WorldWideScience

Sample records for spp including listeria

  1. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes.

    Science.gov (United States)

    Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo

    2014-02-01

    The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  2. Detection of Listeria spp. using ACTERO listeria enrichment media.

    Science.gov (United States)

    Claveau, David; Olishevskyy, Sergiy; Giuffre, Michael; Martinez, Gabriela

    2014-01-01

    ACTERO Listeria Enrichment Media (ACTERO Listeria) is a selective medium developed for a single-step recovery and enrichment of Listeria spp. from environmental samples. Robustness testing of the ACTERO Listeria medium demonstrated good performance when minor changes were introduced to the incubation temperature and time. All 54 Listeria strains tested, representing the most frequently isolated Listeria species from food (L. monocytogenes, L. ivanovii, L. seeligeri, L. welshimeri, and L. grayi), were successfully enriched in ACTERO Listeria. None of the 30 nontarget strains tested in the exclusivity study was recovered after incubation in ACTERO Listeria. Recovery of Listeria was consistent across three independently produced lots of the ACTERO Listeria, and the prepared medium was stable for 45 days when stored at 4 degrees C in the dark. Matrix studies performed with environmental sponge samples from plastic and stainless steel surfaces demonstrated similar recovery of Listeria spp. in a single-step enrichment using ACTERO Listeria from plastic, and significantly better recovery from stainless steel surfaces when compared to the U.S. Department of Agriculture-Food Safety and Inspection Service reference method. The results of this study prove that ACTERO Listeria Enrichment Media can be effectively used in replacement of the two-step enrichment suggested by the reference method without affecting the recovery of Listeria spp. from environmental samples.

  3. Coselection of Cadmium and Benzalkonium Chloride Resistance in Conjugative Transfers from Nonpathogenic Listeria spp. to Other Listeriae

    Science.gov (United States)

    Katharios-Lanwermeyer, S.; Rakic-Martinez, M.; Elhanafi, D.; Ratani, S.; Tiedje, J. M.

    2012-01-01

    Resistance to the quaternary ammonium disinfectant benzalkonium chloride (BC) may be an important contributor to the ability of Listeria spp. to persist in the processing plant environment. Although a plasmid-borne disinfectant resistance cassette (bcrABC) has been identified in Listeria monocytogenes, horizontal transfer of these genes has not been characterized. Nonpathogenic Listeria spp. such as L. innocua and L. welshimeri are more common than L. monocytogenes in food processing environments and may contribute to the dissemination of disinfectant resistance genes in listeriae, including L. monocytogenes. In this study, we investigated conjugative transfer of resistance to BC and to cadmium from nonpathogenic Listeria spp. to other nonpathogenic listeriae, as well as to L. monocytogenes. BC-resistant L. welshimeri and L. innocua harboring bcrABC, along with the cadmium resistance determinant cadA2, were able to transfer resistance to other nonpathogenic listeriae as well as to L. monocytogenes of diverse serotypes, including strains from the 2011 cantaloupe outbreak. Transfer among nonpathogenic Listeria spp. was noticeably higher at 25°C than at 37°C, whereas acquisition of resistance by L. monocytogenes was equally efficient at 25 and 37°C. When the nonpathogenic donors were resistant to both BC and cadmium, acquisition of cadmium resistance was an effective surrogate for transfer of resistance to BC, suggesting coselection between these resistance attributes. The results suggest that nonpathogenic Listeria spp. may behave as reservoirs for disinfectant and heavy metal resistance genes for other listeriae, including the pathogenic species L. monocytogenes. PMID:22904051

  4. Coselection of cadmium and benzalkonium chloride resistance in conjugative transfers from nonpathogenic Listeria spp. to other Listeriae.

    Science.gov (United States)

    Katharios-Lanwermeyer, S; Rakic-Martinez, M; Elhanafi, D; Ratani, S; Tiedje, J M; Kathariou, S

    2012-11-01

    Resistance to the quaternary ammonium disinfectant benzalkonium chloride (BC) may be an important contributor to the ability of Listeria spp. to persist in the processing plant environment. Although a plasmid-borne disinfectant resistance cassette (bcrABC) has been identified in Listeria monocytogenes, horizontal transfer of these genes has not been characterized. Nonpathogenic Listeria spp. such as L. innocua and L. welshimeri are more common than L. monocytogenes in food processing environments and may contribute to the dissemination of disinfectant resistance genes in listeriae, including L. monocytogenes. In this study, we investigated conjugative transfer of resistance to BC and to cadmium from nonpathogenic Listeria spp. to other nonpathogenic listeriae, as well as to L. monocytogenes. BC-resistant L. welshimeri and L. innocua harboring bcrABC, along with the cadmium resistance determinant cadA2, were able to transfer resistance to other nonpathogenic listeriae as well as to L. monocytogenes of diverse serotypes, including strains from the 2011 cantaloupe outbreak. Transfer among nonpathogenic Listeria spp. was noticeably higher at 25°C than at 37°C, whereas acquisition of resistance by L. monocytogenes was equally efficient at 25 and 37°C. When the nonpathogenic donors were resistant to both BC and cadmium, acquisition of cadmium resistance was an effective surrogate for transfer of resistance to BC, suggesting coselection between these resistance attributes. The results suggest that nonpathogenic Listeria spp. may behave as reservoirs for disinfectant and heavy metal resistance genes for other listeriae, including the pathogenic species L. monocytogenes.

  5. Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants.

    Science.gov (United States)

    Alali, Walid Q; Schaffner, Donald W

    2013-07-01

    The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

  6. 21 CFR 866.3355 - Listeria spp. serological reagents.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Listeria spp. serological reagents. 866.3355 Section 866.3355 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... belonging to the genus Listeria, and provides epidemiological information on diseases caused by these...

  7. Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility.

    Science.gov (United States)

    Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F

    2013-04-01

    Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

  8. Listeria monocytogenes and Listeria spp. contamination patterns in retail delicatessen establishments in three U.S. states.

    Science.gov (United States)

    Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F

    2014-11-01

    Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in

  9. Validation of the ANSR Listeria method for detection of Listeria spp. in environmental samples.

    Science.gov (United States)

    Wendorf, Michael; Feldpausch, Emily; Pinkava, Lisa; Luplow, Karen; Hosking, Edan; Norton, Paul; Biswas, Preetha; Mozola, Mark; Rice, Jennifer

    2013-01-01

    ANSR Listeria is a new diagnostic assay for detection of Listeria spp. in sponge or swab samples taken from a variety of environmental surfaces. The method is an isothermal nucleic acid amplification assay based on the nicking enzyme amplification reaction technology. Following single-step sample enrichment for 16-24 h, the assay is completed in 40 min, requiring only simple instrumentation. In inclusivity testing, 48 of 51 Listeria strains tested positive, with only the three strains of L. grayi producing negative results. Further investigation showed that L. grayi is reactive in the ANSR assay, but its ability to grow under the selective enrichment conditions used in the method is variable. In exclusivity testing, 32 species of non-Listeria, Gram-positive bacteria all produced negative ANSR assay results. Performance of the ANSR method was compared to that of the U.S. Department of Agriculture-Food Safety and Inspection Service reference culture procedure for detection of Listeria spp. in sponge or swab samples taken from inoculated stainless steel, plastic, ceramic tile, sealed concrete, and rubber surfaces. Data were analyzed using Chi-square and probability of detection models. Only one surface, stainless steel, showed a significant difference in performance between the methods, with the ANSR method producing more positive results. Results of internal trials were supported by findings from independent laboratory testing. The ANSR Listeria method can be used as an accurate, rapid, and simple alternative to standard culture methods for detection of Listeria spp. in environmental samples.

  10. Validation of the ANSR® Listeria Method for Detection of Listeria spp. in Selected Foods.

    Science.gov (United States)

    Caballero, Oscar; Alles, Susan; Wendorf, Michael; Gray, R Lucas; Walton, Kayla; Pinkava, Lisa; Mozola, Mark; Rice, Jennifer

    2015-01-01

    ANSR® Listeria was previously certified as Performance Tested Method(SM) 101202 for detection of Listeria spp. on selected environmental surfaces. This study proposes a matrix extension to the method for detection of Listeria spp. in selected food matrixes. The method is an isothermal nucleic acid amplification assay based on the nicking enzyme amplification reaction technology. Following single-step sample enrichment for 16-24 h, the assay is completed in less than 50 min, requiring only simple instrumentation. Inclusivity testing was performed using a panel of 51 strains of Listeria spp., representing the species L. grayi, L. innocua, L. ivanovii, L. monocytogenes, L. seeligeri, and L. welshimeri. All strains tested were detected by the ANSR assay. Exclusivity testing of 30 strains representing non-Listeria Gram-positive bacteria yielded no evidence of cross-reactivity. Performance of the ANSR method for detection of Listeria spp. was compared to that of reference culture procedures for pasteurized liquid egg, pasteurized 2% milk, Mexican-style cheese, ice cream, smoked salmon, lettuce, cantaloupe, and guacamole. Data obtained in these unpaired studies and analyzed using a probability of detection model demonstrated that there were no statistically significant differences in results between the ANSR and reference culture methods, except for milk at 16 h and cantaloupe. In milk and smoked salmon, ANSR sensitivity was low at 16 h and therefore the recommended incubation time is 24 h. In cantaloupe, ANSR was found to be more sensitive than the reference culture method at both 16 and 24 h in independent laboratory testing. The ANSR Listeria method can be used as an accurate, rapid, and simple alternative to standard culture methods for detection of Listeria spp. in selected food types.

  11. Listeria spp. in Street-Vended Ready-to-Eat Foods

    OpenAIRE

    El-Shenawy, Moustafa; El-Shenawy, Mohamed; Ma?es, Jordi; Soriano, Jose M.

    2011-01-01

    Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contamina...

  12. Detection of Listeria Spp. and Listeria monocytogenes in vegetables ...

    African Journals Online (AJOL)

    This paper aimed to study the prevalence and antibiotic resistance pattern among Listeria monocytogenes in raw vegetables sourced from commercial farms and local farms in Terengganu. Thirteen types of vegetables investigated for the presence of L. monocytogenes using multiplex PCR and LAMP methods. Isolation of ...

  13. Prevalence of Listeria spp. and Molecular Characterization of Listeria monocytogenes Isolates from Broilers at the Abattoir.

    Science.gov (United States)

    Bouayad, Leila; Hamdi, Taha M; Naim, Malek; Leclercq, Alexandre; Lecuit, Marc

    2015-07-01

    Products from three broiler abattoirs were sampled for Listeria species to evaluate the changes in the prevalence and contamination rates at two stages of processing. Sampling was performed at the evisceration stage and at the end of processing after packaging and refrigerating at 4°C for 24 h. A total of 212 samples were collected; 52 were from abattoir A, and 80 samples each were collected from abattoirs B and C. Among all samples, 99 (46.7%) tested positive for Listeria, including L. monocytogenes 19 (8.9%), L. innocua 69 (32.5%), L. grayi 10 (4.7%), and L. welshimeri 1 (0.5%). The L. monocytogenes contamination rate varied from 5% to 11.5% in the 3 abattoirs. L. innocua was the most common species identified and was found in 8.8% of the samples from abattoir A and 33.7% of the samples from both abattoirs B and C. Twenty-six of the L. monocytogenes isolates obtained from positive samples were subjected to serotyping by multiplex polymerase chain reaction and characterization by the pulsed-field gel electrophoresis (PFGE) method using two cutting enzymes, ApaI and AscI. Three molecular serogroups were identified: IIa, IIb, and IVb. Serogroup IIa was common to all abattoirs, and serogroups IIb and IVb were found only in abattoir C. The 10 different obtained PFGE profiles were grouped into 7 clusters; some of these clusters were common to the 3 abattoirs, and others were specific to the abattoirs in which they were identified. This study revealed a high prevalence of Listeria spp., particularly L. monocytogenes, in raw broilers. This high incidence presents a risk to consumers due to the potential occurrence of cross-contamination with other foods in domestic refrigerators and the ability of these microorganisms to survive in undercooked products.

  14. A defined, glucose-limited mineral medium for the cultivation of Listeria spp.

    Science.gov (United States)

    Schneebeli, Rudolf; Egli, Thomas

    2013-04-01

    Members of the genus Listeria are fastidious bacteria with respect to their nutritional requirements, and several minimal media described in the literature fail to support growth of all Listeria spp. Furthermore, strict limitation by a single nutrient, e.g., the carbon source, has not been demonstrated for any of the published minimal media. This is an important prerequisite for defined studies of growth and physiology, including "omics." Based on a theoretical analysis of previously published mineral media for Listeria, an improved, well-balanced growth medium was designed. It supports the growth, not only of all tested Listeria monocytogenes strains, but of all other Listeria species, with the exception of L. ivanovii. The growth performance of L. monocytogenes strain Scott A was tested in the newly designed medium; glucose served as the only carbon and energy source for growth, whereas neither the supplied amino acids nor the buffering and complexing components (MOPS [morpholinepropanesulfonic acid] and EDTA) supported growth. Omission of amino acids, trace elements, or vitamins, alone or in combination, resulted in considerably reduced biomass yields. Furthermore, we monitored the specific growth rates of various Listeria strains cultivated in the designed mineral medium and compared them to growth in complex medium (brain heart infusion broth [BHI]). The novel mineral medium was optimized for the commonly used strain L. monocytogenes Scott A to achieve optimum cell yields and maximum specific growth rates. This mineral medium is the first published synthetic medium for Listeria that has been shown to be strictly carbon (glucose) limited.

  15. Listeria spp. and Listeria monocytogenes contamination in ready-to-eat sandwiches collected from vending machines

    Directory of Open Access Journals (Sweden)

    Francesca Cossu

    2016-05-01

    Full Text Available Ready-to-eat (RTE food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5% made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients.

  16. Urban prevalence of Listeria spp. and Listeria monocytogenes in public lavatories and on shoe soles of facility patrons in the European capital city Vienna.

    Science.gov (United States)

    Schoder, D; Schmalwieser, A; Szakmary-Brändle, K; Stessl, B; Wagner, M

    2015-05-01

    The aim of this study was to determine the prevalence of Listeria spp. and Listeria monocytogenes (L. monocytogenes) in urban public lavatories and on shoe soles of facility patrons in a European capital city. More than 91% of all municipal public lavatories in Vienna close to public hubs were included in this study. Overall, 373 swab samples of public lavatories and shoes of facility patrons were enriched, according to ISO 11290-1. Listeria monocytogenes isolates were subtyped using pulsed-field gel electrophoresis. A total of 24 samples were positive for Listeria spp., yielding an overall prevalence of 6.4% (24/373). Listeria monocytogenes was found in 2.1% (8/373) of all samples. Swabs from lavatories in parks, container lavatories and lavatories at markets had the highest prevalences of 20.7% (6/29), 20% (2/10) and 12.5% (1/8) Listeria spp., respectively. These detection rates were statistically significantly higher than those associated with lavatories in shopping centres (P = 0.003, P = 0.002, P = 0.02) and at public transport locations (P = 0.0004, P = 0.005, P = 0.02). Shoes sampled at Christmas markets showed the highest Listeria spp. and L. monocytogenes prevalences of 80% (4/5) and 40% (2/5), respectively. With regard to shoe type, Listeria spp. detection rates were 14.3% (3/21; winter boots), 13.3% (2/15; hiking boots), sport shoes (5.9%; 2/34) and brogues (5.1%; 4/79). No Listeria spp. were found on shoe soles that had smooth treads (0/76), while Listeria spp. were detected on 19.5% (8/41) of medium depth tread shoe types and on 9.4% (3/32) of deep tread shoes. These data suggest that soil environment is still one of the most important reservoirs for the foodborne pathogen L. monocytogenes. © 2014 Blackwell Verlag GmbH.

  17. Comparative and functional genomics of Listeria spp.

    Science.gov (United States)

    Hain, Torsten; Steinweg, Christiane; Chakraborty, Trinad

    2006-10-20

    The genus Listeria comprises a group of non-sporulating, Gram-positive, soil bacteria belonging to the low G+C group of microorganisms. The genus consists of only six species, L. monocytogenes, L. ivanovii, L. seeligeri, L. innocua, L. welshimeri, and L. grayi.L. monocytogenes and L. ivanovii are the only known pathogens of this group. Comparative whole-genome sequencing of representative strains comprising the entire genus is currently being performed and nearing completion. In the genus Listeria, genome reduction has led to the generation of non-pathogenic species from pathogenic progenitor strains. Indeed, many of the regions absent in the non-pathogenic species represent commonly deleted genes. Speciation and diversity of strains has been achieved by horizontal gene transfer of DNA encoding novel genes probably required for niche specific survival. The sequencing of several listerial genomes has also been accompanied by studies using global strategies involving whole-genome transcriptional profiling and proteomics to examine the adaptative changes of L. monocytogenes to growth in different environments and to catalogue the genes mediating these responses. We review this data and present information on the expression profile of L. monocytogenes EGD-e inside the vacuolar and the cytosolic environments of the host cell using whole-genome microarray analysis. Of the 484 genes regulated during intracellular growth 41 genes are species-specific, being absent from the genome of the non-pathogenic L. innocua CLIP 11262 strain. There were 25 genes that are strain-specific i.e. absent from the genome of the L. monocytogenes F2365 serotype 4b strain suggesting heterogeneity in the gene pool required for intracellular survival of L. monocytogenes in host cells.

  18. Evaluation of the pathogenicity of Listeria spp. in Caenorhabditis elegans.

    Science.gov (United States)

    Forrester, Stacyann; Milillo, Sara Rose; Hoose, Wendy A; Wiedmann, Martin; Schwab, Ute

    2007-01-01

    Caenorhabditis has proven to be a useful model for studying host-pathogen interactions as well as the ability of nematodes to serve as vectors for the dispersal of foodborne pathogens. In this study, we evaluated whether C. elegans can serve as a host for Listeria spp. While there was an effect of growth media on C. elegans killing, C. elegans exposed to L. monocytogenes and L. innocua pregrown in Luria-Bertani medium showed reduced survival when compared to nonpathogenic E. coli OP50, while L. seeligeri showed survival similar to E. coli OP50. In a preference assay, C. elegans preferred E. coli over L. monocytogenes and L. innocua, but showed no preference between L. monocytogenes and L. innocua. A gentamicin assay indicated that L. monocytogenes did not persist within the C. elegans intestinal tract. Our findings that L. monocytogenes and L. innocua strains tested have equally deleterious effects on C. elegans and that L. monocytogenes did not establish intestinal infection conflict with other recently published results, which found intestinal infection and killing of C. elegans by L. monocytogenes. Further studies are thus needed to clarify the interactions between L. monocytogenes and C. elegans, including effects of environmental conditions and strain differences on killing and intestinal infection.

  19. Isolation, identification, and characterization of Listeria spp. from various animal origin foods

    Science.gov (United States)

    Nayak, Deepti N.; Savalia, C. V.; Kalyani, I. H.; Kumar, Rajeev; Kshirsagar, D. P.

    2015-01-01

    Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each) collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence-associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9%) were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%), Listeria innocua (5, 27.7%), Listeria welshimeri (4, 22.2%), and L. monocytogenes (3, 16.6%). The highest prevalence was observed in milk samples (8). Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk). All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200) of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest prevalence

  20. Isolation, identification, and characterization of Listeria spp. from various animal origin foods

    Directory of Open Access Journals (Sweden)

    Deepti N. Nayak

    2015-06-01

    Full Text Available Aim: The present study was undertaken with the prime objective of isolating and identifying Listeria spp. from various foods of animal origin sold at retail market outlets in the city of Navsari, Gujarat. Materials and Methods: Total 200 samples comprising of milk, milk products, meat, and fish (50 each collected aseptically from local market which were subjected first to pre-enrichment in half strength Fraser broth followed by enrichment in full strength Fraser broth and subsequent plating on PALCAM agar. The growth with the typical colony characteristics were further identified up to species level on the basis of their morphological and biochemical characteristics. Cultures identified as Listeria monocytogenes were further subjected to in vitro pathogenicity tests and detection of different virulence associated genes viz. actA, hlyA, and iap using polymerase chain reaction. Results: Of the total 200 food samples of animal origin; 18 (9% were found positive for Listeria spp. which were identified as Listeria seeligeri (6, 33.3%, Listeria innocua (5, 27.7%, Listeria welshimeri (4, 22.2%, and L. monocytogenes (3, 16.6%. The highest prevalence was observed in milk samples (8. Species wise, 6 isolates of L. seeligeri which included two each from cow milk, buffalo milk, and meat samples; 5 L. innocua isolates included four recovered from fish and one from meat sample; 4 L. welshimeri comprised of two isolates from ice cream and one each from buffalo milk and meat sample; and 3 isolates of L. monocytogenes recovered from milk (1 cow and 2 buffalo milk. All 3 L. monocytogenes isolates screened for the presence of virulence genes viz. actA, hlyA, and iap using the specific primers revealed the presence of all the genes suggesting the possibility of danger of foodborne listeriosis among raw milk consumers. Conclusion: Listeria spp. was isolated from 9% (18/200 of the animal origin food samples viz.; milk, milk products, meat, and fish with the highest

  1. Identification ofListeriaSpp. Strains Isolated from Meat Products and Meat Production Plants by Multiplex Polymerase Chain Reaction.

    Science.gov (United States)

    Mazza, Roberta; Piras, Francesca; Ladu, Daniela; Putzolu, Miriam; Consolati, Simonetta Gianna; Mazzette, Rina

    2015-11-02

    Listeriosis is a foodborne disease caused by Listeria monocytogenes and is considered as a serious health problem, due to the severity of symptoms and the high mortality rate. Recently, other Listeria species have been associated with disease in human and animals. The aim of this study was to develop a multiplex polymerase chain reaction (PCR) in order to simultaneously detect six Listeria species (L. grayi , L. welshimeri , L. ivanovii , L. monocytogenes , L. seeligeri , L. innocua) in a single reaction. One hundred eighteen Listeria spp . strains, isolated from meat products (sausages) and processing plants (surfaces in contact and not in contact with meat), were included in the study. All the strains were submitted to biochemical identification using the API Listeria system. A multiplex PCR was developed with the aim to identify the six species of Listeria . PCR allowed to uniquely identify strains that had expressed a doubtful profile with API Listeria The results suggest that the multiplex PCR could represent a rapid and sensitive screening test, a reliable method for the detection of all Listeria species, both in contaminated food and in clinical samples, and also a tool that could be used for epidemiological purposes in food-borne outbreaks. A further application could be the development of a PCR that can be directly applied to the pre-enrichment broth.

  2. The prevalence of Listeria spp. food contamination in Iran: A systematic review and meta-analysis.

    Science.gov (United States)

    Hamidiyan, Negar; Salehi-Abargouei, Amin; Rezaei, Zeynab; Dehghani-Tafti, Roohollah; Akrami-Mohajeri, Fateme

    2018-05-01

    Listeria monocytogenes can cause circling disease, encephalitis, meningitis, septicemia, and mastitis in dairy cattle. Contamination from the environment can contaminate foods with Listeria spp. Consumption of foods containing L. monocytogenes can lead to listeriosis in susceptible people (adults with a compromised immune system), pregnant women, and infants. The objective of this study was to determine the prevalence of Listeria spp. and L. monocytogenes in various foods in Iran. We searched PubMed, Science direct, Scopus, Google scholar, and Iranian local databases including Iranian scientific information database and Magiran for relevant studies up to May 2015 using related keywords. In our preliminary search, we retrieved 1344 articles. After removing duplicates and reviewing titles/abstracts, 117 articles were considered, out of which, 75 articles had sufficient quality for inclusion in this meta-analysis. The prevalence of Listeria spp. contamination was about 18.3% in poultry, 8.5% in raw meat, 14.6% in ready-to-eat (RTE) foods, 10% in sea foods, 7.3% in traditional dairy, 3.2% in commercial dairy, and 0.1% in eggs. The findings showed that L. monocytogenes was most prevalent in ready to eat (9.2%), seafood (5.1%), poultry (5%), traditional dairy (4%), raw meat (2.6%), commercial dairy (1.4%), and egg (0.2%), respectively. Furthermore, the presence of L. monocytogenes particularly in RTE foods (that are consumed without further heat processing) and under-cooked products could be a potential risk for public health. So, contamination should be controlled at all levels of the food chain. Copyright © 2018. Published by Elsevier Ltd.

  3. Prevalence of food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran.

    Science.gov (United States)

    Akya, A; Najafi, A; Moradi, J; Mohebi, Z; Adabagher, S

    2013-05-01

    Listeria monocytogenes is a human pathogen causing serious diseases. We aimed to determine food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran. Samples (185 dairy, 187 meat products and 158 ready-to-eat foods such as salads) were randomly collected from markets. After processing, samples were cultured in half-Fraser and Fraser broth followed by cultivation on PALCAM and Oxford media. Confirmatory tests including carbohydrate utilization were performed on isolates to determine species. Bacteria were isolated from 66/530 samples (12.5%). Meat products showed the highest (27.2%) and dairy products the lowest (3.8%) contamination rates. L. innocua was found in 56 (10.6%) samples, but L. monocytogenes was only found in 3 samples (0.6%). The results indicate that the rate of contamination with L. monocytogenes, even for ready-to-eat foods, was low but for other Listeria spp., in particular strains of L. innocua, the rate of contamination was higher, suggesting that more control on food sanitation is required.

  4. Ocorrência de Listeria spp. e de Listeria monocytogenes, em um matadouro-frigorífico de bovinos do estado de São Paulo

    OpenAIRE

    Caselani, Kelly [UNESP; Prata, Luiz Francisco [UNESP; Bizari, Paula Adriana [UNESP; Pereira, Gener Tadeu [UNESP; de Marchi, Patrícia Gelli Feres [UNESP; Picinato, Mirelle Andréa de Carvalho [UNESP

    2013-01-01

    We evaluated the presence of Listeria spp. and Listeria monocytogenes in environmental samples by means of swabs collected the bovine slaughter plant enabled to export, located in the state of Sao Paulo, Brazil. After the pre-enrichment at 30±1°C for 22 to 26h the samples were analyzed using the BAX System Listeria. Those positive for Listeria spp. were submitted a second PCR reaction to confirm the presence of Listeria monocytogenes. From 411 environmental samples analyzed, 62 (15.1%) were p...

  5. Establishment of a simple and rapid identification method for Listeria spp. by using high-resolution melting analysis, and its application in food industry.

    Science.gov (United States)

    Ohshima, Chihiro; Takahashi, Hajime; Phraephaisarn, Chirapiphat; Vesaratchavest, Mongkol; Keeratipibul, Suwimon; Kuda, Takashi; Kimura, Bon

    2014-01-01

    Listeria monocytogenes is the causative bacteria of listeriosis, which has a higher mortality rate than that of other causes of food poisoning. Listeria spp., of which L. monocytogenes is a member, have been isolated from food and manufacturing environments. Several methods have been published for identifying Listeria spp.; however, many of the methods cannot identify newly categorized Listeria spp. Additionally, they are often not suitable for the food industry, owing to their complexity, cost, or time consumption. Recently, high-resolution melting analysis (HRMA), which exploits DNA-sequence differences, has received attention as a simple and quick genomic typing method. In the present study, a new method for the simple, rapid, and low-cost identification of Listeria spp. has been presented using the genes rarA and ldh as targets for HRMA. DNA sequences of 9 Listeria species were first compared, and polymorphisms were identified for each species for primer design. Species specificity of each HRM curve pattern was estimated using type strains of all the species. Among the 9 species, 7 were identified by HRMA using rarA gene, including 3 new species. The remaining 2 species were identified by HRMA of ldh gene. The newly developed HRMA method was then used to assess Listeria isolates from the food industry, and the method efficiency was compared to that of identification by 16S rDNA sequence analysis. The 2 methods were in coherence for 92.6% of the samples, demonstrating the high accuracy of HRMA. The time required for identifying Listeria spp. was substantially low, and the process was considerably simplified, providing a useful and precise method for processing multiple samples per day. Our newly developed method for identifying Listeria spp. is highly valuable; its use is not limited to the food industry, and it can be used for the isolates from the natural environment.

  6. Comparison of lithium chloride-phenylethanol-moxalactam and modified Vogel Johnson agars for detection of Listeria spp. in retail-level meats, poultry, and seafood.

    Science.gov (United States)

    Buchanan, R L; Stahl, H G; Bencivengo, M M; Del Corral, F

    1989-03-01

    The effectiveness of Modified Vogel Johnson agar and lithium chloride-phenylethanol-moxalactam agar for detection of Listeria spp. in foods was compared by using the media to analyze retail-level meat, poultry, and seafood both by direct plating and in conjunction with a three-tube most-probable-number enrichment. The most-probable-number protocol detected Listeria species, including Listeria monocytogenes, in a substantial portion of the fresh meat and seafood samples. In most instances the Listeria levels were less than 2 CFU/g, which precluded detection by direct plating. Modified Vogel Johnson agar performed as well as did lithium chloride-phenylethanol-moxalactam agar and was considerably easier to use because of its ability to differentiate Listeria spp. from other microorganisms.

  7. Incidence of Listeria spp. and Listeria monocytogenes in a poultry processing environment and in poultry products and their rapid confirmation by multiplex PCR.

    OpenAIRE

    Lawrence, L M; Gilmour, A

    1994-01-01

    The incidence of Listeria spp. and Listeria monocytogenes in a poultry processing plant and in raw and cooked poultry products was determined over a 6-month period. Within the raw and cooked poultry processing environments, 46% (36 of 79) and 29% (51 of 173) of the samples contained Listeria spp. while 26% (21 of 79) and 15% (27 of 173) contained L. monocytogenes, respectively. Various sites within the processing environment were found to be consistently positive for L. monocytogenes througho...

  8. Occurrence of Listeria spp. in farmed salmon and during subsequent slaughter: Comparison of listertest TM lift and the USDA method

    DEFF Research Database (Denmark)

    Embarek, Peter Karim Ben; Hansen, Lisbeth Truelstrup; Enger, O.

    1997-01-01

    Salmon and environmental samples from a fish farm and a salmon slaughterhouse were analysed for Listeria spp. using the USDA method and the rapid quantitative Listertest(TM). Listeria spp. were not detected in any of 119 samples analysed. However, Corynebacterium spp. gave disturbing false...

  9. Characterization of antibiotic resistance in Listeria spp. isolated from slaughterhouse environments, pork and human infections.

    Science.gov (United States)

    Moreno, Luisa Z; Paixão, Renata; Gobbi, Débora D S; Raimundo, Daniele C; Ferreira, Thais P; Moreno, Andrea M; Hofer, Ernesto; Reis, Cristhiane M F; Matté, Glavur R; Matté, Maria H

    2014-04-15

    Listeria species are susceptible to most antibiotics. However, over the last decade, increasing reports of multidrug-resistant Listeria spp. from various sources have prompted public health concerns. The objective of this study was to characterize the antibiotic susceptibility of Listeria spp. and the genetic mechanisms that confer resistance. Forty-six Listeria spp. isolates were studied, and their minimal inhibitory concentrations of antibiotics were determined by microdilution using Sensititre standard susceptibility MIC plates. The isolates were screened for the presence of gyrA, parC, lde, lsa(A), lnu(A), and mprF by PCR, and the amplified genes were sequenced. All isolates were susceptible to penicillin, ampicillin, tetracycline, erythromycin, and carbapenems. Resistance to clindamycin, daptomycin, and oxacillin was found among L. monocytogenes and L. innocua, and all species possessed at least intermediate resistance to fluoroquinolones. GyrA, parC, and mprF were detected in all isolates; however, mutations were found only in gyrA sequences. A high daptomycin MIC, as reported previously, was observed, suggesting an intrinsic resistance of Listeria spp. to daptomycin. These results are consistent with reports of emerging resistance in Listeria spp. and emphasize the need for further genotypic characterization of antibiotic resistance in this genus.

  10. Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

    Directory of Open Access Journals (Sweden)

    ALESSANDRA PARO RODRIGUES CESAR

    2011-06-01

    Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

  11. Listeria spp. in Street-Vended Ready-to-Eat Foods

    Directory of Open Access Journals (Sweden)

    Moustafa El-Shenawy

    2011-01-01

    Full Text Available Street-vended ready-to-eat food sold in Egypt, including sandwiches and dishes of traditional food, was examined for the presence of Listeria species. Out of 576 samples, 24% were found to contain Listeria species. L. monocytogenes and L. innocua were isolated from 57% and 39% of the contaminated samples, respectively. Other Listeria spp. were detected with lower frequency. L. monocytogenes of ≥103 CFU/g were detected in 7% of the total examined samples, which represent 49% of the contaminated food samples (meat, poultry, seafood, dairy products, and products of plant origin. Most of the samples contaminated by L. monocytogenes had high levels of total viable bacterial counts. The results obtained may help to clarify the epidemiology of listeriosis in the country and draw the attention of the decision makers to issue hygienic regulations for food processing industries as well as street vendors in order to ensure safe street-vended ready-to-eat food.

  12. Detection of Listeria spp. in food handling areas of retail food stores in the state of Pernambuco, Brazil

    Directory of Open Access Journals (Sweden)

    Mariana Gomes Ferreira Machado de Siqueira

    2017-07-01

    Full Text Available Abstract The identification of Listeria spp. in food handling areas is of great concern to health surveillance agencies, and their control is often hampered by the ability of the bacteria to grow and maintain themselves even under adverse conditions. The present study aimed to isolate and identify Listeria spp. in the food handling areas of 10 retail food stores in the state of Pernambuco, Brazil. Eighty-six swab samples were collected from equipment, utensils and surfaces used for processing ready-to-eat meat products. The Dry and Wet Swabbing Methods (3M™ Quick Swabs and 3M™ Petrifilm™ Plates were used to identify Listeria spp. Contamination by Listeria monocytogenes was confirmed by the Real-time Polymerase Chain Reaction (qPCR. The hygienic and sanitary conditions of the food handling areas of each store were also assessed. Listeria spp. was isolated in eight stores (80%. Of the 86 swab samples analyzed, 27 (31.2% [confidence interval 21.81% to 42.30%] were positive for Listeria spp. and only one (3.7% was confirmed as Listeria monocytogenes. The main contamination sites were the floor (50.0%, the plastic cutting board (42.9% and the knife (40.0%. None of the hygienic and sanitary conditions assessed in the present study were associated with contamination by Listeria spp. (p = 0.700. It was concluded that Listeria spp. was widely distributed in the retail food stores studied, being a possible risk factor for public health.

  13. Ecology of Listeria spp. in a fish farm and molecular typing of Listeria monocytogenes from fish farming and processing companies.

    Science.gov (United States)

    Miettinen, Hanna; Wirtanen, Gun

    2006-11-01

    This study focused on the ecology of Listeria monocytogenes in a fish farm by following the changes in its occurrence in different types of samples for a three year period. In addition, L. monocytogenes isolates from different seafood industry areas were compared with pulsed field gel electrophoresis (PFGE) typing to discover possible associations between primary production, further processing and final products. Weather conditions were found to have a strong influence on the probability of finding Listeria spp. in a fish farm environment. The number of samples contaminated with Listeria spp. was typically bigger after rainy periods. Brook and river waters as well as other runoff waters seemed to be the main contamination source at the farm studied. The farmed fish originally found to carry L. monocytogenes become gradually Listeria free. The time needed for the purification of the fish was several months. The sea bottom soil samples were the ones that preserved the L. monocytogenes contamination the longest time. It can be stated that the fish and fish farm equipment studied did not spread listeria contamination. On the contrary, they were found to suffer from listeria contamination coming from outside sources like the brook water. There was a wide range of different L. monocytogenes PFGE-pulsotypes (30) found at 15 Finnish fish farms and fish processing factories. L. monocytogenes isolates from the final products often belonged to the same pulsotypes as did the isolates from the processing environment as well as from the raw fish. This suggests that, in addition to the fish processing factory environment, the fish raw materials are important sources of L. monocytogenes contamination in final products.

  14. Frequency, virulence genes and antimicrobial resistance of Listeria spp. isolated from bovine clinical mastitis.

    Science.gov (United States)

    Jamali, Hossein; Radmehr, Behrad

    2013-11-01

    The aims of this study were to determine the prevalence, characteristics and antimicrobial resistance of Listeria spp. isolated from bovine clinical mastitis in Iran. Listeria spp. were detected in 21/207 bovine mastitic milk samples from dairy farms in Iran, comprising L. monocytogenes (n=17), L. innocua (n=3) and L. ivanovii (n=1). L. monocytogenes isolates were grouped into serogroups '4b, 4d, 4e', '1/2a, 3a', '1/2b, 3b, 7' and '1/2c, 3c'; all harboured inlA, inlC and inlJ virulence genes. Listeria spp. were most frequently resistant to penicillin G (14/21 isolates, 66.7%) and tetracyclines (11/21 isolates, 52.4%). Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Prevalence, identification by a DNA microarray-based assay of human and food isolates Listeria spp. from Tunisia.

    Science.gov (United States)

    Hmaïed, F; Helel, S; Le Berre, V; François, J-M; Leclercq, A; Lecuit, M; Smaoui, H; Kechrid, A; Boudabous, A; Barkallah, I

    2014-02-01

    We aimed at evaluating the prevalence of Listeria species isolated from food samples and characterizing food and human cases isolates. Between 2005 and 2007, one hundred food samples collected in the markets of Tunis were analysed in our study. Five strains of Listeria monocytogenes responsible for human listeriosis isolated in hospital of Tunis were included. Multiplex PCR serogrouping and pulsed field gel electrophoresis (PFGE) applying the enzyme AscI and ApaI were used for the characterization of isolates of L. monocytogenes. We have developed a rapid microarray-based assay to a reliable discrimination of species within the Listeria genus. The prevalence of Listeria spp. in food samples was estimated at 14% by using classical biochemical identification. Two samples were assigned to L. monocytogenes and 12 to L. innocua. DNA microarray allowed unambiguous identification of Listeria species. Our results obtained by microarray-based assay were in accordance with the biochemical identification. The two food L. monocytogenes isolates were assigned to the PCR serogroup IIa (serovar 1/2a). Whereas human L. monocytogenes isolates were of PCR serogroup IVb, (serovars 4b). These isolates present a high similarity in PFGE. Food L. monocytogenes isolates were classified into two different pulsotypes. These pulsotypes were different from that of the five strains responsible for the human cases. We confirmed the presence of Listeria spp. in variety of food samples in Tunis. Increased food and clinical surveillance must be taken into consideration in Tunisia to identify putative infections sources. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. Prevalence and Antibiotic Resistance of Listeria Spp. Isolated from Ready-to-Eat Foods in Ankara

    OpenAIRE

    ŞİRELİ, Ufuk Tansel; GÜCÜKOĞLU, Ali

    2014-01-01

    In this study the presence of Listeria spp. is tested in 100 ready-to-eat food samples purchased from different stores and traditional food shops in the province of Ankara. The tested materials were 20 each of the following: mayonnaise based salad, kadınbudu köfte (fried meatball), fried liver, rice stuffed mussel, and green salad. Microbiological analyzes showed that 13 of 100 salad samples (13%) were contaminated with Listeria spp. while 10 of 100 salad samples (10%) were contaminated with ...

  17. Rapid detection of listeria spp. using an internalin A aptasensor based on carbon-metal nanohybrid structures

    Science.gov (United States)

    Vanegas, D. C.; Rong, Yue; Schwalb, N.; Hills, K. D.; Gomes, C.; McLamore, E. S.

    2015-05-01

    Foodborne outbreaks caused by Listeria monocytogenes continue to raise major public health concerns worldwide. In the United States alone, the centers for disease control and prevention have confirmed the occurrence of 183 cases of listeriosis with 39 fatalities within the last 3 years. Standard methods for the detection of pathogenic strains require up to 7 days to yield results, thus faster techniques with the same level of reliability for bacteria detection are desirable. This study reports on the development of a rapid, accurate, and sensitive electrochemical biosensor for rapid testing of Listeria spp. based on the selective binding of InlA aptamers to internalins in the cell membrane of the target bacteria. Hybrid nanomaterial platforms based on reduced graphene oxide and nanoplatinum were deposited onto Pt/Ir electrodes for enhancing electrochemical transduction during the recognition events. InlA aptamers were immobilized onto the nanomaterial platforms via metal-thiol adsorption. Aptamer loading onto different platform nanostructures was investigated through cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The detection mechanism was evaluated by recording the electrochemical response to several bacterial dilutions in PBS buffer using the non-pathogenic species Listeria innocua. These preliminary results show that the aptasensor can be tuned for detection of Listeria concentrations as low as 100 CFU/ml in less than 3 hours (including incubation time and data analysis). The developed aptasensor opens a promising direction for rapid testing of Listeria monocytogenes in food products.

  18. Contamination by Salmonella spp., Campylobacter spp. and Listeria spp. of most popular chicken- and pork-sausages sold in Reunion Island.

    Science.gov (United States)

    Trimoulinard, A; Beral, M; Henry, I; Atiana, L; Porphyre, V; Tessier, C; Leclercq, A; Cardinale, E

    2017-06-05

    One of the most popular meat products of the local "cuisine" is sausage composed with 100% chicken or 100% pork. In this study, we aimed to determine the presence of Salmonella spp., Campylobacter spp. and Listeria spp. in chicken- and pork-sausages, quantify Salmonella spp. population and identify the factors that could be associated with contamination in the outlets. Two hundred and three batches of pork and chicken sausages were randomly collected from 67 local outlets (supermarkets, groceries and butcher shops). Salmonella spp. was detected in 11.8% (95% confidence interval (CI): [10.0; 13.5]) of samples, Campylobacter spp. in 1.5% [0.7; 4.2] and Listeria monocytogenes in 5.9% [4.4; 7.3]. Most probable number of Salmonella spp. varied between 6cfu per gram to 320cfu per gram. Salmonella serotypes isolated from pork and chicken sausages were S. Typhimurium (45.8%), S. London (20.8%), S. Derby (16.7%), S. Newport (8.33%), S. Blockley (4.2%) and S. Weltevreden (4.17%). Using a logistic (mixed-effect) regression model, we found that Salmonella spp. contamination was positively associated with sausages sold in papers or plastic bags and no control of rodents. Chicken sausages were associated with a decreasing risk of Salmonella contamination. Listeria monocytogenes contamination was positively associated with the presence of fresh rodent droppings in the outlet and negatively when the staff was cleaning regularly their hands with soap and water or water only. All the sampled outlets of Reunion Island were not equivalent in terms of food safety measures. Increasing awareness of these traders remains a cornerstone to limit the presence of Salmonella spp. and Listeria spp. in sausages, particularly in a tropical context (high temperature and humidity). Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates.

    Science.gov (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn

    2016-02-01

    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  20. Listeria spp. occurrence in equipments and processing plants of meat/ Listeria spp. ocorrência em equipamentos e ambientes de processamento de carne bovina

    Directory of Open Access Journals (Sweden)

    Luís Augusto Nero

    2004-05-01

    Full Text Available Exopolysaccharides, biopolymers or hydrosolubles gums, are produced by a great variety of microorganisms and possess physical, structural and chemical properties quite homogeneous, in relation to derived from algae and plants. The production is relatively independent on climatic conditions, faster obtaining of the finished product and need small space. Biopolymers have been studied thoroughly in the last years. Due to wide diversity in structure and physical properties, the microbial polysaccharides possess a lot of applications in food, pharmaceutical, oil, cosmetics, textile, inks and agricultural products among others industries. Some of those applications, include uses as emulsifying, stabilizing, binding, jellifying, clotting, lubricants, film coated, thickening and suspender agents. The parameters that have most influenced the process of exopolysaccharides biosyntheses have been the microorganism, the culture medium composition, pH and temperature of incubation. The exopolysaccharide production can be developed by species of Gram-negative and Gram-positive bacteria, some microalgae and many moulds. This work discusses the influence of these parameters during the production process and exopolysaccharides biosyntheses by bacteria.O objetivo desta pesquisa foi estabelecer a ocorrência de Listeria monocytogenes em diversos pontos de plantas de processamento de carne bovina em 01 abatedouro e 05 casas de carnes localizados na região norte do Paraná. Para a detecção de Listeria spp. em 124 amostras de equipamentos/utensílios e instalações, utilizou-se a metodologia preconizada pelo United States Departament of Agriculture (USDA, com identificação das espécies por testes bioquímicos e posterior confirmação pelo API Listeria (bioMérieux. Os resultados obtidos indicaram freqüências de 6,25% de L. monocytogenes; 68,75% de L. innocua; 18,75% de L. welshimeri; 4,17% de L. seeligeri e 2,08% de L. grayi. As amostras positivas para L

  1. Detection of Antibiotic Resistant Listeria spp. in Beef Burgers Distributed in Ahvaz City, Iran

    Directory of Open Access Journals (Sweden)

    Maktabi

    2016-03-01

    Full Text Available Background Listeria spp. are able to be survive in many foods during frozen storage. One particular species, Listeria monocytogenes, is one of the most important food-borne pathogens globally. The antimicrobial resistance of pathogenic microorganisms is a worldwide public health concern because of increasing global trade and travel. Objectives The aim of this study was to evaluate the occurrence and antibiotic resistance of Listeria spp. in the Iranian beef burgers distributed in Ahvaz city. Materials and Methods During a five-month period, 150 frozen burgers were purchased from local markets in Ahvaz city, and tested for presence of Listeria spp. The experimental procedure consisted of a one-step enrichment in Listeria enrichment broth, followed by plating on Oxford agar. Suspected colonies were subjected to subsequent biochemical tests and a polymerase chain reaction (PCR assay. The susceptibility of the isolates to various antibiotics was investigated using the Kirby-Bauer disk diffusion method, and the results were analyzed via the chi-square test and Fisher’s exact test using SPSS 16.0 software. Results Out of 150 samples, only two were contaminated with Listeria innocua, and the statistical analysis showed no significant differences in the prevalence of Listeria between companies (P > 0.05. One of the isolates was resistant to tetracycline and the other to co-trimoxazole. Both of the isolates showed an intermediate susceptibility to chloramphenicol; however, they were sensitive to the other tested antibiotics. Conclusions L. innocua is not a pathogen, but the presence of the bacterium could be an indicator of probable contamination with L. monocytogenes. Moreover, there is a potential risk to public health from the consumption of raw or undercooked burgers, which may increase the possibility of the acquisition of resistance to antibiotics.

  2. IDENTIFIKASI Listeria spp. PADA PANGAN JAJANAN BERBASIS IKAN DI KOTA BOGOR

    Directory of Open Access Journals (Sweden)

    Elia Yuswita

    2016-06-01

    Full Text Available L. monocytogenes contamination in processed food, especially fish-based snack, may results from contaminated raw materials, underprocessed or recontamination. The aims of this study were to identify the presence of Listeria spp. especially L. monocytogenes by PCR method and biochemical methods, as well as calculate the prevalence of Listeria spp. in fish-based snack food in Bogor. This study was conducted of 4 steps: (1 determination of L. monocytogenes’s DNA limit detection, (2 sample preparation, (3 identification of L. monocytogenes with real-time PCR, and (4 identification of Listeria spp. with biochemical methods. The results showed that DNA detection limits of L. monocytogenes in fish meatball and otak-otak were at 8.3x102 and 2.9x102 CFU/g, respectively. The study on 65 samples indicated that contamination of L. monocytogenes was not observed, but other species of Listeria spp., namely L. grayi and L. innocua, were found. The prevalence of L. grayi and L. innocua in siomay was at 5.9%, while the prevalence of L. grayi in shrimp meatballs, fish meat balls, fried meatballs was at 8.3, 9.1, and 50%, respectively. Furthermore, L. innocua from takoyaki samples with a prevalence of 20% was observed.

  3. Detección de Listeria spp. y Listeria monocytogenes en muestras de leche cruda y quesos artesanales respectivamente, mediante PCR en Tiempo Real

    Directory of Open Access Journals (Sweden)

    Viviana Pamela Chiluisa-Utreras

    2017-07-01

    Full Text Available Background. In Ecuador, studies about bacteria genre Listeria in artisanal cheeses are scarce, and in raw milk, practically nonexistent. Milk production is one of the main livestock activities in the province of Pichincha and it is essential to study these products. Since all the cantons that make up Pichincha are milk producers, three of them, Cayambe, Quito and Pedro Moncayo were randomly sampled. Objective. To determine Listeria spp. And Listeria monocytogenes in samples of raw milk and artisanal cheeses, respectively, using Real Time PCR. Methods. The application of the qPCR technique in the detection of microorganisms and especially of bacteria in food, is based on four fundamental aspects: its sensitivity, specificity, speed and processing capacity of large sample flow. It is possible to detect small amounts of pathogenic microorganisms, such as Listeria spp in raw milk, after extraction and quantification of total DNA. Results. In this study in raw milk, one positive was determined from a total of 60 samples, representing 1.6% of Listeria spp. and 16 positive samples of 45, representing 35.6% of Listeria monocytogenes in artisanal cheeses from three farms in the province of Pichincha. Conclusions. The results, according to the statistical analyzes carried out with the Kruskal - Wallis test, show that in Pichincha the bacterium is present in raw milk, but in non - representative quantities, whereas for Listeria monocytogenes there is statistical significance in the cheeses samples

  4. Colonization of barley (Hordeum vulgare) with Salmonella enterica and Listeria spp.

    Science.gov (United States)

    Kutter, Stefan; Hartmann, Anton; Schmid, Michael

    2006-05-01

    Colonization of barley plants by the food-borne pathogens Salmonella enterica serovar typhimurium and three Listeria spp. (L. monocytogenes, L. ivanovii, L. innocua) was investigated in a monoxenic system. Herbaspirillum sp. N3 was used as a positive control and Escherichia coli HB101 as a negative control for endophytic root colonization. Colonization of the plants was tested 1-4 weeks after inoculation by determination of CFU, specific PCR assays and fluorescence in situ hybridization (FISH) with fluorescently labelled oligonucleotide probes in combination with confocal laser scanning microscopy (CLSM). Both S. enterica strains were found as endophytic colonizers of barley roots and reached up to 2.3 x 10(6) CFU per g root fresh weight after surface sterilization. The three Listeria strains had 10-fold fewer cell numbers after surface sterilization on the roots and therefore were similar to the results of nonendophytic colonizers, such as E. coli HB101. The FISH/CSLM approach demonstrated not only high-density colonization of the root hairs and the root surface by S. enterica but also a spreading to subjacent rhizodermis layers and the inner root cortex. By contrast, the inoculated Listeria spp. colonized the root hair zone but did not colonize other parts of the root surface. Endophytic colonization of Listeria spp. was not observed. Finally, a systemic spreading of S. enterica to the plant shoot (stems and leaves) was demonstrated using a specific PCR analysis and plate count technique.

  5. The characterization of Listeria spp. isolated from food products and the food-processing environment.

    Science.gov (United States)

    O'Connor, L; O'Leary, M; Leonard, N; Godinho, M; O'Reilly, C; Coffey, L; Egan, J; O'Mahony, R

    2010-11-01

    To enhance the information pertaining to the epidemiology of a collection of 378 Listeria spp. isolates obtained from several food-processing plants in Ireland over a 3-year period (2004-2007). The collection was characterized by pulsed-field gel electrophoresis (PFGE). The most prevalent pulse-type was PFGE profile I (n=14·5%) that consisted mainly of environmental Listeria spp. samples. Serotyping of 145 Listeria monocytogenes isolates was performed. The most common serovar was 1/2a and comprised 57·4% (n=77) of the L. monocytogenes collection. The other serovars were as follows: 4b (14·1%, n=19), 1/2b (9·7%, n=13), 4c (4·4%, n=6) and 1/2c (6·7%, n=9), respectively. Eleven isolates were identified as non-Listeria spp., the remaining ten L. monocytogenes isolates were nontypeable. The antimicrobial susceptibility testing revealed the antibiotic that isolates displayed the most resistance to was gentamicin (5%) followed by sulfamethoxazole-trimethoprim (2%), tetracycline and ciprofloxacin (1·5%). The subtyping has indicated the diversity of the Listeria spp. The presence of serotype 1/2a, 1/2b and 4b in both raw and cooked ready-to-eat food products is a public health concern, as these serotypes are frequently associated with foodborne outbreaks and sporadic cases of human listeriosis. In addition, the emergence of antimicrobial-resistant L. monocytogenes isolates could have serious therapeutic consequences. The molecular subtyping and the further characterization of these isolates may be valuable particularly in the context of a suspected common source outbreak in the future. © 2010 The Authors. © 2010 The Society for Applied Microbiology.

  6. Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

    Directory of Open Access Journals (Sweden)

    Yolanda Albarracín C

    2008-08-01

    Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

  7. Occurrence and genetic relatedness of Listeria spp. in two brands of locally processed ready-to-eat meats in Trinidad.

    Science.gov (United States)

    Syne, S M; Ramsubhag, A; Adesiyun, A A

    2011-05-01

    Contamination of locally produced, ready-to-eat meats by Listeria spp. has been previously reported at one processing plant in Trinidad. However, the status of this pathogen in locally produced products sold at retail outlets is unknown. This study was conducted to establish whether there is a risk to consumers of locally processed meats caused by the presence of Listeria spp., and whether a link exists between the presence of the pathogen in retail products and the manufacturing plant of one brand (B). Four hundred and eighty ready-to-eat meat products of two popular local brands (A and B) were collected from retail outlets and analysed for the presence of Listeria spp. together with food samples and surfaces from one manufacturing plant (B). Eighty-eight of the retail products (18·3%) were contaminated with Listeria spp., of which, 52·3% were L. innocua, 44·3% were L. monocytogenes and 3·4% belonged to the L. seeligeri-L. welshimeri-L. ivanovii (Siwi) group. L. innocua was found in 15 in-process food samples and on three surfaces of equipment at plant B. Four in-process food samples were also contaminated with Siwi isolates. Repetitive extragenic palindromic PCR DNA fingerprinting showed a possible association between strains of different Listeria spp. and brand as well as with manufacturing plant B.

  8. 3M™ Molecular detection system versus MALDI-TOF mass spectrometry and molecular techniques for the identification of Escherichia coli 0157:H7, Salmonella spp. &Listeria spp.

    Science.gov (United States)

    Loff, Marché; Mare, Louise; de Kwaadsteniet, Michele; Khan, Wesaal

    2014-06-01

    The aim of this study was to compare standard selective plating, conventional PCR (16S rRNA and species specific primers), MALDI-TOF MS and the 3M™ Molecular Detection System for the routine detection of the pathogens Listeria, Salmonella and Escherichia coli 0157:H7 in wastewater and river water samples. MALDI-TOF MS was able to positively identify 20/21 (95%) of the E. coli isolates obtained at genus and species level, while 16S rRNA sequencing only correctly identified 6/21 (28%) as E. coli strains. None of the presumptive positive Listeria spp. and Salmonella spp. isolates obtained by culturing on selective media were positively identified by MALDI-TOF and 16S rRNA analysis. The species-specific E. coli 0157:H7 PCR described in this present study, was not able to detect any E. coli 0157:H7 strains in the wastewater and river water samples analysed. However, E. coli strains, Listeria spp., L. monocytogenes and Salmonella spp. were detected using species specific PCR. Escherichia coli 0157:H7, Listeria spp. and Salmonella spp. were also sporadically detected throughout the sampling period in the wastewater and river water samples analysed by the 3M™ Molecular Detection System. MALDI-TOF MS, which is a simple, accurate and cost-effective detection method, efficiently identified the culturable organisms, while in the current study both species specific PCR (Listeria spp. and Salmonella spp.) and 3M™ Molecular Detection System could be utilised for the direct routine analysis of pathogens in water sources. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Development and validation of qualitative SYBR®Green real-time PCR for detection and discrimination of Listeria spp. and Listeria monocytogenes.

    Science.gov (United States)

    Barbau-Piednoir, Elodie; Botteldoorn, Nadine; Yde, Marc; Mahillon, Jacques; Roosens, Nancy H

    2013-05-01

    A combination of four qualitative SYBR®Green qPCR screening assays targeting two levels of discrimination: Listeria genus (except Listeria grayi) and Listeria monocytogenes, is presented. These assays have been developed to be run simultaneously using the same polymerase chain reaction (PCR) programme. The paper also proposes a new validation procedure to specifically validate qPCR assays applied to food microbiology according to two guidelines: the ISO 22118 norm and the "Definition of minimum performance requirements for analytical methods of GMO testing". The developed assays target the iap, prs and hlyA genes that belong to or neighbour the virulence cluster of Listeria spp. The selected primers were designed to amplify short fragments (60 to 103 bp) in order to obtain optimal PCR efficiency (between 97 and 107 % efficiency). The limit of detection of the SYBR®Green qPCR assays is two to five copies of target genes per qPCR reaction. These assays are highly accurate (98.08 and 100 % accuracy for the Listeria spp. and L. monocytogenes assays, respectively).

  10. [Detection of Salmonella, Listeria spp., Vibrio spp., and Yersinia enterocolitica in frozen seafood and comparison with enumeration for faecal indicators: implication for public health].

    Science.gov (United States)

    Ripabelli, G; Sammarco, M L; Fanelli, I; Grasso, G M

    2004-01-01

    Infections transmitted through consumption of contaminated seafood is a significant source of human morbidity. The aim of this study was to compare the detection of Salmonella, Listeria, Vibrio, and Yersinia enterocolitica in frozen seafood with results from enumeration of conventional faecal indicators. A total of 213 crustaceans or molluscs were purchased from local vendors in Italy: 74% were harvested in Italy, 25% from other European countries and 1% from outside Europe. Listeria spp. was isolated from 20% of samples, Vibrio spp. from 11%, Salmonella from 3% and Y. enterocolitica from 1%. Listeria species isolated were L. monocytogenes, L. innocua, L. welshimeri, L. ivanovii and L. seeligeri. Vibrio species isolated were V. alginolyticus and V. fluvialis. The most contaminated shellfish for both faecal indicator microrganism and pathogens were hen clams (6% contained Salmonella, 27% Listeria spp. and 3% Y. enterocolitica), while from 27% of shrimps Vibrio spp. was recovered. Higher levels of faecal indicators were recovered from samples harvested outside Europe, and 66% of samples harvested in Thailand were contaminated from Salmonella. Significant differences were found in the levels of contamination of seafoods depending upon the freezing regime, but there was a limited association between presence of potential pathogens (particularly Vibrio spp.) and conventional faecal indicators. Hence, we suggest reconsideration of current legal parameters to evaluate microbiological quality of seafood.

  11. Epidemiology of Salmonella spp., Listeria monocytogenes and Campylobacter spp., in the poultry chain production system

    Directory of Open Access Journals (Sweden)

    Realpe-Delgado, María Elena

    2016-10-01

    Full Text Available Salmonella spp., Campylobacter spp., and L. monocytogenes are zoonotic foodborne pathogens, associated with the consumption of contaminated foods of animal origin. In this study we determined the prevalence and risk factors associated with the presence of these microorganisms at all stages of the production system, in two Colombian poultry companies (EI-EI-I and II. In EI-I, Campylobacter spp., and Salmonella spp., were isolated from 10 % and 4.4 % of the specimens, and S. Heidelberg was the predominant serotype. Salmonella spp., was found in 6 % of hands and stool samples of workers. S. Saphra was the most prevalent serotype. In EI-II, the prevalence of Campylobacter spp., and Salmonella spp., from animal specimens was 7 % and 17 %, respectively. L. monocytogenes was not detected. This study established the prevalence of these zoonotic pathogens through the production chain and showed the presence of pathogen carriers among workers/food handlers. “Lack of medical examination of employees in the previous year” was found to be a possible risk factor for carriage of Salmonella spp.

  12. Occurrence of salmonella and Listeria spp. on retail poultry products in south Italy and comparison of conventional and rapid methods for their detection.

    Science.gov (United States)

    Isidori, M; Pascarella, L; Parrella, A

    2007-06-01

    Salmonella and Listeria spp. are frequently detected in poultry meats. Conventional isolation and identification methods to detect these microrganisms in food are laborious and time-consuming. In the present study the occurrence of Salmonellae and Listeriae on 362 samples of retail poultry in Caserta, South Italy was evaluated and standard microbiological and rapid methods were compared. Furthermore, the samples were collected and analyzed twice a week, on Monday and Friday to establish their possible variability from storage. Both methods showed a strong contamination of samples by Listeria spp. (about 50% for both methods) with 12% Listeria monocytogenes while the contamination of Salmonella was poorer (14-15%). The two procedures showed a good agreement for the detection of Listeriae while the sensitivity of the Rapid test for Salmonellae was poorer (75%). Data about sampling on Monday and Friday highlighted a significant increase in Listeria spp. at the end of the week.

  13. Investigation for possible source(s) of contamination of ready-to-eat meat products with Listeria spp. and other pathogens in a meat processing plant in Trinidad.

    Science.gov (United States)

    Gibbons, I-Sanna; Adesiyun, Abiodun; Seepersadsingh, Nadira; Rahaman, Saed

    2006-06-01

    In 2003, there was a recall of three processed (chicken franks, spice ham and turkey ham ready-to-eat (RTE) meat products by a large processing plant in Trinidad as a result of contamination by Listeria monocytogenes. The study was conducted to investigate the possible source(s) of Listeria contamination of recalled RTE meat products and to determine the prevalence of Listeria spp., Salmonella spp., Escherichia coli and Campylobacter spp. in the products and air within the plant. Raw and processed meat products, as well as food contact surfaces were also tested for Salmonella spp., Listeria spp. and Campylobacter spp. initially after thorough clean-up and close-down of the plant. Faecal and effluent samples from the piggery, in close proximity to the plant, were tested for the presence of Salmonella spp., Listeria spp. and Campylobacter spp. Air samples and food contact surfaces were negative for the tested organisms. Ten (58.8%) of the 17 effluent samples and 4 (11.8%) of the 34 faecal samples were positive for Campylobacter coli. Of the 11 raw meat products tested, 10 (90.9%) were positive for E. coli and Listeria spp. either singly or in combination. Of the 32 processed RTE products tested, 11 (34.4%) were positive for E. coli, Salmonella spp., Listeria spp. and Campylobacter spp. in combination or singly. Eleven (61.1%) of 18 processed products contained unacceptable levels of aerobic bacteria using international standards. Four months later, following the implementation of recommended cleaning, sanitizing and hygienic practices at the plant, pre- and post-processed products were sampled and Listeria spp. were identified in 4 (80.0%) of the 5 raw products and in 1 of the 5 (20.0%) finished products. Two (40.0%) of the finished products contained unacceptable microbial levels. It was concluded that the close proximity of the piggery to the processing plant was not the probable source of Listeria contamination of the recalled meat products. The data suggested

  14. DNA fingerprinting by ERIC-PCR for comparing Listeria spp. strains isolated from different sources in San Luis: Argentina Caracterización molecular por ERIC-PCR de cepas de Listeria spp. aisladas de diversos orígenes en San Luis: Argentina

    Directory of Open Access Journals (Sweden)

    A. Laciar

    2006-04-01

    Full Text Available In this study, a total of 24 Listeria spp. strains were analyzed. Twenty-two isolates were obtained in San Luis (Argentina from human, animal, and food samples. Two types of strains, Listeria monocytogenes CLIP 22762 and Listeria innocua CLIP 74915, were included as reference strains. All isolates were biochemically identified and characterized by serotyping, phage typing, and amplification of the flaA gene by polymerase chain reaction (PCR. Repetitive intergenic consensus (ERIC sequence-based PCR was used to generate DNA fingerprints. On the basis of ERIC-PCR fingerprints, Listeria spp. strains were divided into three major clusters matching origin of isolation. ERIC-PCR fingerprints of human and animal isolates were different from those of food isolates. In addition, groups I and II included ten L. monocytogenes strains, and only one Listeria seeligeri strain. Group III included nine L. innocua strains and four L. monocytogenes strains. Computer evaluation of ERIC-PCR fingerprints allowed discrimination between the tested serotypes 1/2b, 4b, 6a, and 6b within each major cluster. The index of discrimination calculated was 0.94. This study suggests that the ERIC-PCR technique provides an alternative method for the identification of Listeria species and the discrimination of strains within one species.En este estudio se analizaron 24 cepas de Listeria spp. De ellas, 22 fueron obtenidas en San Luis (Argentina, a partir de muestras humanas, de animales y alimentos. Se incluyeron 2 cepas de referencia Listeria monocytogenes CLIP 22762 y Listeria innocua CLIP 74915. Todos los aislamientos fueron identificados bioquímicamente y caracterizados por serotipificación, fagotipificación y detección del gen flaA por reacción en cadena de la polimerasa (PCR. Se generaron perfiles de bandas de ADN mediante la amplificación de secuencias repetitivas de consenso intergénico de enterobacterias (ERIC-PCR. De acuerdo a los resultados obtenidos por ERIC

  15. IS THE DISTRIBUTION OF LISTERIA SPP. ISOLATED FROM ALL-NATURAL, MIXED SPECIES, PASTURED-RAISED BROILER FARMS RELATED TO DIFFERENTIAL GROWTH?

    Science.gov (United States)

    Background: Listeria spp. represent an important foodborne pathogen, but relatively little is known about its environmental prevalence on poultry farms. Considering the environmental exposure inherent with pasture-raised production systems, these types of alternative poultry management systems repr...

  16. Listeria spp. no processamento de lingüiça frescal em frigoríficos de Pelotas, RS, Brasil Listeria spp. in the processing of fresh sausages in slaughterhou ses from Pelotas, RS, Brazil

    Directory of Open Access Journals (Sweden)

    Wladimir Padilha da Silva

    2004-06-01

    Full Text Available Alimentos intensamente manipulados, como as lingüiças mistas do tipo frescal são freqüentemente responsáveis pela veiculação de enfermidades transmitidas por alimentos. Devido ao risco à saúde pública que a bactéria Listeria monocytogenes representa, este trabalho teve como objetivo estudar a presença de Listeria spp., em especial de L. monocytogenes, durante o processamento de lingüiças mistas do tipo frescal, em três frigoríficos com inspeção sanitária estadual, em Pelotas-RS. Para isso, analisou-se a matéria-prima utilizada no preparo da lingüiça, os equipamentos da linha de processamento e o produto final. Isolou-se Listeria spp. em 100% das 41 amostras analisadas, nos 3 estabelecimentos estudados. Dentre as diferentes espécies, L. innocua foi aquela isolada com maior freqüência, em 97,6% das amostras, seguida por L. monocytogenes em 29,3% e L. welshimeri em 24,4%. A presença destes microrganismos nas amostras analisadas, em especial no produto final, demonstra a necessidade de readequação nas práticas de limpeza e sanificação das plantas de processamento analisadas, bem como representa risco potencial de listeriose ao consumidor.Food that is highly manipulated, such as fresh sausages, is frequently responsible for spreading food borne diseases. Due to the threat that the bacterium Listeria monocytogenes represents to public health, the aim of this work was to study the presence of Listeria spp., especially Listeria monocytogenes, during processing of fresh sausages, in three slaughterhouses with state food inspection, in the city of Pelotas, Brazil. The raw material used for the sausage elaboration, the equipment used in the processing and the end products were analyzed. The results showed Listeria spp. in 100% of the 41 samples analyzed. Among the different species, L. innocua was the most frequent, isolated from 97.6% of the samples, followed by the L. monocytogenes and L. welshimeri that were isolated from

  17. [Comparison of the antibiotics sensibility pattern of Listeria monocytogenes and Salmonella spp. strains isolated from food with clinical origin samples].

