
2009-06-15
In this study Listeria monocytogenes (L. monocytogenes) was isolated from three traditionally consumed Lebanese dairy-based food products. One hundred and sixty four samples (45 samples of Baladi cheese, 36 samples of Shankleesh and 83 of Kishk) were collected from the Bekaa Valley in the Northeast region of Lebanon. Suspected Listeria colonies were selected and initially identified by using standard biochemical tests. Initial identification of the positive L. monocytogenes colonies was confirmed at the molecular level by Polymerase Chain Reaction (n=30) and the confirmed isolates were evaluated for their susceptibility to 10 commonly used antimicrobials. All of the 30 isolates were confirmed to be L. monocytogenes yielding a PCR product of approximately 660 base pairs (bp). L. monocytogenes was detected in 26.67%, 13.89% and 7.23% of the Baladi cheese, Shankleesh and Kishk samples, respectively. The highest resistance in L. monocytogenes isolates was noted against oxacillin (93.33%) followed by penicillin (90%). The results provide an indication of the contamination levels of dairy-based foods in Lebanon and highlight the emergence of multi-drug resistant Listeria in the environment.
Brignardello, Silvana; Sabiu, Rosangela; Tedde, Tiziana; Cocco, Enrica; Pitzalis, Gabriella; Meli, Clara; Cogoni, Maria Paola
2014-08-28
During this research 159 samples of ready-to-eat and precooked food were examined for the detection of Salmonella spp., Listeria monocytogenes , Escherichia coli , coagulase-positive staphylococci and Enterobacteriaceae , bacterial count. All samples were negative for Salmonella spp. and Listeria monocytogenes ; although a low count of coagulase-positive staphylococci (no. 5 samples) and E. coli (no. 3) was found. We proceeded with the identification of the isolates on every sample with high, moderate and low-count of Enterobacteriaceae , to better understand the microbial ecology. The Enterobacteriaceae species most frequently detected were Pantoea spp. (29.62%), Enterobacter cloacae (20.37%) and Serratia liquefaciens (12.96%); other different species of Enterobacteriaceae were detected with a ready-to-eat and precooked food, to proceed with the identification of every microorganism.
Fødevarebetinget listeria monocytogenes endokarditis
DEFF Research Database (Denmark)
Frydland, Martin; Bundgaard, Henning; Moser, Claus
2014-01-01
Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....
Draft Genome Sequence of Lactobacillus salivarius L28 Isolated from Ground Beef.
Ayala, Diana I; Cook, Peter W; Campos, David L; Brashears, Mindy M; den Bakker, Henk; Nightingale, Kendra K
2017-09-28
In this report, we describe the draft genome sequence of a newly discovered probiotic strain, Lactobacillus salivarius L28. L. salivarius L28 demonstrates antagonistic effects against human foodborne pathogens, including Escherichia coli O157:H7, Salmonella spp., and Listeria monocytogenes , in coculture experiments and food matrices. Copyright © 2017 Ayala et al.
Dwiastuti, Mutia Erti; Fajri, Melisa N; Yunimar, Yunimar
2015-01-01
Layu yang disebabkan oleh Fusarium spp. merupakan salah satu penyakit penting tanaman stroberi (Fragaria x ananassa Dutch.) di daerah subtropika, yang dapat menggagalkan panen. Penelitian bertujuan untuk mempelajari potensi Trichoderma spp. dalam mengendalikan Fusarium spp. Isolat Trichoderma spp. diisolasi dari rizosfer tanaman stroberi dan Fusarium spp. diisolasi dari tanaman stroberi yang mengalami layu fusarium. Isolat cendawan dimurnikan, dikarakterisasi, dan dibandingkan dengan isolat c...
Parola, Philippe; Cornet, Jean-Paul; Sanogo, Yibayiri Osée; Miller, R Scott; Thien, Huynh Van; Gonzalez, Jean-Paul; Raoult, Didier; Telford III, Sam R; Wongsrichanalai, Chansuda
2003-04-01
A total of 650 ticks, including 13 species from five genera, were collected from animals, from people, or by flagging of the vegetation at sites on the Thai-Myanmar border and in Vietnam. They were tested by PCR to detect DNA of bacteria of the order RICKETTSIALES: Three Anaplasma spp. were detected in ticks collected in Thailand, including (i) Anaplasma sp. strain AnDa465, which was considered a genotype of Anaplasma platys (formerly Ehrlichia platys) and which was obtained from Dermacentor auratus ticks collected from dogs; (ii) Anaplasma sp. strain AnAj360, which was obtained from Amblyomma javanense ticks collected on a pangolin; and (iii) Anaplasma sp. strain AnHl446, which was closely related to Anaplasma bovis and which was detected in Haemaphysalis lagrangei ticks collected from a bear. Three Ehrlichia spp. were identified, including (i) Ehrlichia sp. strain EBm52, which was obtained from Boophilus microplus ticks collected from cattle from Thailand; (ii) Ehrlichia sp. strain EHh324, which was closely related to Ehrlichia chaffeensis and which was detected in Haemaphysalis hystricis ticks collected from wild pigs in Vietnam; and (iii) Ehrlichia sp. strain EHh317, which was closely related to Ehrlichia sp. strain EBm52 and which was also detected in H. hystricis ticks collected from wild pigs in Vietnam. Two Rickettsia spp. were detected in Thailand, including (i) Rickettsia sp. strain RDla420, which was detected in Dermacentor auratus ticks collected from a bear, and (ii) Rickettsia sp. strain RDla440, which was identified from two pools of Dermacentor larvae collected from a wild pig nest. Finally, two bacteria named Eubacterium sp. strain Hw124 and Eubacterium sp. strain Hw191 were identified in Haemaphysalis wellingtoni ticks collected from chicken in Thailand; these strains could belong to a new group of bacteria.
Digital Repository Service at National Institute of Oceanography (India)
Kumar, S.; Parvathi, A.; George, J.; Krohne, G.; Karunasagar, Indrani; Karunasagar, Iddya
, Germany Address for correspondence Sanath Kumar ENMU 2386 1500 S, Ave K Portales, New Mexico 88130 USA e-mail: sanathkm@yahoo.com Running Title: Gene mutations and Listeria biofilm Abstract Biofilms formed by the human pathogen Listeria...
Weller, Daniel; Wiedmann, Martin
2015-01-01
While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668
9 CFR 430.4 - Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products.
2010-01-01
... post-lethality exposed ready-to-eat products. 430.4 Section 430.4 Animals and Animal Products FOOD... Control of Listeria monocytogenes in post-lethality exposed ready-to-eat products. (a) Listeria... comes into direct contact with a food contact surface which is contaminated with L. monocytogenes. (b...
Listeria monocytogenes repellence by enzymatically modified PES surfaces
Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.
2015-01-01
: The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces
Symes, Sally; Goldsmith, Paul; Haines, Heather
2015-07-01
Seed sprouts have been implicated as vehicles for numerous foodborne outbreaks worldwide. Seed sprouts pose a unique food safety concern because of the ease of microbiological seed contamination, the inherent ability of the sprouting process to support microbial growth, and their consumption either raw or lightly cooked. To examine seed sprout safety in the Australian state of Victoria, a survey was conducted to detect specific microbes in seed sprout samples and to investigate food handling practices relating to seed sprouts. A total of 298 seed sprout samples were collected from across 33 local council areas. Escherichia coli was detected in 14.8%, Listeria spp. in 12.3%, and Listeria monocytogenes in 1.3% of samples analyzed. Salmonella spp. were not detected in any of the samples. A range of seed sprout handling practices were identified as potential food safety issues in some food businesses, including temperature control, washing practices, length of storage, and storage in proximity to unpackaged ready-to-eat potentially hazardous foods.
Directory of Open Access Journals (Sweden)
Ewa Sawosz
2010-08-01
Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano
Directory of Open Access Journals (Sweden)
Gusman Vera
2014-01-01
Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.
Directory of Open Access Journals (Sweden)
Hayat Ennaji
2008-09-01
Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR
Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur
Wemekamp-Kamphuis, H.H.; Abee, T.
2004-01-01
Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat
Listeria monocytogenes growth limits and stress resistance mechanisms
Veen, van der S.
2008-01-01
The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health
Antimicrobial susceptibility profile of Listeria species isolated from ...
African Journals Online (AJOL)
The antimicrobial susceptibility profile of L. monocytogenes and other Listeria species isolated from some ready-to-eat (RTE) foods sold in Kano metropolis, north-western Nigeria was carried out using disc-diffusion method. The results obtained showed that L. monocytogenes was moderately susceptible to all the ...
Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt.
Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A
2016-01-01
The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (pbacteria was found in the samples stored at 6°C (D-10 value = 243.9 h), whereas the highest reduction in the number of the bacteria was observed in the samples stored at 15°C (D-10 value = 87.0 h). The number of L. monocytogenes was correlated with the pH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.
Investigation of Listeria monocytogenes transmission from environmental sources associated with pasture-raised chickens to poultry products is needed to determine ways to prevent potential foodborne illness. Here, we report the complete genome sequence of Listeria monocytogenes MR310, one of the iso...
Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity
Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc
2016-01-01
Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754
Tortorano, A M; Richardson, M; Roilides, E; van Diepeningen, A; Caira, M; Munoz, P; Johnson, E; Meletiadis, J; Pana, Z-D; Lackner, M; Verweij, P; Freiberger, T; Cornely, O A; Arikan-Akdagli, S; Dannaoui, E; Groll, A H; Lagrou, K; Chakrabarti, A; Lanternier, F; Pagano, L; Skiada, A; Akova, M; Arendrup, M C; Boekhout, T; Chowdhary, A; Cuenca-Estrella, M; Guinea, J; Guarro, J; de Hoog, S; Hope, W; Kathuria, S; Lortholary, O; Meis, J F; Ullmann, A J; Petrikkos, G; Lass-Flörl, C
2014-04-01
Mycoses summarized in the hyalohyphomycosis group are heterogeneous, defined by the presence of hyaline (non-dematiaceous) hyphae. The number of organisms implicated in hyalohyphomycosis is increasing and the most clinically important species belong to the genera Fusarium, Scedosporium, Acremonium, Scopulariopsis, Purpureocillium and Paecilomyces. Severely immunocompromised patients are particularly vulnerable to infection, and clinical manifestations range from colonization to chronic localized lesions to acute invasive and/or disseminated diseases. Diagnosis usually requires isolation and identification of the infecting pathogen. A poor prognosis is associated with fusariosis and early therapy of localized disease is important to prevent progression to a more aggressive or disseminated infection. Therapy should include voriconazole and surgical debridement where possible or posaconazole as salvage treatment. Voriconazole represents the first-line treatment of infections due to members of the genus Scedosporium. For Acremonium spp., Scopulariopsis spp., Purpureocillium spp. and Paecilomyces spp. the optimal antifungal treatment has not been established. Management usually consists of surgery and antifungal treatment, depending on the clinical presentation. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.
Listeria monocytogenes meningitis in the Netherlands, 1985-2014: A nationwide surveillance study.
Koopmans, Merel M; Bijlsma, Merijn W; Brouwer, Matthijs C; van de Beek, Diederik; van der Ende, Arie
2017-07-01
Listeria monocytogenes can cause sepsis and meningitis. We report national surveillance data on L. monocytogenes meningitis in the Netherlands, describing incidence changes, genetic epidemiology and fatality rate. We analyzed data from the Netherlands Reference Laboratory of Bacterial Meningitis for cases of L. monocytogenes meningitis. Strains were assessed by serotyping and bacterial population structure by multi-locus sequence typing. A total of 375 cases of Listeria meningitis were identified between 1985 and 2014. Peak incidence rates were observed in neonates (0.61 per 100,000 live births) and older adults (peak at 87 year; 0.53 cases per 100,000 population of the same age). Neonatal listerial meningitis decreased 17-fold from 1.95 per 100,000 live births between 1985 and 1989, to 0.11 per 100,000 live births between 2010 and 2014. Overall case fatality rate was 31%, in a multivariate analysis older age and concomitant bacteremia were associated with mortality (both p listeria meningitis has remained high. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Liébana, Susana; Brandão, Delfina [Grup de Sensors i Biosensors, Departament de Química, Universitat Autònoma de Barcelona, 08193, Cerdanyola del Vallès (Bellaterra) (Spain); Cortés, Pilar; Campoy, Susana [Departament de Genètica i de Microbiologia, Universitat Autònoma de Barcelona, 08193, Cerdanyola del Vallès (Bellaterra) (Spain); Alegret, Salvador [Grup de Sensors i Biosensors, Departament de Química, Universitat Autònoma de Barcelona, 08193, Cerdanyola del Vallès (Bellaterra) (Spain); Pividori, María Isabel, E-mail: Isabel.Pividori@uab.cat [Grup de Sensors i Biosensors, Departament de Química, Universitat Autònoma de Barcelona, 08193, Cerdanyola del Vallès (Bellaterra) (Spain)
2016-01-21
A magneto-genosensing approach for the detection of the three most common pathogenic bacteria in food safety, such as Salmonella, Listeria and Escherichia coli is presented. The methodology is based on the detection of the tagged amplified DNA obtained by single-tagging PCR with a set of specific primers for each pathogen, followed by electrochemical magneto-genosensing on silica magnetic particles. A set of primers were selected for the amplification of the invA (278 bp), prfA (217 bp) and eaeA (151 bp) being one of the primers for each set tagged with fluorescein, biotin and digoxigenin coding for Salmonella enterica, Listeria monocytogenes and E. coli, respectively. The single-tagged amplicons were then immobilized on silica MPs based on the nucleic acid-binding properties of silica particles in the presence of the chaotropic agent as guanidinium thiocyanate. The assessment of the silica MPs as a platform for electrochemical magneto-genosensing is described, including the main parameters to selectively attach longer dsDNA fragments instead of shorter ssDNA primers based on their negative charge density of the sugar-phosphate backbone. This approach resulted to be a promising detection tool with sensing features of rapidity and sensitivity very suitable to be implemented on DNA biosensors and microfluidic platforms. - Highlights: • Silica magnetic particles were used for the first time as carrier in electrochemical magneto-genosensing of single-tagged amplicons. • They demonstrated to be a robust platform for the electrochemical detection of PCR products. • Differential adsorption properties for longer dsDNA amplicon incorporating the tagging primers over shorter ssDNA tagged primers were observed due to the negative charge density. • Electrochemical magneto-genosensing of Salmonella enterica, Listeria monocytogenes and Escherichia coli was successfully performed.
International Nuclear Information System (INIS)
Liébana, Susana; Brandão, Delfina; Cortés, Pilar; Campoy, Susana; Alegret, Salvador; Pividori, María Isabel
2016-01-01
A magneto-genosensing approach for the detection of the three most common pathogenic bacteria in food safety, such as Salmonella, Listeria and Escherichia coli is presented. The methodology is based on the detection of the tagged amplified DNA obtained by single-tagging PCR with a set of specific primers for each pathogen, followed by electrochemical magneto-genosensing on silica magnetic particles. A set of primers were selected for the amplification of the invA (278 bp), prfA (217 bp) and eaeA (151 bp) being one of the primers for each set tagged with fluorescein, biotin and digoxigenin coding for Salmonella enterica, Listeria monocytogenes and E. coli, respectively. The single-tagged amplicons were then immobilized on silica MPs based on the nucleic acid-binding properties of silica particles in the presence of the chaotropic agent as guanidinium thiocyanate. The assessment of the silica MPs as a platform for electrochemical magneto-genosensing is described, including the main parameters to selectively attach longer dsDNA fragments instead of shorter ssDNA primers based on their negative charge density of the sugar-phosphate backbone. This approach resulted to be a promising detection tool with sensing features of rapidity and sensitivity very suitable to be implemented on DNA biosensors and microfluidic platforms. - Highlights: • Silica magnetic particles were used for the first time as carrier in electrochemical magneto-genosensing of single-tagged amplicons. • They demonstrated to be a robust platform for the electrochemical detection of PCR products. • Differential adsorption properties for longer dsDNA amplicon incorporating the tagging primers over shorter ssDNA tagged primers were observed due to the negative charge density. • Electrochemical magneto-genosensing of Salmonella enterica, Listeria monocytogenes and Escherichia coli was successfully performed.
Pathogenic potential of Listeria monocytogenes isolated from cattle ...
African Journals Online (AJOL)
Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...
Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...
African Journals Online (AJOL)
One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...
Review of Prosthetic Joint Infection from Listeria monocytogenes.
Bader, Gilbert; Al-Tarawneh, Mohammed; Myers, James
2016-12-01
Prosthetic joint infection from Listeria monocytogenes is rare. We decided to shed light on this illness and review the reported cases to better understand its characteristics. We conducted a comprehensive review of the English literature using PubMed. We also included one case that we had managed. We found 25 cases of prosthetic joint infection from L. monocytogenes reported individually and a retrospective study of 43 cases of joint and bone listerial infection, including 34 with prosthetic joint infection, conducted in France. We have described their clinical and para-clinical features and tried to elaborate on the pathophysiology, treatment, and prevention. Prosthetic joint infection from L. monocytogenes is mainly late. Systemic inflammation may be absent. Although rare, it must be suspected in patients at high risk for both prosthetic joint and listerial infections. In addition, those patients must be instructed on appropriate preventive measures.
