WorldWideScience

Sample records for spore development pathogenicity

  1. Genetic Factors and Host Traits Predict Spore Morphology for a Butterfly Pathogen

    Directory of Open Access Journals (Sweden)

    Jacobus C. de Roode

    2013-08-01

    Full Text Available Monarch butterflies (Danaus plexippus throughout the world are commonly infected by the specialist pathogen Ophryocystis elektroscirrha (OE. This protozoan is transmitted when larvae ingest infectious stages (spores scattered onto host plant leaves by infected adults. Parasites replicate internally during larval and pupal stages, and adult monarchs emerge covered with millions of dormant spores on the outsides of their bodies. Across multiple monarch populations, OE varies in prevalence and virulence. Here, we examined geographic and genetic variation in OE spore morphology using clonal parasite lineages derived from each of four host populations (eastern and western North America, South Florida and Hawaii. Spores were harvested from experimentally inoculated, captive-reared adult monarchs. Using light microscopy and digital image analysis, we measured the size, shape and color of 30 replicate spores per host. Analyses examined predictors of spore morphology, including parasite source population and clone, parasite load, and the following host traits: family line, sex, wing area, and wing color (orange and black pigmentation. Results showed significant differences in spore size and shape among parasite clones, suggesting genetic determinants of morphological variation. Spore size also increased with monarch wing size, and monarchs with larger and darker orange wings tended to have darker colored spores, consistent with the idea that parasite development depends on variation in host quality and resources. We found no evidence for effects of source population on variation in spore morphology. Collectively, these results provide support for heritable variation in spore morphology and a role for host traits in affecting parasite development.

  2. Validated modified Lycopodium spore method development for ...

    African Journals Online (AJOL)

    Validated modified lycopodium spore method has been developed for simple and rapid quantification of herbal powdered drugs. Lycopodium spore method was performed on ingredients of Shatavaryadi churna, an ayurvedic formulation used as immunomodulator, galactagogue, aphrodisiac and rejuvenator. Estimation of ...

  3. The spore differentiation pathway in the enteric pathogen Clostridium difficile.

    Directory of Open Access Journals (Sweden)

    Fátima C Pereira

    Full Text Available Endosporulation is an ancient bacterial developmental program that culminates with the differentiation of a highly resistant endospore. In the model organism Bacillus subtilis, gene expression in the forespore and in the mother cell, the two cells that participate in endospore development, is governed by cell type-specific RNA polymerase sigma subunits. σ(F in the forespore, and σ(E in the mother cell control early stages of development and are replaced, at later stages, by σ(G and σ(K, respectively. Starting with σ(F, the activation of the sigma factors is sequential, requires the preceding factor, and involves cell-cell signaling pathways that operate at key morphological stages. Here, we have studied the function and regulation of the sporulation sigma factors in the intestinal pathogen Clostridium difficile, an obligate anaerobe in which the endospores are central to the infectious cycle. The morphological characterization of mutants for the sporulation sigma factors, in parallel with use of a fluorescence reporter for single cell analysis of gene expression, unraveled important deviations from the B. subtilis paradigm. While the main periods of activity of the sigma factors are conserved, we show that the activity of σ(E is partially independent of σ(F, that σ(G activity is not dependent on σ(E, and that the activity of σ(K does not require σ(G. We also show that σ(K is not strictly required for heat resistant spore formation. In all, our results indicate reduced temporal segregation between the activities of the early and late sigma factors, and reduced requirement for the σ(F-to-σ(E, σ(E-to-σ(G, and σ(G-to-σ(K cell-cell signaling pathways. Nevertheless, our results support the view that the top level of the endosporulation network is conserved in evolution, with the sigma factors acting as the key regulators of the pathway, established some 2.5 billion years ago upon its emergence at the base of the Firmicutes Phylum.