    Science.gov (United States)

    Zamora, Juan Manuel; Chaves, Carolina; Arias, María Laura

    2006-06-01

    The actual use of antibiotics includes, not just its therapeutic cases, but also for disease prevention and as a growth promoter in animals. These practices have resulted in the propagation of resistance to antibiotics, representing a threat for Public Health. In this work, the antibiotic sensibility pattern of 20 Listeria monocytogenes and 40 Salmonella spp. strains, isolated from foodstuff was studied and compared with the antibiotic sensibility patterns of 20 L. monocytogenes and 100 Salmonella strains of clinical origin. 95% of the L. monocytogenes strains isolated from food were sensible to ampicillin, compared with the 65% of the clinical origin strains. Same way, 100% of food strains were sensible to gentamicin, compared with 85% of clinical origin strains. 95% of both showed sensibility to trimethoprim sulfametoxazole and 100% to ciprofloxacin. For Salmonella spp., the sensibility patterns for trimethoprim sulfametoxazole, gentamicin, ciprofloxacin, nalidixic acid and amoxicilin/clavulanic acid from both origins were similar. Nevertheless, food origin strains showed a 97.5% and 82.5% sensibility for tetracycline and cephalosporin respectively, compared with a 83 and 90% sensibility shown by clinical origin strains. The results obtained demonstrate the potential risk that bacterial strains isolated from food represent in the transmission of antibiotics' resistance.

  18. THE PREVALENCE OF Salmonella sp., Listeria sp. AND Aeromonas spp. IN CATFISH (CLARIAS (Clarias gariepinus AND TILAPIA (Tilapia mossambica BY PELLETING METHOD

    Directory of Open Access Journals (Sweden)

    Titik Budiati

    2013-06-01

    Full Text Available The aim of this study was to modify the isolation methods of Aeromonas sp., Salmonella spp., and Listeria sp. in catfish (Clarias gariepinus and tilapia (Tilapia mossambica obtained from wet markets and ponds in Malaysia by pelleting the sample. A total of 108 samples (32 catfish intestines, 32 tilapia intestines, and 44 water samples were obtained from nine wet markets and eight ponds. The modified method was employed by pelleting the samples and followed by either implementing pre-enrichment or without pre-enrichment on the isolation of Salmonella and Listeria spp. The modified method (by pelleting the sample in combination with pre-enrichment was the most efficient for Salmonella and Listeria isolation. The sensitivity of the modified Salmonella isolation method was 0.53 and 0.73 for fish and water samples, respectively. The sensitivity of the modified Listeria method was 1 and 0.92 for fish and water samples, respectively. However, the sensitivity of the method by pelleting the sample was similar to those of non-pelleting the sample on Aeromonas isolation. Five species of Aeromonas spp., seven serovars of Salmonella sp., and four species of Listeria sp. were observed in catfish, tilapia and water samples. Overall, by pelleting the sample offered the beneficial to isolate Aeromonas spp., Salmonella sp. and Listeria spp. in catfish, tilapia and water.

  19. Prevalence and relative risk of Cronobacter spp., Salmonella spp., and Listeria monocytogenes associated with the body surfaces and guts of individual filth flies.

    Science.gov (United States)

    Pava-Ripoll, Monica; Pearson, Rachel E Goeriz; Miller, Amy K; Ziobro, George C

    2012-11-01

    Although flies are important vectors of food-borne pathogens, there is little information to accurately assess the food-related health risk of the presence of individual flies, especially in urban areas. This study quantifies the prevalence and the relative risk of food-borne pathogens associated with the body surfaces and guts of individual wild flies. One hundred flies were collected from the dumpsters of 10 randomly selected urban restaurants. Flies were identified using taxonomic keys before being individually dissected. Cronobacter spp., Salmonella spp., and Listeria monocytogenes were detected using the PCR-based BAX system Q7. Positive samples were confirmed by culture on specific media and through PCR amplification and sequencing or ribotyping. Among collected flies were the housefly, Musca domestica (47%), the blowflies, Lucilia cuprina (33%) and Lucilia sericata (14%), and others (6%). Cronobacter species were detected in 14% of flies, including C. sakazakii, C. turicensis, and C. universalis, leading to the proposal of flies as a natural reservoir of this food-borne pathogen. Six percent of flies carried Salmonella enterica, including the serovars Poona, Hadar, Schwarzengrund, Senftenberg, and Brackenridge. L. monocytogenes was detected in 3% of flies. Overall, the prevalence of food-borne pathogens was three times greater in the guts than on the body surfaces of the flies. The relative risk of flies carrying any of the three pathogens was associated with the type of pathogen, the body part of the fly, and the ambient temperature. These data enhance the ability to predict the microbiological risk associated with the presence of individual flies in food and food facilities.

  20. Detection of Listeria spp. in liquid egg products and in the egg breaking plants environment and tracking of Listeria monocytogenes by PFGE.

    Science.gov (United States)

    Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne

    2013-08-16

    Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well

  1. Specific biological properties of Listeria innocua spp. isolated in Primorye Territory

    Directory of Open Access Journals (Sweden)

    E. A. Zaitseva

    2017-01-01

    Full Text Available Rationale: Most cases of listeriosis are caused by the pathogenic Listeria monocytogenes. Some cases of isolation of L.  innocua with pathogenicity factors from foods have been published, as well as on the cases of the disease in humans caused by this species. Aim: To assess biological properties including potential pathogenicity of L.  innocua, isolated from food and environmental objects. Materials and methods: We performed microbiological study of L. innocua cultures isolated from foods (n=35 and environmental objects (n=15 on the territory of Primorye Territory (Russian Federation, as well as assessment of their sensitivity to antibiotics. Results: The studied L.  innocua cultures showed stable phenotypic features of their biological properties, such as morphology, typical colony growth on the medium with characteristic odor of fermented milk, blue or blue-green luminescence induced by inclined light, presence of catalase activity and absence of the oxidase activity. Only 38±6.9% of L.  innocua demonstrated movements at T 22 °С. L.  innocua cultures did not ferment mannitol (100% of cultures; they degraded ramnose to its acid without gas (70±6.5% and degraded xylose (42.8±7%. Listeria isolated from vegetables and environmental objects could ferment ramnose (92.8±7.2% of the studied cultures and xylose (28.5±12.5% more frequently than L. innocua isolated from meat and fish foods. L.  innocua demonstrated variable biochemical activities towards mannose (92±3.8%, saccharose (85.7±7.8% and melesitose (76.2±9.5%. L. innocua cultures with hemolytic activity (34±6.7% (α or β  type were isolated, more commonly from fish products. All Listeria irrespective of their isolation source showed lipase activity. L.  innocua cultures from foods and environmental objects were highly sensitive to antimicrobials from the following classes: penicillins (ampicillin, carbenicillin, combined amoxicillin and clavulanic acid, aminoglycosides

  2. Brotes por Salmonella spp., Staphylococcus aureus y Listeria monocytogenes asociados al consumo de pollo

    Directory of Open Access Journals (Sweden)

    Marcela Mercado

    2012-04-01

    Full Text Available Introducción. Las enfermedades transmitidas por alimentos son un serio problema de salud pública y,el pollo, uno de los alimentos asociados con ellas. Objetivo. Determinar la distribución y frecuencia de brotes alimentarios asociados al consumo de pollocontaminado por Salmonella spp., Listeria monocytogenes y Staphylococus aureus, mediante unarevisión sistemática de la literatura científica. Materiales y métodos. Se buscaron los estudios de brotes asociados a Salmonella spp., S. aureus y L.monocytogenes, en las bases de datos Medline, Pubmed, Science Direct, SciELO, Librería Cochrane(CCRT, Biblioteca Virtual en Salud (BVS, Highwire, HINARI y MedicLatina. Se obtuvieron los datospara el cálculo de odds ratios (OR mediante la elaboración de tablas de contingencia en el programaRevMan5™. Resultados. Siete artículos cumplieron con los criterios de inclusión y no se encontraron reportesde L. monocytogenes. El OR global fue de 3,01 (IC95% 2,37-3,81, lo que se interpreta como unaasociación significativa entre el consumo de pollo contaminado y la infección alimentaria. Se presentó heterogeneidad en los estudios incluidos (p=0,03, por lo que fue necesario un análisis por subgruposde microorganismos; para el caso de Salmonella spp., el OR fue de 2,67 (IC95% 2,09-3,41. No se hizoanálisis para S. aureus por reportarse un solo artículo. Conclusiones. Se encontró un OR de 2,61, lo que indica que hay una fuerte asociación entre el consumode pollo y la adquisición de salmonelosis. El principal factor de riesgo para adquirir salmonelosis es elconsumo de pollo de asadero en los restaurantes.   doi: http://dx.doi.org/10.7705/biomedica.v32i3.697

  3. How a routine checking of Escherichia coli in retailed food of animal origin can protect consumers against exposition to Campylobacter spp. and Listeria monocytogenes?

    Directory of Open Access Journals (Sweden)

    Trajković-Pavlović Ljiljana

    2010-01-01

    Full Text Available Background/Aim. According to the literature that has been published over the last two decades Campylobacter spp i Listeria monocitogens can be identified as causes of numerous diseases derived by consuming food of animal origin. The purpose of this paper was to find out how established national microbiological criteria of the Republic of Serbia on food safety in retailed food of animal origin could contribute to consumer's protection against exposition to foodborne pathogens such as Campylobacter spp. and Listeria monocytogenes. Methods. During a routine microbiological safety control of randomly selected 60 samples of fresh poultry meat, 30 samples of other fresh meat readymade for grilling, 30 samples of sausage products, 37 samples of heattreated meat, 39 samples of toppings for fast food of animal origin and 31 samples of dairy products a national food safety criteria (Escherichia coli, aerobic plate count, Salmonella spp., coagulasa positive Staphylococcus, Proteus spp., sulphitoreducting Clostridia were applied and, as well as, testing to Campylobacter spp. and Listeria monocitogens. In determination of Campylobacter spp. and Listeria monocytogenes, food quality control methods of the Food and Agriculture Organization (FAO were applied, while in determination of the other above motioned bacteria, national provisions on microbiological methods were applied who are adjusted to the FAO ones. Results. Related to the national criteria on microbiological food safety, 88 (38.8% samples, out of the total 227 tested, were rejected. When to these results, the results of laboratory tests on Listeria monocytogens were added, a terminal number of rejected samples were not changed. When to these results, the results of Campylobacter spp. testing were added, 91 (40.1% out of the 227 samples were unsatisfied. Results of logistic regression model with occurrence of Escherichia coli as dependent variable indicated that Escherichia coli was 4.5 times likely

  4. How a routine checking of Escherichia coli in retailed food of animal origin can protect consumers against exposition to Campylobacter spp. and Listeria monocytogenes?

    Science.gov (United States)

    Trajković-Pavlović, Ljiljana; Novaković, Budimka; Martinov-Cvejin, Mirjana; Gusman, Vera; Bijelović, Sanja; Dragnić, Natasa; Balać, Dragana

    2010-08-01

    According to the literature that has been published over the last two decades Campylobacter spp i Listeria monocitogens can be identified as causes of numerous diseases derived by consuming food of animal origin. The purpose of this paper was to find out how established national microbiological criteria of the Republic of Serbia on food safety in retailed food of animal origin could contribute to consumer's protection against exposition to foodborne pathogens such as Campylobacter spp. and Listeria monocytogenes. During a routine microbiological safety control of randomly selected 60 samples of fresh poultry meat, 30 samples of other fresh meat readymade for grilling, 30 samples of sausage products, 37 samples of heat-treated meat, 39 samples of toppings for fast food of animal origin and 31 samples of dairy products a national food safety criteria (Escherichia coli, aerobic plate count, Salmonella spp., coagulasa positive Staphylococcus, Proteus spp., sulphito-reducting Clostridia) were applied and, as well as, testing to Campylobacter spp. and Listeria monocitogens. In determination of Campylobacter spp. and Listeria monocytogenes, food quality control methods of the Food and Agriculture Organization (FAO) were applied, while in determination of the other above motioned bacteria, national provisions on microbiological methods were applied who are adjusted to the FAO ones. Related to the national criteria on microbiological food safety, 88 (38.8%) samples, out of the total 227 tested, were rejected. When to these results, the results of laboratory tests on Listeria monocytogens were added, a terminal number of rejected samples were not changed. When to these results, the results of Campylobacter spp. testing were added, 91 (40.1%) out of the 227 samples were unsatisfied. Results of logistic regression model with occurrence of Escherichia coli as dependent variable indicated that Escherichia coli was 4.5 times likely to occur among samples with Campylobacter spp

  5. Prevalence, Antimicrobial Resistance, and Genetic Diversity of Listeria spp. Isolated from Raw Chicken Meat and Chicken-Related Products in Malaysia.

    Science.gov (United States)

    Chin, Pui San; Ang, Geik Yong; Yu, Choo Yee; Tan, Eng Lee; Tee, Kok Keng; Yin, Wai Fong; Chan, Kok Gan; Tan, Geok Yuan Annie

    2018-02-01

    Listeria spp. are ubiquitous in nature and can be found in various environmental niches such as soil, sewage, river water, plants, and foods, but the most frequently isolated species are Listeria monocytogenes and Listeria innocua. In this study, the presence of Listeria spp. in raw chicken meat and chicken-related products sold in local markets in Klang Valley, Malaysia was investigated. A total of 44 Listeria strains (42 L. innocua and 2 L. welshimeri) were isolated from 106 samples. Antibiotic susceptibility tests of the L. innocua strains revealed a high prevalence of resistance to clindamycin (92.9%), ceftriaxone (76.2%), ampicillin (73.8%), tetracycline (69%), and penicillin G (66.7%). Overall, 31 L. innocua and 1 L. welshimeri strain were multidrug resistant, i.e., nonsusceptible to at least one antimicrobial agent in three or more antibiotic classes. The majority of the L. innocua strains were placed into five AscI pulsogroups, and overall 26 distinct AscI pulsotypes were identified. The detection of multidrug-resistant Listeria strains from different food sources and locations warrants attention because these strains could serve as reservoirs for antimicrobial resistance genes and may facilitate the spread and emergence of other drug-resistant strains.

  6. Occurrence and genetic characterization of Listeria spp. in minimally processed vegetables commercialized in Porto Alegre, Brazil

    OpenAIRE

    Verdin, Sylvia Elisa Frizzo; Silva, Silvia Regina Pavan da; Pereira, Dariane Castro; Schatkoski, Aline Modelski; Corção, Gertrudes

    2007-01-01

    Minimally processed vegetables go through many steps before they are refrigerated, selection, washing, peeling, cutting, disinfection and finally packaging. However, if no care is taken at the origin of the raw materials and in the processing stages, there is a chance of finding pathogenic bacteria, such as Listeria monocytogenes, which are able to grow at low temperatures. The aim of this research was to verify the occurrence of Listeria sp. in minimally processed vegetables sold in Porto Al...

  7. Monitoring transmission routes of Listeria spp. in smoked salmon production with repetitive element sequence-based PCR techniques.

    Science.gov (United States)

    Zunabovic, M; Domig, K J; Pichler, I; Kneifel, W

    2012-03-01

    Various techniques have been used for tracing the transmission routes of Listeria species and for the assessment of hygiene standards in food processing plants. The potential of repetitive element sequence-based PCR (Rep-PCR) methods (GTG₅ and REPI + II) for the typing of Listeria isolates (n = 116), including Listeria monocytogenes (n = 46), was evaluated in a particular situation arising from the relocation of a company producing cold-smoked salmon. Pulsed-field gel electrophoresis (PFGE) using three restriction enzymes (ApaI, AscI, and SmaI) was used for comparison. Identical transmission scenarios among two companies could be identified by cluster analysis of L. monocytogenes isolates that were indistinguishable by both Rep-PCR and PFGE. The calculated diversity index (DI) indicates that Rep-PCR subtyping of Listeria species with primer sets GTG₅ and REPI + II has a lower discrimination power than does PFGE. When concatenated Rep-PCR cluster analysis was used, the DI increased from 0.934 (REPI + II) and 0.923 (GTG₅) to 0.956. The discrimination power of this method was similar to that of PFGE typing based on restriction enzyme Apa I (DI = 0.955). Listeria welshimeri may be useful as an indicator for monitoring smoked salmon processing environments. Rep-PCR meets the expectations of a reasonable, fast, and low-cost molecular subtyping method for the routine monitoring of Listeria species. The discriminatory power as characterized by the DI sufficiently quantifies the probability of unrelated isolates being characterized as different subtypes. Therefore, Rep-PCR typing based on two primer systems (GTG₅ and REPI + II) may be a useful tool for monitoring industrial hygiene.

  8. Effects of lactate on the growth of Listeria monocytogenes, Escherichia coli 0157:H7 and Salmonella SPP., in cooked ham at refrigeration and abuse temperatures

    Science.gov (United States)

    The objective of this study was to determine the effect of sodium lactate on the survival of Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella spp. in cooked ham during storage at refrigeration and abuse temperatures. Cooked ham was added with 0-3% lactate, inoculated with a multiple...

  9. Evaluation of a cross contamination model describing transfer of salmonella spp. and listeria monocytogenes during grinding of pork and beef

    DEFF Research Database (Denmark)

    Møller, Cleide Oliveira de Almeida; Hansen, Tina Beck; Aabo, Søren

    2015-01-01

    Introduction: The cross contamination model (Møller et al. 2012) was evaluated to investigate its capability of describing transfer of Salmonella spp. and Listeria monocytogenes during grinding of pork and beef of varying sizes (50 – 324 g) and numbers of pieces to be ground (10 – 100), in two...... grinder systems. Methods: Data from 19 trials were collected. Three different evaluation approaches were applied: i) an Acceptable Simulation Zone (ASZ) method compared observed with simulated transfer from the proposed model, ii) each trial was fitted and its respective parameter estimates were...... integrated in a Quantitative Microbiological Risk Assessment (QMRA) model (Møller et al. 2015), and iii) the Total Transfer Potential (TTP) was calculated for each of the 20 fitted parameter estimates. Results: The ASZ showed that the Møller et al. (2012) model could only describe seven of the 19 trials...

  10. Validation of a modification to Performance-Tested Method 070601: Reveal Listeria Test for detection of Listeria spp. in selected foods and selected environmental samples.

    Science.gov (United States)

    Alles, Susan; Peng, Linda X; Mozola, Mark A

    2009-01-01

    A modification to Performance-Tested Method (PTM) 070601, Reveal Listeria Test (Reveal), is described. The modified method uses a new media formulation, LESS enrichment broth, in single-step enrichment protocols for both foods and environmental sponge and swab samples. Food samples are enriched for 27-30 h at 30 degrees C and environmental samples for 24-48 h at 30 degrees C. Implementation of these abbreviated enrichment procedures allows test results to be obtained on a next-day basis. In testing of 14 food types in internal comparative studies with inoculated samples, there was a statistically significant difference in performance between the Reveal and reference culture [U.S. Food and Drug Administration's Bacteriological Analytical Manual (FDA/BAM) or U.S. Department of Agriculture-Food Safety and Inspection Service (USDA-FSIS)] methods for only a single food in one trial (pasteurized crab meat) at the 27 h enrichment time point, with more positive results obtained with the FDA/BAM reference method. No foods showed statistically significant differences in method performance at the 30 h time point. Independent laboratory testing of 3 foods again produced a statistically significant difference in results for crab meat at the 27 h time point; otherwise results of the Reveal and reference methods were statistically equivalent. Overall, considering both internal and independent laboratory trials, sensitivity of the Reveal method relative to the reference culture procedures in testing of foods was 85.9% at 27 h and 97.1% at 30 h. Results from 5 environmental surfaces inoculated with various strains of Listeria spp. showed that the Reveal method was more productive than the reference USDA-FSIS culture procedure for 3 surfaces (stainless steel, plastic, and cast iron), whereas results were statistically equivalent to the reference method for the other 2 surfaces (ceramic tile and sealed concrete). An independent laboratory trial with ceramic tile inoculated with L

  11. Bacteriophage amplification assay for detection of Listeria spp. using virucidal laser treatment

    Directory of Open Access Journals (Sweden)

    I.C. Oliveira

    2012-09-01

    Full Text Available A protocol for the bacteriophage amplification technique was developed for quantitative detection of viable Listeria monocytogenes cells using the A511 listeriophage with plaque formation as the end-point assay. Laser and toluidine blue O (TBO were employed as selective virucidal treatment for destruction of exogenous bacteriophage. Laser and TBO can bring a total reduction in titer phage (ca. 10(8 pfu/mL without affecting the viability of L. monocytogenes cells. Artificially inoculated skimmed milk revealed mean populations of the bacteria as low as between 13 cfu/mL (1.11 log cfu/mL, after a 10-h assay duration. Virucidal laser treatment demonstrated better protection of Listeria cells than the other agents previously tested. The protocol was faster and easier to perform than standard procedures. This protocol constitutes an alternative for rapid, sensitive and quantitative detection of L. monocytogenes.

  12. Prevalence of Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella spp. in seafood products using multiplex polymerase chain reaction.

    Science.gov (United States)

    Zarei, Mehdi; Maktabi, Siavash; Ghorbanpour, Masoud

    2012-02-01

    Although several etiological agents can be transmitted through seafood consumption, Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella spp. are considered among the most important pathogens in terms of public health and disease. In this study, multiplex polymerase chain reaction (PCR), as a rapid and cost-effective method, was used to determine the prevalence of these pathogens in 245 samples of raw/fresh, frozen, and ready-to-eat (RTE) seafood products marketed in Iran. The prevalence of L. monocytogenes in raw/fresh fish and shrimp samples was 1.4%, whereas 2.9% of the raw/fresh fish and 7.1% of the shrimp samples were contaminated with V. parahaemolyticus. No contamination with L. monocytogenes and V. parahaemolyticus was found in frozen and RTE seafood products. The prevalence of S. aureus was found to be higher than other investigated pathogens. S. aureus was detected in 5% of the raw/fresh samples of fish and shrimp, 17.5% of the frozen, and 12.3% of the RTE samples. Further, our findings indicate that 2.9% of the fish samples, 4.3% of the shrimp samples, and 1.5% of the RTE samples were contaminated with Salmonella spp. Owing to the potential hazard of these pathogenic bacteria, multiplex PCR can provide a rapid and cost-effective method for the surveillance of these pathogens in seafood products.

  13. Universal primer-multiplex PCR approach for simultaneous detection of Escherichia coli, Listeria monocytogenes, and Salmonella spp. in food samples.

    Science.gov (United States)

    Yuan, Yanfang; Xu, Wentao; Zhai, Zhifang; Shi, Hui; Luo, Yunbo; Chen, Zhuojun; Huang, Kunlun

    2009-10-01

    Escherichia coli, Listeria monocytogenes, and Salmonella spp. are 3 kinds of the most important food-borne human pathogens. Traditional microbiological analysis is labor-intensive, time-consuming, and easily contaminated, thus producing false positive signals; it also involves much subjectivity judgments. Multiplex-PCR could be applied to detect multiple target organisms simultaneously to save time and labor, but there is always disproportionate amplification resulting from the disparity of different primers. To gain a rapid and sensitive method, a universal primer-multiplex PCR system (UP-M-PCR) was developed and applied for simultaneous detection of the 3 organisms. This method simplified traditional multiplex-PCR reaction system and overcame its amplification disparities among different primers; moreover, it got a high specificity and sensitivity (85, 155, and 104 copies/reaction for E. coli O157, L. monocytogenes, and Salmonella spp., respectively). Compared with the time-consuming and laborious microbiological analysis, UP-M-PCR had a lower risk of cross-contamination without inoculation and incubation. Test results for 36 food samples showed that UP-M-PCR method got a relative accuracy of 91.77% when compared with traditional microbiological analysis. It could serve as a rapid screening method for pathogen detection and could detect target genes even in dead pathogenic cells. In addition, it has the potential to be performed in an automation mode and might find broader application in simultaneous detection of other multiple pathogens.

  14. Evaluation of applied biosystems MicroSEQ real-time PCR system for detection of Listeria spp. in food and environmental samples.

    Science.gov (United States)

    Petrauskene, Olga V; Cao, Yanxiang; Zoder, Patrick; Wong, Lily Y; Balachandran, Priya; Furtado, Manohar R; Tebbs, Robert S

    2012-01-01

    A complete system for real-time PCR detection of Listeria species was validated in five food matrixes and five environmental surfaces, namely, hot dogs, roast beef, lox (smoked salmon), pasteurized whole cow's milk, dry infant formula, stainless steel, plastic cutting board, ceramic tile, rubber sheets, and sealed concrete. The system consists of the MicroSEQ Listeria spp. Detection Kit, two sample preparation kits (PrepSEQ Nucleic Acid Extraction Kit and PrepSEQ Rapid Spin Sample Preparation Kit), the Applied Biosystems 7500 Fast Real-Time PCR instrument, and the RapidFinderTM Express v1.1 Software for data analysis. The test method was compared to the ISO 11290-1 reference method using an unpaired study design. The MicroSEQ Listeria spp. Detection Kit and the ISO 11290-1 reference method showed equivalent detection based on Chi-square analysis for all matrixes except hot dogs. For hot dogs, the MicroSEQ method detected more positives than the reference method for the low- and high-level inoculations, with all of the presumptive positives confirmed by the reference method. An independent validation study confirmed these findings on lox and stainless steel surface. The MicroSEQ kit detected all 50 Listeria strains tested and none of the 31 nontarget bacteria strains.

  15. Rapid identification and classification of Listeria spp. and serotype assignment of Listeria monocytogenes using fourier transform-infrared spectroscopy and artificial neural network analysis

    Science.gov (United States)

    The use of Fourier Transform-Infrared Spectroscopy (FT-IR) in conjunction with Artificial Neural Network software, NeuroDeveloper™ was examined for the rapid identification and classification of Listeria species and serotyping of Listeria monocytogenes. A spectral library was created for 245 strains...

  16. Tomatidine and analog FC04-100 possess bactericidal activities against Listeria, Bacillus and Staphylococcus spp.

    Science.gov (United States)

    Guay, Isabelle; Boulanger, Simon; Isabelle, Charles; Brouillette, Eric; Chagnon, Félix; Bouarab, Kamal; Marsault, Eric; Malouin, François

    2018-02-13

    Tomatidine (TO) is a plant steroidal alkaloid that possesses an antibacterial activity against the small colony variants (SCVs) of Staphylococcus aureus. We report here the spectrum of activity of TO against other species of the Bacillales and the improved antibacterial activity of a chemically-modified TO derivative (FC04-100) against Listeria monocytogenes and antibiotic multi-resistant S. aureus (MRSA), two notoriously difficult-to-kill microorganisms. Bacillus and Listeria SCVs were isolated using a gentamicin selection pressure. Minimal inhibitory concentrations (MICs) of TO and FC04-100 were determined by a broth microdilution technique. The bactericidal activity of TO and FC04-100 used alone or in combination with an aminoglycoside against planktonic bacteria was determined in broth or against bacteria embedded in pre-formed biofilms by using the Calgary Biofilm Device. Killing of intracellular SCVs was determined in a model with polarized pulmonary cells. TO showed a bactericidal activity against SCVs of Staphylococcus aureus, Bacillus cereus, B. subtilis and Listeria monocytogenes with MICs of 0.03-0.12 μg/mL. The combination of an aminoglycoside and TO generated an antibacterial synergy against their normal phenotype. In contrast to TO, which has no relevant activity by itself against Bacillales of the normal phenotype (MIC > 64 μg/mL), the TO analog FC04-100 showed a MIC of 8-32 μg/mL. Furthermore, FC04-100 showed a strong bactericidal activity against L. monocytogenes SCVs in kill kinetics experiments, while TO did not. The addition of FC04-100 (4 μg/mL) to a cefalexin:kanamycin (3:2) combination improved the activity of the combination by 32 fold against cefalexin and kanamycin-resistant MRSA strains. In combination with gentamicin, FC04-100 also exhibited a strong bactericidal activity against biofilm-embedded S. aureus. Also, FC04-100 and TO showed comparable intracellular killing of S. aureus SCVs. Chemical modifications of TO allowed

  17. Longitudinal studies on Listeria in smoked fish plants: impact of intervention strategies on contamination patterns.

    Science.gov (United States)

    Lappi, Victoria R; Thimothe, Joanne; Nightingale, Kendra Kerr; Gall, Kenneth; Scott, Virginia N; Wiedmann, Martin

    2004-11-01

    Four ready-to-eat smoked fish plants were monitored for 2 years to study Listeria contamination patterns and the impact of plant-specific Listeria control strategies, including employee training and targeted sanitation procedures, on Listeria contamination patterns. Samples from the processing plant environment and from raw and finished product were collected monthly and tested for Listeria spp. and Listeria monocytogenes. Before implementation of intervention strategies, 19.2% of raw product samples (n = 276), 8.7% of finished product samples (n = 275), and 26.1% of environmental samples (n = 617) tested positive for Listeria spp. During and after implementation of Listeria control strategies, 19.0% of raw product samples (n = 242), 7.0% of finished product samples (n = 244), and 19.5% of environmental samples (n = 527) were positive for Listeria spp. In one of the four fish plants (plant 4), no environmental samples were positive for L. monocytogenes, and this plant was thus excluded from statistical analyses. Based on data pooled from plants 1, 2, and 3, environmental Listeria spp. prevalence was significantly lower (P Listeria prevalence for floor drains was similar before and after implementation of controls (49.6 and 54.2%, respectively). Regression analysis revealed a significant positive relationship (P Listeria control strategies. Molecular subtyping (EcoRI ribotyping) revealed that specific L. monocytogenes ribotypes persisted in three processing plants over time. These persistent ribotypes were responsible for all six finished product contamination events detected in plant 1. Ribotype data also indicated that incoming raw material is only rarely a direct source of finished product contamination. While these data indicate that plant-specific Listeria control strategies can reduce cross-contamination and prevalence of Listeria spp. and L. monocytogenes in the plant environment, elimination of persistent L. monocytogenes strains remains a considerable

  18. The effect of soil management on the persistence of E. coli and Listeria spp. in manure- amended soils in the Northeast United States

    Science.gov (United States)

    Introduction: Enterohemorrhagic Escherichia coli and Listeria monocytogenes can contaminate leafy greens through inappropriately managed raw manure applied to soils. Current FDA guidance includes calling for additional scientific data to determine the appropriate interval between application of man...

  19. Prevalence of Salmonella spp. and Listeria monocytogenes at small-scale spanish factories producing traditional fermented sausages.

    Science.gov (United States)

    Martin, Belen; Garriga, Margarita; Aymerich, Teresa

    2011-05-01

    The manufacturing of fermented sausages is subject to natural contamination processes that can potentially carry foodborne pathogens along the process chain and result in contamination of the final product. The aim of this study was to evaluate the occurrence of Salmonella spp. and Listeria monocytogenes at different sampling points during the manufacturing process of fuet, a type of traditional fermented sausage, at 10 small-scale Spanish factories. The presence of both pathogens was studied in the raw materials (19 casings and 19 meat batters), the final products (19 fermented sausages), and the factory equipment (12 mincing, 12 mixing, and 19 stuffing machines, 19 cutting tables, 11 knives, and 12 cold rooms) by using classical microbiological techniques and real-time PCR. Salmonella was not detected in the equipment analyzed or in the final products, but it was detected in the raw materials (23.7% of samples). L. monocytogenes showed higher incidence than Salmonella and was detected in the equipment (11.8% of samples), the raw materials (28.9%), and the final products (15.8%), confirming its ubiquity throughout the manufacturing process of fermented sausages. Five factories were further investigated to study the changes in the distribution of pathogens in the fuet production process over a period of either 2 or 3 years. There was considerable variation in the incidence of both pathogens at different sampling periods, and there was no relation between seasonal variations or geographic location of the factories.

  20. Behavior of Listeria monocytogenes and Aeromonas spp. on fresh-cut produce packaged under equilibrium-modified atmosphere.

    Science.gov (United States)

    Jacxsens, L; Devlieghere, F; Falcato, P; Debevere, J

    1999-10-01

    Storage experiments were conducted to follow the behavior of pathogens on fresh-cut vegetables (trimmed brussels sprouts, grated carrots, shredded iceberg lettuce, and shredded chicory endives) packaged under an equilibrium-modified atmosphere (EMA) (2 to 3% O2, 2 to 3% CO2, and 94 to 96% N2) and stored at 7 degrees C. As a comparison, fresh-cut vegetables were also packaged in a perforated high-barrier film (air conditions) and stored at 7 degrees C. In a first step, the shelf life of the vegetables in the two kinds of packages was determined by evaluating the microbiological quality as well as the sensorial quality (appearance, taste, and odor). In general, sensorial properties were faster in limiting the shelf life than microbiological criteria. The shelf life of the vegetables stored under an EMA was extended by 50% or more, compared with the air-stored vegetables. In a second storage experiment, the four fresh-cut vegetables were inoculated with a cocktail of psychrotrophic pathogens (Listeria monocytogenes, Aeromonas caviae [HG4]) and A. bestiarum (HG2) before packaging under an EMA and air at 7 degrees C. The inoculated pathogens were more influenced by the type of vegetable than by the type of atmosphere. No growth was detected on the brussels sprouts or on carrots (L. monocytogenes). Aeromonas spp. had a higher growth rate than L. monocytogenes on the shredded chicory endives and shredded iceberg lettuce at 7 degrees C.

  1. Isolation and characterization of Listeria species from rodents in natural environments in China.

    Science.gov (United States)

    Wang, Yan; Lu, Liang; Lan, Ruiting; Salazar, Joelle K; Liu, Jingli; Xu, Jianguo; Ye, Changyun

    2017-06-07

    Listeria is ubiquitous in a variety of environments and can be isolated from a wide range of animal hosts. Rodents are capable of carrying pathogenic bacteria in their intestines, such as Listeria, and can disseminate those pathogens into the natural environment and to where human activity occurs. In this study, we investigated the occurrence and antimicrobial susceptibility of Listeria spp. isolated from wild rodents found in natural environments in China. We collected 341 intestinal fecal samples of rodents from five different regions of China, all representing different rodent habitats. The antimicrobial susceptibility of the Listeria spp. isolates obtained were firstly assessed using the Kirby-Bauer disk diffusion method. Thirty-one samples were positive for Listeria spp., of which 11 were positive for Listeria monocytogenes and seven were positive for Listeria ivanovii. Other species identified include Listeria innocua, Listeria fleischmannii and Listeria floridensis. All Listeria spp. isolates were sensitive to the majority of the antimicrobials tested, but largely resistant to oxacillin (94.1%) and cefuroxime (70.6%). All L. monocytogenes isolates were further characterized by serotyping, multi-locus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). L. monocytogenes strains were grouped into three serotypes, five sequence types and five pulsotypes (PTs) by serotyping, MLST and PFGE, respectively. Almost half of the isolates (five of 11) belonged to serotype 1/2b, ST87 and PT1. This study determined that Listeria is carried in the intestinal tracts of wild rodents from multiple regions at a low rate, filling an epidemiological data gap on Listeria in natural environments in China.

  2. Listeria spp. associated to different levels of autochthonous microbiota in meat, meat products and processing plants Listeria spp. associado a diferentes níveis da microbiota autóctone de carne, produtos cárneos e plantas de processamento

    Directory of Open Access Journals (Sweden)

    Márcia de Aguiar Ferreira Barros

    2007-12-01

    Full Text Available High levels of microbial contamination, commonly found in animal origin foods and food processing environments, are able to hinder the growth of pathogens in these products and interfere in the results of laboratory analyses for detection of these pathogens. With the aim of verifying the possible interference of the autochthonous microbiota encountered in meat and meat products and processing plants over the presence of Listeria spp., 443 samples, collected from 11 meat retail establishments, were submitted to microbiological analysis to determine the levels of mesophilic aerobes, total coliforms and Escherichia coli and the presence of Listeria spp., according to the methodology proposed by the USDA. The results did not show evident interference of the autochthonous microbiota over Listeria spp., once the genus was detected even in the meat, meat products and environmental samples with high levels of contamination by mesophilic aerobes and coliforms.Altos níveis de contaminação microbiana, usualmente encontrados em alimentos de origem animal e nos ambientes de processamento, podem inibir a multiplicação de microrganismos patogênicos nesses produtos e interferir nos resultados das análises laboratoriais para o isolamento desses patógenos. Com o objetivo de verificar as possíveis interferências da microbiota autóctone encontrada na carne, produtos cárneos e plantas de processamento sobre a presença de Listeria spp., 443 amostras, coletadas em 11 estabelecimentos processadores, foram submetidas a análises microbiológicas para determinação dos níveis de contaminação por aeróbios mesófilos, coliformes totais e Escherichia coli e para verificação da presença de Listeria spp., de acordo com a metodologia proposta pelo USDA. Os resultados obtidos não mostraram uma interferência evidente da microbiota autóctone sobre Listeria spp., uma vez que esse gênero foi detectado mesmo nas amostras de carne e produtos cárneos e

  3. Combined effects of NaCl, NaOH, and biocides (monolaurin or lauric acid) on inactivation of Listeria monocytogenes and Pseudomonas spp.

    Science.gov (United States)

    Vasseur, C; Rigaud, N; Hébraud, M; Labadie, J

    2001-09-01

    This study highlighted combinations of chemical stresses that could decrease or eliminate Listeria monocytogenes and Pseudomonas spp. surviving in food processing plants. Strains of L. monocytogenes, Pseudomonas fragi, and Pseudomonas fluorescens isolated from processing environments (meat and milk) were grown at 20 degrees C up to the early stationary phase. The strains were then subjected to 30 min of physicochemical treatments. These treatments included individual or combined acid (acetic acid), alkaline (NaOH), osmotic (NaCl), and biocides (fatty acids) challenges. Survival of the strains was studied after individual or combined acid (acetic acid), alkaline (NaOH), osmotic (NaCl), and biocides (monolaurin, lauric acid) challenges. Individual pH shocks had lower efficiencies than those used in combinations with other parameters. The treatment pH 5.4 followed by pH 10.5 had a low efficiency against L. monocytogenes. The opposite combination, pH 10.5 followed by pH 5.4, led to a 3-log reduction of the L. monocytogenes population. Pseudomonas spp. strains were much more sensitive than L. monocytogenes, and population reductions of 5 and 8 log (total destruction), respectively, were observed after the same treatments. As for L. monocytogenes, the combination pH 10.5 followed by pH 5.4 is more deleterious than the opposite. Whatever the bacterial species, the most efficient treatments were combinations of alkaline, osmotic, and biocide shocks. For instance, the combination pH 10.5 and 10% NaCl plus biocides showed reductions of 5 to 8 log for both bacteria. The origins of the observed lethal effects are discussed.

  4. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    Directory of Open Access Journals (Sweden)

    Ebrahim Rahimi

    2014-02-01

    Full Text Available Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. Results: Using cultural method, 19 samples (7.3% were positive for Listeria spp. The highest prevalence of Listeria was found in raw water buffalo milk (11.8%, followed by raw bovine milk (10.6%, raw ovine milk (7.1%, and raw caprine milk (4.2% samples. All 37 camel milk samples from 20 camel breeding farms were negative for Listeria spp. The overall prevalence of Listeria was 7.3%, in which Listeria innocua was the most recovered species (4.2%; the remaining isolates were Listeria monocytogenes (1.9%, Listeria ivanovii (0.08% and Listeria seeligari (0.04%. The PCR assay could identify 8 Listeria-contaminated milk samples that were negative using the cultural method. Conclusions: The results presented in this study indicate the potential risk of infection with Listeria in people consuming raw and unpasteurized milk.

  5. Ocorrência de Listeria spp. em amostras de carne bovina moída comercializadas no município de Niterói, RJ, Brasil Occurrence of Listeria spp. in bovine ground meat samples commercialized in Niterói, RJ, Brazil

    Directory of Open Access Journals (Sweden)

    Samira Pirola Santos Mantilla

    2007-08-01

    Full Text Available Foram analisadas 30 amostras de carne bovina moída resfriada, previamente embaladas, provenientes de estabelecimentos comercias do município de Niterói, RJ, com o objetivo de se observar a freqüência de bactérias do gênero Listeria spp. Utilizou-se para isto a metodologia revisada do USDA. 50% das amostras analisadas apresentaram contaminação por Listeria spp., sendo a L. innocua (SEELIGER & SCHOOFS, 1979 a espécie isolada em maior número, seguida pela L. monocytogenes (MURRAY et al., 1926; PIRIE, 1940. Na tipificação sorológica, observou-se maior prevalência de L. monocytogenes pertencente ao sorotipo 4b (50%, porém o sorotipo ½ c também foi identificado. As amostras que apresentaram-se contaminadas com L. monocytogenes, caracterizam-se como potencialmente capazes de ocasionar enfermidades transmitidas por alimentos.Thirty bovine ground meat samples from several markets from Niterói, RJ, were analyzed, in order to observe the frequency of bacterias of the genus Listeria spp. A USDA revised methodology as applied in this research. Fifty percent of the samples were contaminated by Listeria spp.. L. innocua species as the most isolated, followed by L. monocytogenes. In serological typification, the greatest prevalence was that of sorotype 4b L. monocytogenes (50%, however the ½ c sorotype was also identified. Samples contaminated by L. monocytogenes are potentially capable of causing diseases through food consumption.

  6. Strain and growth temperature influence Listeria spp. attachment to intact and cut cabbage.

    Science.gov (United States)

    Ells, Timothy C; Truelstrup Hansen, Lisbeth

    2006-08-15

    Twenty four Listeria strains representing three different species and two serotypes of L. monocytogenes were investigated for their ability to attach to and colonize cabbage tissue. All strains exhibited a preference to attach to cut tissues compared to the intact leaf surfaces. Most strains attached to cut surfaces at levels 1.0 to 1.2 log CFU/cm(2) above numbers on intact tissue. Although all strains demonstrated the ability to colonize both intact and cut surfaces, some strains consistently exhibited higher levels of attachment. This attribute was independent of species or serotype. Scanning electron microscopy (SEM) revealed the presence of increased cell numbers on the cut edges with numerous cells located within folds and crevices. The distribution of cells found on the intact surfaces appeared to be randomly distributed with no apparent affinity for specialized surface structures such as stomata. SEM analysis also revealed the increased presence of large clusters of cells on leaf surfaces after 4 and 24 h. These cell aggregates appeared to be in the early stages of biofilm development. L. moncytogenes strain Scott A was used to examine the effect of prior growth temperature on attachment at 10 degrees C. Cells attached to intact cabbage surfaces within 5 min of exposure, with numbers reaching 4.3 log CFU/cm(2) for cells grown at 22 degrees C and 37 degrees C, and 3.8 log CFU/cm(2) for 10 degrees C cultures. The culture growth temperature was shown to significantly (P0.05) where more than 80% of cells, regardless of cultivation temperature, remained attached to the leaf surfaces following successive washes. Irrespectively of prior growth temperature, increasing exposure time to the cabbage resulted in increased attached cell numbers as well as increased binding strength. The increase in development of cell clusters and early biofilm structures may explain the decreased efficiency over time in removal of cells from the cabbage surfaces. The information

  7. Occurrence of Listeria spp. in retail meat and dairy products in the area of Addis Ababa, Ethiopia.

    Science.gov (United States)

    Derra, Firehiwot Abera; Karlsmose, Susanne; Monga, Dharam P; Mache, Abebe; Svendsen, Christina Aaby; Félix, Benjamin; Granier, Sophie A; Geyid, Abera; Taye, Girum; Hendriksen, Rene S

    2013-06-01

    Listeriosis, a bacterial disease in humans and animals, is mostly caused by ingestion of Listeria monocytogenes via contaminated food and/or water, or by a zoonotic infection. Globally, listeriosis has in general a low incidence but a high case fatality rate. The objective of this study was to investigate the occurrence, antimicrobial profiles, and genetic relatedness of L. monocytogenes from raw meat and dairy products (raw milk, cottage cheese, cream cake), collected from the capital and five neighboring towns in Ethiopia. Two hundred forty food samples were purchased from July to December 2006 from food vendors, shops, and supermarkets, using a cross-sectional study design. L. monocytogenes were isolated and subjected to molecular serotyping. The genetic relatedness and antimicrobial susceptibility patterns were investigated using pulsed-field gel electrophoresis (PFGE) and minimum inhibitory concentration determinations. Of 240 food samples tested, 66 (27.5%) were positive for Listeria species. Of 59 viable isolates, 10 (4.1%) were L. monocytogenes. Nine were serotype 4b and one was 2b. Minimum inhibitory concentration determination and PFGE of the 10 L. monocytogenes isolates showed low occurrence of antimicrobial resistance among eight different PFGE types. The findings in this study correspond to similar research undertaken in Ethiopia by detecting L. monocytogenes with similar prevalence rates. Public education is crucial as regards the nature of this organism and relevant prevention measures. Moreover, further research in clinical samples should be carried out to estimate the prevalence and carrier rate in humans, and future investigations on foodborne outbreaks must include L. monocytogenes.

  8. Evaluation of a cross contamination model describing transfer of Salmonella spp. and Listeria monocytogenes during grinding of pork and beef.

    Science.gov (United States)

    Møller, C O A; Sant'Ana, A S; Hansen, S K H; Nauta, M J; Silva, L P; Alvarenga, V O; Maffei, D; Silva, F F P; Lopes, J T; Franco, B D G M; Aabo, S; Hansen, T B

    2016-06-02

    In a previous study, a model was developed to describe the transfer and survival of Salmonella during grinding of pork (Møller, C.O.A., Nauta, M.J., Christensen, B.B., Dalgaard, P., Hansen, T.B., 2012. Modelling transfer of Salmonella typhimurium DT104 during simulation of grinding of pork. Journal of Applied Microbiology 112 (1), 90-98). The robustness of this model is now evaluated by studying its performance for predicting the transfer and survival of Salmonella spp. and Listeria monocytogenes during grinding of different types of meat (pork and beef), using two different grinders, different sizes and different numbers of pieces of meats to be ground. A total of 19 grinding trials were collected. Acceptable Simulation Zone (ASZ), visual inspection of the data, Quantitative Microbiological Risk Assessment (QMRA), as well as the Total Transfer Potential (TTP) were used as approaches to evaluate model performance and to access the quality of the cross contamination model predictions. Using the ASZ approach and considering that 70% of the observed counts have to be inside a defined acceptable zone of ±0.5 log10CFU per portion, it was found that the cross contamination parameters suggested by Møller et al. (2012) were not able to describe all 19 trials. However, for each of the collected grinding trials, the transfer event was well described when fitted to the model structure proposed by Møller et al. (2012). Parameter estimates obtained by fitting observed trials performed at different conditions, such as size and number of pieces of meat to be ground, may not be applied to describe cross contamination of unlike processing. Nevertheless, the risk estimates, as well as the TTP, revealed that the risk of disease may be reduced when the grinding of meat is performed in a grinder made of stainless steel (for all surfaces in contact with the meat), using a well-sharpened knife and holding at room temperatures lower than 4°C. Copyright © 2016 Elsevier B.V. All

  9. Hazards in non-pasteurized milk on retail sale in Brazil: prevalence of Salmonella spp, Listeria monocytogenes and chemical residues Perigos em leite não-pasteurizado comercializado no Brasil: ocorrência de Salmonella spp, Listeria monocytogenes e de resíduos químicos

    Directory of Open Access Journals (Sweden)

    Luís Augusto Nero

    2004-09-01

    Full Text Available Fluctuations in the Brazilian milk market force small milk producers to find temporary trade alternatives, which include selling raw milk to people who prefer this type of milk rather than heat-processed milk. Considering the importance of these small milk producers to the market and the well-known health risks associated to consumption of raw milk, this study evaluated the microbiological quality and the presence of Listeria monocytogenes, Salmonella spp., chlorine, antimicrobials and insecticides (organophosphates and carbamates in raw milk produced in 210 small and medium farms located in four important milk-producing Brazilian states (Paraná, São Paulo, Minas Gerais and Rio Grande do Sul. In 66% of the selected farms the milking was manual. In 33% of them, the milking was semi-automatic, and only 1% were equipped with fully automatic milking systems. All raw milk samples were negative for L. monocytogenes, Salmonella spp and chlorine. Mesophilic aerobes counts were higher than 10(5 CFU/ml in 75.7% of the samples. In 80.4%, coliforms were over 10² CFU/ml. Escherichia coli was detected in 36.8% of the samples. Insecticides and antimicrobial residues were observed in 74.4% and 11.5% of the samples, respectively. The presence of unacceptable levels of hygiene indicators, insecticides and antimicrobial residues were considered more important risk factors than the two pathogens.A instabilidade do mercado de leite no Brasil força pequenos produtores de leite a procurar alternativas de comércio de sua produção, o que inclui a venda de leite cru para indivíduos que dão preferência a esse tipo de leite. Considerando a importância desse mercado e os conhecidos riscos à saúde que o consumo de leite cru pode representar, este estudo avaliou a qualidade microbiológica e a presença de Listeria monocytogenes, Salmonella spp., resíduos de cloretos, antimicrobianos e inseticidas (organofosforados e carbamatos em leite cru produzido em 210

  10. Comparison of conventional culture method and fluorescent in situ hybridization technique for detection of Listeria spp. in ground beef, turkey, and chicken breast fillets in İzmir, Turkey.

    Science.gov (United States)

    Baysal, Ayse Handan

    2014-12-01

    The occurrence of Listeria species in refrigerated fresh chicken breast fillet, turkey breast fillet, and ground beef was evaluated, comparing the conventional culture method and fluorescent in situ hybridization (FISH). FISH uses hybridization of a nucleic acid sequence target of a microorganism with a specific DNA probe labeled with a fluorochrome and imaging by a fluorescence microscope. First, Listeria was inoculated in chicken breast fillet, turkey breast fillet, or ground beef, and the applicability of the FISH method was evaluated. Second, Listeria was detected in fresh chicken breast fillet, turkey breast fillet, and ground beef by culture and FISH methods. Listeria was isolated from 27 (37.4%) of 216 samples by the standard culture method, whereas FISH detected 25 (24.7%) preenriched samples. Of these isolates, 17 (63%) were L. innocua, 6 (22%) L. welshimeri, and 4 (14.8%) L. seeligeri. Overall, the prevalences of Listeria spp. found with the conventional culture method in chicken breast fillet, turkey breast fillet, and ground beef were 9.7, 6.9, and 20.8%, whereas with the FISH technique these values were 11.1, 6.9, and 16.7%, respectively. The molecular FISH technique appears to be a cheap, sensitive, and time-efficient procedure that could be used for routine detection of Listeria spp. in meat. This study showed that retail raw meats are potentially contaminated with Listeria spp. and are, thus, vehicles for transmitting diseases caused by foodborne pathogens, underlining the need for increased precautions, such as implementation of hazard analysis and critical control points and consumer food safety education.

  11. Listeria Species in Broiler Poultry Farms: Potential Public Health Hazards.

    Science.gov (United States)

    Dahshan, Hesham; Merwad, Abdallah Mohamed Amin; Mohamed, Taisir Saber

    2016-09-28

    Broiler meat production worldwide has been plagued by lethal food-poisoning bacteria diseases, including listeriosis. A fatality rate of 15.6% was recorded in human beings in the EU in 2015. During 2013, a total of 200 poultry farm samples, including litter, chicken breast, farm feed, and drinking water, were collected to generate baseline data for the characterization of the genus Listeria in broiler poultry farms. Listeria spp. were detected in a total of 95 (47.5%) poultry farm samples. The isolates of Listeria spp. included L. innocua (28.5%), L. ivanovii (12.5%), L. welshimeri (4.5%), and L. monocytogenes and L. seeligeri (1% each). Listeria spp. contamination rates were higher in farm feed (70%), followed by litter (52.5%), chicken breasts (42.2%), and drinking water (10%). Almost all Listeria spp. isolates were resistant to more than three classes of antibiotics (multidrug resistant). Besides this, we observed a significant resistance level to penicillin and fluoroquinolone drugs. However, lower resistance levels were recorded for broad-spectrum cephalosporins. The inlA, inlC, and inlJ virulence genes were detected in almost all of the L. monocytogenes isolates. Thus, food safety management approaches and interventions at all stages of the broiler rearing cycle were needed to control cross-contamination and the zoonotic potential of listeriosis.

  12. Diversity of Listeria Species in Urban and Natural Environments

    Science.gov (United States)

    Overdevest, Jon; Fortes, Esther; Windham, Katy; Schukken, Ynte; Lembo, Arthur; Wiedmann, Martin

    2012-01-01

    A total of 442 Listeria isolates, including 234 Listeria seeligeri, 80 L. monocytogenes, 74 L. welshimeri, 50 L. innocua, and 4 L. marthii isolates, were obtained from 1,805 soil, water, and other environmental samples collected over 2 years from four urban areas and four areas representing natural environments. Listeria spp. showed similar prevalences in samples from natural (23.4%) and urban (22.3%) environments. While L. seeligeri and L. welshimeri were significantly associated with natural environments (P ≤ 0.0001), L. innocua and L. monocytogenes were significantly associated with urban environments (P ≤ 0.0001). Sequencing of sigB for all isolates revealed 67 allelic types with a higher level of allelic diversity among isolates from urban environments. Some Listeria spp. and sigB allelic types showed significant associations with specific urban and natural areas. Nearest-neighbor analyses also showed that certain Listeria spp. and sigB allelic types were spatially clustered within both natural and urban environments, and there was evidence that these species and allelic types persisted over time in specific areas. Our data show that members of the genus Listeria not only are common in urban and natural environments but also show species- and subtype-specific associations with different environments and areas. This indicates that Listeria species and subtypes within these species may show distinct ecological preferences, which suggests (i) that molecular source-tracking approaches can be developed for Listeria and (ii) that detection of some Listeria species may not be a good indicator for L. monocytogenes. PMID:22504820

  13. Listeria Genomics

    Science.gov (United States)

    Cabanes, Didier; Sousa, Sandra; Cossart, Pascale

    The opportunistic intracellular foodborne pathogen Listeria monocytogenes has become a paradigm for the study of host-pathogen interactions and bacterial adaptation to mammalian hosts. Analysis of L. monocytogenes infection has provided considerable insight into how bacteria invade cells, move intracellularly, and disseminate in tissues, as well as tools to address fundamental processes in cell biology. Moreover, the vast amount of knowledge that has been gathered through in-depth comparative genomic analyses and in vivo studies makes L. monocytogenes one of the most well-studied bacterial pathogens. This chapter provides an overview of progress in the exploration of genomic, transcriptomic, and proteomic data in Listeria spp. to understand genome evolution and diversity, as well as physiological aspects of metabolism used by bacteria when growing in diverse environments, in particular in infected hosts.

  14. Listeria (Listeriosis)

    Science.gov (United States)

    ... Search Form Controls Cancel Submit Search The CDC Listeria (Listeriosis) Note: Javascript is disabled or is not ... Compartir Get answers to commonly asked questions about Listeria Listeria information en español Learn how CDC’s Listeria ...

  15. Prevalence and Characterization of Listeria Species from Raw Milk and Dairy Products from Çanakkale Province

    Directory of Open Access Journals (Sweden)

    Pınar Şanlıbaba

    2018-02-01

    Full Text Available The objective of this study was to determine the prevalence of Listeria species, specifically Listeria monocytogenes, in raw milk, pasteurized milk, white cheese, and homemade cheese. A total of 200 food samples were collected and analyzed to examine the presence of Listeria spp. The EN ISO 11290-1 method was used for isolation of Listeria. API Listeria test kit was used for biochemically characterization. Listeria spp. were isolated in 25 of the 200 samples (12.5%. The largest number of Listeria spp. was detected in homemade cheese (24%, followed by raw milk (18%, and white cheese (8%. Listeria spp. were not isolated from the pasteurized milk. The most common species isolated were Listeria innocua (5.5%; the remaining Listeria isolates were Listeria ivanovi (3.5%, Listeria welshimeri (3%, and Listeria monocytogenes (0.5%. Listeria monocytogenes was detected in only raw milk.

  16. Development of a nucleic acid lateral flow immunoassay for simultaneous detection of Listeria spp. and Listeriamonocytogenes in food

    NARCIS (Netherlands)

    Blazkova, M.; Koets, M.; Rauch, P.; Amerongen, van A.

    2009-01-01

    We present a new nucleic acid lateral flow immunoassay (NALFIA) for the assessment of listeria contamination. The detection procedure starts with enrichment of sample in Half Fraser broth (24 h). Following isolation of DNA, a duplex PCR is performed with two labelled primer sets, one generic and

  17. Prevalence of Listeria species in some foods and their rapid ...

    African Journals Online (AJOL)

    profiling and verified using API Listeria system. Protein profiling by SDS-PAGE was also used to identify. Listeria spp. Results: Out of 40 meat samples, 14 (35 %) samples were contaminated with Listeria spp., with the highest incidence (50 %) occurring in raw beef products and raw chicken. Protein profiling by SDS-.

  18. Irrigation Water Sources and Time Intervals as Variables on the Presence of Campylobacter spp. and Listeria monocytogenes on Romaine Lettuce Grown in Muck Soil.

    Science.gov (United States)

    Guévremont, Evelyne; Lamoureux, Lisyanne; Généreux, Mylène; Côté, Caroline

    2017-07-01

    Irrigation water has been identified as a possible source of vegetable contamination by foodborne pathogens. Risk management for pathogens such as Campylobacter spp. and Listeria monocytogenes in fields can be influenced by the source of the irrigation water and the time interval between last irrigation and harvest. Plots of romaine lettuce were irrigated with manure-contaminated water or aerated pond water 21, 7, or 3 days prior to harvesting, and water and muck soil samples were collected at each irrigation treatment. Lettuce samples were collected at the end of the trials. The samples were tested for the presence of Campylobacter spp. and L. monocytogenes. Campylobacter coli was isolated from 33% of hog manure samples (n = 9) and from 11% of the contaminated water samples (n = 27), but no lettuce samples were positive (n = 288). L. monocytogenes was not found in manure, and only one sample of manure-contaminated irrigation water (n = 27) and one lettuce sample (n = 288) were positive. No Campylobacter or L. monocytogenes was recovered from the soil samples (n = 288). Because of the low incidence of pathogens, it was not possible to link the contamination of either soil or lettuce with the type of irrigation water. Nevertheless, experimental field trials mimicking real conditions provide new insights into the survival of two significant foodborne pathogens on romaine lettuce.

  19. Validation of a modification to Performance-Tested Method 010403: microwell DNA hybridization assay for detection of Listeria spp. in selected foods and selected environmental surfaces.

    Science.gov (United States)

    Alles, Susan; Peng, Linda X; Mozola, Mark A

    2009-01-01

    A modification to Performance-Tested Method 010403, GeneQuence Listeria Test (DNAH method), is described. The modified method uses a new media formulation, LESS enrichment broth, in single-step enrichment protocols for both foods and environmental sponge and swab samples. Food samples are enriched for 27-30 h at 30 degrees C, and environmental samples for 24-48 h at 30 degrees C. Implementation of these abbreviated enrichment procedures allows test results to be obtained on a next-day basis. In testing of 14 food types in internal comparative studies with inoculated samples, there were statistically significant differences in method performance between the DNAH method and reference culture procedures for only 2 foods (pasteurized crab meat and lettuce) at the 27 h enrichment time point and for only a single food (pasteurized crab meat) in one trial at the 30 h enrichment time point. Independent laboratory testing with 3 foods showed statistical equivalence between the methods for all foods, and results support the findings of the internal trials. Overall, considering both internal and independent laboratory trials, sensitivity of the DNAH method relative to the reference culture procedures was 90.5%. Results of testing 5 environmental surfaces inoculated with various strains of Listeria spp. showed that the DNAH method was more productive than the reference U.S. Department of Agriculture-Food Safety and Inspection Service (USDA-FSIS) culture procedure for 3 surfaces (stainless steel, plastic, and cast iron), whereas results were statistically equivalent to the reference method for the other 2 surfaces (ceramic tile and sealed concrete). An independent laboratory trial with ceramic tile inoculated with L. monocytogenes confirmed the effectiveness of the DNAH method at the 24 h time point. Overall, sensitivity of the DNAH method at 24 h relative to that of the USDA-FSIS method was 152%. The DNAH method exhibited extremely high specificity, with only 1% false

  20. Prevalence and antimicrobial resistance of Listeria, Salmonella, and Yersinia species isolates in ducks and geese.

    Science.gov (United States)

    Jamali, Hossein; Radmehr, Behrad; Ismail, Salmah

    2014-04-01

    The aims of this study were to determine the prevalence and antimicrobial resistance of Listeria, Salmonella, and Yersinia spp. isolated from duck and goose intestinal contents. A total of 471 samples, including 291 duck and 180 goose intestinal contents, were purchased from wet markets between November 2008 and July 2010. Listeria, Salmonella, and Yersinia spp. were isolated from 58 (12.3%), 107 (22.7%), and 80 (17%) of the samples, respectively. It was concluded that Listeria ivanovii, Salmonella Thompson, and Yersinia enterocolitica were the predominant serovars among Listeria, Salmonella, and Yersinia spp., respectively. Moreover, resistance to tetracycline was common in Listeria (48.3%) and Salmonella spp. (63.6%), whereas 51.3% of the Yersinia spp. isolates were resistant to cephalothin. Therefore, continued surveillance of the prevalence of the pathogens and also of emerging antibiotic resistance is needed to render possible the recognition of foods that may represent risks and also ensure the effective treatment of listeriosis, salmonellosis, and yersiniosis.

  1. Free-Living Species of Carnivorous Mammals in Poland: Red Fox, Beech Marten, and Raccoon as a Potential Reservoir of Salmonella, Yersinia, Listeria spp. and Coagulase-Positive Staphylococcus.

    Science.gov (United States)

    Nowakiewicz, Aneta; Zięba, Przemysław; Ziółkowska, Grażyna; Gnat, Sebastian; Muszyńska, Marta; Tomczuk, Krzysztof; Majer Dziedzic, Barbara; Ulbrych, Łukasz; Trościańczyk, Aleksandra

    2016-01-01

    The objective of the study was to examine a population of free-living carnivorous mammals most commonly found in Poland (red fox, beech marten, and raccoon) for the occurrence of bacteria that are potentially pathogenic for humans and other animal species and to determine their virulence potential (the presence of selected virulence genes). From the total pool of isolates obtained (n = 328), we selected 90 belonging to species that pose the greatest potential threat to human health: Salmonella spp. (n = 19; 4.51%), Yersinia enterocolitica (n = 10; 2.37%), Listeria monocytogenes and L. ivanovii (n = 21), and Staphylococcus aureus (n = 40; 9.5%). The Salmonella spp. isolates represented three different subspecies; S. enterica subsp. enterica accounted for a significant proportion (15/19), and most of the serotypes isolated (S. Typhimurium, S. Infantis, S. Newport and S. Enteritidis) were among the 10 non-typhoidal Salmonella serotypes that are most often responsible for infections in Europe, including Poland. Y. enterococlitica was detected in the smallest percentage of animals, but 60% of strains among the isolates tested possessed the ail gene, which is responsible for attachment and invasion. Potentially pathogenic Listeria species were isolated from approx. 5% of the animals. The presence of all tested virulence genes was shown in 35% of L. monocytogenes strains, while in the case of the other strains, the genes occurred in varying numbers and configurations. The presence of the inlA, inlC, hlyA, and iap genes was noted in all strains, whereas the genes encoding PI-PLC, actin, and internalin Imo2821 were present in varying percentages (from 80% to 55%). S. aureus was obtained from 40 individuals. Most isolates possessed the hla, hld (95% for each), and hlb (32.5%) genes encoding hemolysins as well as the gene encoding leukotoxin lukED (70%). In a similar percentage of strains (77.5%), the presence of at least one gene encoding enterotoxin was found, with 12

  2. Free-Living Species of Carnivorous Mammals in Poland: Red Fox, Beech Marten, and Raccoon as a Potential Reservoir of Salmonella, Yersinia, Listeria spp. and Coagulase-Positive Staphylococcus.

    Directory of Open Access Journals (Sweden)

    Aneta Nowakiewicz

    Full Text Available The objective of the study was to examine a population of free-living carnivorous mammals most commonly found in Poland (red fox, beech marten, and raccoon for the occurrence of bacteria that are potentially pathogenic for humans and other animal species and to determine their virulence potential (the presence of selected virulence genes. From the total pool of isolates obtained (n = 328, we selected 90 belonging to species that pose the greatest potential threat to human health: Salmonella spp. (n = 19; 4.51%, Yersinia enterocolitica (n = 10; 2.37%, Listeria monocytogenes and L. ivanovii (n = 21, and Staphylococcus aureus (n = 40; 9.5%. The Salmonella spp. isolates represented three different subspecies; S. enterica subsp. enterica accounted for a significant proportion (15/19, and most of the serotypes isolated (S. Typhimurium, S. Infantis, S. Newport and S. Enteritidis were among the 10 non-typhoidal Salmonella serotypes that are most often responsible for infections in Europe, including Poland. Y. enterococlitica was detected in the smallest percentage of animals, but 60% of strains among the isolates tested possessed the ail gene, which is responsible for attachment and invasion. Potentially pathogenic Listeria species were isolated from approx. 5% of the animals. The presence of all tested virulence genes was shown in 35% of L. monocytogenes strains, while in the case of the other strains, the genes occurred in varying numbers and configurations. The presence of the inlA, inlC, hlyA, and iap genes was noted in all strains, whereas the genes encoding PI-PLC, actin, and internalin Imo2821 were present in varying percentages (from 80% to 55%. S. aureus was obtained from 40 individuals. Most isolates possessed the hla, hld (95% for each, and hlb (32.5% genes encoding hemolysins as well as the gene encoding leukotoxin lukED (70%. In a similar percentage of strains (77.5%, the presence of at least one gene encoding enterotoxin was found, with 12

  3. Occurrence of Listeria spp. in retail meat and dairy products in the area of Addis Ababa, Ethiopia

    DEFF Research Database (Denmark)

    Derra, F. A.; Karlsmose, Susanne; Monga, D. P.

    2013-01-01

    L. monocytogenes isolates showed low occurrence of antimicrobial resistance among eight different PFGE types. Discussion and Conclusions. The findings in this study correspond to similar research undertaken in Ethiopia by detecting L. monocytogenes with similar prevalence rates. Public education......Background. Listeriosis, a bacterial disease in humans and animals, is mostly caused by ingestion of Listeria monocytogenes via contaminated food and/or water, or by a zoonotic infection. Globally, listeriosis has in general a low incidence but a high case fatality rate. Objective. The objective...... of this study was to investigate the occurrence, antimicrobial profiles, and genetic relatedness of L. monocytogenes from raw meat and dairy products (raw milk, cottage cheese, cream cake), collected from the capital and five neighboring towns in Ethiopia. Methods. Two hundred forty food samples were purchased...

  4. Evaluation of the efficacy of commercial sanitizers against adhered and planktonic cells of Listeria monocytogenes and Salmonella spp.

    Directory of Open Access Journals (Sweden)

    Julia Carballo

    2012-09-01

    Full Text Available Antimicrobial activities of two commercial disinfectants, alone or combined with heat, against three Salmonella strains and three Listeria monocytogenes strains were studied. The efficacy of disinfectants against planktonic bacteria and bacteria attached to three food contact industrial surfaces (stainless steel, polytetraflourethylene, and rubber was investigated. The tests were conducted using the sanitizer (quaternary ammonium compounds, and alquyldiethylenediamineglycine and di-alquyldiamineethylglycine concentrations recommended by the manufacturers, and concentrations twice and four times higher than those values. The recommended concentrations were not effective to kill bacteria, especially when they were attached to surfaces. Concentrations of disinfectants twice and four times higher than those recommended were needed to fully eliminate planktonic bacteria. These same sanitizer concentrations were not sufficient to remove attached bacteria. To remove them from the surfaces, a treatment with recommended concentrations in combination with heat was needed. Our results indicate that these two pathogenic bacteria could survive common sanitation programs used in the food industry.