Presence of Staphylococcus spp. and Candida spp. in the human oral cavity
Directory of Open Access Journals (Sweden)
Martins Clélia Aparecida de Paiva
2002-01-01
Full Text Available The presence of yeasts and staphylococci in the oral cavity is important because they can act as supplementary microbiota and in certain situations can cause oral or systemic diseases. The aim of this work was to study the prevalence of Candida spp. and Staphylococcus spp. in the human oral cavity. Oral rinses were collected from sixty-eight individuals according to the technique described by Samaranayake and MacFarlane and then cultured on Sabouraud medium supplemented with chloramphenicol and Baird-Parker agar. After the incubation period, the microorganisms were isolated and identified through biochemical tests. The data obtained were statistically analysed by ANOVA. Candida spp. were isolated from 61.76% of the examined individuals and C. albicans was the more frequently isolated specie. Staphylococcus spp. were isolated from 95.60% of the individuals and 41 strains were coagulase negative (63%. Among the coagulase positive strains, nine were S. aureus, 11 S. hyicus and 4 S. schleiferi subspecie coagulans. No correlation was observed between the counts (cfu of the isolated Candida spp. and Staphylococcus spp.
Silva, A; Genovés, S; Martorell, P; Zanini, S F; Rodrigo, D; Martinez, A
2015-09-01
The aim of this study was to evaluate the effect of two antimicrobial substances, carvacrol and citral, on Listeria monocytogenes and Listeria innocua cells, as well as possible virulence changes in injured cells, using Caenorhabditis elegans as a model test. The results indicated that the percentage of sublethal damage was higher in L. monocytogenes than in L. innocua. The results of the study carried out by using C. elegans indicated that C. elegans fed in a lawn of L. monocytogenes previously treated with carvacrol showed a loss in life span (p ≤ 0.05) as compared with L. monocytogenes treated with citral, Escherichia coli OP50 as a negative control, and treated and untreated L. innocua. Egg laying was also affected: worms fed in a lawn of treated and untreated L. monocytogenes laid fewer eggs than those fed in a lawn of treated and untreated L. innocua or fed with OP50 as a negative control. Worms fed in a lawn of treated and untreated L. innocua also laid fewer eggs than those fed with OP50 as a negative control. A phenotype named bag of worms and an undescribed new one, "vulva inflammation", were also observed. Copyright © 2015 Elsevier Ltd. All rights reserved.
Antibiotic resistant pattern of environmental isolates of Listeria ...
African Journals Online (AJOL)
Incidence of Listeria monocytogenes in cow manure, agricultural soil, and common vegetables sold in major markets in Ado-Ekiti, Nigeria was determined. Antibiotic resistant pattern of the isolates was examined by paper disk assay. A total of 196 environmental samples were cultured on a selective medium out of which ...
[The relevance of Candida spp. in chronic periodontal disease].
Razina, I N; Chesnokova, M G; Nedoseko, V B
The aim of the study was to assess the correlation of Candida spp. incidence in periodontal tissues with various clinical manifestations of chronic periodontal disease (CPD). Ninety patients with CPD were included in the study in which Candida spp. was evaluated in periodontal pockets content and gingival biopsy material. In severe CPD more Candida spp. were seen in gingival biopsy than in periodontal pockets (p=0.0006). Candida spp. incidence and quantity correlated directly with the disease grade showing incidence increase from 40 to 73.3% and quantity increase from 0.8±0.18 до 3.6±0.49 lg CFU/ml in light and severe CPD, correspondingly Candida spp. had statistically significant association with cyanotic gingival color (p=0.0018), tongue plaque and swelling (р=0.0042), lip exfoliation (р=0.0030), periodontal pockets depth >5 mm (р=0.0030), oral mucosa hyperemia (р=0.0157), alveolar bone destruction >1/2 of root length (р=0.0157). These data prove the relevance of Candida spp. and mycological assessment of gingival biopsy in CPD patients.
Directory of Open Access Journals (Sweden)
Li Ma
Full Text Available Many food safety-related studies require tracking of introduced foodborne pathogens to monitor their fate in complex environments. The green fluorescent protein (GFP gene (gfp provides an easily detectable phenotype so has been used to label many microorganisms for ecological studies. The objectives of this study were to label major foodborne pathogens and related bacteria, including Listeria monocytogenes, Listeria innocua, Salmonella, and Escherichia coli O157:H7 strains, with GFP and characterize the labeled strains for stability of the GFP plasmid and the plasmid's effect on bacterial growth. GFP plasmids were introduced into these strains by a CaCl(2 procedure, conjugation or electroporation. Stability of the label was determined through sequential propagation of labeled strains in the absence of selective pressure, and rates of plasmid-loss were calculated. Stability of the GFP plasmid varied among the labeled species and strains, with the most stable GFP label observed in E. coli O157:H7. When grown in nonselective media for two consecutive subcultures (ca. 20 generations, the rates of plasmid loss among labeled E. coli O157:H7, Salmonella and Listeria strains ranged from 0%-30%, 15.8%-99.9% and 8.1%-93.4%, respectively. Complete loss (>99.99% of the plasmid occurred in some labeled strains after five consecutive subcultures in the absence of selective pressure, whereas it remained stable in others. The GFP plasmid had an insignificant effect on growth of most labeled strains. E. coli O157:H7, Salmonella and Listeria strains can be effectively labeled with the GFP plasmid which can be stable in some isolates for many generations without adversely affecting growth rates.
DEFF Research Database (Denmark)
Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck
2009-01-01
Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model...... for distinguishing between Listeria with different virulence properties and (2) to explore whether it was possible to reduce the required number of animals by dosing with mixed cultures instead of monocultures. Consistent with in vitro observations of infectivity in Caco-2 cells, faecal densities and presence...... of Listeria strains gave similar results as dosage with a mixture of the three strains; thus, the mixed infection approach was a feasible way to reduce the number of animals needed for determination of listerial virulence....
Nyenje, Mirriam E.; Odjadjare, Collins E.; Tanih, Nicoline F.; Green, Ezekiel; Ndip, Roland N.
2012-01-01
This study assessed the microbiological quality of various ready-to-eat foods sold in Alice, South Africa. Microbiological analysis was conducted on 252 samples which included vegetables, potatoes, rice, pies, beef and chicken stew. The isolates were identified using biochemical tests and the API 20E, API 20NE and API Listeria kits; results were analyzed using the one-way-ANOVA test. Bacterial growth was present in all the food types tested; high levels of total aerobic count were observed in vegetables, 6.8 ± 0.07 followed by rice, 6.7 ± 1.7 while pies had the lowest count (2.58 ± 0.24). Organisms isolated included: Listeria spp. (22%), Enterobacter spp. (18%), Aeromonas hydrophila (12%), Klebsiella oxytoca (8%), Proteus mirabilis (6.3%), Staphylococcus aureus (3.2%) and Pseudomonas luteola (2.4%). Interestingly, Salmonella spp. and Escherichia coli were not isolated in any of the samples. There was a statistically significant difference (p < 0.05) in the prevalence of foodborne pathogens from hygienic and unhygienic cafeterias. The results indicated that most of the ready-to-eat food samples examined in this study did not meet bacteriological quality standards, therefore posing potential risks to consumers. This should draw the attention of the relevant authorities to ensure that hygienic standards are improved to curtain foodborne infections. PMID:23066386
Cavicchioli, V Q; Scatamburlo, T M; Yamazi, A K; Pieri, F A; Nero, L A
2015-12-01
Consumption of goat milk has been increasing due to its nutritional characteristics and health benefits. Therefore, assessment of the presence of foodborne pathogens in this product is critical to ensure its safety to consumers. The present study aimed to identify common foodborne pathogens in raw goat milk. Fifty-three samples of raw goat milk from 11 farms were collected and cultured for the presence of Salmonella spp. and Listeria monocytogenes, as well as for enumeration and isolation of coagulase-positive and coagulase-negative Staphylococcus (CPS and CNS, respectively). All samples tested negative for Salmonella spp. and L. monocytogenes. The CPS counts in raw goat milk samples were predominantly less than 2 log cfu/mL (n=39), and CNS counts were predominantly higher than 3 log cfu/mL (n=42). Based on Staphylococcus counts, 51 isolates were selected (CPS=26; CNS=25) and tested by PCR for the presence of classic enterotoxin-encoding genes (sea, seb, sec, sed, and see). Only 3 isolates (CPS=2, CNS=1) were negative for all enterotoxin-encoding genes tested, and the genotype sec and see was the most frequent (n=16), followed by sea, sec, and see (n=13) and sec (n=13); sed was not detected in any isolate. The frequencies of enterotoxin-encoding genes for CPS and CNS were similar, demonstrating the equivalence of both groups in harboring these virulent markers. These results suggest that Salmonella and L. monocytogenes are not frequent contaminants of raw goat milk, but that Staphylococcus spp. that are capable of producing enterotoxins are prevalent; therefore, consumers of raw goat milk and products made from raw milk are at risk. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Bacteriophage biocontrol of Listeria monocytogenes on soft ripened white mold and red-smear cheeses.
Guenther, Susanne; Loessner, Martin J
2011-03-01
Soft-ripened cheeses belong to the type of food most often contaminated with Listeria monocytogenes, and they have been implicated in several outbreaks of listeriosis. Bacteriophages represent an attractive way to combat foodborne pathogens without affecting other properties of the food. We used the broad host range, virulent Listeria phage A511 for control of L. monocytogenes during the production and ripening phases of both types of soft-ripened cheeses, white mold (Camembert-type) cheese, as well as washed-rind cheese with a red-smear surface (Limburger-type). The surfaces of young, unripened cheese were inoculated with 10(1)-10(3) cfu/cm(2)L. monocytogenes strains Scott A (serovar 4b) or CNL 10(3)/2005 (serovar 1/2a). Phage was applied at defined time points thereafter, in single or repeated treatments, at 3 × 10(8) or 1 × 10(9) pfu/cm(2). With Scott A (10(3) cfu/cm(2)) and a single dose of A511 (3 × 10(8) pfu/cm(2)) on camembert-type cheese, viable counts dropped 2.5 logs at the end of the 21 day ripening period. Repeated phage application did not further inhibit the bacteria, whereas a single higher dose (1 × 10(9) pfu/cm(2)) was found to be more effective. On red-smear cheese ripened for 22 days, Listeria counts were down by more than 3 logs. Repeated application of A511 further delayed re-growth of Listeria, but did not affect bacterial counts after 22 days. With lower initial Listeria contamination (10(1)-10(2) cfu/cm(2)), viable counts dropped below the limit of detection, corresponding to more than 6 logs reduction compared to the control. Our data clearly demonstrate the potential of bacteriophage for biocontrol of L. monocytogenes in soft cheese.
21 CFR 172.785 - Listeria-specific bacteriophage preparation.
2010-04-01
... application to meat and poultry products that comply with the ready-to-eat definition in 9 CFR 430.1. Current... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Listeria-specific bacteriophage preparation. 172.785 Section 172.785 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN...
Survey of Infectious Etiologies of Bovine Abortion during Mid- to Late Gestation in Dairy Herds
Barkallah, Mohamed; Gharbi, Yaakoub; Ben Hassena, Amal; Ben Slima, Ahlem; Mallekh, Zouhir; Gautier, Michel; Greub, Gilbert; Gdoura, Radhouane
2014-01-01
Bovine abortion of unknown infectious etiology still remains a major economic problem. Thus, we investigated whether Brucella spp., Listeria monocytogenes, Salmonella spp., Campylobacter spp. and Coxiella burnetii are associated with abortion and/or stillbirth in Tunisian dairy cattle. Using a pan-Chlamydiales PCR, we also investigated the role of Chlamydiaceae, Waddlia chondrophila, Parachlamydia acanthamoebae and other members of the Chlamydiales order in this setting. Veterinary samples ta...
Directory of Open Access Journals (Sweden)
P. Boria
2013-02-01
Full Text Available Flow diagram for a processing line of sea bass in two different fish farms have been drawn and on the base of C.P sampling have been planned in order to assess G.H.P by means of skin swabs for the TMC test. The muscles of fish have been sampled for the research of pathogens bacteria Vibrio spp, Salmonella spp and Listeria spp.
Distribution of the bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk
Terekhova, V. E.; Sosnin, V. A.; Buzoleva, L. S.; Shakirov, R. B.
2010-04-01
The Amur River’s influence on the distribution of the opportunistic bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk is discussed. The presence of Listeria in the seawater, sea ice, and sediments on the northeastern Sakhalin shelf and slope supports the idea of its connection with the Amur River discharge. The hypothesis of the allochtonic parentage of L. monocytogenes in the sea’s development is proved.
Directory of Open Access Journals (Sweden)
Licht Tine
2007-06-01
Full Text Available Abstract Background Listeria monocytogenes has been implicated in several food borne outbreaks as well as sporadic cases of disease. Increased understanding of the biology of this organism is important in the prevention of food borne listeriosis. The infectivity of Listeria monocytogenes ScottA, cultivated with and without oxygen restriction, was compared in vitro and in vivo. Fluorescent protein labels were applied to allow certain identification of Listeria cells from untagged bacteria in in vivo samples, and to distinguish between cells grown under different conditions in mixed infection experiments. Results Infection of Caco-2 cells revealed that Listeria cultivated under oxygen-restricted conditions were approximately 100 fold more invasive than similar cultures grown without oxygen restriction. This was observed for exponentially growing bacteria, as well as for stationary-phase cultures. Oral dosage of guinea pigs with Listeria resulted in a significantly higher prevalence (p Listeria in fecal samples was observed after dosage with oxygen-restricted bacteria. These differences were seen after challenge with single Listeria cultures, as well as with a mixture of two cultures grown with and without oxygen restriction. Conclusion Our results show for the first time that the environmental conditions to which L. monocytogenes is exposed prior to ingestion are decisive for its in vivo infective potential in the gastrointestinal tract after passage of the gastric barrier. This is highly relevant for safety assessment of this organism in food.
Salazar, Joelle K.; Bathija, Vriddi M.; Carstens, Christina K.; Narula, Sartaj S.; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou
2018-01-01
This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. m...
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland
Directory of Open Access Journals (Sweden)
Emmanuel Okpo
2015-11-01
Full Text Available Summary: Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP. Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing.This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Keywords: Listeria monocytogenes, Outbreak, Foodborne, Community acquired infection, Listeriosis
Directory of Open Access Journals (Sweden)
Tipparat Hongpattarakere
2008-04-01
Full Text Available Ethyl acetate extracts and hydrodistillated-essential oils from peels of Citrus spp. were investigated for their antimicrobial activities against food related microorganisms by broth microdilution assay. Overall, ethyl acetate extracts from all citrus peels showed stronger antimicrobial activities than their essential oils obtained from hydrodistillation. The ethyl acetate extract of kaffir lime (Citrus hystrix DC. peel showed broad spectrum of inhibition against all Gram-positive bacteria, yeast and molds including Staphylococcus aureus, Bacillus cereus, Listeria monocytogenes, Saccharomyces cerevisiae var. sake and Aspergillus fumigatus TISTR 3180. It exhibited minimum inhibitory concentration (MIC values of 0.28 and 0.56 mg/ml against Sac. cerevisiae var. sake and B. cereus, respectively while the minimum bactericidal concentration (MBC values against both microbes were 0.56 mg/ml. The MIC values of the extract against L. monocytogenes, A. fumigatus TISTR 3180 and S. aureus were 1.13 mg/ml while the MBC values against L. monocytogenes as well as A. fumigatus TISTR 3180 and S. aureus were 2.25 and 1.13 mg/ml, respectively. The major components of the ethyl acetate extract from kaffir lime were limonene (31.64 %, citronellal (25.96 % and b-pinene (6.83 % whereas b-pinene (30.48 %, sabinene (22.75 % and citronellal (15.66 % appeared to be major compounds of the essential oil obtained from hydrodistillation.
Herrin, Brian H; Peregrine, Andrew S; Goring, Jonas; Beall, Melissa J; Little, Susan E
2017-05-19
Canine test results generated by veterinarians throughout Canada from 2013-2014 were evaluated to assess the geographical distribution of canine infection with Borrelia burgdorferi, Dirofilaria immitis, Ehrlichia spp., and Anaplasma spp. The percent positive test results of 115,636 SNAP® 4Dx® Plus tests from dogs tested were collated by province and municipality to determine the distribution of these vector-borne infections in Canada. A total of 2,844/115,636 (2.5%) dogs tested positive for antibody to B. burgdorferi. In contrast, positive test results for D. immitis antigen and antibodies to Ehrlichia spp. and Anaplasma spp. were low, with less than 0.5% of dogs testing positive for any one of these three agents nationwide. Provincial seroprevalence for antibodies to B. burgdorferi ranged from 0.5% (Saskatchewan)-15.7% (Nova Scotia); the areas of highest percent positive test results were in proximity to regions in the USA considered endemic for Lyme borreliosis, including Nova Scotia (15.7%) and Eastern Ontario (5.1%). These high endemic foci, which had significantly higher percent positive test results than the rest of the nation (P Canada. Using dogs as sentinels for these pathogens can aid in recognition of the public and veterinary health threat that each pose.