  4. Large-spored Alternaria pathogens in section Porri disentangled.

    Science.gov (United States)

    Woudenberg, J H C; Truter, M; Groenewald, J Z; Crous, P W

    2014-09-01

    The omnipresent fungal genus Alternaria was recently divided into 24 sections based on molecular and morphological data. Alternaria sect. Porri is the largest section, containing almost all Alternaria species with medium to large conidia and long beaks, some of which are important plant pathogens (e.g. Alternaria porri, A. solani and A. tomatophila). We constructed a multi-gene phylogeny on parts of the ITS, GAPDH, RPB2, TEF1 and Alt a 1 gene regions, which, supplemented with morphological and cultural studies, forms the basis for species recognition in sect. Porri. Our data reveal 63 species, of which 10 are newly described in sect. Porri, and 27 species names are synonymised. The three known Alternaria pathogens causing early blight on tomato all cluster in one clade, and are synonymised under the older name, A. linariae. Alternaria protenta, a species formerly only known as pathogen on Helianthus annuus, is also reported to cause early blight of potato, together with A. solani and A. grandis. Two clades with isolates causing purple blotch of onion are confirmed as A. allii and A. porri, but the two species cannot adequately be distinguished based on the number of beaks and branches as suggested previously. This is also found among the pathogens of Passifloraceae, which are reduced from four to three species. In addition to the known pathogen of sweet potato, A. bataticola, three more species are delineated of which two are newly described. A new Alternaria section is also described, comprising two large-spored Alternaria species with concatenate conidia.

  5. Protein Composition of Infectious Spores Reveals Novel Sexual Development and Germination Factors in Cryptococcus.

    Directory of Open Access Journals (Sweden)

    Mingwei Huang

    2015-08-01

    Full Text Available Spores are an essential cell type required for long-term survival across diverse organisms in the tree of life and are a hallmark of fungal reproduction, persistence, and dispersal. Among human fungal pathogens, spores are presumed infectious particles, but relatively little is known about this robust cell type. Here we used the meningitis-causing fungus Cryptococcus neoformans to determine the roles of spore-resident proteins in spore biology. Using highly sensitive nanoscale liquid chromatography/mass spectrometry, we compared the proteomes of spores and vegetative cells (yeast and identified eighteen proteins specifically enriched in spores. The genes encoding these proteins were deleted, and the resulting strains were evaluated for discernable phenotypes. We hypothesized that spore-enriched proteins would be preferentially involved in spore-specific processes such as dormancy, stress resistance, and germination. Surprisingly, however, the majority of the mutants harbored defects in sexual development, the process by which spores are formed. One mutant in the cohort was defective in the spore-specific process of germination, showing a delay specifically in the initiation of vegetative growth. Thus, by using this in-depth proteomics approach as a screening tool for cell type-specific proteins and combining it with molecular genetics, we successfully identified the first germination factor in C. neoformans. We also identified numerous proteins with previously unknown functions in both sexual development and spore composition. Our findings provide the first insights into the basic protein components of infectious spores and reveal unexpected molecular connections between infectious particle production and spore composition in a pathogenic eukaryote.

  6. Fate of pathogenic Bacillus cereus spores after ingestion by protist grazers

    DEFF Research Database (Denmark)

    Winding, Anne; Santos, Susana; Hendriksen, Niels Bohse

    The aim of this study is to understand the symbiosis between bacterivorous protists and pathogenic bacterial spores, in order to gain insight on survival and dispersal of pathogenic bacteria in the environment. It is generally accepted that resistance to grazing by protists has contributed...... to the evolution of Bacillus cereus group bacteria (e.g. B. cereus, B. anthracis, B. thuringiensis) as a pathogen. It has been hypothesized that the spore stage protects against digestion by predating protists. Indeed, B. thuringiensis spores have been shown to be readily ingested by ciliated protists but failed...... to be digested (Manasherob et al 1998 AEM 64:1750-). Here we report how diverse protist grazers grow on both vegetative cells and spores of B. cereus and how the bacteria survive ingestion and digestion, and even proliferate inside the digestive vacuoles of ciliated protists. The survival ability of B. cereus...