  5. The antimicrobial efficacy and structure activity relationship of novel carbohydrate fatty acid derivatives against Listeria spp. and food spoilage microorganisms.

    Science.gov (United States)

    Nobmann, Patricia; Smith, Aoife; Dunne, Julie; Henehan, Gary; Bourke, Paula

    2009-01-15

    Novel mono-substituted carbohydrate fatty acid (CFA) esters and ethers were investigated for their antibacterial activity against a range of pathogenic and spoilage bacteria focussing on Listeria monocytogenes. Carbohydrate derivatives with structural differences enable comparative studies on the structure/activity relationship for antimicrobial efficacy and mechanism of action. The antimicrobial efficacy of the synthesized compounds was compared with commercially available compounds such as monolaurin and monocaprylin, as well as the pure free fatty acids, lauric acid and caprylic acid, which have proven antimicrobial activity. Compound efficacy was compared using an absorbance based broth microdilution assay to determine the minimum inhibitory concentration (MIC), increase in lag phase and decrease in maximum growth rate. Among the carbohydrate derivatives synthesized, lauric ether of methyl alpha-d-glucopyranoside and lauric ester of methyl alpha-d-mannopyranoside showed the highest growth-inhibitory effect with MIC values of 0.04 mM, comparable to monolaurin. CFA derivatives were generally more active against Gram positive bacteria than Gram negative bacteria. The analysis of both ester and ether fatty acid derivatives of the same carbohydrate, in tandem with alpha and beta configuration of the carbohydrate moiety suggest that the carbohydrate moiety is involved in the antimicrobial activity of the fatty acid derivatives and that the nature of the bond also has a significant effect on efficacy, which requires further investigation. This class of CFA derivatives has great potential for developing antibacterial agents relevant to the food industry, particularly for control of Listeria or other Gram-positive pathogens.

  6. Isolation and pulsed-field gel electrophoresis typing of Listeria monocytogenes from modified atmosphere packaged fresh-cut vegetables collected in Ireland.

    Science.gov (United States)

    Francis, Gillian A; O'Beirne, David

    2006-10-01

    The incidence of Listeria monocytogenes in modified atmosphere packaged fresh-cut fruits and vegetables from chill cabinets of a supermarket in Ireland was investigated over a 2-year period. Overall, 9.58% of fresh-cut produce was contaminated with Listeria spp. Various species of Listeria were isolated from samples, including L. monocytogenes, L. seeligeri, L. innocua, L. welshimeri, and L. ivanovii. No fruit samples contained detectable L. monocytogenes. Overall, a total of 21 L. monocytogenes isolates (2.9% of samples) were recovered from a range of products, including dry coleslaw mix (80% shredded cabbage and 20% shredded carrot), bean sprouts, and leafy vegetables such iceberg, romaine, and radicchio lettuce and mixed salad leaves (curly endive, escarole, and radicchio leaves). Dry coleslaw mix appeared to have the highest incidence of Listeria contamination (20%) compared with other products. Listeria contamination was more frequent (P modified atmosphere can support growth of numerous species of Listeria, including L. monocytogenes.

  7. Prevalence of Listeria species in camel sausages from retail markets in Aydin province in Turkey and RAPD analysis of Listeria monocytogenes isolates

    OpenAIRE

    Ozbey, Gokben; Ertas, Hasan Basri; Kok, Filiz

    2006-01-01

    Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%), Listeria innocua from 14 samples (14%) and Listeria welshimeri from two samples(2%). A 701 bp fragment of listeriolysi...

  8. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Science.gov (United States)

    Morton, Josephine; Karoonuthaisiri, Nitsara; Charlermroj, Ratthaphol; Stewart, Linda D; Elliott, Christopher T; Grant, Irene R

    2013-01-01

    The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni). Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  9. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Directory of Open Access Journals (Sweden)

    Josephine Morton

    Full Text Available The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni. Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  10. Examination of equine glandular stomach lesions for bacteria, including Helicobacter spp by fluorescence in situ hybridisation

    DEFF Research Database (Denmark)

    husted, Louise; Jensen, Tim Kåre; Olsen, Susanne N.

    2010-01-01

    Background: The equine glandular stomach is commonly affected by erosion and ulceration. The aim of this study was to assess whether bacteria, including Helicobacter, could be involved in the aetiology of gastric glandular lesions seen in horses. Results: Stomach lesions, as well as normal...... by cloning and sequencing. Mucosal lesions were found in 36/63 stomachs and included hyperplastic rugae, polypoid structures and focal erosions. None of the samples were tested positive for urease activity or for FISH using the Helicobacter genus specific probe. In samples of lesions, as well as normal...... faecium. The Enterococcus were found colonising the mucosal surface, while E. fergusonii organisms were also demonstrated intraepithelial. Conclusion: Gastric Helicobacter spp. could not be verified as being involved in lesions of the glandular stomach of the horse. Since E. fergusonii has been described...

  11. Non-Specific Reactions during Immunomagnetic Separation of Listeria

    Directory of Open Access Journals (Sweden)

    Iveta Zachová

    2005-01-01

    Full Text Available Problems occurring during the immunomagnetic separation (IMS of Listeria using immunomagnetic particles Dynabeads® anti-Listeria (Dynal Biotech, Norway were specified. Characteristics of these particles were compared with anti-Listeria spp. magnetite particles (Quantum Magnetics, USA. Pure cultures of Listeria innocua, Arthrobacter spp., Bacillus subtilis, Citrobacter braakii, Escherichia coli, Enterobacter aerogenes, Enterobacter cloacae and Staphylococcus aureus were used to evaluate non-specific reactions during IMS. Gram-positive microorganisms, especially Staphylococcus aureus and Arthrobacter spp., were found to be responsible for non-specific reactions in most cases. The capacity of Dynabeads® anti-Listeria particles was determined to be about 10 % of the initial pure cultures of Listeria spp., after 10 min of incubation. Non-specific reactions during IMS of Listeria were examined on the artificially inoculated food samples in which Gram-positive bacteria showed the highest percentage of capture. Influence of washing in two buffers was also studied.

  12. Influence of probiotics, included in peanut butter, on the fate of selected Salmonella and Listeria strains under simulated gastrointestinal conditions.

    Science.gov (United States)

    Klu, Y A K; Chen, J

    2016-04-01

    This study observed the behaviour of probiotics and selected bacterial pathogens co-inoculated into peanut butter during gastrointestinal simulation. Peanut butter homogenates co-inoculated with Salmonella/Listeria strains (5 log CFU ml(-1) ) and lyophilized or cultured probiotics (9 log CFU ml(-1) ) were exposed to simulated gastrointestinal conditions for 24 h at 37°C. Sample pH, titratable acidity and pathogen populations were determined. Agar diffusion assay was performed to assess the inhibitory effect of probiotic culture supernatants with either natural (3·80 (Lactobacillus), 3·78 (Bifidobacteirum) and 5·17 (Streptococcus/Lactococcus)) or neutralized (6·0) pH. Antibacterial effect of crude bacteriocin extracts were also evaluated against the pathogens. After 24 h, samples with probiotics had lower pH and higher titratable acidity than those without probiotics. The presence of probiotics caused a significant reduction (P pH diminished their antibacterial activities. Crude bacteriocin extracts had a strain-specific inhibitory effect only towards Listeria monocytogenes. Probiotics in 'peanut butter' survived simulated gastrointestinal conditions and inhibited the growth of Salmonella/Listeria. Peanut butter is a plausible carrier to deliver probiotics to improve the gastrointestinal health of children in developing countries. © 2016 The Society for Applied Microbiology.

  13. Adherence characteristics of Listeria strains isolated from three ready-to-eat meat processing plants.

    Science.gov (United States)

    Kushwaha, Kalpana; Muriana, Peter M

    2009-10-01

    Over 1,560 non-food contact surface swabs and raw meat ingredient samples were collected from three ready-to-eat meat processing plants (520 from each plant) from 1998 to 1999, resulting in the recovery of 259 isolates of Listeria obtained from postprocess areas including drains, floors, garbage bins, cart wheels, walls, equipment surfaces, tables, brooms, pallet jacks, hoses, ladders, and waste chutes. We further examined 246 of the 259 isolates for adherence phenotype and used PCR to identify those that were Listeria monocytogenes. Adherence was classified as weak, moderate, or strong depending on results obtained with all Listeria isolates by using a fluorescent microplate adherence assay. Among the 246 isolates, there were 61 weakly, 148 moderately, and 37 strongly adherent Listeria, of which 130 (53%) were found to be L. monocytogenes. Plants A and B provided similar recoveries of 39 (7.5%) and 43 (8.3%) Listeria-positive isolates, including 9 (23.1% of Listeria) and 41 (95.3% of Listeria) identified as L. monocytogenes, respectively, that were weakly or moderately adherent. In plant C, we recovered 164 Listeria-positive samples (31.5% isolation rate), which included 80 L. monocytogenes-positive samples (49.8% of Listeria spp.), 52 of which were moderately adherent, as well as all 9 strongly adherent isolates of L. monocytogenes obtained in this study. Adherence properties of Listeria may allow persistence and recurrence in plant environments, potentially increasing the chance of eventual product contamination, and this emphasizes the need for sanitary approaches to prevent colonization by Listeria as well as product antimicrobial interventions should the sanitation barrier be breached.

  14. Protective effect of Carnobacterium spp. against Listeria monocytogenes during host cell invasion using in vitro HT29 model

    Directory of Open Access Journals (Sweden)

    Tereza Pilchova

    2016-08-01

    Full Text Available The pathogenesis of listeriosis results mainly from the ability of Listeria monocytogenes to attach, invade, replicate and survive within various cell types in mammalian tissues. In this work, the effect of two bacteriocin-producing Carnobacterium (C. divergens V41 and C. maltaromaticum V1 and three non-bacteriocinogenic strains: (C. divergens V41C9, C. divergens 2763 and C. maltaromaticum 2762 was investigated on the reduction of L. monocytogenes Scott A plaque-forming during human infection using the HT-29 in vitro model. All Carnobacteria tested resulted in a reduction in the epithelial cell invasion caused by L. monocytogenes Scott A. To understand better the mechanism underlying the level of L. monocytogenes infection inhibition by Carnobacteria, infection assays from various pretreatments of Carnobacteria were assessed. The results revealed the influence of bacteriocin production combined with a passive mechanism of mammalian cell monolayers protection by Carnobacteria. These initial results showing a reduction in L. monocytogenes virulence on epithelial cells by Carnobacteria would be worthwhile analyzing further as a promising probiotic tool for human health.

  15. Identification of six Listeria species by real-time PCR assay.

    Science.gov (United States)

    Hage, E; Mpamugo, O; Ohai, C; Sapkota, S; Swift, C; Wooldridge, D; Amar, C F L

    2014-06-01

    The Listeria genus comprises 10 recognized species. Listeria monocytogenes causes listeriosis in humans and other animals primarily via contaminated food or animal feed. Listeria ivanovii causes listeriosis in animals and on rare occasions in humans. The identification of nonpathogenic species of Listeria in foods indicates that conditions exist that support the growth of pathogenic strains and is used to facilitate the implementation of control and prevention measures. This study shows the development and evaluation of a 5'exonuclease real-time PCR assay for the rapid identification of Listeria seeligeri, Listeria welshimeri, L. monocytogenes, L. ivanovii, Listeria grayi and Listeria innocua. The assay consists of two triplexes that were evaluated using 53 cultures of Gram-positive bacteria, including 49 Listeria spp. from human, animal, food or food-processing environments. The assay was rapid, specific and reproducible and could identify each of the six species from a mixture of strains. The developed assay proved to be a powerful means of rapidly identifying Listeria species and could be usefully implemented in busy specialist reference laboratories. The identification of species of Listeria from foods is important to monitor pathogenic strains and facilitates the implementation of control measures. This study shows the development and evaluation of a 5'exonuclease real-time PCR assay for the rapid identification of L. seeligeri, L. welshimeri, L. monocytogenes and L. ivanovii, L. grayi, L. innocua. The developed assay proved to be specific, rapid and reproducible and therefore could be implemented in busy specialist reference laboratories. © 2014 The Society for Applied Microbiology.

  16. Prevalence of Listeria monocytogenes and other Listeria species in butter from United Kingdom production, retail, and catering premises.

    Science.gov (United States)

    Lewis, H C; Little, C L; Elson, R; Greenwood, M; Grant, K A; McLauchlin, J

    2006-07-01

    Two recent listeriosis outbreaks involving butter prompted this first cross-sectional study on the prevalence, levels, and types of Listeria species in 3229 samples of butter from production, retail, and catering premises in the United Kingdom during May and June 2004. When the criteria of the Microbiological Guidelines were used, 99.4% of samples were found to be of satisfactory microbiological quality, 0.5% were of acceptable quality, and 0.1% were of unsatisfactory quality as a result of high levels (>100 CFU/g) of Listeria spp. The butter samples with Listeria spp. present at more than 100 CFU/g were negative for L. monocytogenes. L. monocytogenes was detected in 0.4% (n=13) of samples, all at levels of less than 10 CFU/g, and were therefore of acceptable quality. Butter was contaminated more frequently with Listeria spp., including L. monocytogenes, when packed in plastic tubs, when in pack sizes of 500 g or less, when stored or displayed above 8 degrees C, when a hazard analysis system was not in place, and when the manager had received no food hygiene training. This study demonstrates that although butter is regarded as a low-risk product, it may provide an environment for the persistence and growth of Listeria spp., including L. monocytogenes. The control of L. monocytogenes in food processing and supply systems is critical in order to minimize the potential for this bacterium to be present in foods at the point of consumption at levels hazardous to health.

  17. A population genetics-based and phylogenetic approach to understanding the evolution of virulence in the genus Listeria.

    Science.gov (United States)

    den Bakker, Henk C; Bundrant, Brittany N; Fortes, Esther D; Orsi, Renato H; Wiedmann, Martin

    2010-09-01

    The genus Listeria includes (i) the opportunistic pathogens L. monocytogenes and L. ivanovii, (ii) the saprotrophs L. innocua, L. marthii, and L. welshimeri, and (iii) L. seeligeri, an apparent saprotroph that nevertheless typically contains the prfA virulence gene cluster. A novel 10-loci multilocus sequence typing scheme was developed and used to characterize 67 isolates representing six Listeria spp. (excluding L. grayi) in order to (i) provide an improved understanding of the phylogeny and evolution of the genus Listeria and (ii) use Listeria as a model to study the evolution of pathogenicity in opportunistic environmental pathogens. Phylogenetic analyses identified six well-supported Listeria species that group into two main subdivisions, with each subdivision containing strains with and without the prfA virulence gene cluster. Stochastic character mapping and phylogenetic analysis of hly, a gene in the prfA cluster, suggest that the common ancestor of the genus Listeria contained the prfA virulence gene cluster and that this cluster was lost at least five times during the evolution of Listeria, yielding multiple distinct saprotrophic clades. L. welshimeri, which appears to represent the most ancient clade that arose from an ancestor with a prfA cluster deletion, shows a considerably lower average sequence divergence than other Listeria species, suggesting a population bottleneck and a putatively different ecology than other saprotrophic Listeria species. Overall, our data suggest that, for some pathogens, loss of virulence genes may represent a selective advantage, possibly by facilitating adaptation to a specific ecological niche.

  18. Examination of equine glandular stomach lesions for bacteria, including Helicobacter spp by fluorescence in situ hybridisation

    Directory of Open Access Journals (Sweden)

    Olsen Susanne N

    2010-03-01

    Full Text Available Abstract Background The equine glandular stomach is commonly affected by erosion and ulceration. The aim of this study was to assess whether bacteria, including Helicobacter, could be involved in the aetiology of gastric glandular lesions seen in horses. Results Stomach lesions, as well as normal appearing mucosa were obtained from horses slaughtered for human consumption. All samples were tested for urease activity using the Pyloritek® assay, while mucosal bacterial content was evaluated using Fluorescence In Situ Hybridisation. In selected sub samples, bacteria characterisation was pursued further by cloning and sequencing. Mucosal lesions were found in 36/63 stomachs and included hyperplastic rugae, polypoid structures and focal erosions. None of the samples were tested positive for urease activity or for FISH using the Helicobacter genus specific probe. In samples of lesions, as well as normal samples, clones with 99% similarities to Lactobacillus salivarius and Sarcina ventriculi were found. Escherichia like bacterium clones and Enterococcus clones were demonstrated in one focal erosion. Based on a phylogenetic tree these clones had 100% similarity to Escherichia fergusonii and Enterococcus faecium. The Enterococcus were found colonising the mucosal surface, while E. fergusonii organisms were also demonstrated intraepithelial. Conclusion Gastric Helicobacter spp. could not be verified as being involved in lesions of the glandular stomach of the horse. Since E. fergusonii has been described as an emerging pathogen in both humans and animals, the finding of this bacterium in gastric erosion warrants further clarification to whether gastric infection with this type bacterium is important for horses.

  19. Geographical and meteorological factors associated with isolation of Listeria species in New York State produce production and natural environments.

    Science.gov (United States)

    Chapin, Travis K; Nightingale, Kendra K; Worobo, Randy W; Wiedmann, Martin; Strawn, Laura K

    2014-11-01

    Listeria species have been isolated from diverse environments, often at considerable prevalence, and are known to persist in food processing facilities. The presence of Listeria spp. has been suggested to be a marker for Listeria monocytogenes contamination. Therefore, a study was conducted to (i) determine the prevalence and diversity of Listeria spp. in produce production and natural environments and (ii) identify geographical and/or meteorological factors that affect the isolation of Listeria spp. in these environments. These data were also used to evaluate Listeria spp. as index organisms for L. monocytogenes in produce production environments. Environmental samples collected from produce production (n = 588) and natural (n = 734) environments in New York State were microbiologically analyzed to detect and isolate Listeria spp. The prevalence of Listeria spp. was approximately 33 and 34% for samples obtained from natural environments and produce production, respectively. Co-isolation of L. monocytogenes and at least one other species of Listeria in a given sample was recorded for 3 and 9% of samples from natural environments and produce production, respectively. Soil moisture and proximity to water and pastures were highly associated with isolation of Listeria spp. in produce production environments, while elevation, study site, and proximity to pastures were highly associated with isolation of Listeria spp. in natural environments, as determined by randomForest models. These data show that Listeria spp. were prevalent in both agricultural and nonagricultural environments and that geographical and meteorological factors associated with isolation of Listeria spp. were considerably different between the two environments.

  20. Fructose 1,6-Bisphosphate Aldolase, a Novel Immunogenic Surface Protein on Listeria Species.

    Science.gov (United States)

    Mendonça, Marcelo; Moreira, Gustavo Marçal Schmidt Garcia; Conceição, Fabricio Rochedo; Hust, Michael; Mendonça, Karla Sequeira; Moreira, Ângela Nunes; França, Rodrigo Correa; da Silva, Wladimir Padilha; Bhunia, Arun K; Aleixo, José Antonio G

    2016-01-01

    Listeria monocytogenes is a ubiquitous food-borne pathogen, and its presence in food or production facilities highlights the importance of surveillance. Increased understanding of the surface exposed antigens on Listeria would provide potential diagnostic and therapeutic targets. In the present work, using mass spectrometry and genetic cloning, we show that fructose-1,6-bisphosphate aldolase (FBA) class II in Listeria species is the antigen target of the previously described mAb-3F8. Western and dot blot assays confirmed that the mAb-3F8 could distinguish all tested Listeria species from close-related bacteria. Localization studies indicated that FBA is present in every fraction of Listeria cells, including supernatant and the cell wall, setting Listeria spp. as one of the few bacteria described to have this protein on their cell surface. Epitope mapping using ORFeome display and a peptide membrane revealed a 14-amino acid peptide as the potential mAb-3F8 epitope. The target epitope in FBA allowed distinguishing Listeria spp. from closely-related bacteria, and was identified as part of the active site in the dimeric enzyme. However, its function in cell surface seems not to be host cell adhesion-related. Western and dot blot assays further demonstrated that mAb-3F8 together with anti-InlA mAb-2D12 could differentiate pathogenic from non-pathogenic Listeria isolated from artificially contaminated cheese. In summary, we report FBA as a novel immunogenic surface target useful for the detection of Listeria genus.

  1. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed.

    Science.gov (United States)

    Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth

    2015-06-01

    Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. 4610 Volume 11 No. 2 March 2011 OCCURRENCE OF LISTERIA ...

    African Journals Online (AJOL)

    user

    2011-03-02

    Mar 2, 2011 ... were detected in 60% of bulked raw milk, 30% of LPY and 15% of Bongo samples. Bulked raw milk had significantly ... monocytogenes and other Listeria spp. in raw milk and dairy products, few studies have been conducted in Uganda ... Standards for microbiological analysis. Levels of Listeria spp. and L.

  3. Irrigation Is Significantly Associated with an Increased Prevalence of Listeria monocytogenes in Produce Production Environments in New York State.

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

    2015-06-01

    Environmental (i.e., meteorological and landscape) factors and management practices can affect the prevalence of foodborne pathogens in produce production environments. This study was conducted to determine the prevalence of Listeria monocytogenes, Listeria species (including L. monocytogenes), Salmonella, and Shiga toxin-producing Escherichia coli (STEC) in produce production environments and to identify environmental factors and management practices associated with their isolation. Ten produce farms in New York State were sampled during a 6-week period in 2010, and 124 georeferenced samples (80 terrestrial, 33 water, and 11 fecal) were collected. L. monocytogenes, Listeria spp., Salmonella, and STEC were detected in 16, 44, 4, and 5% of terrestrial samples, 30, 58, 12, and 3% of water samples, and 45, 45, 27, and 9% of fecal samples, respectively. Environmental factors and management practices were evaluated for their association with terrestrial samples positive for L. monocytogenes or other Listeria species by univariate logistic regression; analysis was not conducted for Salmonella or STEC because the number of samples positive for these pathogens was low. Although univariate analysis identified associations between isolation of L. monocytogenes or Listeria spp. from terrestrial samples and various water-related factors (e.g., proximity to wetlands and precipitation), multivariate analysis revealed that only irrigation within 3 days of sample collection was significantly associated with isolation of L. monocytogenes (odds ratio = 39) and Listeria spp. (odds ratio = 5) from terrestrial samples. These findings suggest that intervention at the irrigation level may reduce the risk of produce contamination.

  4. In vitro bactericidal activity of aminoglycosides, including the next-generation drug plazomicin, against Brucella spp.

    Science.gov (United States)

    Plazomicin is a next-generation aminoglycoside with a potentially improved safety profile compared to other aminoglycosides. This study assessed plazomicin MICs and MBCs in four Brucella spp. reference strains. Like other aminoglycosides and aminocyclitols, plazomicin MBC values equaled MIC values ...

  5. Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets.

    Science.gov (United States)

    Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh

    2015-07-25

    The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.

  6. Evaluation of a cross contamination model describing transfer of Salmonella spp. and Listeria monocytogenes during grinding of pork and beef

    DEFF Research Database (Denmark)

    Møller, Cleide Oliveira de Almeida; Sant'Ana, A.S.; Hansen, Solvej Katrine Holm

    2016-01-01

    A cross contamination model was challenged and evaluated applying a new approach.•QMRA and Total Transfer Potential (TTP) were included.•Transfer estimates were not applicable for unlike processing.•The risk of disease may be reduced when using a stainless steel grinder.•Well-sharpened knife...

  7. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI

    2015-01-01

    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  8. Listeria Occurrence in Poultry Flocks: Detection and Potential Implications

    Directory of Open Access Journals (Sweden)

    Michael J. Rothrock

    2017-08-01

    Full Text Available Foodborne pathogens such as Salmonella, Campylobacter, Escherichia coli, and Listeria are a major concern within the food industry due to their pathogenic potential to cause infection. Of these, Listeria monocytogenes, possesses a high mortality rate (approximately 20% and is considered one of the most dangerous foodborne pathogens. Although the usual reservoirs for Listeria transmission have been extensively studied, little is known about the relationship between Listeria and live poultry production. Sporadic and isolated cases of listeriosis have been attributed to poultry production and Listeria spp. have been isolated from all stages of poultry production and processing. Farm studies suggest that live birds may be an important vector and contributor to contamination of the processing environment and transmission of Listeria to consumers. Therefore, the purpose of this review is to highlight the occurrence, incidence, and potential systemic interactions of Listeria spp. with poultry.

  9. LISTERIA SPP., COLIFORMES TOTAIS E FECAIS E E.COLI NO LEITE CRU E PASTEURIZADO DE UMA INDÚSTRIA DE LATICÍNIOS, NO ESTADO DA PARAÍBA (BRASIL

    Directory of Open Access Journals (Sweden)

    CATÃO Raïssa Mayer Ramalho

    2001-01-01

    Full Text Available Investigou-se a qualidade microbiológica do leite in natura e na linha de produção (leite recém-pasteurizado e leite ensacado, de uma usina de beneficiamento em Campina Grande-PB. Foi pesquisada a presença de Listeria spp. e sua diversidade de espécies, os níveis de coliformes totais (CT, coliformes fecais (CF e Escherichia coli. Analisou-se um total de 75 amostras de leite, sendo 45 de leite cru, 15 de leite recém-pasteurizado e 15 de leite ensacado. Os resultados foram reunidos em dois grupos segundo o período de monitoramento: antes e após mudanças no processo de higienização da usina. Foi evidenciada elevada contaminação nas amostras de leite cru nas duas épocas. Na primeira (março-abril/1998, todas as amostras de leite beneficiado estiveram fora dos padrões da legislação vigente para CT e CF; na segunda (maio-agosto/1998, houve acentuada redução dos níveis destas bactérias indicadoras, porém as melhorias na higienização não foram suficientes para solucionar este problema, visto que 11,1% das amostras recém-pasteurizadas estavam fora dos padrões para CT e 33,3% para CF. Das amostras ensacadas, 22,2% estavam fora dos padrões para CT e 44,4% para CF. Comparando-se os resultados de CT, CF, e E.coli nas amostras de leite recém-pasteurizado e não ensacado com as amostras de leite ensacado, foi verificado que as amostras após serem pasteurizadas e ensacadas apresentaram valores de CT e CF levemente mais elevados, sugerindo contaminação durante o processo de ensacamento ou falhas na armazenagem. Observou-se que 33 (73,3% das amostras de leite cru e 9 (30% das de leite pasteurizado estavam contaminadas com Listeria spp., sendo identificadas L. monocytogenes em 17 (51,5% amostras de leite cru e em 9 (100% de leite beneficiado (4 recém-pasteurizadas e 5 ensacadas. Em relação à diversidade de espécies, nas amostras de leite cru foram encontradas: L. monocytogenes (66,6%, L. innocua (25,3%, L. ivanovii (3,9%, L

  10. Survival of Vibrio spp. including inoculated V. cholerae 0139 during heat-treatment of cockles (Anadara granosa).

    Science.gov (United States)

    Liew, W S; Leisner, J J; Rusul, G; Radu, S; Rassip, A

    1998-07-21

    The effect of heat-treatment on the internal temperature of raw cockles (Anadara granosa) and survival of their intrinsic flora of Vibrio spp. as well as of inoculated V. cholerae 0139 was examined. The cockles were purchased from markets in Malaysia and had an average weight including shells of 8.90+/-2.45 g. In one experiment heatpenetration of individual cockles was examined. Cockles weighing 12 g exhibited maximum internal temperatures between 42 and 58 degrees C when heated in water at 99 degrees C for 10 s and 56-69 degrees C when heated for 30 s. In another experiment, heat-treatment of 10 cockles treated as a group at 99 degrees C for 10 or 30 s resulted in reduction of levels of intrinsic Vibrio spp. (enumerated directly on thiosulphate-citrate-bile salt sucrose agar; TCBS) from 5.73 to 3.15 log cfu g(-1) or below 1 log cfu g(-1), respectively. The levels of Vibrio spp. after heat-treatment decreased with an increase in numbers of cockles grouped together during treatment. In a third experiment V. cholerae 0139 was inoculated into cockles and subjected to heat-treatment at 99 degrees C for 0, 10, 15, 20, 25 or 30 s. The levels of Vibrio spp. in uninoculated, non-heat-treated cockles was 4.89 log cfu g(-1) on TCBS, and the predominant species were V. parahaemolyticus and V. alginolyticus. V. cholerae 0139 inoculated into cockles with an average weight of 13.5+/-1.90 g (including shell) decreased for samples examined immediately after heat-treatment from 6 log cfu g(-1) initially to 3.5 log cfu g(-1) after 25 s and < 1 log cfu g(-1) (TCBS) after 30 s of heat-treatment. The most probable number method by enrichment in alkaline peptone water gave in general within 1 log unit higher counts than TCBS direct enumeration. TCBS direct enumeration and MPN counts were up to 2.38 or 1.30 log units higher, respectively, for samples heat-treated for 20 s or longer and stored for 6 h at 30 degrees C before examination, than for samples heat-treated for same periods of

  11. Listeria species in retail smoked fish at Jos, Nigeria | Chukwu ...

    African Journals Online (AJOL)

    The prevalence of Listeria species in 65 samples of smoked fish at the retail markets in Jos, Nigeria, is reported. The experimental samples which included 30 catfish (Clarias species) and 35 Tilapia were screened for Listeria monocytogenes and other Listeria species using a two-step enrichment method. Total Listeria ...

  12. Antimicrobial resistance and virulence signatures of Listeria and Aeromonas species recovered from treated wastewater effluent and receiving surface water in Durban, South Africa.

    Science.gov (United States)

    Olaniran, Ademola O; Nzimande, Sphephile B T; Mkize, Ndumiso G

    2015-10-24

    Treated wastewater effluent has been found to contain high levels of contaminants, including disease-causing bacteria such as Listeria and Aeromonas species. The aim of this study was to evaluate the antimicrobial resistance and virulence signatures of Listeria and Aeromonas spp. recovered from treated effluents of two wastewater treatment plants and receiving rivers in Durban, South Africa. A total of 100 Aeromonas spp. and 78 Listeria spp. were positively identified based on biochemical tests and PCR detection of DNA region conserved in these genera. The antimicrobial resistance profiles of the isolates were determined using Kirby Bauer disc diffusion assay. The presence of important virulence genes were detected via PCR, while other virulence determinants; protease, gelatinase and haemolysin were detected using standard assays. Highest resistance was observed against penicillin, erythromycin and nalidixic acid, with all 78 (100%) tested Listeria spp displaying resistance, followed by ampicillin (83.33%), trimethoprim (67.95%), nitrofurantoin (64.10%) and cephalosporin (60.26%). Among Aeromonas spp., the highest resistance (100%) was observed against ampicillin, penicillin, vancomycin, clindamycin and fusidic acid, followed by cephalosporin (82%), and erythromycin (58%), with 56% of the isolates found to be resistant to naladixic acid and trimethoprim. Among Listeria spp., 26.92% were found to contain virulence genes, with 14.10, 5.12 and 21% harbouring the actA, plcA and iap genes, respectively. Of the 100 tested Aeromonas spp., 52% harboured the aerolysin (aer) virulence associated gene, while lipase (lip) virulence associated gene was also detected in 68% of the tested Aeromonas spp. The presence of these organisms in effluents samples following conventional wastewater treatment is worrisome as this could lead to major environmental and human health problems. This emphasizes the need for constant evaluation of the wastewater treatment effluents to ensure

  13. A multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in Korean ready-to-eat food.

    Science.gov (United States)

    Lee, Nari; Kwon, Kyung Yoon; Oh, Su Kyung; Chang, Hyun-Joo; Chun, Hyang Sook; Choi, Sung-Wook

    2014-07-01

    A multiplex polymerase chain reaction (PCR) assay was developed for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in various Korean ready-to-eat foods. The six specific primer pairs for multiplex PCR were selected based on the O157 antigen (rfbE) gene of E. coli O157:H7, the DNA gyrase subunit B (gyrB) gene of B. cereus, the toxin regulatory protein (toxR) gene of V. parahaemolyticus, the invasion protein A (invA) gene of Salmonella spp., the hemolysin (hly) gene of L. monocytogenes, and the thermonuclease (nuc) gene of S. aureus. The 16S rRNA gene was targeted as an internal control gene in the presence of bacterial DNA. The specificity and sensitivity assays for multiplex primer pairs were investigated by testing different strains. When this multiplex PCR assay was applied to evaluate the validity of detecting six foodborne pathogens in artificially inoculated several ready-to-eat food samples, the assay was able to specifically simultaneously detect as few as 1 colony-forming unit/mL of each pathogen after enrichment for 12 h. Their presence in naturally contaminated samples also indicates that the developed multiplex PCR assay is an effective and informative supplement for practical use.

  14. Influence of fatty acid precursors, including food preservatives, on the growth and fatty acid composition of Listeria monocytogenes at 37 and 10degreesC.

    Science.gov (United States)

    Julotok, Mudcharee; Singh, Atul K; Gatto, Craig; Wilkinson, Brian J

    2010-03-01

    Listeria monocytogenes is a food-borne pathogen that grows at refrigeration temperatures and increases its content of anteiso-C(15:0) fatty acid, which is believed to be a homeoviscous adaptation to ensure membrane fluidity, at these temperatures. As a possible novel approach for control of the growth of the organism, the influences of various fatty acid precursors, including branched-chain amino acids and branched- and straight-chain carboxylic acids, some of which are also well-established food preservatives, on the growth and fatty acid composition of the organism at 37 degrees C and 10 degrees C were studied in order to investigate whether the organism could be made to synthesize fatty acids that would result in impaired growth at low temperatures. The results indicate that the fatty acid composition of L. monocytogenes could be modulated by the feeding of branched-chain amino acid, C(4), C(5), and C(6) branched-chain carboxylic acid, and C(3) and C(4) straight-chain carboxylic acid fatty acid precursors, but the growth-inhibitory effects of several preservatives were independent of effects on fatty acid composition, which were minor in the case of preservatives metabolized via acetyl coenzyme A. The ability of a precursor to modify fatty acid composition was probably a reflection of the substrate specificities of the first enzyme, FabH, in the condensation of primers of fatty acid biosynthesis with malonyl acyl carrier protein.

  15. Occurrence of listeria monocytogenes in bulked raw milk and ...

    African Journals Online (AJOL)

    fermented dairy product sold at most informal milk cooling points in Uganda, were assessed for occurrence of Listeria spp. and Listeria monocytogenes. Total plate counts (TPC), holding temperature, pH and titratable acidity were also determined in all the milk products at the point of collection using standard methods.

  16. Examination of equine glandular stomach lesions for bacteria, including Helicobacter spp by fluorescence in situ hybridisation

    DEFF Research Database (Denmark)

    husted, Louise; Jensen, Tim Kåre; Olsen, Susanne N.

    2010-01-01

    by cloning and sequencing. Mucosal lesions were found in 36/63 stomachs and included hyperplastic rugae, polypoid structures and focal erosions. None of the samples were tested positive for urease activity or for FISH using the Helicobacter genus specific probe. In samples of lesions, as well as normal...

  17. Presence of Listeria species in fresh meats from retail markets in Serbia

    Directory of Open Access Journals (Sweden)

    Dimić Gordana R.

    2010-01-01

    Full Text Available Listeria spp. are Gram positive, short, non-sporing rods, microaerophilic. Of the six species currently recognized, Listeria monocytogenes is the most important as it causes a range of infections in humans and animals. The organism can be found in a wide variety of habitats including the soil, food processing environments and raw foods. The ability of the organism to grow at refrigeration temperatures is of major importance in food production. This study examines the presence of Listeria species in fresh meat. 29 samples (chicken, pork and beef meat. This bacteria was found in 82.7% of analyzed samples; 7 L. innocua, 8 L. monocytogenes and 9 L. welshimeri (of all isolates. L. innocua prevailed in pork meat (40%, L. monocytogenes in chicken and pork meat (30%, and L. welshimeri in beef meat (44.4%.

  18. Parapharyngodon n. spp. (Nematoda: Pharyngodonidae) parasites of hylid frogs from Mexico and review of species included in the genus.

    Science.gov (United States)

    Velarde-Aguilar, María G; Mata-López, Rosario; Guillén-Hernández, Sergio; León-Règagnon, Virginia

    2015-04-01

    Two new species of Parapharyngodon Chatterji, 1933 , parasitizing 3 species of hylid frogs (Diaglena spatulata, Triprion petasatus, and Trachycephalus typhonius) from Mexico are described. The 2 new species share the presence of a gubernaculum with Parapharyngodon lamothei and belong to the group of those species with short spicule; both differ from the remaining species of the genus in the papillar pattern on ventrolateral and dorsal lips and in the thickness of cuticular annulations and cuticular ornamentation in the female specimens. These are the third and fourth reports of Parapharyngodon spp. parasitizing hylid frogs. In addition to the egg characteristics, we propose that length of the lateral alae is also a taxonomically relevant feature to differentiate species of the genus. A bibliographic review of all species historically assigned to Parapharyngodon is given, including those that have been declared species inquirenda, or transferred to other genera and those that are considered valid.

  19. Listeria Infection (Listeriosis)

    Science.gov (United States)

    Listeria infection Overview Listeria infection is a foodborne bacterial illness that can be very serious for pregnant women and people with impaired immune systems. Listeria infection is most commonly contracted by eating improperly ...

  20. Survival and growth parameters of Escherichia Coli 0157:H7, Salmonella Spp. and Listeria Monocytogenes on fresh-cut pieces prepared from whole cantaloupe treated with Lovit sanitizer

    Science.gov (United States)

    Incidence of foodborne illness due to consumption of fresh-cut melons contaminated with human bacterial pathogens and recalls of such contaminated fresh-cut melons continues to be a food safety problem. Cantaloupe rind surfaces were inoculated with a three cocktail of E. coli O157:H7, Salmonella spp...

  1. The relationship between land management, fecal indicator bacteria, and the occurrence of Campylobacter and Listeria spp. in water and sediments during synoptic sampling in the S. Fork Broad River Watershed, N.E. Georgia, U.S.A

    Science.gov (United States)

    Bradshaw, J. K.; Molina, M.; Sidle, R. C.; Sullivan, K.; Oakley, B.; Berrang, M.; Meinersmann, R.

    2013-12-01

    Fecal indicator bacteria (FIB) and pathogens stored in the bed sediments of streams and rivers may be mobilized into the water column affecting overall water quality. Furthermore, land management may play an important role in the concentrations of FIB and the occurrence of pathogens in stream water and sediments. The purpose of this study was to determine the relationship between FIB and pathogens in stream water and sediment based on three land management-affected categories: agricultural, forest, and waters receiving treated municipal wastewater. Two synoptic sampling events were conducted under baseflow conditions (Campylobacter and Listeria spp. were measured in stream water and sediment samples collected at 15 locations (six agricultural (AG); six forested (FORS); and three receiving discharge from water pollution control plants (WPCP)) in the S. Fork Broad River watershed located in northeast Georgia, USA. Mean E. coli and E. faecalis concentrations were highest in the AG stream water samples (3.08 log MPN 100 mL -1 for E. coli and 3.07 log CFU 100 mL -1 for E. faecalis ) and lowest in the FORS water samples for E. coli (2.37 log MPN 100 mL -1 ) and WPCP water samples for E. faecalis (2.53 log CFU 100 mL -1 ). E. coli concentrations (2.74 log MPN 100 mL -1 ) in the WPCP streams were intermediate. Similar to water samples, E. coli concentrations were highest in the AG sediments (4.31 log MPN g -1 ), intermediate in the WPCP sediments (4.06 log MPN g -1 ), and lowest in the FORS sediments (3.46 log MPN g -1 ). In contrast to E. coli, E. faecalis concentrations were lower (1.10 to 1.31 log CFU g -1 ) and relatively more constant than E. coli in sediments over the three land management categories. Campylobacter was detected in 27% of the water samples and 8% of the sediment samples. The highest occurrence of Campylobacter detection was in the AG streams (15% of the water samples; 5% of the sediment samples). Listeria was detected in 76% of the water samples and

  2. The Antibiofilm Effect of Ginkgo biloba Extract Against Salmonella and Listeria Isolates from Poultry.

    Science.gov (United States)

    Wu, Yan; Park, Keun Cheol; Choi, Beom Geun; Park, Jin Hwa; Yoon, Ki Sun

    2016-05-01

    Salmonella spp. and Listeria spp. are common foodborne pathogens in poultry and have caused a large number of outbreaks worldwide. Biofilm formation is common in the food industry and is also a mechanism of antimicrobial resistance. The aim of this work was to investigate the antimicrobial effect and mechanism of Ginkgo biloba extract against the biofilm formation of Salmonella and Listeria isolates from poultry at retail markets. Bacteria detection, isolation, and enumeration were carried out on 27 chicken and 29 ducks at retail markets. The effects of temperature and G. biloba extract against biofilm formation of Salmonella and Listeria isolates were measured using the crystal violet assay and swimming and swarming motilities. The monitoring results of Salmonella and Listeria in 56 poultry carcasses at retail markets in Korea showed that the prevalence of Salmonella spp. in poultry was low (5.4%), but the prevalence of Listeria spp (78.6%) was high. L. innocua was the predominant serotype (80%) in the isolated Listeria species. Temperature, strain, and surface affected the biofilm formation of Salmonella spp. and Listeria spp. L. innocua showed the best biofilm formation ability on a 96-well plate, while Salmonella Enteritidis formed the most biofilm on a glass slide. Biofilm formation abilities of Salmonella spp. and Listeria spp. were increased with the increase of temperature. G. biloba extract at 75 μg/mL significantly inhibited biofilm formation of Salmonella spp. and Listeria spp (p Listeria, but not L. monocytogenes. The findings of this study provided the basis for the application of G. biloba extract as a food additive to promote the quality and safety of poultry products.

  3. Contamination of cooked peeled shrimp (Pandalus borealis) by Listeria monocytogenes during processing at two processing plants.

    Science.gov (United States)

    Gudmundsdóttir, Sigrún; Gudbjörnsdóttir, Birna; Einarsson, Hjörleifur; Kristinsson, Karl G; Kristjansson, Már

    2006-06-01

    Listeria spp. and Listeria monocytogenes contamination was evaluated in cooked peeled shrimp (final or semifinal product, 82 samples) and the shrimp-processing environment (two plants, 613 samples) in eight surveys conducted from 1998 through 2001. Listeria was detected in 12.5% (78) of the 695 samples (11.2% of the samples were positive for L. monocytogenes), but none of the samples of final product contained Listeria. One hundred seventy-two L. monocytogenes isolates were characterized by pulsed-field gel electrophoresis. Cleavage with macrorestriction enzymes AscI and ApaI yielded 14 different pulsotypes in the plants; two types were dominant, one in each plant. Sixty-three of the 106 isolates in plant A and 43 of the 66 isolates in plant B were of the dominant types. Certain strains, mainly of serotypes 1/2c and 4b and pulsotypes 1A and 2H, were persistent for long periods in both plants. Adaptation of good hygienic practices in the processing plants, including strict rules concerning traffic of staff and equipment, and existing hygienic requirements appeared to be effective in preventing contamination between areas within plants and in the final product. The persistence of Listeria strains in these two processing plants indicates the importance of detecting the places in the processing environment (e.g., transporters, equipment, floors, and drains) where L. monocytogenes can survive so that cleaning and disinfection efforts can be directed to such niches.

  4. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria innocua over Listeria monocytogenes

    OpenAIRE

    Locatelli, Aude; Lewis, Micah A.; Rothrock, Michael J.

    2017-01-01

    The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments...

  5. Sequence Variation in the Ribosomal Internal Transcribed Spacers, Including the 5.8S rDNA, of Naegleria spp.

    Science.gov (United States)

    De Jonckheere, J F

    1998-09-01

    The ribosomal internal transcribed spacer (ITS), including the 5.8S rDNA, from the majority of the 11 described species of the amoeboflagellate Naegleria and from Willaertia magna have a size between 300 and 450 bp. In N. jadini and N. minor these products are approximately 750 bp long. The products from strains of the pathogenic N. fowleri vary between 323 and 423 bp. These length variations in N. fowleri are due to insertions of short repeats in the ITS1, causing the elongation of one stem-loop in the putative secondary structure. In all other species the sizes were identical from strains of the same species. In N. jadini and N. minor there are long inserts in the ITS2. Naegleria italica, N. clarki and N. galeacystis have shorter inserts in the ITS2. These inserts cause the elongation of one stem-loop in the putative secondary structure proposed for the ITS2. Because of the small differences in sequence between N. fowleri and N. lovaniensis the ITS does not provide target sequences for specifically identifying the pathogenic N. fowleri. However, differences in ITS1 do allow to distinguish different N. fowleri isolates. The ITS and 5.8S rDNA sequences will be of additional help in describing new Naegleria spp., which becomes more based on molecular data because morphological differences are scarce in these organisms. Copyright © 1998 Elsevier GmbH. All rights reserved.

  6. Prevalence and location of Listeria monocytogenes in farmed rainbow trout.

    Science.gov (United States)

    Miettinen, Hanna; Wirtanen, Gun

    2005-10-15

    A total of 510 rainbow trout originating from fish farms in lakes and sea areas around Finland were studied for the presence of Listeria monocytogenes. Samples were studied as pools from five fish. Gill, viscera, and skin from the pooled samples were analysed separately. The individual samples were analysed later if the pooled sample was found to be Listeria positive. The prevalence of Listeria spp. and L. monocytogenes in pooled unprocessed fresh rainbow trout was on average 35.0% and 14.6%, respectively. On the other hand, the prevalence of Listeria spp. and L. monocytogenes in individual thawed fish was found to be 14.3% and 8.8%, respectively. These numbers tend to overestimate and underestimate the real situation because not all fish in pooled samples were necessarily contaminated and in some of the Listeria positive pooled samples all individual samples turned out to be Listeria free. The prevalence of L. monocytogenes varied greatly between different fish farms from zero to 100% in pooled samples and from zero to 75% according to individually studied fish samples. Some indications of the influence of weather conditions and seasonal variations that strongly affected the Listeria contamination of fish were also noticed. The location of Listeria spp. and L. monocytogenes in different parts of the fish differed with statistical significance in rainbow trout. Up to 95.6% of the L. monocytogenes and 84.5% of Listeria spp. positive samples were gill samples. Only 4.4% (2/45) of the L. monocytogenes positive samples were obtained from skin or viscera. Closer study at one fish farm revealed that there was only one L. monocytogenes ribotype present in the contaminated fish, although water and surfaces were heavily contaminated with six other L. monocytogenes ribotypes.

  7. PCR-based methodologies for detection and characterization of Listeria monocytogenes and Listeria ivanovii in foods and environmental sources

    Directory of Open Access Journals (Sweden)

    Jin-Qiang Chen

    2017-06-01

    Full Text Available Listeria monocytogenes is an important foodborne pathogen responsible for listeriosis, a fatal disease. It is widely distributed in various foods and environmental sources. In this review, we focused on addressing PCR-based technologies, including conventional PCR, qPCR and droplet digital PCR (ddPCR. Specifically, we described (a conventional PCR and mono-, duplex- and multiplex-qPCR methodologies; (b development and applications of gene HlyA-, Iap-, PrfA – and SsrA-based conventional and qPCR assays as well as PCR assays targeting newly identified gene targets for specific detection of L. monocytogenes; differentiation of viable from dead L. monocytogenes by qPCR in conjugation with propidium monoazide pretreatment; PCR-based serotype identification of L. monocytogenes isolates; PCR-based detection of L. ivanovii, infecting ruminants, differentiation of L. monocytogenes from other Listeria species; and sigB-gene based PCR identification of Listeria spp; (c applications of ddPCR in detection of L. monocytogenes; and (d application of qPCR assays in detection and subtyping of L. monocytogenes in milk and dairy products; meats, meat products and meat-processing environment; and seafood, seafood products and processing environment. Our goal was to provide a relatively comprehensive overview of PCR-based methodologies available in detection, characterization and subtyping of various strains of L. monocytogenes in foods and environmental sources.

  8. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed

    Science.gov (United States)

    Stea, Emma C.; Purdue, Laura M.; Jamieson, Rob C.; Yost, Chris K.

    2015-01-01

    Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P prevalence of L. monocytogenes of 62% versus 17% by the culture-based method. Both methods revealed higher prevalences in the rural watershed and during the fall and winter seasons. Elevated Escherichia coli (≥100 CFU/100 ml) levels were not associated with the pathogen regardless of the detection method. Isolation of Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds. PMID:25819965

  9. Prevalence of Listeria in Chinese food products from 13 provinces between 2000 and 2007 and virulence characterization of Listeria monocytogenes isolates.

    Science.gov (United States)

    Chen, Jianshun; Zhang, Xiaofeng; Mei, Lingling; Jiang, Lingli; Fang, Weihuan

    2009-01-01

    Listeriosis is a severe disease with high mortality rate, especially in immunosuppressed individuals. The causative organism Listeria monocytogenes is primarily transmitted to humans through contaminated foods. To gain an understanding of the prevalence of Listeria in Chinese food products, we reviewed relevant papers from journals published in China from 2000 to 2007. The average recovery rate of Listeria spp. was 3.7% (0.1-7.7%) in all food categories in 13 provinces, with raw meat being the leading source. L. innocua (28.9%, 271/937) and L. monocytogenes (25.3%, 237/937) were more commonly isolated, both at higher proportion in all food types. Subtyping schemes in three laboratories in different provinces revealed that the majority of the L. monocytogenes isolates belonged to lineage II (67.1%), followed by lineage I at 31.6%, including the pathogenic serovars 1/2a, 1/2b, and 4b isolates. Lineage III isolates comprising the low-pathogenic serovar 4a were rare. Knowledge of the prevalence of Listeria in various food products in different regions of China may be useful for developing intervention strategies for control of contaminations along the production chains.

  10. Isolation of Cronobacter spp. (Enterobacter sakazakii from artisanal mozzarella

    Directory of Open Access Journals (Sweden)

    Francesco Casalinuovo

    2014-02-01

    Full Text Available Cronobacter spp. (Enterobacter sakazakii is an opportunistic bacterial pathogen capable of causing disease and even fatalities in newborn infants within the first weeks of life if consumed as part of the diet. Premature and immunocompromised newborn infants are at particular risk. The microorganism has been isolated from a variety of foods including contaminated infant milk formula powder and milk powder substitute. The study aimed to evaluate the level of microbiological contamination in 47 samples of mozzarella cheese made with cow’s milk collected from artisan cheese producers in Southern Italy. Samples were collected from commercial sales points and underwent qualitative and quantitative microbiological analyses to test for the bacterial contaminants most commonly found in milk and cheese products. The 47 samples underwent qualitative and quantitative microbiological tests according to ISO UNI EN standards. Analyses focused on Staphylococcus aures, Salmonella spp., Listeria monocytogenes, Pseudomonas spp., E. coli, Yersinia spp., total coliforms and Cronobacter sakazakii. The ISO/TS 22964:2006 method was used to investigate possible contamination by C. sakazakii. Biochemical identification was carried out using an automated system for identification and susceptibility tests. None of the samples examined resulted positive for Salmonella spp. or Listeria spp. Only one sample resulted positive for Staphylococcus aureus. Pseudomonas spp. was isolated in 10 (21% of 47 samples. High levels of total coliforms were found in 10 of 47 samples. Cronobacter spp. (Enterobacter sakazakii was isolated in one sample. This is the first study to confirm isolation of C. sakazakii in artisan mozzarella cheese made from cow’s milk. The presence of C. sakazakii could be related to external contamination during the phases of production or to the use of contaminated milk. Since mozzarella is recommended in the diet of children and adults of all ages, this

  11. Host Ranges of Listeria-Specific Bacteriophages from the Turkey Processing Plant Environment in the United States ▿

    Science.gov (United States)

    Kim, Jae-Won; Siletzky, Robin M.; Kathariou, Sophia

    2008-01-01

    Even though at least 400 Listeria phages have been isolated from various sources, limited information is available on phages from the food processing plant environment. Phages in the processing plant environment may play critical roles in determining the Listeria population that becomes established in the plant. In this study, we pursued the isolation of Listeria-specific phages from environmental samples from four turkey processing plants in the United States. These environmental samples were also utilized to isolate Listeria spp. Twelve phages were isolated and classified into three groups in terms of their host range. Of these, nine (group 1) showed a wide host range, including multiple serotypes of Listeria monocytogenes, as well as other Listeria spp. (L. innocua, L. welshimeri, L. seeligeri, and L. ivanovii). The remaining phages mostly infected L. monocytogenes serotype 4b as well as L. innocua, L. ivanovii, and/or L. welshimeri. All but one of the strains of the serotype 4b complex (4b, 4d, 4e) from the processing plant environment could be readily infected by the wide-host-range phages isolated from the environment of the processing plants. However, many strains of other serotypes (1/2a [or 3a] and 1/2b [or 3b]), which represented the majority of L. monocytogenes strains isolated from the environmental samples, were resistant to infection by these phages. Experiments with two phage-resistant strains showed reduced phage adsorption onto the host cells. These findings suggest that phage resistance may be an important component of the ecology of L. monocytogenes in the turkey processing plants. PMID:18791016

  12. Host ranges of Listeria-specific bacteriophages from the turkey processing plant environment in the United States.

    Science.gov (United States)

    Kim, Jae-Won; Siletzky, Robin M; Kathariou, Sophia

    2008-11-01

    Even though at least 400 Listeria phages have been isolated from various sources, limited information is available on phages from the food processing plant environment. Phages in the processing plant environment may play critical roles in determining the Listeria population that becomes established in the plant. In this study, we pursued the isolation of Listeria-specific phages from environmental samples from four turkey processing plants in the United States. These environmental samples were also utilized to isolate Listeria spp. Twelve phages were isolated and classified into three groups in terms of their host range. Of these, nine (group 1) showed a wide host range, including multiple serotypes of Listeria monocytogenes, as well as other Listeria spp. (L. innocua, L. welshimeri, L. seeligeri, and L. ivanovii). The remaining phages mostly infected L. monocytogenes serotype 4b as well as L. innocua, L. ivanovii, and/or L. welshimeri. All but one of the strains of the serotype 4b complex (4b, 4d, 4e) from the processing plant environment could be readily infected by the wide-host-range phages isolated from the environment of the processing plants. However, many strains of other serotypes (1/2a [or 3a] and 1/2b [or 3b]), which represented the majority of L. monocytogenes strains isolated from the environmental samples, were resistant to infection by these phages. Experiments with two phage-resistant strains showed reduced phage adsorption onto the host cells. These findings suggest that phage resistance may be an important component of the ecology of L. monocytogenes in the turkey processing plants.

  13. Efficacy of Pseudomonas graminis CPA-7 against Salmonella spp. and Listeria monocytogenes on fresh-cut pear and setting up of the conditions for its commercial application.

    Science.gov (United States)

    Iglesias, M B; Abadias, M; Anguera, M; Viñas, I

    2018-04-01

    Pseudomonas graminis CPA-7 has been reported to control foodborne pathogens on fresh-cut apple, peach and melon. The first aim of this study was to assess its antagonistic activity against Salmonella spp. and L. monocytogenes on fresh-cut pear. CPA-7 was able to control both pathogens on fresh-cut pear stored in air conditions at 5, 10 and 20 °C. However, when CPA-7 antagonistic effect was tested by simulating commercial application (with antioxidant solution and passive modified atmosphere packaging), its effect decreased and no reductions of foodborne pathogens were reported at 10 °C. Therefore, the second aim was to optimise the antioxidant solution and the packaging in order to retain its antagonistic capacity. The selected antioxidant solution was 2% ascorbic acid +2% sodium citrate +1% CaCl 2 according to growth and effect of CPA-7. Film permeability, which affects gas composition inside fruit packages, influenced CPA-7 efficacy. If the biopreservative strain is used, film has to be sufficiently gas permeable to allow CPA-7 function and at the same time to maintain product quality. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Prevalence of Listeria monocytogenes in Idiazabal cheese.

    Science.gov (United States)

    Arrese, E; Arroyo-Izaga, M

    2012-01-01

    Raw-milk cheese has been identified in risk assessment as a food of greater concern to public health due to listeriosis. To determine the prevalence and levels of Listeria monocytogenes in semi-hard Idiazabal cheese manufactured by different producers in the Basque Country at consumer level. A total of 51 Idiazabal cheese samples were obtained from 10 separate retail establishments, chosen by stratified random sampling. Samples were tested using the official standard ISO procedure 11290-1 for detection and enumeration methods. All cheese samples tested negative for L. monocytogenes. However, 9.8% tested positive for Listeria spp., different from L. monocytogenes. Positive samples came from two brands, two were natural and three were smoked. The presence of Listeria spss. suggests that the cheese making process and the hygiene whether at milking or during cheese making could be insufficient.

  15. Prevalence of Listeria species in food products in Isfahan, Iran.

    Science.gov (United States)

    Jalali, M; Abedi, D

    2008-03-20

    A total of 617 meat and meat products, diary, vegetables and ready to eat food samples were collected. Listeria spp. isolated by using USDA method of isolation and L. monocytogenes identified by biochemical and Polymerase Chain Reaction (PCR). The incidence of Listeria spp. was 4.6% in all food samples. L. monocytogenes was found in 1.2% of food samples. It was found that Listeria spp. was present in 6.7% of meat and meat product samples, 1.3% of diary samples, 1.2% of vegetable samples and 12% ready to eat samples. The results presented in this study indicate, the potential risk of eating ready to eat food or raw and undercooked foods.

  16. Characterization of Listeria monocytogenes and Listeria innocua from a vegetable processing plant by RAPD and REA.

    Science.gov (United States)

    Aguado, V; Vitas, A I; García-Jalón, I

    2004-02-01

    The incidence of Listeria monocytogenes in a vegetable processing plant was investigated over a 23-month period. Frozen ready-to-eat vegetable samples, well as the plant environment, were sampled. The molecular subtyping techniques, Random Amplified Polymorphic DNA (RAPD) and Restriction Endonuclease Analyses (REA), were performed to help investigate the origin and routes of Listeria dissemination. The low and sporadic incidence of L. monocytogenes made it impossible to establish an epidemiological sequence in the processing plant, though a case of cross-contamination between tomato and ratatouille was detected. Listeria innocua subtyping, however, allowed us to determine the prevalence of several strains in vegetables, and their presence on machinery samples suggested the possibility of cross-contamination during processing. The low incidence of L. monocytogenes indicated that the risk of listeriosis transmission by vegetable consumption is low. On the other hand, the isolation of the same strain of L. innocua in several surveys pointed out the risk of colonisation on surfaces and machinery. The persistence of Listeria spp. is a cause for concern as can lead to future contamination of vegetables processed in the plant and to a possible increased risk for health. Therefore, periodic controls for the presence of Listeria spp. and a further review of the cleaning and disinfection procedures used in frozen vegetable plants are recommended.

  17. Microbiological quality of selected ready-to-eat leaf vegetables, sprouts and non-pasteurized fresh fruit-vegetable juices including the presence of Cronobacter spp.

    Science.gov (United States)

    Berthold-Pluta, Anna; Garbowska, Monika; Stefańska, Ilona; Pluta, Antoni

    2017-08-01

    Bacteria of the genus Cronobacter are emerging food-borne pathogens. Foods contaminated with Cronobacter spp. may pose a risk to infants or adults with suppressed immunity. This study was aimed at determining the microbiological quality of ready-to-eat (RTE) plant-origin food products available on the Polish market with special emphasis on the prevalence of Cronobacter genus bacteria. Analyses were carried out on 60 samples of commercial RTE type plant-origin food products, including: leaf vegetables (20 samples), sprouts (20 samples) and non-pasteurized vegetable, fruit and fruit-vegetable juices (20 samples). All samples were determined for the total count of aerobic mesophilic bacteria (TAMB) and for the presence of Cronobacter spp. The isolates of Cronobacter spp. were subjected to genetic identification and differentiation by 16S rDNA sequencing, PCR-RFLP analysis and RAPD-PCR and evaluation of antibiotic susceptibility by the disk diffusion assay. The TAMB count in samples of lettuces, sprouts and non-pasteurized fruit, vegetable and fruit-vegetable juices was in the range of 5.6-7.6, 6.7-8.4 and 2.9-7.7 log CFU g -1 , respectively. The presence of Cronobacter spp. was detected in 21 (35%) samples of the products, including in 6 (30%) samples of leaf vegetables (rucola, lamb's lettuce, endive escarola and leaf vegetables mix) and in 15 (75%) samples of sprouts (alfalfa, broccoli, small radish, lentil, sunflower, leek and sprout mix). No presence of Cronobacter spp. was detected in the analyzed samples of non-pasteurized fruit, vegetable and fruit-vegetable juices. The 21 strains of Cronobacter spp. isolated from leaf vegetable and sprouts included: 13 strains of C. sakazakii, 4 strains of C. muytjensii, 2 strains of C. turicensis, one strain of C. malonaticus and one strain of C. condimenti. All isolated C. sakazakii, C. muytjensii, C. turicensis and C. malonaticus strains were sensitive to ampicillin, cefepime, chloramphenicol, gentamycin

  18. Evaluation of the efficacy of commercial sanitizers against adhered and planktonic cells of Listeria monocytogenes and Salmonella spp. Avaliação da eficiência de desinfetantes comerciais contra células aderidas e planctônicas de Listeria monocytogenes e Salmonella spp.

    Directory of Open Access Journals (Sweden)

    Julia Carballo

    2012-09-01

    Full Text Available Antimicrobial activities of two commercial disinfectants, alone or combined with heat, against three Salmonella strains and three Listeria monocytogenes strains were studied. The efficacy of disinfectants against planktonic bacteria and bacteria attached to three food contact industrial surfaces (stainless steel, polytetraflourethylene, and rubber was investigated. The tests were conducted using the sanitizer (quaternary ammonium compounds, and alquyldiethylenediamineglycine and di-alquyldiamineethylglycine concentrations recommended by the manufacturers, and concentrations twice and four times higher than those values. The recommended concentrations were not effective to kill bacteria, especially when they were attached to surfaces. Concentrations of disinfectants twice and four times higher than those recommended were needed to fully eliminate planktonic bacteria. These same sanitizer concentrations were not sufficient to remove attached bacteria. To remove them from the surfaces, a treatment with recommended concentrations in combination with heat was needed. Our results indicate that these two pathogenic bacteria could survive common sanitation programs used in the food industry.Neste estudo, foi avaliada a atividade antimicrobiana de dois desinfetantes comerciais, individualmente e combinados com calor, contra três estirpes de Salmonella e três de Listeria monocytogenes. A eficácia dos desinfetantes foi investigada contra bactérias em suspensão e contra bactérias aderidas a três superfícies de contacto comuns na indústria de alimentos (aço inoxidável, politetrafluoretileno e borracha. Os ensaios foram realizados com base nas concentrações de desinfetantes recomendadas pelos fabricantes e em concentração dupla e quádrupla. As concentrações recomendadas não foram efetivas contra as bactérias, especialmente quando estas estavam aderidas às superfícies. Foi necessário o dobro ou o quádruplo da concentração recomendada

  19. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand.

    Science.gov (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn

    2017-09-01

    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Listeria booriae sp. nov. and Listeria newyorkensis sp. nov., from food processing environments in the USA.

    Science.gov (United States)

    Weller, Daniel; Andrus, Alexis; Wiedmann, Martin; den Bakker, Henk C

    2015-01-01

    Sampling of seafood and dairy processing facilities in the north-eastern USA produced 18 isolates of Listeria spp. that could not be identified at the species-level using traditional phenotypic and genotypic identification methods. Results of phenotypic and genotypic analyses suggested that the isolates represent two novel species with an average nucleotide blast identity of less than 92% with previously described species of the genus Listeria. Phylogenetic analyses based on whole genome sequences, 16S rRNA gene and sigB gene sequences confirmed that the isolates represented by type strain FSL M6-0635(T) and FSL A5-0209 cluster phylogenetically with Listeria cornellensis. Phylogenetic analyses also showed that the isolates represented by type strain FSL A5-0281(T) cluster phylogenetically with Listeria riparia. The name Listeria booriae sp. nov. is proposed for the species represented by type strain FSL A5-0281(T) ( =DSM 28860(T) =LMG 28311(T)), and the name Listeria newyorkensis sp. nov. is proposed for the species represented by type strain FSL M6-0635(T) ( =DSM 28861(T) =LMG 28310(T)). Phenotypic and genotypic analyses suggest that neither species is pathogenic. © 2015 IUMS.

  1. Transfer of antibiotic resistance from Enterococcus faecium of fermented meat origin to Listeria monocytogenes and Listeria innocua.

    Science.gov (United States)

    Jahan, M; Holley, R A

    2016-04-01

    Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.

  2. Study on contamination of sheep meat in Shahrekord area with Listeria ivanovii and determination its antibiotic resistance pattern

    Directory of Open Access Journals (Sweden)

    Farid Khalili Borujeni

    2013-06-01

    Full Text Available Background and objectives: Listeria monocytogenes and Listeria ivanovii are two pathogenic species of Listeria. The role of Listeria ivanovii is important in abortion, stillbirth, septicemia in animals and this bacterium sometimes is pathogenic in humans. Contamination of ovine carcasses during the slaughter and processing can cause foodborne infections in humans. In this study we examined the contamination of sheep meat in slaughter house of Shahrekord city to Listeria ivanovii and determined its antibiotic resistance pattern.Material and Methods: A total 200 samples of sheep meat were collected from abattoir and processed by use of two enrichment method. After doing specific biochemical tests and PCR, Listeria spp was identified and antibiotic resistance of isolated Listeria were tested by the agar disc diffusion method. Results: The contamination of sheep carcasses with listeria was 2.5% (5 out of 200 samples. All five isolates (2.5% were recognized as Listeria ivanovii and were resistant to four antibiotics, sensitive to six antibiotics and intermediate to other antibiotics.  Conclusion: According to the contamination rate in sheep carcasses with Listeria ivanovii and the relatively high antibiotic resistance specified in this bacteria, the role of red meat in transmission of Listeria spp. and appropriate use of antibiotics against this bacteria should be considered.

  3. Important vectors for Listeria monocytogenes transmission at farm dairies manufacturing fresh sheep and goat cheese from raw milk.

    Science.gov (United States)

    Schoder, Dagmar; Melzner, Daniela; Schmalwieser, Alois; Zangana, Abdoulla; Winter, Petra; Wagner, Martin

    2011-06-01

    The aim of this study was to determine the transmission routs of Listeria spp. in dairy farms manufacturing fresh cheese made from ovine and caprine raw milk and to evaluate the impact of Listeria monocytogenes mastitis on raw milk contamination. Overall, 5,799 samples, including 835 environmental samples, 230 milk and milk product samples, and 4,734 aseptic half-udder foremilk samples were collected from 53 dairy farms in the dairy intensive area of Lower Austria. Farms were selected for the study because raw milk was processed to cheese that was sold directly to consumers. A total of 153 samples were positive for Listeria spp., yielding an overall prevalence of 2.6%; L. monocytogenes was found in 0.9% of the samples. Bulk tank milk, cheese, and half-udder samples were negative for Listeria spp. Because none of the sheep and goats tested positive from udder samples, L. monocytogenes mastitis was excluded as a significant source of raw milk contamination. L. monocytogenes was detected at 30.2% of all inspected farms. Swab samples from working boots and fecal samples had a significantly higher overall prevalence (P < 0.001) of L. monocytogenes (15.7 and 13.0%, respectively) than did swab samples from the milk processing environment (7.9%). A significant correlation was found between the prevalence of L. monocytogenes in the animal and in the milk processing environment and the silage feeding practices. Isolation of L. monocytogenes was three to seven times more likely from farms where silage was fed to animals throughout the year than from farms where silage was not fed to the animals.