The influence of Listeria monocytogenes cells on the primary immunologic response in irradiated mice
International Nuclear Information System (INIS)
Borowski, J.; Jokoniuk, P.
1977-01-01
The influence of killed Listeria monocytogenes cells on the primary immunologic response in mice irradiated with 300 or 500 R was studied. The immunologic response of the mice to sheep red blood cells used as antigen was assessed at the cellular level (by counting PFC) and humoral level. Injection of killed Listeria monocytogenes cells before irradiation of the mice diminished the immunosuppressive effect of roentgen radiation. Injection of the cells after irradiation accelerated regeneration of immunologic reactivity in the irradiated mice. (author)
Sonnier, Jakeitha L; Karns, Jeffrey S; Lombard, Jason E; Kopral, Christine A; Haley, Bradd J; Kim, Seon-Woo; Van Kessel, Jo Ann S
2018-03-01
The dairy farm environment is a well-documented reservoir for zoonotic pathogens such as Salmonella enterica, Shiga-toxigenic Escherichia coli, and Listeria monocytogenes, and humans may be exposed to these pathogens via consumption of unpasteurized milk and dairy products. As part of the National Animal Health Monitoring System Dairy 2014 study, bulk tank milk (BTM, n = 234) and milk filters (n = 254) were collected from a total of 234 dairy operations in 17 major dairy states and analyzed for the presence of these pathogens. The invA gene was detected in samples from 18.5% of operations and Salmonella enterica was isolated from 18.0% of operations. Salmonella Dublin was detected in 0.7% of operations. Sixteen Salmonella serotypes were isolated, and the most common serotypes were Cerro, Montevideo, and Newport. Representative Salmonella isolates (n = 137) were tested against a panel of 14 antimicrobials. Most (85%) were pansusceptible; the remaining were resistant to 1 to 9 antimicrobials, and within the resistant strains the most common profile was resistance to ampicillin/clavulanic acid, ampicillin, cefoxitin, ceftiofur, ceftriaxone, chloramphenicol, streptomycin, sulfisoxazole, and tetracycline. Listeria spp. were isolated from 19.9% of operations, and L. monocytogenes was isolated from 3.0% of operations. Serogroups 1/2a and 1/2b were the most common, followed by 4b and 4a. One or more E. coli virulence genes were detected in the BTM from 30.5% of operations and in the filters from 75.3% of operations. A combination of stx 2 , eaeA, and γ-tir genes was detected in the BTM from 0.5% of operations and in the filters from 6.6% of operations. The results of this study indicate an appreciable prevalence of bacterial pathogens in BTM and filters, including serovars known to infect humans. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Thalyta Marina Benetti
2012-12-01
Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at
Sewell, Duane A; Shahabi, Vafa; Gunn, George R; Pan, Zhen-Kun; Dominiecki, Mary E; Paterson, Yvonne
2004-12-15
Previous work in our laboratory has established that the fusion of tumor-associated antigens to a truncated form of the Listeria monocytogenes virulence factor listeriolysin O (LLO) enhances the immunogenicity and antitumor efficacy of the tumor antigen when delivered by Listeria or by vaccinia. LLO contains a PEST sequence at the NH(2) terminus. These sequences, which are found in eukaryotic proteins with a short cellular half-life, target proteins for degradation in the ubiquitin-proteosome pathway. To investigate whether the enhanced immunogenicity conferred by LLO is due to the PEST sequence, we constructed new Listeria recombinants that expressed the HPV-16 E7 antigen fused to LLO, which either contained or had been deleted of this sequence. We then compared the antitumor efficacy of this set of vectors and found that Listeria expressing the fusion protein LLO-E7 or PEST-E7 were effective at regressing established macroscopic HPV-16 immortalized tumors in syngeneic mice. In contrast, Listeria recombinants expressing E7 alone or E7 fused to LLO from which the PEST sequence had been genetically removed could only slow tumor growth. Because CD8(+) T cell epitopes are generated in the ubiquitin-proteosome pathway, we also investigated the ability of the vaccines to induce E7-specific CD8(+) T cells in the spleen and to generate E7-specific tumor-infiltrating lymphocytes. A strong correlation was observed between CD8(+) T-cell induction and tumor homing and the antitumor efficacy of the Listeria-E7 vaccines. These findings suggest a strategy for the augmentation of tumor antigen-based immunotherapeutic strategies that may be broadly applicable.
Parola, Philippe; Cornet, Jean-Paul; Sanogo, Yibayiri Osée; Miller, R. Scott; Thien, Huynh Van; Gonzalez, Jean-Paul; Raoult, Didier; Telford III, Sam R.; Wongsrichanalai, Chansuda
2003-01-01
A total of 650 ticks, including 13 species from five genera, were collected from animals, from people, or by flagging of the vegetation at sites on the Thai-Myanmar border and in Vietnam. They were tested by PCR to detect DNA of bacteria of the order Rickettsiales. Three Anaplasma spp. were detected in ticks collected in Thailand, including (i) Anaplasma sp. strain AnDa465, which was considered a genotype of Anaplasma platys (formerly Ehrlichia platys) and which was obtained from Dermacentor ...
An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food
Directory of Open Access Journals (Sweden)
Jodi Woan-Fei Law
2015-11-01
Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.
Weller, Daniel; Wiedmann, Martin; Strawn, Laura K
2015-09-01
While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Biosensor for the detection of Listeria monocytogenes: emerging trends
Soni, Dharmendra Kumar
2018-05-23
The early detection of Listeria monocytogenes (L. monocytogenes) and understanding the disease burden is of paramount interest. The failure to detect pathogenic bacteria in the food industry may have terrible consequences, and poses deleterious effects on human health. Therefore, integration of methods to detect and trace the route of pathogens along the entire food supply network might facilitate elucidation of the main contamination sources. Recent research interest has been oriented towards the development of rapid and affordable pathogen detection tools/techniques. An innovative and new approach like biosensors has been quite promising in revealing the foodborne pathogens. In spite of the existing knowledge, advanced research is still needed to substantiate the expeditious nature and sensitivity of biosensors for rapid and in situ analysis of foodborne pathogens. This review summarizes recent developments in optical, piezoelectric, cell-based, and electrochemical biosensors for Listeria sp. detection in clinical diagnostics, food analysis, and environmental monitoring, and also lists their drawbacks and advantages.
Incidence and pathogenicity profile of Listeria sp. isolated from food ...
African Journals Online (AJOL)
USER
2010-07-26
Jul 26, 2010 ... in the brain, adrenal glands, spleen, kidney, lungs and the gastrointestinal ..... Cryptogenic liver abscess due to Listeria monocytogenes. .... of foods in sporadic listeriosis I. Case – control study of dietry risk factors. J. Am. Med.
Olutayo Israel Falodun; Moturayo Janet Amusan
2017-01-01
Introduction: Untreated waste being discharged into the environment due to proliferation of poultry and fish farms can constitute a public health threat to human. Listeria, an emerging pathogen is commonly associated with food. This study aimed at determining the antibiotic resistant pattern of Listeria species isolated from poultry droppings and fish pond water in Ibadan. Materials and Methods: Poultry waste and fishpond water samples were collected between April and July, 2016. Listeria...
Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat
Directory of Open Access Journals (Sweden)
Masoud Rezaei
2012-02-01
Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.
PCR detection of Bartonella spp. in the dog
Directory of Open Access Journals (Sweden)
Jarmila Konvalinová
2014-01-01
Full Text Available Our study aimed at using PCR to identify the incidence of Bartonella spp. in blood of dogs. Altogether 286 dogs of 92 breeds aged 3 month to 17 years were tested from October 2008 to December 2009. Healthy dogs as well as dogs with various clinical symptoms of disease were included in the group. Samples were tested by polymerase chain reaction (PCR specific for the presence of Bartonella spp. Following the DNA examination in 286 dogs by PCR and subsequent sequencing, two samples were identified as Bartonella henselae (0.7%. Other species of Bartonella were not found. It was the first time in the Czech Republic when incidence of Bartonella spp. was determined in dogs.
Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes
DEFF Research Database (Denmark)
Harmsen, Morten; Lappann, Martin; Knøchel, S
2010-01-01
(eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...
Understanding serine proteases implications on Leishmania spp lifecycle.
Alves, Carlos Roberto; Souza, Raquel Santos de; Charret, Karen Dos Santos; Côrtes, Luzia Monteiro de Castro; Sá-Silva, Matheus Pereira de; Barral-Veloso, Laura; Oliveira, Luiz Filipe Gonçalves; da Silva, Franklin Souza
2018-01-01
Serine proteases have significant functions over a broad range of relevant biological processes to the Leishmania spp lifecycle. Data gathered here present an update on the Leishmania spp serine proteases and the status of these enzymes as part of the parasite degradome. The serine protease genes (n = 26 to 28) in Leishmania spp, which encode proteins with a wide range of molecular masses (35 kDa-115 kDa), are described along with their degrees of chromosomal and allelic synteny. Amid 17 putative Leishmania spp serine proteases, only ∼18% were experimentally demonstrated, as: signal peptidases that remove the signal peptide from secretory pre-proteins, maturases of other proteins and with metacaspase-like activity. These enzymes include those of clans SB, SC and SF. Classical inhibitors of serine proteases are used as tools for the characterization and investigation of Leishmania spp. Endogenous serine protease inhibitors, which are ecotin-like, can act modulating host actions. However, crude or synthetic based-natural serine protease inhibitors, such as potato tuber extract, Stichodactyla helianthus protease inhibitor I, fukugetin and epoxy-α-lapachone act on parasitic serine proteases and are promising leishmanicidal agents. The functional interrelationship between serine proteases and other Leishmania spp proteins demonstrate essential functions of these enzymes in parasite physiology and therefore their value as targets for leishmaniasis treatment. Copyright © 2017 Elsevier Inc. All rights reserved.
Lee, Sangmi; Ward, Todd J; Jima, Dereje D; Parsons, Cameron; Kathariou, Sophia
2017-11-01
In the foodborne pathogen Listeria monocytogenes , arsenic resistance is encountered primarily in serotype 4b clones considered to have enhanced virulence and is associated with an arsenic resistance gene cluster within a 35-kb chromosomal region, Listeria genomic island 2 (LGI2). LGI2 was first identified in strain Scott A and includes genes putatively involved in arsenic and cadmium resistance, DNA integration, conjugation, and pathogenicity. However, the genomic localization and sequence content of LGI2 remain poorly characterized. Here we investigated 85 arsenic-resistant L. monocytogenes strains, mostly of serotype 4b. All but one of the 70 serotype 4b strains belonged to clonal complex 1 (CC1), CC2, and CC4, three major clones associated with enhanced virulence. PCR analysis suggested that 53 strains (62.4%) harbored an island highly similar to LGI2 of Scott A, frequently (42/53) in the same location as Scott A ( LMOf2365_2257 homolog). Random-primed PCR and whole-genome sequencing revealed seven novel insertion sites, mostly internal to chromosomal coding sequences, among strains harboring LGI2 outside the LMOf2365_2257 homolog. Interestingly, many CC1 strains harbored a noticeably diversified LGI2 (LGI2-1) in a unique location ( LMOf2365_0902 homolog) and with a novel additional gene. With few exceptions, the tested LGI2 genes were not detected in arsenic-resistant strains of serogroup 1/2, which instead often harbored a Tn 554 -associated arsenic resistance determinant not encountered in serotype 4b. These findings indicate that in L. monocytogenes , LGI2 has a propensity for certain serotype 4b clones, exhibits content diversity, and is highly promiscuous, suggesting an ability to mobilize various accessory genes into diverse chromosomal loci. IMPORTANCE Listeria monocytogenes is widely distributed in the environment and causes listeriosis, a foodborne disease with high mortality and morbidity. Arsenic and other heavy metals can powerfully shape the
Isolation and characterisation of Listeria species from ruminants in ...
African Journals Online (AJOL)
A cross sectional study was carried out to determine the prevalence of Listeria species in ruminants in Maiduguri. Three hundred faecal samples were randomly collected from ruminants at the Maiduguri central abattoir from January – March, 2011. One hundred faecal samples each were collected from cattle, sheep and ...
Genome sequences of Listeria monocytogenes strains with resistance to arsenic
Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...
Directory of Open Access Journals (Sweden)
Irene Ortega Blázquez
2017-11-01
Full Text Available The aim of the present study was to determine the efficacy of films activated with enterocin AS-48 plus thymol singly, or in combination with high-hydrostatic pressure (HHP on the inactivation of Listeria innocua in sea bream fillets and in fruit puree stored under refrigeration for 10 days. L. innocua proliferated in control fish fillets during storage. The activated film reduced viable Listeria counts in fillets by 1.76 log cycles and prevented growth of survivors until mid-storage. Application of HHP treatment to fillets packed in films without antimicrobials reduced Listeria counts by 1.83 log cycles, but did not prevent the growth of survivors during storage. The combined treatment reduced viable counts by 1.88 log cycles and delayed growth of survivors during the whole storage period. L. innocua survived in puree during storage. The activated film reduced Listeria counts by 1.80 and 2.0 log cycles at days 0 and 3. After that point, Listeria were below the detection limit. No viable Listeria were detected in the purees after application of HHP treatment singly, or in combination with the activated film. Results from the study indicate that the efficacy of activated films against Listeria is markedly influenced by the food type.
Directory of Open Access Journals (Sweden)
Paola Mendes Milanesi
2013-12-01
Full Text Available This study aimed i to quantify the occurrence of Fusarium spp. and Trichoderma spp. in rhizospheric soil, with and without symptoms of Sudden Death Syndrome (SDS in eight soybean genotypes; ii morphologically identify isolates of Fusarium spp. from roots with SDS; iii evaluate the antagonism between Trichoderma spp. and Fusarium spp. isolates from rhizospheric soil and roots from with and without SDS, respectively; and iv characterize through the ITS1-5.8S-ITS2 region of rDNA the isolates of Trichoderma spp. with better performance in the direct confrontation. The sampling of soil and roots was performed in an experimental area located in Cruz Alta, RS, Brazil. In the laboratory, serial dilutions of soil samples, counting of the number of Colony Forming Units (UFCs/g-1 of rhizospheric soil were performed as well as isolation for identification of isolates of Fusarium spp. and Trichoderma spp. and testing of direct confrontation. There were significant differences between the population of Trichoderma spp. in the rhizosphere of plants with and without symptoms of SDS. For the population of Fusarium spp., significant difference was observed only in the rhizosphere of plants without symptoms of SDS. In diseased roots the following species were identified: F. solani, F. avenaceum, F. graminearum, F. oxysporum and F. verticillioides. In the test of direct confrontation, eight isolates of Trichoderma spp. achieved the best performance in the antagonism to Fusarium spp. and Trichoderma spp. from areas with symptoms of SDS had a higher control efficiency in vitro. These isolates showed high similarity to the species of T. koningii agregate.
Prevalence of Trichomonas, Salmonella, and Listeria in Wild Birds from Southeast Texas.
Brobey, Britni; Kucknoor, Ashwini; Armacost, Jim
2017-09-01
Infectious diseases can be a major threat to wildlife populations, especially in human-modified habitats, but infection rates in populations of wild animals are often poorly studied. Trichomonas, Salmonella, and Listeria are all pathogens known to infect birds, but their infection rates in wild bird populations are not well documented. This study documents infection rates of the three pathogens in wild bird populations inhabiting a suburban to rural gradient in Southeast Texas. Various species of wild birds were sampled at five sites in Southeastern Texas representing rural (Birds were captured in mist nets and samples were taken from the oral cavity, crop, and vent to detect the presence of pathogens. Samples were screened for Trichomonas by examining wet mounts under a light microscope, whereas samples were screened for Salmonella and Listeria by examining colonies grown on agar plates. Pathogens detected during the initial screening were further confirmed by PCR and DNA sequencing. Infection rates for Trichomonas, Salmonella, and Listeria were 9%, 17%, and 5%, respectively. The distributions of infection rates across habitats (i.e., rural, exurban, rural) did not differ significantly from the expected null distributions for any of the three pathogens; however, the data suggested some interesting patterns that should be confirmed with a larger dataset. Infection rates for Trichomonas and Salmonella were highest at the suburban sites, whereas the infection rate for Listeria was highest at the rural site. Feeder birds were more likely to be infected by all three pathogens than non-feeder birds. Small sample sizes prevent definitive conclusions regarding variation in infection rates along the suburban to rural gradient, but the results suggest that pathogens followed the predicted patterns. For many of the bird species sampled, this study presents the first report of infection rates by these three pathogens in wild populations.