  7. Large-spored Alternaria pathogens in section Porri disentangled

    NARCIS (Netherlands)

    Woudenberg, J H C; Truter, M; Groenewald, J Z; Crous, P W

    The omnipresent fungal genus Alternaria was recently divided into 24 sections based on molecular and morphological data. Alternaria sect. Porri is the largest section, containing almost all Alternaria species with medium to large conidia and long beaks, some of which are important plant pathogens

  8. Large-spored Alternaria pathogens in section Porri disentangled

    NARCIS (Netherlands)

    Woudenberg, J.H.C.; Truter, M.; Groenewald, J.Z.; Crous, P.W.

    2014-01-01

    The omnipresent fungal genus Alternaria was recently divided into 24 sections based on molecular and morphological data. Alternaria sect. Porri is the largest section, containing almost all Alternaria species with medium to large conidia and long beaks, some of which are important plant pathogens

  9. Large-spored Alternaria pathogens in section Porri disentangled

    OpenAIRE

    Woudenberg, J.H.C.; Truter, M.; Groenewald, J.Z.; Crous, P.W.

    2014-01-01

    The omnipresent fungal genus Alternaria was recently divided into 24 sections based on molecular and morphological data. Alternaria sect. Porri is the largest section, containing almost all Alternaria species with medium to large conidia and long beaks, some of which are important plant pathogens (e.g. Alternaria porri, A. solani and A. tomatophila). We constructed a multi-gene phylogeny on parts of the ITS, GAPDH, RPB2, TEF1 and Alt a 1 gene regions, which, supplemented with morphological an...

  10. Resting spore formation of aphid-pathogenic fungus Pandora nouryi depends on the concentration of infective inoculum.

    Science.gov (United States)

    Huang, Zhi-Hong; Feng, Ming-Guang

    2008-07-01

    Resting spore formation of some aphid-pathogenic Entomophthorales is important for the seasonal pattern of their prevalence and survival but this process is poorly understood. To explore the possible mechanism involved in the process, Pandora nouryi (obligate aphid pathogen) interacted with green peach aphid Myzus persicae on cabbage leaves under favourable conditions. Host nymphs showered with primary conidia of an isolate (LC(50): 0.9-6.7 conidia mm(-2) 4-7 days post shower) from air captures in the low-latitude plateau of China produced resting spores (azygospores), primary conidia or both spore types. Surprisingly, the proportion of mycosed cadavers forming resting spores (P(CFRS)) increased sharply within the concentrations (C) of 28-240 conidia mm(-2), retained high levels at 240-1760, but was zero or extremely low at 0.3-16. The P(CFRS)-C relationship fit well the logistic equation P(CFRS) = 0.6774/[1 + exp(3.1229-0.0270C)] (r(2) = 0.975). This clarified for the first time the dependence of in vivo resting spore formation of P. nouryi upon the concentration of infective inoculum. A hypothesis is thus proposed that some sort of biochemical signals may exist in the host-pathogen interaction so that the fungal pathogen perceives the signals for prompt response to forthcoming host-density changes by either producing conidia for infecting available hosts or forming resting spores for surviving host absence in situ.

  11. Metabolomes of Potato Root Exudates: Compounds That Stimulate Resting Spore Germination of the Soil-Borne Pathogen Spongospora subterranea.

    Science.gov (United States)

    Balendres, Mark A; Nichols, David S; Tegg, Robert S; Wilson, Calum R

    2016-10-12

    Root exudation has importance in soil chemical ecology influencing rhizosphere microbiota. Prior studies reported root exudates from host and nonhost plants stimulated resting spore germination of Spongospora subterranea, the powdery scab pathogen of potato, but the identities of stimulatory compounds were unknown. This study showed that potato root exudates stimulated S. subterranea resting spore germination, releasing more zoospores at an earlier time than the control. We detected 24 low molecular weight organic compounds within potato root exudates and identified specific amino acids, sugars, organic acids, and other compounds that were stimulatory to S. subterranea resting spore germination. Given that several stimulatory compounds are commonly found in exudates of diverse plant species, we support observations of nonhost-specific stimulation. We provide knowledge of S. subterranea resting spore biology and chemical ecology that may be useful in formulating new disease management strategies.