  4. Prevalence and serotypes of Listeria monocytogenes contamination in Chinese beef processing plants.

    Science.gov (United States)

    Zhu, Lixian; Feng, Xiaohui; Zhang, Lihua; Zhu, Ruiliang; Luo, Xin

    2012-06-01

    The aim of this work was to study the epidemiology of Listeria spp., particularly Listeria monocytogenes, and to identify the serotypes present in contaminated samples from beef processing plants in China. A total of 439 samples were obtained from bovine feces, hides, and carcasses at three commercial processing plants. A standard protocol (ISO 11290-1) was followed to detect Listeria spp. and L. monocytogenes, and multiplex polymerase chain reaction was used to identify the various L. monocytogenes serotypes. The overall prevalences of Listeria spp. and L. monocytogenes were 65.6% and 26.4%, respectively, and the contamination was highest in the hide samples. The identified L. monocytogenes serotypes were 1/2c and 1/2a. The results of the current study indicate that Listeria spp. contamination is common in Chinese beef processing plants; specific measures should be taken to prevent and/or treat L. monocytogenes contamination of feces and hides in beef slaughter plants. Furthermore, because Listeria spp. contamination was found to be prevalent, it should, therefore, be studied further. The prevention of cases of sporadic listeriosis in China should also be addressed.

  5. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants.

    Science.gov (United States)

    Williams, Shanna K; Roof, Sherry; Boyle, Elizabeth A; Burson, Dennis; Thippareddi, Harshavardhan; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin; Nightingale, Kendra

    2011-01-01

    A longitudinal study was conducted to track Listeria contamination patterns in ready-to-eat meats from six small or very small meat processing plants located in three states over 1 year. A total of 688 environmental sponge samples were collected from nonfood contact surfaces during bimonthly visits to each plant. Overall, L. monocytogenes was isolated from 42 (6.1%) environmental samples, and its prevalence ranged from 1.7 to 10.8% across different plants. Listeria spp., other than L. monocytogenes, were isolated from 9.5% of samples overall, with the prevalence ranging from 1.5 to 18.3% across different plants. The prevalence of L. monocytogenes correlated well with that of other Listeria spp. for some but not all plants. One L. monocytogenes isolate representing each positive sample was characterized by molecular serotyping, EcoRI ribotyping, and pulsed-field gel electrophoresis typing. Seven sample sites tested positive for L. monocytogenes on more than one occasion, and the same ribotype was detected more than once at five of these sites. Partial sigB sequencing was used to speciate other Listeria spp. isolates and assign an allelic type to each isolate. Other Listeria spp. were isolated more than once from 14 sample sites, and the same sigB allelic type was recovered at least twice from seven of these sites. One plant was colonized by an atypical hemolytic L. innocua strain. Our findings indicate that small and very small meat processing plants that produce ready-to-eat meat products are characterized by a varied prevalence of Listeria, inconsistent correlation between contamination by L. monocytogenes and other Listeria spp., and a unique Listeria molecular ecology.

  6. Method Modification for the AtlasListeriaEnvironmental LE Detection Assay Using FoodChek ActeroListeriaEnrichment Media and Half-Fraser Media for the Detection ofListeriaspp. from Environmental Surfaces.

    Science.gov (United States)

    Maroni, Brett; Lopez, Tucker; Neal, Cambria; Verver, Sarah; Puente, Celina; Lauffer, Jannelle; Garcia, Joseph; Groschel, Bettina; Dreyling, Erin; Chaney, W Evan; Bastin, Ben; Bird, Patrick; Benzinger, M Joseph; Agin, James; Goins, David; Hariram, Upasana; Chen, Yi; Ryser, Elliot; Brodsky, Michael

    2018-03-01

    Two candidate method modifications for the Atlas Listeria Environmental LE Detection Assay were compared with the U.S. Department of Agriculture (USDA)-Food Safety and Inspection Service Microbiology Laboratory Guidebook 8.09 (MLG 8.09) method for detection of Listeria spp. on stainless steel, polyvinyl chloride (PVC), and sealed concrete surfaces. For LE candidate method 1, samples were enriched in FoodChek Actero Listeria Enrichment Media [ALEM; Performance Tested MethodSM (PTM) 111201] at 35 ± 2°C for 18 to 24 h and evaluated for a range of analytical sample volumes. For LE candidate method 2, the current Roka PTM using 90 mL of Half-Fraser broth for enrichment at 35 ± 2°C was evaluated at 24 h with a reduced sample volume. These comparisons were made in multiple studies across the three environmental surfaces. Within each method and study, a total of 5 samples were uninoculated, 20 samples were inoculated with Listeria spp. at a low level to target fractional positivity, and 5 samples were inoculated with Listeria spp. at a high level to approach a probability of detection of 1. Inclusivity and exclusivity studies were also conducted for the LE method in combination with Half-Fraser and ALEM. The Atlas Listeria Environmental LE Detection Assay detected all 50 inclusive organisms, including 25 strains of L. monocytogenes and 5 strains of each of the other five common species of Listeria (L. innocua, L. welshimeri, L. ivanovii, L. seeligeri, and L. grayi) and none of the 30 exclusive organisms across all media and with both 200 and 2000 µL sample volumes. For the LE candidate method 1 studies, no significant differences were observed within the Roka ALEM method at 18, 20, or 24 h and for both the 200 and 2000 µL sample volumes as compared with the paired culture outcome. However, the ALEM method performed significantly better as compared with the unpaired reference method for sealed concrete and stainless steel. For the LE candidate method 2 studies, no

  7. Prevalence of Listeria monocytogenes in raw milk in North Lebanon

    International Nuclear Information System (INIS)

    Al Kassaa, I; El Omari, Kh.; Esmail, B.; Hamze, M; Saati, M.

    2016-01-01

    Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressedby febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptableto the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France). The results obtained revealed the absence of Listeria monocytogenes inall analyzed samples. (Author)

  8. Listeria monocytogenes: Overview and Targeting Advances

    Directory of Open Access Journals (Sweden)

    Mostafa F.N. Abushahba

    2016-04-01

    Full Text Available Listeria monocytogenes is a serious foodborne zoonotic pathogen capable of causing gastroenteritis and severe systemic infections such as septicemia, meningitis or abortion in the infected individuals what is called listeriosis. The bacterium is reported as the third leading cause of death among the foodborne pathogens preceded by nontyphoidal Salmonella spp. and Toxoplasma gondii. The power to tolerate a wide range of temperatures is considered the most prominent trait distinguishing it from the other foodborne pathogens. Within the infected host, the bacteria harbor inside macrophages and jump from cell to another without leaving the safeguarding milieu of the host's cells utilizing a set of genes including hly (listeriolysin O, plcA (phosphatidylinositol-specific phospholipase c, plcB (phosphatidylcholine-phospholipase C and actA (actin-assembly inducing protein. In addition to the health concerns associated with antibiotics, treatment failure likely occurs among listeriosis-infected persons especially with the inability of most antibiotics to access intracellular replicative niches and achieve the optimum therapeutic concentrations within the infected cells. Recently, one novel choice, peptide nucleic acid (PNA, has been emerged to target this bacterium as a model of targeting intracellular pathogens with anti-sense agents. PNA is a one of the DNA analogues which works via specific inhibition of bacterial gene expression.

  9. Grosmannia and Leptographium spp. associated with conifer-infesting bark beetles in Finland and Russia, including Leptographium taigense sp. nov.

    Science.gov (United States)

    Linnakoski, Riikka; de Beer, Z Wilhelm; Duong, Tuan A; Niemelä, Pekka; Pappinen, Ari; Wingfield, Michael J

    2012-08-01

    Species of Grosmannia with Leptographium anamorphs include important forest pathogens and agents of blue stain in timber. They are commonly found in association with forest pests, such as bark beetles. During a survey of ophiostomatoid fungi in eastern parts of Finland and neighboring Russia, species belonging to the genus Grosmannia were isolated from 12 different bark beetle species infesting Picea abies and Pinus sylvestris, the most economically important conifers in the region. Identification of these fungi was based on morphology, DNA sequence comparisons for three gene regions and phylogenetic analyses. A total of ten taxa were identified. These belonged to six different species complexes in Grosmannia. The phylogenetic analyses provided an opportunity to redefine the G. galeiformis-, L. procerum-, L. lundbergii-, G. piceiperda-, G. olivacea- and G. penicillata-complexes, and to consider the species emerging from the survey within the context of these complexes. The species included G. galeiformis, G. olivacea, L. chlamydatum, L. lundbergii, L. truncatum and a novel taxon, described here as L. taigense sp. nov. In addition, species closely related to G. cucullata, G. olivaceapini comb. nov., G. piceiperda and L. procerum were isolated but their identity could not be resolved. The overall results indicate that the diversity of Grosmannia species in the boreal forests remains poorly understood and that further studies are needed to clarify the status of several species or species complexes.

  10. EFICIÊNCIA DO ENRIQUECIMENTO EM DUPLO ESTÁGIO REALIZADO NOS CALDOS UVM E FRASER E DESEMPENHO DOS ÁGARES LPM E LSAB-CAN PARA A DETECÇÃO DE Listeria spp. EM CARNE DE FRANGO NATURALMENTE CONTAMINADA EFFICIENCY OF DOUBLE STEPS ENRICHMENT IN THE UVM AND FRASER BROTHES AND PERFORMANCE OF LPM AND LSAB-CAN AGARS TO DETECTION OF Listeria spp. IN NATURALLY CONTAMINATED CHICKEN MEAT

    Directory of Open Access Journals (Sweden)

    Albenones José de Mesquita

    2007-09-01

    Full Text Available

    No presente trabalho, avaliou-se o desempenho de dois caldos e dois ágares seletivos para o isolamento de Listeria a partir de carne de frango naturalmente contaminada, adquirida no comércio varejista de Goiânia - GO, no período de janeiro a junho de 1992. A metodologia de isolamento e identificação de Listeria adotada envolveu a utilização de enriquecimento seletivo em estágio duplo nos caldos "University of Vermont" e Fraser e plaqueamento no ágar cloreto de lítio-feniletanol-moxalactam e no ágar base seletivo para Listeria, suplementado com cicloheximide, acriflavina e ácido nalidíxico. Verificou-se o desempenho dos caldos e enriquecimento para Listeria (caldos UVM e Fraser, associados à passagem da cultura por uma solução de hidróxido de potássio a 0,25%, constatando-se que os mesmos se equivaleram estatisticamente (Z= -1,7393<1,96. Por outro lado, o ágar LPM apresentou destacada superioridade frente ao ágar LSAB-CAN em relação ao total de amostras analisadas (Z= 7, 368>Z0,975. O tratamento da cultura com a solução de hidróxido de potássio a 0,25% mostrou ligeira inibição, contribuindo para redução no número de amostras positivas detectadas.

    PALAVRAS-CHAVE: Listeria; caldo de enriquecimento; carne de frango.

    It was determined the performance of two selective broths and two agars to isolate Listeria from chicken meat naturally contaminated, acquired in the supermarkets of Goiânia-Goiás, between January and June 1992. Methodology of isolation involved the utilization of two-stage selective enrichment in the University of Vermont and Fraser broths and plating in lithium chloride-phenyletanol-moxalactam agar and the Listeria selective agar base supplemented with cicloheximide

  11. VIDAS Listeria species Xpress (LSX).

    Science.gov (United States)

    Johnson, Ronald; Mills, John

    2013-01-01

    The AOAC GovVal study compared the VIDAS Listeria species Xpress (LSX) to the Health Products and Food Branch MFHPB-30 reference method for detection of Listeria on stainless steel. The LSX method utilizes a novel and proprietary enrichment media, Listeria Xpress broth, enabling detection of Listeria species in environmental samples with the automated VIDAS in a minimum of 26 h. The LSX method also includes the use of the chromogenic media, chromID Ottaviani Agosti Agar (OAA) and chromID Lmono for confirmation of LSX presumptive results. In previous AOAC validation studies comparing VIDAS LSX to the U.S. Food and Drug Administration's Bacteriological Analytical Manual (FDA-BAM) and the U.S. Department of Agriculture-Food Safety and Inspection Service (USDA-FSIS) reference methods, the LSX method was approved as AOAC Official Method 2010.02 for the detection of Listeria species in dairy products, vegetables, seafood, raw meats and poultry, and processed meats and poultry, and as AOAC Performance Tested Method 100501 in a variety of foods and on environmental surfaces. The GovVal comparative study included 20 replicate test portions each at two contamination levels for stainless steel where fractionally positive results (5-15 positive results/20 replicate portions tested) were obtained by at least one method at one level. Five uncontaminated controls were included. In the stainless steel artificially contaminated surface study, there were 25 confirmed positives by the VIDAS LSX assay and 22 confirmed positives by the standard culture methods. Chi-square analysis indicated no statistical differences between the VIDAS LSX method and the MFHPB-30 standard methods at the 5% level of significance. Confirmation of presumptive LSX results with the chromogenic OAA and Lmono media was shown to be equivalent to the appropriate reference method agars. The data in this study demonstrate that the VIDAS LSX method is an acceptable alternative method to the MFHPB-30 standard

  12. Morphological and molecular characterization of four Sarcocystis spp., including Sarcocystis linearis n. sp., from roe deer (Capreolus capreolus) in Italy.

    Science.gov (United States)

    Gjerde, Bjørn; Giacomelli, Stefano; Bianchi, Alessandro; Bertoletti, Irene; Mondani, Hajime; Gibelli, Lucia Rita

    2017-04-01

    Sarcocystis linearis n. sp. At the 18S rRNA gene, however, the two species could not be clearly separated from each other. Thus, there was considerable intraspecific sequence variation in the 18S rRNA gene of S. linearis (98.1-99.9% identity between 24 sequences), which was similar both in magnitude and nature to the variation previously found in this gene of S. taeniata. The new 18S rRNA gene sequences of S. linearis shared an identity of 97.9-99.6% with those of S. taeniata (overlap between intra- and interspecific identity), and in the phylogenetic tree, sequences of the two species were interspersed. By scanning electron microscopy (SEM), the sarcocysts of S. linearis were found to possess regularly spaced, thin and narrow ribbon-like cyst wall protrusions (about 2.8-3.2 μm long, 0.3-0.4 μm wide and about 0.02-0.03 μm thick), terminating in a plate-like structure of the same thickness but with an elliptic outline (about 0.3-0.4 μm wide and 0.7-0.9 μm long). The terminal plates were connected in the middle with the band-like portion of the protrusions like the board of a seesaw (tilting board). The terminal plates of adjacent protrusions were neatly arranged in a hexagonal pattern resembling tiles on a roof. Together, they formed an outer roof-like layer facing the surrounding cytoplasm of the host cell and completely covering the band-like proximal portion of the protrusions, which overlapped and were stacked in three to four layers close to the cyst surface. The sarcocyst morphology of S. linearis was consistent with that of an unnamed Sarcocystis sp. in roe deer previously found by transmission electron microscopy in several countries, including Italy. A few sarcocysts of S. gracilis and S. silva were also examined by SEM, confirming the presence of regularly distributed, short knob-like protrusions in S. gracilis (as seen in previous SEM studies) and revealing tightly packed, erect 6-7-μm-long villus-like protrusions having regularly distributed round

  13. Prevalence of Listeria monocytogenes in the river receiving the effluent of municipal wastewater treatment plant

    Directory of Open Access Journals (Sweden)

    Atefeh Taherkhani

    2013-01-01

    Full Text Available Aims: The objective of this study was to evaluate the prevalence of Listeria spp. in the river water before and after discharge of the effluent of the municipal wastewater treatment plant (WWTP in Isfahan, Iran. Materials and Methods: A total of 66 samples were collected bi-weekly over 4 months from eleven discrete sampling locations in Zayandehrood River, Iran. Three sampling sites were located above the discharge point and five sites were located after the discharge point of WWTP. Samples were also collected from the influent and the effluent of WWTP. Listeria spp. were isolated using a selective enrichment procedure and a subculture onto polymyxin-acriflavine-lithium chloride-ceftazidime-esculin-mannitol Agar. All isolates were subjected to standard biochemical tests. Results: L. monocytogenes was isolated from influent (83%, effluent (50% and (18.5% river water. Listeria spp. was not found before the discharge point in river water. However, L. monocytogenes was isolated in samples collected from 200 m (33%, 500 m (33%, 2 km (16.5%, 5 km (16.5% and 10 km (16.5% downstream from the WWTP. Listeria innocua (9% and Listeria seeligeri (10% were the second most frequently isolated species. Conclusion: During the wastewater treatment, Listeria spp. is not removed completely. L. monocytogenes is widely distributed in the Zayandehrood river. L. monocytogenes released into surface water demonstrates a potential risk for public health. These results indicate the need for appropriate water management in order to reduce human and animal exposure to such pathogens.

  14. Novel Method To Identify Source-Associated Phylogenetic Clustering Shows that Listeria monocytogenes Includes Niche-Adapted Clonal Groups with Distinct Ecological Preferences

    DEFF Research Database (Denmark)

    Nightingale, K. K.; Lyles, K.; Ayodele, M.

    2006-01-01

    in humans and different animal species and which can be isolated from a number of environments including food, as a model organism to develop and implement a two-step statistical approach to the identification of phylogenetic clades that are significantly associated with different source populations......, including humans, animals, and food. If the null hypothesis that the genetic distances for isolates within and between source populations are identical can be rejected (SourceCluster test), then particular clades in the phylogenetic tree with significant overrepresentation of sequences from a given source......Stats test identified 10 clades with significant (P animal-, and food-associated clusters. Epidemiological and virulence phenotype data supported the fact that the source-associated clonal groups identified here...

  15. Prevalence and antimicrobial resistance of listeria species isolated from different types of raw meat in Iran.

    Science.gov (United States)

    Rahimi, Ebrahim; Yazdi, Farzad; Farzinezhadizadeh, Hussein

    2012-12-01

    Listeria and particularly Listeria monocytogenes are important foodborne pathogens that can cause listeriosis and severe complications in immunocompromised individuals, children, pregnant women, and the elderly. The objective of this study was to determine the prevalence of Listeria spp. in raw meat in Iran. From July 2010 to November 2011, a total of 1,107 samples of various raw meats were obtained from randomly selected retail butcher shops. The results of conventional bacteriologic and PCR methods revealed that 141 samples (12.7%) were positive for Listeria spp. The highest prevalence of Listeria was found in raw buffalo meat samples (7 of 24 samples; 29.2%) followed by quail meat (26 of 116 samples; 22.4%), partridge meat (13 of 74 samples; 17.6%), and chicken meat (27 of 160 samples; 16.9%). The most common species recovered was Listeria innocua (98 of 141 strains; 75.9 % ); the remaining isolates were L. monocytogenes (19.1% of strains), Listeria welshimeri (6.4% of strains), Listeria seeligeri (3.5% of strains), and Listeria grayi (1.4% of strains). Susceptibilities of the 141 strains to 11 antimicrobial drugs were determined using the disk diffusion assay. Overall, 104 (73.8%) of the Listeria isolates were resistant to one or more antimicrobials, and 17.0% of the isolates were resistant to three or more antimicrobials. The present study provides the first baseline data on the prevalence of Listeria in raw meat derived from sheep, goat, buffalo, quail, partridge, chicken, and ostrich in Iran and the susceptibility of these isolates to antimicrobials.

  16. Prevalence of Listeria species in camel sausages from retail markets in Aydin province in Turkey and RAPD analysis of Listeria monocytogenes Isolates

    Directory of Open Access Journals (Sweden)

    Ozbey Gokben

    2006-06-01

    Full Text Available Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%, Listeria innocua from 14 samples (14% and Listeria welshimeri from two samples(2%. A 701 bp fragment of listeriolysin O sequence for L. monocytogenes was amplified using specific primers by polymerase chain reaction (PCR for confirmation of the identification. A random primer (OPA-11 was used in a random amplified polymorphic DNA (RAPD assay. This detected five different band profiles amongst the L. monocytogenes isolates, indicating a relatively large amount of genetic heterogeneity amongst the nine isolates. The study has highlighted the need for improved strategies for food safety, in particular appropriate hygienic precautions to avoid contamination of sausage during the manufacturing process and appropriate preservation techniques during storage and transport, to prevent transmission of Listeria spp to consumers at home and abroad.

  17. Identification of Listeria species by microarray-based assay.

    Science.gov (United States)

    Volokhov, Dmitriy; Rasooly, Avraham; Chumakov, Konstantin; Chizhikov, Vladimir

    2002-12-01

    We have developed a rapid microarray-based assay for the reliable detection and discrimination of six species of the Listeria genus: L. monocytogenes, L. ivanovii, L. innocua, L. welshimeri, L. seeligeri, and L. grayi. The approach used in this study involves one-tube multiplex PCR amplification of six target bacterial virulence factor genes (iap, hly, inlB, plcA, plcB, and clpE), synthesis of fluorescently labeled single-stranded DNA, and hybridization to the multiple individual oligonucleotide probes specific for each Listeria species and immobilized on a glass surface. Results of the microarray analysis of 53 reference and clinical isolates of Listeria spp. demonstrated that this method allowed unambiguous identification of all six Listeria species based on sequence differences in the iap gene. Another virulence factor gene, hly, was used for detection and genotyping all L. monocytogenes, all L. ivanovii, and 8 of 11 L. seeligeri isolates. Other members of the genus Listeria and three L. seeligeri isolates did not contain the hly gene. There was complete agreement between the results of genotyping based on the hly and iap gene sequences. All L. monocytogenes isolates were found to be positive for the inlB, plcA, plcB, and clpE virulence genes specific only to this species. Our data on Listeria species analysis demonstrated that this microarray technique is a simple, rapid, and robust genotyping method that is also a potentially valuable tool for identification and characterization of bacterial pathogens in general.

  18. Sensitivity of Campylobacter spp. to irradiation in poultry meat

    International Nuclear Information System (INIS)

    Patterson, M.F.

    1995-01-01

    The sensitivity of Campylobacter jejuni (three strains), Camp. coli (three strains), Camp. fetus (one strain) and Camp. lari (one strain) to irradiation in poultry meat was investigated. There was no significant difference in the counts obtained on Blood or Skirrows agar. Preston agar gave a significantly lower recovery of the pathogens after irradiation so these results were not included in calculations of D10 values. The D10 values ranged from 0.12 to 0.25 kGy and there was a significant difference in the radiation sensitivity between different Campylobacter spp. and within strains of the same species. These values indicate that Campylobacter spp. are more radiation-sensitive than Salmonella and Listeria monocytogenes irradiated under similar conditions. Therefore irradiation treatments suggested to eliminate the latter from poultry carcasses would also be sufficient to remove Campylobacter

  19. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Science.gov (United States)

    Rakic Martinez, Mira; Wiedmann, Martin; Ferguson, Martine; Datta, Atin R

    2017-01-01

    Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05) higher LT50 (lower virulence) than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05) higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05) lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were

  20. Cerebrospinal fluid inflammatory markers in patients with Listeria monocytogenes meningitis

    NARCIS (Netherlands)

    Koopmans, Merel M.; Brouwer, Matthijs C.; Geldhoff, Madelijn; Seron, Mercedes Valls; Houben, Judith; van der Ende, Arie; van de Beek, Diederik

    2014-01-01

    Listeria monocytogenes meningitis is the third most common cause of bacterial meningitis and is associated with high rates of mortality and unfavorable outcome. We analyzed 101 cytokines, chemokines and complement factors in CSF of adult patients with Listeria meningitis included in a prospective

  1. Procamallanus (Procamallanus) spp. (Nematoda: Camallanidae) in fishes of the Okavango River, Botswana, including the description of P. (P.) pseudolaeviconchus n. sp. parasitic in Clarias spp. (Clariidae) from Botswana and Egypt.

    Science.gov (United States)

    Moravec, František; Van As, Liesl L

    2015-02-01

    Parasitological dissections of fishes from the Okavango River, Botswana, revealed the presence of nematodes of the subgenus Procamallanus (Procamallanus) Baylis, 1923 in five fish species belonging to three different families. Based on light and scanning electron microscopical examinations, they proved to represent one previously known and one new species, i.e. P. (P.) laeviconchus (Wedl, 1861) from Synodontis nigromaculatus Boulenger, S. thamalakanensis Fowler (new host) (both Mochokidae) and Schilbe intermedius Rüppel (new host) (Schilbeidae), and P. (P.) pseudolaeviconchus n. sp. from Clarias stappersi Boulenger and C. theodorae Weber (both Clariidae). Specimens of the new species previously collected from Clarias gariepinus (Burchell) (type-host) in Egypt were also examined. Both of these nematode species are very similar, differing from each other mainly in the shape of the circumoral flange, which is conspicuously lobed in P. laeviconchus and unlobed in P. pseudolaeviconchus. Previously, these two species have been confused in the literature under the name P. laeviconchus. A key to Procamallanus (Procamallanus) spp. parasitising freshwater fishes in Africa, including Madagascar, is provided.

  2. Detection of Listeria monocytogenes in pigs and pork.

    Science.gov (United States)

    Kanuganti, Sreenivas R; Wesley, Irene V; Reddy, P Gopal; McKean, James; Hurd, H Scott

    2002-09-01

    In this study, we surveyed hogs (n = 300) as well as pork products (ground pork and raw chitterlings) for Listeria monocytogenes. Pig specimens collected before (tonsil swabs) and after slaughter (tonsils, lymph nodes, carcass swabs, and rectal contents) were examined for L. monocytogenes by enrichment with conventional enrichment broths followed by subculturing to selective agar. A multiplex polymerase chain reaction assay targeting the highly conserved 16S rRNA gene of the Listeria species as well as the hlyA gene unique to L. monocytogenes was used to screen aliquots of the enrichment (method I) as well as to confirm presumptive Listeria colonies from Columbia agar with 0.05% glucose supplemented with polymyxin B-acriflavine-lithium chloride-ceftazidime-aesculin-mannitol (PALCAM; method II). Subculturing to PALCAM agar was the more sensitive of the two methods on the basis of the overall detection of Listeria. For hog tissues, method I detected L. monocytogenes (0.87% positive) and no other Listeria spp. in all samples (n = 1,849). In contrast, method II detected significantly more (P enrichments with University of Vermont modified Listeria enrichment broth; plating to PALCAM slightly improved recovery (9%). Overall, ground pork samples (n = 340) harbored L. monocytogenes (45% positive) and other Listeria species (1.5% positive), as determined by method I. Subculturing to PALCAM significantly (P < 0.05) improved the detection of L. monocytogenes (50.2%) but not that of other Listeria species (1.7%). L. monocytogenes isolates (n = 243) were assigned to serotype 1 (53.5%), serotype 4 (25%), and serotypes other than 1 and 4 (21.4%).

  3. Isolation and characterization of Listeria species from rodents in natural environments in China

    OpenAIRE

    Wang, Yan; Lu, Liang; Lan, Ruiting; Salazar, Joelle K; Liu, Jingli; Xu, Jianguo; Ye, Changyun

    2017-01-01

    Listeria is ubiquitous in a variety of environments and can be isolated from a wide range of animal hosts. Rodents are capable of carrying pathogenic bacteria in their intestines, such as Listeria, and can disseminate those pathogens into the natural environment and to where human activity occurs. In this study, we investigated the occurrence and antimicrobial susceptibility of List eria spp. isolated from wild rodents found in natural environments in China. We collected 341 intestinal fecal ...

  4. Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment.

    Science.gov (United States)

    Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier

    2014-09-01

    A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. A New Pathway for the Synthesis of α-Ribazole-Phosphate in Listeria innocua

    OpenAIRE

    Gray, Michael J.; Escalante-Semerena, Jorge C.

    2010-01-01

    The genomes of Listeria spp. encode all but one of 25 enzymes required for the biosynthesis of adenosylcobalamin (AdoCbl; coenzyme B12). Notably, all Listeria genomes lack CobT, the nicotinamide mononucleotide:5,6-dimethylbenzimidazole (DMB) phosphoribosyltransferase (EC 2.4.2.21) enzyme that synthesizes the unique α-linked nucleotide N1-(5-phospho-α-D-ribosyl)-DMB (α-ribazole-5′-P, α-RP), a precursor of AdoCbl. We have uncovered a new pathway for the synthesis of α-RP in Listeria innocua tha...

  6. Carrier status for Listeria monocytogenes and other Listeria species ...

    African Journals Online (AJOL)

    Background: Listeria organisms are documented to be zoonotic; one of the sources of infection is the domestic fowl where it could occur as in apparent infection. The carriage of Listeria monocytogenes and other Listeria in indigenous birds has not been documented in Kenya. Objective: To establish whether healthy looking ...

  7. Prevalence of and risk factors for Listeria species on dairy farms.

    Science.gov (United States)

    Vilar, M J; Yus, E; Sanjuán, M L; Diéguez, F J; Rodríguez-Otero, J L

    2007-11-01

    This cross-sectional study determined the prevalence of Listeria spp. in bulk-tank milk on dairy farms in the region of Galicia in northwest Spain. The aim was to identify management practices associated with the presence of Listeria spp. and possible effects on milk hygienic quality. A total of 98 farms was randomly selected on the basis of an expected prevalence of 6.5% for Listeria monocytogenes from 20,107 dairy farms in the region. Bulk-tank milk samples were obtained from 98 farms, fecal samples from lactating cows from 97 farms, and silage samples from 83 farms. Listeria monocytogenes was detected in 6.1, 9.3, and 6.0% of these samples, respectively. Statistical analyses confirmed the relationship between low silage quality (as indicated by high pH) and presence of Listeria spp. in silage (29.5 vs. 6.2% for pH above or below 4.5, respectively). Only milking system [tie-stall systems (28.6%) vs. parlor milking (10%)] and inadequately controlled milking order [yes (32.0%) vs. no (10.7%)] had statistically significant effects on management practices for increasing the risk of Listeria contamination of bulk-tank milk.

  8. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia.

    Science.gov (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe

    2015-11-30

    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  9. Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

    DEFF Research Database (Denmark)

    Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit

    2000-01-01

    A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

  10. Prevalence and level of Listeria monocytogenes and other Listeria sp. in ready-to-eat minimally processed and refrigerated vegetables.

    Science.gov (United States)

    Kovačević, Mira; Burazin, Jelena; Pavlović, Hrvoje; Kopjar, Mirela; Piližota, Vlasta

    2013-04-01

    Minimally processed and refrigerated vegetables can be contaminated with Listeria species bacteria including Listeria monocytogenes due to extensive handling during processing or by cross contamination from the processing environment. The objective of this study was to examine the microbiological quality of ready-to-eat minimally processed and refrigerated vegetables from supermarkets in Osijek, Croatia. 100 samples of ready-to-eat vegetables collected from different supermarkets in Osijek, Croatia, were analyzed for presence of Listeria species and Listeria monocytogenes. The collected samples were cut iceberg lettuces (24 samples), other leafy vegetables (11 samples), delicatessen salads (23 samples), cabbage salads (19 samples), salads from mixed (17 samples) and root vegetables (6 samples). Listeria species was found in 20 samples (20 %) and Listeria monocytogenes was detected in only 1 sample (1 %) of cut red cabbage (less than 100 CFU/g). According to Croatian and EU microbiological criteria these results are satisfactory. However, the presence of Listeria species and Listeria monocytogenes indicates poor hygiene quality. The study showed that these products are often improperly labeled, since 24 % of analyzed samples lacked information about shelf life, and 60 % of samples lacked information about storage conditions. With regard to these facts, cold chain abruption with extended use after expiration date is a probable scenario. Therefore, the microbiological risk for consumers of ready-to-eat minimally processed and refrigerated vegetables is not completely eliminated.

  11. Homology-Based Modeling of Universal Stress Protein from Listeria innocua Up-Regulated under Acid Stress Conditions

    Science.gov (United States)

    Tremonte, Patrizio; Succi, Mariantonietta; Coppola, Raffaele; Sorrentino, Elena; Tipaldi, Luca; Picariello, Gianluca; Pannella, Gianfranco; Fraternali, Franca

    2016-01-01

    An Universal Stress Protein (USP) expressed under acid stress condition by Listeria innocua ATCC 33090 was investigated. The USP was up-regulated not only in the stationary phase but also during the exponential growth phase. The three dimensional (3D) structure of USP was predicted using a combined proteomic and bioinformatics approach. Phylogenetic analysis showed that the USP from Listeria detected in our study was distant from the USPs of other bacteria (such as Pseudomonas spp., Escherichia coli, Salmonella spp.) and clustered in a separate and heterogeneous class including several USPs from Listeria spp. and Lactobacillus spp. An important information on the studied USP was obtained from the 3D-structure established through the homology modeling procedure. In detail, the Model_USP-691 suggested that the investigated USP had a homo-tetrameric quaternary structure. Each monomer presented an architecture analogous to the Rossmann-like α/β-fold with five parallel β-strands, and four α-helices. The analysis of monomer-monomer interfaces and quality of the structure alignments confirmed the model reliability. In fact, the structurally and sequentially conserved hydrophobic residues of the β-strand 5 (in particular the residues V146 and V148) were involved in the inter-chains contact. Moreover, the highly conserved residues I139 and H141 in the region α4 were involved in the dimer association and functioned as hot spots into monomer–monomer interface assembly. The hypothetical assembly of dimers was also supported by the large interface area and by the negative value of solvation free energy gain upon interface interaction. Finally, the structurally conserved ATP-binding motif G-2X-G-9X-G(S/T-N) suggested for a putative role of ATP in stabilizing the tetrameric assembly of the USP. Therefore, the results obtained from a multiple approach, consisting in the application of kinetic, proteomic, phylogenetic and modeling analyses, suggest that Listeria USP could

  12. Homology-based modeling of Universal Stress Protein from Listeria innocua up-regulated under acid stress conditions

    Directory of Open Access Journals (Sweden)

    Patrizio Tremonte

    2016-12-01

    Full Text Available An Universal Stress Protein (USP expressed under acid stress condition by Listeria innocua ATCC 33090 was investigated. The USP was up-regulated not only in the stationary phase but also during the exponential growth phase. The three dimensional (3D structure of USP was predicted using a combined proteomic and bioinformatics approach. Phylogenetic analysis showed that the USP from Listeria detected in our study was distant from the USPs of other bacteria (such as Pseudomonas spp., Escherichia coli, Salmonella spp. and clustered in a separate and heterogeneous class including several USPs from Listeria spp. and Lactobacillus spp. An important information on the studied USP was obtained from the 3D-structure established through the homology modelling procedure. In detail, the Model_USP-691 suggested that the investigated USP had a homo-tetrameric quaternary structure. Each monomer presented an architecture analogous to the Rossmann-like α/β fold with 5 parallel β-strands and 4 α-helices. The analysis of monomer-monomer interfaces and quality of the structure alignments confirmed the model reliability. In fact, the structurally and sequentially conserved hydrophobic residues of the β-strand 5 (in particular the residues V146 and V148 were involved in the inter-chains contact. Moreover, the highly conserved residues I139 and H141 in the region α 4 were involved in the dimer association and functioned as hot spots into monomer-monomer interface assembly. The hypothetical assembly of dimers was also supported by the large interface area and by the negative value of solvation free energy gain upon interface interaction. Finally, the structurally conserved ATP-binding motif G-2X-G-9X-G(S/T-N suggested for a putative role of ATP in stabilizing the tetrameric assembly of the USP. Therefore, the results obtained from a multiple approach, consisting in the application of kinetic, proteomic, phylogenetic and modelling analyses, suggest that Listeria

  13. Antimicrobial Resistance Profiles of Listeria monocytogenes and Listeria innocua Isolated from Ready-to-Eat Products of Animal Origin in Spain.

    Science.gov (United States)

    Escolar, Cristina; Gómez, Diego; Del Carmen Rota García, María; Conchello, Pilar; Herrera, Antonio

    2017-06-01

    The objective of this work was to investigate the antimicrobial resistance in Listeria spp. isolated from food of animal origin. A total of 50 Listeria strains isolated from meat and dairy products, consisting of 7 Listeria monocytogenes and 43 Listeria innocua strains, were characterized for antimicrobial susceptibility against nine antimicrobials. The strains were screened by real-time PCR for the presence of antimicrobial resistance genes: tet M, tet L, mef A, msr A, erm A, erm B, lnu A, and lnu B. Multidrug resistance was identified in 27 Listeria strains, 4 belonging to L. monocytogenes. Resistance to clindamycin was the most common resistance phenotype and was identified in 45 Listeria strains; the mechanisms of resistance are still unknown. A medium prevalence of resistance to tetracycline (15 and 9 resistant and intermediate strains) and ciprofloxacin (13 resistant strains) was also found. Tet M was detected in Listeria strains with reduced susceptibility to tetracycline, providing evidence that both L. innocua and L. monocytogenes displayed acquired resistance. The presence of antimicrobial resistance genes in L. innocua and L. monocytogenes indicates that these genes may be transferred to commensal and pathogenic bacteria via the food chain; besides this, antibiotic resistance in L. monocytogenes could compromise the effective treatment of listeriosis in humans.

  14. A Meta-analysis of the Rates of Listeria monocytogenes and Enterococcus in Febrile Infants.

    Science.gov (United States)

    Leazer, Rianna; Perkins, Amy M; Shomaker, Kyrie; Fine, Bryan

    2016-04-01

    A change in the epidemiology of pathogens causing serious bacterial infection (SBI) has been noted since original recommendations were made for the empirical antibiotic choices for young infants with fever. To assess the prevalence of SBI caused by Listeria monocytogenes and Enterococcus species. A literature search was conducted on keywords related to SBI, L. monocytogenes, and Enterococcus spp. infections. Eligible studies were those conducted in the United States and published between January 1998 and June 2014 focusing on SBI in infants≤90 days of age. The rates of urinary tract infection, bacteremia, and meningitis for each pathogen were recorded for each study. Meta-analysis was performed to calculate the prevalence for each pathogen in a random effects model with 0.5 continuity correction added to studies with zero events. Sixteen studies were included. A total of 20,703 blood cultures were included, with weighted prevalences for L. monocytogenes and Enterococcus spp. bacteremia of 0.03% and 0.09%, respectively. A total of 13,775 cerebrospinal fluid cultures were included with event rates (unweighted prevalences) for L. monocytogenes and Enterococcus spp. meningitis of 0.02% and 0.03%, respectively. A total of 18,283 urine cultures were included, with no cases of L. monocytogenes and a weighted prevalence for Enterococcus spp. urinary tract infection of 0.28%. There may have been reporting bias or incomplete retrieval or inadvertent exclusion of relevant studies. SBI caused by L. monocytogenes and Enterococcus spp. in febrile infants is rare, and therefore clinicians may consider a change in empirical antibiotic choices. Copyright © 2016 by the American Academy of Pediatrics.

  15. Predominance and persistence of a single clone of Listeria ivanovii in a Manchego cheese factory over 6 months.

    Science.gov (United States)

    Vázquez-Villanueva, J; Orgaz, B; Ortiz, S; López, V; Martínez-Suárez, J V; SanJose, C

    2010-09-01

    In an attempt to study the diversity and persistence of molecular subtypes of pathogenic Listeria spp. in a cheese factory at the La Mancha region of Spain, 43 samples were taken from incoming raw milk (cow's, ewe's, goat's and mixed species) and from certain food-contact and environmental surfaces before and/or after sanitation. Of these samples, 12 contained pathogenic Listeria. From the chromogenic agar plates corresponding to those, 46 phosphatidylinositol-specific phospholipase C-positive isolates were randomly taken for further analysis, including biochemical tests and pulsed-field gel electrophoresis (PFGE). They coincided in identifying all the 46 as Listeria ivanovii subsp. ivanovii, apparently a single PFGE type. Both ewe's and goat's raw milk batches from asymptomatic animals tested along the 6-month period persistently carried the same strain, which was also obtained from inner surfaces of raw milk truck tanks and the milk dump tank at the cheese factory. Biofilm-forming abilities of this L. ivanovii clone and interference against L. monocytogenes Scott A reference strain were tested, but failed to account for the clone's apparent pervasive presence. © 2009 Blackwell Verlag GmbH.

  16. Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran

    Directory of Open Access Journals (Sweden)

    Ehsan Shamloo

    2015-01-01

    Full Text Available Aim: The study aimed to assess the prevalence of Listeria spp. in raw milk and traditional non-pasteurized dairy products in Isfahan, Iran. Materials and Methods: A total of 292 samples of raw milk and traditional dairy were examined for the presence of Listeria spp. using a two-step selective enrichment recommended by the United States Department of Agriculture. All isolates were subjected to standard biochemical tests. L. monocytogenes strains were further confirmed by polymerase chain reaction (PCR amplification. Results: Of 292 samples, 21 (7.14% and 4 (1.47% were positive for Listeria spp. and pathogenic L. monocytogenes, respectively. The prevalence of Listeria spp. in raw milk, ice cream, cream, and freni were 5.91 (5.49%, 12.63 (19.04%, 3.27 (11.11% and 1.25 (4%, respectively. Listeria was not detected from yogurt, butter, Kashk, and cheese. Listeria innocua at 16.21 (5.44% was the most prevalent species isolated, followed by L. monocytogenes at 4.21 (19% and L. seeligeri at 1.21 (4.7%. All strains of L. monocytogenes identified by biochemical tests were also confirmed by PCR. Conclusion: The study shows the prevalence of L. monocytogenes in raw milk and traditional dairy products sold in the market. Consumption of raw milk with mild heat treatment or its usage in traditional dishes could pose serious health problems due to lack of appropriate control measures. The lack of knowledge on the risks of listeriosis transmission indicates the need for implementation of a food safety education program. In addition, the Iranian food safety authorities should urgently set up an effective standard to screen all susceptible food products for the presence of Listeria.

  17. Longitudinal studies on Listeria monocytogenes and other Listeria species in two salmon processing plants

    OpenAIRE

    Klæboe, Halvdan; Rosef, Olav; Sæbø, Mona

    2005-01-01

    Two plants processing salmon fillets and cold smoked salmon were investigated for occurrence of Listeria in products and the environment. Analyses were conducted for a period of 31 weeks. At plant A, 252 samples were examined of which 97 were from unprocessed fish and 155 from cold-smoked fish. At plant B, 189 samples of unprocessed fish were investigated. The first examination of unprocessed fish at plant A showed a presence of L. monocytogenes and L. spp. in 81% and 19% of the samples respe...

  18. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during p...

  19. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech

    2000-01-01

    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  20. A Case of Leukocytoclastic Vasculitis Caused by Listeria monocytogenes Bacteremia

    Directory of Open Access Journals (Sweden)

    Daniel R. Bunker

    2016-01-01

    Full Text Available Importance. Infections can cause leukocytoclastic vasculitis. Observations. We report the case of a patient with a left ventricular assist device who presented with acute kidney injury and biopsy proven leukocytoclastic vasculitis. Blood cultures grew Listeria monocytogenes. The patient’s rash improved with treatment of the underlying Listeria infection. Conclusion. Clinicians should be aware that there are a number of broad categories of disease associated with the histologic finding of vasculitis, including infection. It is important to keep in mind the risk factors of a particular patient when formulating a differential diagnosis. This is the first reported case of Listeria bacteremia causing leukocytoclastic vasculitis.

  1. Two new species of coccidia (Apicomplexa: Eimeriidae) from leaf-tailed geckos, Uroplatus spp. (Sauria: Gekkonidae) from Madagascar, including a new host of Eimeria brygooi Upton & Barnard, 1987.

    Science.gov (United States)

    McAllister, Chris T; Scott Seville, R; Hartdegen, Ruston

    2016-10-01

    During May and June 2015, four common leaf-tailed geckos, Uroplatus fimbriatus (Schneider), five satanic leaf-tailed geckos, Uroplatus phantasticus (Boulenger), and four mossy leaf-tailed geckos, Uroplatus sikorae Boettger originally collected from Madagascar and housed at the Dallas Zoo, USA, had their faeces examined for coccidian parasites. Eight (62%) geckos were found to be passing oöcysts, including a new eimerian, a new isosporan and a previously described eimerian. Three of four (75%) U. fimbratus (type-host) and one of five (20%) U. phantasticus were infected with Eimeria schneideri n. sp.; oöcysts were subspheroidal to ellipsoidal with a bi-layered wall and measured (mean length × width, L × W) 15.1 × 13.5 µm, with a length/width (L/W) ratio of 1.1. A micropyle and oöcyst residuum were absent but one to many polar granules were present. Sporocysts were ovoidal, 6.9 × 5.3 µm, L/W = 1.3. Stieda, sub-Stieda and para-Stieda bodies were absent. A globular sporocyst residuum was present as dispersed granules. Four of five (80%) U. phantasticus harboured Isospora boulengeri n. sp.; oöcysts were subpheroidal to ellipsoidal with a bi-layered wall and measured 17.3 × 16.0 µm, L/W = 1.1. A micropyle and oöcyst residuum were absent but a polar granule was present. Sporocysts were ellipsoidal, 9.5 × 6.9 µm, L/W = 1.4. Stieda and sub-Stieda bodies were present but a para-Stieda body was absent. A globular sporocyst residuum was present with dispersed granules. In addition, one of four (25%) U. sikorae was infected with an eimerian indistinguishable from Eimeria brygooi Upton & Barnard, 1987, previously reported from Madagascar day gecko, Phelsuma grandis Gray and golddust day gecko, Phelsuma laticauda (Boettger) from Madagascar. These are the first coccidians described from Uroplatus spp.

  2. Kayseri’de Satışa Sunulan Kanatlı Eti Ürünlerinde Listeria spp. Varlığının Belirlenmesi*

    OpenAIRE

    YERLİKAYA, Osman Burak; YILDIRIM, Yeliz

    2015-01-01

     Bu çalışma, Kayseri’de satışa sunulan kanatlı eti ürünlerinde Listeria türlerinin varlığını belirlemek ve bu ürünlerinlisteriozis açısından taşıdığı halk sağlığı risklerini değerlendirmek amacıyla planlanmıştır. Beş farklı kanatlı eti ürününe (Taşlık,ciğer, nugget, sosis, salam) ait örneklerden 20’şer adet olmak üzere toplam 100 örnek analiz edilmiştir. Örnekler iki aşamalızenginleştirme prosedürünü takiben iki ayrı selektif besi yerine ekim ve biyokimyasal identifikasyon yapılmak s...

  3. Three cryptic species in Asecodes (Förster) (Hymenoptera, Eulophidae) parasitizing larvae of Galerucella spp. (Coleoptera, Chrysomelidae), including a new species

    OpenAIRE

    Hansson,Christer; Hambäck,Peter

    2013-01-01

    Three morphologically very similar species of Asecodes Förster (Hymenoptera: Eulophidae) are reviewed. Asecodes parviclava (Thomson) is removed from synonymy under A. lucens stat. rev., and differentiated from A. lucens (Nees) and A. lineophagum sp. n. All three species develop as gregarious endoparasitoids in larvae of Galerucella spp. (Coleoptera: Chrysomelidae), but each species has its own unique host range. Asecodes lineophagum attacks only Galerucella lineola (Fabr.) and A. lucens ...

  4. Investigating Listeria Outbreaks

    Centers for Disease Control (CDC) Podcasts

    2013-01-04

    Dr. Emily Cartwright, Infectious Disease fellow at Emory University and former EIS Officer with CDC’s Division of Foodborne, Waterborne, and Environmental Diseases discusses foodborne Listeria outbreaks.  Created: 1/4/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 1/8/2013.

  5. Prevalence of listeria, Aeromonas, and Vibrio species in fish used for human consumption in Turkey.

    Science.gov (United States)

    Yücel, Nihal; Balci, Senay

    2010-02-01

    A total of 78 raw retail fish samples from 30 freshwater and 48 marine fish were examined for the presence of Listeria, Aeromonas, and Vibrio species. The overall incidence of Listeria spp. was 30% in freshwater samples and 10.4% in marine fish samples. Listeria monocytogenes (44.5%) was the most commonly isolated species in freshwater fish, and Listeria murrayi (83.5%) was the most commonly isolated species in marine fish samples. Motile aeromonads were more common in marine fish samples (93.7%) than in freshwater fish samples (10%). Vibrio alginolyticus, Vibrio fluvialis, and Vibrio damsela were isolated only in marine fish samples, representing 40.9, 38.6, and 36.3% of Vibrio isolates, respectively. In freshwater and marine fish, the highest incidences of Listeria and Aeromonas were found in skin samples; the highest incidence of Vibrio in marine fish was found in gill samples. The location of Listeria spp. and L. monocytogenes in a fish was significantly different among freshwater fish. A high incidence of these bacterial pathogens was found in the brown trout (Salmo trutta) and horse mackerel (Trachurus trachurus). Handling of contaminated fish, cross-contamination, or eating raw fish might pose a health hazard, especially in immunosuppressed individuals, elderly people, and children. This study highlights the importance of bacterial pathogens in fish intended for human consumption, but more study is needed.

  6. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria innocua over Listeria monocytogenes

    Science.gov (United States)

    Locatelli, Aude; Lewis, Micah A.; Rothrock, Michael J.

    2017-01-01

    The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%), L. monocytogenes (17.4%), and Listeria welshimeri (15.1%). Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate) to determine if culture medium [tripticase soy broth (TSB) and University of Vermont modified Listeria enrichment broth (UVM)], inoculum concentration (102 or 105 CFU/ml), or incubation temperature (20, 30, and 42°C) differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups) under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes. However, cocultures in UVM for high inoculum concentration did not show preferential growth of L. innocua

  7. The Distribution of Listeria in Pasture-Raised Broiler Farm Soils Is Potentially Related to University of Vermont Medium Enrichment Bias toward Listeria innocua over Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Aude Locatelli

    2017-12-01

    Full Text Available The occurrence of Listeria monocytogenes has been widely investigated in the poultry production chain from the processing plant to the final product. However, limited data are available on Listeria species, including Listeria monocytogenes, in the poultry farm environment. Therefore, fecal and soil samples from 37 pastured poultry flocks from 10 all-natural farms over 3 years were assessed to determine the prevalence and diversity of Listeria within these alternative poultry farm environments using standard cultural and molecular methods. Listeria species were isolated in 15% of poultry farm samples and included Listeria innocua (65.7%, L. monocytogenes (17.4%, and Listeria welshimeri (15.1%. Additional multiplex PCR serotyping showed group 1/2a-3a to be the most dominant L. monocytogenes serovar group. Based on these results, monoculture growth experiments were conducted on four Listeria soil isolates (three L. monocytogenes isolates representing the three recovered serovar groups and one L. innocua isolate to determine if culture medium [tripticase soy broth (TSB and University of Vermont modified Listeria enrichment broth (UVM], inoculum concentration (102 or 105 CFU/ml, or incubation temperature (20, 30, and 42°C differentially affected these Listeria species. Overall, very few significant growth differences were observed between the behavior of the three L. monocytogenes isolates (representing the three recovered serovar groups under the growth conditions tested. Alternatively, at 30°C in UVM with the lower inoculum concentration, the L. innocua isolate had a significantly shorter lag phase than the L. monocytogenes isolates. In coculture growth studies under these same incubation conditions, the lag phase of L. innocua and L. monocytogenes was similar, but the final concentration of L. innocua was significantly higher than L. monocytogenes. However, cocultures in UVM for high inoculum concentration did not show preferential growth of

  8. Listeria prevalence and Listeria monocytogenes serovar diversity at cull cow and bull processing plants in the United States.

    Science.gov (United States)

    Guerini, Michael N; Brichta-Harhay, Dayna M; Shackelford, T Steven D; Arthur, Terrance M; Bosilevac, Joseph M; Kalchayanand, Norasak; Wheeler, Tommy L; Koohmaraie, Mohammad

    2007-11-01

    Listeria monocytogenes, the causative agent of epidemic and sporadic listeriosis, is routinely isolated from many sources, including cattle, yet information on the prevalence of Listeria in beef processing plants in the United States is minimal. From July 2005 through April 2006, four commercial cow and bull processing plants were sampled in the United States to determine the prevalence of Listeria and the serovar diversity of L. monocytogenes. Samples were collected during the summer, fall, winter, and spring. Listeria prevalence on hides was consistently higher during cooler weather (28 to 92% of samples) than during warmer weather (6 and 77% of samples). The Listeria prevalence data collected from preevisceration carcass ranged from undetectable in some warm season samples to as high as 71% during cooler weather. Listeria on postintervention carcasses in the chill cooler was normally undetectable, with the exception of summer and spring samples from one plant where > 19% of the carcasses were positive for Listeria. On hides, L. monocytogenes serovar 1/2a was the predominant serovar observed, with serovars 1/2b and 4b present 2.5 times less often and serovar 1/2c not detected on any hides sampled. L. monocytogenes serovars 1/2a, 1/2c, and 4b were found on postintervention carcasses. This prevalence study demonstrates that Listeria species are more prevalent on hides during the winter and spring and that interventions being used in cow and bull processing plants appear to be effective in reducing or eliminating Listeria contamination on carcasses.

  9. Atypical cerebral listeriosis associated with Listeria innocua in a beef bull.

    Science.gov (United States)

    Rocha, Paulo Ricardo Dell'Armelina; Dalmasso, Alessandra; Grattarola, Carla; Casalone, Cristina; Del Piero, Fabio; Bottero, Maria Teresa; Capucchio, Maria Teresa

    2013-02-01

    Natural infections of cattle associated with Listeria innocua have not been reported. This report describes the first case of cerebral listeriosis in a bull due to Listeria innocua. The animal presented neurological signs characterized by weakness, incoordination and recumbency. Histopathologic evaluation of brain tissue revealed multifocal microabscesses, perivascular lymphocytic cuffing, vasculitis, oedema and haemorrhages. All lesions extended from the medulla oblongata to the basal nuclei/parietal cortex area. Indirect immunohistochemistry labelled for Listeria sp. in the brain tissue, but not for Listeria monocytogenes, neurotropic Flaviviruses, BVDV, bovine Herpesvirus 1, Chlamydophila spp. and Histophilus somni. PCR was negative for ovine herpesvirus. L. innocua was isolated from brainstem and identified by biochemical tests (Camp and beta-hemolysis negative). Subsequently, the species was confirmed by a duplex PCR and minisequencing assays. L. innocua should be histologically considered as a differential diagnosis of thrombotic meningoencephalitis, malignant catarrhal fever and cerebral listeriosis due to L. monocytogenes in cattle. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Prevalence, characterization and sources of Listeria monocytogenes in blue crab (Callinectus sapidus) meat and blue crab processing plants.

    Science.gov (United States)

    Pagadala, Sivaranjani; Parveen, Salina; Rippen, Thomas; Luchansky, John B; Call, Jeffrey E; Tamplin, Mark L; Porto-Fett, Anna C S

    2012-09-01

    Seven blue crab processing plants were sampled to determine the prevalence and sources of Listeria spp. and Listeria monocytogenes for two years (2006-2007). A total of 488 raw crabs, 624 cooked crab meat (crab meat) and 624 environmental samples were tested by standard methods. Presumptive Listeria spp. were isolated from 19.5% of raw crabs, 10.8% of crab meat, and 69.5% of environmental samples. L. monocytogenes was isolated from 4.5% of raw crabs, 0.2% of crab meat, and 2.1% of environmental samples. Ninety-seven percent of the isolates were resistant to at least one of the ten antibiotics tested. Eight different serotypes were found among 76 L. monocytogenes isolates tested with the most common being 4b, 1/2b and 1/2a. Automated EcoRI ribotyping differentiated 11 ribotypes among the 106 L. monocytogenes isolates. Based on ribotyping analysis, the distribution of the ribotypes in each processing plant had a unique contamination pattern. A total of 92 ApaI and 88 AscI pulsotypes among the 106 L. monocytogenes isolates were found and distinct pulsotypes were observed in raw crab, crab meat and environmental samples. Ribotypes and serotypes recovered from crab processing plants included subtypes that have been associated with listeriosis cases in other food outbreaks. Our findings suggest that molecular methods may provide critical information about sources of L. monocytogenes in crab processing plants and will augment efforts to improve food safety control strategies such as targeting specific sources of contamination and use of aggressive detergents prior to sanitizing. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Two cases of listeria rhombencephalitis

    Directory of Open Access Journals (Sweden)

    Christopher Thomas Mansbridge

    2018-01-01

    Full Text Available Listeria rhombencephalitis (LRE is a rare encephalitis of the hindbrain that can present with a variety of neurological symptoms. It is a diagnostic challenge, but prompt antimicrobial therapy is important to prevent high rates of mortality and morbidity. We report two cases of LRE, with several contrasting clinical features and different disease courses. Despite being rare, it is important to consider listeria in patients with possible meningoencephalitis, even if cultures are negative. Empirical treatment of meningoencephalitis should provide coverage for listeria, especially if the patient is at risk of listeriosis or there is a potential history of listeria exposure.

  12. Prevalence of Listeria Species in Ready-to-Eat Food in Shahrekord Restaurants

    OpenAIRE

    Rahimi, E; Shakerian, A. (PhD

    2014-01-01

    Background and Objective: Listeria bacteria with worldwide widespread are commonly found in soil, sewage, dust and water. Among which,Listeria monocytogenes can cause a serious food-borne disease. The objective of this study was to investigate the prevalence of Listeria species in ready-to-eat foods. Material and Methods: The samples (n=235) including oloveyh salad (n = 64), Yogurt stew (n= 35), vegetable salad (n=52), macaroni salad (n= 48) and meat salad (n =36) were collected from the rest...

  13. Airborne Salmonella and Listeria associated with Irish commercial beef, sheep and pig plants.

    Science.gov (United States)

    Okraszewska-Lasica, Wioletta; Bolton, D J; Sheridan, J J; McDowell, D A

    2014-06-01

    Air samples from lairage, hide/fleece pulling or dehairing/scraping, evisceration and chilling areas in commercial beef, sheep and pig plants were examined for Salmonella spp. and Listeria monocytogenes, by impaction or sedimentation onto selective (Brilliant Green Agar, BSA; Listeria Selective Agar, LSA) and non-selective (Plate Count Agar, PCA) media. Both pathogens were frequently detected in all three plants. Improved recoveries were achieved by combining sedimentation, and broth based resuscitation, suggesting cell injury. Salmonella were recovered from all three plants, with the highest counts on BGA in the pig plant. The most common serotypes were S. Typhimurium in the beef/sheep plants and S. Derby in the pig plant. Very low counts of L. monocytogenes (e.g. 2.6CFUm(2)) were detected at hide removal on LSA sedimentation plates in the beef plant. These included serogroup 1/2a-3a and 1/2b-3b-7. Pathogen counts in the three plants were generally very low, suggesting that air is unlikely to be a significant source of carcass or plant surface contamination. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Formylpeptide receptors are critical for rapid neutrophil mobilization in host defense against Listeria monocytogenes

    Science.gov (United States)

    Liu, Mingyong; Chen, Keqiang; Yoshimura, Teizo; Liu, Ying; Gong, Wanghua; Wang, Aimin; Gao, Ji-Liang; Murphy, Philip M.; Wang, Ji Ming

    2012-01-01

    Listeria monocytogenes (Listeria) causes opportunistic infection in immunocompromised hosts with high mortality. Resistance to Listeria depends on immune responses and recruitment of neutrophils of the immune system into infected sites is an early and critical step. Mouse neutrophils express two G protein-coupled formylpeptide receptor subtypes Fpr1 and Fpr2 that recognize bacterial and host-derived chemotactic molecules including Listeria peptides for cell migration and activation. Here we report deficiency in Fprs exacerbated the severity of the infection and increased the mortality of infected mice. The mechanism involved impaired early neutrophil recruitment to the liver with Fpr1 and Fpr2 being sole receptors for neutrophils to sense Listeria chemoattractant signals and for production of bactericidal superoxide. Thus, Fprs are essential sentinels to guide the first wave of neutrophil infiltration in the liver of Listeria-infected mice for effective elimination of the invading pathogen. PMID:23139859

  15. Specific gene probe for detection of biotyped and serotyped Listeria strains.

    OpenAIRE

    Notermans, S; Chakraborty, T; Leimeister-Wächter, M; Dufrenne, J; Heuvelman, K J; Maas, H; Jansen, W; Wernars, K; Guinee, P

    1989-01-01

    A total of 284 strains of Listeria, including all known serovars and biovars together with Listeria grayi and Listeria murrayi, were biotyped and serotyped. Biotyping and serotyping could be done in 2 days. A gene probe encoding a delayed hypersensitivity factor (DTH) was used in the detection of pathogenic biotypes and serotypes of the tested strains. The gene was found in all 117 tested Listeria monocytogenes strains of serogroups 1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4c, 4d, 4e, 4ab, and 7. It was...

  16. Modelling and predicting the simultaneous growth of Listeria monocytogenes and psychrotolerant lactic acid bacteria in processed seafood and mayonnaise-based seafood salads

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Dalgaard, Paw

    2015-01-01

    A new combined model for Listeria monocytogenes and psychrotolerant Lactobacillus spp. was constructed and evaluated for processed seafood and mayonnaise-based seafood salads. The new model was constructed by combining existing cardinal parameter models for L. monocytogenes and Lactobacillus spp....

  17. Prevalence of Listeria Species in Ice Creams Sold in The Cities of Kahramanmaraş and Adana

    OpenAIRE

    AKMAN, Deniz; DURAN, Nizami; DIĞRAK, Metin

    2004-01-01

    In this study, the prevalence of Listeria spp. was investigated in the ice cream samples collected from the downtown stores of Kahramanmaras (28 samples) and Adana (30 samples). A total of 58 ice cream samples were analysed by the Food and Drug Administration (FDA) two-stage enrichment techniques. Growth of Listeria spp. was determined in 14 (24.1%) of the samples collected from Kahramanmaras and 10 (17.2%) samples from Adana. The results of the biochemical tests revealed that the bacterial g...

  18. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model.

    Directory of Open Access Journals (Sweden)

    Mira Rakic Martinez

    Full Text Available Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1 confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2 assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3 virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50 and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P < 0.05 higher LT50 (lower virulence than the wild type L. monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P < 0.05 higher LT50 than the wild type strain at the inoculum of 106CFU/larva. Food isolates had significantly (P < 0.05 lower virulence than the paired clinical isolates, at all three inoculum concentrations. L. monocytogenes strains related to non-invasive (gastroenteritis outbreaks of listeriosis showed significantly (P < 0.05 lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in

  19. Three cryptic species in Asecodes (Förster (Hymenoptera, Eulophidae parasitizing larvae of Galerucella spp. (Coleoptera, Chrysomelidae, including a new species

    Directory of Open Access Journals (Sweden)

    Christer Hansson

    2013-01-01

    Full Text Available Three morphologically very similar species of Asecodes Förster (Hymenoptera: Eulophidae are reviewed. Asecodes parviclava (Thomson is removed from synonymy under A. lucens stat. rev., and differentiated from A. lucens (Nees and A. lineophagum sp. n. All three species develop as gregarious endoparasitoids in larvae of Galerucella spp. (Coleoptera: Chrysomelidae, but each species has its own unique host range. Asecodes lineophagum attacks only Galerucella lineola (Fabr. and A. lucens only G. sagittariae (Gyllenhal, whereas A. parviclava parasitizes G. tenella (L., G. calmariensis (L. and G. pusilla (Duftschmid. The Asecodes species are similar but display small though distinct morphological differences, and are distinguished also through molecular differences. The genetic distance in mitochondrial CO1 ranged from 2.3% to 7.3% between the species. Five names, one valid and four synonyms, were available for this group of species, but none of them was linked to a primary type. To promote stability of nomenclature, primary types are designated for all five names, neotypes for Eulophus lucens Nees, Entedon mento Walker and Derostenus parviclava Thomson, and lectotypes for Entedon chthonia Walker and Entedon metagenes Walker. Entedon mento, E. chthonia and E. metagenes remain synonymized under A. lucens.

  20. Prevalence and antimicrobial resistance of Listeria monocytogenes isolated in chicken slaughterhouses in Northern Greece.

    Science.gov (United States)

    Sakaridis, I; Soultos, N; Iossifidou, E; Papa, A; Ambrosiadis, I; Koidis, P

    2011-06-01

    This study was conducted to determine the prevalence and antimicrobial resistance of Listeria monocytogenes recovered from chicken carcasses in slaughterhouses in Northern Greece. A total of 100 poultry samples (300 carcasses) were examined for Listeria spp. The samples were neck skin taken from four different slaughterhouses in Northern Greece. Forty samples were also taken from the environment of the slaughterhouses. Identification of L. monocytogenes was carried out by PCR and fingerprinting of the isolates by random amplified polymorphic DNA. L. monocytogenes strains isolated from chicken carcasses and from the environment of the slaughterhouses were also examined for antibiotic resistance. Fifty-five isolates of L. monocytogenes were tested for susceptibility to 20 antibiotics using the disk diffusion method. Listeria spp. were present in 99 of the poultry samples tested (99%), and 38 yielded L monocytogenes (38%). L. monocytogenes was also isolated in 80% of samples from the environment of a certain slaughterhouse, while the other slaughterhouses were found to be contaminated only with Listeria spp. All isolates were resistant to nalidixic acid and oxolinic acid, the majority of them to clindamycin, and only a few to tetracycline and oxytetracycline, whereas they were found to be susceptible to all other antimicrobials. The results of this study demonstrate a high prevalence of L. monocytogenes contamination in chicken carcasses, and all isolates were found to be sensitive to the antimicrobials most commonly used to treat human listeriosis.

  1. Confirmed low prevalence of Listeria mastitis in she-camel milk delivers a safe, alternative milk for human consumption.