Jafar Bekloo, Ahmad; Ramzgouyan, Maryam Roya; Shirian, Sadegh; Faghihi, Faezeh; Bakhshi, Hassan; Naseri, Fatemeh; Sedaghat, Mehdi; Telmadarraiy, Zakkyeh
2018-05-01
Anaplasma/Ehrlichia species are tick-transmitted pathogens that cause infections in humans and numerous domestic and wild animal species. There is no information available on the molecular characteristics and phylogenetic position of Anaplasma/Ehrlichia spp. isolated from tick species from different geographic locations in Iran. The aim of this study was to determine the prevalence, molecular characteristics, and phylogenetic relationship of both Anaplasma spp. and Ehrlichia spp. in tick species isolated from different domestic animals from two different geographical locations of Iran. A total of 930 ticks were collected from 93 cattle, 250 sheep, and 587 goats inhabiting the study areas. The collected ticks were then investigated for the presence of Anaplasma/Ehrlichia spp. using nested PCR based on the 16S rRNA gene, followed by sequencing. Sequence analysis was done based on the data published in the GenBank on Anaplasma/Ehrlichia spp. isolates using bioinformatic tools such as the standard nucleotide BLAST. Genome of Anaplasma or Ehrlichia spp. was detected in 14 ticks collected in Heris, including 5 Dermacentor marginatus, 1 Haemaphysalis erinacei, 3 Hyalomma anatolicum, and 4 Rhipicephalus sanguineus, also in 29 ticks collected in Chabahar, including 14 R. sanguineus, 8 D. marginatus, 3 Hyalomma Anatolicum, and 4 Hyalomma dromedarii. Partial analysis of the 16S rRNA gene sequence of positive samples collected from goats and sheep showed that they were infected with Anaplasma/Ehrlichia spp. that were 94-98% identical to ovine Anaplasma and 91-96% identical to Neoehrlichia and Ehrlichia spp. The various ticks identified in this study suggest the possible emergence of tick-borne diseases in animals and humans in these regions. R. sanguineus and D. marginatus seem to be predominant vectors responsible for anaplasmosis in these regions. Partial sequence analysis of the 16S rRNA gene showed that A. ovis is genetically polymorphic in these regions. Furthermore, an
Listeria monocytogenes infection in pregnancy and neonatal sepsis
Directory of Open Access Journals (Sweden)
Francesca Pascale
2008-06-01
Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.
Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...
African Journals Online (AJOL)
The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.
Formation of biofilm by strains of Listeria monocytogenes isolated ...
African Journals Online (AJOL)
Quantification of biofilm formation by 40 Listeria monocytogenes strains from wara soft cheese and its processing environment was assessed on glass vials surfaces. Attachement to glass surface was quantified using a crystal violet binding assay. All the 40 strains produced biofilms after 48 and 72 h incubation at 37oC.
[TYPING OF LEPTOSPIRA SPP. STRAINS BASED ON 16S rRNA].
Ostankova, Yu V; Semenov, A V; Stoyanova, N A; Tokarevich, N K; Lyubimova, N E; Petrova, O A; Ananina, Yu V; Petrov, E M
2016-01-01
Comparative typing of Leptospira spp. strain collection based on analysis of 16S RNA fragment. 2 pairs of primers were used for PCR, that jointly flank 1423b.p. sized fragment. Sequences of Leptospira spp. strain 16S rRNA, presented in the international database, were used for phylogenetic analysis. A high similarity, including interspecies, of the 16S fragment in Leptospira spp. strains was shown independently of the source, serovar and serogroup. Heterogeneity of the primary matrix, spontaneous mutations of hotspots and erroneous nucleotide couplings, characteristic for 16S sequence of pathogenic Leptospira spp. strains, are discussed. Molecular-genetic characteristic of certain reference Leptospira spp. strains by 16S sequence is obtained. Results of the studies give evidence on expedience of introduction into clinical practice of identification of Leptospira spp. by 16S sequence directly from the clinical material, that would allow to significantly reduce identification time, dismiss complex type-specific sera and other labor-intensive methods.
Methylobacterium spp. as an indicator for the presence or absence of Mycobacterium spp.
Falkinham, Joseph O; Williams, Myra D; Kwait, Rebecca; Lande, Leah
2016-06-01
A published survey of bacteria in showerhead biofilm samples revealed that Methylobacterium spp. and Mycobacterium spp. seldom coexisted in biofilms. To confirm that information, biofilm samples were collected from household plumbing of Mycobacterium avium patients and Methylobacterium spp. and M. avium numbers were measured by direct colony counts. The results demonstrated that if Methylobacterium spp. were present, Mycobacterium spp. were absent, and the opposite. The data demonstrate that microbial populations in biofilms can influence the presence or absence of opportunistic premise plumbing pathogens and, thereby, increase the range of strategies to reduce exposure to waterborne pathogens. Finally, by assessing for the visual presence of methylobacteria as pink pigmentation on showers and shower curtains, homeowners and managers of hospitals and other buildings can quickly determine whether a premise plumbing biofilm sample has mycobacteria with a high degree of assurance. Copyright © 2016 Asian African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.
An Internalin A Probe-Based Genosensor for Listeria monocytogenes Detection and Differentiation
Directory of Open Access Journals (Sweden)
Laura Bifulco
2013-01-01
Full Text Available Internalin A (InlA, a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide on the surfaces of screen-printed gold electrodes (Au-SPEs by means of a mercaptan-activated self-assembled monolayer (SAM. The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV using methylene blue (MB as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.
Listeria monocytogenes behaviour in presence of non-UV-irradiated titanium dioxide nanoparticles.
Directory of Open Access Journals (Sweden)
Maria Grazia Ammendolia
Full Text Available Listeria monocytogenes is the agent of listeriosis, a food-borne disease. It represents a serious problem for the food industry because of its environmental persistence mainly due to its ability to form biofilm on a variety of surfaces. Microrganisms attached on the surfaces are a potential source of contamination for environment and animals and humans. Titanium dioxide nanoparticles (TiO2 NPs are used in food industry in a variety of products and it was reported that daily exposure to these nanomaterials is very high. Anti-listerial activity of TiO2 NPs was investigated only with UV-irradiated nanomaterials, based on generation of reactive oxigen species (ROS with antibacterial effect after UV exposure. Since both Listeria monocytogenes and TiO2 NPs are veicolated with foods, this study explores the interaction between Listeria monocytogenes and non UV-irradiated TiO2 NPs, with special focus on biofilm formation and intestinal cell interaction. Scanning electron microscopy and quantitative measurements of biofilm mass indicate that NPs influence both production and structural architecture of listerial biofilm. Moreover, TiO2 NPs show to interfere with bacterial interaction to intestinal cells. Increased biofilm production due to TiO2 NPs exposure may favour bacterial survival in environment and its transmission to animal and human hosts.
Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F
2014-03-03
This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.
Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola
DEFF Research Database (Denmark)
Nilsson, Lilian; Bech Hansen, T.; Garrido, P.
2005-01-01
Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...
Monitoring paneer for Listeria monocytogenes - A high risk food ...
African Journals Online (AJOL)
A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...
Guerra, Diogo Ribeiro Almeida
2012-01-01
Dissertação de Mestrado Integrado em Medicina Veterinária Echinococcus spp., Taenia spp. and Toxocara spp. are important parasites of domestic and wild canids and neglected zoonotic helminths. Despite their relevance in Public Health, little is known about their prevalence in Portugal. An epidemiological study was conducted to clarify the role of canids in the sylvatic and synanthropic cycles of these pathogens in our country. Fecal samples from dog (n = 51), red fox (n = 62) and Iberia...
Commensal Staphylococcus spp., Acinetobacter spp. and ...
African Journals Online (AJOL)
ANTHONY
2012-07-31
Jul 31, 2012 ... Intermittent assessment of resistance genes in the ecosystem should be ..... among resistant Acinetobacter spp. isolated from integrated fish .... independent studies on the emerging phylogenetic view of bacterial .... Functional.
Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han
2015-01-01
Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are
Survival strategies of Listeria monocytogenes - roles of regulators and transporters
Wemekamp-Kamphuis, H.H.
2003-01-01
Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.
Influence of temperature on alkali stress adaptation in Listeria monocytogenes
Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...
Directory of Open Access Journals (Sweden)
M. Kolář
2008-01-01
Full Text Available The study aimed at determining the level of resistance of selected bacterial species (Staphylococcus spp., Enterococcus spp., Escherichia coli isolated from rectal swabs of pigs to antimicrobial agents. The tested strains were isolated from piglets aged 7 to 30 days. Bacterial species were identified by standard microbiological techniques and susceptibility to antibiotics was determined quantitatively by the standard microdilution method. Resistance of the Staphylococcus aureus strain to oxacillin was confirmed by detection of the mecA gene and PBP2a. A total of 115 Staphylococcus spp. isolates were collected. In the case of Staphylococcus aureus, the methicillin-resistant strain (MRSA was identified. Moreover, higher frequency of coagulase-negative staphylococci with minimum inhibitory concentration of oxacillin ≥ 0.5 mg/l was noticed. Inducible resistance to clindamycin in the Staphylococcus hominis strain was also detected. The strains of Enterococcus spp. (61 isolates exhibited high resistance to tetracycline (98.5%, erythromycin (86.8% and chloramphenicol (54.4%. Vancomycin-resistant enterococci were not isolated. In the case of Escherichia coli strains (111 isolates, higher frequency of resistant strains to tetracycline (81.1% and ampicillin (62.2% was documented. Resistance to fluoroquinolones and production of broad-spectrum β-lactamases was not noticed. The presented study may be considered as a pilot project assessing the prevalence of resistant bacteria in piglets kept on a single farm. It demonstrated the presence of resistant strains of Staphylococcus spp., including one MRSA strain, Enterococcus spp. and Escherichia coli. These strains may be present as a result of postnatal colonization with both bacterial microflora of dams and environmental microflora.
Paola Mendes Milanesi; Elena Blume; Marlove Fátima Brião Muniz; Lia Rejane Silveira Reiniger; Zaida Inês Antoniolli; Emanuele Junges; Manoeli Lupatini
2013-01-01
This study aimed i) to quantify the occurrence of Fusarium spp. and Trichoderma spp. in rhizospheric soil, with and without symptoms of Sudden Death Syndrome (SDS) in eight soybean genotypes; ii) morphologically identify isolates of Fusarium spp. from roots with SDS; iii) evaluate the antagonism between Trichoderma spp. and Fusarium spp. isolates from rhizospheric soil and roots from with and without SDS, respectively; and iv) characterize through the ITS1-5.8S-ITS2 region of rDNA the isolate...
Patogénesis de Listeria monocytogenes, microorganismo zoonotico emergente
Directory of Open Access Journals (Sweden)
Kirvis Torres
2005-05-01
Full Text Available Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertidoen sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelularde otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismocuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria dealimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de los marcadores devirulencia de este microorganismo, la biología celular de las interacciones de los marcadores de virulenciacon los receptores de la célula hospedero, el citoesqueleto, las vías de transducción de señales y losmecanismos de inmunidad mediada por células del hospedero. El propósito de esta revisión es describiralgunas características taxonómicas y filogenéticas de Listeria monocytogenes , la incidencia humana yanimal de varios serotipos, la fisiopatología de la infección , modelos animales y de cultivo celular utilizadospara estudios de virulencia, las poblaciones de riesgo, manifestaciones clínicas de listeriosis humana yanimal, el tratamiento, la organización genética y evolución de los determinantes de virulencia, losmecanismos empleados para interactuar con la célula hospedera, y los mecanismos para escapar de losprocesos de muerte celular y pasar de una célula infectada a otra. La información recopilada resulta degran importancia para el personal de salud, industria, consumidores y población de riesgo; razón por lacual Listeria monocytogenes es un patógeno que representa una amenaza para la salud pública mundial.
Directory of Open Access Journals (Sweden)
Roland N. Ndip
2012-07-01
Full Text Available This study assessed the microbiological quality of various ready-to-eat foods sold in Alice, South Africa. Microbiological analysis was conducted on 252 samples which included vegetables, potatoes, rice, pies, beef and chicken stew. The isolates were identified using biochemical tests and the API 20E, API 20NE and API Listeria kits; results were analyzed using the one-way-ANOVA test. Bacterial growth was present in all the food types tested; high levels of total aerobic count were observed in vegetables, 6.8 ± 0.07 followed by rice, 6.7 ± 1.7 while pies had the lowest count (2.58 ± 0.24. Organisms isolated included: Listeria spp. (22%, Enterobacter spp. (18%, Aeromonas hydrophila (12%, Klebsiella oxytoca (8%, Proteus mirabilis (6.3%, Staphylococcus aureus (3.2% and Pseudomonas luteola (2.4%. Interestingly, Salmonella spp. and Escherichia coli were not isolated in any of the samples. There was a statistically significant difference (p < 0.05 in the prevalence of foodborne pathogens from hygienic and unhygienic cafeterias. The results indicated that most of the ready-to-eat food samples examined in this study did not meet bacteriological quality standards, therefore posing potential risks to consumers. This should draw the attention of the relevant authorities to ensure that hygienic standards are improved to curtain foodborne infections.
Novel Listeria Vectors Secreting Gut Flora Altering Agents to Prevent Colon Cancer and Treat Colitis
2016-09-01
ABSTRACT In the prior period we obtained needed IACUC and biosafety approvals, and developed the backbone Listeria vector needed to produce the B7-H1...Unclassified 19b. TELEPHONE NUMBER (include area code) Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 1 Table of contents...cells Timeline Site 1 Major Task 1 Regulatory approvals Months Subtask 1 IACUC approval Done 1-3 Dr. Curiel Subtask 2 Biosafety approval Done 1-3
Liébana, Susana; Brandão, Delfina; Cortés, Pilar; Campoy, Susana; Alegret, Salvador; Pividori, María Isabel
2016-01-21
A magneto-genosensing approach for the detection of the three most common pathogenic bacteria in food safety, such as Salmonella, Listeria and Escherichia coli is presented. The methodology is based on the detection of the tagged amplified DNA obtained by single-tagging PCR with a set of specific primers for each pathogen, followed by electrochemical magneto-genosensing on silica magnetic particles. A set of primers were selected for the amplification of the invA (278 bp), prfA (217 bp) and eaeA (151 bp) being one of the primers for each set tagged with fluorescein, biotin and digoxigenin coding for Salmonella enterica, Listeria monocytogenes and E. coli, respectively. The single-tagged amplicons were then immobilized on silica MPs based on the nucleic acid-binding properties of silica particles in the presence of the chaotropic agent as guanidinium thiocyanate. The assessment of the silica MPs as a platform for electrochemical magneto-genosensing is described, including the main parameters to selectively attach longer dsDNA fragments instead of shorter ssDNA primers based on their negative charge density of the sugar-phosphate backbone. This approach resulted to be a promising detection tool with sensing features of rapidity and sensitivity very suitable to be implemented on DNA biosensors and microfluidic platforms. Copyright © 2015 Elsevier B.V. All rights reserved.
Detection of Listeria species in Gamma irradiated Fishes during Storage periods
International Nuclear Information System (INIS)
Mohamed, W.S.
2011-01-01
This investigation was carried out to detect the post irradiation recovery and growth of Listeria species encountered in frozen whole Tilapia fishes ,Tilapia fillet and frozen Hamour fillets fishes (-18 degree C) irradiated at 1, 2, 2.5 and 3 kGy. The pathogen was eliminated at a dose of 2.5 kGy of gamma radiation. The presence of the microorganism was monitored for sex months on appropriate selective media. The ability of recovery of the organism from irradiation damage was not influenced by the kind of fish. No increased counts of the organism in irradiated fishes at 2.5 kGy of gamma radiation was noticed during 6 months of freezing storage at -18 degree C. This study also aimed to evaluate the effect of different enrichment procedures on the detection of Listeria species in fishes
Kayseri’de Satışa Sunulan Kanatlı Eti Ürünlerinde Listeria spp. Varlığının Belirlenmesi*
YERLİKAYA, Osman Burak; YILDIRIM, Yeliz
2015-01-01
Bu çalışma, Kayseri’de satışa sunulan kanatlı eti ürünlerinde Listeria türlerinin varlığını belirlemek ve bu ürünlerinlisteriozis açısından taşıdığı halk sağlığı risklerini değerlendirmek amacıyla planlanmıştır. Beş farklı kanatlı eti ürününe (Taşlık,ciğer, nugget, sosis, salam) ait örneklerden 20’şer adet olmak üzere toplam 100 örnek analiz edilmiştir. Örnekler iki aşamalızenginleştirme prosedürünü takiben iki ayrı selektif besi yerine ekim ve biyokimyasal identifikasyon yapılmak s...