  12. Spore Acquisition and Survival of Ambrosia Beetles Associated with the Laurel Wilt Pathogen in Avocados after Exposure to Entomopathogenic Fungi

    Directory of Open Access Journals (Sweden)

    Pasco B. Avery

    2018-04-01

    Full Text Available Laurel wilt is a disease threatening the avocado industry in Florida. The causative agent of the disease is a fungus vectored by ambrosia beetles that bore into the trees. Until recently, management strategies for the vectors of the laurel wilt fungus relied solely on chemical control and sanitation practices. Beneficial entomopathogenic fungi (EPF are the most common and prevalent natural enemies of pathogen vectors. Laboratory experiments demonstrated that commercial strains of EPF can increase the mortality of the primary vector, Xyleborus glabratus, and potential alternative vectors, Xylosandrus crassiusculus, Xyleborus volvulus and Xyleborus bispinatus (Coleoptera: Curculionidae: Scolytinae. Our study provides baseline data for three formulated commercially-available entomopathogenic fungi used as potential biocontrol agents against X. crassiusculus, X. volvulus and X. bispinatus. The specific objectives were to determine: (1 the mean number of viable spores acquired per beetle species adult after being exposed to formulated fungal products containing different strains of EPF (Isaria fumosorosea, Metarhizium brunneum and Beauveria bassiana; and (2 the median and mean survival times using paper disk bioassays. Prior to being used in experiments, all fungal suspensions were adjusted to 2.4 × 106 viable spores/mL. The number of spores acquired by X. crassiusculus was significantly higher after exposure to B. bassiana, compared to the other fungal treatments. For X. volvulus, the numbers of spores acquired per beetle were significantly different amongst the different fungal treatments, and the sequence of spore acquisition rates on X. volvulus from highest to lowest was I. fumosorosea > M. brunneum > B. bassiana. After X. bispinatus beetles were exposed to the different suspensions, the rates of acquisition of spores per beetle amongst the different fungal treatments were similar. Survival estimates (data pooled across two tests indicated an

  13. Spore Acquisition and Survival of Ambrosia Beetles Associated with the Laurel Wilt Pathogen in Avocados after Exposure to Entomopathogenic Fungi.

    Science.gov (United States)

    Avery, Pasco B; Bojorque, Verónica; Gámez, Cecilia; Duncan, Rita E; Carrillo, Daniel; Cave, Ronald D

    2018-04-25

    Laurel wilt is a disease threatening the avocado industry in Florida. The causative agent of the disease is a fungus vectored by ambrosia beetles that bore into the trees. Until recently, management strategies for the vectors of the laurel wilt fungus relied solely on chemical control and sanitation practices. Beneficial entomopathogenic fungi (EPF) are the most common and prevalent natural enemies of pathogen vectors. Laboratory experiments demonstrated that commercial strains of EPF can increase the mortality of the primary vector, Xyleborus glabratus , and potential alternative vectors, Xylosandrus crassiusculus , Xyleborus volvulus and Xyleborus bispinatus (Coleoptera: Curculionidae: Scolytinae). Our study provides baseline data for three formulated commercially-available entomopathogenic fungi used as potential biocontrol agents against X. crassiusculus , X. volvulus and X. bispinatus. The specific objectives were to determine: (1) the mean number of viable spores acquired per beetle species adult after being exposed to formulated fungal products containing different strains of EPF ( Isaria fumosorosea , Metarhizium brunneum and Beauveria bassiana ); and (2) the median and mean survival times using paper disk bioassays. Prior to being used in experiments, all fungal suspensions were adjusted to 2.4 × 10⁶ viable spores/mL. The number of spores acquired by X. crassiusculus was significantly higher after exposure to B. bassiana , compared to the other fungal treatments. For X. volvulus , the numbers of spores acquired per beetle were significantly different amongst the different fungal treatments, and the sequence of spore acquisition rates on X. volvulus from highest to lowest was I. fumosorosea > M. brunneum > B. bassiana . After X. bispinatus beetles were exposed to the different suspensions, the rates of acquisition of spores per beetle amongst the different fungal treatments were similar. Survival estimates (data pooled across two tests) indicated an