    Science.gov (United States)

    Osman, Kamelia M; Samir, Ahmed; Orabi, Ahmed; Zolnikov, Tara Rava

    2014-02-01

    She-camel milk is an alternative solution for people allergic to milk; unfortunately, potential harmful bacteria have not been tested in she-camel milk. Listeria monocytogenes is one harmful bacterium that causes adverse health effects if chronically or acutely ingested by humans. The purpose of this study was to estimate the prevalence, characterize the phenotypic, genetic characterization, virulence factors, and antibiopotential harmful bacteria resistance profile of Listeria isolated from the milk of she-camel. Udder milk samples were collected from 100 she-camels and screened for mastitis using the California mastitis test (46 healthy female camels, 24 subclinical mastitic animals and 30 clinical mastitic animals). Samples were then examined for the presence of pathogenic Listeria spp; if located, the isolation of Listeria was completed using the International Organization for Standards technique to test for pathogenicity. The isolates were subjected to PCR assay for virulence-associated genes. Listeria spp. were isolated from 4% of samples and only 1.0% was confirmed as L. monocytogenes. The results of this study provide evidence for the low prevalence of intramammary Listeria infection; additionally, this study concludes she-camel milk in healthy camels milked and harvested in proper hygienic conditions may be used as alternative milk for human consumption. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Occurrence of Listeria monocytogenes in cheese and ice cream produced in the State of Paraná, Brazil Ocorrência de Listeria monocytogenes em queijos e sorvetes produzidos no Estado do Paraná, Brasil

    Directory of Open Access Journals (Sweden)

    Wanda Moscalewski Abrahão

    2008-06-01

    Full Text Available The occurrence of Listeria monocytogenes in Brazilian ice cream and in some soft and semi-soft cheeses produced and sold in the State of Paraná, Brazil was evaluated. Ninety samples of cheese and sixty samples of ice creams were analyzed following the guidelines outlined by the official institutes, AOAC and FDA. In the ice cream samples no isolation of Listeria spp. was found. The percentage of these ninety samples of cheeses positive for Listeria spp. was 12.20%. Listeria monocytogenes was detected in six (6.70% of the same samples. The presence of Listeria innocua was five (5.50% in the samples analyzed was also observed. According to the results of the work it is possible to presume that there is a potential health risk to the brazilian population, heightened by aging and the increase in immunodepressed. These results indicate the need for the implementation of monitoring of these microorganisms as much by producers as by health inspectors. The results also show that the VIP (visual immunoprecipitation assay is a viable triage method of contaminated samples for the liberation of products for commercialization, as it is quick, reliable and does not require additional equipment other than that normally found in production labs, while presenting reliable results.A ocorrência de Listeria monocytogenes em sorvetes e alguns tipos de queijos macios e semi-macios produzidos e vendidos no Estado do Paraná Brasil foram avaliados. Noventa amostras de queijo e sessenta amostras de sorvete foram analisadas seguindo os protocolos da AOAC e FDA. Nas amostras de sorvete, não ocorreu o isolamento de Listeria spp. Foi detectada Listeria spp em 12,20% de amostras de queijo, das quais 6 (6,70% foram positivas para Listeria monocytogenes. Foi também observada a presença de Listeria innocua em 5 amostras (5,50% das mesmas amostras. Pelos resultados deste trabalho pode-se pressupor que existe um risco potencial à saúde da população brasileira com o

  3. Prevalence and contamination patterns of Listeria monocytogenes in catfish processing environment and fresh fillets.

    Science.gov (United States)

    Chen, Bang-Yuan; Pyla, Rajkumar; Kim, Tae-Jo; Silva, Juan L; Jung, Yean-Sung

    2010-08-01

    Catfish skins, intestines, fresh fillets, processing surfaces at different production stages, chiller water and non-food contact surfaces were sampled for Listeria monocytogenes and other Listeria species. Among 315 samples, prevalence of L. monocytogenes, Listeria innocua and a group of Listeria seeligeri-Listeria welshimeri-Listeria ivanovii was 21.6, 13.0 and 29.5%, respectively. No Listeria grayi was detected in this survey. While no L. monocytogenes strains were isolated from catfish skins and intestines, the strains were found with a frequency of 76.7% in chilled fresh catfish fillets and 43.3% in unchilled fillets. L. monocytogenes and Listeria spp. were also detected in fish contact surfaces such as deheading machine, trimming board, chiller water, conveyor belts at different stages, and fillet weighing table. Among L. monocytogenes, 1/2b (47.0%), 3b (16.0%) and 4c (14%) were the predominant serotypes isolated, whereas 4b, 4e, 1/2c and 1/2a were detected at much lower frequencies. Genotype analyses of L. monocytogenes isolates using serotyping, pulsed-field gel electrophoresis (PFGE) and enterobacterial repetitive intergenic consensus (ERIC)-PCR revealed that chiller water represented an important contamination source of L. monocytogenes in the chilled catfish fillets of two processing facilities, whereas fillet weighing table significantly contributed to the catfish fillet contamination of the third facility. This study suggests that L. monocytogenes contamination in the processed catfish fillets originates from the processing environment, rather than directly from catfish. Results from this study can aid the catfish industry to develop a plant-specific proper cleaning and sanitation procedure for equipment and the processing environment designed to specifically target L. monocytogenes contamination. Copyright 2010 Elsevier Ltd. All rights reserved.

  4. Efficacies of nisin A and nisin V semipurified preparations alone and in combination with plant essential oils for controlling Listeria monocytogenes.

    Science.gov (United States)

    Field, Des; Daly, Karen; O'Connor, Paula M; Cotter, Paul D; Hill, Colin; Ross, R Paul

    2015-04-01

    The food-borne pathogenic bacterium Listeria is known for relatively low morbidity and high mortality rates, reaching up to 25 to 30%. Listeria is a hardy organism, and its control in foods represents a significant challenge. Many naturally occurring compounds, including the bacteriocin nisin and a number of plant essential oils, have been widely studied and are reported to be effective as antimicrobial agents against spoilage and pathogenic microorganisms. The aim of this study was to investigate the ability of semipurified preparations (SPP) containing either nisin A or an enhanced bioengineered derivative, nisin V, alone and in combination with low concentrations of the essential oils thymol, carvacrol, and trans-cinnamaldehyde, to control Listeria monocytogenes in both laboratory media and model food systems. Combinations of nisin V-containing SPP (25 μg/ml) with thymol (0.02%), carvacrol (0.02%), or cinnamaldehyde (0.02%) produced a significantly longer lag phase than any of the essential oil-nisin A combinations. In addition, the log reduction in cell counts achieved by the nisin V-carvacrol or nisin V-cinnamaldehyde combinations was twice that of the equivalent nisin A-essential oil treatment. Significantly, this enhanced activity was validated in model food systems against L. monocytogenes strains of food origin. We conclude that the fermentate form of nisin V in combination with carvacrol and cinnamaldehyde offers significant advantages as a novel, natural, and effective means to enhance food safety by inhibiting food-borne pathogens such as L. monocytogenes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. 16S rRNA partial gene sequencing for the differentiation and molecular subtyping of Listeria species.

    Science.gov (United States)

    Hellberg, Rosalee S; Martin, Keely G; Keys, Ashley L; Haney, Christopher J; Shen, Yuelian; Smiley, R Derike

    2013-12-01

    Use of 16S rRNA partial gene sequencing within the regulatory workflow could greatly reduce the time and labor needed for confirmation and subtyping of Listeria monocytogenes. The goal of this study was to build a 16S rRNA partial gene reference library for Listeria spp. and investigate the potential for 16S rRNA molecular subtyping. A total of 86 isolates of Listeria representing L. innocua, L. seeligeri, L. welshimeri, and L. monocytogenes were obtained for use in building the custom library. Seven non-Listeria species and three additional strains of Listeria were obtained for use in exclusivity and food spiking tests. Isolates were sequenced for the partial 16S rRNA gene using the MicroSeq ID 500 Bacterial Identification Kit (Applied Biosystems). High-quality sequences were obtained for 84 of the custom library isolates and 23 unique 16S sequence types were discovered for use in molecular subtyping. All of the exclusivity strains were negative for Listeria and the three Listeria strains used in food spiking were consistently recovered and correctly identified at the species level. The spiking results also allowed for differentiation beyond the species level, as 87% of replicates for one strain and 100% of replicates for the other two strains consistently matched the same 16S type. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆

    Science.gov (United States)

    Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike

    2016-01-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325

  7. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth.

    Science.gov (United States)

    Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike

    2015-04-01

    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

  8. Prevalence of Listeria monocytogenes in Retail Lightly Pickled Vegetables and Its Successful Control at Processing Plants.

    Science.gov (United States)

    Taguchi, Masumi; Kanki, Masashi; Yamaguchi, Yuko; Inamura, Hideichi; Koganei, Yosuke; Sano, Tetsuya; Nakamura, Hiromi; Asakura, Hiroshi

    2017-03-01

    Incidences of food poisoning traced to nonanimal food products have been increasingly reported. One of these was a recent large outbreak of Shiga toxin-producing Escherichia coli (STEC) O157 infection from the consumption of lightly pickled vegetables, indicating the necessity of imposing hygienic controls during manufacturing. However, little is known about the bacterial contamination levels in these minimally processed vegetables. Here we examined the prevalence of STEC, Salmonella spp., and Listeria monocytogenes in 100 lightly pickled vegetable products manufactured at 55 processing factories. Simultaneously, we also performed quantitative measurements of representative indicator bacteria (total viable counts, coliform counts, and β-glucuronidase-producing E. coli counts). STEC and Salmonella spp. were not detected in any of the samples; L. monocytogenes was detected in 12 samples manufactured at five of the factories. Microbiological surveillance at two factories (two surveys at factory A and three surveys at factory B) between June 2014 and January 2015 determined that the areas predominantly contaminated with L. monocytogenes included the refrigerators and packaging rooms. Genotyping provided further evidence that the contaminants found in these areas were linked to those found in the final products. Taken together, we demonstrated the prevalence of L. monocytogenes in lightly pickled vegetables sold at the retail level. Microbiological surveillance at the manufacturing factories further clarified the sources of the contamination in the retail products. These data indicate the necessity of implementing adequate monitoring programs to minimize health risks attributable to the consumption of these minimally processed vegetables.

  9. Antimicrobial-resistant Listeria species from retail meat in metro Detroit.

    Science.gov (United States)

    da Rocha, Liziane S; Gunathilaka, Gayathri U; Zhang, Yifan

    2012-12-01

    A total of 138 Listeria isolates from retail meat, including 58 Listeria welshimeri, 44 Listeria monocytogenes, and 36 Listeria innocua isolates, were characterized by antimicrobial susceptibility tests against nine antimicrobials. In addition, the 44 L. monocytogenes isolates were analyzed by serotype identification using PCR and genotyping using pulsed-field gel electrophoresis. Resistance to one or two antimicrobials was observed in 32 Listeria isolates (23.2%). No multidrug resistance was identified. Tetracycline resistance was the most common resistance phenotype and was identified in 22 Listeria isolates. A low prevalence of resistance to ciprofloxacin, erythromycin, gentamicin, and vancomycin was also detected. L. innocua isolates demonstrated the highest overall prevalence of antimicrobial resistance, 36.1%, followed by 34.1% in L. monocytogenes isolates and 6.9% in L. welshimeri isolates. Serotypes 1/2a, 1/2b, and 4b were identified in 19, 23, and 1 L. monocytogenes isolate, respectively. One isolate was untypeable. Fifteen L. monocytogenes isolates were antimicrobial resistant (12 were serotype 1/2b, 2 were 1/2a, and 1 was untypeable). A diverse population of L. monocytogenes isolates was identified, as evidenced by multiple pulsed-field gel electrophoresis patterns in the 44 isolates. The data indicate that Listeria contamination is common in retail meat. Although antimicrobial resistance still occurs at a low prevalence, multiple Listeria species can serve as reservoirs of antimicrobial resistance. Various antimicrobial susceptibilities may exist in L. monocytogenes isolates of different serotypes.

  10. Determinaci?n de Listeria monocytogenes en quesos blancos artesanales expendidos en la plaza de mercado de C?queza, Cundinamarca

    OpenAIRE

    Baquero Acu?a, Deissy Milena; Bernal Gonz?lez, Astrid Marcela; Campuzano, Silvia

    2006-01-01

    Las intoxicaciones alimentar?as son un problema de salud p?blica, ya que estas se presentan en cualquier tipo de poblaci?n aumentando la prevalencia en personas inmunosuprimidas, mujeres embarazadas y personas de edad avanzada. Seg?n los datos obtenidos, el 80% de las muestras positivas para Listeria spp presentaron Listeria monocytogenes y el 20% Listeria innocua, indicando una prevalencia de la especie pat?gena para los humanos, aumentando el riesgo en la poblaci?n de padecer enfermedades g...

  11. Modeling of spatially referenced environmental and meteorological factors influencing the probability of Listeria species isolation from natural environments.

    Science.gov (United States)

    Ivanek, R; Gröhn, Y T; Wells, M T; Lembo, A J; Sauders, B D; Wiedmann, M

    2009-09-01

    Many pathogens have the ability to survive and multiply in abiotic environments, representing a possible reservoir and source of human and animal exposure. Our objective was to develop a methodological framework to study spatially explicit environmental and meteorological factors affecting the probability of pathogen isolation from a location. Isolation of Listeria spp. from the natural environment was used as a model system. Logistic regression and classification tree methods were applied, and their predictive performances were compared. Analyses revealed that precipitation and occurrence of alternating freezing and thawing temperatures prior to sample collection, loam soil, water storage to a soil depth of 50 cm, slope gradient, and cardinal direction to the north are key predictors for isolation of Listeria spp. from a spatial location. Different combinations of factors affected the probability of isolation of Listeria spp. from the soil, vegetation, and water layers of a location, indicating that the three layers represent different ecological niches for Listeria spp. The predictive power of classification trees was comparable to that of logistic regression. However, the former were easier to interpret, making them more appealing for field applications. Our study demonstrates how the analysis of a pathogen's spatial distribution improves understanding of the predictors of the pathogen's presence in a particular location and could be used to propose novel control strategies to reduce human and animal environmental exposure.

  12. PRÉVALENCE DE LISTERIA MONOCYTOGENES DANS LE LAIT CRU DE VACHE AU LIBAN NORD

    Directory of Open Access Journals (Sweden)

    Imad al Kassaa

    2016-06-01

    Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

  13. Long-term mortality in patients diagnosed with Listeria monocytogenes meningitis: A Danish nationwide cohort study

    DEFF Research Database (Denmark)

    Roed, Casper; Engsig, Frederik Neess; Omland, Lars Haukali

    2012-01-01

    OBJECTIVES: To determine the long-term mortality, the causes of death and the incidence of cancer in listeria meningitis patients. METHODS: Nationwide, population-based cohort study including all adult patients diagnosed with listeria meningitis from 1977 to 2006 and alive 1 year after diagnosis......, and an age-and gender-matched, population control cohort. Kaplan-Meier tables, Cox regression analysis and cumulative incidence function were used as outcome analyses. RESULTS: We identified 114 listeria meningitis patients and 1026 population controls. The adjusted mortality rate ratio (MRR) for listeria...... meningitis patients the first 5 years of follow-up was 2.35(95% confidence interval (CI) 1.60-3.45) thereafter the MRR was 0.93(95% CI: 0.56-1.55). Listeria meningitis patients had an increased risk of death due to cancer the first 5 years of follow-up, and in the same period patients above 50 years of age...

  14. Performance of Isfahan North Wastewater Treatment Plant in the Removal of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    nahid Navijouy

    2013-08-01

    Full Text Available Listeria and in particular Listeria monocytogenes is considered a ubiquitous foodborne pathogen which can lead listeriosis in human and animals. Listeriosis can be serious and may cause meningitis, septicemia and abortion in pregnant women. Although wastewater or sludge may contaminate foods of plant origin, there are no data on occurrence of Listeria spp. in wastewater and sludge in Iran. The purpose of current investigation was to study the occurrence of Listeria spp. in various samples of wastewater and sludge in Isfahan North wastewater treatment plant. Influent, effluent, raw sludge and dried sludge samples were collected from Isfahan North municipal wastewater treatment plant. L. monocytogenes were enumerated by a three–tube most probable number (MPN assay using enrichment Fraser broth. A total of 65 various samples from five step in 13 visits were collected. The presence of Listeria spp. also was determined using USDA procedure. Then, phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction amplification. L. monocytogenes isolated from 76.9%, 38.5%, 84.6%, 69.2% and 46.2% of influent, effluent, raw sludge, stabilized sludge and dried sludge respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal L. monocytogenes were 69.6%, 64.7% and 73.4% respectively. All phenotypically identified L. monocytogenes were further confirmed by Polymerase Chain Reaction. The results of present study have shown that Listeriaspp. and L. monocytogenes in particular, were present in wastewater treatment plant effluents and sludge at high level. The bacteria may spread on agriculture land and contaminate foods of plant origin. This may cause a risk of spreading disease to human and animals.

  15. The search of Listeria and Salmonella in different food matrices

    International Nuclear Information System (INIS)

    Ben Saad, Emna

    2010-01-01

    The foods safety and security does not cease to be a priority. Although foods contaminants generate changes in the sensory characteristics, they may cause diseases and pose a risk to human health. This study includes a targeted search of two food borne pathogens Listeria and Salmonella responsible respectively of two serious infections listeriosis and salmonellosis. 100 Food samples taken from the market for public consumption are analyzed in the CNSTN laboratory of microbiology and molecular biology. Once isolated (eight strains of Listeria and one of Salmonella), the strains were identified by Api (Listeria and 20E) and PCR. The results obtained show the ability of our products to be contaminated which arise the importance of strengthening measures of prevention and health control.

  16. Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

    DEFF Research Database (Denmark)

    Gaini, Shahin

    2015-01-01

    A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....

  17. Listeria floridensis sp. nov., Listeria aquatica sp. nov., Listeria cornellensis sp. nov., Listeria riparia sp. nov. and Listeria grandensis sp. nov., from agricultural and natural environments.

    Science.gov (United States)

    den Bakker, Henk C; Warchocki, Steven; Wright, Emily M; Allred, Adam F; Ahlstrom, Christina; Manuel, Clyde S; Stasiewicz, Matthew J; Burrell, Angela; Roof, Sherry; Strawn, Laura K; Fortes, Esther; Nightingale, Kendra K; Kephart, Daniel; Wiedmann, Martin

    2014-06-01

    Sampling of agricultural and natural environments in two US states (Colorado and Florida) yielded 18 Listeria-like isolates that could not be assigned to previously described species using traditional methods. Using whole-genome sequencing and traditional phenotypic methods, we identified five novel species, each with a genome-wide average BLAST nucleotide identity (ANIb) of less than 85% to currently described species. Phylogenetic analysis based on 16S rRNA gene sequences and amino acid sequences of 31 conserved loci showed the existence of four well-supported clades within the genus Listeria; (i) a clade representing Listeria monocytogenes, L. marthii, L. innocua, L. welshimeri, L. seeligeri and L. ivanovii, which we refer to as Listeria sensu stricto, (ii) a clade consisting of Listeria fleischmannii and two newly described species, Listeria aquatica sp. nov. (type strain FSL S10-1188(T) = DSM 26686(T) = LMG 28120(T) = BEI NR-42633(T)) and Listeria floridensis sp. nov. (type strain FSL S10-1187(T) = DSM 26687(T) = LMG 28121(T) = BEI NR-42632(T)), (iii) a clade consisting of Listeria rocourtiae, L. weihenstephanensis and three novel species, Listeria cornellensis sp. nov. (type strain TTU A1-0210(T) = FSL F6-0969(T) = DSM 26689(T) = LMG 28123(T) = BEI NR-42630(T)), Listeria grandensis sp. nov. (type strain TTU A1-0212(T) = FSL F6-0971(T) = DSM 26688(T) = LMG 28122(T) = BEI NR-42631(T)) and Listeria riparia sp. nov. (type strain FSL S10-1204(T) = DSM 26685(T) = LMG 28119(T) = BEI NR- 42634(T)) and (iv) a clade containing Listeria grayi. Genomic and phenotypic data suggest that the novel species are non-pathogenic. © 2014 IUMS.

  18. Performance of the municipal wastewater treatment plant for removal of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nahid Navidjouy

    2013-01-01

    Full Text Available Aims: The aim of present study was determination of occurrence of Listeria Listeria spp. in various point of a municipal wastewater treatment plant. Materials and Methods: The samples were collected of influent, effluent, raw sludge, stabilized sludge and dried sludge from north wastewater treatment plant Isfahan, Iran. The presence of Listeria spp. was determined using USDA procedure and enumerated by a three-tube most probable number assay using Fraser enrichment broth. Then, biochemically identified Listeria monocytogenes was further confirmed by PCR amplification. Results: L. monocytogenes, L. innocua and L. seeligeri were isolated from 76.9%, 23.1% and 23.1% of influent, 38.5%, 46.2% and 7.7% of effluent, 84.6%, 69.2% and 46.2% of raw sludge, 69.2%, 76.9% and 0% of stabilized sludge and 46.2%, 7.7% and 0% of dried sludge samples, respectively. The efficiency of wastewater treatment processes, digester tank and drying bed in removal of L. monocytogenes were 69.6%, 64.7% and 73.4%, respectively. All phenotypically identified L. monocytogenes were further confirmed by PCR method. Conclusion: Application of sewage sludge in agricultural farms as fertilizer may result in bacteria spreading in agriculture fields and contaminated foods with plant origin. This may cause a risk of spreading disease to human and animals. Using parameters such as BOD 5 is not sufficient standard for the elimination of pathogenic microorganisms.

  19. Listeria Endocarditis: A Diagnostic Challenge

    Directory of Open Access Journals (Sweden)

    Wilhelmina J. A. R. M. Valckx MD

    2017-04-01

    Full Text Available A 74-year-old hemodialysis patient with a history of an atrial septum defect closure, coronary bypass surgery, and a St. Jude aortic prosthetic valve was diagnosed with pneumonia and volume overload. Blood cultures were positive for Listeria monocytogenes, and amoxicillin was given for 2 weeks. Immediately after discontinuation of amoxicillin, fever relapsed. Transthoracic and transesophageal echocardiography showed no sign of endocarditis. Given the fever relapse and 3 positive minor Duke criteria, an 18F-FDG PET-CT scan (18F-fluorodeoxyglucose-positron emission tomography-computed tomography scan was performed. This scan showed activity at the aortic root, proximal ascending aorta, and inferior wall of the heart, making Listeria monocytogenes endocarditis a likely explanation. Amoxicillin was given for 6 weeks with good clinical result. Diagnosing a life-threatening Listeria monocytogenes endocarditis can be challenging and an 18F-FDG PET-CT scan can be helpful.

  20. Listeria monocytogenes Monographic Study

    Directory of Open Access Journals (Sweden)

    Emil Tirziu

    2010-05-01

    Full Text Available Listeria monocytogenes is a ubiquitous bacteria with a remarkable resistance in discordant condition which produce listeriosis, an infectious disease that affects multiple domestic and wild animals’ species, but also humans. Receptive to listeriosis are the majority of domestic or wild mammals and birds, in the last years being registered an increase of receptivity in humans. The concept of listeriosis in human pathology, a disease caused by eating or drinking contaminated food and water, appeared for the first time in 1981, during an outbreak in Canada with seven cases in adults and 34 cases of maternalfetal listeriosis. The alimentary origin of human listeriosis can be easily explained if considered some general characteristics of the bacteria. Thus, resistance in various conditions, especially at lower temperatures, justifies its dissemination and food contamination, particularly when is conserved by refrigeration. Also, L. monocytogenes has a significant presence in alimentary products. Some studies showed that 4% of the milk products, 29% of the meat products, 5% of the vegetable products and 26% of the products obtained from fishes and shell fishes are positive for L. monocytogenes, which allows us to say that battle against these bacteria is a war against microbial contamination.

  1. Prevalence and level of Listeria monocytogenes and other Listeria species in retail pre-packaged mixed vegetable salads in the UK.

    Science.gov (United States)

    Little, C L; Taylor, F C; Sagoo, S K; Gillespie, I A; Grant, K; McLauchlin, J

    2007-01-01

    As part of the European Commission (EC) co-ordinated programme for 2005, a study of pre-packaged ready-to-eat (RTE) mixed salads containing meat or seafood ingredients from retail premises was undertaken in the UK to determine the frequency and level of Listeria monocytogenes in these products. Almost all (99.8%; 2682/2686) samples were of satisfactory/acceptable microbiological quality. Two (0.1%) samples exceeded EC legal food safety criteria due to the presence of L. monocytogenes in excess of 100 cfu g(-1) (1.7 x 10(2), 9.9 x 10(2)cfu g(-1)) while another two (0.1%) were unsatisfactory due to L. welshimeri levels over 100 cfu g(-1) (1.2 x 10(3), 6.0 x 10(3) cfu g(-1)). Overall contamination of Listeria spp. and L. monocytogenes found in samples of mixed salads in the UK was 10.8% and 4.8%, respectively. Almost twice as many salad samples with meat ingredients were contaminated with Listeria spp. and L. monocytogenes (14.7% and 6.0%, respectively) compared to samples with seafood ingredients (7.4% and 3.8%, respectively). Pre-packaged mixed salads were contaminated with Listeria spp. and L. monocytogenes more frequently when: collected from sandwich shops; not packaged on the premises; stored or displayed above 8 degrees C. This study demonstrates that the control of L. monocytogenes in food manufacturing and at retail sale is essential in order to minimize the potential for this bacterium to be present in mixed salads at the point of consumption at levels hazardous to health.

  2. Resistance of Listeria monocytogenes biofilms to sanitizing agents

    Science.gov (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  3. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions

    Science.gov (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  4. Neonatal infection with Listeria monocytogenes: Rare, but serious

    NARCIS (Netherlands)

    Van Stuijvenberg, M.; Spanjaard, L.; Bergman, K.A.

    2006-01-01

    Between 1993 and 2003, three infants, two girls and a boy, were found to have an invasive infection with Listeria monocytogenes. They received intensive care including respiratory and circulatory support, antibiotics, and treatment of the neurological complications when possible. One of the girls

  5. Effect of Ozone Treatment on Inactivation of Escherichia coli and Listeria sp. on Spinach

    Directory of Open Access Journals (Sweden)

    Shreya Wani

    2015-03-01

    Full Text Available The efficacy of “gaseous” ozone in reducing numbers and re-growth of food-borne pathogens, (Escherichia coli and Listeria spp., on leafy salads was investigated using spinach. A preliminary in vivo study showed 1-log reduction in six strains of E. coli and two species of Listeria spp. on spinach exposed to 1 ppm ozone for 10 min. A range of ozone treatments were explored to deliver optimal bacterial inactivation while maintaining the visual appearance (color of produce. Exposure to a higher ozone concentration for a shorter duration (10 ppm for 2 min significantly reduced E. coli and Listeria spp. viable counts by 1-log and the pathogens did not re-grow following treatment (over a nine-day storage period. Impacts of 1 and 10 ppm ozone treatments were not significantly different. Approximately 10% of the pathogen population was resistant to ozone treatment. We hypothesized that cell age may be one of several factors responsible for variation in ozone resistance. E. coli cells from older colonies demonstrated higher ozone resistance in subsequent experiments. Overall, we speculate that gaseous ozone treatment constitutes the basis for an alternative customer-friendly method to reduce food pathogen contamination of leafy produce and is worth exploring on a pilot-scale in an industrial setting.

  6. Evaluation of the MIT RMID 1000 system for the identification of Listeria species.

    Science.gov (United States)

    Ricardi, John; Haavig, David; Cruz, Lasaunta; Paoli, George; Gehring, Andrew

    2010-01-01

    The Micro Imaging Technology (MIT) 1000 Rapid Microbial Identification (RMID) System is a device that uses the principles of light scattering coupled with proprietary algorithms to identify bacteria after being cultured and placed in a vial of filtered water. This specific method is for pure culture identification of Listeria spp. A total of 81 microorganisms (55 isolates) were tested by the MIT 1000 System, of which 25 were Listeria spp. and 30 a variety of other bacterial species. In addition, a total of 406 tests over seven different ruggedness parameters were tested by the MIT 1000 System to determine its flexibility to the specifications stated in the MIT 1000 System User Guide in areas where they might be deviated by a user to shorten the test cycle. Overall, MIT concluded that the MIT 1000 System had an accuracy performance that should certify this Performance Test Method for the identification of Listeria spp. This report discusses the tests performed, results achieved, and conclusions, along with several reference documents to enable a higher understanding of the technology used by the MIT 1000 System.

  7. Comparative Genomics of Listeria Sensu Lato: Genus-Wide Differences in Evolutionary Dynamics and the Progressive Gain of Complex, Potentially Pathogenicity-Related Traits through Lateral Gene Transfer.

    Science.gov (United States)

    Chiara, Matteo; Caruso, Marta; D'Erchia, Anna Maria; Manzari, Caterina; Fraccalvieri, Rosa; Goffredo, Elisa; Latorre, Laura; Miccolupo, Angela; Padalino, Iolanda; Santagada, Gianfranco; Chiocco, Doriano; Pesole, Graziano; Horner, David S; Parisi, Antonio

    2015-07-15

    Historically, genome-wide and molecular characterization of the genus Listeria has concentrated on the important human pathogen Listeria monocytogenes and a small number of closely related species, together termed Listeria sensu strictu. More recently, a number of genome sequences for more basal, and nonpathogenic, members of the Listeria genus have become available, facilitating a wider perspective on the evolution of pathogenicity and genome level evolutionary dynamics within the entire genus (termed Listeria sensu lato). Here, we have sequenced the genomes of additional Listeria fleischmannii and Listeria newyorkensis isolates and explored the dynamics of genome evolution in Listeria sensu lato. Our analyses suggest that acquisition of genetic material through gene duplication and divergence as well as through lateral gene transfer (mostly from outside Listeria) is widespread throughout the genus. Novel genetic material is apparently subject to rapid turnover. Multiple lines of evidence point to significant differences in evolutionary dynamics between the most basal Listeria subclade and all other congeners, including both sensu strictu and other sensu lato isolates. Strikingly, these differences are likely attributable to stochastic, population-level processes and contribute to observed variation in genome size across the genus. Notably, our analyses indicate that the common ancestor of Listeria sensu lato lacked flagella, which were acquired by lateral gene transfer by a common ancestor of Listeria grayi and Listeria sensu strictu, whereas a recently functionally characterized pathogenicity island, responsible for the capacity to produce cobalamin and utilize ethanolamine/propane-2-diol, was acquired in an ancestor of Listeria sensu strictu. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Listeria monocytogenes contamination of the environment and surfaces of the equipment in the meat processing facilities in republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Dean Jankuloski

    2007-11-01

    Full Text Available Listeria monocytogenes contamination of the environment and surfaces of the equipment was examined in seven meat processing facilities. Up to date prevalence of this foodborn pathogen in meat processing facilities facilities in Republic of Macedonia was unknown. Biofilms are composed from food spoilage microorganisms and food born pathogens. They are located on the surfaces of the equipment that come in contact with food and in facilities environment. Microorganisms in biofilm presenting micro eco system and are source of dissemination and contamination of food born pathogens in final meat products. During the preparation of this study we have covered a 7 meat processing facilities and we took a total of 39 swabs from surfaces that come in direct or indirect contact with food. Listeria monocytogenes was discovered in 10 (25,64% swabs (locations. Prevalence of other Listeria spp. compared with total number of taken samples was 15 (38,46% Listeria innocua, 3 (7,69% Listeria welshimeri and 1 (2,65% isolate Listeria seeligeri.

  9. Occurrence and distribution of listeria species in facilities producing ready-to-eat foods in British Columbia, Canada.

    Science.gov (United States)

    Kovačević, Jovana; McIntyre, Lorraine F; Henderson, Sarah B; Kosatsky, Tom

    2012-02-01

    In British Columbia (BC), Canada, food processing facilities licensed under provincial authority are not required to sample for Listeria monocytogenes in food products or processing environments. In 2009, we conducted a survey of dairy, fish, and meat facilities under BC authority to estimate the prevalence of Listeria spp. and L. monocytogenes in ready-to-eat (RTE) foods and production environments. From August to October, 250 RTE food samples and 258 swabs from the food processing environments of 43 facilities were collected. Standard culture methods were applied to both food samples and swabs. Of swabs collected from all 258 environmental surfaces, 15% were positive for Listeria spp. Significantly (P, 0.001) more fish facilities than dairy and meat facilities had food contact surfaces contaminated with Listeria spp. L. monocytogenes was found in RTE foods from fish facilities alone (5 of 12); in all five of the fish facilities with contaminated product, one or more environmental swabs were also positive for L. monocytogenes. The results suggest that while control of L. monocytogenes in BC-inspected dairy and meat facilities is effective in limiting food contamination, there is a need for provincial inspectors to initiate improved monitoring and management of contamination by L. monocytogenes in RTE fish processing facilities.

  10. Enrichment dynamics of Listeria monocytogenes and the associated microbiome from naturally contaminated ice cream linked to a listeriosis outbreak.

    Science.gov (United States)

    Ottesen, Andrea; Ramachandran, Padmini; Reed, Elizabeth; White, James R; Hasan, Nur; Subramanian, Poorani; Ryan, Gina; Jarvis, Karen; Grim, Christopher; Daquiqan, Ninalynn; Hanes, Darcy; Allard, Marc; Colwell, Rita; Brown, Eric; Chen, Yi

    2016-11-16

    Microbiota that co-enrich during efforts to recover pathogens from foodborne outbreaks interfere with efficient detection and recovery. Here, dynamics of co-enriching microbiota during recovery of Listeria monocytogenes from naturally contaminated ice cream samples linked to an outbreak are described for three different initial enrichment formulations used by the Food and Drug Administration (FDA), the International Organization of Standardization (ISO), and the United States Department of Agriculture (USDA). Enrichment cultures were analyzed using DNA extraction and sequencing from samples taken every 4 h throughout 48 h of enrichment. Resphera Insight and CosmosID analysis tools were employed for high-resolution profiling of 16S rRNA amplicons and whole genome shotgun data, respectively. During enrichment, other bacterial taxa were identified, including Anoxybacillus, Geobacillus, Serratia, Pseudomonas, Erwinia, and Streptococcus spp. Surprisingly, incidence of L. monocytogenes was proportionally greater at hour 0 than when tested 4, 8, and 12 h later with all three enrichment schemes. The corresponding increase in Anoxybacillus and Geobacillus spp.indicated these taxa co-enriched in competition with L. monocytogenes during early enrichment hours. L. monocytogenes became dominant after 24 h in all three enrichments. DNA sequences obtained from shotgun metagenomic data of Listeria monocytogenes at 48 h were assembled to produce a consensus draft genome which appeared to have a similar tracking utility to pure culture isolates of L. monocytogenes. All three methods performed equally well for enrichment of Listeria monocytogenes. The observation of potential competitive exclusion of L. mono by Anoxybacillus and Geobacillus in early enrichment hours provided novel information that may be used to further optimize enrichment formulations. Application of Resphera Insight for high-resolution analysis of 16S amplicon sequences accurately identified L. monocytogenes

  11. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR

    Science.gov (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.

    2017-09-01

    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  12. First Trimester Listeria monocytogenes Septicemia

    NARCIS (Netherlands)

    Goddijn, M.; Schipper, H. G.; Spanjaard, L.; Wolf, H.

    1997-01-01

    Background: Little is known about fetal outcome after Listeria monocytogenes septicemia in the first trimester of pregnancy.Case: A primigravida with L. monocytogenes septicemia at 9 weeks gestation was treated with amoxicillin. At 40 weeks gestation a healthy female infant was born.Conclusion: This

  13. NATURAL ATYPICAL LISTERIA INNOCUA STRAINS WITH LISTERIA MONOCYTOGENES PATHOGENICITY ISLAND 1 GENES

    Science.gov (United States)

    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  14. Enhanced detection and enumeration of Listeria monocytogenes from foodstuffs and food-processing environments.

    Science.gov (United States)

    Johansson, T

    1998-03-03

    Listeria monocytogenes blood agar (LMBA) was compared to Listeria selective agar based on lithium chloride and ceftazidime (LA) and to the Oxford and Palcam media recommended by ISO and IDF for the detection and enumeration of L. monocytogenes from foodstuffs and food-processing environments. LMBA is based on trypticase soy agar with the following additions: sheep blood (5%) and as selective agents lithium chloride (10 g/l), polymyxin B sulphate (10 mg/l) and ceftazidime (20 mg/l), whereas the selectivity of LA is based on lithium chloride (15 g/l) and ceftazidime (15 g/l). The media were compared in the detection of L. monocytogenes after enrichment from naturally contaminated foodstuffs (n = 423) and from food-processing environments (n = 93), and in the enumeration of the species from naturally contaminated foodstuffs (n = 287). LMBA was superior both to the standard media and to LA in detection after enrichment and also in enumeration, except in the case of fresh broiler cut samples. The overall sensitivities of the Palcam, Oxford, LA and LMBA media were 68%, 67%, 74% and 96% in detection after enrichment and 64%, 73%, 76% and 80% in the enumeration of the species from ready to eat foods. The superiority of LMBA is based on distinguishing L. monocytogenes from other Listeria species by detection of beta-hemolysis, whereas the other media gave false-negative results because of the overgrowth of Listeria spp. other than L. monocytogenes, especially in detection after enrichment. A more selective medium than LMBA would have been required for the enumeration of the species from samples with high levels of competitive bacteria other than Listeria spp. The results indicate the need for a more specific isolation medium for L. monocytogenes in addition to those recommended by ISO and IDF for both detection and enumeration. LMBA offers an alternative to be used in combination with either Palcam or Oxford as well as with LA.

  15. Microbial quality and prevalence of Salmonella and Listeria in eggs

    Directory of Open Access Journals (Sweden)

    Manijeh Mahdavi

    2012-01-01

    Full Text Available Aims: This study was undertaken to determine the microbial quality and the prevalence of Salmonella and Listeria in table eggs in Isfahan, Iran. Materials and Methods: A total of 525 samples were randomly collected from various shops in Isfahan, Iran. Microbial quality of eggs evaluated by coliform count and total bacterial viable counts. Also, detection of Listeria and Salmonella in egg contents and on eggs shells was performed. Results: The mean of total viable bacteria and coliform counts in the egg contents were 3.95 × 10 4 CFU/g and 4.94 × 10 3 CFU/g, respectively. Salmonella and Listeria were not found on the shell or content of eggs. Enterobacteriaceae families were found in 357 of 525 (68.28% and 276 of 525 (52.44% of egg shell and egg content samples, respectively. Moreover, Pseudomonas aeruginosa was isolated from 175 (33.41% and 144 (25.37% of egg shell and egg content, respectively. The isolated Enterobacteriaceae were included: Enterobacter aerogenes, Escherichia coli, Klebsiella pneumoniae, Buttiauxella agrestis, Cedecea lapagei, Cedecea davisae and Erwinia herbicola. Conclusion: The findings of the present study indicate although Salmonella and Listeria were not found in egg samples; however, there is an urgent need to improve the hygienic level of consumed eggs.

  16. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)

    2007-10-03

    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  17. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno

    2014-01-01

    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  18. Genomic, proteomic and morphological characterization of two novel broad host lytic bacteriophages (phi)PD10.3 and (phi)PD23.1 infecting pectinolytic Pectobacterium spp. and Dickeya spp.

    NARCIS (Netherlands)

    Czajkowski, Robert; Ozymko, Zofia; de Jager, Victor; Siwinska, Joanna; Smolarska, Anna; Ossowicki, Adam; Narajczyk, Magdalena; Lojkowska, Ewa

    2015-01-01

    Pectinolytic Pectobacterium spp. and Dickeya spp. are necrotrophic bacterial pathogens of many important crops, including potato, worldwide. This study reports on the isolation and characterization of broad host lytic bacteriophages able to infect the dominant Pectobacterium spp. and Dickeya spp.

  19. Eradication of high viable loads of Listeria monocytogenes contaminating food-contact surfaces

    Directory of Open Access Journals (Sweden)

    Silvia ede Candia

    2015-07-01

    Full Text Available This study demonstrates the efficacy of cold gaseous ozone treatments at low concentrations in the eradication of high Listeria monocytogenes viable cell loads from glass, polypropylene, stainless steel and expanded polystyrene food-contact surfaces. Using a step by step approach, involving the selection of the most resistant strain-surface combinations, 11 Listeria spp. strains resulted inactivated by a continuous ozone flow at 1.07 mg m-3 after 24 or 48 h of cold incubation, depending on both strain and surface evaluated. Increasing the inoculum level to 9 log CFU coupon-1, the best inactivation rate was obtained after 48h of treatment at 3.21 mg m-3 ozone concentration when cells were deposited onto stainless steel and expanded polystyrene coupons, resulted the most resistant food-contact surfaces in the previous assays.The addition of naturally microbiologically contaminated meat extract to a high load of L. monocytogenes LMG 23775 cells, the most resistant strain out of the 11 assayed Listeria spp. strains, led to its complete inactivation after four days of treatment.To the best of our knowledge, this is the first report describing the survival of L. monocytogenes and the effect of ozone treatment under cold storage conditions on expanded polystyrene, a commonly-used material in food packaging. These results could be useful for reducing pathogen cross-contamination phenomena during cold food storage.

  20. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    Prof. Ogunji

    The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood ... Key words: Spontaneous abortion, Listeria, isolation, incidence. Correspondence: .... Chukwu O. Chukwu of the listeria study group at NVRI Vom for provision of listeria standard, and Dr. (Mrs) Lami Lombin for ...

  1. Acidithiobacillus caldus , Leptospirillum spp., Ferroplasma spp. and ...

    African Journals Online (AJOL)

    Acidithiobacillus caldus , Leptospirillum spp., Ferroplasma spp. and Sulphobacillus spp. mixed strains for use in cobalt and copper removal from water. ... Such findings suggest that if optimal conditions for biosorption of the metals by micro-organisms are achieved, this should afford a cost-effective method of removing metal ...

  2. Control of Listeria species food safety at a poultry food production facility.

    Science.gov (United States)

    Fox, Edward M; Wall, Patrick G; Fanning, Séamus

    2015-10-01

    Surveillance and control of food-borne human pathogens, such as Listeria monocytogenes, is a critical aspect of modern food safety programs at food production facilities. This study evaluated contamination patterns of Listeria species at a poultry food production facility, and evaluated the efficacy of procedures to control the contamination and transfer of the bacteria throughout the plant. The presence of Listeria species was studied along the production chain, including raw ingredients, food-contact, non-food-contact surfaces, and finished product. All isolates were sub-typed by pulsed-field gel electrophoresis (PFGE) to identify possible entry points for Listeria species into the production chain, as well as identifying possible transfer routes through the facility. The efficacy of selected in-house sanitizers against a sub-set of the isolates was evaluated. Of the 77 different PFGE-types identified, 10 were found among two or more of the five categories/areas (ingredients, food preparation, cooking and packing, bulk packing, and product), indicating potential transfer routes at the facility. One of the six sanitizers used was identified as unsuitable for control of Listeria species. Combining PFGE data, together with information on isolate location and timeframe, facilitated identification of a persistent Listeria species contamination that had colonized the facility, along with others that were transient. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Adenovirus-based vaccine against Listeria monocytogenes

    DEFF Research Database (Denmark)

    Jensen, Søren; Steffensen, Maria Abildgaard; Jensen, Benjamin Anderschou Holbech

    2013-01-01

    bacteria, using Listeria monocytogenes as a model organism. Protection in C57BL/6 mice against recombinant L. monocytogenes expressing an immunodominant epitope of the LCMV glycoprotein (GP33) was greatly accelerated, augmented, and prolonged following vaccination with an adenoviral vaccine encoding GP......The use of replication-deficient adenoviruses as vehicles for transfer of foreign genes offers many advantages in a vaccine setting, eliciting strong cellular immune responses involving both CD8(+) and CD4(+) T cells. Further improving the immunogenicity, tethering of the inserted target Ag to MHC...... class II-associated invariant chain (Ii) greatly enhances both the presentation of most target Ags, as well as overall protection against viral infection, such as lymphocytic choriomeningitis virus (LCMV). The present study extends this vaccination concept to include protection against intracellular...

  4. [Survey of the presence of Listeria monocytogenes in meat products sold in retail].

    Science.gov (United States)

    Langiano, E; Lanni, L; Atrei, P; De Vito, E

    2007-01-01

    The present study evaluates the presence of Listeria spp and particularly of L. monocytogenes in bovine, pork and poultry meats sold by retail in supermarkets and butchers in the city of Cassino. The sensibility to the antibiotics mostly used in the veterinary practice has been tested on the isolated strains. The different species of Listeria have shown a considerable variation of isolation based on the meat's typology and on the different store's provenance. Moreover our results show greater degree of contamination than the data currently available the Italian literature. In our study poultry meat is the most contaminated one. We can assert that omissions and poor caring errors in the manipulation and conservation of meat expose the customer to an even higher risk of infection.

  5. Defensins from the tick Ixodes scapularis are effective against phytopathogenic fungi and the human bacterial pathogen Listeria grayi

    Czech Academy of Sciences Publication Activity Database

    Tonk, Miray; Cabezas-Cruz, A.; Valdés, James J.; Rego, Ryan O. M.; Chrudimská, Tereza; Strnad, Martin; Šíma, Radek; Bell-Sakyi, L.; Franta, Z.; Vilcinskas, A.; Grubhoffer, Libor; Rahnamaeian, M.

    2014-01-01

    Roč. 7, DEC 3 2015 (2014), s. 554 ISSN 1756-3305 R&D Projects: GA ČR(CZ) GAP302/11/1901; GA MŠk(CZ) EE2.3.30.0032; GA ČR GP13-12816P Institutional support: RVO:60077344 Keywords : Antimicrobial peptide * Defensin * Listeria grayi * Fusarium spp * Ixodes scapularis * Tick cell line Subject RIV: EE - Microbiology, Virology Impact factor: 3.430, year: 2014

  6. Comparative genomics of the bacterial genus Listeria: Genome evolution is characterized by limited gene acquisition and limited gene loss

    Directory of Open Access Journals (Sweden)

    Barker Melissa

    2010-12-01

    Full Text Available Abstract Background The bacterial genus Listeria contains pathogenic and non-pathogenic species, including the pathogens L. monocytogenes and L. ivanovii, both of which carry homologous virulence gene clusters such as the prfA cluster and clusters of internalin genes. Initial evidence for multiple deletions of the prfA cluster during the evolution of Listeria indicates that this genus provides an interesting model for studying the evolution of virulence and also presents practical challenges with regard to definition of pathogenic strains. Results To better understand genome evolution and evolution of virulence characteristics in Listeria, we used a next generation sequencing approach to generate draft genomes for seven strains representing Listeria species or clades for which genome sequences were not available. Comparative analyses of these draft genomes and six publicly available genomes, which together represent the main Listeria species, showed evidence for (i a pangenome with 2,032 core and 2,918 accessory genes identified to date, (ii a critical role of gene loss events in transition of Listeria species from facultative pathogen to saprotroph, even though a consistent pattern of gene loss seemed to be absent, and a number of isolates representing non-pathogenic species still carried some virulence associated genes, and (iii divergence of modern pathogenic and non-pathogenic Listeria species and strains, most likely circa 47 million years ago, from a pathogenic common ancestor that contained key virulence genes. Conclusions Genome evolution in Listeria involved limited gene loss and acquisition as supported by (i a relatively high coverage of the predicted pan-genome by the observed pan-genome, (ii conserved genome size (between 2.8 and 3.2 Mb, and (iii a highly syntenic genome. Limited gene loss in Listeria did include loss of virulence associated genes, likely associated with multiple transitions to a saprotrophic lifestyle. The genus

  7. Factors affecting survival of Listeria monocytogenes and Listeria innocua in soil samples.

    Science.gov (United States)

    McLaughlin, Heather P; Casey, Pat G; Cotter, Jeni; Gahan, Cormac G M; Hill, Colin

    2011-11-01

    We investigated the ability of several strains of L. monocytogenes and Listeria innocua strains to survive in local soil samples in vitro. Survival of three L. monocytogenes strains, EGDe, CD83, and CD1038, and three L. innocua strains, CLIP, FH2117, FH2152, was monitored in soil samples by direct enumeration of colony-forming units on selective agar. The study did not demonstrate any species-specific difference in soil survival, and all Listeria strains exhibited a marked decline in numbers over time. Bioluminescence imaging approaches to detect lux-tagged strains in soil proved largely ineffective, most likely due to the reduced metabolic activity of strains in this environment. We investigated the influence of specific factors including the presence of a background microbiota, growth temperature, moisture and strain motility upon persistence in this environment. A sequenced L. monocytogenes strain, EGDe, was capable of active growth in sterile soil yet exhibited a decline in the presence of the normal soil microbiota. Furthermore, greater survival was seen at lower incubation temperatures in normal soil. Finally, we demonstrated a direct correlation between motility and survival of L. monocytogenes in soil with highly motile L. monocytogenes strains exhibiting greater soil survival than non-motile mutants.

  8. Prevalence of Trichinella spp. in black bears, grizzly bears, and wolves in the Dehcho Region, Northwest Territories, Canada, including the first report of T. nativa in a grizzly bear from Canada.

    Science.gov (United States)

    Larter, Nicholas C; Forbes, Lorry B; Elkin, Brett T; Allaire, Danny G

    2011-07-01

    Samples of muscle from 120 black bears (Ursus americanus), 11 grizzly bears (Ursus arctos), and 27 wolves (Canis lupus) collected in the Dehcho Region of the Northwest Territories from 2001 to 2010 were examined for the presence of Trichinella spp. larvae using a pepsin-HCl digestion assay. Trichinella spp. larvae were found in eight of 11 (73%) grizzly bears, 14 of 27 (52%) wolves, and seven of 120 (5.8%) black bears. The average age of positive grizzly bears, black bears, and wolves was 13.5, 9.9, and approximately 4 yr, respectively. Larvae from 11 wolves, six black bears, and seven grizzly bears were genotyped. Six wolves were infected with T. nativa and five with Trichinella T6, four black bears were infected with T. nativa and two with Trichinella T6, and all seven grizzly bears were infected with Trichinella T6 and one of them had a coinfection with T. nativa. This is the first report of T. nativa in a grizzly bear from Canada. Bears have been linked to trichinellosis outbreaks in humans in Canada, and black bears are a subsistence food source for residents of the Dehcho region. In order to assess food safety risk it is important to monitor the prevalence of Trichinella spp. in both species of bear and their cohabiting mammalian food sources.

  9. Development of a Novel Listeria Enrichment Broth for the Isolation of Pathogenic Listeria.

    Science.gov (United States)

    Liu, Dongxin; Wang, Yan; Wang, Yi; Zhang, Lu; Luo, Lijuan; Liu, Kai; Ye, Changyun

    2017-10-01

    Listeriosis, the disease caused by pathogenic Listeria species, can present severe symptoms in susceptible people. The goal of this study was to develop a novel enrichment broth, Listeria allose enrichment broth (LAEB), to improve isolation of Listeria monocytogenes and Listeria ivanovii from samples through incorporating a specific carbohydrate and reducing inhibitor concentrations. Other coexisting bacteria, particularly Listeria innocua, can interfere with the isolation of pathogenic Listeria in such ways as overgrowth of L. innocua and the generation of inhibitory metabolites. The incorporation of allose into the novel LAEB was effective for slowing the growth of L. innocua and other nontarget microorganisms. We determined that 35°C and pH 7.0 under aerobic conditions are optimal for Listeria growth in this medium. The novelty of the use of LAEB is the single enrichment procedure at 35°C for 24 h, obviating the need for a secondary enrichment medium. In 50 simulated samples, the sensitivity of the LAEB method (86%) was higher than that of the International Organization for Standardization (EN ISO) method (70%). In 142 naturally contaminated samples tested, the isolation rate for pathogenic Listeria with the LAEB method was 26.0% (37 of 142 samples), which was significantly higher than the 17.6% (25 of 142 samples) for the EN ISO method. Higher isolation rates and a quicker and easier protocol make the novel LAEB method an appropriate alternative for the isolation of pathogenic Listeria.

  10. Symptomatic hydrocephalus in a newborn infected with listeria monocytogenes Hidrocefalia sintomática em um recém-nascido infectado com Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Analía L. Laciar

    2000-03-01

    Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.

  11. An allelopathy based model for the Listeria overgrowth phenomenon.

    Science.gov (United States)

    Fgaier, Hedia; Kalmokoff, Martin; Ells, Timothy; Eberl, Hermann J

    2014-01-01

    In a standard procedure of food safety testing, the presence of the pathogenic bacterium Listeria monocytogenes can be masked by non-pathogenic Listeria. This phenomenon of Listeria overgrowth is not well understood. We present a mathematical model for the growth of a mixed population of L. innocua and L. monocytogenes that includes competition for a common resource and allelopathic control of L. monocytogenes by L. innocua when this resource becomes limited, which has been suggested as one potential explanation for the overgrowth phenomenon. The model is tested quantitatively and qualitatively against experimental data in batch experiments. Our results indicate that the phenomenon of masked pathogens can depend on initial numbers of each population present, and on the intensity of the allelopathic effect. Prompted by the results for the batch setup, we also analyze the model in a hypothetical chemostat setup. Our results suggest that it might be possible to operate a continuous growth environment such that the pathogens outcompete the non-pathogenic species, even in cases where they would be overgrown in a batch environment. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Manipulation of host membranes by the bacterial pathogens Listeria, Francisella, Shigella and Yersinia.

    Science.gov (United States)

    Pizarro-Cerdá, Javier; Charbit, Alain; Enninga, Jost; Lafont, Frank; Cossart, Pascale

    2016-12-01

    Bacterial pathogens display an impressive arsenal of molecular mechanisms that allow survival in diverse host niches. Subversion of plasma membrane and cytoskeletal functions are common themes associated to infection by both extracellular and intracellular pathogens. Moreover, intracellular pathogens modify the structure/stability of their membrane-bound compartments and escape degradation from phagocytic or autophagic pathways. Here, we review the manipulation of host membranes by Listeria monocytogenes, Francisella tularensis, Shigella flexneri and Yersinia spp. These four bacterial model pathogens exemplify generalized strategies as well as specific features observed during bacterial infection processes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  13. Validation of the 3M molecular detection system for the detection of listeria in meat, seafood, dairy, and retail environments.

    Science.gov (United States)

    Fortes, Esther D; David, John; Koeritzer, Bob; Wiedmann, Martin

    2013-05-01

    There is a continued need to develop improved rapid methods for detection of foodborne pathogens. The aim of this project was to evaluate the 3M Molecular Detection System (3M MDS), which uses isothermal DNA amplification, and the 3M Molecular Detection Assay Listeria using environmental samples obtained from retail delicatessens and meat, seafood, and dairy processing plants. Environmental sponge samples were tested for Listeria with the 3M MDS after 22 and 48 h of enrichment in 3M Modified Listeria Recovery Broth (3M mLRB); enrichments were also used for cultural detection of Listeria spp. Among 391 samples tested for Listeria, 74 were positive by both the 3M MDS and the cultural method, 310 were negative by both methods, 2 were positive by the 3M MDS and negative by the cultural method, and one sample was negative by the 3M MDS and positive by the cultural method. Four samples were removed from the sample set, prior to statistical analyses, due to potential cross-contamination during testing. Listeria isolates from positive samples represented L. monocytogenes, L. innocua, L. welshimeri, and L. seeligeri. Overall, the 3M MDS and culture-based detection after enrichment in 3M mLRB did not differ significantly (P < 0.05) with regard to the number of positive samples, when chi-square analyses were performed for (i) number of positive samples after 22 h, (ii) number of positive samples after 48 h, and (iii) number of positive samples after 22 and/or 48 h of enrichment in 3M mLRB. Among 288 sampling sites that were tested with duplicate sponges, 67 each tested positive with the 3M MDS and the traditional U.S. Food and Drug Administration Bacteriological Analytical Manual method, further supporting that the 3M MDS performs equivalently to traditional methods when used with environmental sponge samples.

  14. Incidence of Listeria species in bovine, ovine, caprine, camel and water buffalo milk using cultural method and the PCR assay

    OpenAIRE

    Rahimi, Ebrahim; Momtaz, Hassan; Behzadnia, Asma; Baghbadorani, Zeinab Torki

    2014-01-01

    Objective: To determine the prevalence rate of Listeria species in bovine, ovine, caprine, camel and water buffalo milk in Iran. Methods: From September 2010 to December 2011 a total of 260 bulk milk samples including 85 bovine, 37 camel, 34 water buffalo, 56 ovine and 48 caprine bulk milk samples were collected from commercial dairy herds, in Fars and Khuzestan provinces, Iran and were evaluated for the presence of Listeria species using cultural method and the PCR assay. R...

  15. Listeria monocytogenes endophthalmitis following keratoconjunctivitis.

    Science.gov (United States)

    Shoughy, Samir S; Tabbara, Khalid F

    2014-01-01

    Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.

  16. Microbial background flora in small-scale cheese production facilities does not inhibit growth and surface attachment of Listeria monocytogenes.

    Science.gov (United States)

    Schirmer, B C T; Heir, E; Møretrø, T; Skaar, I; Langsrud, S

    2013-10-01

    The background microbiota of 5 Norwegian small-scale cheese production sites was examined and the effect of the isolated strains on the growth and survival of Listeria monocytogenes was investigated. Samples were taken from the air, food contact surfaces (storage surfaces, cheese molds, and brine) and noncontact surfaces (floor, drains, and doors) and all isolates were identified by sequencing and morphology (mold). A total of 1,314 isolates were identified and found to belong to 55 bacterial genera, 1 species of yeast, and 6 species of mold. Lactococcus spp. (all of which were Lactococcus lactis), Staphylococcus spp., Microbacterium spp., and Psychrobacter sp. were isolated from all 5 sites and Rhodococcus spp. and Chryseobacterium spp. from 4 sites. Thirty-two genera were only found in 1 out of 5 facilities each. Great variations were observed in the microbial background flora both between the 5 producers, and also within the various production sites. The greatest diversity of bacteria was found in drains and on rubber seals of doors. The flora on cheese storage shelves and in salt brines was less varied. A total of 62 bacterial isolates and 1 yeast isolate were tested for antilisterial activity in an overlay assay and a spot-on-lawn assay, but none showed significant inhibitory effects. Listeria monocytogenes was also co-cultured on ceramic tiles with bacteria dominating in the cheese production plants: Lactococcus lactis, Pseudomonas putida, Staphylococcus equorum, Rhodococcus spp., or Psychrobacter spp. None of the tested isolates altered the survival of L. monocytogenes on ceramic tiles. The conclusion of the study was that no common background flora exists in cheese production environments. None of the tested isolates inhibited the growth of L. monocytogenes. Hence, this study does not support the hypothesis that the natural background flora in cheese production environments inhibits the growth or survival of L. monocytogenes. Copyright © 2013 American

  17. Prevalence and characterization of Listeria monocytogenes, Salmonella and Shiga toxin-producing Escherichia coli isolated from small Mexican retail markets of queso fresco.

    Science.gov (United States)

    Soto Beltran, Marcela; Gerba, Charles P; Porto Fett, Anna; Luchansky, John B; Chaidez, Cristobal

    2015-01-01

    Queso fresco (QF) is a handmade cheese consumed and produced in Latin America. In Mexico, QF production is associated with a microbiological risk. The aim of the study was to determine the incidence and characterization of Listeria monocytogenes, Salmonella spp., and Shiga toxin-producing Escherichia coli (STEC) in QF from retail markets of the north-western State of Sinaloa, Mexico, and to assess the effect of physicochemical parameters on Listeria presence. A total of 75 QF samples were obtained. L. monocytogenes, E. coli, and coliforms were detected in 9.3, 94, and 100%, respectively. Salmonella was not detected. STEC isolates showed virulence genes. Microbial loads were above the maximum values recommended by the Official Mexican Standards. Physicochemical parameters such as water activity (aw), moisture content, pH, and salinity played a role in Listeria prevalence in QF. Rigorous control in QF made in Culiacan, Mexico is needed to reduce the risk of foodborne pathogens.

  18. Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

    Directory of Open Access Journals (Sweden)

    Shahin Gaini

    2015-01-01

    Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.

  19. Inactivation of Salmonella enterica and Listeria monocytogenes in cantaloupe puree by high hydrostatic pressure with/without added ascorbic acid.

    Science.gov (United States)

    Mukhopadhyay, Sudarsan; Sokorai, Kimberly; Ukuku, Dike; Fan, Xuetong; Juneja, Vijay; Sites, Joseph; Cassidy, Jennifer

    2016-10-17

    The objective of this research was to evaluate and develop a method for inactivation of Salmonella enterica and Listeria monocytogenes in cantaloupe puree (CP) by high hydrostatic pressure (HHP). Cantaloupe being the most netted varieties of melons presents a greater risk of pathogen transmission. Freshly prepared CP with or without 0.1% ascorbic acid (AA) was inoculated with a bacterial cocktail composed of a three serotype mixture of S. enterica (S. Poona, S. Newport H1275 and S. Stanley H0558) and a mixture of three strains of L. monocytogenes (Scott A, 43256 and 51742) to a population of ca. 10(8)CFU/g. Double sealed and double bagged inoculated CP (ca. 5g) were pressure treated at 300, 400 and 500MPa at 8°C and 15°C for 5min. Data indicated increased inactivation of both Salmonella and Listeria spp. with higher pressure. Log reduction for CP at 300MPa, 8°C for 5min was 2.4±0.2 and 1.6±0.5logCFU/g for Salmonella and Listeria, respectively. Survivability of the pathogens was significantly compromised at 400MPa and 8°C, inactivating 4.5±0.3logCFU/g of Salmonella and 3.0±0.4logCFU/g of Listeria spp. Complete inactivation of the pathogens in the puree (log reduction >6.7logCFU/g), with or without AA, was achieved when the pressure was further increased to 500MPa, except that for Listeria containing no AA at 8°C. Listeria presented higher resistance to pressure treatment compared to Salmonella spp. Initial temperatures (8 and 15°C) had no significant influence on Salmonella log reductions. Log reduction of pathogens increased but not significantly with increase of temperature. AA did not show any significant antimicrobial activity. Viable counts were about 0.2-0.4logCFU/g less in presence of 0.1% AA. These data validate that HHP can be used as an effective method for decontamination of cantaloupe puree. Published by Elsevier B.V.

  20. Detection of Listeria in raw milk in Syria

    International Nuclear Information System (INIS)

    Al-Mariri, A.; Abou-Younes, A.

    2010-01-01

    The 66 milk collected from all province of Syria, were examined for the presence of Listeria sp. using a several technique, and L. monocytogenes serotypes associated with human listeriosis were also identified in the product. The PCR based method identified 117 strains of Listeria, L. monocytogenes, L. innocua, L. ivanovii, L. gravi, and L. welshimeri. The API Listeria system identified 94% of the isolates whereas FTIR identification was 98% for all Listeria species. (author)

  1. Prevalence, pathogenic capability, virulence genes, biofilm formation, and antibiotic resistance of Listeria in goat and sheep milk confirms need of hygienic milking conditions.

    Science.gov (United States)

    Osman, Kamelia M; Zolnikov, Tara Rava; Samir, Ahmed; Orabi, Ahmed

    2014-01-01

    Goat and sheep milk is consumed by human populations throughout the world; as a result, it has been proposed as an alternative, nutrient-rich milk to feed infants allergic to cow's milk. Unfortunately, potentially harmful bacteria have not been thoroughly tested in goat or sheep milk. Listeria monocytogenes is a harmful bacterium that causes adverse health effects if ingested by humans. The purpose of this study was to estimate the prevalence and characterize the phenotype, genotype, virulence factors, biofilm formation, and antibiopotential of Listeria isolated from the milk of goat and sheep. Udder milk samples were collected from 107 goats and 102 sheep and screened for mastitis using the California mastitis test (CMT). Samples were then examined for the presence of pathogenic Listeria spp; if detected, the isolation of pathogenic Listeria (L. monocytogenes and Listeria ivanovii) was completed using isolation and identification techniques recommended by the International Organization for Standards (ISO 11290-1, 1996), in addition to serological, in vitro and in vivo pathogenicity tests. The isolates were subjected to PCR assay for virulence associated genes (hlyA, plcA, actA, and iap). Pathogenic Listeria spp. were isolated from 5·6% of goat and 3·9% sheep milk samples, with 33·3 and 25% of these selected samples respectively containing L. monocytogenes. The results of this study provide evidence of the low-likelihood of contamination leading to the presence of L. monocytogenes in raw goat and sheep milk; however, this study also confirmed a strong in vitro ability for biofilm formation and pathogenic capability of L. monocytogenes if discovered in the milk. L. monocytogenes may be present in goat and sheep milk and in order to reduce the exposure, hygienic milking conditions must be employed for the milk to be considered a safe alternative for human consumption.

  2. Listeria monocytogenes transiently alters mitochondrial dynamics during infection

    OpenAIRE

    Stavru, Fabrizia; Bouillaud, Frederic; Sartori, Anna; Ricquier, Daniel; Cossart, Pascale

    2011-01-01

    Mitochondria are essential and highly dynamic organelles, constantly undergoing fusion and fission. We analyzed mitochondrial dynamics during infection with the human bacterial pathogen Listeria monocytogenes and show that this infection profoundly alters mitochondrial dynamics by causing transient mitochondrial network fragmentation. Mitochondrial fragmentation is specific to pathogenic Listeria monocytogenes, and it is not observed with the nonpathogenic Listeria innocua species or several ...

  3. Chemical Composition, Antioxidant and Antibacterial Activity of Bunium persicum, Eucalyptus globulus, and Rose Water on Multidrug-Resistant Listeria Species.

    Science.gov (United States)

    Sharafati Chaleshtori, Farhad; Saholi, Mohamad; Sharafati Chaleshtori, Reza

    2018-01-01

    This research was aimed at investigating the antioxidant and antibacterial activity of Bunium persicum, Eucalyptus globulus, and rose water on multidrug-resistant Listeria species. The antibiotic resistance of Listeria spp obtained from seafood samples were determined by the Kirby-Bauer method. The antioxidant and antibacterial activity of the essential oils and extracts were evaluated using ferric reducing antioxidant power and microdilution methods, respectively. A total 2 samples (1.88%) were positive for Listeria spp. L monocytogenes was found to be resistant to ampicillin, amoxicillin/clavulanic acid, penicillin, vancomycin, and kanamycin. B persicum essential oil showed the greatest antioxidant activity (248.56 ± 1.09 µM Fe 2+ /g). The E globulus essential oil showed consistently strong antimicrobial activity against L monocytogenes and L grayi, while rose water showed no antimicrobial activity against any of the tested bacterial strains. The results showed that after adding the B persicum and E globulus essential oils to bacteria, the cell components' release increased significantly.

  4. Protein Chips for Detection of Salmonella spp. from Enrichment Culture

    Directory of Open Access Journals (Sweden)

    Palmiro Poltronieri

    2016-04-01

    Full Text Available Food pathogens are the cause of foodborne epidemics, therefore there is a need to detect the pathogens in food productions rapidly. A pre-enrichment culture followed by selective agar plating are standard detection methods. Molecular methods such as qPCR have provided a first rapid protocol for detection of pathogens within 24 h of enrichment culture. Biosensors also may provide a rapid tool to individuate a source of Salmonella contamination at early times of pre-enrichment culture. Forty mL of Salmonella spp. enrichment culture were processed by immunoseparation using the Pathatrix, as in AFNOR validated qPCR protocols. The Salmonella biosensor combined with immunoseparation showed a limit of detection of 100 bacteria/40 mL, with a 400 fold increase to previous results. qPCR analysis requires processing of bead-bound bacteria with lysis buffer and DNA clean up, with a limit of detection of 2 cfu/50 μL. Finally, a protein chip was developed and tested in screening and identification of 5 common pathogen species, Salmonella spp., E. coli, S. aureus, Campylobacter spp. and Listeria spp. The protein chip, with high specificity in species identification, is proposed to be integrated into a Lab-on-Chip system, for rapid and reproducible screening of Salmonella spp. and other pathogen species contaminating food productions.

  5. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    2017-01-01

    Both in Europe and worldwide cheese has caused important outbreaks of listeriosis and can be a vehicle for transmission of Listeria monocytogenes to consumers. A systematic review and meta-analysis were conducted using scientific literature and European Food Safety Authority (EFSA) reports...... to summarize available data on the prevalence of L. monocytogenes in different types of cheeses produced in Europe. Meta-analysis models were used to estimate mean prevalence of the pathogen and to compare prevalence among types of cheeses (fresh, ripened, veined, smear and brined) and cheeses produced using.......5-1.1%). The prevalence differed among types of cheeses including fresh (0.8%; CI: 0.3-1.9%), ripened (2.0%; CI: 0.8-4.9%), veined (2.4%; CI: 0.9-6.3%), smear (5.1%; CI: 1.9-13.1%) and brined (11.8%; CI: 3.5-33.3%). Mean prevalence of L. monocytogenes in soft/semi-soft cheeses were not significantly different (P > 0...