Factors associated with fecal-shedding of Salmonella spp by horses on US operations
Directory of Open Access Journals (Sweden)
Losinger W.C.
2002-01-01
Full Text Available In a cross-sectional national study that included 972 operations with > 3 horses on 1/1/98 in 28 states in the USA, 8,417 fecal specimens were collected from horses and cultured to test for the presence of Salmonella spp. Operations were characterized as Salmonella spp-positive if at least one fecal specimen tested positive for Salmonella spp. Percentages of Salmonella spp-positive operations were computed by management and other factors (collected from operation-level questionnaires that were hypothesized to be related to fecal shedding of Salmonella spp. A logistic-regression model was constructed to identify factors associated with horses? shedding Salmonella spp in feces on an operation. The odds of an operation being Salmonella spp positive increased as the number of resident horses increased. In addition, the following factors were found to be associated with increased odds of an operation being Salmonella spp positive: horses were used primarily for breeding; operation cleanliness was characterized as poor by the data collector; and new resident equids had been added to the operation without routine quarantine.
Directory of Open Access Journals (Sweden)
Jonatas Campos Almeida
Full Text Available The purpose of this study was to investigate the occurrence of Cryptosporidium spp. and Giardia spp. in a public water-treatment system. Samples of raw and treated water were collected and concentrated using the membrane filtration technique. Direct Immunofluorescence Test was performed on the samples. DNA extraction using a commercial kit was performed and the DNA extracted was submitted to a nested-PCR reaction (n-PCR and sequencing. In the immunofluorescence, 2/24 (8.33% samples of raw water were positive for Giardia spp.. In n-PCR and sequencing, 2/24 (8.33% samples of raw water were positive for Giardia spp., and 2/24 (8.33% samples were positive for Cryptosporidium spp.. The sequencing showed Cryptosporidium parvum and Giardia duodenalis DNA. In raw water, there was moderate correlation among turbidity, color and Cryptosporidium spp. and between turbidity and Giardia spp.. The presence of these protozoans in the water indicates the need for monitoring for water-treatment companies.
To ensure the microbial safety of produce including blueberries, sanitization is a critical step. This study evaluated the efficacy of sanitizers when coupled with frozen storage, in inactivating Escherichia coli O157:H7, Salmonella Typhimurium and Listeria monocytogenes inoculated on wild blueberri...
Incidence and control of Listeria monocytogenes in foods in Denmark
DEFF Research Database (Denmark)
Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen
1999-01-01
The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...
LISTERIA MONOCYTOGENES IN THE CONTEXT OF THE NEW COMMUNITY REGULATIONS
Directory of Open Access Journals (Sweden)
A. Bragagnolo
2008-02-01
Full Text Available In recent years in the countries of the European Union have occurred profound and radical changes regarding the safety and hygiene of foodstuffs. The aim of this work is to highlight the significant changes made by the recent legislation in the control of Listeria monocytogenes.
Phages of Listeria offer novel tools for diagnostics and biocontrol
Directory of Open Access Journals (Sweden)
Martin J Loessner
2014-04-01
Full Text Available Historically, bacteriophages infecting their hosts have perhaps been best known and even notorious for being a nuisance in dairy-fermentation processes. However, with the rapid progress in molecular microbiology and microbial ecology, a new dawn has risen for phages. This review will provide an overview on possible uses and applications of Listeria phages, including phage-typing, reporter phage for bacterial diagnostics, and use of phage as biocontrol agents for food safety. The use of phage-encoded enzymes such as endolysins for the detection and as antimicrobial will also be addressed. Desirable properties of candidate phages for biocontrol will be discussed. While emphasizing the enormous future potential for applications, we will also consider some of the intrinsic limitations dictated by both phage and bacterial ecology.
Energy Technology Data Exchange (ETDEWEB)
Schlech, W.F. III
1984-01-01
The route or mechanism of transmission of Listeria monocytogenes from its rural veterinary reservoir to newborn and older human populations has been obscure. Anecdotal reports of milk-borne infection from cows with Listeria mastitis have been published, but intensive investigations of small outbreaks of L. monocytogenes infections in humans have not supported a gastrointestinal mode of infection. Several recent studies, however, strongly suggest this possibility, and case-control studies of epidemic listeriosis in the Canadian Maritime provinces in 1981 documented an association between ingestion of uncooked vegetables and the development of illness (p = 0.02). In that study, coleslaw from a regional producer which was distributed throughout the Maritimes was considered to be the vehicle of transmission. Cabbage, the raw product in the production of coleslaw, was contaminated at a farm prior to arrival at the plant. Contamination occurred through fertilization with raw manure from a flock of sheep known to harbor L. monocytogenes. Therefore, an indirect link was established between Listeria monocytogenes infection of sheep on a cabbage farm and subsequent development of invasive listeriosis in humans. This study supports findings from other epidemiologic studies of human listeriosis and is consistent with results of investigations into the mode of transmission of natural and laboratory-acquired listeriosis in animals. 34 references.
Prevalence and antibiotics susceptibility profile of Enterococcus spp ...
African Journals Online (AJOL)
This study investigated the prevalence and antibiotics susceptibility of Enterococcus spp. isolated from patients and some selected hospital environment in Abuja, Nigeria. The samples included clinical and environmental. The clinical samples included stool, urine and wound swabs while the environmental samples ...
A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes
Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...
Antimicrobial treatments to control Listeria monocytogenes in queso fresco.
Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco
2017-06-01
Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4 CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.
RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression
Lebreton, Alice; Cossart, Pascale
2017-01-01
ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337
Miller, E. S.; Bates, R. A.; Koebel, D. A.; Fuchs, B. B.; Sonnenfeld, G.
1998-01-01
Exposure to different forms of psychological and physiological stress can elicit a host stress response, which alters normal parameters of neuroendocrine homeostasis. The present study evaluated the influence of the metabolic stressor 2-deoxy-D-glucose (2-DG; a glucose analog, which when administered to rodents, induces acute periods of metabolic stress) on the capacity of mice to resist infection with the facultative intracellular bacterial pathogen Listeria monocytogenes. Female BDF1 mice were injected with 2-DG (500 mg/kg b. wt.) once every 48 h prior to, concurrent with, or after the onset of a sublethal dose of virulent L. monocytogenes. Kinetics of bacterial growth in mice were not altered if 2-DG was applied concurrently or after the start of the infection. In contrast, mice exposed to 2-DG prior to infection demonstrated an enhanced resistance to the listeria challenge. The enhanced bacterial clearance in vivo could not be explained by 2-DG exerting a toxic effect on the listeria, based on the results of two experiments. First, 2-DG did not inhibit listeria replication in trypticase soy broth. Second, replication of L. monocytogenes was not inhibited in bone marrow-derived macrophage cultures exposed to 2-DG. Production of neopterin and lysozyme, indicators of macrophage activation, were enhanced following exposure to 2-DG, which correlated with the increased resistance to L. monocytogenes. These results support the contention that the host response to 2-DG-induced metabolic stress can influence the capacity of the immune system to resist infection by certain classes of microbial pathogens.
Furustrand Tafin, U.; Meis, J.F.G.M.; Trampuz, A.
2012-01-01
We evaluated isothermal microcalorimetry for real-time susceptibility testing of non-Aspergillus molds. MIC and minimal effective concentration (MEC) values of Mucorales (n = 4), Fusarium spp. (n = 4), and Scedosporium spp. (n = 4) were determined by microbroth dilution according to the Clinical
Directory of Open Access Journals (Sweden)
Shahin Gaini
2015-01-01
Full Text Available A previously healthy 74-year-old Caucasian man with penicillin allergy was admitted with evolving headache, confusion, fever, and neck stiffness. Treatment for bacterial meningitis with dexamethasone and monotherapy ceftriaxone was started. The cerebrospinal fluid showed negative microscopy for bacteria, no bacterial growth, and negative polymerase chain reaction for bacterial DNA. The patient developed hydrocephalus on a second CT scan of the brain on the 5th day of admission. An external ventricular catheter was inserted and Listeria monocytogenes grew in the cerebrospinal fluid from the catheter. The patient had severe neurological sequelae. This case report emphasises the importance of covering empirically for Listeria monocytogenes in all patients with penicillin allergy with suspected bacterial meningitis. The case also shows that it is possible to have significant infection and inflammation even with negative microscopy, negative cultures, and negative broad range polymerase chain reaction in cases of Listeria meningitis. Follow-up spinal taps can be necessary to detect the presence of Listeria monocytogenes.
DEFF Research Database (Denmark)
Doyscher, Dominik; Fieseler, Lars; Dons, Lone Elisabet
2013-01-01
Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.?monocytogenes, wher......Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.......?monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L.?monocytogenes is unable to persist in Acanthamoeba castellanii and A.?polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites......-lapse microscopy revealed that shortly after the bacteria are collected, the amoeba can change direction of movement, phagocytose the backpack and continue to repeat the process. The phenomenon was also observed with avirulent L.?monocytogenes mutants, non-pathogenic Listeria, and other motile bacteria, indicating...
Comparative Genomic Analysis of Holospora spp., Intranuclear Symbionts of Paramecia
Directory of Open Access Journals (Sweden)
Sofya K. Garushyants
2018-04-01
Full Text Available While most endosymbiotic bacteria are transmitted only vertically, Holospora spp., an alphaproteobacterium from the Rickettsiales order, can desert its host and invade a new one. All bacteria from the genus Holospora are intranuclear symbionts of ciliates Paramecium spp. with strict species and nuclear specificity. Comparative metabolic reconstruction based on the newly sequenced genome of Holospora curviuscula, a macronuclear symbiont of Paramecium bursaria, and known genomes of other Holospora species shows that even though all Holospora spp. can persist outside the host, they cannot synthesize most of the essential small molecules, such as amino acids, and lack some central energy metabolic pathways, including glycolysis and the citric acid cycle. As the main energy source, Holospora spp. likely rely on nucleotides pirated from the host. Holospora-specific genes absent from other Rickettsiales are possibly involved in the lifestyle switch from the infectious to the reproductive form and in cell invasion.
Disinfectant effect of Methylated Ethanol against Listeria species
Y Yakubu; M D Salihu; O O Faleke; M B Abubakar; A A Magaji,A U Junaidu
2012-01-01
This study was carried out in order to determine the disinfectant effect of Methylated spirit® (95% methanol and 5% ethanol) as a teat dip against Listeria species. Hand milking was employed to collect 576 (288 x 2) raw milk samples from different lactating cows within Sokoto metropolis (Nigeria). 288 samples were collected before disinfecting the udder teats with Methylated spirit®, while the other 288 were collected after disinfection with Methylated spirit®. The ...
Rapid detection of Brucella spp. using loop-mediated isothermal amplification (LAMP).
Chen, Shouyi; Li, Xunde; Li, Juntao; Atwill, Edward R
2013-01-01
Brucella spp. are facultative intracellular bacteria that cause zoonotic disease of brucellosis worldwide. Livestock that are most vulnerable to brucellosis include cattle, goats, and pigs. Brucella spp. cause serious health problems to humans and animals and economic losses to the livestock industry. Traditional methods for detection of Brucella spp. take 48-72 h (Kumar et al., J Commun Dis 29:131-137, 1997; Barrouin-Melo et al., Res Vet Sci 83:340-346, 2007) that do not meet the food industry's need of rapid detection. Therefore, there is an urgent need of fast, specific, sensitive, and inexpensive method for diagnosing of Brucella spp. Loop-mediated isothermal amplification (LAMP) is a method to amplify nucleic acid at constant temperatures. Amplification can be detected by visual detection, fluorescent stain, turbidity, and electrophoresis. We targeted at the Brucella-specific gene omp25 and designed LAMP primers for detection of Brucella spp. Amplification of DNA with Bst DNA polymerase can be completed at 65 °C in 60 min. Amplified products can be detected by SYBR Green I stain and 2.0% agarose gel electrophoresis. The LAMP method is feasible for detection of Brucella spp. from blood and milk samples.
da Silva, Indjara Mallmann; Boelter, Juliana Ferreira; da Silveira, Nádya Pesce; Brandelli, Adriano
2014-07-01
There is increased interest on the use of natural antimicrobial peptides in biomedicine and food preservation technologies. In this study, the antimicrobial activity of nisin encapsulated into nanovesicles containing polyanionic polysaccharides was investigated. Nisin was encapsulated in phosphatidylcholine (PC) liposomes containing chitosan or chondroitin sulfate by the thin-film hydration method and tested for antimicrobial activity against Listeria spp. The mean particle size of PC liposomes was 145 nm and varied to 210 and 134 nm with the incorporation of chitosan and chondroitin sulfate, respectively. Nisin-containing nanovesicles with and without incorporation of polysaccharides had a zeta potential values around -20 mV, showing mostly spherical structures when observed by transmission electron microscopy. Encapsulated nisin had similar efficiency as free nisin in inhibiting Listeria spp. isolated from bovine carcass, and greater efficiency in inhibiting Listeria monocytogenes. The formulation containing chitosan was more stable and more efficient in inhibiting L. monocytogenes when compared to the other nanovesicles tested. After 24 h, the viable cell counts were 2 log lower as compared with the other treatments and 7 log comparing to controls.
International Nuclear Information System (INIS)
Turgis, Mélanie; Millette, Mathieu; Salmieri, Stéphane; Lacroix, Monique
2012-01-01
A combined treatment of an edible coating composed of trans-cinnamaldehyde (TCN; 0.5% p/p) with γ-irradiation was investigated against Listeria inoculated in peeled mini-carrots. First, the D 10 value (γ-irradiation dose required to eliminate 90% of the bacterial population) of TCN was evaluated under air. This treatment resulted in a 3.66-fold increase in relative bacterial radiosensitivity (RBR) as compared to the control without antimicrobial coating. Secondly, the shelf life of mini-carrots during 21 day of storage at 4 °C was studied. Antimicrobial coating containing TCN was assayed in combination with two irradiation doses (0.25 and 0.5 kGy). Results suggested that the inactive coating did not have any antimicrobial effect against Listeria while the coating containing TCN resulted in a 1.29 log reduction in carrots packed under air after 21 days of storage. Hence, these observations indicated that the combination of irradiation with antimicrobial coating played an important role in enhancing the radiosensitization of Listeria to γ-irradiation. - Highlights: ► Synergistic effect of essential oils and γ-radiation against food pathogens. ► Reducing any undesirable organoleptic impact due to high concentration of EOs. ► Potential in controlling food pathogens and food spoilage bacteria in food. ► Elimination of Listeria monocytogenes in the carrots during the storage.
Bacterial microflora of roach (Rutilus rutilus caught in the Driksna river in Latvia
Directory of Open Access Journals (Sweden)
Alina Kluga
2017-05-01
Full Text Available Fish and fish products are a food group with a high nutritional value, however, the fish may contains a variety of microorganisms, which may cause foodborne infection outbreaks in humans after consumption. The aim of the present study was to identify the bacterial microflora of skin, gill and gut of roach caught in river. Altogether, nine roach (Rutilus rutilus samples were collected from fishermen from Driksna river in Latvia. Skin, gills and gut samples were investigated for total bacterial count (TBC, coliforms and Enterobacteriaceae. Pooled skin, muscles and internal organ samples were examined for presence of pathogens – Salmonella spp., Listeria spp. and Yersinia spp. in accordance with ISO standards. Identification of bacterial species was performed with MALDI-TOF MS Biotyper. TBC ranged from 1.96 to 5.16 log10 CFU g-1, coliforms from 0 to 3.66 log10 CFU g-1 and Enterobacteriaceae from 0 to 4.16 log10 CFU g-1 in roach skin, gills and gut samples. The highest counts of TBC, coliforms and Enterobacteriaceae was found in roach gills and gut samples, while there were no significant differences between the TBC in skin, gills and gut (p<0.05. Rahnella spp. and Pseudomonas spp. were the dominant bacteria identified in fish skin, gills and gut. These microorganisms promote the development of deterioration processes of fish meat, and also can be associated with human infections. Salmonella spp., Listeria spp. and Yersinia spp. were not detected in fish samples, however, the presence of potential human pathogens - Aeromonas spp. and Staphylococcus spp. in roach samples was observed.
Transferability of SSR and RGA markers developed in Cynodon spp. to Zoysia spp.
Bermudagrass (Cynodon spp.) and zoysiagrass (Zoysia spp.), which are both used as warm-season turfgrasses in the United States, are members of subfamily Chloridoideae and are reported to be at least 55% genetically similar. To assess if molecular tools between the two species can be interchanged, 93...