  14. In vitro spore germination and gametophytic growth development of ...

    African Journals Online (AJOL)

    The effects of sucrose, pH and plant growth hormones on spore germination percentage and gametophyte growths of Pteris tripartita were studied. Various morphological structures of gametophytes were observed namely, filamentous, spatulate and heart stages in the MS culture medium with hormones. After 15 days, the ...

  15. Development of bioprocess for high density cultivation yield of the probiotic Bacillus coagulans and its spores

    Directory of Open Access Journals (Sweden)

    Kavita R. Pandey

    2016-09-01

    Full Text Available Bacillus coagulans is a spore forming lactic acid bacterium. Spore forming bacteria, have been extensively studied and commercialized as probiotics. Probiotics are produced by fermentation technology. There is a limitation to biomass produced by conventional modes of fermentation. With the great demand generated by range of probiotic products, biomass is becoming very valuable for several pharmaceutical, dairy and probiotic companies. Thus, there is a need to develop high cell density cultivation processes for enhanced biomass accumulation. The bioprocess development was carried out in 6.6 L bench top lab scale fermentor. Four different cultivation strategies were employed to develop a bioprocess for higher growth and sporulation efficiencies of probiotic B. coagulans. Batch fermentation of B. coagulans yielded 18 g L-1 biomass (as against 8.0 g L-1 productivity in shake flask with 60% spore efficiency. Fed-batch cultivation was carried out for glucose, which yielded 25 g L-1 of biomass. C/N ratio was very crucial in achieving higher spore titres. Maximum biomass yield recorded was 30 g L-1, corresponding to 3.8 × 1011 cells mL-1 with 81% of cells in sporulated stage. The yield represents increment of 85 times the productivity and 158 times the spore titres relative to the highest reported values for high density cultivation of B. coagulans.

  16. Flavonoids released naturally from alfalfa promote development of symbiotic glomus spores in vitro.

    Science.gov (United States)

    Tsai, S M; Phillips, D A

    1991-05-01

    Because flavonoids from legumes induce transcription of nodulation genes in symbiotic rhizobial bacteria, it is reasonable to test whether these compounds alter the development of vesicular-arbuscular mycorrhizal (VAM) fungi that infect those plants. Quercetin-3-O-galactoside, the dominant flavonoid released naturally from alfalfa (Medicago sativa L.) seeds, promoted spore germination of Glomus etunicatum and Glomus macrocarpum in vitro. Quercetin produced the maximum increases in spore germination, hyphal elongation, and hyphal branching in G. etunicatum at 1 to 2.5 muM concentrations. Two flavonoids exuded from alfalfa roots, 4',7-dihydroxyflavone and 4',7-dihydroxyflavanone, also enhanced spore germination of this fungal species. Formononetin, an isoflavone that is released from stressed alfalfa roots, inhibited germination of both Glomus species. These in vitro results suggest that plant flavonoids may facilitate or regulate the development of VAM symbioses and offer new hope for developing pure, plant-free cultures of VAM fungi.

  17. Subboiling Moist Heat Favors the Selection of Enteric Pathogen Clostridium difficile PCR Ribotype 078 Spores in Food

    Directory of Open Access Journals (Sweden)