  6. Prevalence of Listeria monocytogenes in ready-to-eat foods sampled from the point of sale in Wales, United Kingdom.

    Science.gov (United States)

    Meldrum, R J; Ellis, P W; Mannion, P T; Halstead, D; Garside, J

    2010-08-01

    A survey of Listeria in ready-to-eat food took place in Wales, United Kingdom, between February 2008 and January 2009. In total, 5,840 samples were taken and examined for the presence of Listeria species, including L. monocytogenes. Samples were tested using detection and enumeration methods, and the results were compared with current United Kingdom guidelines for the microbiological quality of ready-to-eat foods. The majority of samples were negative for Listeria by both direct plating and enriched culture. Seventeen samples (0.29%) had countable levels of Listeria species (other than L. monocytogenes), and another 11 samples (0.19%) had countable levels of L. monocytogenes. Nine samples (0.15%) were unsatisfactory or potentially hazardous when compared with United Kingdom guideline limits; six (0.10%) were in the unsatisfactory category (>100 CFU/g) for Listeria species (other than L. monocytogenes), and three (0.05%) were in the unacceptable or potentially hazardous category (>100 CFU/g) for L. monocytogenes. All three of these samples were from sandwiches (two chicken sandwiches and one ham-and-cheese sandwich). The most commonly isolated serotype of L. monocytogenes was 1/2a. This survey was used to determine the current prevalence of Listeria species and L. monocytogenes in ready-to-eat foods sampled from the point of sale in Wales.

  7. Radiosensitivity of Listeria innocua in fourth sort vegetables and effect of the irradiation on microbiological and sensory parameters

    International Nuclear Information System (INIS)

    Acevedo Gonzalez, Claudia Jose

    2004-01-01

    In the markets of many countries, including Chile, a wide variety of minimally processed or fourth sort vegetables are offered. Nevertheless, recent studies have reported that some of these products could be a potential risk to the public health due, to microbiological contamination. As a feasible treatment to solve this problem, irradiation of this kind of vegetable products is proposed. The natural microbiological contamination of two minimally processed mixed salads Toscana (iceberg lettuce ( Lactuca sativa var. capita), red cabbage (Brassica oleraceae var. rubra) and shredded carrot (Dacus carota L.)) and Four Seasons (romaine lettuce (Lactuca sativa var. longifolia), iceberg lettuce (lactuca sativa var. capitata), lollo rossa lettuce (Lactuca sativa var. acephala) and spinach (Spinacia oleraceae), was assayed controlling the total plate count (TPC), the Enterobacteriaceae count (EC) and the presence or absence of Listeria spp.in 25 g. Inoculating both salads with Listeria innocua, as surrogate microorganism for a possible contamination with Listeria monocytogenes, the D 10 value was determined. The effect of irradiating the vegetables with 5 D 10 doses, on the initial microflora and the evaluation of possible changes in the microbiological and sensory quality during a 7 days refrigerated storage, was carried out. The effect on the sensory quality was evaluated by a 10 judges trained panel, through a triangular test at day 0 and day 7, in order to determine possible significantly differences between the no irradiated and the irradiated samples. A test for quality descriptors was performed at 0, 3 and 7 days, to compare the irradiated salads with the no irradiated control. The evaluated sensory attributes were appearance, color, flavor, sweetness, bitterness, texture and total quality. The levels of the initial microflora ranged for TPC between 10 6 cfu/g and 10 8 cfu/g in Toscana salad and 10 4 cfu/g and 10 8 cfu/g in Four Seasons salad. The EC initial levels

  8. Sviluppo e validazione di un antigene-capture ELISA basato su anticorpi monoclonali specifici per Listeria monocytogenes negli alimenti

    Directory of Open Access Journals (Sweden)

    Rossella Lelli

    2011-09-01

    Full Text Available È stato standardizzato e validato un dosaggio immunoenzimatico capture ELISA per l’identificazione di Listeria monocytogenes negli alimenti. Il dosaggio è stato messo a punto analizzando campioni di prodotti carnei, ittici e lattiero-caseari, pasta di semola e di farina di grano. Il metodo è risultato specifico al 100% per Listeria spp., con limite di rivelazione di 6,6 × 10(3 cfu/ml. Il metodo L. monocytogenes capture ELISA è stato confrontato con il metodo ufficiale ISO 11290-1:1996 per l’isolamento e l’identificazione di L. monocytogenes in matrici alimentari ottenendo un indice di concordanza significativo. Il dosaggio è stato validato in base alle indicazioni della norma ISO 16140:2003 relativamente ai metodi di analisi qualitativi. Il dosaggio è risultato accurato, specifico, sensibile, selettivo, riproducibile e rapido da eseguire, consentendo nello screening degli alimenti la riduzione di tempi e costi dell’indagine microbiologica.

  9. Listeria monocytogenes endophthalmitis following keratoconjunctivitis

    Directory of Open Access Journals (Sweden)

    Shoughy SS

    2014-01-01

    Full Text Available Samir S Shoughy,1 Khalid F Tabbara1–31The Eye Center and The Eye Foundation for Research in Ophthalmology, Riyadh, Saudi Arabia; 2Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 3The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USAAbstract: Endophthalmitis due to endogenous or exogenous bacteria is a rare infection of the eye. We report a case of endophthalmitis following Listeria monocytogenes keratoconjunctivitis in a 27-year-old healthy white male presenting with hand motion visual acuity, right eye mucopurulent conjunctivitis, elevated intraocular pressure, and pigmented hypopyon 6 months post-keratectomy. The conjunctivitis was unresponsive to a 5-day course of topical tobramycin eye drops, and the patient developed keratitis with pain that progressed to endophthalmitis after 21 days. Diagnostic B-scan revealed vitreous exudates. Intraocular fluid specimen showed Gram-positive organisms and the aqueous culture grew penicillin-/aminoglycoside-sensitive L. monocytogenes. The patient was given intravitreal and systemic vancomycin and ceftazidime. The eye was unresponsive to intravenous penicillin and gentamicin; the anterior chamber progressively flattened and developed phthisis bulbi. L. monocytogenes keratoconjunctivitis may lead to bacterial endophthalmitis. Prompt culture and early antibiotic therapy are recommended.Keywords: conjunctivitis, L. monocytogenes, endophthalmitis

  10. Phylogenomic grouping of Listeria monocytogenes.

    Science.gov (United States)

    Doijad, Swapnil; Weigel, Markus; Barbuddhe, Sukhadeo; Blom, Jochen; Goesmann, Alexander; Hain, Torsten; Chakraborty, Trinad

    2015-09-01

    The precise delineation of lineages and clonal groups are a prerequisite to examine within-species genetic variations, particularly with respect to pathogenic potential. A whole-genome-based approach was used to subtype and subgroup isolates of Listeria monocytogenes. Core-genome typing was performed, employing 3 different approaches: total core genes (CG), high-scoring segment pairs (HSPs), and average nucleotide identity (ANI). Examination of 113 L. monocytogenes genomes available in-house and in public domains revealed 33 phylogenomic groups (PGs). Each PG could be differentiated into a number of genomic types (GTs), depending on the approach used: HSPs (n = 57 GTs), CG (n = 71 GTs), and ANI (n = 83 GTs). Demarcation of the PGs was concordant with the 4 known lineages and led to the identification of sublineages in the lineage groups I, II, and III. In addition, PG assignments had discriminatory power similar to multi-virulence-locus sequence typing types and clonal complexes of multilocus sequence typing. Clustering of genomically highly similar isolates from different countries, sources, and isolation dates using whole-genome-based PG suggested that dispersion of phylogenomic clones of L. monocytogenes preceded their subsequent evolution. Classification according to PG may act as a guideline for future epidemiological studies.

  11. Evaluation of the Thermo Scientific SureTect Listeria species assay. AOAC Performance Tested Method 071304.

    Science.gov (United States)

    Cloke, Jonathan; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron

    2014-01-01

    The Thermo Scientific SureTect Listeria species Assay is a new real-time PCR assay for the detection of all species of Listeria in food and environmental samples. This validation study was conducted using the AOAC Research Institute (RI) Performance Tested Methods program to validate the SureTect Listeria species Assay in comparison to the reference method detailed in International Organization for Standardization 11290-1:1996 including amendment 1:2004 in a variety of foods plus plastic and stainless steel. The food matrixes validated were smoked salmon, processed cheese, fresh bagged spinach, cantaloupe, cooked prawns, cooked sliced turkey meat, cooked sliced ham, salami, pork frankfurters, and raw ground beef. All matrixes were tested by Thermo Fisher Scientific, Microbiology Division, Basingstoke, UK. In addition, three matrixes (pork frankfurters, fresh bagged spinach, and stainless steel surface samples) were analyzed independently as part of the AOAC-RI-controlled independent laboratory study by the University ofGuelph, Canada. Using probability of detection statistical analysis, a significant difference in favour of the SureTect assay was demonstrated between the SureTect and reference method for high level spiked samples of pork frankfurters, smoked salmon, cooked prawns, stainless steel, and low-spiked samples of salami. For all other matrixes, no significant difference was seen between the two methods during the study. Inclusivity testing was conducted with 68 different isolates of Listeria species, all of which were detected by the SureTect Listeria species Assay. None of the 33 exclusivity isolates were detected by the SureTect Listeria species Assay. Ruggedness testing was conducted to evaluate the performance of the assay with specific method deviations outside of the recommended parameters open to variation, which demonstrated that the assay gave reliable performance. Accelerated stability testing was additionally conducted, validating the assay

  12. Presence of listeria monocytogenes in prepared foods: analysis of influencing factors

    OpenAIRE

    Carbó Moliner, Rosa; Valle Mendoza, Luis Javier del

    2016-01-01

    Although food-borne outbreaks of listeriosis are uncommon, they remain a major public health problem. We assessed the prevalence of Listeria monocytogenes in prepared foods and the influence of different factors (including type of food or presence of accompanying bacteria). Results showed that accompanying bacteria cause interference in the sensitivity of the detection method, being half Fraser

  13. Disinfectant effect of Methylated Ethanol against Listeria species

    Directory of Open Access Journals (Sweden)

    Y Yakubu

    2012-04-01

    Full Text Available This study was carried out in order to determine the disinfectant effect of Methylated spirit® (95% methanol and 5% ethanol as a teat dip against Listeria species. Hand milking was employed to collect 576 (288 x 2 raw milk samples from different lactating cows within Sokoto metropolis (Nigeria. 288 samples were collected before disinfecting the udder teats with Methylated spirit®, while the other 288 were collected after disinfection with Methylated spirit®. The samples were analyzed using selective culture and isolation technique in which the 288 samples collected before disinfection, 114 (39.6% were positive for Listeria species. Among the positive samples 44 (38.6% were Listeria innocua, 16 (14.0% Listeria ivanovii, 36 (31.6% Listeria monocytogenes, 11 (9.6% Listeria welshimeri and 7 (6.1% Listeria seeligeri, while none of the 288 samples collected after disinfection was positive. The study has shown high prevalence of Listeria species in milk collected without washing/disinfecting the teats and has also established the sensitivity of Listeria species to methylated ethanol which can be used as dip for disinfecting udder teats before milking in order to prevent contamination with Listeria species and other methylated spirit-sensitive organisms. This study is essential to educate Fulani herdsmen and other milk handlers on the importance of disinfecting udder teats before milking. [Vet. World 2012; 5(2.000: 91-93

  14. Molecular serotype and evolutionary lineage of Listeria ...

    African Journals Online (AJOL)

    The molecular serotypes and the evolutionary lineage of Listeria monocytogenes isolated from various foods in Nigeria are yet to be documented. Consequently, popular uncooked food items known locally as Okazi Utazi, Onugbu, Ogbono, Garri and Egusi obtained from plants botanically known as Gnetum africanum, ...

  15. LACTIC FLORA-LISTERIA MONOCYTOGENES INTERACTION

    Directory of Open Access Journals (Sweden)

    S. Colombo

    2012-08-01

    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  16. Prevalence, antimicrobial resistance profiles of Listeria ...

    African Journals Online (AJOL)

    Listeria monocytogenes is known to cause epidemic and sporadic cases of listeriosis. The present study investigated the occurrence, antibiograms and molecular serotypes of the organism in various retail outlets in Gaborone, Botswana. Food samples were obtained randomly from selected supermarkets and street vendors ...

  17. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...

  18. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.

    2011-01-01

    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  19. Determination of virulence and antibiotic resistance pattern of biofilm producing Listeria species isolated from retail raw milk.

    Science.gov (United States)

    Osman, Kamelia M; Samir, Ahmed; Abo-Shama, Usama H; Mohamed, Essam H; Orabi, Ahmed; Zolnikov, Tara

    2016-11-08

    One of the foodborne pathogens is Listeria monocytogenes, which causes serious invasive illness in elderly and immunocompromised patients, pregnant women, newborns and infants ranking second after salmonellosis because of its high case fatality rate. Listerial cow mastitis marked by abnormal milk, increased cell counts and reduced production has not been reported. Therefore, apparently healthy cows can be reservoirs of L. monocytogenes. A number of 203 udder milk samples from apparently healthy animals (buffalo, n = 100; cow, n = 103) were collected and tested for Listeria. Isolated colonies on the PALCAM agar were Listeria species confirmed according to their biochemical and the Christie-Atkins-Munch-Petersen (CAMP) reactions. The Listeria species pathogenicity of was tested by phosphatidylinositol-specific phospholipase C, DL-alanine-β-naphthylamide HCl, Dalanine-p-nitroanilide tests, chick embryo, mice inoculation tests, Vero cell cytotoxicity and biofilm formation. The virulence-associated genes, hlyA, plcB, actA and iap associated with Listeria were molecularly assayed. The 17 isolated Listeria spp. represented a prevalence rate of 8.4 %. Of these 3 (1.4 %), 2 (1 %), 5 (2.5 %), 4 (2 %) and 3 (1.5 %) were confirmed as L. monocytogenes, L. innocua, L. welshimeri, L. seelegeri, respectively. While the L. monocytogenes isolate displayed all the four virulence-associated genes, L. seelegeri carried the hlyA gene only. The L. monocytogenes had a strong in vitro affinity to form a biofilm, in particular serotype 4 which is associated with human infections. L. monocytogenes showed resistance for 9/27 antibiotics. The biofilm forming capability of the Listeria spps. makes them particularly successful in colonizing surfaces within the host thus being responsible for persistence infections and due to their antimicrobial resistant phenotype that this structure confers. In addition, strains belonging to serotypes associated with human infections and

  20. Listeria monocytogenes transiently alters mitochondrial dynamics during infection.

    Science.gov (United States)

    Stavru, Fabrizia; Bouillaud, Frédéric; Sartori, Anna; Ricquier, Daniel; Cossart, Pascale

    2011-03-01

    Mitochondria are essential and highly dynamic organelles, constantly undergoing fusion and fission. We analyzed mitochondrial dynamics during infection with the human bacterial pathogen Listeria monocytogenes and show that this infection profoundly alters mitochondrial dynamics by causing transient mitochondrial network fragmentation. Mitochondrial fragmentation is specific to pathogenic Listeria monocytogenes, and it is not observed with the nonpathogenic Listeria innocua species or several other intracellular pathogens. Strikingly, the efficiency of Listeria infection is affected in cells where either mitochondrial fusion or fission has been altered by siRNA treatment, highlighting the relevance of mitochondrial dynamics for Listeria infection. We identified the secreted pore-forming toxin listeriolysin O as the bacterial factor mainly responsible for mitochondrial network disruption and mitochondrial function modulation. Together, our results suggest that the transient shutdown of mitochondrial function and dynamics represents a strategy used by Listeria at the onset of infection to interfere with cellular physiology.

  1. Trajectories of Listeria-type motility in two dimensions

    Science.gov (United States)

    Wen, Fu-Lai; Leung, Kwan-tai; Chen, Hsuan-Yi

    2012-12-01

    Force generated by actin polymerization is essential in cell motility and the locomotion of organelles or bacteria such as Listeria monocytogenes. Both in vivo and in vitro experiments on actin-based motility have observed geometrical trajectories including straight lines, circles, S-shaped curves, and translating figure eights. This paper reports a phenomenological model of an actin-propelled disk in two dimensions that generates geometrical trajectories. Our model shows that when the evolutions of actin density and force per filament on the disk are strongly coupled to the disk self-rotation, it is possible for a straight trajectory to lose its stability. When the instability is due to a pitchfork bifurcation, the resulting trajectory is a circle; a straight trajectory can also lose stability through a Hopf bifurcation, and the resulting trajectory is an S-shaped curve. We also show that a half-coated disk, which mimics the distribution of functionalized proteins in Listeria, also undergoes similar symmetry-breaking bifurcations when the straight trajectory loses stability. For both a fully coated disk and a half-coated disk, when the trajectory is an S-shaped curve, the angular frequency of the disk self-rotation is different from that of the disk trajectory. However, for circular trajectories, these angular frequencies are different for a fully coated disk but the same for a half-coated disk.

  2. Whole genome sequence-based serogrouping of Listeria monocytogenes isolates.

    Science.gov (United States)

    Hyden, Patrick; Pietzka, Ariane; Lennkh, Anna; Murer, Andrea; Springer, Burkhard; Blaschitz, Marion; Indra, Alexander; Huhulescu, Steliana; Allerberger, Franz; Ruppitsch, Werner; Sensen, Christoph W

    2016-10-10

    Whole genome sequencing (WGS) is currently becoming the method of choice for characterization of Listeria monocytogenes isolates in national reference laboratories (NRLs). WGS is superior with regards to accuracy, resolution and analysis speed in comparison to several other methods including serotyping, PCR, pulsed field gel electrophoresis (PFGE), multilocus sequence typing (MLST), multilocus variable number tandem repeat analysis (MLVA), and multivirulence-locus sequence typing (MVLST), which have been used thus far for the characterization of bacterial isolates (and are still important tools in reference laboratories today) to control and prevent listeriosis, one of the major sources of foodborne diseases for humans. Backward compatibility of WGS to former methods can be maintained by extraction of the respective information from WGS data. Serotyping was the first subtyping method for L. monocytogenes capable of differentiating 12 serovars and national reference laboratories still perform serotyping and PCR-based serogrouping as a first level classification method for Listeria monocytogenes surveillance. Whole genome sequence based core genome MLST analysis of a L. monocytogenes collection comprising 172 isolates spanning all 12 serotypes was performed for serogroup determination. These isolates clustered according to their serotypes and it was possible to group them either into the IIa, IIc, IVb or IIb clusters, respectively, which were generated by minimum spanning tree (MST) and neighbor joining (NJ) tree data analysis, demonstrating the power of the new approach. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  3. Zdravotní rizika spojená s rodem Listeria

    OpenAIRE

    KARBANOVÁ, Aneta

    2016-01-01

    This bachelor thesis is concerned with the health risks associated with the genus Listeria, especially with the species Listeria monocytogenes and Listeria ivanovii inducing listeriosis. As for humans, listeriosis occurs rather sporadically, nevertheless, it can cause outbreaks, listeriosis can also become a hospital infection. Listeriosis is dangerous primarily for pregnant women where it can cause abortions and for individuals with weakened immune systems where it may even cause encephaliti...

  4. Identification of Multiple Bacteriocins in Enterococcus spp. Using an Enterococcus-Specific Bacteriocin PCR Array

    Directory of Open Access Journals (Sweden)

    Chris Henning

    2015-02-01

    Full Text Available Twenty-two bacteriocin-producing Enterococcus isolates obtained from food and animal sources, and demonstrating activity against Listeria monocytogenes, were screened for bacteriocin-related genes using a bacteriocin PCR array based on known enterococcal bacteriocin gene sequences in the NCBI GenBank database. The 22 bacteriocin-positive (Bac+ enterococci included En. durans (1, En. faecalis (4, En. faecium (12, En. hirae (3, and En. thailandicus (2. Enterocin A (entA, enterocins mr10A and mr10B (mr10AB, and bacteriocin T8 (bacA were the most commonly found structural genes in order of decreasing prevalence. Forty-five bacteriocin genes were identified within the 22 Bac+ isolates, each containing at least one of the screened structural genes. Of the 22 Bac+ isolates, 15 possessed two bacteriocin genes, seven isolates contained three different bacteriocins, and three isolates contained as many as four different bacteriocin genes. These results may explain the high degree of bactericidal activity observed with various Bac+ Enterococcus spp. Antimicrobial activity against wild-type L. monocytogenes and a bacteriocin-resistant variant demonstrated bacteriocins having different modes-of-action. Mixtures of bacteriocins, especially those with different modes-of-action and having activity against foodborne pathogens, such as L. monocytogenes, may play a promising role in the preservation of food.

  5. Sakacin-A antimicrobial packaging for decreasing Listeria contamination in thin-cut meat: preliminary assessment.

    Science.gov (United States)

    Barbiroli, Alberto; Musatti, Alida; Capretti, Giorgio; Iametti, Stefania; Rollini, Manuela

    2017-02-01

    Minimally processed ready-to-eat products are considered a high-risk food because of the possibility of contamination with pathogenic bacteria, including Listeria monocytogenes from the animal reservoir, and the minimal processing they undergo. In this study, a sakacin-A anti-Listeria active package was developed and tested on thin-cut veal meat slices (carpaccio). Enriched food-grade sakacin-A was obtained from a cell-free supernatant of a Lactobacillus sakei culture and applied (0.63 mg cm -2 ) onto the surface of polyethylene-coated paper sheets to obtain an active antimicrobial package. The coating retained antimicrobial features, indicating that the process did not affect sakacin-A functionality, as evidenced in tests carried out in vitro. Thin-cut veal meat slices inoculated with Listeria innocua (a surrogate of pathogenic L. monocytogenes) were laid on active paper sheets. After 48 h incubation at 4 °C, the Listeria population was found to be 1.5 log units lower with respect to controls (3.05 vs 4.46 log colony-forming units (CFU) g -1 ). This study demonstrates the possibility of using an antimicrobial coating containing sakacin-A to inhibit or decrease the Listeria population in ready-to-eat products, thus lowering the risk of food-related diseases. © 2016 The Authors. Journal of The Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. © 2016 The Authors. Journal of The Science of Food and Agriculture published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry.

  6. Isolation and biochemical and molecular characterization of Listeria monocytogenes in food

    International Nuclear Information System (INIS)

    Helel, Salma

    2008-01-01

    monocytogenes is a Gram-positive bacteria, saprophytic, non-spore. This is an extremely resistant seeds to environmental conditions outside, especially since the cold psychrotrophic. It can contaminate raw vegetables, cooked meals ready for consumption or foods to be stored in the refrigerator, such as cheese or meat. It is the bacteria responsible for listeriosis. It threatens first unborn children, infants, pregnant women, the elderly and people whose immune system is weakened. Strains of Listeria spp isolated from foods (seafood, meat, meat) were first identified at the stage of the genus by classical tests (Gram staining, catalase test, oxidase test and mobility) and stage of the test case by hemolysis, CAMP test and the gallery Api Listeria. Biochemical characterization allowed after a numerical analysis, to assign 100% of isolates to the genus Listeria. Molecular characterization was performed by PCR amplification of genes coding for protein p60 (iap), the listeriolysine O (hly), the Phosphatidylinositol Phospholipase C (PI-PLC plca) Phosphatidylcholine Phospholipase C (plcB). The result showed an amplification of the iap gene of 100% of the hly gene, plca, plcB of 31.81%. This characterization represents an identification of the collection on the genetic level and shows that 31.81% of isolates, is likely to express the genes responsible for virulence factors of L. monocytogenes, to produce listeriolysine O, phospholipase C and Lecithinase. The molecular identification was performed by microarray technique and identified isolates L. September monocytogenes (five original clinical isolates and two food-borne), fourteen L. innocua (of food) and a strain not identified by DNA chip.. (Author)

  7. A new pathway for the synthesis of α-ribazole-phosphate in Listeria innocua.

    Science.gov (United States)

    Gray, Michael J; Escalante-Semerena, Jorge C

    2010-09-01

    The genomes of Listeria spp. encode all but one of 25 enzymes required for the biosynthesis of adenosylcobalamin (AdoCbl; coenzyme B(12) ). Notably, all Listeria genomes lack CobT, the nicotinamide mononucleotide:5,6-dimethylbenzimidazole (DMB) phosphoribosyltransferase (EC 2.4.2.21) enzyme that synthesizes the unique α-linked nucleotide N(1) -(5-phospho-α-D-ribosyl)-DMB (α-ribazole-5'-P, α-RP), a precursor of AdoCbl. We have uncovered a new pathway for the synthesis of α-RP in Listeria innocua that circumvents the lack of CobT. The cblT and cblS genes (locus tags lin1153 and lin1110) of L. innocua encode an α-ribazole (α-R) transporter and an α-R kinase respectively. Results from in vivo experiments indicate that L. innocua depends on CblT and CblS activities to salvage exogenous α-R, allowing conversion of the incomplete corrinoid cobinamide (Cbi) into AdoCbl. Expression of the L. innocua cblT and cblS genes restored AdoCbl synthesis from Cbi and α-R in a Salmonella enterica cobT strain. LinCblT transported α-R across the cell membrane, but not α-RP or DMB. UV-visible spectroscopy and mass spectrometry data identified α-RP as the product of the ATP-dependent α-R kinase activity of LinCblS. Bioinformatics analyses suggest that α-R salvaging occurs in important Gram-positive human pathogens. © 2010 Blackwell Publishing Ltd.

  8. Listeria monocytogenes in fish farming and processing

    OpenAIRE

    Miettinen, Hanna

    2006-01-01

    Contamination of fish products with Listeria monocytogenes, a bacterium causing listeriosis, presents a risk to consumer health. To better control this, the present study investigated the prevalence and sources of L. monocytogenes in different stages of fish production chain as well as the effects of a pasteurisation method on rainbow trout roe products. Farmed rainbow trout from different fish farms were found to contain L. monocytogenes at an average rate of 9%. L. monocytogenes preval...

  9. A PNPase Dependent CRISPR System in Listeria

    Science.gov (United States)

    Sesto, Nina; Touchon, Marie; Andrade, José Marques; Kondo, Jiro; Rocha, Eduardo P. C.; Arraiano, Cecilia Maria; Archambaud, Cristel; Westhof, Éric; Romby, Pascale; Cossart, Pascale

    2014-01-01

    The human bacterial pathogen Listeria monocytogenes is emerging as a model organism to study RNA-mediated regulation in pathogenic bacteria. A class of non-coding RNAs called CRISPRs (clustered regularly interspaced short palindromic repeats) has been described to confer bacterial resistance against invading bacteriophages and conjugative plasmids. CRISPR function relies on the activity of CRISPR associated (cas) genes that encode a large family of proteins with nuclease or helicase activities and DNA and RNA binding domains. Here, we characterized a CRISPR element (RliB) that is expressed and processed in the L. monocytogenes strain EGD-e, which is completely devoid of cas genes. Structural probing revealed that RliB has an unexpected secondary structure comprising basepair interactions between the repeats and the adjacent spacers in place of canonical hairpins formed by the palindromic repeats. Moreover, in contrast to other CRISPR-Cas systems identified in Listeria, RliB-CRISPR is ubiquitously present among Listeria genomes at the same genomic locus and is never associated with the cas genes. We showed that RliB-CRISPR is a substrate for the endogenously encoded polynucleotide phosphorylase (PNPase) enzyme. The spacers of the different Listeria RliB-CRISPRs share many sequences with temperate and virulent phages. Furthermore, we show that a cas-less RliB-CRISPR lowers the acquisition frequency of a plasmid carrying the matching protospacer, provided that trans encoded cas genes of a second CRISPR-Cas system are present in the genome. Importantly, we show that PNPase is required for RliB-CRISPR mediated DNA interference. Altogether, our data reveal a yet undescribed CRISPR system whose both processing and activity depend on PNPase, highlighting a new and unexpected function for PNPase in “CRISPRology”. PMID:24415952

  10. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus

    2014-01-01

    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  11. Prevalence and populations of Listeria monocytogenes in meat products retailed in Sao Paulo, Brazil.

    Science.gov (United States)

    Ristori, Christiane Asturiano; Rowlands, Ruth Estela Gravato; Martins, Cecília Geraldes; Barbosa, Maria Luisa; Yoshida, Júlia T U; Franco, Bernadette D G de Melo

    2014-12-01

    This study evaluated the prevalence of the populations and serotypes of Listeria monocytogenes in 552 refrigerated samples of ground beef, chicken leg, hot dog, and pork sausage collected in supermarkets in the city of Sao Paulo, SP, Brazil, between May 2008 and July 2009. The supermarkets were selected after stratification by geographical region and by random draw. Tests for presence and enumeration of L. monocytogenes were based on ISO 11290-1:1996/Amd.1:2004 and ISO 11290-2:1998 methods, respectively. Listeria spp. were detected in 469 (85.0%) of the studied meat products. The most frequently isolated species was L. innocua (64.1%), followed by L. monocytogenes (48.7%), L. welshimeri (13.4%), L. seeligeri (7.1%), L. ivanovii (0.2%), and L. grayi subspecies murrayi (0.2%). L. monocytogenes was detected in 269 (48.7%) samples, with highest prevalence in ground beef (59.4%) followed by chicken legs (58.0%), pork sausages (39.8%), and hot dogs (37.7%). The populations were Prevalence of serotypes varied according to the type of meat product. These data are relevant for estimating the risks of listeriosis associated with consumption of meat products in Sao Paulo, and for establishing science-based intervention strategies aimed at reducing these risks, especially for pregnant women and immunocompromised individuals.

  12. Serotypes and Pulsotypes diversity of Listeria monocytogenes in a beef-processing environment.

    Science.gov (United States)

    Camargo, Anderson Carlos; Dias, Mariane Rezende; Cossi, Marcus Vinícius Coutinho; Lanna, Frederico Germano Piscitelli Alvarenga; Cavicchioli, Valéria Quintana; Vallim, Deyse Christina; Pinto, Paulo Sérgio de Arruda; Hofer, Ernesto; Nero, Luís Augusto

    2015-04-01

    Utensils and equipment from meat-processing facilities are considered relevant cross-contamination points of Listeria monocytogenes to foods, demanding tracking studies to identify their specific origins, and predict proper control. The present study aimed to detect L. monocytogenes in a beef-processing facility, investigating the diversity of serotypes and pulsotypes in order to identify the possible contamination routes. Surface samples from knives (n=26), tables (n=78), and employees hands (n=74) were collected before and during the procedures from a beef-processing facility, in addition to surface samples of end cuts: round (n=32), loin (n=30), and chuck (n=32). All samples were subjected to L. monocytogenes screening according ISO 11.290-1, and the obtained isolates were subjected to serotyping and pulsed-field gel electrophoresis. Listeria spp. were identified in all processing steps, in 61 samples, and L. monocytogenes was detected in 17 samples, not being found only in knives. Eighty-five isolates were identified as L. monocytogenes, from serotypes 1/2c (n=65), 4b (n=13), and 1/2b (n=7), being grouped in 19 pulsotypes. Considering these results, cross-contamination among hands, tables, and beef cuts could be identified. The obtained data indicated the relevance of cross-contamination in the beef-processing facility, and the occurrence of serotypes 1/2b and 4b in beef cuts distributed for retail sale is a public health concern.

  13. Prevalence and Virulence Characterization of Listeria monocytogenes in Chilled Pork in Zhejiang Province, China.

    Science.gov (United States)

    Fang, Chun; Shan, Ying; Cao, Tong; Xia, Ye; Xin, Yongping; Cheng, Changyong; Song, Houhui; Li, Xiaoliang; Fang, Weihuan

    2016-01-01

    Listeria monocytogenes is an important foodborne pathogen that can grow in refrigeration temperature and causes severe human infections. The aims of this work were to estimate the prevalence of L. monocytogenes in chilled pork in Zhejiang, China and to examine the virulence features of the isolates. Of 331 meat samples, 196 were positive for Listeria spp., with L. innocua accounting for 54.4%, L. monocytogenes for 11.5%, and L. welshimeri for 4.2%. The most prevalent L. monocytogenes serotype was 1/2c (60.5%), followed by serotypes 1/2a (28.9%), 1/2b (7.9%), and 4b (2.6%). All L. monocytogenes isolates contained virulence-associated genes examined. Adhesion and invasion ability of serotype 1/2c isolates was much lower than those of other serotypes. Only one isolate was defective in cell-to-cell spread. These findings are important for risk assessment of chilled pork as a source of potential transmission of L. monocytogenes to other food products, particularly to ready-to-eat food products.

  14. ISG15 counteracts Listeria monocytogenes infection

    Science.gov (United States)

    Radoshevich, Lilliana; Impens, Francis; Ribet, David; Quereda, Juan J; Nam Tham, To; Nahori, Marie-Anne; Bierne, Hélène; Dussurget, Olivier; Pizarro-Cerdá, Javier; Knobeloch, Klaus-Peter; Cossart, Pascale

    2015-01-01

    ISG15 is an interferon-stimulated, linear di-ubiquitin-like protein, with anti-viral activity. The role of ISG15 during bacterial infection remains elusive. We show that ISG15 expression in nonphagocytic cells is dramatically induced upon Listeria infection. Surprisingly this induction can be type I interferon independent and depends on the cytosolic surveillance pathway, which senses bacterial DNA and signals through STING, TBK1, IRF3 and IRF7. Most importantly, we observed that ISG15 expression restricts Listeria infection in vitro and in vivo. We made use of stable isotope labeling in tissue culture (SILAC) to identify ISGylated proteins that could be responsible for the protective effect. Strikingly, infection or overexpression of ISG15 leads to ISGylation of ER and Golgi proteins, which correlates with increased secretion of cytokines known to counteract infection. Together, our data reveal a previously uncharacterized ISG15-dependent restriction of Listeria infection, reinforcing the view that ISG15 is a key component of the innate immune response. DOI: http://dx.doi.org/10.7554/eLife.06848.001 PMID:26259872

  15. Occurrence of Listeria monocytogens in raw milk of ruminants in Basrah province

    Directory of Open Access Journals (Sweden)

    B. A. Abbas

    2012-01-01

    Full Text Available The present study was performed on three hundred raw milk samples, 100 each from cows, sheep and buffaloes were collected from different places of Basrah city. 7.3 % of the samples were found to be positive for Listeria spp. Cow's milk was found to be more infected than other animals milk with this bacteria. All bacterial isolates were confirmed as L. monocytogens by colony characteristics, beta haemolysis, cold enrichment procedure, selective media, Anton test, tumbling and inverted pine tree motility and sugar fermentation tests. Most isolates were found to be sensitive to cefotaxine, sulfamethoxazol, chloramphenical and tobramycin. rifampicin was found to have less effect on these isolates. Effects of pH and temperature on bacterial growth were also studied to test the ability of this microorganism to survive in milk under severe conditions. The pH range for growth was from 4 to 9.5. The temperature range was between 4 – 45 ºC.

  16. Mathematical Model of Interaction Between Bacteriocin-Producing Lactic Acid Bacteria and Listeria. Part 2: Bifurcations and Applications.

    Science.gov (United States)

    Delboni, Roberta Regina; Yang, Hyun Mo

    2017-10-01

    The big challenge for the food industry is the attending to demands for minimally processed foods, avoiding intense heat treatments and reducing the addition of chemical preservatives, but at the same time ensuring microbiological safety of these products. Lactic acid bacteria are traditionally used in the production of fermented foods. They are responsible for the production of antimicrobial compounds, such as organic acids and bacteriocins, which are protein compounds with bactericidal effect against related species and bacteria such as Listeria monocytogenes and Staphylococcus aureus. Aiming to study quantitatively the biological control as a technique of conservation, we developed a mathematical model to describe the interaction between lactic acid bacteria and Listeria in the food. The steady state and dynamical trajectories analyses of the model permit us to study the suitability of including lactic acid bacteria in order to reduce the growth of Listeria in food.

  17. Novel Cadmium Resistance Determinant in Listeria monocytogenes.

    Science.gov (United States)

    Parsons, Cameron; Lee, Sangmi; Jayeola, Victor; Kathariou, Sophia

    2017-03-01

    Listeria monocytogenes is a foodborne pathogen that can cause severe disease (listeriosis) in susceptible individuals. It is ubiquitous in the environment and often exhibits resistance to heavy metals. One of the determinants that enables Listeria to tolerate exposure to cadmium is the cadAC efflux system, with CadA being a P-type ATPase. Three different cadA genes (designated cadA1 to cadA3 ) were previously characterized in L. monocytogenes A novel putative cadmium resistance gene ( cadA4 ) was recently identified through whole-genome sequencing, but experimental confirmation for its involvement in cadmium resistance is lacking. In this study, we characterized cadA4 in L. monocytogenes strain F8027, a cadmium-resistant strain of serotype 4b. By screening a mariner-based transposon library of this strain, we identified a mutant with reduced tolerance to cadmium and that harbored a single transposon insertion in cadA4 The tolerance to cadmium was restored by genetic complementation with the cadmium resistance cassette ( cadA4C ), and enhanced cadmium tolerance was conferred to two unrelated cadmium-sensitive strains via heterologous complementation with cadA4C Cadmium exposure induced cadA4 expression, even at noninhibitory levels. Virulence assessments in the Galleria mellonella model suggested that a functional cadA4 suppressed virulence, potentially promoting commensal colonization of the insect larvae. Biofilm assays suggested that cadA4 inactivation reduced biofilm formation. These data not only confirm cadA4 as a novel cadmium resistance determinant in L. monocytogenes but also provide evidence for roles in virulence and biofilm formation. IMPORTANCE Listeria monocytogenes is an intracellular foodborne pathogen causing the disease listeriosis, which is responsible for numerous hospitalizations and deaths every year. Among the adaptations that enable the survival of Listeria in the environment are the abilities to persist in biofilms, grow in the cold, and

  18. Analysis of Listeria using exogenous volatile organic compound metabolites and their detection by static headspace-multi-capillary column-gas chromatography-ion mobility spectrometry (SHS-MCC-GC-IMS).

    Science.gov (United States)

    Taylor, Carl; Lough, Fraser; Stanforth, Stephen P; Schwalbe, Edward C; Fowlis, Ian A; Dean, John R

    2017-07-01

    Listeria monocytogenes is a Gram-positive bacterium and an opportunistic food-borne pathogen which poses significant risk to the immune-compromised and pregnant due to the increased likelihood of acquiring infection and potential transmission of infection to the unborn child. Conventional methods of analysis suffer from either long turn-around times or lack the ability to discriminate between Listeria spp. reliably. This paper investigates an alternative method of detecting Listeria spp. using two novel enzyme substrates that liberate exogenous volatile organic compounds in the presence of α-mannosidase and D-alanyl aminopeptidase. The discriminating capabilities of this approach for identifying L. monocytogenes from other species of Listeria are investigated. The liberated volatile organic compounds (VOCs) are detected using an automated analytical technique based on static headspace-multi-capillary column-gas chromatography-ion mobility spectrometry (SHS-MCC-GC-IMS). The results obtained by SHS-MCC-GC-IMS are compared with those obtained by the more conventional analytical technique of headspace-solid phase microextraction-gas chromatography-mass spectrometry (HS-SPME-GC-MS). The results found that it was possible to differentiate between L. monocytogenes and L. ivanovii, based on their VOC response from α-mannosidase activity.

  19. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    Prof. Ogunji

    Abstract. The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold ...

  20. Application of heat in postcook meat chillers reduces Listeria.

    Science.gov (United States)

    Eglezos, Sofroni; Dykes, Gary A

    2011-06-01

    Electrical air-blowing heaters were used to heat and dry out holding chillers used for postcook commercial processed meats in an attempt to control the presence of Listeria. A baseline study of the prevalence of Listeria in holding chillers in seven facilities was undertaken. Listeria was detected in four of the seven chillers, and swab samples showed Listeria prevalence ranging from 7 (7.8%) of 90 to 6 (20%) of 30, depending on the facility. Two of the facilities with established Listeria contamination (A and E) were chosen for further studies. The heating trials consisted of three individual heating interventions at each of the two facilities, with 2 weeks of postintervention sampling after each treatment. The initial Listeria prevalence in chiller A was 19 (10.6%) of 180, and treatment at 37°C for 36 h reduced prevalence to 3 (1.7%) of 180. The initial Listeria prevalence in chiller E was 7 (7.8%) of 90, and treatment at 50°C for 2 h reduced prevalence to 0 of 90. Both reductions were statistically significant at P prevalence of Listeria in chillers.

  1. Listeria Occurrence in Poultry Flocks: Detection and Potential Implications

    Science.gov (United States)

    Foodborne pathogens such as Salmonella, Campylobacter, Escherichia coli, and Listeria are a major concern within the food industry due to their pathogenic potential to cause infection. Of these, Listeria monocytogenes, possesses a high mortality rate (approximately20%) and is considered one of the m...

  2. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-03

    Sep 3, 2008 ... monocytogenes and other Listeria species are common contaminant of smoked fish, and this may pose serious public health implications. Key words: Smoked fish, Listeria monocytogenes, contamination, public health. INTRODUCTION ... L. monocytogenes belong to the recently emerging psychrotrophic ...

  3. Sensitivity of Listeria species, recovered from indigenous chickens ...

    African Journals Online (AJOL)

    Background: Resistance of bacteria to antibiotics and disinfectants has been reported widely in the world. Listeria monocytogenes is no exception, although normally it tends to be variably sensitive to many antibiotics and disinfectants. Objectives: To assess the susceptibility of Listeria isolates recovered from indigenous ...

  4. Occurrence of Listeria Monocytogenes in Irrigation Water and ...

    African Journals Online (AJOL)

    In this study, thirty water samples obtained from rivers, streams and ponds used for irrigation of vegetables at thirty different sites in Jos, Plateau state, Nigeria were analyzed for the presence Listeria monocytogenes and other Listeria species using the two-step enrichment method. Ten samples each spinach, lettuce and ...

  5. application à une population de Listeria monocytogenes CIP 7831 ...

    African Journals Online (AJOL)

    Etude de l'impact de la variation de la température sur les activités microbiennes : application à une population de Listeria monocytogenes CIP 7831, Listeria monocytogenes Scott A CIP 103575 et Escherichia coli ATCC 25922.

  6. Incidence of Listeria monocytogenes and Other Bacteria in ...

    African Journals Online (AJOL)

    The involvement of Listeria monocytogenes in spontaneous abortion in Jos was investigated. One hundred blood and 100 placenta samples were collected from spontaneous abortion patients in Jos. The samples were inoculated first into Listeria enrichment broth. Incubation was at 37o C, followed by cold enrichment at ...

  7. Evaluation of a loop-mediated isothermal amplification method for the detection ofListeria monocytogenesin dairy food.

    Science.gov (United States)

    Tirloni, Erica; Bernardi, Cristian; Drago, Sandro; Stampone, Giuseppe; Pomilio, Francesco; Cattaneo, Patrizia; Stella, Simone

    2017-10-20

    Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP)-based method for the detection of Listeria monocytogenes , with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32) of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3-0.7 Log CFU/g) was also evaluated, in duplicate, in pasteurised milk (whole and skimmed) and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola). The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.

  8. Evaluation of a loop-mediated isothermal amplification method for the detection of Listeria monocytogenes in dairy food

    Directory of Open Access Journals (Sweden)

    Erica Tirloni

    2017-12-01

    Full Text Available Objective of the present study was to test the performances of a loop-mediated isothermal amplification (LAMP-based method for the detection of Listeria monocytogenes, with particular focus on the dairy products. The specificity of the method was evaluated on 42 different Listeria spp. strains from collections, food and environmental samples. 100% (32 of 32 of the L. monocytogenes strains were correctly recognised, and none of other 10 Listeria spp. strains was misidentified. The sensitivity was evaluated on four L. monocytogenes strains from different sources. The instrument was able to detect 10-400 CFU/mL. The ability to detect low initial numbers of L. monocytogenes (0.3- 0.7 Log CFU/g was also evaluated, in duplicate, in pasteurised milk (whole and skimmed and dairy samples (fresh ricotta, crescenza, mascarpone, mozzarella, cottage cheese, cream cheese, taleggio, gorgonzola. The analysis was performed after 18, 24 and 48 h of incubation, and was coupled with the count of L. monocytogenes in the broth. Microbial loads were insufficient to achieve a positive result after 18 and 24 h in most of the samples; after 48 h, all the products, except taleggio and one gorgonzola sample, were identified as positive; the sensitivity of the method when applied to contaminated dairy foods was about 5 Log CFU/g. The LAMP method tested can be considered a very useful tool, as it is a costeffective and easy-functioning method. The preliminary data obtained should be confirmed with a validation process taking into account different food typologies.

  9. Foodborne Listeria monocytogenes: A Real Challenge in Quality Control

    Directory of Open Access Journals (Sweden)

    Tünde Pusztahelyi

    2016-01-01

    Full Text Available Listeria monocytogenes is a foodborne pathogen, and the detection and differentiation of this bacterium from the nonpathogenic Listeria species are of great importance to the food industry. Differentiation of Listeria species is very difficult, even with the sophisticated MALDI-TOF MS technique because of the close genetic relationship of the species and the usual gene transfer. The present paper emphasizes the difficulties of the differentiation through the standardized detection and confirmation according to ISO 11290-1:1996 and basic available L. monocytogenes detection methods and tests (such as API Listeria test, MALDI-TOF MS analysis, and hly gene PCR. With the increase of reports on the pathogenesis of atypical Listeria strains in humans, the significance of species level determination has become questionable, especially in food quality control, and the detection of pathogenic characteristics seems to be more relevant.

  10. Phages of Listeria offer novel tools for diagnostics and biocontrol

    Directory of Open Access Journals (Sweden)

    Martin J Loessner

    2014-04-01

    Full Text Available Historically, bacteriophages infecting their hosts have perhaps been best known and even notorious for being a nuisance in dairy-fermentation processes. However, with the rapid progress in molecular microbiology and microbial ecology, a new dawn has risen for phages. This review will provide an overview on possible uses and applications of Listeria phages, including phage-typing, reporter phage for bacterial diagnostics, and use of phage as biocontrol agents for food safety. The use of phage-encoded enzymes such as endolysins for the detection and as antimicrobial will also be addressed. Desirable properties of candidate phages for biocontrol will be discussed. While emphasizing the enormous future potential for applications, we will also consider some of the intrinsic limitations dictated by both phage and bacterial ecology.

  11. Rapid detection and differentiation of Listeria monocytogenes and Listeria species in deli meats by a new multiplex PCR method

    Science.gov (United States)

    Listeria monocytogenes is an important foodborne pathogen. To effectively control this pathogen, it is necessary to have a method that can detect and differentiate L. monocytogenes from other Listeria species in food, environmental, and clinical samples. A new multiplex PCR method using new primers ...

  12. Reduced detectability of Listeria monocytogenes in the presence of Listeria innocua.

    Science.gov (United States)

    Zitz, Ulrike; Zunabovic, Marija; Domig, Konrad J; Wilrich, Peter-Theodor; Kneifel, Wolfgang

    2011-08-01

    Recent foodborne crises have demonstrated the importance of monitoring food safety. In terms of microbiological criteria, food safety requires the reliable detection of pathogens such as Listeria monocytogenes along the food chain by appropriate analytical methods. However, indications exist that accompanying Listeria innocua strains suppress the growth of L. monocytogenes during selective enrichment, which may cause reduced or even inhibited detection. To study these effects, the limit of detection of L. monocytogenes was investigated in the presence of L. innocua using the International Organization for Standardization standard method ISO 11290-1 and the VIDAS LDUO system, an automated method based on enzyme-linked fluorescence technology. The challenge was to provide low initial Listeria concentrations at sufficient precision to quantify the influence on the probability of detection of L. monocytogenes. The application of reference materials appropriate for quantitative test methods and a standardized dilution procedure were necessary to ensure accurate CFU levels of defined proportions of mixtures of both Listeria species. During selective enrichment, overgrowth of L. monocytogenes by L. innocua could be confirmed, leading to high rates of false-negative results. Moreover, with both methods, a significant decrease in the detectability of L. monocytogenes could be quantified at ratios of 2:1 at very low concentrations representative of natural contamination levels often found in foods and environments. It is concluded that there is a need to improve existing procedures with respect to selective enrichment, as well as the detection techniques.

  13. New Aspects Regarding Evolution and Virulence of Listeria monocytogenes Revealed by Comparative Genomics and DNA Arrays

    Science.gov (United States)

    Doumith, Michel; Cazalet, Christel; Simoes, Natalie; Frangeul, Lionel; Jacquet, Christine; Kunst, Frank; Martin, Paul; Cossart, Pascale; Glaser, Philippe; Buchrieser, Carmen

    2004-01-01

    Listeria monocytogenes is a food-borne bacterial pathogen that causes a wide spectrum of diseases, such as meningitis, septicemia, abortion, and gastroenteritis, in humans and animals. Among the 13 L. monocytogenes serovars described, invasive disease is mostly associated with serovar 4b strains. To investigate the genetic diversity of L. monocytogenes strains with different virulence potentials, we partially sequenced an epidemic serovar 4b strain and compared it with the complete sequence of the nonepidemic L. monocytogenes EGDe serovar 1/2a strain. We identified an unexpected genetic divergence between the two strains, as about 8% of the sequences were serovar 4b specific. These sequences included seven genes coding for surface proteins, two of which belong to the internalin family, and three genes coding for transcriptional regulators, all of which might be important in different steps of the infectious process. Based on the sequence information, we then characterized the gene content of 113 Listeria strains by using a newly designed Listeria array containing the “flexible” part of the sequenced Listeria genomes. Hybridization results showed that all of the previously identified virulence factors of L. monocytogenes were present in the 93 L. monocytogenes strains tested. However, distinct patterns of the presence or absence of other genes were identified among the different L. monocytogenes serovars and Listeria species. These results allow new insights into the evolution of L. monocytogenes, suggesting that early divergence of the ancestral L. monocytogenes serovar 1/2c strains from the serovar 1/2b strains led to two major phylogenetic lineages, one of them including the serogroup 4 strains, which branched off the serovar 1/2b ancestral lineage, leading (mostly by gene loss) to the species Listeria innocua. The identification of 30 L. monocytogenes-specific and several serovar-specific marker genes, such as three L. monocytogenes serovar 4b

  14. Uji Infeksi Mycosphaerella spp Terhadap Bibit Eucalyptus spp

    OpenAIRE

    Lidya Morita Sondang

    2009-01-01

    Tujuan penelitian ini adalah untuk mengetahui tingkat ketahanan 2 klon Eucalyptus spp yaitu Eucalyptus grandis x Eucalyptus pellita dan Eucalyptus grandis x Eucalyptus urophylla terhadap Mycosphaerella spp serta mengetahui virulensi Mycospaherella spp pada 2 kelas umur (2 dan 3 bulan) pada tanaman Eucalyptus spp. Penelitian ini dilaksanakan dengan pengambilan sampel bibit tanaman Eucalyptus grandis x Eucalyptus pellita dan Eucalyptus grandis x Eucalyptus urophylla dari pembibitan PT.Toba Pulp...

  15. Listeria monocytogenes Growth Kinetics in Milkshakes Made from Naturally and Artificially Contaminated Ice Cream

    OpenAIRE

    Salazar, Joelle K.; Bathija, Vriddi M.; Carstens, Christina K.; Narula, Sartaj S.; Shazer, Arlette; Stewart, Diana; Tortorello, Mary Lou

    2018-01-01

    This study assessed the growth of Listeria monocytogenes in milkshakes made using the process-contaminated ice cream associated with a listeriosis outbreak in comparison to milkshakes made with artificially contaminated ice cream. For all temperatures, growth kinetics including growth rates, lag phases, maximum populations, and population increases were determined for the naturally and artificially derived contaminants at 5, 10, 15, and 25°C storage for 144 h. The artificially inoculated L. m...

  16. Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics.

    Science.gov (United States)

    Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A

    2014-05-01

    The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.

  17. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food.

    Science.gov (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V

    2016-01-01

    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  18. Occurrence of Babesia spp., Rickettsia spp. and Bartonella spp. in Ixodes ricinus in Bavarian public parks, Germany

    Directory of Open Access Journals (Sweden)

    Mahling Monia

    2011-07-01

    Full Text Available Abstract Background Only limited information is available about the occurrence of ticks and tick-borne pathogens in public parks, which are areas strongly influenced by human beings. For this reason, Ixodes ricinus were collected in public parks of different Bavarian cities in a 2-year survey (2009 and 2010 and screened for DNA of Babesia spp., Rickettsia spp. and Bartonella spp. by PCR. Species identification was performed by sequence analysis and alignment with existing sequences in GenBank. Additionally, coinfections with Anaplasma phagocytophilum were investigated. Results The following prevalences were detected: Babesia spp.: 0.4% (n = 17, including one pool of two larvae in 2009 and 0.5 to 0.7% (n = 11, including one pool of five larvae in 2010; Rickettsia spp.: 6.4 to 7.7% (n = 285, including 16 pools of 76 larvae in 2009. DNA of Bartonella spp. in I. ricinus in Bavarian public parks could not be identified. Sequence analysis revealed the following species: Babesia sp. EU1 (n = 25, B. divergens (n = 1, B. divergens/capreoli (n = 1, B. gibsoni-like (n = 1, R. helvetica (n = 272, R. monacensis IrR/Munich (n = 12 and unspecified R. monacensis (n = 1. The majority of coinfections were R. helvetica with A. phagocytophilum (n = 27, but coinfections between Babesia spp. and A. phagocytophilum, or Babesia spp. and R. helvetica were also detected. Conclusions I. ricinus ticks in urban areas of Germany harbor several tick-borne pathogens and coinfections were also observed. Public parks are of particularly great interest regarding the epidemiology of tick-borne pathogens, because of differences in both the prevalence of pathogens in ticks as well as a varying species arrangement when compared to woodland areas. The record of DNA of a Babesia gibsoni-like pathogen detected in I. ricinus suggests that I. ricinus may harbor and transmit more Babesia spp. than previously known. Because of their high recreational value for human beings, urban green

  19. Occurrence of Babesia spp., Rickettsia spp. and Bartonella spp. in Ixodes ricinus in Bavarian public parks, Germany.

    Science.gov (United States)

    Schorn, Sabine; Pfister, Kurt; Reulen, Holger; Mahling, Monia; Silaghi, Cornelia

    2011-07-15

    Only limited information is available about the occurrence of ticks and tick-borne pathogens in public parks, which are areas strongly influenced by human beings. For this reason, Ixodes ricinus were collected in public parks of different Bavarian cities in a 2-year survey (2009 and 2010) and screened for DNA of Babesia spp., Rickettsia spp. and Bartonella spp. by PCR. Species identification was performed by sequence analysis and alignment with existing sequences in GenBank. Additionally, coinfections with Anaplasma phagocytophilum were investigated. The following prevalences were detected: Babesia spp.: 0.4% (n = 17, including one pool of two larvae) in 2009 and 0.5 to 0.7% (n = 11, including one pool of five larvae) in 2010; Rickettsia spp.: 6.4 to 7.7% (n = 285, including 16 pools of 76 larvae) in 2009. DNA of Bartonella spp. in I. ricinus in Bavarian public parks could not be identified. Sequence analysis revealed the following species: Babesia sp. EU1 (n = 25), B. divergens (n = 1), B. divergens/capreoli (n = 1), B. gibsoni-like (n = 1), R. helvetica (n = 272), R. monacensis IrR/Munich (n = 12) and unspecified R. monacensis (n = 1). The majority of coinfections were R. helvetica with A. phagocytophilum (n = 27), but coinfections between Babesia spp. and A. phagocytophilum, or Babesia spp. and R. helvetica were also detected. I. ricinus ticks in urban areas of Germany harbor several tick-borne pathogens and coinfections were also observed. Public parks are of particularly great interest regarding the epidemiology of tick-borne pathogens, because of differences in both the prevalence of pathogens in ticks as well as a varying species arrangement when compared to woodland areas. The record of DNA of a Babesia gibsoni-like pathogen detected in I. ricinus suggests that I. ricinus may harbor and transmit more Babesia spp. than previously known. Because of their high recreational value for human beings, urban green areas are likely to remain in the research focus on

  20. Prevalence of Salmonella enterica, Listeria monocytogenes, and pathogenic Escherichia coli in bulk tank milk and milk filters from US dairy operations in the National Animal Health Monitoring System Dairy 2014 study.

    Science.gov (United States)

    Sonnier, Jakeitha L; Karns, Jeffrey S; Lombard, Jason E; Kopral, Christine A; Haley, Bradd J; Kim, Seon-Woo; Van Kessel, Jo Ann S

    2018-03-01

    The dairy farm environment is a well-documented reservoir for zoonotic pathogens such as Salmonella enterica, Shiga-toxigenic Escherichia coli, and Listeria monocytogenes, and humans may be exposed to these pathogens via consumption of unpasteurized milk and dairy products. As part of the National Animal Health Monitoring System Dairy 2014 study, bulk tank milk (BTM, n = 234) and milk filters (n = 254) were collected from a total of 234 dairy operations in 17 major dairy states and analyzed for the presence of these pathogens. The invA gene was detected in samples from 18.5% of operations and Salmonella enterica was isolated from 18.0% of operations. Salmonella Dublin was detected in 0.7% of operations. Sixteen Salmonella serotypes were isolated, and the most common serotypes were Cerro, Montevideo, and Newport. Representative Salmonella isolates (n = 137) were tested against a panel of 14 antimicrobials. Most (85%) were pansusceptible; the remaining were resistant to 1 to 9 antimicrobials, and within the resistant strains the most common profile was resistance to ampicillin/clavulanic acid, ampicillin, cefoxitin, ceftiofur, ceftriaxone, chloramphenicol, streptomycin, sulfisoxazole, and tetracycline. Listeria spp. were isolated from 19.9% of operations, and L. monocytogenes was isolated from 3.0% of operations. Serogroups 1/2a and 1/2b were the most common, followed by 4b and 4a. One or more E. coli virulence genes were detected in the BTM from 30.5% of operations and in the filters from 75.3% of operations. A combination of stx 2 , eaeA, and γ-tir genes was detected in the BTM from 0.5% of operations and in the filters from 6.6% of operations. The results of this study indicate an appreciable prevalence of bacterial pathogens in BTM and filters, including serovars known to infect humans. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Factors that inhibit growth of Listeria monocytogenes in nature-ripened Gouda cheese: A major role for undissociated lactic acid

    NARCIS (Netherlands)

    Wemmenhove, E.; Valenberg, van H.J.F.; Hooijdonk, van A.C.M.; Wells-Bennik, M.H.J.; Zwietering, M.H.

    2018-01-01

    In this study, factors relevant to nature-ripened Gouda cheese were evaluated for their potential to inhibit growth of Listeria monocytogenes. Factors included water activity, pH, undissociated acetic and lactic acid, diacetyl, free fatty acids, lactoferrin, nitrate, nitrite and nisin. In addition,

  2. Variations in biofilm formation, desiccation resistance and Benzalkonium chloride susceptibility among Listeria monocytogenes strains isolated in Canada

    DEFF Research Database (Denmark)

    Piercey, Marta J.; C. Ells, Timothy; Macintosh, Andrew J.

    2017-01-01

    Listeria monocytogenes is a pathogenic foodborne microorganism noted for its ability to survive in the environment and food processing facilities. Survival may be related to the phenotype of individual strains including the ability to form biofilms and resist desiccation and/or sanitizer exposure...... for sanitation efforts....

  3. [Virulence of Listeria monocytogenes in pregnant mice].

    Science.gov (United States)

    Menudier, A; Bosgiraud, C; Nicolas, J A

    1994-05-01

    Serious food-borne outbreaks of listeriosis have been reported in North America and in Europe, during the past decade. The predominant risk groups appear to be immunocompromised adults, elderly people, newborn babies and pregnant women. In order to examine the relationship between alimentation, listeriosis and pregnant females, we developed an experimental model using Swiss mice fed ad libitum during 4 days with pellets containing a high concentration of Listeria monocytogenes serovar 4b (10(9) u.f.c/g). Samples were taken from many series of pregnant mice which had been infected respectively by L. monocytogenes from 6th, 10th, 14th and 18th day of pregnancy onwards. This was compared to non infected control series. The transmission of infection from mother to progeny and contamination of surviving progeny were evaluated by Listeria numeration in liver, brain and intestines. Females infected between day 6 and day 10, and between day 10 and day 14 after fertilization, aborted or died of encephalitis. Mice contaminated between day 14 and day 18, were the least prone to experimental listeriosis. On the other hand, some mice contaminated between day 18 and day 22, i.e. at the end of their pregnancy, may develop encephalitis a few days after parturition of a healthy litter. Series contaminated between day 6 and day 10, and between day 10 and day 14 turned out to be highly sensitive to the transmission of infection from mother to young. In two other series (day 14--day 18; day 18--day 22), the young mice contained generally no Listeria. Our experimental model shows the relationship between listeriosis and alimentation. In pregnant mice, sensitivity to infection depends on their gestational status with large individual variability.

  4. Antimicrobial treatments to control Listeria monocytogenes in queso fresco.

    Science.gov (United States)

    Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco

    2017-06-01

    Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin ® (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10 4  CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Activation of bovine neutrophils by Brucella spp.

    Science.gov (United States)

    Keleher, Lauren L; Skyberg, Jerod A

    2016-09-01

    Brucellosis is a globally important zoonotic infectious disease caused by gram negative bacteria of the genus Brucella. While many species of Brucella exist, Brucella melitensis, Brucella abortus, and Brucella suis are the most common pathogens of humans and livestock. The virulence of Brucella is largely influenced by its ability to evade host factors, including phagocytic killing mechanisms, which are critical for the host response to infection. The aim of this study was to characterize the bovine neutrophil response to virulent Brucella spp. Here, we found that virulent strains of smooth B. abortus, B. melitensis, B. suis, and virulent, rough, strains of Brucella canis possess similar abilities to resist killing by resting, or IFN-γ-activated, bovine neutrophils. Bovine neutrophils responded to infection with a time-dependent oxidative burst that varied little between Brucella spp. Inhibition of TAK1, or SYK kinase blunted the oxidative burst of neutrophils in response to Brucella infection. Interestingly, Brucella spp. did not induce robust death of bovine neutrophils. These results indicate that bovine neutrophils respond similarly to virulent Brucella spp. In addition, virulent Brucella spp., including naturally rough strains of B. canis, have a conserved ability to resist killing by bovine neutrophils. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Medicago sativa spp. falcata

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... Falcata (Medicago sativa spp. falcata L.), with its high resistance to cold weather, drought and disease, .... 40 plants. Seeds were grown in a greenhouse and seedlings were transplanted three months later to the experiment station in Hebei province ..... latitude range (from northern latitude 29° to northern.

  7. due to Klebsiella spp.

    African Journals Online (AJOL)

    This was a prospective study undertaken at Hillbrow. Hospital in Johannesburg during a 3-month period. All patients from whose sputum cultures Klebsiella spp. were isolated in significant growth on primary blood agar plates following culture of fresh sputum specimens were entered into the study (2+ grO\\:vth was equal to.

  8. [Prevalence of emerging foodborne pathogens and illness: Campylobacter and Listeria].

    Science.gov (United States)

    Ferriero, Anna Maria; Damiani, Gianfranco; Neve, Caterina Bianca; Bianchi, Aurora; Ronconi, Alessandra; Laurenti, Patrizia

    2011-01-01

    This study evaluated the proportion of food samples, examined by the Italian Istituti Zooprofilattici Sperimentali (Experimental Zooprophylactic Institutes) in the years 2000-2005, positive for Campylobacter and Listeria. A correlation was found between food samples found positive for Listeria in the years 2002-2005 and the number of hospitalisations for Listeria illness in the same years (as reported in hospital discharge abstract forms). This confirms that attention should be given in the evaluation of phenomena known to be under reported and for which data are collected and analysed by different methods.

  9. Prevalence of Listeria monocytogenes in traditional ice cream, Yazd, IRAN (1394 and compared to other studies in different parts of Iran

    Directory of Open Access Journals (Sweden)

    Negar Hamidian

    2017-07-01

    in raw milk and traditional dairy products in Isfahan, Iran[persian]. International Journal of Environmental Health Engineering 2015;4(1:1-5. 22-Rahimi E, Momtaz H, Sharifzadeh A, Behzadnia A, Ashtari MS, Zandi Esfahani S, et al. Prevalence and antimicrobial resistance of Listeria species iIsolated from traditional dairy products in chahar Mahal & Bakhtiyari, Iran. Bulgarian Journal of Veterinary Medicine 2012;15(2:115-22. 23-Shakrian A, Karim G, Tajbakhsh E, Shfei M. Investigating the microbial contamination of traditional ice creams in Shahrakord[persian]. Journal of Food Science and Technology 2007;2(4:21-7. 24-Karim G, Razavilar V, Akhonndzade A. Investigating the contamination of Iranian traditional ice cream to important bacterial infections and food poisoning[persian]. Tehran University Faculty of Veterinary Medicine 1374;50:71-8. 25-Pacini R, Galleschi G, Tozzi E, Malloggi L, Galassi R, Quagli E. Biological hazards connected with consumption of animal origin foods. 1. Pathogenic bacteria. Industrie Alimentari 1996;35(344:27-32. 26-Rola J, Kwiatek K, Wojton B, Michalski M. Incidence of Listeria monocytogenes in raw milk and dairy products. Medycyna Weterynaryjna (Poland 1994;50(7:323-5. 27-Warke R, Kamat A, Kamat M, Thomas P. Incidence of pathogenic psychrotrophs in ice creams sold in some retail outlets in Mumbai, India. Food Control 2000;11(2:77-83. 28-Molla B, Yilma R, Alemayehu D. Listeria monocytogenes and other Listeria species in retail meat and milk products in Addis Ababa, Ethiopia. Ethiopian Journal of Health Development 2004;18(3:208-12. 29-Salehian M, Salehifar E, Esfahanizadeh M, Karimzadeh L, Rezaei R, Molanejad M. Microbial contamination in traditional ice cream and effective factors, Sari 2012[persian]. Journal of Mazandaran University of Medical Sciences 2013;23(99:28-33. 30-Akya A, Najafi F, Moradi J, Mohebi Z, Adabagher S. Prevalence of food contamination with Listeria spp. in Kermanshah, Islamic Republic of Iran. Eastern Mediterranean

  10. Prevalence and Antimicrobial Resistance Profile of Listeria Species Isolated from Farmed and On-Sale Rainbow Trout ( Oncorhynchus mykiss) in Western Iran.