Directory of Open Access Journals (Sweden)
Leonora González Mesa
2005-12-01
Full Text Available La resistencia a meticilina en el género Staphylococcus spp es un problema creciente en el ámbito mundial. La producción de una PBP alterada (PBP2a con baja afinidad a betalactámicos, mediada por el gen mec A, es la responsable de esta resistencia. Mientras que los Staphylococcus spp todavía permanecen sensibles a vancomicina, algunos Enterococcus spp han adquirido la capacidad de neutralizar esta droga. En nuestro país no se conocen datos actualizados sobre la tasa de infección por S. aureus meticilina resistente (SAMR, ni sobre la circulación de este germen en la comunidad, tampoco existen reportes de Enterococcus spp vancomicina resistente (EVR. En este estudio fueron analizadas 774 cepas, colectadas en hospitales del país. Se determinó el mecanismo de resistencia utilizando métodos sugeridos por las guías NCCLS. El 9.3 % (23 de los S. aureus aislados en los hospitales y 4.0% (7 S. aureus aislados en la comunidad, fueron SAMR, portadores del gen mec A, el 69.9 % (72 de Staphylococcus coagulasa negativo, fueron resistentes a oxacilina. En la detección del Enterococcus spp vancomicina resistente (EVR, se encontró una cepa portadora de este fenotipo. Nuestros resultados revelan que en nuestro país los SAMR no son un problema en los hospitales, ni en el ambiente comunitario, a pesar de que se reporta por primera vez la circulación de estos en la comunidad y la circulación de EVR en el ambiente hospitalario, su frecuencia es muy baja lo que refleja los avances obtenidos en la aplicación de políticas encaminadas a racionalizar el uso y consumo de antibióticos.Resistance to methicilline in Staphylococcus spp genus is a growing problem worldwide. The production of an altered penicillin-fixing protein with low mecA gen-mediated affinity to beta-lactams is responsible for this resistance. Although Staphylococcus spp still remain susceptible to vancomycin, some Enterococcus spp have acquired the capacity of neutralizing this drug. In
Activity of daptomycin against Listeria monocytogenes isolates from cerebrospinal fluid
Spanjaard, Lodewijk; Vandenbroucke-Grauls, Christina M. J. E.
2008-01-01
We tested the activity of daptomycin against 76 Listeria monocytogenes isolates from cerebrospinal fluid by broth dilution and Etest methods. For the broth dilution method, the MIC range was 1.0 to 8.0 and the MIC at which 90% of the isolates tested were inhibited (MIC(90)) was 4.0 mg/liter. For the
Listeria monocytogenes, a down-to-earth pathogen.
Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal
2013-01-01
Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.
EKOLOGI Anopheles spp. DI KABUPATEN LOMBOK TENGAH
Directory of Open Access Journals (Sweden)
Majematang Mading
2014-07-01
Full Text Available Malaria remains a public health problem in West Nusa Tenggara Province. Central Lombok District is one of the areas with high case of malaria. Annual Malaria Incidence (AMI was increased from 5.9 ‰ in 2006, 6.7‰ up to 8.1‰ in 2008. The objective of the study is to describe the ecological condition of Anopheles spp. through observation, measurement of environmental variables, larvae and adult collection. This research was an observational research with cross-sectional study. The population of this study is all mosquitos and breeding habitats of Anopheles spp. that exist in the research location. Ecological observations carried out on anopheles breeding habitats including acidity, salinity, shaded places and aquatic biota. Air temperature and humidity measured at the adult mosquitoes trapping sites. The result showed that pH values of water is around 9.00, salinity in the breeding habitats around 14 ppm, and water biota (i.e. moss, grass, shrimps, fishes, tadpoles and crabs surrounded by bushes with larvae density 0,1-28,8 each dipping. The air measurement at the time was between 23°-27° Celsius and 65%-84% humidity. This research concludes that ecology and environmental conditions were supporting the development of larvae and adult mosquito of Anopheles spp.Keywords: ecology, Anopheles spp., Central Lombok
da Silva Fernandes, Meg; Kabuki, Dirce Yorika; Kuaye, Arnaldo Yoshiteru
2015-05-04
The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8 days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8 days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8 days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8 days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organismsbiofilms under all tested conditions (counts of the all microorganisms biofilms under all the test conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels
Directory of Open Access Journals (Sweden)
Qi Zhu
2017-03-01
Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.
Draft Genome Sequences of Historical Listeria monocytogenes from Human Listeriosis, 1933
We report here the draft genome sequences of two Listeria monocytogenes strains from some of the earliest reported cases of human listeriosis in North America. The strains were isolated in 1933 from patients in Massachusetts and Connecticut, USA, and belong to the widely disseminated hypervirulent c...
Nastasijevic, Ivan; Milanov, Dubravka; Velebit, Branko; Djordjevic, Vesna; Swift, Craig; Painset, Anais; Lakicevic, Brankica
2017-09-18
Repeated Listeria outbreaks particularly associated with Ready-To-Eat (RTE) delicatessen meat products have been reported annually at global level. The most frequent scenario that led to foodborne outbreaks was the post-thermal treatment cross-contamination of deli meat products during slicing and modified atmosphere packaging (MAP). The precondition for such cross contamination is the previous introduction of Listeria into meat processing facilities and subsequent colonization of the production environment, associated with formation of biofilms resilient to common sanitation procedures regularly applied in meat establishments. The use of Whole Genome Sequencing (WGS) can facilitate the understanding of contamination and colonization routes of pathogens within the food production environment and enable efficient pathogen tracking among different departments. This study aimed to: a) provide a proof of concept on practical use of WGS in a meat establishment to define the entry routes and spread pattern of L. monocytogenes, and b) to consider the regular use of WGS in meat processing establishments as a strong support of food safety management system. The results revealed that Listeria spp. was present in slaughter line, chilling chambers, deboning, slicing, MAP, as well as in corridors and dispatch (53 positive samples, out of 240). Eight L. monocytogenes isolates (out of 53) were identified from the slaughterhouse, chilling chambers, deboning, MAP and dispatch. L. monocytogenes isolates were of three different serotypes (1/2a, 1/2c, 4b) and correspondingly of three MLST sequence types. Overall, two pairs of L. monocytogenes isolates were genetically identical, i.e. two serotype 4b isolates (ST1), isolated from water drain at dispatch unit and two isolates obtained from slaughterhouse (floorwall junction at the carcass wash point) and MAP (water drain). These findings indicated that L. monocytogenes isolates identified in meat processing units (MAP, chilling chamber
Azlan, Asprizatul; Yoza, Defri; Mardhiansyah, M
2016-01-01
Trigona spp. is include into stingless bee honey. Trigona spp. has another names, such as, galo-galo (Sumatera), klanceng, lenceng (Jawa), andteuweul (Sunda). The population of Trigona spp. in many areas in Indonesia. Trigona spp. produce are honey, pollen, royal jelly, propolis and beeswax. People do not know much yet about the benefit and how to cultivation of Trigona spp. type, material and size of bee's nest. The purpose of this research is to know successfull affectiveness movement of Tr...
Sensitivity of Listeria monocytogenes to irradiation
International Nuclear Information System (INIS)
Tarjan, Veronika
1990-01-01
Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs
Johnsen, Bjørn Odd; Lingaas, Egil; Torfoss, Dag; Strøm, Erik H; Nordøy, Ingvild
2010-12-01
Listeria monocytogenes is a foodborne pathogen with a high mortality rate. We report a large, nosocomial outbreak of Listeria monocytogenes infection. Patients with L. monocytogenes isolated from a sterile site, or from faeces when diarrhoea and fever were present, were included. Clinical data were collected from the patient records. The incubation period was calculated as the time between exposure and start of symptoms. Seventeen patients (11 women, median age 64 years) were infected of whom 15 patients were at increased risk for listeriosis. Eleven patients received empiric antibiotic treatment, eight of them with cephalosporins. Three patients died with a resulting mortality rate of 18%. The source of the outbreak was a Camembert cheese made from pasteurised milk containing up to 360 million colony forming units per portion. The median incubation period was 3-4 days. The incubation period in this outbreak was significantly shorter than previously reported, a fact that may be due to the high number of ingested bacteria. Furthermore, food restrictions in hospitals seem warranted, as do treatment with antibiotics effective against L. monocytogenes in at-risk populations. Copyright © 2010 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Potentially harmful Ostreopsis spp. in the coastal waters of Alexandria - Egypt
Directory of Open Access Journals (Sweden)
A. ISMAEL
2012-09-01
Full Text Available Ostreopsis spp. has been reported for the first time from the Egyptian Mediterranean waters. Macroalgal samples were collected monthly between June 2005 and December 2007, from the rocks at Abu Qir, from less than 1.5 m depth, and their associated microalgae examined. Populations of two Ostreopsis morphotypes were found to occur in this location, east of Alexandria, viz., O. cf ovata Fukuyo and Ostreopsis morph1. The Ostreopsis spp. was abundant and dominant during the summer. They were more abundant as epiphytes of the brown algae Padina sp. and Sargassum sp., less abundant on the red algae Corallina sp., Jania sp., Laurencia sp. and even less so on the green algae Ulva spp. Ostreopsis cf. ovata was also identified during the summer months on the same macroalgal species, although in a much lower abundance. Ostreopsis spp. alternated in dominance with the benthic cyanobacteria Oscillatoria spp. and the diatom Licmophora sp. Other benthic dinoflagellates recorded at low abundance included Amphidinium carterae, Gymnodinium sp. and Prorocentrum lima.
Pathogen inactivation in liquid dairy manure during anaerobic and aerobic digestions
Biswas, S.; Pandey, P.; Castillo, A. R.; Vaddella, V. K.
2014-12-01
Controlling manure-borne pathogens such as E. coli O157:H7, Salmonella spp. and Listeria monocytogenes are crucial for protecting surface and ground water as well as mitigating risks to human health. In California dairy farms, flushing of dairy manure (mainly animal feces and urine) from freestall barns and subsequent liquid-solid manure separation is a common practice for handling animal waste. The liquid manure fraction is generally pumped into the settling ponds and it goes into aerobic and/or anaerobic lagoons for extended period of time. Considering the importance of controlling pathogens in animal waste, the objective of the study was to understand the effects of anaerobic and aerobic digestions on the survival of three human pathogens in animal waste. The pathogen inactivation was assessed at four temperatures (30, 35, 42, and 50 °C), and the relationships between temperature and pathogen decay were estimated. Results showed a steady decrease of E. coli levels in aerobic and anaerobic digestion processes over the time; however, the decay rates varied with pathogens. The effect of temperature on Salmonella spp. and Listeria monocytogenes survival was different than the E. coli survival. In thermophilic temperatures (42 and 50 °C), decay rate was considerable greater compared to the mesophilic temperatures (30 and 35°C). The E. coli log reductions at 50 °C were 2.1 in both aerobic and anaerobic digestions after 13 days of incubation. The Salmonella spp. log reductions at 50 °C were 5.5 in aerobic digestion, and 5.9 in anaerobic digestion. The Listeria monocytogenes log reductions at 50 °C were 5.0 in aerobic digestion, and 5.6 in anaerobic digestion. The log reduction of E. coli, Salmonella spp., and Listeria monocytogens at 30 °C in aerobic environment were 0.1, 4.7, and 5.6, respectively. In anaerobic environment, the corresponding reductions were 0.4, 4.3, and 5.6, respectively. We anticipate that the outcomes of the study will help improving the
Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A
2017-01-01
Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.
Evaluation of Listeria monocytogenes survival and infectivity in non-traditional agricultural waters
Introduction: Listeria monocytogenes (Lm) is an enteric bacterium that can be found in environmental reservoirs. Restricted water availability for agriculture has increased interest in surface and reuse water sources which could potentially transmit Lm. Purpose: Persistence and infectivity of Lm re...
Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling
Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pat...
Lu, J; Struewing, I; Yelton, S; Ashbolt, N
2015-07-01
To examine the occurrence and quantity of potential pathogens and an indicator of microbial contamination in the sediments of municipal drinking water storage tanks (MDWSTs), given the absence of such data across the United States. Sediment samples (87 MDWST) from eighteen locations across ten states of the United States were collected and assayed by qPCR for a range of potential enteric and opportunistic microbial pathogens and a sewage-associated Bacteroides marker. Potential opportunistic pathogens dominated, with the highest detection of occurrence (per cent positive detection; average cell equivalence (CE)) being Mycobacterium spp. (88·9%; 6·7 ± 8·5 × 10(4) CE g(-1) ), followed by Legionella spp. (66·7%; 5·2 ± 5·9 × 10(3) CE g(-1) ), Pseudomonas aeruginosa (22·2%; 250 ± 880 CE g(-1) ) and Acanthamoeba spp. (38·9%; 53 ± 70 CE g(-1) ), with no detected Naegleria fowleri. Most enteric pathogens (Campylobacter jejuni, Escherichia coli 0157:H7, Salmonella enterica, Cryptosporidium parvum and Giardia duodenalis) were not detected, except for a trace signal for Campylobacter spp. There was significant correlation between the qPCR signals of Legionella spp. and Acanthamoeba spp. (R(2) = 0·61, n = 87, P = 0·0001). Diverse Legionella spp. including Leg. pneumophila, Leg. pneumophila sg1 and Leg. anisa were identified, each of which might cause legionellosis. These results imply that potential opportunistic pathogens are common within MDWST sediments and could act as a source of microbial contamination, but need downstream growth to be of potential concern. The results imply that opportunistic pathogen risks may need to be managed by regular tank cleaning or other management practices. 2015 The Society for Applied Microbiology.
Gómez, Natacha Caballero; Abriouel, Hikmate; Grande, M A José; Pulido, Rubén Pérez; Gálvez, Antonio
2012-05-01
Enterocin AS-48 was tested on a cocktail of Listeria monocytogenes strains in planktonic and sessile states, singly or in combination with biocides benzalkonium chloride, cetrimide, hexadecylpyridinium chloride, didecyldimethylammonium bromide, triclosan, poly-(hexamethylen guanidinium) hydrochloride, chlorhexidine, hexachlorophene, and the commercial sanitizers P3 oxonia and P3 topax 66. Combinations of sub-inhibitory bacteriocin concentrations and biocide concentrations 4 to 10-fold lower than their minimum inhibitory concentrations (MIC) completely inhibited growth of the planktonic listeriae. Inactivation of Listeria in biofilms formed on polystyrene microtiter plates required concentrations of enterocin AS-48 greater than 50 μg/ml, and biocide concentrations ten to 100-fold higher. In combination with enterocin AS-48 (25 or 50 μg/ml), microbial inactivation increased remarkably for all biocides except P3 oxonia and P3 topax 66 solutions. Polystyrene microtiter plates conditioned with enterocin solutions (0.5-25 μg/ml) decreased the adherence and biofilm formation of the L. monocytogenes cell cocktail, avoiding biofilm formation for at least 24 h at a bacteriocin concentration of 25 μg/ml. Copyright © 2011 Elsevier Ltd. All rights reserved.
Comparative evaluation of the antimicrobial activity of Citrullus ...
African Journals Online (AJOL)
... Salmonella typhimurium, Vibrio parahaemolyticus and Vibrio alginolyticus) and gram-positive (Enterococcus faecalis, Staphylococcus aureus, Staphylococcus epidermidis, Listeria monocytogenes and Micrococcus luteus) bacteria and various Candida spp. (Candida glabrata, Candida albicans, Candida parapsilosis and ...
Directory of Open Access Journals (Sweden)
Hllytchaikra Ferraz Fehlberg
Full Text Available The objective of this study was to standardize the high-resolution melting method for identification and discrimination of Toxoplasma gondii, Sarcocystis spp., Neospora spp., and Cryptosporidium spp. by amplification of 18S ribosomal DNA (rDNA using a single primer pair. The analyses were performed on individual reactions (containing DNA from a single species of a protozoan, on duplex reactions (containing DNA from two species of protozoa in each reaction, and on a multiplex reaction (containing DNA of four parasites in a single reaction. The proposed method allowed us to identify and discriminate the four species by analyzing the derivative, normalized, and difference melting curves, with high reproducibility among and within the experiments, as demonstrated by low coefficients of variation (less than 2.2% and 2.0%, respectively. This is the first study where this method is used for discrimination of these four species of protozoa in a single reaction.
Directory of Open Access Journals (Sweden)
Adetunji, V. O
2013-12-01
Full Text Available Aim: Over the years, there have been considerable increases in the consumption of frozen poultry foods across Nigeria. Little attention has been paid to the microbial quality of these foods and hence constitutes a threat to public health. The contamination levels (Enterobacteriaceae and Listeria counts and the presence of pathogenic E. coli, Salmonella and Listeria along the processing line of sale of frozen poultry foods were assayed in retail outlets. Methodology and results: Bacteriological counts and bacterial isolation were carried out using standard plate methods, while the direct slide agglutination technique was utilized for serology. Bacteriological assay revealed extremely high counts (Listeria count (LC: 7.784±1.109 - 9.586±0.016 log cfu/cm2; Enterobacteriaceae count (EC: 7.151±0.213 - 9.318±0.161 log cfu/cm2, higher than stipulated by International Food Standard Agencies. The highest count for EC (9.318±0.161 log cfu/cm2 and LC 9.586±0.016 log cfu/cm2 was from the weighing scale and processing table. Averagely, LC (8.598±0.733 log cfu/cm2 was higher than EC (8.145±0.936 log cfu/cm2. Weighing scale had counts significantly different (p < 0.05 from all others for EC. But there were no significant differences in LC. Weighing scale and meat tables were critical control points (CCPs in the processing line for sale of frozen poultry meats in the retail outlets. E. coli spp., E. coli O157:H7, Salmonella spp., Salmonella Enteritidis, Listeria spp. and Listeria monocytogenes were isolated along the processing line. Conclusion, significance and impact of the study: Results of this study indicated that poultry meat are easily contaminated along the processing line of sale and may act as a potential risk to public health if counteractive measures are not applied to reduce microbial contamination during storage, sale and distribution to consumers.
Morphological change and decreasing transfer rate of biofilm-featured Listeria monocytogenes EGDe
Listeria monocytogenes, a lethal foodborne pathogen, has the ability to resist the hostile food-processing environment and, thus, frequently contaminates ready-to-eat foods during processing. It is commonly accepted that L. monocytogenes’ tendency to generate biofilms on various surfaces enhances it...
African Journals Online (AJOL)
Items 7451 - 7500 of 11090 ... ... Listeria monocytogenes- A high risk food pathogen by multiplex PCR, Abstract PDF ... and molecular characterization of Oyster mushroom (Pleurotus spp.) ... Vol 14, No 15 (2015), Morphological and RAPD-marker ...
Rai, Rakesh K; Vishvakarma, Naveen K; Mohapatra, Tribhuban M; Singh, Sukh Mahendra
2012-09-01
This study investigates the effect of Listeria administration on differentiation of macrophages from precursor bone marrow cells and functional status of tumor-associated macrophages (TAM). Listeria administration not only resulted in an augmented infiltration of tumor by F4/80 macrophages but also repolarized the functional status of TAM displaying features of some M1 macrophage subtype with upregulated phagocytosis and tumoricidal activity accompanied by altered expression of monocarboxylate transporter-1, toll-like receptor-2, surface markers: CD11c, interleukin-2 receptor, CD62L, and secreted molecules: nitric oxide, interleukin (IL)-1, IL-6, tumor necrosis factor-α, and vascular endothelial growth factor. Declined tumor cell survival and modulated repertoire of cytokines: interferon-γ, IL-6, IL-10, and transforming growth factor-β in tumor microenvironment indicated their role in polarization of TAM towards proinflammatory state. Bone marrow cell of Listeria-administered tumor-bearing mice showed augmented survival, declined expression of p53 upregulated modulator of apoptosis with an upregulated differentiation into activation responsive bone marrow-derived macrophages along with altered expression of macrophage-colony stimulating factor, macrophage-colony stimulating factor receptor, and granulocyte macrophage-colony stimulating factor receptor. These findings indicate that Listeria infection is associated with an augmented differentiation of macrophages accompanied by tumoricidal activation of TAM.
Directory of Open Access Journals (Sweden)
Ahmad Muslim
2014-08-01
Full Text Available Soil microbes associated with rhizosphere are important for promoting plant growth and inducing resistance to diseases. The research was conducted to study the ability of Trichoderma spp. and Penicillium spp. isolated from rhizosphere in lowland swampy area for controlling damping-off disease caused by Rhizoctonia solani Khun. Trichoderma spp. and Penicillium spp. were cultured in bran, corn meal, and rice straw containing media and applied as inoculum to 2-weeks old seedlings. Application of two fungi isolates effectively induced resistance of chili plants to damping-off disease. Trichoderma spp. and Penicillium spp. were significantly reduced disease incidence by 61.5–100% to 46.2–100%, respectively and disease severity by 50–100% and 30–95.9%, respectively. This experiment showed the potential of Trichoderma spp. and Penicillium spp. as biocontrol agents to control damping-off disease on chili.
Evaluation of the Thermo Scientific SureTect Listeria monocytogenes Assay.
Cloke, Jonathan; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Evans, Katharine; Crabtree, David; Hughes, Annette; Hopper, Craig; Simpson, Helen; Withey, Sophie; Oleksiuk, Milena; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko
2014-01-01
The Thermo Scientific SureTect Listeria monocytogenes Assay is a new real-time PCR assay for the detection of Listeria monocytogenes in food and environmental samples. This assay was validated using the AOAC Research Institute (AOAC-RI) Performance Tested Methods program in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996, including Amendment 1:2004 with the following foods and food contact surfaces: smoked salmon, processed cheese, fresh bagged spinach, fresh cantaloupe, cooked prawns (chilled product), cooked sliced turkey meat (chilled product), ice cream, pork frankfurters, salami, ground raw beef meat (12% fat), plastic, and stainless steel. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, bagged lettuce, and stainless steel) were analyzed independently as part of the AOAC-RI controlled laboratory study by the University of Guelph, Canada. Using probability of detection (POD) statistical analysis, a significant difference was demonstrated between the candidate and reference methods for salami, cooked sliced turkey and ice cream in favor of the SureTect assay. For all other matrixes, no significant difference by POD was seen between the two methods during the study. Inclusivity and exclusivity testing was also conducted with 53 and 30 isolates, respectively, which demonstrated that the SureTect assay was able to detect all serotypes of L. monocytogenes. None of the exclusivity isolates analyzed were detected by the SureTect assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside the recommended parameters open to variation, i.e., enrichment time and temperature and lysis temperature, which demonstrated that the assay gave reliable performance. Accelerated stability testing was also conducted, validating the assay shelf life.
Directory of Open Access Journals (Sweden)
Zineb Benmechernene
2013-01-01
Full Text Available Two strains (B7 and Z8 of the Leuconostoc mesenteroides subspecies mesenteroides that were isolated from Algerian camel milk from an initial pool of 13 strains and demonstrated a high ability to inhibit the growth of Listeria spp. were selected and characterised at the phenotypic and genotypic levels. Probiotic profiling and inhibition spectra against food borne pathogens in mixed cultures were also investigated. The bacteriocin produced by L. mesenteroides strain B7 was identified as leucocin B by specific PCR. In vitro studies demonstrated that both Leuconostoc mesenteroides strains exhibited a marked probiotic profile, showing high survival at low pH (2-3 and 4 in the presence of 0.5%, 1%, and 2% of bile salts and at pH 3 in the presence of 3 mg/mL pepsin. Susceptibility testing against antimicrobial agents was also performed for both strains. When tested in a mixed culture with Listeria innocua, Listeria ivanovii, or Staphylococcus aureus, strain B7 reduced the numbers of these species by 1.87, 1.78, and 1.38 log units, respectively. Consequently, these two strains were found to possess good probiotic properties in vitro and a high capacity for Listeria spp. inhibition in mixed cultures. Therefore, these strains have a favourable technological aptitude and a potential application as novel probiotic starters.
Recuperación de listeria monocytogenes dañada subletalmente por efecto de la congelación
Blanco Gutiérrez, María del Mar
1995-01-01
Se han estudiado distintos aspectos relacionados con la influencia que ejerce la congelación sobre la viabilidad y el daño celular sobre las listerias en general y l. Monocytogenes, asi como distintas cuestiones con relación a la detección de listerias a partir de muestras que han sufrido un proceso de congelación. Respecto a la primera parte, hemos observado que la resistencia de l. Monocytogenes a los efectos letales y subletales de la congelación (-20 c) se ve influenciada por la concentra...
Directory of Open Access Journals (Sweden)
abazar pournajaf
2013-09-01
Full Text Available Background: Listeria monocytogenes is a facultative intracellular pathogen that causes listeriosis which has extensive clinical manifestations. Infections with L. monocytogenes are a serious threat to immunocompromised persons. The aim of this study was to determine the frequency of L. monocytogenes strains recovered from clinical and non-clinical samples using phenotypic methods and confirmed by PCR. Materials and Methods: In this study, 617 specimens were analyzed. All specimens were cultured in the specific PALCAM agar. Colonies were initially identified by routine biochemical tests. Finally, PCR assays using primers specific for inlA gene were performed. Results: In all, 46 (8.2% L. monocytogenes isolates were recovered from 617 specimens. Fourteen (8.2% strains, including 4 (7.5%, 2 (5.7%, 5 (14.2% and 3 (8.5% isolates were obtained from placental tissue, urine, vaginal and rectal swabs, respectively. In addition, 9 (7.4% strains of L. monocytogenes which were isolated from 107 different dairy products originated from cheese 5 (7.1%, cream 2 (10% and kashk 2 (11.7%, respectively. Among 11 (5.2% strains isolated from 210 different meat products, 5 (5.5%, 4 (7.2% and 2 (3% strains belonged to sausage, meat and poultry extracts, respectively. Finally, 12 (9.2% Listeria strains were recovered from 130 animal specimens that included 6 (10%, 4 (8% and 2 (10% strains from goat, sheep and cattle, respectively. Furthermore, all Listeria isolates (100% were found to be carriers of inlA gene in PCR assay. Conclusion: The present study showed that the clinical and non-clinical specimens were contaminated with L. monocytogenes. So, it seems necessary to use a simple and standard technique such as PCR for rapid detection of this organism from various sources.
Development of novel Alicyclobacillus spp. isolation medium.
Chang, S; Kang, D-H
2005-01-01
To develop a new isolation medium with higher recovery rates of Alicyclobacillus spp. SK agar was developed with optimized incubation temperature, pH, acidulant, Tween 80 concentration and divalent cation addition. Results indicate that detection of Alicyclobacillus spp. by SK agar was significantly higher (P > 0.05) than those obtained by K agar, orange serum agar, and potato dextrose agar. Current media used for Alicyclobacillus spp. isolation still resulted in high numbers of false negative products. The sensitivity of SK agar to Alicyclobacillus spp. allows detection of low numbers of Alicyclobacillus spp. and also provides a more higher isolation results compared with currently used media. SK agar will be useful to the fruit juice industry to obtain more accurate numbers of contaminant Alicyclobacillus spp. With this media, false negative samples can be reduced, and the likelihood of exported products being rejected can be greatly reduced.
Rodriguez, Andres; Autio, Wesley R; McLandsborough, Lynne A
2008-01-01
The purpose of this study was to evaluate the effect of surface roughness (Ra) and finish of mechanically polished stainless steel (Ra = 0.26 +/- 0.05, 0.49 +/- 0.10, and 0.69 +/- 0.05 microm) and electropolished stainless steel (Ra = 0.16 +/- 0.06, 0.40 +/- 0.003, and 0.67 +/- 0.02 microm) on Listeria adhesion and biofilm formation. A four-strain cocktail of Listeria monocytogenes was used. Each strain (0.1%) was added to 200 ml of tryptic soy broth (TSB), and coupons were inserted to the mixture for 5 min. For biofilm formation, coupons with adhesive cells were incubated in 1:20 diluted TSB at 32 degrees C for 48 h. The experiment was performed by a randomized block design. Our results show that the level of Listeria present after 48 h of incubation (mean = 7 log CFU/cm2) was significantly higher than after 5 min (mean = 6.0 log CFU/cm2) (P stainless steel (mean = 6.7 log CFU/cm2) (P > 0.05). Listeria initial adhesion (values ranged from 5.9 to 6.1 log CFU/cm2) or biofilm formation (values ranged from 6.9 to 7.2 log CFU/cm2) was not significantly correlated with Ra values (P > 0.05). Image analysis with an atomic force microscope showed that bacteria did not colonize the complete surface after 48 h but were individual cells or grouped in microcolonies that ranged from 5 to 10 microm in diameter and one to three cell layers in thickness. Exopolymeric substances were observed to be associated with the colonies. According to our results, electropolishing stainless steel does not pose a significant advantage for food sanitation over mechanically finished stainless steel.
Stress Distribution, Friction and Listeria Propulsion
Prost, Jacques
2003-03-01
I will review our work on the physics of listeria propulsion based on an unavoidable elastic analysis of the stress distribution in the actin gel and dynamical boundary conditions (both normal and tangential). I will show in particular that it provides a natural explanation for the symmetry breaking transition occurring with beads (work with K. Sekimoto and F. Julicher), of the saltatory behavior of beads reported by A Bernheim et al (Nature 2002) and of the shape of soft beads (with O. Campas and J.F Joanny). This last analysis proves that, as announced in an earlier paper (F; Gerbal et al Biophys Journal 2000) the rear part of the gel contributes negatively to the motion.
CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS
Directory of Open Access Journals (Sweden)
R. Mioni
2013-02-01
Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.
Directory of Open Access Journals (Sweden)
Tanzia Akon
2015-06-01
Full Text Available Objective: To demonstrate the antibacterial activity of cosmetic products commonly used by the community of Dhaka metropolis. Methods: A total of 10 categories of cosmetic samples (with a subtotal of 30 brands were subjected to microbiological analysis through conventional culture and biochemical tests. Agar well diffusion method was used to determine the antibacterial trait in the tested samples which was further confirmed by the minimum inhibitory concentration method. Results: All samples were found to be populated with bacteria and fungi up to 105 CFU/ g and 103 CFU/g, respectively. Growth of Staphylococcus spp., Pseudomonas spp. and Klebsiella spp. was recorded as well. Conversely, 7 out of 30 items were found to exhibit the in vitro antibacterial activity against an array of laboratory test bacterial species including Staphylococcus spp., E. coli, Bacillus spp., Pseudomonas spp., Klebsiella spp. and Listeria spp. Consequently, all the samples showed antibacterial activity below the concentration of 0.46 mg/mL as found in the minimum inhibitory concentration test. Conclusions: Overall, the presence of huge microbial population in cosmetic products is not acceptable from the point microbiological contamination level. The antibacterial trait of these items, in contrary, may draw an overall public health impact.
Hanaoka, Nozomu; Matsutani, Minenosuke; Satoh, Masaaki; Ogawa, Motohiko; Shirai, Mutsunori; Ando, Shuji
2017-01-24
We developed a novel loop-mediated isothermal amplification (LAMP) method to detect Rickettsia spp., including Rickettsia prowazekii and R. typhi. Species-specific LAMP primers were developed for orthologous genes conserved among Rickettsia spp. The selected modified primers could detect all the Rickettsia spp. tested. The LAMP method was successfully used to detect 100 DNA copies of Rickettsia spp. within approximately 60 min at 63℃. Therefore, this method may be an excellent tool for the early diagnosis of rickettsiosis in a laboratory or in the field.
Fu, B; Jiang, Q; Liu, H-B; Liu, H
2015-10-01
The presence of viable but nonculturable (VBNC) bacterial pathogens which often fail to be detected by cultivation and can regain the cultivability if the living conditions improve were reported. The objective of this study was to determine the occurrence of VBNC Salmonella spp. and Shigella spp. in the biosolids during anaerobic digestion and its reactivation during the cake storage. The occurrence of VBNC Salmonella spp. and Shigella spp. during mesophilic, temperature-phased, thermophilic anaerobic digestion of sewage sludge and the subsequent storage were studied by RT-qPCR and most probable number (MPN) method. The VBNC incidence of Salmonella spp. and Shigella spp. during thermophilic digestion was four orders of magnitude higher than those of mesophilic digestion. Accordingly, higher resuscitation ratio of VBNC pathogens was also achieved in thermophilic digested sludge. As a result, the culturable Salmonella typhimurium contents in thermophilic digested sludge after cake storage were two orders of magnitude higher than mesophilic digestion. Both quantitative PCR and reverse transcription quantitative PCR assay results showed the two bacterial counting numbers remained stable throughout the cake storage. The results indicate that the increase in the culturable Salmonella spp. and Shigella spp. after centrifugal dewatering was attributed to the resuscitation from the VBNC state to the culturable state. Thermophilic anaerobic digestion mainly induced Salmonella spp. and Shigella spp. into VBNC state rather than killed them, suggesting that the biological safety of sewage sludge by temperature-phased anaerobic digestion should be carefully assessed. © 2015 The Society for Applied Microbiology.
A dynamical systems approach to actin-based motility in Listeria monocytogenes
Hotton, S.
2010-11-01
A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.
An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland.
Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom
2015-01-01
Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.
Fermentability of an enzymatically modified solubilised potato polysaccharide (SPP)
DEFF Research Database (Denmark)
Olesen, M.; Gudmund-Høyer, E.; Norsker, Merete
1998-01-01
: Seven healthy volunteers ingested in random order on seven different days: 20 g SPP; bread made of 180 g wheat flour served with 20 g raw SPP; bread baked of 180 g wheat flour and 20 g SPP; bread made from 180 g what flour; 20 g lactulose; 20 g oat bran; and 20 g wheat bran. The hydrogen breath test...... was used to evaluate oro-coecal transit time (OCTT) and fermentation. RESULTS: Fermentation of SPP yielded a measurable increase in end-expiratory H2. The total incremental increase in end expiratory H2 due to SPP was unaffected of whether SPP was served alone, as the raw flour served with bread, or baked...... into bread. The OCTT for raw SPP was significantly delayed compared to lactulose (P = 0.01). The OCTT for SPP baked into bread was significantly delayed compared to raw SPP (P = 0.01), indicating that SPP may be used as a marker of oro-coecal transit time for as well the fluid phase as the solid phase...