    Science.gov (United States)

    Rezai, Ramin; Ahmadi, Elham; Salimi, Behnam

    2018-05-01

    Listeria species are important foodborne pathogens, among which L. monocytogenes and L. ivanovii cause human listeriosis. The purpose of this study was to evaluate the incidence and antimicrobial resistance profiles of Listeria species in farmed and on-sale rainbow trout ( Oncorhynchus mykiss) in Kurdistan province, western Iran. A total of 240 fresh rainbow trout fish (120 samples from farms and 120 samples from retail outlets) were collected and analyzed phenotypically for the presence of Listeria. All Listeria isolates were differentiated with molecular techniques, and L. monocytogenes strains were identified to serotype. The antibiotic susceptibility of all Listeria isolates also was determined. Among the 240 samples, 86 (35.83%) were contaminated with Listeria: 32 samples of farmed fish and 54 samples of on-sale fish. The prevalence among the 240 samples was 9.16% (22 samples) for L. monocytogenes, 6.66% (16 samples) for L. ivanovii, 3.75% (9 samples) for L. welshimeri, 4.99% (12 samples) for L. grayi, 7.5% (18 samples) for L. innocua, and 3.75% (9 samples) for L. seeligeri. The prevalences of the human pathogenic strains L. monocytogenes and L. ivanovii were 4.16% (5 samples) and 14.16% (17 samples) in farmed fish and 5.83% (7 samples) and 7.5% (9 samples) in on-sale fish, respectively. Of the 22 L. monocytogenes isolates, 15, 3, and 4 were identified as serotypes 4b, 1/2a, and 1/2b, respectively. The highest rates of antibiotic resistance among the 86 Listeria isolates was observed against tetracycline (62.79% of all isolates), enrofloxacin (56.97%), and ciprofloxacin (38.37%). Very high resistance was also detected against penicillin (36.04%) and ampicillin (34.88%). These results highlight the potential public health threat posed by fish contaminated with Listeria species, including L. monocytogenes, in the west of Iran. Regular monitoring of Listeria contamination, upgrading of sanitary conditions in the fish industry, and prudent use of antibiotics is

  11. Microbiological and chemical evaluation of Helix spp. snails from local and non-EU markets, utilised as food in Sardinia

    Directory of Open Access Journals (Sweden)

    Arianna Corda

    2014-04-01

    Full Text Available With this study, 28 pools of snails of the genus Helix, respectively Helix aspersa (n=24 and Helix vermiculata (n=4 were analysed. They were taken from snail farming and stores. The snails were from Sardinia, other regions of Italy, and from abroad. All the samples were examined as pool looking for these microbiological target: Salmonella spp., Listeria monocytogenes, Escherichia coli O157, Clostridium perfringens, Norovirus and Hepatitis A Virus (HAV. In the same pools, the concentration of cadmium and lead by inductively coupled plasma mass spectrometry was also determined. The levels of these heavy metals were quite high, especially for cadmium. Two samples were positive for Salmonella spp., while no sample was positive for Escherichia coli O157, HAV and Norovirus. Two samples were positive for Clostridium perfringens and 8 for Listeria monocytogenes. The microrganisms related to Listeria monocytogenes were identified using biochemical techniques, then serotyped and gene sequenced by multiple loci sequence typing technique. Furthermore, antimicrobial restistence was tested on the same samples.

  12. An approach towards public health and foodborne human listeriosis--the Austrian Listeria monitoring.

    Science.gov (United States)

    Asperger, H; Wagner, M; Brandl, E

    2001-01-01

    The Institute for Milk Hygiene, Milk Technology and Food Science has launched a Listeria monitoring for Austrian cheese factories in 1988 which is nowadays a valuable tool to control the safety of cheese production. It is a means to qualify the proper hygienic conditions in the participating cheese plants. Proper hygiene protects cheese plants from getting contaminated by L. monocytogenes. The preventive elimination of foodborne pathogens facilitates a thriving economical development of the domestic cheese industry as contamination by L. monocytogenes may lead to a stop of delivery, product recall and other costly measures. This report comprehensively describes the principle of the monitoring including a description of the microbiological and molecular tools. It summarizes data on the detection frequency of Listeria contamination with respect to the different matrices under investigation. Furthermore an overview is given on the course of 17 contamination periods in 10 cheese plants and the outcome of the decontamination endeavours is described. Apart from epidemiological investigations, this report summarizes data regarding molecular species confirmation in the genus Listeria as the species assignment was comparatively examined by both conventional microbiology and molecular tools. Genotyping by Pulsed Field Gel Electrophoresis was applied in three plants which were confronted with a long term contamination period. The data presented in this paper rely on results which were collected through a decade of investigation (1990-2000).

  13. Genome-Wide siRNA Screen Identifies Complementary Signaling Pathways Involved in Listeria Infection and Reveals Different Actin Nucleation Mechanisms during Listeria Cell Invasion and Actin Comet Tail Formation

    Science.gov (United States)

    Kühbacher, Andreas; Emmenlauer, Mario; Rämo, Pauli; Kafai, Natasha; Dehio, Christoph

    2015-01-01

    ABSTRACT Listeria monocytogenes enters nonphagocytic cells by a receptor-mediated mechanism that is dependent on a clathrin-based molecular machinery and actin rearrangements. Bacterial intra- and intercellular movements are also actin dependent and rely on the actin nucleating Arp2/3 complex, which is activated by host-derived nucleation-promoting factors downstream of the cell receptor Met during entry and by the bacterial nucleation-promoting factor ActA during comet tail formation. By genome-wide small interfering RNA (siRNA) screening for host factors involved in bacterial infection, we identified diverse cellular signaling networks and protein complexes that support or limit these processes. In addition, we could precise previously described molecular pathways involved in Listeria invasion. In particular our results show that the requirements for actin nucleators during Listeria entry and actin comet tail formation are different. Knockdown of several actin nucleators, including SPIRE2, reduced bacterial invasion while not affecting the generation of comet tails. Most interestingly, we observed that in contrast to our expectations, not all of the seven subunits of the Arp2/3 complex are required for Listeria entry into cells or actin tail formation and that the subunit requirements for each of these processes differ, highlighting a previously unsuspected versatility in Arp2/3 complex composition and function. PMID:25991686

  14. Prevalence and antimicrobial susceptibility profile of listeria species from ready-to-eat foods of animal origin in Gondar Town, Ethiopia.

    Science.gov (United States)

    Garedew, Legesse; Taddese, Ayele; Biru, Tigist; Nigatu, Seleshe; Kebede, Elias; Ejo, Mebrat; Fikru, Abraham; Birhanu, Tamiru

    2015-05-12

    Listeriosis, mostly caused by Listeria monocytogenes species, has become a major concern to public health authorities due to its clinical severity and high mortality rate, particularly in high risk groups. Currently, there is limited information regarding the prevalence and antimicrobial susceptibility profiles of listeria species in ready-to-eat foods of animal origin in Gondar town, Ethiopia. The aim of this study was to determine the prevalence and antimicrobial susceptibility pattern of Listeria species isolated from ready-to-eat food of animal origin from public dinning places in Gondar town, Ethiopia. A cross sectional study on ready-toeat foods of animal origin sampled from major supermarkets, butcher shops, pastry shops, restaurants and hotels was carried out. Culture, biochemical and sugar tests were conducted for listeria species identification and disc diffusion test was performed to study the antimicrobial susceptibility profiles of the isolates. Out of 384 food samples examined, 96 (25%) were positive for Listeria species. Listeria monocytogenes was detected in 24 (6.25%) of the samples. Listeria monocytogenes was isolated from cake, raw meat, ice cream, minced beef, fish, unpasteurized milk and pizza in that order from higher to lower rate. Assessment of antimicrobial susceptibility profile of L. monocytogenes revealed the presence of four multi-drug resistant isolates. The higher resistance rate was recorded for penicillin, nalidixic acid, tetracycline and chloramphenicol, in decreasing order. All L. monocytogenes identified in the current study were sensitive to amoxicillin, cephalothin, cloxacillin, sulfamethoxazole, gentamicin and vancomycin. The presence of L. monocytogenes including drug resistant and multidrug resistant isolates in some ready-to-eat food items is an indicator of the presence of public health hazards to the consumer, particularly to the high-risk groups. Hence awareness creation on food safety and implementation of regulations

  15. Listeria innocua and Salmonella panama in mussels: a comparative study.

    Science.gov (United States)

    Plusquellec, A; Monfort, P; Piclet, G; Rio, L

    1998-09-01

    Bivalve molluscs are exposed to a wide range of contamination by pathogenic bacteria and viruses. Therefore, the behavior of bacterial pathogens in bivalves after harvesting is important in terms of food safety. Mussels were artificially contaminated with Listeria innocua and Salmonella panama, held under different conditions, and then examined for Listeria and Salmonella viable counts. In a simplified depuration system, L. innocua levels were lower than those observed for S. panama in mussels during the same period and under the same conditions. This result may be related to the rapid die-off reported for Listeria in seawater. In mussels stored in air, the two pathogens presented similar behaviors: levels of both pathogens remained constant in mussels during the storage period in air. However, in shucked mussels Listeria innocua counts increased with the duration of storage, whereas Salmonella panama showed a slight decrease.

  16. Organelle targeting during bacterial infection: insights from Listeria.

    Science.gov (United States)

    Lebreton, Alice; Stavru, Fabrizia; Cossart, Pascale

    2015-06-01

    Listeria monocytogenes, a facultative intracellular bacterium responsible for severe foodborne infections, is now recognized as a multifaceted model in infection biology. Comprehensive studies of the molecular and cellular basis of the infection have unraveled how the bacterium crosses the intestinal and feto-placental barriers, invades several cell types in which it multiplies and moves, and spreads from cell to cell. Interestingly, although Listeria does not actively invade host cell organelles, it can interfere with their function. We discuss the effect of Listeria on the endoplasmic reticulum (ER) and the mechanisms leading to the fragmentation of the mitochondrial network and its consequences, and review the strategies used by Listeria to subvert nuclear functions, more precisely to control host gene expression at the chromatin level. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Induced systemic resistance by fluorescent Pseudomonas spp.

    NARCIS (Netherlands)

    Bakker, P.A.H.M.; Pieterse, C.M.J.; Loon, L.C. van

    2007-01-01

    Fluorescent Pseudomonas spp. have been studied for decades for their plant growth-promoting effects through effective suppression of soilborne plant diseases. The modes of action that play a role in disease suppression by these bacteria include siderophore-mediated competition for iron, antibiosis,

  18. Postenrichment Population Differentials Using Buffered Listeria Enrichment Broth: Implications of the Presence of Listeria innocua on Listeria monocytogenes in Food Test Samples†

    Science.gov (United States)

    KEYS, ASHLEY L.; DAILEY, RACHEL C.; HITCHINS, ANTHONY D.; SMILEY, R. DERIKE

    2016-01-01

    The recovery of low levels of Listeria monocytogenes from foods is complicated by the presence of competing microorganisms. Nonpathogenic species of Listeria pose a particular problem because variation in growth rate during the enrichment step can produce more colonies of these nontarget cells on selective and/or differential media, resulting in a preferential recovery of nonpathogens, especially Listeria innocua. To gauge the extent of this statistical barrier to pathogen recovery, 10 isolates each of L. monocytogenes and L. innocua were propagated together from approximately equal initial levels using the current U.S. Food and Drug Administration’s enrichment procedure. In the 100 isolate pairs, an average 1.3-log decrease was found in the 48-h enrichment L. monocytogenes population when L. innocua was present. In 98 of the 100 isolate pairs, L. innocua reached higher levels at 48 h than did L. monocytogenes, with a difference of 0.2 to 2.4 log CFU/ml. The significance of these population differences was apparent by an increase in the difficulty of isolating L. monocytogenes by the streak plating method. L. monocytogenes went completely undetected in 18 of 30 enrichment cultures even after colony isolation was attempted on Oxoid chromogenic Listeria agar. This finding suggests that although both Listeria species were present on the plate, the population differential between them restricted L. monocytogenes to areas of the plate with confluent growth and that isolated individual colonies were only L. innocua. PMID:24215687

  19. OrfX, a Nucleomodulin Required for Listeria monocytogenes Virulence

    Directory of Open Access Journals (Sweden)

    Andrzej Prokop

    2017-10-01

    Full Text Available Listeria monocytogenes is a bacterial pathogen causing severe foodborne infections in humans and animals. Listeria can enter into host cells and survive and multiply therein, due to an arsenal of virulence determinants encoded in different loci on the chromosome. Several key Listeria virulence genes are clustered in Listeria pathogenicity island 1. This important locus also contains orfX (lmo0206, a gene of unknown function. Here, we found that OrfX is a small, secreted protein whose expression is positively regulated by PrfA, the major transcriptional activator of Listeria virulence genes. We provide evidence that OrfX is a virulence factor that dampens the oxidative response of infected macrophages, which contributes to intracellular survival of bacteria. OrfX is targeted to the nucleus and interacts with the regulatory protein RybP. We show that in macrophages, the expression of OrfX decreases the level of RybP, which controls cellular infection. Collectively, these data reveal that Listeria targets RybP and evades macrophage oxidative stress for efficient infection. Altogether, OrfX is after LntA, the second virulence factor acting directly in the nucleus.

  20. Thermal inactivation of Listeria monocytogenes and Salmonella spp. in sous-vide processed marinated chicken breast

    Science.gov (United States)

    The heat resistance of a cocktail of five Salmonella strains and five L. monocytogenes strains was determined in teriyaki-marinated chicken breasts. Inoculated meat, packaged in bags, were completely immersed in a circulating water bath and cooked to a final temperature of 55, 57.5 or 60C in one h...

  1. Molecular Detection of Legionella spp. and their associations with Mycobacterium spp., Pseudomonas aeruginosa and amoeba hosts in a drinking water distribution system.

    Science.gov (United States)

    Lu, J; Struewing, I; Vereen, E; Kirby, A E; Levy, K; Moe, C; Ashbolt, N

    2016-02-01

    This study investigated waterborne opportunistic pathogens (OPs) including potential hosts, and evaluated the use of Legionella spp. for indicating microbial water quality for OPs within a full-scale operating drinking water distribution system (DWDS). To investigate the occurrence of specific microbial pathogens within a major city DWDS we examined large volume (90 l drinking water) ultrafiltration (UF) concentrates collected from six sites between February, 2012 and June, 2013. The detection frequency and concentration estimates by qPCR were: Legionella spp. (57%/85 cell equivalent, CE l(-1) ), Mycobacterium spp. (88%/324 CE l(-1) ), Pseudomonas aeruginosa (24%/2 CE l(-1) ), Vermamoeba vermiformis (24%/2 CE l(-1) ) and Acanthamoeba spp. (42%/5 cyst equivalent, CE l(-1) ). There was no detection of the following microorganisms: human faecal indicator Bacteroides (HF183), Salmonella enterica, Campylobacter spp., Escherichia coli O157:H7, Giardia intestinalis, Cryptosporidium spp. or Naegleria fowleri. There were significant correlations between the qPCR signals of Legionella spp. and Mycobacterium spp., and their potential hosts V. vermiformis and Acanthamoeba spp. Sequencing of Legionella spp. demonstrated limited diversity, with most sequences coming from two dominant groups, of which the larger dominant group was an unidentified species. Other known species including Legionella pneumophila were detected, but at low frequency. The densities of Legionella spp. and Mycobacterium spp. were generally higher (17 and 324 folds, respectively) for distal sites relative to the entry point to the DWDS. Legionella spp. occurred, had significant growth and were strongly associated with free-living amoebae (FLA) and Mycobacterium spp., suggesting that Legionella spp. could provide a useful DWDS monitoring role to indicate potential conditions for non-faecal OPs. The results provide insight into microbial pathogen detection that may aid in the monitoring of microbial water

  2. Occurrence and distribution of Listeria monocytogenes and other Listeria species in ready-to-eat and raw meat products.

    Science.gov (United States)

    Mengesha, Desalegn; Zewde, Bayleyegn Molla; Toquin, Marie-Thérèse; Kleer, Josef; Hildebrandt, Goetz; Gebreyes, Wondwossen A

    2009-01-01

    The present study was undertaken to estimate the occurrence and distribution of Listeria monocytogenes and other Listeria species in ready-to-eat food items (pasteurized milk, cheese, ice cream, and cakes) and raw meat products (minced beef, pork, and chicken carcasses). A total of 711 randomly selected samples were collected from supermarkets and pastry shops in Addis Ababa, Ethiopia. Listeria monocytogenes and other Listeria species were isolated and identified according to the techniques recommended by the International Organization for Standardization (ISO 11290-1). Serotyping of L. monocytogenes strains was carried out at the French Food Safety Agency (AFSSA), Ploufragan, France. Of the 711 food samples examined, 189 (26.6%) were Listeria positive of which 34 (4.8%) were L. monocytogenes. Pork was the most contaminated with Listeria species (62.5%) followed by minced beef (47.7%), ice cream (42.7%), soft cheese (16.8%), chicken carcasses (16.0%), and cakes (12.1%). All pasteurized milk and cottage cheese samples examined were Listeria negative. Listeria monocytogenes strains were isolated in ready-to-eat food items consisting of ice cream (11.7%), cakes (6.5%), and soft cheese (3.9%) and in meat products ranging from 3.7% to 5.1%. Among the 34 isolates of L. monocytogenes serotyped, serotypes 4b/4e (n = 32), 4c, and 4e (n = 2) were identified. The presence of L. monocytogenes in some ready-to-eat food items could pose public health hazards to the consumer, particularly to the high-risk group of the population.

  3. Isolation and characterization of Listeria monocytogenes and other Listeria species in foods of animal origin in Addis Ababa, Ethiopia.

    Science.gov (United States)

    Gebretsadik, Simon; Kassa, Tesfu; Alemayehu, Haile; Huruy, Kahsay; Kebede, Nigatu

    2011-03-01

    Listeriosis is a disease of humans and animals, in which it is one of the important emerging bacterial zoonotic diseases worldwide. Among the different species of the genus Listeria, Listeria monocytogenes (L. monocytogenes) is known to cause listeriosis in humans and animals with low incidence but high case fatality rate. Information on the occurrence and distribution of L. monocytogenes and other Listeria species is very limited both in the veterinary and public health sectors in Ethiopia. The objective of this study was to isolate and characterize L. monocytogenes and other Listeria species from foods of animal origin (cottage cheese, raw beef, raw milk and liquid whole egg) in Addis Ababa, Ethiopia. A total of 391 food samples of animal origin were collected randomly, using a cross-sectional study design from November 2008 to March 2009. L. monocytogenes isolation and characterization were performed according to mainly the United States Food and Drug Administration procedures. Of the samples examined, 102 (26.1%) were found to be positive for Listeria. Listeria species were isolated in 39 (51.3%), 37 (32.2%), 22 (22%) and 4 (4%) of the raw beef, liquid whole egg, raw milk and cottage cheese samples respectively. L. monocytogenes was detected in 5.4% of the samples analyzed. It was isolated mainly from raw milk (13%) and liquid whole egg (4.3%) followed by raw beef (2.6%) and cottage cheese (1%). In addition to L. monocytogenes, other Listeria species were identified as L. innocua (60.8%), L. welshimeri (6.9%), L. seeligeri (3.9%), L. murrayi (2.9%) and L. grayi (2.9%) and L. ivanovii (1.9%). It was shown that L. monocytogenes and other Listeria species are widely spread in occurrence in foods of animal origin in Addis Ababa, Ethiopia. Copyright © 2010 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  4. Listeria monocytogenes meningitis in an immunocompromised patient.

    Science.gov (United States)

    Barocci, Simone; Mancini, Alessio; Canovari, Benedetta; Petrelli, Enzo; Sbriscia-Fioretti, Emanuela; Licci, Alberto; D'Addesa, Simona; Petrini, Giancarlo; Giacomini, Marinella; Renzi, Antonella; Migali, Antonio; Briscolini, Sara

    2015-01-01

    This report describes a case of meningitis caused by Listeria monocytogenes in a stem cell transplant recipient on immunosuppressive therapy for cutaneous chronic graft-versus host disease. A 59-year-old woman had undergone allogeneic stem cell transplantation (from a matched unrelated donor) 13 months previously for chronic lymphocytic leukemia. She was on regular hematologic follow-up. Though her previous malignancy has been in remission, she was immunosuppressed due to the pharmacological treatment. We describe a meningitis caused by a typical food-borne pathogen, dangerous in patients with impaired cell-mediated immunity. Moreover the bacterium had a multidrug resistance, a rare characteristic in clinical listeriosis. Rapid diagnosis and treatment are key factors in these cases. We chose ampicillin and rifampicin that allowed a complete resolution of the clinical manifestations.

  5. Sensitivity of Listeria monocytogenes to irradiation

    International Nuclear Information System (INIS)

    Tarjan, Veronika

    1990-01-01

    Irradiation of Listeria monocytogenes (L.m.) was carried out in culture media and pork meat paste at room temperature with 60 Co radiation source of 6.6 kGy h -1 dose rate. The employed doses were 0, 0.5, 1, 2, 3, 4 and 6 kGy. One strain out of 3 survived as high as 4 kGy irradiation. Radiation with 2 kGy resulted 7 log cycles reduction of cell count. After lower irradiation doses the L.m. count decreased in proportion to increasing doses. It has been concluded that L.m. compared with Gram-negative pathogens, are less sensitive to irradiation. (author) 6 refs.; 4 figs

  6. Detection and characterization of Listeria monocytogenes in Sao Jorge (Portugal) cheese production.

    Science.gov (United States)

    Kongo, J M; Malcata, F X; Ho, A J; Wiedmann, M

    2006-11-01

    Listeria monocytogenes is a foodborne pathogen that can cause serious invasive disease in humans. Because human listeriosis cases have previously been linked to consumption of contaminated cheese, control of this pathogen throughout the cheese production chain is of particular concern. To understand the potential for L. monocytogenes transmission via São Jorge cheese, a Portuguese artisanal cheese variety that bears a Protected Denomination of Origin classification, 357 raw milk, curd, natural whey starter, and cheese samples representative of the production chain of this cheese were collected over one year and tested for the presence of L. monocytogenes and selected physicochemical parameters. Although neither L. monocytogenes nor other Listeria spp. were detected in whey, curd, or cheese samples, 2 of the 105 raw milk samples analyzed were positive for L. monocytogenes. These 2 raw milk isolates represented a ribotype that has previously been linked to multiple human listeriosis outbreaks and cases elsewhere, indicating the potential of these isolates to cause human listeriosis. On average, physicochemical parameters of São Jorge cheese ripened for 4 mo presented values that likely minimize the risk of L. monocytogenes outgrowth during ripening and storage (mean pH = 5.48; mean moisture = 37.79%; mean NaCl concentration = 4.73%). However, some cheese samples evaluated in this study were characterized by physicochemical parameters that may allow growth and survival of L. monocytogenes. Even though our results indicate that raw milk used for São Jorge cheese manufacture as well as finished products is rarely contaminated with L. monocytogenes, continued efforts to control the presence of this pathogen in the São Jorge cheese production chain are urged and are critical to ensure the safety of this product.

  7. Prevalence of Listeria monocytogenes in ready-to-eat seafood marketed in Thessaloniki (Northern Greece

    Directory of Open Access Journals (Sweden)

    N. Soultos

    2014-11-01

    Full Text Available Aim: In the current study, a contribution to the knowledge on the prevalence and level of contamination of Listeria monocytogenes in ready-to-eat (RTE seafood marketed in Thessaloniki (Northern Greece was provided; the serovar identity of the L. monocytogenes isolates was also determined. Materials and Methods: A total of 132 RTE seafood samples consisting of 74 smoked fish products, 18 salted fish products, 16 dried fish products, 9 raw marinated fish products, 10 cooked marinated cephalopods and 5 surimi crab stick products were analyzed. L. monocytogenes were isolated and enumerated based on ISO 11290-1/A1 and ISO 11290-2/A1 protocols, respectively, and identified using a multiplex polymerase chain reaction (PCR system utilizing genus and species specific primers. For the identification of serotypes a second multiplex PCR assay was used which clusters L. monocytogenes strains into four major serogroups. Results: Of the samples examined, 11 (8.3% proved positive for Listeria spp. with 8 (6.1% yielding L. monocytogenes. Only in one sample of smoked mackerel the level of L. monocytogenes exceeded the legal safety limit of 100 cfu/g set out in Commission Regulation (EC No. 1441/2007. Serotyping showed higher percentages of isolates belonging to PCR serogroup 3:1/2b, 3b, 7 (46.7% and serogroup 1:1/2a, 3a (40% followed by serogroup 4:4b, 4d, 4e (13.3%. Conclusion: This study demonstrated that L. monocytogenes can be isolated from processed RTE seafood products at retail in Thessaloniki (Northern Greece in low concentrations. However, the presence of this human pathogen in RTE seafood should not be overlooked, but it should be considered as having significance public health implications, particularly among the persons who are at greater risk. Therefore, RTE seafood should be produced under appropriate hygienic and technological conditions since the product does not undergo any treatment before consumption.

  8. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  9. IDENTIFICATION OF DIFFERENT FUSARIUM SPP. IN ALLIUM SPP. IN GERMANY.

    Science.gov (United States)

    Boehnke, B; Karlovsky, P; Pfohl, K; Gamliel, A; Isack, Y; Dehne, H W

    2015-01-01

    In 2013 Allium cepa bulbs from different fields in Northern and Southern Germany, seeds and sets from onion breeders were analysed for infestation with Fusarium species. The same investigation was done in 2014 with different edible Allium spp. from local markets. Different Fusarium spp. were isolated and identified by morphological characterisation. 24 different Fusarium spp. were identified. The diversity of Fusarium spp. and the intensity of infestation was higher on edible bulbs compared to the younger sets and seeds. The analysed onions and other edible Allium spp. from local markets showed also high contents of different Fusarium species. The most prevalent identified Fusarium sp. in the analysed Allium spp. in Germany was Fusarium oxysporum which can cause the Fusarium Basal Rot, followed by Fusarium solani. Fusarium proliferatum, which can cause the Fusarium Salmon Blotch in onions, could be detected in about half of the sampled onion fields and in approximately 10% of all analysed onions from fields. Also in the onion sets, on the surface of the seeds and in other edible Allium spp. F. proliferatum could be identified. Besides F. proliferatum, further mycotoxin producing Fusarium spp. like Fusarium equiseti or Fusarium tricinctum were identified. Other Fusarium spp. like Fusarium sporotrichioides and Fusarium poae were first described in Allium sp. in this study. The two most prevalent Fusarium spp. F. oxysporum and F. solani are able to produce mycotoxins like enniatins, fumonisins, moniliformin and T-2 toxins. Fusarium sp. like F. proliferatum, F. equiseti and F. tricinctum are able to produce additional toxins like beauvericins, zearalenone and diacetoscirpenol. This high number of Fusarium spp., which are able to produce a broad spectrum of different mycotoxins, could be a potential health risk for human beings and livestock.

  10. PREVALENCE OF BABESIA SPP., EHRLICHIA SPP., AND TICK INFESTATIONS IN OKLAHOMA BLACK BEARS (URSUS AMERICANUS).

    Science.gov (United States)

    Skinner, Delaina; Mitcham, Jessica R; Starkey, Lindsay A; Noden, Bruce H; Fairbanks, W Sue; Little, Susan E

    2017-10-01

    American black bears (Ursus americanus) are commonly infested with ticks throughout their range, but there are few surveys for tick-borne disease agents in bears. To characterize tick infestations and determine the prevalence of current infection with Babesia spp. and past or current infection with Ehrlichia spp. in newly re-established populations of black bears in east central and southeastern Oklahoma, US, we identified adult (n=1,048) and immature (n=107) ticks recovered from bears (n=62). We evaluated serum and whole blood samples from a subset (n=49) for antibodies reactive to, and characteristic DNA fragments of, Ehrlichia spp., as well as characteristic DNA fragments of Babesia spp. Amblyomma americanum, the most common tick identified, was found on a majority (56/62; 90%) of bears and accounted for 697/1,048 (66.5%) of all ticks recovered. Other ticks included Dermacentor variabilis (338/1,048; 32.3%) from 36 bears, Amblyomma maculatum (9/1,048; 0.9%) from three bears, and Ixodes scapularis (4/1,048; 0.4%) from three bears. Antibodies reactive to Ehrlichia spp. were detected in every bear tested (49/49; 100%); maximum inverse titers to Ehrlichia chaffeensis ranged from 64-4,096 (geometric mean titer 1,525). However, PCR failed to identify active infection with E. chaffeensis, Ehrlichia ewingii, or an Ehrlichia ruminantium-like agent. Infection with Babesia spp. was detected by PCR in 3/49 (6%) bears. Together these data confirm that tick infestations and infection with tick-borne disease agents are common in bears in the southern US. The significance of these infestations and infections to the health of bears, if any, and the identity of the Ehrlichia spp. responsible for the antibody reactivity seen, warrant further evaluation.

  11. Physiology and immunology of mucosal barriers in catfish (Ictalurus spp.)

    Science.gov (United States)

    The mucosal barriers of catfish (Ictalurus spp.) constitute the first line of defense against pathogen invasion while simultaneously carrying out a diverse array of other critical physiological processes, including nutrient adsorption, osmoregulation, waste excretion, and environmental sensing. Catf...

  12. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food.

    Science.gov (United States)

    Kim, Kwang-Pyo; Singh, Atul K; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K

    2015-09-08

    The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 10⁴ CFU/mL.

  13. The Arsenic Resistance-Associated Listeria Genomic Island LGI2 Exhibits Sequence and Integration Site Diversity and a Propensity for Three Listeria monocytogenes Clones with Enhanced Virulence.

    Science.gov (United States)

    Lee, Sangmi; Ward, Todd J; Jima, Dereje D; Parsons, Cameron; Kathariou, Sophia

    2017-11-01

    In the foodborne pathogen Listeria monocytogenes , arsenic resistance is encountered primarily in serotype 4b clones considered to have enhanced virulence and is associated with an arsenic resistance gene cluster within a 35-kb chromosomal region, Listeria genomic island 2 (LGI2). LGI2 was first identified in strain Scott A and includes genes putatively involved in arsenic and cadmium resistance, DNA integration, conjugation, and pathogenicity. However, the genomic localization and sequence content of LGI2 remain poorly characterized. Here we investigated 85 arsenic-resistant L. monocytogenes strains, mostly of serotype 4b. All but one of the 70 serotype 4b strains belonged to clonal complex 1 (CC1), CC2, and CC4, three major clones associated with enhanced virulence. PCR analysis suggested that 53 strains (62.4%) harbored an island highly similar to LGI2 of Scott A, frequently (42/53) in the same location as Scott A ( LMOf2365_2257 homolog). Random-primed PCR and whole-genome sequencing revealed seven novel insertion sites, mostly internal to chromosomal coding sequences, among strains harboring LGI2 outside the LMOf2365_2257 homolog. Interestingly, many CC1 strains harbored a noticeably diversified LGI2 (LGI2-1) in a unique location ( LMOf2365_0902 homolog) and with a novel additional gene. With few exceptions, the tested LGI2 genes were not detected in arsenic-resistant strains of serogroup 1/2, which instead often harbored a Tn 554 -associated arsenic resistance determinant not encountered in serotype 4b. These findings indicate that in L. monocytogenes , LGI2 has a propensity for certain serotype 4b clones, exhibits content diversity, and is highly promiscuous, suggesting an ability to mobilize various accessory genes into diverse chromosomal loci. IMPORTANCE Listeria monocytogenes is widely distributed in the environment and causes listeriosis, a foodborne disease with high mortality and morbidity. Arsenic and other heavy metals can powerfully shape the

  14. Enteroxigenic Staphylococcus spp. and other microbial contaminants during production of Canastra cheese, Brazil Staphylococcus spp. enterotoxigênicos e outros contaminantes microbiológicos durante a produção de queijo Canastra, Brasil

    Directory of Open Access Journals (Sweden)

    Beatriz M. Borelli

    2006-12-01

    Full Text Available Canastra cheese is produced from raw cow's milk, and it is made at the farmhouse level using artisanal procedures and natural starters. The aim of this work was to determine the main hygienic-sanitary indicators and enterotoxigenic staphylococcal strains present during the manufacturing of traditional cheese of Serra da Canastra region, Minas Gerais state, Brazil. Samples from 10 farms were studied, and they included: water employed in the process, raw milk, natural starters, cheese curd before salting and cheese after five days of ripening. All water samples exhibited faecal coliform contamination above the maximum acceptable value recommended by Brazilian standards. Pseudomonas aeruginosa and sulfite-reducing clostridia were also isolated from the water samples. In five samples of raw milk faecal coliform were above the limits allowed by the Brazilian legislation. The counts of Staphylococcus spp. in milk were between O queijo Canastra é produzido a partir de leite cru, e é fabricado em fazendas utilizando procedimentos artesanais e culturas naturais de soro como iniciadoras. O objetivo deste trabalho foi determinar os principais indicadores higiênico-sanitário e as linhagens enterotoxigenicas de Staphylococcus presentes durante a fabricação do queijo tradicional da região da Serra da Canastra, Minas Gerais, Brasil. Amostras provenientes de 10 fazendas foram estudadas, e estas incluíram: a água utilizada no processo, o leite cru, o soro iniciador, a coalhada antes da salga, e o queijo após cinco dias de cura. Todas as amostras de água apresentaram contaminação por coliformes fecais acima do valor máximo recomendado pelos padrões brasileiros. Pseudomonas aeruginosa e clostrídios sufito-redutores também foram isolados das amostras de água. Em cinco amostras de leite cru os coliformes fecais apresentaram-se acima dos limites permitidos pela legislação brasileira. As contagens de Staphylococcus spp. no leite variaram de <2.0 a

  15. EKOLOGI Anopheles spp. DI KABUPATEN LOMBOK TENGAH

    Directory of Open Access Journals (Sweden)

    Majematang Mading

    2014-07-01

    Full Text Available Malaria remains a public health problem in West Nusa Tenggara Province. Central Lombok District is one of the areas with high case of malaria. Annual Malaria Incidence (AMI was increased from 5.9 ‰ in 2006, 6.7‰ up to 8.1‰ in 2008. The objective of the study is to describe the ecological condition of Anopheles spp. through observation, measurement of environmental variables, larvae and adult collection. This research was an observational research with cross-sectional study. The population of this study is all mosquitos and breeding habitats of Anopheles spp. that exist in the research location. Ecological observations carried out on anopheles breeding habitats including acidity, salinity, shaded places and aquatic biota. Air temperature and humidity measured at the adult mosquitoes trapping sites. The result showed that pH values of water is around 9.00, salinity in the breeding habitats around 14 ppm, and water biota (i.e. moss, grass, shrimps, fishes, tadpoles and crabs surrounded by bushes with larvae density 0,1-28,8 each dipping. The air measurement at the time was between 23°-27° Celsius and 65%-84% humidity. This research concludes that ecology and environmental conditions were supporting the development of larvae and adult mosquito of Anopheles spp.Keywords: ecology, Anopheles spp., Central Lombok

  16. [Prevalence of Listeria monocytogenes in fresh tomatoes (Lycopersicum esculentum) and coriander (Coriandrum sativum) in three markets of Valencia, Venezuela].

    Science.gov (United States)

    Ramírez Mérida, Luis Guillermo; Morón de Salim, Alba; Alfieri Graterol, Ana Yudith; Gamboa, Orlando

    2009-09-01

    The incidence of L. monocytogenes in tomatoes and coriander obtained from three different markets, during eight weeks were determined. 192 samples were evaluated: 96 of tomatoes, and 96 of coriander. The isolation of L. monocytogenes was performed using COVENIN 3718:2001. The data were analyzed by SPSS version 12.0. Kolmogorov Smirnov, Mann Whitney U, Kruskal Wallis U test; Spearman's correlation were applied, and p<0.05 significance level was aplied. It was not found significant differences between the medias values and standard deviations of Most Probable Number (MPN) of Listeria spp to tomatoes and coriander during the eight weeks of recollection in the markets; neither between the distributions of MPN of tomatoes and coriander from the markets (Chi2=5,233 p<0,073; Chi2=1,624 p<0,444 respectively) neither the samples per weeks (Chi2=6,547 p<0,477; Chi2=2,667 p<0,914 respectively). In the number of MPN between tomatoes and coriander both distributions were significant different according to test U Mann Whitney U=3040,5 (Z=-4,216 p<0,0001). It was found statistical significance (p<0,001) between the number of MPN of tomatoes and coriander. The presence of Listeria spp in tomatoe was 41,66% (25,0% L. monocytogenes and 16,7% L. ivanovii); in coriander 77,08% (36,5% L. monocytogenes, 33,3% L. ivanovii and 7,3% L. seelige). We concluded that the high level of L. monocytogenes in tomatoes and coriander is independent of the markets store; we see the necessity of a microbiological control on the irrigation system, collection and distribution to ensure the quality of the product.

  17. EFFICIENCY OF THE ENRICHMENT BROTHES (LEB1 AND LEB2 AND SELECTIVE AGARS (LPM AND LSAB-CAN TO ISOLATE BACTERIA OF THE GENUS Listeria IN MEAT AND RESIDUAL WATER OF WASHING CARCASS EFICIÊNCIA DOS CALDOS DE ENRIQUECIMENTO (LEB1 E LEB2 E DOS ÁGARES SELETIVOS (LPM E LSAB-CAN NO ISOLAMENTO DE BACTÉRIAS DO GÊNERO Listeria EM CARNE BOVINA E ÁGUA RESIDUÁRIA DE LAVAGEM DE CARCAÇA

    Directory of Open Access Journals (Sweden)

    Albenones José de Mesquita

    2007-09-01

    Full Text Available

    In this paper it was observed the efficiency of enrichment brothes for Listeria (LEB1 and LEB2, associated to the passage of the culture through a 0.25% potassium hidroxide solution, verifying that the secondary enrichment broth (LEB2 and LEB2KOH was better than the primary enrichment broth (LEB1KOH for this purpose. On the other hand, lithium chloride-phenylethanol-moxalactam agar and the selective Listeria agar base, supplemented with cicloheximide, acriflavine and nalidixic acid (LSAIB-CAN showed equivalency, at the statistic point of view (p=0.l442, in relation to the number of positive samples for Listeria spp., although the LSAB-CAN agar had given the greatest number of bacteria isolated from this genus.

    KEY-WORDS: Listeria; enrichment broth; selective agar.

    No presente trabalho verificou-se a eficiência dos caldos de enriquecimento para Listeria (LEB1 e LEB 2 associados à passagem da cultura por uma solução de hidróxido de potássio a 0,25%, constatando-se que o caldo de enriquecimento secundário (LEB2 e LEB2KOH foi superior ao caldo de enriquecimento primário (LEB1KOH. Por outro lado, o ágar cloreto de lítio-feniletanol-moxalactam (LPM e o ágar base seletivo para Listeria, suplementado com cicloheximida, acriflavina e ácido nalidíxico (LSAB-CAN equivaleram-se estatisticamente (p= 0,l442 em relação ao número de amostras positivas para Listeria, embora o ágar LSAB-CAN tenha proporcionado um maior número de isolamentos da bactéria.

    PALAVRAS-CHAVE: Caldo de enriquecimento; ágar seletivo; Listeria.

  18. Existence of Cryptosporidium spp. oocysts and Giardia spp. cysts in well water in Nineveh governorate

    OpenAIRE

    R. G. Mohammad

    2011-01-01

    The study included examination of 110 water samples from well distributed in Mosul city and few towns and villages around it from May 2009 to March 2010 for detection of Cryptosporidium spp oocysts and Giardia spp cysts in well water. The results revealed that the prevalence of Cryptosporidium oocysts was 16.36% while the prevalence of Giardia cysts was 12.72%. The percentages of prevalence with Cryptosporidium and Giardia were in high rate in Bartilla and some villages around it 20% for Cryp...

  19. A survey of Babesia spp. and Hepatozoon spp. in wild canids in Israel.

    Science.gov (United States)

    Margalit Levi, Maayan; Nachum-Biala, Yaarit; King, Roni; Baneth, Gad

    2018-03-20

    Babesia spp. and Hepatozoon spp. are apicomplexan parasites that infect a variety of animals, including canids. Their life-cycle includes an invertebrate hematophagous vector as a definitive host and vertebrates as intermediate hosts. The aims of this study were to investigate the prevalence and risk factors for Babesia spp. and Hepatozoon spp. infections in wild golden jackals (Canis aureus) and red foxes (Vulpes vulpes) in Israel and to compare spleen with blood sample polymerase chain reaction (PCR) for the detection of infection. Blood and spleen samples from 109 golden jackals and 21 red foxes were tested by PCR for the detection of Babesia spp. and Hepatozoon spp. using primers for the 18S ribosomal (r) RNA gene. Hepatozoon canis was detected in 50/109 (46%) of the jackals and 9/21 (43%) of the foxes. "Babesia vulpes" (the Babesia microti-like piroplasm) was detected in 4/21 (19%) of the foxes and in none of the jackals. A previously unknown genotype termed Babesia sp. MML related to Babesia lengau (96-97% identity) was detected in 1/109 (1%) of the jackals and 4/21 (19%) of the foxes. Further characterization of this genotype carried out by PCR of the rRNA internal transcribed spacer 2 (ITS2) indicated that it had only 87% identity with the B. lengau ITS2. Sex (male or female), age (juvenile or adult) and geographic zone (North, Central or South Israel) were not found to be significant risk factors for these protozoan infections. The prevalence of "B. vulpes" and Babesia sp. MML infections was significantly higher in foxes compared to jackals (χ 2  = 15.65, df = 1, P Babesia related to B. lengau from Africa.

  20. Keberadaan Bakteri Listeria monocytogenes pada Keju Gouda Produksi Lokal dan Impor (PRESENCE OF LISTERIA MONOCYTOGENES IN LOCAL AND IMPORTED GOUDA CHEESES

    Directory of Open Access Journals (Sweden)

    Debby Fadhilah Pazra

    2014-08-01

    Full Text Available Listeria monocytogenes is included in the foodborne pathogen, which has been associated with severaloutbreaks of human listeriosis especially in high risk groups. Listeria monocytogenes could be found inGouda cheeses because of poor hygienic and sanitation practices. In addition, this bacteria could surviveduring the making of cheese and cheese ripening process. The purpose of this study was to identify thepresence of L. monocytogenes in local and imported Gouda cheeses and how the safety level of the Goudacheese against contamination of L. monocytogenes. This study used the conventional method in accordancewith the Bacteriological Analytical Manual, US Food and Drug Administration and Bergey’s Manual ofDeterminative Bacteriology to detect the presence of L. monocytogenes at 15 samples of local Gouda cheeseand 15 samples of imported Gouda cheese sold in supermarkets in Jakarta and Bogor. The results of thisstudy showed that was not found L. monocytogenes in local and imported Gouda cheese. It could be concludedthat is Gouda cheese relatively safe from L. monocytogenes and meets Indonesian National Standard.

  1. Leptospira spp. in Rodents and Shrews in Germany

    Directory of Open Access Journals (Sweden)

    Anne Mayer-Scholl

    2014-07-01

    Full Text Available Leptospirosis is an acute, febrile disease occurring in humans and animals worldwide. Leptospira spp. are usually transmitted through direct or indirect contact with the urine of infected reservoir animals. Among wildlife species, rodents act as the most important reservoir for both human and animal infection. To gain a better understanding of the occurrence and distribution of pathogenic leptospires in rodent and shrew populations in Germany, kidney specimens of 2973 animals from 11 of the 16 federal states were examined by PCR. Rodent species captured included five murine species (family Muridae, six vole species (family Cricetidae and six shrew species (family Soricidae. The most abundantly trapped animals were representatives of the rodent species Apodemus flavicollis, Clethrionomys glareolus and Microtus agrestis. Leptospiral DNA was amplified in 10% of all animals originating from eight of the 11 federal states. The highest carrier rate was found in Microtus spp. (13%, followed by Apodemus spp. (11% and Clethrionomys spp. (6%. The most common Leptospira genomospecies determined by duplex PCR was L. kirschneri, followed by L. interrogans and L. borgpetersenii; all identified by single locus sequence typing (SLST. Representatives of the shrew species were also carriers of Leptospira spp. In 20% of Crocidura spp. and 6% of the Sorex spp. leptospiral DNA was detected. Here, only the pathogenic genomospecies L. kirschneri was identified.

  2. Leptospira spp. in Rodents and Shrews in Germany

    Science.gov (United States)

    Mayer-Scholl, Anne; Hammerl, Jens Andre; Schmidt, Sabrina; Ulrich, Rainer G.; Pfeffer, Martin; Woll, Dietlinde; Scholz, Holger C.; Thomas, Astrid; Nöckler, Karsten

    2014-01-01

    Leptospirosis is an acute, febrile disease occurring in humans and animals worldwide. Leptospira spp. are usually transmitted through direct or indirect contact with the urine of infected reservoir animals. Among wildlife species, rodents act as the most important reservoir for both human and animal infection. To gain a better understanding of the occurrence and distribution of pathogenic leptospires in rodent and shrew populations in Germany, kidney specimens of 2973 animals from 11 of the 16 federal states were examined by PCR. Rodent species captured included five murine species (family Muridae), six vole species (family Cricetidae) and six shrew species (family Soricidae). The most abundantly trapped animals were representatives of the rodent species Apodemus flavicollis, Clethrionomys glareolus and Microtus agrestis. Leptospiral DNA was amplified in 10% of all animals originating from eight of the 11 federal states. The highest carrier rate was found in Microtus spp. (13%), followed by Apodemus spp. (11%) and Clethrionomys spp. (6%). The most common Leptospira genomospecies determined by duplex PCR was L. kirschneri, followed by L. interrogans and L. borgpetersenii; all identified by single locus sequence typing (SLST). Representatives of the shrew species were also carriers of Leptospira spp. In 20% of Crocidura spp. and 6% of the Sorex spp. leptospiral DNA was detected. Here, only the pathogenic genomospecies L. kirschneri was identified. PMID:25062275

  3. Actin-based motility of Listeria: Right-handed helical trajectories

    Science.gov (United States)

    Rangarajan, Murali

    2012-06-01

    Bacteria such as Listeria monocytogenes recruit cellular machinery to move in and between cells. Understanding the mechanism of motility, including force and torque generation and the resultant displacements, holds keys to numerous applications in medicine and biosensing. In this work, a simple back-of-the-envelope calculation is presented to illustrate that a biomechanical model of actin-based motility of a rigid surface through persistently attached filaments propelled by affinity-modulated molecular motors can produce a right-handed helical trajectory consistent with experimental observations. The implications of the mechanism to bacterial motility are discussed.

  4. COMPARISON OF TWO METHODS FOR THE DETECTION OF LISTERIA MONOCYTOGENES

    Directory of Open Access Journals (Sweden)

    G. Tantillo

    2013-02-01

    Full Text Available The aim of this study was to compare the performance of the conventional methods for detection of Listeria monocytogenes in food using media Oxford and ALOA (Agar Listeria acc. to Ottaviani & Agosti in according to the ISO 11290-1 to a new chromogenic medium “CHROMagar Listeria” standardized in 2005 AFNOR ( CHR – 21/1-12/01. A total of 40 pre-packed ready-to-eat food samples were examined. Using two methods six samples were found positive for Listeria monocytogenes but the medium “CHROMagar Listeria” was more selective in comparison with the others. In conclusion this study has demonstrated that isolation medium able to target specifically the detection of L. monocytogenes such as “CHROMagar Listeria” is highly recommendable because of that detection time is significantly reduced and the analysis cost is less expensive.

  5. Early trigeminal nerve involvement in Listeria monocytogenes rhombencephalitis

    DEFF Research Database (Denmark)

    Karlsson, William K; Harboe, Zitta Barrella; Roed, Casper

    2017-01-01

    dysfunction on that side. In addition, we identified another 120 cases of Listeria rhombencephalitis following a systematic review. Cranial nerves VII, V, IX, and X, respectively, medulla oblongata, cerebellum and pons, were the most frequently involved brain structures. The present clinical and radiological...... findings corroborate earlier data from animal experiments, indicating that L. monocytogenes may be capable of retrograde intra-axonal migration along the cranial nerves. We suggest that in a subset of patients with rhombencephalitis L. monocytogenes enters the cerebellopontine angle through the trigeminal......Listeria monocytogenes is associated with rhombencephalitis. However, the exact mechanisms of brainstem invasion remains poorly understood. Here, we demonstrate clinical and radiological data suggesting that Listeria may invade the brainstem via the trigeminal nerve. Three females (41, 64 and 70...

  6. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco

    2016-03-01

    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  7. [A Listeria breast abscess in a man].

    Science.gov (United States)

    Marsaudon, E; Berthy, J; Mamoune, S; Deniel, A; Ksiyer, S; Tiuca, D

    2018-03-01

    Listeriosis is a food-borne illness leading to bacteriemia or central nervous system infection especially in pregnant women or high-risk patients. It is rarely a localized infection. Breast contamination has rarely been reported in lactating women. We report a breast abscess in man. A 80 year old man, hypertensive and arrhythmic, was explored for weakness and dehydration. Type 2 diabetes and chronic lymphocytic leukemia were diagnosed. Clinical examination disclosed a breast abcess related to L monocytogenes infection. Histopathological study also revealed a breast subcutaneous infiltration by chronic lymphocytic leukemia. Listeriosis sometimes uncover an unknown immunosuppression, especially in the elderly. Breast is a non-sterile tissue containing a stable microbiome partly from digestive origin. It can thereby be contaminated by Listeria. The specific cutaneous infiltrate of chronic lymphocytic leukemia can create the conditions for a local infection. Copyright © 2017 Société Nationale Française de Médecine Interne (SNFMI). Published by Elsevier SAS. All rights reserved.

  8. Consumer method to control Salmonella and Listeria species in shrimp.

    Science.gov (United States)

    Edwards, Genevieve; Janes, Marlene; Lampila, Lucina; Supan, John

    2013-01-01

    The purpose of this study was to determine whether the current consumer method of boiling shrimp until floating and pink in color is adequate for destroying Listeria and Salmonella. Shrimp samples were submerged in bacterial suspensions of Listeria and Salmonella for 30 min and allowed to air dry for 1 h under a biosafety cabinet. Color parameters were then measured with a spectrophotometer programmed with the CIELAB system. Twenty-four shrimp samples were divided into groups (days 0, 1, or 2) and stored at 4°C. The samples were treated by placing them in boiling water (100°C) on days 0, 1, and 2. The shrimp were immediately removed from the boiling water once they floated to the surface, and color parameters were measured. Bacterial counts were determined, and the log CFU per gram was calculated. The effect of sodium tripolyphosphate on the color change of cooked shrimp also was determined. Initial bacterial counts on shrimp after air drying were 5.31 ± 0.14 log CFU/g for Salmonella Enteritidis, 5.24 ± 0.31 log CFU/g for Salmonella Infantis, 5.40 ± 0.16 log CFU/g for Salmonella Typhimurium, 3.91 + 0.11 log CFU/g for Listeria innocua, 4.45 ± 0.11 log CFU/g for Listeria monocytogenes (1/2a), and 3.70 ± 0.22 log CFU/g for Listeria welshimeri. On days 0, 1, and 2, all bacterial counts were reduced to nondetectable levels for shrimp samples that floated. The average time for shrimp to float was 96 ± 8 s. The bacterial counts remained at nondetectable levels (Listeria and Salmonella contamination, but color change is not a good indication of reduction of these pathogens because of the wide natural color variation.

  9. Generation of airborne Listeria innocua from model floor drains.

    Science.gov (United States)

    Berrang, Mark E; Frank, Joseph F

    2012-07-01

    Listeria monocytogenes can colonize floor drains in poultry processing and further processing facilities, remaining present even after cleaning and disinfection. Therefore, during wash down, workers exercise caution to avoid spraying hoses directly into drains in an effort to prevent the escape and transfer of drain microflora to food contact surfaces. The objective of this study was to examine the extent to which an inadvertent water spray into a colonized floor drain can cause the spread of airborne Listeria. Listeria innocua was used to inoculate a polyvinyl chloride model floor drain, resulting in approximately 10(8) cells per ml of phosphate-buffered saline and 10(4) attached cells per square centimeter of inner surface. Each model drain was subjected to a 2-s spray of tap water at 68.9 kPa from a distance of 1 m. Drains were sprayed while filled and again after emptying. Airborne cells were collected by using sedimentation plates containing Listeria selective agar which were placed on the floor and walls of a contained room at incremental horizontal and vertical distances of 0.6, 1.2, 2.4, or 4.0 m from the drain. Sedimentation plates were exposed for 10 min. A mechanical sampler was used to also collect air by impaction on the surface of Listeria selective agar to determine the number of cells per liter of air. The experiment was conducted in triplicate rooms for each of four replications. L. innocua was detected on sedimentation plates on the floor as far as 4.0 m from the drain and on walls as high as 2.4 m above the floor and 4 m from the drain. A 2-s spray with a water hose into a contaminated drain can cause airborne spread of Listeria, resulting in the potential for cross-contamination of food contact surfaces, equipment, and exposed product.

  10. Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes

    OpenAIRE

    Chen, Yi; Gonzalez-Escalona, Narjol; Hammack, Thomas S.; Allard, Marc W.; Strain, Errol A.; Brown, Eric W.

    2016-01-01

    ABSTRACT Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST...

  11. Induced systemic resistance by fluorescent Pseudomonas spp.

    OpenAIRE

    Bakker, P.A.H.M.; Pieterse, C.M.J.; Loon, L.C. van

    2007-01-01

    Fluorescent Pseudomonas spp. have been studied for decades for their plant growth-promoting effects through effective suppression of soilborne plant diseases. The modes of action that play a role in disease suppression by these bacteria include siderophore-mediated competition for iron, antibiosis, production of lytic enzymes, and induced systemic resistance (ISR). The involvement of ISR is typically studied in systems in which the Pseudomonas bacteria and the pathogen are inoculated and rema...

  12. Molecular detection of Acanthamoeba spp., Naegleria fowleri and Vermamoeba (Hartmannella) vermiformis as vectors for Legionella spp. in untreated and solar pasteurized harvested rainwater

    OpenAIRE

    Dobrowsky, Penelope H.; Khan, Sehaam; Cloete, Thomas E.; Khan, Wesaal

    2016-01-01

    Background Legionella spp. employ multiple strategies to adapt to stressful environments including the proliferation in protective biofilms and the ability to form associations with free-living amoeba (FLA). The aim of the current study was to identify Legionella spp., Acanthamoeba spp., Vermamoeba (Hartmannella) vermiformis and Naegleria fowleri that persist in a harvested rainwater and solar pasteurization treatment system. Methods Pasteurized (45??C, 65??C, 68??C, 74??C, 84??C and 93??C) a...

  13. INK128 Exhibits Synergy with Azoles against Exophiala spp. and Fusarium spp.

    Science.gov (United States)

    Gao, Lujuan; Sun, Yi; He, Chengyan; Li, Ming; Zeng, Tongxiang; Lu, Qiaoyun

    2016-01-01

    Infections of Exophiala spp. and Fusarium spp. are often chronic and recalcitrant. Systemic disseminations, which mostly occur in immunocompromised patients, are often refractory to available antifungal therapies. The conserved target of rapamycin (TOR) orchestrates cell growth and proliferation in response to nutrients and growth factors, which are important for pathogenicity and virulence. INK128 is a second-generation ATP-competitive TOR inhibitor, which binds the TOR catalytic domain and selectively inhibits TOR. In the present study, we investigated the in vitro activities of INK128 alone and the interactions of INK128 with conventional antifungal drugs including itraconazole, voriconazole, posaconazole, and amphotericin B against 18 strains of Exophiala spp. and 10 strains of Fusarium spp. via broth microdilution checkerboard technique system adapted from Clinical and Laboratory Standards Institute broth microdilution method M38-A2. INK128 alone was inactive against all isolates tested. However, favorable synergistic effects between INK128 and voriconazole were observed in 61% Exophiala strains and 60% Fusarium strains, despite Fusarium strains exhibited high MIC values (4-8 μg/ml) against voriconazole. In addition, synergistic effects of INK128/itraconazole were shown in 33% Exophiala strains and 30% Fusarium strains, while synergy of INK128/posaconazole were observed in 28% Exophiala strains and 30% Fusarium strains. The effective working ranges of INK128 were 0.125-2 μg/ml and 1-4 μg/ml against Exophiala isolates and Fusarium isolates, respectively. No synergistic effect was observed when INK128 was combined with amphotericin B. No antagonism was observed in all combinations. In conclusion, INK128 could enhance the in vitro antifungal activity of voriconazole, itraconazole and posaconazole against Exophiala spp. and Fusarium spp., suggesting that azoles, especially voriconazole, combined with TOR kinase inhibitor might provide a potential strategy to

  14. Effectiveness of different antimicrobial washes combined with freezing against Escherichia coli O157:H7, Salmonella Typhimurium, and Listeria monocytogenes inoculated on blueberries

    Science.gov (United States)

    To ensure the microbial safety of produce including blueberries, sanitization is a critical step. This study evaluated the efficacy of sanitizers when coupled with frozen storage, in inactivating Escherichia coli O157:H7, Salmonella Typhimurium and Listeria monocytogenes inoculated on wild blueberri...

  15. Effect of Filling Type and Heating Method on Prevalence of Listeria species and Listeria monocytogenes in Dumplings Produced in Poland.

    Science.gov (United States)

    Szymczak, Barbara; Dąbrowski, Waldemar

    2015-05-01

    The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries). © 2015 Institute of Food Technologists®

  16. Microbiological and Chemical Evaluation ofHelixSpp. Snails from Local and Non-EU Markets, Utilised as Food in Sardinia.

    Science.gov (United States)

    Corda, Arianna; Mara, Laura; Virgilio, Sebastiano; Pisanu, Margherita; Chessa, Giannina; Parisi, Antonio; Cogoni, Maria Paola

    2014-04-17

    With this study, 28 pools of snails of the genus Helix , respectively Helix aspersa (n=24) and Helix vermiculata (n=4) were analysed. They were taken from snail farming and stores. The snails were from Sardinia, other regions of Italy, and from abroad. All the samples were examined as pool looking for these microbiological target: Salmonella spp., Listeria monocytogenes , Escherichia coli O157, Clostridium perfringens , Norovirus and Hepatitis A Virus (HAV). In the same pools, the concentration of cadmium and lead by inductively coupled plasma mass spectrometry was also determined. The levels of these heavy metals were quite high, especially for cadmium. Two samples were positive for Salmonella spp., while no sample was positive for Escherichia coli O157, HAV and Norovirus. Two samples were positive for Clostridium perfringens and 8 for Listeria monocytogenes . The microrganisms related to Listeria monocytogenes were identified using biochemical techniques, then serotyped and gene sequenced by multiple loci sequence typing technique. Furthermore, antimicrobial restistence was tested on the same samples.

  17. Potential Roles of Essential Oil and Extracts of Piper chaba Hunter to Inhibit Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Atiqur Rahman

    2011-01-01

    Full Text Available The in vitro anti-listerial potential of essential oil and various organic extracts of Piper chaba Hunter (Piperaceae were evaluated. The chemical composition of the essential oil was analyzed by the GC-MS. Fifty four compounds representing 95.4% of the total oil w ere identified, of which α-humulene (16.4%, caryophyllene oxide (12.2%, veridiflorol (8.1%, globulol (7.4%, β-selinene (7.1%, spathulenol (6.2%, trans-nerolidol (5.1%, linalool (4.5%, 3-pentanol (3.5%, tricyclene (2.2% and p-cymene (1.6% were the major compounds. The oil and organic extracts revealed a great potential anti-listerial effect against all five strains of Listeriamonocytogenes ATCC 19111, 19116, 19118, 19166 and 15313. Also the essential oil had a strong inhibitory effect on the viable cell count of the tested Listeria spp. Our findings demonstrate that the essential oil and extracts derived from the leaf of P. chaba might be a potential source of natural preservatives used in food industries.

  18. Electrochemical genosensing of Salmonella, Listeria and Escherichia coli on silica magnetic particles

    International Nuclear Information System (INIS)

    Liébana, Susana; Brandão, Delfina; Cortés, Pilar; Campoy, Susana; Alegret, Salvador; Pividori, María Isabel

    2016-01-01

    A magneto-genosensing approach for the detection of the three most common pathogenic bacteria in food safety, such as Salmonella, Listeria and Escherichia coli is presented. The methodology is based on the detection of the tagged amplified DNA obtained by single-tagging PCR with a set of specific primers for each pathogen, followed by electrochemical magneto-genosensing on silica magnetic particles. A set of primers were selected for the amplification of the invA (278 bp), prfA (217 bp) and eaeA (151 bp) being one of the primers for each set tagged with fluorescein, biotin and digoxigenin coding for Salmonella enterica, Listeria monocytogenes and E. coli, respectively. The single-tagged amplicons were then immobilized on silica MPs based on the nucleic acid-binding properties of silica particles in the presence of the chaotropic agent as guanidinium thiocyanate. The assessment of the silica MPs as a platform for electrochemical magneto-genosensing is described, including the main parameters to selectively attach longer dsDNA fragments instead of shorter ssDNA primers based on their negative charge density of the sugar-phosphate backbone. This approach resulted to be a promising detection tool with sensing features of rapidity and sensitivity very suitable to be implemented on DNA biosensors and microfluidic platforms. - Highlights: • Silica magnetic particles were used for the first time as carrier in electrochemical magneto-genosensing of single-tagged amplicons. • They demonstrated to be a robust platform for the electrochemical detection of PCR products. • Differential adsorption properties for longer dsDNA amplicon incorporating the tagging primers over shorter ssDNA tagged primers were observed due to the negative charge density. • Electrochemical magneto-genosensing of Salmonella enterica, Listeria monocytogenes and Escherichia coli was successfully performed.

  19. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  20. Electrochemical genosensing of Salmonella, Listeria and Escherichia coli on silica magnetic particles

    Energy Technology Data Exchange (ETDEWEB)

    Liébana, Susana; Brandão, Delfina [Grup de Sensors i Biosensors, Departament de Química, Universitat Autònoma de Barcelona, 08193, Cerdanyola del Vallès (Bellaterra) (Spain); Cortés, Pilar; Campoy, Susana [Departament de Genètica i de Microbiologia, Universitat Autònoma de Barcelona, 08193, Cerdanyola del Vallès (Bellaterra) (Spain); Alegret, Salvador [Grup de Sensors i Biosensors, Departament de Química, Universitat Autònoma de Barcelona, 08193, Cerdanyola del Vallès (Bellaterra) (Spain); Pividori, María Isabel, E-mail: Isabel.Pividori@uab.cat [Grup de Sensors i Biosensors, Departament de Química, Universitat Autònoma de Barcelona, 08193, Cerdanyola del Vallès (Bellaterra) (Spain)

    2016-01-21

    A magneto-genosensing approach for the detection of the three most common pathogenic bacteria in food safety, such as Salmonella, Listeria and Escherichia coli is presented. The methodology is based on the detection of the tagged amplified DNA obtained by single-tagging PCR with a set of specific primers for each pathogen, followed by electrochemical magneto-genosensing on silica magnetic particles. A set of primers were selected for the amplification of the invA (278 bp), prfA (217 bp) and eaeA (151 bp) being one of the primers for each set tagged with fluorescein, biotin and digoxigenin coding for Salmonella enterica, Listeria monocytogenes and E. coli, respectively. The single-tagged amplicons were then immobilized on silica MPs based on the nucleic acid-binding properties of silica particles in the presence of the chaotropic agent as guanidinium thiocyanate. The assessment of the silica MPs as a platform for electrochemical magneto-genosensing is described, including the main parameters to selectively attach longer dsDNA fragments instead of shorter ssDNA primers based on their negative charge density of the sugar-phosphate backbone. This approach resulted to be a promising detection tool with sensing features of rapidity and sensitivity very suitable to be implemented on DNA biosensors and microfluidic platforms. - Highlights: • Silica magnetic particles were used for the first time as carrier in electrochemical magneto-genosensing of single-tagged amplicons. • They demonstrated to be a robust platform for the electrochemical detection of PCR products. • Differential adsorption properties for longer dsDNA amplicon incorporating the tagging primers over shorter ssDNA tagged primers were observed due to the negative charge density. • Electrochemical magneto-genosensing of Salmonella enterica, Listeria monocytogenes and Escherichia coli was successfully performed.

  1. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food.

    Science.gov (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  2. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law

    2015-11-01

    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  3. Comparative Genomic Analysis of Holospora spp., Intranuclear Symbionts of Paramecia

    Directory of Open Access Journals (Sweden)

    Sofya K. Garushyants

    2018-04-01

    Full Text Available While most endosymbiotic bacteria are transmitted only vertically, Holospora spp., an alphaproteobacterium from the Rickettsiales order, can desert its host and invade a new one. All bacteria from the genus Holospora are intranuclear symbionts of ciliates Paramecium spp. with strict species and nuclear specificity. Comparative metabolic reconstruction based on the newly sequenced genome of Holospora curviuscula, a macronuclear symbiont of Paramecium bursaria, and known genomes of other Holospora species shows that even though all Holospora spp. can persist outside the host, they cannot synthesize most of the essential small molecules, such as amino acids, and lack some central energy metabolic pathways, including glycolysis and the citric acid cycle. As the main energy source, Holospora spp. likely rely on nucleotides pirated from the host. Holospora-specific genes absent from other Rickettsiales are possibly involved in the lifestyle switch from the infectious to the reproductive form and in cell invasion.

  4. Potensi Trichoderma Spp. Sebagai Agens Pengendali Fusarium Spp. Penyebab Penyakit Layu Pada Tanaman Stroberi

    OpenAIRE

    Dwiastuti, Mutia Erti; Fajri, Melisa N; Yunimar, Yunimar

    2015-01-01

    Layu yang disebabkan oleh Fusarium spp. merupakan salah satu penyakit penting tanaman stroberi (Fragaria x ananassa Dutch.) di daerah subtropika, yang dapat menggagalkan panen. Penelitian bertujuan untuk mempelajari potensi Trichoderma spp. dalam mengendalikan Fusarium spp. Isolat Trichoderma spp. diisolasi dari rizosfer tanaman stroberi dan Fusarium spp. diisolasi dari tanaman stroberi yang mengalami layu fusarium. Isolat cendawan dimurnikan, dikarakterisasi, dan dibandingkan dengan isolat c...

  5. Human heat-shock protein 60 receptor-coated paramagnetic beads show improved capture of Listeria monocytogenes in the presence of other Listeria in food.