Furustrand Tafin, Ulrika; Meis, Jacques F; Trampuz, Andrej
2012-08-01
We evaluated isothermal microcalorimetry for real-time susceptibility testing of non-Aspergillus molds. MIC and minimal effective concentration (MEC) values of Mucorales (n = 4), Fusarium spp. (n = 4), and Scedosporium spp. (n = 4) were determined by microbroth dilution according to the Clinical Laboratory Standard Institute M38-A2 guidelines. Heat production of molds was measured at 37 °C in Sabouraud dextrose broth inoculated with 2.5 × 10(4) spores/mL in the presence of amphotericin B, voriconazole, posaconazole, caspofungin, and anidulafungin. As determined by microcalorimetry, amphotericin B was the most active agent against Mucorales (MHIC 0.06-0.125 μg/mL) and Fusarium spp. (MHIC 1-4 μg/mL), whereas voriconazole was the most active agent against Scedosporium spp. (MHIC 0.25 to 8 μg/mL). The percentage of agreement (within one 2-fold dilution) between the MHIC and MIC (or MEC) was 67%, 92%, 75%, and 83% for amphotericin B, voriconazole, posaconazole, and caspofungin, respectively. Microcalorimetry provides additional information on timing of antifungal activity, enabling further investigation of drug-mold and drug-drug interaction, and optimization of antifungal treatment. Copyright © 2012 Elsevier Inc. All rights reserved.
Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen
2017-05-01
Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3 ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.
Occurrence of Cronobacter spp. in Dried Foods, Fresh Vegetables and Soil.
Ueda, Shigeko
2017-01-01
The present study surveyed the occurrence of Cronobacter spp. in dried foods including milk powder, spices and herbs and others, and fresh vegetables commercially available in markets, and ground soil materials for the agriculture. Cronobacter spp. were isolated from 15% of 33 spice and herb samples and 3% of 36 taste foods, and these were C. turicensis, C. malonaticus, C. sakazakii and C. dubliensis. Cronobacter spp. from fresh vegetables were detected in 12% of field vegetables and 13% of hydroponic vegetables. C. turicensis was prevalent in field vegetables, and C. malonaticus was in hydroponic ones. And, Cronobacter spp. in shredded vegetables were detected from 44% of 9 samples, and these were C. dubliensis, C. turicensis and C. sakazakii. Also, Cronobacter spp. in soil from rice field, vegetable field and sandpits were predominantly C. sakazakii and C. malonaticus.
Centers for Disease Control (CDC) Podcasts
La epidemióloga Ruth Luna-Gierke, de la División de Enfermedades Transmitidas por los Alimentos, el Agua y el Ambiente de los CDC, habla sobre los peligros de la infección por Listeria o listeriosis durante el embarazo, y sobre cómo el queso fresco y otros tipos de quesos blandos consumidos en la comunidad hispana a veces pueden estar contaminados con Listeria.
Combinations of nisin with salt (NaCl) to control Listeria ...
African Journals Online (AJOL)
This study evaluated the effect of combinations of nisin with salt (NaCl) to control Listeria monocytogenes on sheep natural sausage casings. Casings were inoculated with 3.0 x 105 cfu/g final inocula of L. monocytogenes, stored at 6°C in different solutions of nisin at 0, 100, 150 and 200 ìg/g. Each combined with salt at 0, 4, ...
Quadros, M R; Souza Brito, A R; Queiroz, M L
1999-02-01
In this study we have investigated the effects of Petiveria alliacea on the hematopoietic response of mice infected with Listeria monocytogenes. Our results demonstrate a protective effect of the crude extract of P. alliacea since the survival of the treated/infected was higher than that in the infected group. Moreover, the number of granulocyte/macrophage colonies (CFU-GM) and the serum colony stimulating activity levels were increased in the treated/infected mice in relation to the infected group. These results suggest an immunomodulation of Petiveria alliacea extract on hematopoiesis, which may be responsible, at least in part, for the increased resistance of mice to Listeria monocytogenes infection.
Directory of Open Access Journals (Sweden)
RATIH DEWI HASTUTI
2012-12-01
Full Text Available Xanthomonas oryzae pv. oryzae (Xoo, a causal agent of bacterial leaf blight (BLB, is one of the most important pathogens of rice. The effectiveness of ten Streptomyces spp. isolates in suppressing Xoo disease was assessed in planta and in vitro. In planta experiments were carried out in a greenhouse and arranged in a randomized completely block design (RCBD with three replications. Twenty treatments were tested which included plants inoculated with both Streptomyces spp. and Xoo, and plants inoculated with only Streptomyces spp. Plants inoculated with Xoo and sprayed with a chemical bactericide, and plants inoculated with only Xoo served as positive controls, whereas plants not inoculated with either Streptomyces spp. or Xoo were used as negative controls. The results showed that the effect of endophytic Streptomyces spp. on BLB disease expressed as area under disease progress curve (AUDPC was not significantly different to that on control plants (P > 0.05. However, plants inoculated with endophytic Streptomyces spp. were significantly taller and produced higher tiller number than control plants (P < 0.05. Streptomyces spp. isolate AB131-1 gave the highest plant height. In vitro studies on biocontrol mechanisms of selected Streptomyces spp. isolates showed that isolate LBR02 gave the highest inhibition activity on Xoo growth, followed by AB131-1 and AB131-2. Two isolates (AB131-1 and LBR02 were able to produce chitinase, phosphatase, and siderophore which included biocontrol characteristics. Morphological and colonization studies under SEM and light microscopy confirmed that the three isolates were endophytic Streptomyces spp. from different species. These studies found that the paddy plant which was inoculated with endophytic Streptomyces spp. AB131-1 and infected by Xoo could increase the height of plant and number of tillers.
Zwaferink, Heather; Stockinger, Silvia; Reipert, Siegfried; Decker, Thomas
2008-01-01
Murine macrophage death upon infection with Listeria monocytogenes was previously shown to be increased by beta interferon, produced by the infected cells. We saw that interferon-upregulated caspase activation or other interferon-inducible, death-associated proteins, including TRAIL, protein kinase R, and p53, were not necessary for cell death. Macrophage death was reduced when inducible nitric oxide synthase (iNOS) was inhibited during infection, and iNOS-deficient macrophages were less susc...
Chang, Su-Sen; Kang, Dong-Hyun
2004-01-01
The first Alicyclobacillus spp. was isolated in 1982, and was originally thought to be strictly limited to thermophilic and acidic environments. Two years later, another Alicyclobacillus sp., A. acidoterrestris, was identified as the causative agent in spoilage of commercially pasteurized apple juice. Subsequent studies soon found that Alicyclobacillus spp. are soilborne bacteria, and do not strictly require thermophilic and acidic environments. Alicyclobacillus spp. posess several distinct characteristics; the major one is their ability to survive commercial pasteurization processes and produce off-flavors in fruit juices. The fruit juice industry has acknowledged Alicyclobacillus spp. as a major quality control target microorganism. Guaiacol and halophenols were identified as the offensive smelling agent in many Alicyclobacillus spp. related spoilage. Though the exact formation pathway of these off-flavors by Alicyclobacillus spp. are not yet identified, studies report that the presence of Alicyclobacillus spp. in the medium may be a major contributor to the formation of these off-flavors. Many identification methods and isolation media were developed in the last two decades. However, most of these methods were developed specifically for A. acidoterrestris, which was the first identified off-flavor producing Alicyclobacillus. However, recent studies indicate that other species of Alicyclobacillus may also produce guaiacol or the halophenols. In this respect, all Alicyclobacillus spp. should be monitored as potential spoilage bacteria in fruit juices. This article includes an overall review of the history of Alicyclobacillus spp., characteristics, suggested off-flavor production pathways, and commonly used identification methods for the currently identified Alicyclobacillus spp.
Sant'Ana, Anderson S; Barbosa, Matheus S; Destro, Maria Teresa; Landgraf, Mariza; Franco, Bernadette D G M
2012-06-15
Growth potential (δ) is defined as the difference between the population of a microorganism at the end of shelf-life of specific food and its initial population. The determination of δ of Salmonella and Listeria monocytogenes in RTE vegetables can be very useful to determine likely threats to food safety. However, little is known on the behavior of these microorganisms in several RTE vegetables. Therefore, the aim of this study was to determine the δ of both pathogens in nine different types of RTE vegetables (escarole, collard green, spinach, watercress, arugula, grated carrot, green salad, and mix for yakisoba) stored at refrigeration (7°C) and abuse temperature (15°C). The population of aerobic microorganisms and lactic acid bacteria, including those showing antimicrobial activity has been also determined. Results indicated that L. monocytogenes was able to grow (δ≥0.5 log(10)) in more storage conditions and vegetables than Salmonella. Both microorganisms were inhibited in carrots, although a more pronounced effect has been observed against L. monocytogenes. The highest δ values were obtained when the RTE vegetables were stored 15°C/6days in collard greens (δ=3.3) and arugula (δ=3.2) (L. monocytogenes) and arugula (δ=4.1) and escarole (δ=2.8) (Salmonella). In most vegetables and storage conditions studied, the counts of total aerobic microorganisms raised significantly independent of the temperature of storage (pvegetables partially or fully stored at abuse temperature with recovery of isolates showing antimicrobial activity. In conclusion, the results of this study show that Salmonella and L. monocytogenes may grow and reach high populations in RTE vegetables depending on storage conditions and the definition of effective intervention strategies are needed to control their growth in these products. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Dalmiro Cazorla-Perfetti
2017-11-01
Full Text Available The infraorden Tipulomorpha contains insects of the order Diptera, suborder Nematocera commonly called as crane flies. Based on information from the Catalogue of the Crane flies of World, in the presente article a revised and updated checklist of the Tipulomorpha (superfamily Tipuloidea registered from Venezuela is shown. Until now, 226 valid species of crane flies has been recorded, grouped into two families, 5 subfamilies and 40 genera, including family Tipulidae s.s., subfamily Tipulinae (genera Brachypremna: 6 species; Leptotarsus: 8 species; Nephrotoma: 3 species; Ozodicera: 3 species; Tipula: 28 species; Zelandotipula: 6 species and the subfamily Ctenophorinae (genus Pselliophora: 1 species; family Limoniidae, subfamily Chioneinae (genera Atarba: 6 species; Cheilotrichia: 1 species; Cryptolabis: 1 species; Ellipteroides: 2 species; Erioptera: 3 species; Eriopterodes: 1 species; Eugnophomyia: 1 species; Gnophomyia: 4 species; Gonomyia: 9 species; Molophilus: 5 species; Neognophomyia: 1 species; Rhabdomastix: 1 species; Sigmatomera: 1 species; Styringomyia: 1 species; Teucholabis: 15 species; subfamily Limnophilinae (genera Austrolimnophila: 1 species; Epiphragma: 10 species; Hexatoma: 11 species; Lecteria: 1 species; Limnophila: 5 species; Paradelphomyia: 1 species; Polymera: 3 species; Shannonomyia: 5 species;; and subfamily Limoniinae (Dicranomyia: 26 species; Elephantomyia: 1 species; Geranomyia: 25 species; Helius: 5 species; Neolimonia: 2 species; Orimarga: 4 species; Protohelius: 1 species; Rhipidia: 10 species; Toxorhina: 4 species; Trentepohlia: 4 species. In addition, the first records of Brachypremna spp., Gonomyia spp. and Dicranomyia spp. are described for the urban semiarid area from Falcon state, north-western region. Data on the geographical distribution of the species is provided, and bio-ecological, agronomic, medical relevance and research needs on the Venezuelan crane flies, are discussed.
Enhanced biofilm formation in dual-species culture of Listeria monocytogenes and Ralstonia insidiosa
In the environment, many microorganisms coexist in communities as biofilms. The objective of this study was to investigate the interactions between Listeria monocytogenes and Ralstonia insidiosa in dual species biofilms. Biofilm development was measured using crystal violet in 96-well microtiter pla...
SPP: A data base processor data communications protocol
Fishwick, P. A.
1983-01-01
The design and implementation of a data communications protocol for the Intel Data Base Processor (DBP) is defined. The protocol is termed SPP (Service Port Protocol) since it enables data transfer between the host computer and the DBP service port. The protocol implementation is extensible in that it is explicitly layered and the protocol functionality is hierarchically organized. Extensive trace and performance capabilities have been supplied with the protocol software to permit optional efficient monitoring of the data transfer between the host and the Intel data base processor. Machine independence was considered to be an important attribute during the design and implementation of SPP. The protocol source is fully commented and is included in Appendix A of this report.
The genotypic characterization of Cronobacter spp. isolated in China.
Directory of Open Access Journals (Sweden)
Jinghua Cui
Full Text Available Cronobacter spp. (Enterobacter sakazakii is an important pathogen contaminating powdered infant formula (PIF. To describe the genotypic diversity of Cronobacter isolated in China, we identified the isolates using fusA allele sequencing, and subtyped all of the isolates using pulsed-field gel electrophoresis (PFGE, multi-locus sequence typing (MLST, and multiple-locus variable-number tandem-repeat analysis (MLVA. A total of 105 isolates were identified, which included C. sakazakii (58 isolates, C. malonaticus (30 isolates, C. dublinensis (11 isolates, C. turicensis (5 isolates, and C. muytjensii (1 isolate. These isolates were showed to have 85 PFGE-patterns, 71 sequence types (STs, and 55 MLVA-patterns. Comparisons among the three molecular subtyping methods revealed that the PFGE method was the most distinguishable tool in identifying clusters of Cronobacter spp. through DNA fingerprinting, and MLST method came second. However, ESTR-1, ESTR-2, ESTR-3, and ESTR-4 were not effective loci for subtyping Cronobacter spp. such that the MLVA method requires further improvement.
Pathogenicity of isolates of Colletotrichum spp.: The causal agents of anthracnose
Živković, Svetlana; Dolovac, Nenad; Popović, Tatjana; Stojanović, Saša
2012-01-01
The pathogenic characteristics of 20 isolates of Colletotrichum spp. originating from pear, apple, sour cherry and tomato fruits, as well as reference strains of C. acutatum (CBS 294.67) and C. gloeosporioides (CBS 516.97) are presented in this paper. In the studies of host range of isolates of Colletotrichum spp. were included 17 plant species. Nine days after artificial inoculation all tested isolates were caused anthracnose lesion on fruits of apple, pear, peach, apricot, sour cherry, swee...
Lukic, J; Jancic, I; Mirkovic, N; Bufan, B; Djokic, J; Milenkovic, M; Begovic, J; Strahinic, I; Lozo, J
2017-10-13
In the light of the increasing resistance of bacterial pathogens to antibiotics, one of the main global strategies in applied science is development of alternative treatments, which would be safe both for the host and from the environmental perspective. Accordingly, the aim of this study was to test whether two lactic acid bacteria (LAB) strains, Lactococcus lactis BGBU1-4 and Lactobacillus salivarius BGHO1, could be applied as safe supplements for Listeria infection. Two major research objectives were set: to compare the effects of BGBU1-4 and BGHO1 on early immune response in gut tissue of Wistar rats co-administered with Listeria monocytogenes ATCC19111 and next, to test how this applies to their usage as therapeutics in acute ATCC19111 infection. Intestinal villi (IV), Peyer's patches (PP) and mesenteric lymph nodes (MLN) were used for the analysis. The results showed that BGHO1 increased the mRNA expression of innate immune markers CD14, interleukin (IL)-1β and tumour necrosis factor (TNF)-α in PP and IV, and, in parallel, caused a decrease of listeriolysin O (LLO) mRNA expression in same tissues. In MLN of BGHO1 treated rats, LLO expression was increased, along with an increase of the expression of OX-62 mRNA and CD69, pointing to the activation of adaptive immunity. On the other hand, in BGBU1-4 treated rats, there was no reduction of LLO mRNA expression and no induction of innate immunity markers in intestinal tissue. Additionally, CD14 and IL-1β, as well as LLO, but not OX-62 mRNA and CD69 expression, were elevated in MLN of BGBU1-4 treated rats. However, when applied therapeutically, both, BGBU1-4 and BGHO1, lowered Listeria count in spleens of infected rats. Our results not only reveal the potential of LAB to ameliorate Listeria infections, but suggest different immunological effects of two different LAB strains, both of which could be effective in Listeria elimination.
Coffey, A; van den Burg, B; Veltman, R; Abee, T
Listeria monocytogenes, a facultative intracellular pathogen, synthesizes an extracellular protease which is responsible for the maturation of phosphatidylcholine phospholipase C (lecithinase), a virulence factor involved in cell-to-cell spread. This work describes the environmental parameters