    Science.gov (United States)

    Koo, O K; Aroonnual, A; Bhunia, A K

    2011-07-01

    To investigate the suitability of human Hsp60, a receptor for Listeria adhesion protein (LAP), on paramagnetic beads (PMB) to capture Listeria monocytogenes from food in the presence of other Listeria to facilitate rapid and specific detection of this pathogen. Commercially available streptavidin-coated PMBs were linked with biotinylated Hsp60 (PMB-Hsp60), and the bacterial capture efficiency from pure culture and meat samples was determined. Capture rate was also compared with the monoclonal antibody (MAb)-C11E9-coated beads (PMB-C11E9) and the commercial Dynabeads anti-Listeria. Captured cells were detected and quantified by plating on selective medium, quantitative real-time PCR (qPCR) and a light-scattering sensor. Overall, all ligand-coated beads had similar capture efficiency (varied from 1·8 to 9·2%) for L. monocytogenes under the conditions employed, and the minimum cell number required to achieve such capture was 10³ CFU ml⁻¹. PMB-Hsp60 had significantly greater capture efficiency for pathogenic Listeria (P Listeria. In contrast, PMB-C11E9 and Dynabeads anti-Listeria had similar capture efficiency for both. The efficacy of all PMBs to capture L. monocytogenes in the presence of Listeria innocua from food matrices was compared. Although Dynabeads anti-Listeria had the overall best capture efficiency, PMB-Hsp60 was able to selectively capture L. monocytogenes even in the presence of 10-100-fold more L. innocua cells from enriched meat samples. Data show that the human cell receptor, Hsp60, is suitable for the capture of pathogenic Listeria on PMB in the presence of other Listeria in food. As pathogen interaction with host cells is highly specific, host cell receptors could be used as alternate capture molecules on PMB to aid in specific detection of pathogens. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  6. The Effect of Oxygen on Bile Resistance in Listeria monocytogenes

    Science.gov (United States)

    Wright, Morgan L; Pendarvis, Ken; Nanduri, Bindu; Edelmann, Mariola J; Jenkins, Haley N; Reddy, Joseph S; Wilson, Jessica G; Ding, Xuan; Broadway, Paul R; Ammari, Mais G; Paul, Oindrila; Roberts, Brandy; Donaldson, Janet R

    2016-01-01

    Listeria monocytogenes is a Gram-positive facultative anaerobe that is the causative agent of the disease listeriosis. The infectious ability of this bacterium is dependent upon resistance to stressors encountered within the gastrointestinal tract, including bile. Previous studies have indicated bile salt hydrolase activity increases under anaerobic conditions, suggesting anaerobic conditions influence stress responses. Therefore, the goal of this study was to determine if reduced oxygen availability increased bile resistance of L. monocytogenes. Four strains representing three serovars were evaluated for changes in viability and proteome expression following exposure to bile in aerobic or anaerobic conditions. Viability for F2365 (serovar 4b), EGD-e (serovar 1/2a), and 10403S (serovar 1/2a) increased following exposure to 10% porcine bile under anaerobic conditions (P 0.05) in bile resistance between aerobic and anaerobic conditions, indicating that oxygen availability does not influence resistance in this strain. The proteomic analysis indicated F2365 and EGD-e had an increased expression of proteins associated with cell envelope and membrane bioenergetics under anaerobic conditions, including thioredoxin-disulfide reductase and cell division proteins. Interestingly, HCC23 had an increase in several dehydrogenases following exposure to bile under aerobic conditions, suggesting that the NADH:NAD+ is altered and may impact bile resistance. Variations were observed in the expression of the cell shape proteins between strains, which corresponded to morphological differences observed by scanning electron microscopy. These data indicate that oxygen availability influences bile resistance. Further research is needed to decipher how these changes in metabolism impact pathogenicity in vivo and also the impact that this has on susceptibility of a host to listeriosis. PMID:27274623

  7. Meningoencefalite por Listeria monocytogenes em ovinos Meningoencephalitis in sheep caused by Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Daniel R. Rissi

    2010-01-01

    Full Text Available São descritos sete casos de doença neurológica em ovinos por Listeria monocytogenes no Rio Grande do Sul e Paraná entre 2000 e 2007. Foram afetados ovinos com idades entre 12-24 meses. Os casos ocorreram no verão e início da primavera e os índices gerais de morbidade e letalidade foram de 3,15% e 100%, respectivamente. Quando essa informação estava disponível, nenhum dos ovinos afetados era alimentado com silagem. Em três propriedades havia contato próximo dos ovinos afetados com outras espécies. A evolução do quadro clínico foi de 12 horas a três dias e os sinais clínicos foram caracterizados por decúbito (7/7, desvio da cabeça (4/7, incoordenação (3/7, depressão (3/7, andar em círculos (2/7, cegueira unilateral, emagrecimento progressivo, febre, midríase, movimentos de pedalagem, nistagmo lateral, opistótono, paralisia flácida dos membros pélvicos ou dos quatro membros, salivação excessiva e tremores (1/7 cada. Histologicamente observou-se encefalite com microabscessos, predominantemente unilateral com variáveis graus de gliose e alterações degenerativas como esferóides axonais e infiltração de células Gitter. As lesões se estendiam desde a medula oblonga até o mesencéfalo. Antígenos de Listeria monocytogenes foram detectados por imuno-histoquímica em seções de tronco encefálico de todos os ovinos afetados. O diagnóstico foi realizado com base nos achados epidemiológicos e clinico-patológicos, e confirmado pela imuno-histoquímica (IHQ utilizando anticorpo policlonal anti-L. monocytogenes.Seven cases of neurological disease in sheep caused by Listeria monocytogenes in Rio Grande do Sul and Paraná state, southern Brazil are described. The cases occurred between 2000 and 2007 and 12-24-month-old sheep were affected. Overall morbidity and lethality rates were 3.15% and 100%, respectively. Cases occurred in the summer and early spring. When this information was available, affected sheep had not been

  8. Listeria monocytogenes repellence by enzymatically modified PES surfaces

    NARCIS (Netherlands)

    Veen, van der S.; Nady, N.; Franssen, M.C.R.; Zuilhof, H.; Boom, R.M.; Abee, T.; Schroën, C.G.P.H.

    2015-01-01

    : The effect of enzyme-catalyzed modification of poly(ethersulfone) (PES) on the adhesion and biofilm formation of two Listeria monocytogenes strains is evaluated under static and dynamic flow conditions. PES has been modified with gallic acid, ferulic acid and 4-hydroxybenzoic acid. The surfaces

  9. Antibiotic resistant pattern of environmental isolates of Listeria ...

    African Journals Online (AJOL)

    Incidence of Listeria monocytogenes in cow manure, agricultural soil, and common vegetables sold in major markets in Ado-Ekiti, Nigeria was determined. Antibiotic resistant pattern of the isolates was examined by paper disk assay. A total of 196 environmental samples were cultured on a selective medium out of which ...

  10. 78 FR 27939 - Draft Interagency Risk Assessment-Listeria monocytogenes

    Science.gov (United States)

    2013-05-13

    ... Listeria (L.) monocytogenes contamination of certain ready-to-eat (RTE) foods, for example cheese, deli meats, and deli salads; in the retail deli environment; in niches (a harborage site); or on incoming RTE... a seven-fold higher incidence and level of L. monocytogenes in deli meats sliced and served in...

  11. Occurrence of Listeria monocytogenes in smoked fish in Sokoto ...

    African Journals Online (AJOL)

    The present study was conducted to determine the prevalence of Listeria monocytogenes in smoked fish in Sokoto, Nigeria. A total of 115 different species of smoked fish from the various retail outlets and market places within the metropolis were analysed for the presence of L. monocytogenes using ISO culture method.

  12. Isolation and characterisation of Listeria species from ruminants in ...

    African Journals Online (AJOL)

    A cross sectional study was carried out to determine the prevalence of Listeria species in ruminants in Maiduguri. Three hundred faecal samples were randomly collected from ruminants at the Maiduguri central abattoir from January – March, 2011. One hundred faecal samples each were collected from cattle, sheep and ...

  13. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.

    2008-01-01

    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health

  14. Antimicrobial susceptibility profile of Listeria species isolated from ...

    African Journals Online (AJOL)

    The antimicrobial susceptibility profile of L. monocytogenes and other Listeria species isolated from some ready-to-eat (RTE) foods sold in Kano metropolis, north-western Nigeria was carried out using disc-diffusion method. The results obtained showed that L. monocytogenes was moderately susceptible to all the ...

  15. Genome sequences of Listeria monocytogenes strains with resistance to arsenic

    Science.gov (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  16. Incidence and pathogenicity profile of Listeria sp. isolated from food ...

    African Journals Online (AJOL)

    Samples of beef, pork, goat meat, poultry, fish and vegetables purchased from a local market located in Nsukka, Enugu State, Nigeria were examined for the presence of Listeria species. Surface swab samples taken from butchers' tables as well as soil samples from the field where cows and pigs were kept before slaughter ...

  17. Listeria monocytogenes : the nature, public health aspects and ...

    African Journals Online (AJOL)

    New food borne infectious diseases have continued to emerge world over in the food industries. Listeria monocytogenes, an intracellular bacterium has become an emerging food borne pathogen that causes listeriosis; a zoonotic disease, posing serious risks to public health; in livestock industries, pregnant mothers, ...

  18. Adhesive ability and biofilm metabolic activity of Listeria ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an important pathogen responsible for major outbreaks associated with food products. Adhesion to surfaces leads to significant modifications in cell physiology. In this work, the ability of L. monocytogenes to produce biofilm and its ability to adhere to abiotic surfaces under cold stress were ...

  19. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H

    2001-01-01

    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...

  20. Genome sequesnce of lineage III Listeria monocytogenes strain HCC23

    Science.gov (United States)

    More than 98% of reported human listeriosis cases are caused by Listeria monocytogenes serotypes within lineages I and II. Serotypes within lineage III (4a and 4c) are commonly isolated from environmental and food specimens. We report the first complete genome sequence of a lineage III isolate, HCC2...

  1. Presence of Listeria monocytogenes in silage products of Shahrekord city

    Directory of Open Access Journals (Sweden)

    Ali Sharifzadeh

    2015-06-01

    Full Text Available Objective: To investigate the presence of Listeria monocytogenes in the silage samples. Methods: Silage samples obtained from 150 different farms in Shahrekord city (Iran and after DNA extraction, all samples were analyzed by PCR technique using one pair of primers for presence of this pathogen. The amplified products were detected on 1.5% agarose gel electrophoresis. Results: Listeria monocytogenes was isolated in 4 (2% of the 150 samples. The detection of this bacterium from silage samples in Shahrekord city indicated that these products could create a serious risk in public health of animal and human. The findings showed that in positive silage samples for Listeria monocytogenes, the pH value was about five and it was due to bacterial activity in these products. Conclusions: The quality of silage and hygiene parameters and good herd health management play an important role in the microbiological quality of herd and farm. Considering the high specificity and sensitivity of the employed PCR technique, it is recommended to be useful technique for identification of Listeria monocytogenes.

  2. Formation of biofilm by strains of Listeria monocytogenes isolated ...

    African Journals Online (AJOL)

    Quantification of biofilm formation by 40 Listeria monocytogenes strains from wara soft cheese and its processing environment was assessed on glass vials surfaces. Attachement to glass surface was quantified using a crystal violet binding assay. All the 40 strains produced biofilms after 48 and 72 h incubation at 37oC.

  3. Pathogenic potential of Listeria monocytogenes isolated from cattle ...

    African Journals Online (AJOL)

    Listeria monocytogenes is an opportunistic food-borne pathogen causing listeriosis especially among immune-compromised persons. Its high rate of morbidity and mortality has classed the organism among the top watch list in foods. It is known to produce several virulence factors which aid its survival in harsh conditions ...

  4. Activity of daptomycin against Listeria monocytogenes isolates from cerebrospinal fluid

    NARCIS (Netherlands)

    Spanjaard, Lodewijk; Vandenbroucke-Grauls, Christina M. J. E.

    2008-01-01

    We tested the activity of daptomycin against 76 Listeria monocytogenes isolates from cerebrospinal fluid by broth dilution and Etest methods. For the broth dilution method, the MIC range was 1.0 to 8.0 and the MIC at which 90% of the isolates tested were inhibited (MIC(90)) was 4.0 mg/liter. For the

  5. Monitoring paneer for Listeria monocytogenes - A high risk food ...

    African Journals Online (AJOL)

    A multiplex polymerase chain reaction (PCR) assay was developed and applied to spiked and natural paneer samples to detect Listeria monocytogenes, a high risk food pathogen. The sensitivity of the assay on L. monocytogenes spiked paneer samples was 104 cells prior to enrichment, was improved to 103 cells after 4 h ...

  6. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.

    2000-01-01

    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...

  7. LISTERIA MONOCYTOGENES IN THE CONTEXT OF THE NEW COMMUNITY REGULATIONS

    Directory of Open Access Journals (Sweden)

    A. Bragagnolo

    2008-02-01

    Full Text Available In recent years in the countries of the European Union have occurred profound and radical changes regarding the safety and hygiene of foodstuffs. The aim of this work is to highlight the significant changes made by the recent legislation in the control of Listeria monocytogenes.

  8. Prevalence and antibiotic susceptibility of Listeria monocytogenes in ...

    African Journals Online (AJOL)

    One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method ...

  9. GROWTH OF NATURALLY OCCURING Listeria innocua IN COPPA DI TESTA

    Directory of Open Access Journals (Sweden)

    G. Merialdi

    2010-06-01

    Full Text Available Coppa di testa is a traditional cooked pork salami produced in different Italian regions. The main raw material is deboned meat of pork head with the addition of tongue and rind. After a long (3-5 h high temperature (97°C cooking, additives and flavourings are added and the salami is prepared. After cooling the salami is often portioned and vacuum- packaged. In this study the growth of naturally occurring contamination of Listeria innocua in three batches of vacuum packaged Coppa di testa, stored at 4°C for 80 days, is described. The average max was 0.24 (days-1 and the average doubling time was 2.87 days. The maximum growth level ranged from 4.90 to 8.17 (log10 cfu/g. These results indicate that Coppa di testa definitely supports the growth of Listeria innocua in the considered storage conditions. Taking into account that at 4°C Listeria monocytogenes strains are associated with higher grow rates than L. innocua, these results emphasize the importance of preventing Listeria monocytogenes contamination in the production stages following cooking.

  10. Incidence and pathogenicity profile of Listeria sp. isolated from food ...

    African Journals Online (AJOL)

    USER

    2010-07-26

    Jul 26, 2010 ... Samples of beef, pork, goat meat, poultry, fish and vegetables purchased from a local market located in. Nsukka, Enugu ... The study goes further to establish the major target organs of attack of the pathogenic. Listeria species. ... farm animals resulting in possible human infection by way of the food chain ...

  11. Effect of Listeria monocytogenes inoculation, sodium acetate and ...

    African Journals Online (AJOL)

    Jane

    2011-08-08

    Aug 8, 2011 ... of fresh fish rapidly occurs which limits the shelf life of the product. Microbial contamination can shorten shelf life of meats; reduce the quality of fresh meat and cause economic loss and health hazards (Gram and Huss,. 1996). Listeria monocytogenes is a new threat to public health and the incidence of food ...

  12. Influence of temperature on alkali stress adaptation in Listeria monocytogenes

    Science.gov (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  13. Study on factors (pH, water activity, salt content affecting the growth of Listeria Monocytogenes in raw dried cured sausages

    Directory of Open Access Journals (Sweden)

    Daskalov Hristo

    2013-09-01

    Full Text Available Commission Regulation (EC 2073:2005 considers the factors which can support or inhibit the growth of Listeria monocytogenesin ready-to-eat foods. The aim of the experiments was to examine the values of pH, water activity (aw, salt content and level of contamination with Listeria monocytogenes of some popular in Bulgaria raw dried cured vacuum packed sausages, produced from June 2006 till May 2008. 81 vacuum-packed samples were taken from 5 different meat producing plants during the period of study. Average water activity level of the tested sausages was 0,87 ± 0,035; pH level - 5,61 ± 0,59 and salt content - 4,12 ± 1,11%. Four specimens contained Listeria spp. (two samples L.monocytogenes, one L.welshimeri and one L.innocua. All contaminated raw dried cured sausages had aw bellow ≤ 0,92 and pH ≥ 4,4 or pH ≥ 5. After 3 months of storage of the same contaminated samples at 40C, in three of them Listeria spp. (two L.monocitogenes and L.welshimeri survived and was detected. Salt content of the samples varied from 2,46 to 6,28% and was not able to affect the growth of L.monocytogenes.Data showed that the detected levels of aw could support the growth of L.monocytogenes in only 6 (7,4% of the tested samples. pH values lower than 5 were presented in three samples and only the combination with low aw was able to inhibit the growth of L.monocytogenes. The detected levels of salt content did not affect the presence and growth of L.monocytogenes. ‘Microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenescan be applied to 75 (92,6% of the tested sausages.

  14. International Life Sciences Institute North America Listeria monocytogenes strain collection: development of standard Listeria monocytogenes strain sets for research and validation studies.

    Science.gov (United States)

    Fugett, Eric; Fortes, Esther; Nnoka, Catherine; Wiedmann, Martin

    2006-12-01

    Research and development efforts on bacterial foodborne pathogens, including the development of novel detection and subtyping methods, as well as validation studies for intervention strategies can greatly be enhanced through the availability and use of standardized strain collections. These types of strain collections are available for some foodborne pathogens, such as Salmonella and Escherichia coli. We have developed a standard Listeria monocytogenes strain collection that has not been previously available. The strain collection includes (i) a diversity set of 25 isolates chosen to represent a genetically diverse set of L. monocytogenes isolates as well as a single hemolytic Listeria innocua strain and (ii) an outbreak set, which includes 21 human and food isolates from nine major human listeriosis outbreaks that occurred between 1981 and 2002. The diversity set represents all three genetic L. monocytogenes lineages (I, n = 9; II, n = 9; and III, n = 6) as well as nine different serotypes. Molecular subtyping by EcoRI automated ribotyping and pulsed-field gel electrophoresis (PFGE) with AscI and ApaI separated the 25 isolates in the diversity set into 23 ribotypes and 25 PFGE types, confirming that this isolate set represents considerable genetic diversity. Molecular subtyping of isolates in the outbreak set confirmed that human and food isolates were identical by ribotype and PFGE, except for human and food isolates for two outbreaks, which displayed related but distinct PFGE patterns. Subtype and source data for all isolates in this strain collection are available on the Internet and are linked to the PathogenTracker database (www.pathogentracker.com), which allows the addition of new, relevant information on these isolates, including links to publications that have used isolates from this collection. We have thus developed a core L. monocytogenes strain collection, which will provide a resource for L. monocytogenes research and development efforts with

  15. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State.

    Science.gov (United States)

    Weller, Daniel; Wiedmann, Martin; Strawn, Laura K

    2015-09-01

    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = <0.001), suggesting that irrigation water may be a point source of L. monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Green fluorescent protein labeling of Listeria, Salmonella, and Escherichia coli O157:H7 for safety-related studies.

    Science.gov (United States)

    Ma, Li; Zhang, Guodong; Doyle, Michael P

    2011-04-04

    Many food safety-related studies require tracking of introduced foodborne pathogens to monitor their fate in complex environments. The green fluorescent protein (GFP) gene (gfp) provides an easily detectable phenotype so has been used to label many microorganisms for ecological studies. The objectives of this study were to label major foodborne pathogens and related bacteria, including Listeria monocytogenes, Listeria innocua, Salmonella, and Escherichia coli O157:H7 strains, with GFP and characterize the labeled strains for stability of the GFP plasmid and the plasmid's effect on bacterial growth. GFP plasmids were introduced into these strains by a CaCl(2) procedure, conjugation or electroporation. Stability of the label was determined through sequential propagation of labeled strains in the absence of selective pressure, and rates of plasmid-loss were calculated. Stability of the GFP plasmid varied among the labeled species and strains, with the most stable GFP label observed in E. coli O157:H7. When grown in nonselective media for two consecutive subcultures (ca. 20 generations), the rates of plasmid loss among labeled E. coli O157:H7, Salmonella and Listeria strains ranged from 0%-30%, 15.8%-99.9% and 8.1%-93.4%, respectively. Complete loss (>99.99%) of the plasmid occurred in some labeled strains after five consecutive subcultures in the absence of selective pressure, whereas it remained stable in others. The GFP plasmid had an insignificant effect on growth of most labeled strains. E. coli O157:H7, Salmonella and Listeria strains can be effectively labeled with the GFP plasmid which can be stable in some isolates for many generations without adversely affecting growth rates.

  17. Green fluorescent protein labeling of Listeria, Salmonella, and Escherichia coli O157:H7 for safety-related studies.

    Directory of Open Access Journals (Sweden)

    Li Ma

    Full Text Available Many food safety-related studies require tracking of introduced foodborne pathogens to monitor their fate in complex environments. The green fluorescent protein (GFP gene (gfp provides an easily detectable phenotype so has been used to label many microorganisms for ecological studies. The objectives of this study were to label major foodborne pathogens and related bacteria, including Listeria monocytogenes, Listeria innocua, Salmonella, and Escherichia coli O157:H7 strains, with GFP and characterize the labeled strains for stability of the GFP plasmid and the plasmid's effect on bacterial growth. GFP plasmids were introduced into these strains by a CaCl(2 procedure, conjugation or electroporation. Stability of the label was determined through sequential propagation of labeled strains in the absence of selective pressure, and rates of plasmid-loss were calculated. Stability of the GFP plasmid varied among the labeled species and strains, with the most stable GFP label observed in E. coli O157:H7. When grown in nonselective media for two consecutive subcultures (ca. 20 generations, the rates of plasmid loss among labeled E. coli O157:H7, Salmonella and Listeria strains ranged from 0%-30%, 15.8%-99.9% and 8.1%-93.4%, respectively. Complete loss (>99.99% of the plasmid occurred in some labeled strains after five consecutive subcultures in the absence of selective pressure, whereas it remained stable in others. The GFP plasmid had an insignificant effect on growth of most labeled strains. E. coli O157:H7, Salmonella and Listeria strains can be effectively labeled with the GFP plasmid which can be stable in some isolates for many generations without adversely affecting growth rates.

  18. Entwicklung von in situ Nachweisverfahren für die humanpathogenen Lebensmittelkontaminanten Listeria, Salmonella und Campylobacter, sowie phylogenetische Analysen der Gattung Listeria und Feindifferenzierung von L. monocytogenes

    OpenAIRE

    Schmid, Michael Wilhelm

    2007-01-01

    In dieser Arbeit wurden rRNS-gerichtete Gensonden zur spezifischen in situ Detektion der pathogenen Mikroorganismen Salmonella, Campylobacter und Listeria konstruiert. Durch vergleichende Sequenzanalyse verschiedener Gene konnte die Evolution der Virulenz der Gattung Listeria aufgeklärt werden. Zudem gelang es, anhand phylogenetischer Analysen von Virulenzgenen innerhalb der Art L. monocytogenes drei Entwicklungslinien zu ermitteln. Zur Feindifferenzierung von L. monocytogenes wurden weiterhi...

  19. Isolation and lytic activity of the Listeria bacteriophage endolysin LysZ5 against Listeria monocytogenes in soya milk.

    Science.gov (United States)

    Zhang, Hui; Bao, Hongduo; Billington, Craig; Hudson, J Andrew; Wang, Ran

    2012-08-01

    The endolysin gene (lysZ5) from the genome of the Listeria monocytogenes phage FWLLm3 was cloned in Escherichia coli and characterized. Comparative sequence analysis revealed that lysZ5 resembled the murein hydrolase ply511 encoded by L. monocytogenes phage A511. The encoded protein LysZ5 had a predicted molecular mass of 35.8 kDa and was expressed in E. coli as an N-terminal fusion protein of 41.5 kDa. Addition of purified fusion protein to lawns of indicator bacteria showed that LysZ5 could lyse L. monocytogenes, Listeria innocua and Listeria welshimeri, but not Staphylococcus aureus or Enterococcus faecalis. The purified protein was able to kill L. monocytogenes growing in soya milk, with the pathogen concentration reduced by more than 4 log₁₀ CFU ml⁻¹ after 3 h incubation at 4 °C. As far as we know, this is the first report of a Listeria phage endolysin to control pathogens in soya milk and to demonstrate endolysin activity in foods at refrigeration temperatures. Moreover, LysZ5 may also be useful for biocontrol in other ready-to-eat foods. Copyright © 2012 Elsevier Ltd. All rights reserved.

  20. Lantibiotics biosynthesis genes and bacteriocinogenic activity of Lactobacillus spp. isolated from raw milk and cheese.

    Science.gov (United States)

    Perin, Luana Martins; Moraes, Paula Mendonça; Silva, Abelardo; Nero, Luís Augusto

    2012-05-01

    Lactobacillus species are usually used as starters for the production of fermented products, and some strains are capable of producing antimicrobial substances, such as bacteriocins. Because these characteristics are highly desirable, research are continually being performed for novel Lactobacillus strains with bacteriocinogenic potential for use by food industries. The aim of this study was to characterise the bacteriocinogenic potential and activity of Lactobacillus isolates. From a lactic acid bacteria culture collection obtained from raw milk and cheese, 27 isolates were identified by 16S rDNA as Lactobacillus spp. and selected for the detection of lantibiotics biosynthesis genes, bacteriocin production, antimicrobial spectra, and ideal incubation conditions for bacteriocin production. Based on the obtained results, 21 isolates presented at least one of the three lantibiotics biosynthesis genes (lanB, lanC or lamM), and 23 isolates also produced antimicrobial substances with sensitivity to at least one proteinase, indicating their bacteriocinogenic activity. In general, the isolates had broad inhibitory activity, mainly against Listeria spp. and Staphylococcus spp. strains, and the best antimicrobial performance of the isolates occurred when they were cultivated at 25 °C for 24 or 48 h or at 35 °C for 12 h. The present study identified the bacteriocinogenic potential of Lactobacillus isolates obtained from raw milk and cheese, suggesting their potential use as biopreservatives in foods.

  1. [The relevance of Candida spp. in chronic periodontal disease].

    Science.gov (United States)

    Razina, I N; Chesnokova, M G; Nedoseko, V B

    The aim of the study was to assess the correlation of Candida spp. incidence in periodontal tissues with various clinical manifestations of chronic periodontal disease (CPD). Ninety patients with CPD were included in the study in which Candida spp. was evaluated in periodontal pockets content and gingival biopsy material. In severe CPD more Candida spp. were seen in gingival biopsy than in periodontal pockets (p=0.0006). Candida spp. incidence and quantity correlated directly with the disease grade showing incidence increase from 40 to 73.3% and quantity increase from 0.8±0.18 до 3.6±0.49 lg CFU/ml in light and severe CPD, correspondingly Candida spp. had statistically significant association with cyanotic gingival color (p=0.0018), tongue plaque and swelling (р=0.0042), lip exfoliation (р=0.0030), periodontal pockets depth >5 mm (р=0.0030), oral mucosa hyperemia (р=0.0157), alveolar bone destruction >1/2 of root length (р=0.0157). These data prove the relevance of Candida spp. and mycological assessment of gingival biopsy in CPD patients.

  2. RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids

    Science.gov (United States)

    Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A

    2012-01-01

    Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150

  3. Listeria phospholipases subvert host autophagic defenses by stalling pre-autophagosomal structures

    Science.gov (United States)

    Tattoli, Ivan; Sorbara, Matthew T; Yang, Chloe; Tooze, Sharon A; Philpott, Dana J; Girardin, Stephen E

    2013-01-01

    Listeria can escape host autophagy defense pathways through mechanisms that remain poorly understood. We show here that in epithelial cells, Listeriolysin (LLO)-dependent cytosolic escape of Listeria triggered a transient amino-acid starvation host response characterized by GCN2 phosphorylation, ATF3 induction and mTOR inhibition, the latter favouring a pro-autophagic cellular environment. Surprisingly, rapid recovery of mTOR signalling was neither sufficient nor necessary for Listeria avoidance of autophagic targeting. Instead, we observed that Listeria phospholipases PlcA and PlcB reduced autophagic flux and phosphatidylinositol 3-phosphate (PI3P) levels, causing pre-autophagosomal structure stalling and preventing efficient targeting of cytosolic bacteria. In co-infection experiments, wild-type Listeria protected PlcA/B-deficient bacteria from autophagy-mediated clearance. Thus, our results uncover a critical role for Listeria phospholipases C in the inhibition of autophagic flux, favouring bacterial escape from host autophagic defense. PMID:24162724

  4. [Analysis of the microbiological quality and potential presence of Listeria monocytogenes in custard apple (Annona muricata), mango (Mangifera indica) and passion fruit (Passiflora edulis) pulps from Costa Rica].

    Science.gov (United States)

    von Breymann, Juliana; Chaves, Carolina; Arias, María Laura

    2013-03-01

    The objective of this work was to determine some of the indicators associated to shelf life, hygiene, process and storage conditions for some of custard apple, mango and passion fruit pulps distributed by the main supermarket chains of the Metropolitan Area of San José, Costa Rica, as well as to examine the potential presence of Listeria monocytogenes in them. Sixty fruit pulp samples were analyzed. Tests included pH determination, total aerobic plate count, yeasts and mold count, lactic bacteria count, total and fecal most probable number and the presence/absence of Listeria monocytogenes in 25 g of the product. Fruit pulp's pH ranged between 3,1 and 3,9, and the microbiological counts obtained were relatively low except for one industry. None of the samples analyzed presented total or fecal coliforms. The presence of Listeria monocytogenes was confirmed in three samples, all of them coming from industry C. Low microbiological counts obtained may be due to the addition of preserving substances and to the pasteurization of some of the products; lack of these two elements may allow the presence of dangerous bacteria such as Listeria monocytogenes.

  5. The high prevalence of Listeria monocytogenes peritonitis in cirrhotic patients of an Egyptian Medical Center.

    Science.gov (United States)

    El Sayed Zaki, Maysaa; El Shabrawy, Walaa Othman; El-Eshmawy, Mervat M; Aly Eletreby, Shahera

    2011-09-01

    Spontaneous bacterial peritonitis (SBP) is a potentially lethal complication of cirrhosis. It is probably the most characteristic infectious complication of cirrhosis. The aim of this study was to evaluate the bacterial and fungal causes of SBP in Egyptian population. Furthermore to predict the occurrence of rare pathogen like Listeria monocytogenes in those patients. The study included 100 patients with end stage liver disease associated with ascites. Patients were suspected to have SBP. The ascitic fluids were subjected to full cytological and microbiological study. The peritoneal fluid cytological study revealed that 50 samples had cell counts >250 cells/mm(3). 37 samples had growth and 13 samples had no growth (CNNA). The distribution of isolated pathogens was Gram positive cocci 48.8% followed by L. monocytogenes 24.4%, Gram negative bacilli 12.2% and Mycobacterium tuberculosis 7.3. The cells counts associated with listeria culture were 475 cells/mm(3) with sensitivity 70% and specificity 68%. The study highlights the prevalence of microorganisms in Egyptian patients with liver cirrhosis associated with ascites. It reflects the occurrence of L. monocytogenes as an important pathogen of such clinical situation. Other rare pathogens like M. tuberculosis are not uncommon in those patients. Copyright © 2011 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  6. Method Modification Study for the Thermo Scientific SureTect™ Listeria Species Assay-Matrix Extension.

    Science.gov (United States)

    Cloke, Jonathan; Evans, Katharine; Crabtree, David; Hughes, Annette; Simpson, Helen; Holopainen, Jani; Wickstrand, Nina; Kauppinen, Mikko; Leon-Velarde, Carlos; Larson, Nathan; Dave, Keron; Chen, Yi; Ryser, Elliot; Carter, Mark

    2016-01-01

    The Thermo Scientific™ SureTect™ Listeria species assay is a new real-time PCR assay for the detection of all species of Listeria in food and environmental samples. The assay was originally certified as Performance Tested Methods(SM) (PTM) 071304 in 2013. This report details the method modification study undertaken to extend the performance claims of the assay for matrixes of raw ground turkey, raw ground pork, bagged lettuce, raw pork sausages, pasteurized 2% fat milk, raw cod, pasteurized brie cheese, and ice cream. The method modification study was conducted using the AOAC Research Institute (RI) PTM program to validate the SureTect PCR assay in comparison to the reference method detailed in ISO 11290-1:1996 including amendment 1:2004. All matrixes were tested by Thermo Fisher Scientific (Basingstoke, United Kingdom). In addition, three matrixes (raw cod, bagged lettuce, and pasteurized brie cheese) were analyzed independently as part of the AOAC RI-controlled independent laboratory study by the University of Guelph, Canada. Using probability of detection statistical analysis, there was no significant difference in the performance between the SureTect assay and the International Organization for Standardization reference method for any of the matrixes analyzed in this study.

  7. Prevalence and Characterization of Listeria Species in Domestic and Industrial Cheeses of Isfahan Region

    OpenAIRE

    Zamani-Zadeh, M; Sheikh-Zeinoddin, M; Soleimanian-Zad, S

    2011-01-01

    Background: Listeria monocytogenes is of major concern to the food industry in general and the dairy industry in particular. Little is known about incidence of this pathogenic bacterium in dairy products in Iran. Methods: A survey was made from 23 September 2006 to 22 June 2007 for Listeria species in ninety samples of traditional and industrial cheeses, in milk and surface where the cheeses were manufactured from unpasteurized raw milk in the province of Isfahan (Iran). Results: Listeria mur...

  8. The Presence and Prevalence of Listeria Species in Milk and Herby Cheese in and Around Van

    OpenAIRE

    SAĞUN, Emrullah; SANCAK, Yakup Can; İŞLEYİCİ, Özgür; EKİCİ, Kamil

    2014-01-01

    In this study 250 raw milk and 254 herby cheese samples collected from Van city center and neighboring villages were investigated in terms of Listeria species. For Listeria isolation,the method recommended by the FDA was used.Of the raw milk samples,6 (2.40 %)were found to be positive with regard to Listeria; 3 (1.20 %)had L.monocytogenes, 1 (0.40 %)L.innocua and 1 (0.40 %)L.welshimeri. Of the herby cheese samples,13 (5.11 %)were found to be positive with regard to Listeria;10 (3.93 %)had...

  9. [Construction and Fluorescence Analysis of the RecombinantListeria ivanoviiStrain Expressing Green Fluorescent Protein].

    Science.gov (United States)

    Zhang, Xiang; Su, Lin; Liu, Si-Jing; Li, Yong-Yu; Jiang, Ming-Juan; Huang, Huan; Wang, Chuan

    2017-11-01

    Constructing the recombinant Listeria ivanovii strain expressing green fluorescent protein to provide an important tool for study of Listeria ivanovii. The promoter of Listeria monocytogenes Listeriolysin O ( phly ) and the green fluorescent protein (GFP) gene were fused by SOEing PCR,and then ligated the fusion gene into plasmid pCW to result in recombinant plasmid pCW- phly-GFP. Recombinant plasmid was electroporated into Listeria ivanovii ,and fluorescence microscope was used to analyze the expression of GFP. To observe the stability of recombinant plasmid and the stable expression of GFP in Listeria ivanovii ,bacteria were cultured in the BHI broth with or without erythromycin for several generations. The stability of recombinant plasmid pCW- phly-GFP and fluorescent protein in each generation of bacteriawas studied by extracting plasmids and observing fluorescence. The exactness of recombinant plasmid pCW- phly-GFP was confirmed with restrictive endonuclease assay and sequence analysis. Under the fluorescence microscope,the green fluorescence was obvious in Listeria ivanovii carried with pCW- phly-GFP. The recombinant plasmid pCW- phly-GFP was stable in Listeria ivanovii and the GFP kept expressing in a high level under the pressure of erythromycin. The prokaryotic expression plasmid pCW- phly-GFP containing GFP gene was successfully constructed. Listeria ivanovii carried with the plasmid efficiently expressed GFP. This research provides an important tool for further study of Listeria ivanovii as a vaccine carrier.

  10. [TYPING OF LEPTOSPIRA SPP. STRAINS BASED ON 16S rRNA].

    Science.gov (United States)

    Ostankova, Yu V; Semenov, A V; Stoyanova, N A; Tokarevich, N K; Lyubimova, N E; Petrova, O A; Ananina, Yu V; Petrov, E M

    2016-01-01

    Comparative typing of Leptospira spp. strain collection based on analysis of 16S RNA fragment. 2 pairs of primers were used for PCR, that jointly flank 1423b.p. sized fragment. Sequences of Leptospira spp. strain 16S rRNA, presented in the international database, were used for phylogenetic analysis. A high similarity, including interspecies, of the 16S fragment in Leptospira spp. strains was shown independently of the source, serovar and serogroup. Heterogeneity of the primary matrix, spontaneous mutations of hotspots and erroneous nucleotide couplings, characteristic for 16S sequence of pathogenic Leptospira spp. strains, are discussed. Molecular-genetic characteristic of certain reference Leptospira spp. strains by 16S sequence is obtained. Results of the studies give evidence on expedience of introduction into clinical practice of identification of Leptospira spp. by 16S sequence directly from the clinical material, that would allow to significantly reduce identification time, dismiss complex type-specific sera and other labor-intensive methods.

  11. Aeromonas spp.: an emerging pathogen?

    Directory of Open Access Journals (Sweden)

    Andrea Bartolini

    2015-12-01

    Full Text Available The aim of this study is to identify and monitor the presence of Aeromonas spp. strains in stool cultures. We analyzed 5564 stool cultures from September 2012 to August 2013. Sixty-three patients were positive for Aeromonas spp. The most frequent symptoms were: diarrhea (46.0% and abdominal pain (12.7%. Pediatric subjects were 28. Samples’ microscopic examination showed leukocytes in 38.1% of cases. It is still controversial whether Aeromonas are responsible for human gastroenteritis, but their presence in faecies of symptomatic patients supports their etiologic role. We propose search for toxins by polymerase chain reaction to identify strains that require an antibiotic therapy.

  12. Zoonotic potential of Helicobacter spp.

    Directory of Open Access Journals (Sweden)

    Irena Mladenova-Hristova

    2017-06-01

    Full Text Available The genus Helicobacter contains more than 35 species. Helicobacter pylori is the most important in terms of human health. Discovery of these helicobacters gives opportunity to understand the relationship between these bacteria which colonise the animal and human gut and their effect on the host. Infection with Helicobacter spp. and the associated diseases in their hosts allow us to study the pathogenic mechanisms. The potential zoonotic pathway for the transmission of Helicobacter spp. and epidemiology of this genus, deserve more attention to these emerging pathogens.

  13. Listeria monocytogenes in RTE foods marketed in Italy: prevalence and automated EcoRI ribotyping of the isolates.

    Science.gov (United States)

    Meloni, Domenico; Galluzzo, Pietro; Mureddu, Anna; Piras, Francesca; Griffiths, Mansel; Mazzette, Rina

    2009-02-15

    The aims of the present study were: (a) to investigate the prevalence and the enumeration of Listeria monocytogenes in 200 samples of ready to eat (RTE) foods of animal and vegetal origin collected from different outlets and processing plants in Sardinia; (b) to characterize the isolates by phenotypical and molecular methods; (c) to analyze a subset of 42 L. monocytogenes by automated EcoRI ribotyping in order to predict the strain's potential virulence for humans. The strains were isolated from: smoked fish products, cooked marinated products, meat products and pre-packaged mixed vegetable salads. Of the samples tested, 22% were positive for Listeria spp. The prevalence of L. monocytogenes was 9.5%, while the level of L. monocytogenes in the positive samples was 93%), belonging to 17 different DuPont Identification Library Codes (DUP-IDs) clones. The Simpson's numerical index of discrimination was 0.911. Cluster analysis pointed out a high similarity among strains isolated from meat, fish, and vegetables of different origin. These results confirmed the existence of a widespread population of L. monocytogenes, characterized by highly related strains existing in different geographical areas. 65% of these strains belonged to lineage II (serotypes 1/2a and 1/2c), subtypes known to be associated with sporadic human listeriosis outbreaks. The remaining 35% of the isolates (serotypes 1/2b, 3b and 4b) were allocated to lineage I and belong to distinct clonal groups (DUP-ID 1038 and 1042), which again have been associated with several outbreaks of human listeriosis. Neither atypical profiles nor lineage III strains were found. EcoRI ribotyping was confirmed as a rapid and reliable method for L. monocytogenes typing, providing useful data for epidemiologic and clonality surveys of L. monocytogenes strains isolated from RTE foods.

  14. Pulsed-Field Gel Electrophoresis characterization of Listeria monocytogenes isolates from cheese manufacturing plants in São Paulo, Brazil.

    Science.gov (United States)

    Barancelli, Giovana V; Camargo, Tarsila M; Gagliardi, Natália G; Porto, Ernani; Souza, Roberto A; Campioni, Fabio; Falcão, Juliana P; Hofer, Ernesto; Cruz, Adriano G; Oliveira, Carlos A F

    2014-03-03

    This study aimed to evaluate the occurrence of Listeria monocytogenes in cheese and in the environment of three small-scale dairy plants (A, B, C) located in the Northern region state of São Paulo, Brazil, and to characterize the isolates using conventional serotyping and PFGE. A total of 393 samples were collected and analyzed from October 2008 to September 2009. From these, 136 came from dairy plant A, where only L. seeligeri was isolated. In dairy plant B, 136 samples were analyzed, and L. innocua, L. seeligeri and L. welshimeri were isolated together with L. monocytogenes. In dairy plant C, 121 samples were analyzed, and L. monocytogenes and L. innocua were isolated. Cheese from dairy plants B and C were contaminated with Listeria spp, with L. innocua being found in Minas frescal cheese from both dairy plants, and L. innocua and L. monocytogenes in Prato cheese from dairy plant C. A total of 85 L. monocytogenes isolates were classified in 3 serotypes: 1/2b, 1/2c, and 4b, with predominance of serotype 4b in both dairy plants. The 85 isolates found in the dairy plants were characterized by genomic macrorestriction using ApaI and AscI with Pulsed Field Gel Electrophoresis (PFGE). Macrorestriction yielded 30 different pulsotypes. The presence of indistinguishable profiles repeatedly isolated during a 12-month period indicated the persistence of L. monocytogenes in dairy plants B and C, which were more than 100 km away from each other. Brine used in dairy plant C contained more than one L. monocytogenes lineage. The routes of contamination were identified in plants B and C, and highlighted the importance of using molecular techniques and serotyping to track L. monocytogenes sources of contamination, distribution, and routes of contamination in dairy plants, and to develop improved control strategies for L. monocytogenes in dairy plants and dairy products. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Tracing sources of Listeria contamination in traditional Italian cheese associated with a US outbreak: investigations in Italy.

    Science.gov (United States)

    Acciari, V A; Iannetti, L; Gattuso, A; Sonnessa, M; Scavia, G; Montagna, C; Addante, N; Torresi, M; Zocchi, L; Scattolini, S; Centorame, P; Marfoglia, C; Prencipe, V A; Gianfranceschi, M V

    2016-10-01

    In 2012 a US multistate outbreak of listeriosis was linked to ricotta salata imported from Italy, made from pasteurized sheep's milk. Sampling activities were conducted in Italy to trace the source of Listeria monocytogenes contamination. The cheese that caused the outbreak was produced in a plant in Apulia that processed semi-finished cheeses supplied by five plants in Sardinia. During an 'emergency sampling', 179 (23·6%) out of 758 end-products tested positive for L. monocytogenes, with concentrations from plants. A 'follow-up sampling' was conducted 8 months later, when environmental samples from three out of six plants tested positive for L. monocytogenes and for Listeria spp. PFGE subtyping showed 100% similarity between US clinical strains and isolates from ricotta salata, confirming the origin of the outbreak. The persistence of strains in environmental niches of processing plants was demonstrated, and is probably the cause of product contamination. Two PFGE profiles from clinical cases of listeriosis in Italy in 2011, stored in the MSS-TESSy database, were found to have 100% similarity to one PFGE profile from a US clinical case associated with the consumption of ricotta salata, according to the US epidemiological investigation (sample C, pulsotype 17). However, they had 87% similarity to the only PFGE profile found both in the US clinical case and in 14 ricotta cheese samples collected during the emergency sampling (sample B, pulsotype 1). Sharing of molecular data and availability of common characterization protocols were key elements that connected the detection of the US outbreak to the investigation of the food source in Italy. Simultaneous surveillance systems at both food and human levels are a necessity for the efficient rapid discovery of the source of an outbreak of L. monocytogenes.

  16. InlB-mediated Listeria monocytogenes internalization requires a balanced phospholipase D activity maintained through phospho-cofilin

    NARCIS (Netherlands)

    Han, Xuelin; Yu, Rentao; Ji, Lei; Zhen, Dongyu; Tao, Sha; Li, Shuai; Sun, Yansong; Huang, Liuyu; Feng, Zhe; Li, Xianping; Han, Gaige; Schmidt, Martina; Han, Li

    Internalization of Listeria monocytogenes into non-phagocytic cells is tightly controlled by host cell actin dynamics and cell membrane alterations. However, knowledge about the impact of phosphatidylcholine cleavage driven by host cell phospholipase D (PLD) on Listeria internalization into

  17. Growth of Pseudomonas spp. in cottage cheese

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre; Dalgaard, Paw

    of spoilage microorganisms in cottage cheese can cause undesirable alterations in flavour, odour, appearance and texture. Contamination and growth of psychrotolerant pseudomonads including Pseudomonas fragi and Pseudomonas putida has been reported for cottage cheese but the influence of these bacteria...... (pH 7.0) showed interesting results. Despite a lower pH value in the cottage cheese, compared to the dressing, more rapid growth was observed. This may be caused by insufficient amounts of oxygen in the cream dressing having a negative effect on growth of Pseudomonas spp. At 15˚C growth...

  18. Prevalence and antibiotics susceptibility profile of Enterococcus spp ...

    African Journals Online (AJOL)

    This study investigated the prevalence and antibiotics susceptibility of Enterococcus spp. isolated from patients and some selected hospital environment in Abuja, Nigeria. The samples included clinical and environmental. The clinical samples included stool, urine and wound swabs while the environmental samples ...

  19. Uncovering Listeria monocytogenes hypervirulence by harnessing its biodiversity

    Science.gov (United States)

    Charlier, Caroline; Touchon, Marie; Chenal-Francisque, Viviane; Leclercq, Alexandre; Criscuolo, Alexis; Gaultier, Charlotte; Roussel, Sophie; Brisabois, Anne; Disson, Olivier; Rocha, Eduardo P. C.; Brisse, Sylvain; Lecuit, Marc

    2016-01-01

    Microbial pathogenesis studies are typically performed with reference strains, thereby overlooking microbial intra-species virulence heterogeneity. Here we integrated human epidemiological and clinical data with bacterial population genomics to harness the biodiversity of the model foodborne pathogen Listeria monocytogenes and decipher the basis of its neural and placental tropisms. Taking advantage of the clonal structure of this bacterial species, we identify clones epidemiologically associated with either food or human central nervous system (CNS) and maternal-neonatal (MN) listeriosis. The latter are also most prevalent in patients without immunosuppressive comorbidities. Strikingly, CNS and MN clones are hypervirulent in a humanized mouse model of listeriosis. By integrating epidemiological data and comparative genomics, we uncovered multiple novel putative virulence factors and demonstrated experimentally the contribution of the first gene cluster mediating Listeria monocytogenes neural and placental tropisms. This study illustrates the exceptional power of harnessing microbial biodiversity to identify clinically relevant microbial virulence attributes. PMID:26829754

  20. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.

    2005-01-01

    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

  1. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  2. Case of contamination by Listeria monocytogenes in mozzarella cheese

    Directory of Open Access Journals (Sweden)

    Sara Greco

    2014-03-01

    Full Text Available Following a Listeria monocytogenes detection in a mozzarella cheese sampled at a dairy plant in Lazio Region, further investigations have been conducted both by the competent Authority and the food business operatordairy factory (as a part of dairy factory HACCP control. In total, 90 dairy products, 7 brine and 64 environmental samples have been tested. The prevalence of Listeria monocytogenes was 24.4% in mozzarella cheese, and 9.4% in environmental samples, while brines were all negatives. Forty-seven strains of L. monocytogenes have been isolated, all belonging to 4b/4e serotype. In 12 of these, the macrorestriction profile has been determined by means of pulsed field gel electrophoresis. The profiles obtained with AscI enzyme showed a 100% similarity while those obtained with ApaI a 96.78% similarity. These characteristics of the isolated strains jointly with the production process of mozzarella cheese has allowed to hypothesise an environmental contamination.

  3. Magnetic bead based immuno-detection of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables using the Bio-Plex suspension array system.

    Science.gov (United States)

    Day, J B; Basavanna, U

    2015-04-01

    Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h. Published by Elsevier Ltd.

  4. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik

    1998-01-01

    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from repeated sampling. The results indicate that it is possible to produce cold-smoked salmon with a low prevalence of L. monocytogenes. The organism showed moderate growth...

  5. Cyclic di-AMP signaling in Listeria monocytogenes

    OpenAIRE

    Whiteley, Aaron Thomas

    2016-01-01

    The Gram positive facultative intracellular pathogen Listeria monocytogenes is both ubiquitous in the environment and is a facultative intracellular pathogen. A high degree of adaptability to different growth niches is one reason for the success of this organism. In this dissertation, two facets of L. monocytogenes, growth and gene expression have been investigated. The first portion examines the function and necessity of the nucleotide second messenger c-di-AMP, and the second portion of thi...

  6. Disinfectant effect of Methylated Ethanol against Listeria species

    OpenAIRE

    Y Yakubu; M D Salihu; O O Faleke; M B Abubakar; A A Magaji,A U Junaidu

    2012-01-01

    This study was carried out in order to determine the disinfectant effect of Methylated spirit® (95% methanol and 5% ethanol) as a teat dip against Listeria species. Hand milking was employed to collect 576 (288 x 2) raw milk samples from different lactating cows within Sokoto metropolis (Nigeria). 288 samples were collected before disinfecting the udder teats with Methylated spirit®, while the other 288 were collected after disinfection with Methylated spirit®. The ...

  7. Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH.

    Science.gov (United States)

    Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Alvarez-Domínguez, Carmen

    2014-01-01

    The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189-201 and LLO91-99 and the GAPDH peptide, GAPDH1-22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1-22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91-99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1-22-specific CD4(+) and CD8(+) immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4(+) and CD8(+) epitopes.

  8. CELLULAR VACCINES IN LISTERIOSIS: ROLE OF THE LISTERIA ANTIGEN GAPDH.

    Directory of Open Access Journals (Sweden)

    Ricardo eCalderon-Gonzalez

    2014-02-01

    Full Text Available The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH, and several epitopes such as the LLO peptides, LLO189–201 and LLO91–99 and the GAPDH peptide, GAPDH1–22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1–22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91–99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1–22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes.

  9. CHALLENGE TESTS WITH LISTERIA MONOCYTOGENES IN SALAMI: PRELIMINARY RESULTS

    Directory of Open Access Journals (Sweden)

    R. Mioni

    2013-02-01

    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  10. Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH

    Science.gov (United States)

    Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M. Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L.; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Álvarez-Domínguez, Carmen

    2014-01-01

    The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189−201 and LLO91−99 and the GAPDH peptide, GAPDH1−22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1−22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91−99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1−22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes. PMID:24600592

  11. Internalized Listeria monocytogenes modulates intracellular trafficking and delays maturation of the phagosome.

    Science.gov (United States)

    Alvarez-Dominguez, C; Roberts, R; Stahl, P D

    1997-03-01

    Previous studies have shown that early phagosome-endosome fusion events following phagocytosis of Listeria monocytogenes are modulated by the live organism. In the present study, we have characterized more fully the intracellular pathway of dead and live Listeria phagosomes. To examine access of endosomal and lysosomal markers to phagosomes containing live and dead Listeria, quantitative electron microscopy was carried out with intact cells using internalized BSA-gold as a marker to quantify transfer of solute from endosomal and lysosomal compartments to phagosomes. To monitor the protein composition of phagosomal membranes and to quantify transfer of HRP from endosomes and lysosomes to phagosomes, highly enriched phagosomes containing live and dead Listeria were isolated. Enriched phagosomal membranes were used for western blotting experiments with endosomal and lysosomal markers. In this study, we used a listeriolysin-deficient mutant, Listeria(hly-), that is retained within the phagosome following phagocytosis. Western blotting experiments indicate that early endosomal markers (mannose receptor, transferrin receptor) and key fusion factors necessary for early events (NSF, alpha/beta-SNAP) but not late endosomal markers (cation dependent mannose 6-phosphate receptor) or lysosomal proteins (cathepsin D or lamp-1) accumulate on the live-Listeria phagosomal membranes. On the contrary, phagosomes containing dead-Listeria are readily accessible by both endocytic and lysosomal markers. Studies with radiolabeled dead- and live-Listeria(hly-) indicate that, following phagocytosis, degradation of the live microorganism is substantially delayed. These findings indicate that dead-Listeria containing phagosomes rapidly mature to a phagolysosomal stage whereas live-Listeria(hly-) prevents maturation, in part, by avoiding fusion with lysosomes. The data suggest that by delaying phagosome maturation and subsequent degradation, Listeria prolongs survival inside the phagosome

  12. Listeria weihenstephanensis sp. nov., isolated from the water plant Lemna trisulca taken from a freshwater pond.

    Science.gov (United States)

    Lang Halter, Evi; Neuhaus, Klaus; Scherer, Siegfried

    2013-02-01

    The phylogenetic position and phenotypic characteristics of two non-spore-forming bacilli similar to members of the genus Listeria were studied. The gram-reaction-positive, slightly motile, facultatively anaerobic strains were isolated from the water plant Lemna trisulca sampled from a freshwater pond in Bavaria, Germany. Although no identification was possible employing the API Listeria test (bioMérieux), 16S rRNA sequence analysis confirmed a close phylogenetic similarity to Listeria rocourtiae DSM 22097(T) (99.0 % sequence similarity) and a more distant relationship to other Listeria species (96.0 % to Listeria monocytogenes DSM 20600(T) and 95.0 % similarity to Listeria grayi DSM 20601(T)). DNA-DNA hybridization analysis between the isolates and Listeria rocourtiae DSM 22097(T) yielded a similarity of 22.5 %. Analysis of partial sequences of sigB, prs, recA and HSP60 were studied and compared with those of other members of the genus Listeria and Brochothrix thermosphacta DSM 20171(T) supporting the relationships indicated by 16S rRNA gene sequences. The studied isolates were non-haemolytic and were not associated with cases of human or animal disease. While the results demonstrate that the strains belong to the genus Listeria, phenotypic and genotypic differences from Listeria rocourtiae DSM 22097(T) suggest that the strains represent a novel species for which the name Listeria weihenstephanensis sp. nov. is proposed; the type strain is WS 4560(T) ( = DSM 24698(T) = LMG 26374(T)), with WS 4615 ( = DSM 24699 = LMG 26375) as a second strain of the species.

  13. Differentiation of Phytopathogenic agrobacterium spp.

    OpenAIRE

    Kuzmanović, Nemanja; Ivanović, Milan; Ćalić, Anđelka; Gašić, Katarina; Obradović, Aleksa

    2011-01-01

    Due to the difficulties in differentiation of phytopathogenic Agrobacterium spp. and lack of a standardized protocol, we carried out selection and evaluation of suitable methods based on the bacterial physiological, genetic and pathogenic properties. Strains of Agrobacterium tumefaciens, A. rhizogenes and A. vitis were differentiated using standard bacteriological and molecular methods. The biochemical and physiological tests confirmed authenticity of the s...

  14. Reservoirs of Listeria Species in Three Environmental Ecosystems

    Science.gov (United States)

    Linke, Kristina; Rückerl, Irene; Brugger, Katharina; Karpiskova, Renata; Walland, Julia; Muri-Klinger, Sonja; Tichy, Alexander; Wagner, Martin

    2014-01-01

    Soil and water are suggested to represent pivotal niches for the transmission of Listeria monocytogenes to plant material, animals, and the food chain. In the present study, 467 soil and 68 water samples were collected in 12 distinct geological and ecological sites in Austria from 2007 to 2009. Listeria was present in 30% and 26% of the investigated soil and water samples, respectively. Generally, the most dominant species in soil and water samples were Listeria seeligeri, L. innocua, and L. ivanovii. The human- and animal-pathogenic L. monocytogenes was isolated exclusively from 6% soil samples in regions A (mountainous region) and B (meadow). Distinct ecological preferences were observed for L. seeligeri and L. ivanovii, which were more often isolated from wildlife reserve region C (Lake Neusiedl) and from sites in proximity to wild and domestic ruminants (region A). The higher L. monocytogenes detection and antibiotic resistance rates in regions A and B could be explained by the proximity to agricultural land and urban environment. L. monocytogenes multilocus sequence typing corroborated this evidence since sequence type 37 (ST37), ST91, ST101, and ST517 were repeatedly isolated from regions A and B over several months. A higher L. monocytogenes detection and strain variability was observed during flooding of the river Schwarza (region A) and Danube (region B) in September 2007, indicating dispersion via watercourses. PMID:25002422

  15. Reservoirs of listeria species in three environmental ecosystems.

    Science.gov (United States)

    Linke, Kristina; Rückerl, Irene; Brugger, Katharina; Karpiskova, Renata; Walland, Julia; Muri-Klinger, Sonja; Tichy, Alexander; Wagner, Martin; Stessl, Beatrix

    2014-09-01

    Soil and water are suggested to represent pivotal niches for the transmission of Listeria monocytogenes to plant material, animals, and the food chain. In the present study, 467 soil and 68 water samples were collected in 12 distinct geological and ecological sites in Austria from 2007 to 2009. Listeria was present in 30% and 26% of the investigated soil and water samples, respectively. Generally, the most dominant species in soil and water samples were Listeria seeligeri, L. innocua, and L. ivanovii. The human- and animal-pathogenic L. monocytogenes was isolated exclusively from 6% soil samples in regions A (mountainous region) and B (meadow). Distinct ecological preferences were observed for L. seeligeri and L. ivanovii, which were more often isolated from wildlife reserve region C (Lake Neusiedl) and from sites in proximity to wild and domestic ruminants (region A). The higher L. monocytogenes detection and antibiotic resistance rates in regions A and B could be explained by the proximity to agricultural land and urban environment. L. monocytogenes multilocus sequence typing corroborated this evidence since sequence type 37 (ST37), ST91, ST101, and ST517 were repeatedly isolated from regions A and B over several months. A higher L. monocytogenes detection and strain variability was observed during flooding of the river Schwarza (region A) and Danube (region B) in September 2007, indicating dispersion via watercourses. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  16. Identification of Listeria monocytogenes on Green Mussels and Cockle Shell

    Directory of Open Access Journals (Sweden)

    Winiati Puji Rahayu

    2017-02-01

    Full Text Available AbstractGreen mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animal protein which is many cultivated in Indonesia because their price is relatively affordable. This study was conducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samples of cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. The target gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant of virulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTG CCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescence signals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeria monocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminated by Listeria welshimeri.

  17. Comparative evaluation of the VIDAS Listeria monocytogenes Xpress (LMX) for the detection of Listeria monocytogenes in a variety of foods.

    Science.gov (United States)

    Johnson, Ronald; Mills, John; Pittet, Jean-Louis; Hughes, Denise

    2013-01-01

    The VIDAS Listeria monocytogenes Xpress (LMX) test is an enzyme-linked fluorescent immunoassay designed for use with the automated VIDAS or mini-VIDAS instruments for the specific detection of L. monocytogenes using a 26 h proprietary enrichment broth. The VIDAS LMX method was validated according to harmonized AOAC Research Institute (RI) and Official Methods of Analysis guidelines in both the AOAC Performance Tested Method (PTM) and GovVal programs. In the PTM comparison studies, the VIDAS LMX method was compared to the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook, the U.S. Food and Drug Administration Bacteriological Analytical Manual, and AOAC Official Methods. The comparative food studies consisted of two main parts: internal testing and AOAC independent laboratory testing, which included seven food matrixes (deli ham, processed cheese, vanilla ice cream, cooked shrimp, smoked white fish, frozen spinach, and peanut butter). As part of the AOAC R1 GovVal program, the VIDAS LMX method was compared to the Health Canada MFHPB-30 method for the detection of L. monocytogenes in five ready-to-eat (RTE) meats (hot dogs, deli turkey, deli ham, fermented sausage, and liver paté). Twenty replicates of each inoculation level and five uninoculated controls were evaluated in each study. The LMX method also included the use ofchromogenic media, chromID Ottaviani Agosti agar and chromID L. mono. agar, for confirmation of LMX presumptive results. In both the PTM and GovVal evaluations, there were no significant differences in the Chi-square values for the LMX method when compared to reference methods. The additional parameters tested in the PTM evaluation (inclusivity, exclusivity, ruggedness, stability, and lot-to-lot) satisfied the AOAC RI performance requirements. In both the PTM and GovVal validation studies, the VIDAS LMX method demonstrated reliability as a rapid qualitative method for next-day detection of L

  18. BACTÉRIAS DO GÊNERO Listeria EM CARNE E ÁGUA RESIDUÁRIA DE LAVAGEM DE CARCAÇA DE UM MATADOURO-FRIGORÍFICO E EM CARNE MOÍDA COMERCIALIZADA NA CIDADE DE GOIÂNIA - GO BACTERIA OF THE GENUS Listeria IN MEAT AND RESIDUAL WASHING CARCASS WATER IN A FRIGORIFIC ABATTOIR AND BOVINE MINCED MEAT COMMERCIALIZED IN GOIÂNIA-GO

    Directory of Open Access Journals (Sweden)

    Sebastião Timo Iaria

    2007-09-01

    Full Text Available

    Com vistas ao isolamento, à identificação e à caracterização sorológica de bactérias do gênero Listeria, foram colhidas em um matadouro-frigorífico de grande porte, sob inspeção federal, 70 amostras de tecido muscular bovino e 30 amostras de água residuária oriunda da lavagem de meias-carcaças. Nenhuma cepa de Listeria foi isolada a partir das amostras de carne bovina, mas uma amostra de água residuária (3,33% revelou-se positiva, sendo a cepa identificada bioquímica e sorologicamente como L. innocua 6a. Foram também analisadas 50 amostras de carne bovina moída, adquiridas no mercado varejista de Goiânia - GO, das quais 24 (48% mostraram-se positivas para Listeria spp. Destas amostras positivas foram isoladas 24 cepas, sendo 22 (91,8% de L. innocua 6a, uma (4,1% de L. innocua não tipável sorologicamente e uma (4,41% de L. monocytogenes 1/2b.

    PALAVRAS-CHAVE: Listeria; carne; carne moída; carcaça.

    With the aim to isolate, identify and carry out serological characterization of’ bacteria of the genus Listeria, 70 samples of bovine muscle tissue and 30 samples of residual washing water of halves carcasses were collected in a large slaughterhouse, under Federal Inspection. No Listeria strain was isolated from samples of bovine meat, but one sample of residual water (3.33% was positive, being the strain identified biochemical and serologically as L. innocua 6a. Fifty samples were also analysed of bovine minced meat acquired in the market of Goiânia - GO, from which 24 (48% showed positive for Listeria spp. From these positive samples 24 strains were isolated, being 22 (91.8% of L. innocua 6a, one (4.1% of L. innocua not tipable and one (4.1% of

  19. Listeria monocytogenes septic arthritis following intra-articular yttrium-90 therapy.

    Science.gov (United States)

    Wilson, A P; Prouse, P J; Gumpel, J M

    1984-01-01

    Listeria monocytogenes is a rare cause of septic arthritis, which usually occurs in a host compromised by systemic illness. Intra-articular irradiation with yttrium-90 is generally free of complication. We report a case of intra-articular sepsis of the knee joint by Listeria monocytogenes acquired under unusual circumstances. PMID:6742916

  20. Listeria monocytogenes: maternal-foetal infections in Denmark 1994-2005

    DEFF Research Database (Denmark)

    Smith, Birgitte; Kemp, Michael; Ethelberg, Steen

    2009-01-01

    Maternal-foetal infection by Listeria monocytogenes is a rare complication in pregnancy. In the period 1994-2005, 37 culture-confirmed cases of maternal-foetal Listeria monocytogenes infections were reported in Denmark. We examined 36 patients' files in order to evaluate risk factors, clinical...

  1. Listeria monocytogenes meningitis: serotype distribution and patient characteristics in The Netherlands, 1976-95

    NARCIS (Netherlands)

    Aouaj, Y.; Spanjaard, L.; van Leeuwen, N.; Dankert, J.

    2002-01-01

    Two hundred and seven cases of listeria meningitis that occurred in The Netherlands over 20 years were reviewed to study associations between Listeria monocytogenes serotype, age, underlying disease, and outcome. The mean annual incidence per 100000 population was 0.12 in 1981-90, decreasing to 0.07

  2. Listeria monocytogenes Internalizes in Romaine Lettuce Grown in Greenhouse Conditions.

    Science.gov (United States)

    Shenoy, Archana G; Oliver, Haley F; Deering, Amanda J

    2017-04-01

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. monocytogenes strains was assessed on three romaine lettuce cultivars. Seeds were germinated, and plants grown in three soil types (i.e., standard potting mix, autoclaved potting mix, and top soil) and sterile soft-top agar for up to 21 days. Average CFU per gram of L. monocytogenes on seeds and plants was calculated from five replicates per harvest day. Up to 8.2 log CFU/g L. monocytogenes persisted on romaine lettuce plants (Braveheart cultivar) grown in soft-top agar, while those grown in commercial potting mix (initial soil aerobic plate count of 4.0 × 10 4 CFU/g) had a final concentration of 5.4 log CFU/g, and autoclaved commercial potting mix had a final concentration of 3.8 ± 0.2 log CFU/g after a 21-day period. Pathogen levels dropped below the limit of detection (2 log CFU/g) by day 18 in 75% topsoil (initial soil aerobic plate count of 4.0 × 10 1 CFU/g); this did not occur in sterile media. Although L. monocytogenes strain differences and presence of a clay coating on seeds did not affect persistence, differences were observed in L. monocytogenes growth and survival among cultivars. To assess internalization, seeds were inoculated with L. monocytogenes expressing green fluorescent protein. Three plants were fixed, paraffin embedded, and sectioned; localization was studied by using standard immunohistochemistry techniques. A total of 539 internalized L. monocytogenes cells were visualized among three 20-day seedlings. L. monocytogenes cells were located in all major tissue types (pith followed by cortex, xylem, phloem, and epidermis). The presence of L. monocytogenes in the plant vasculature suggests potential for transport throughout the plant into edible

  3. Brunfelsia spp (yesterday, today, tomorrow) toxicity in four dogs.

    Science.gov (United States)

    Singh, M; Cowan, S; Child, G

    2008-06-01

    Four dogs were treated for acute toxicity following ingestion of the popular garden shrub 'Yesterday, today, tomorrow' (Brunfelsia spp). Clinical signs included vomiting, diarrhoea, muscle tremors, anxiousness, opisthotonus and seizures. All dogs recovered following treatment with any or all of general anaesthetic, gastric lavage, enema, diazepam, phenobarbitone or propofol sedation. Brunfelsia spp toxicity should be considered in young, previously healthy dogs presenting with gastrointestinal signs that rapidly progress to muscle tremors and seizures. Examination of faeces was required for diagnosis in all cases. Owners should also be questioned thoroughly about their dogs' access to such plants.

  4. PCR detection of Bartonella spp. in the dog

    Directory of Open Access Journals (Sweden)

    Jarmila Konvalinová

    2014-01-01

    Full Text Available Our study aimed at using PCR to identify the incidence of Bartonella spp. in blood of dogs. Altogether 286 dogs of 92 breeds aged 3 month to 17 years were tested from October 2008 to December 2009. Healthy dogs as well as dogs with various clinical symptoms of disease were included in the group. Samples were tested by polymerase chain reaction (PCR specific for the presence of Bartonella spp. Following the DNA examination in 286 dogs by PCR and subsequent sequencing, two samples were identified as Bartonella henselae (0.7%. Other species of Bartonella were not found. It was the first time in the Czech Republic when incidence of Bartonella spp. was determined in dogs.

  5. Inhibition of listeriolysin O oligomerization by lutein prevents Listeria monocytogenes infection.

    Science.gov (United States)

    Liu, Bowen; Teng, Zihao; Wang, Jianfeng; Lu, Gejin; Deng, Xuming; Li, Li

    2017-01-01

    The foodborne pathogenic bacterial species Listeria monocytogenes (L. monocytogenes) has caused incalculable damages to public health, and its successful infection requires various virulence factors, including Listeriolysin O (LLO). By forming pores in phagosomal membranes and even in some organelles, LLO plays an indispensable role in the ability of L. monocytogenes to escape from host immune attacks. Because of its critical role, LLO offers an appropriate therapeutic target against L. monocytogenes infection. Here, lutein, a natural small molecule existing widely in fruits and vegetables, is demonstrated as an effective inhibitor of LLO that works by blocking its oligomeriz