    Alexander Rodriguez-Palacios

    2016-01-01

    Full Text Available Emerging enteric pathogens could have not only more antibiotic resistance or virulence traits; they could also have increased resistance to heat. We quantified the effects of minimum recommended cooking and higher temperatures, individually on a collection of C. difficile isolates and on the survival probability of a mixture of emerging C. difficile strains. While minimum recommended cooking time/temperature combinations (63–71°C allowed concurrently tested strains to survive, higher subboiling temperatures reproducibly favored the selection of newly emerging C. difficile PCR ribotype 078. Survival ratios for “ribotypes 078” :  “other ribotypes” (n=49 : 45 isolates from the mid-2000s increased from 1 : 1 and 0.7 : 1 at 85°C (for 5 and 10 minutes, resp. to 2.3 : 1 and 3 : 1 with heating at 96°C (for 5 and 10 minutes, resp. indicating an interaction effect between the heating temperature and survival of C. difficile genotypes. In multistrain heating experiments, with PCR ribotypes 027 and 078 from 2004 and reference type strain ATCC 9689 banked in the 1970s, multinomial logistic regression (P<0.01 revealed PCR ribotype 078 was the most resistant to increasing lethal heat treatments. Thermal processes (during cooking or disinfection may contribute to the selection of emergent specific virulent strains of C. difficile. Despite growing understanding of the role of cooking on human evolution, little is known about the role of cooking temperatures on the selection and evolution of enteric pathogens, especially spore-forming bacteria.

  18. Long-distance wind-dispersal of spores in a fungal plant pathogen: estimation of anisotropic dispersal kernels from an extensive field experiment.

    Directory of Open Access Journals (Sweden)

    Adrien Rieux

    Full Text Available Given its biological significance, determining the dispersal kernel (i.e., the distribution of dispersal distances of spore-producing pathogens is essential. Here, we report two field experiments designed to measure disease gradients caused by sexually- and asexually-produced spores of the wind-dispersed banana plant fungus Mycosphaerella fijiensis. Gradients were measured during a single generation and over 272 traps installed up to 1000 m along eight directions radiating from a traceable source of inoculum composed of fungicide-resistant strains. We adjusted several kernels differing in the shape of their tail and tested for two types of anisotropy. Contrasting dispersal kernels were observed between the two types of spores. For sexual spores (ascospores, we characterized both a steep gradient in the first few metres in all directions and rare long-distance dispersal (LDD events up to 1000 m from the source in two directions. A heavy-tailed kernel best fitted the disease gradient. Although ascospores distributed evenly in all directions, average dispersal distance was greater in two different directions without obvious correlation with wind patterns. For asexual spores (conidia, few dispersal events occurred outside of the source plot. A gradient up to 12.5 m from the source was observed in one direction only. Accordingly, a thin-tailed kernel best fitted the disease gradient, and anisotropy in both density and distance was correlated with averaged daily wind gust. We discuss the validity of our results as well as their implications in terms of disease diffusion and management strategy.

  19. Development of a method to determine the effectiveness of cleaning agents in removal of biofilm derived spores in milking system

    Directory of Open Access Journals (Sweden)

    Ievgeniia Ostrov

    2016-09-01

    Full Text Available Microbial damages caused by biofilm forming bacteria in the dairy industry are a fundamental threat to safety and quality of dairy products. In order to ensure the optimal level of equipment hygiene in the dairy industry, it is necessary to determine the biofilm removal efficiency of cleaning agents used for cleaning-in-place procedures. However, currently there is no standard method available for evaluating and comparing cleaning agents for use in cleaning-in-place procedures in the dairy industry under realistic conditions. The present study aims to establish a cleaning-in-place model system to evaluate the effectiveness of cleaning agents in removal of biofilm derived spores from the surfaces of stainless steel which is the predominant substrate in milking equipment on dairy farms. The system is based on Bacillus subtilis spores surrounded with exopolymeric substances produced by bacteria during biofilm formation. The spores applied on sampling plates were mounted on T-junctions protruding 1.5 – 11-times the milk pipe diameter from the main loop to resemble different levels of cleaning difficulty. The cleaning tests were conducted using commercial alkaline detergents and caustic soda at conditions which are relevant to actual farm environment. The spores removal effect was evaluated by comparing the number of viable spores (attached to sampling plates before and after cleaning. Evaluation of the cleaning and disinfecting effect of cleaning agents towards biofilm derived spores was further performed, which indicates whether spores elimination effect of an agent is due to killing the spores or removing them from the surfaces of dairy equipment. Moreover, it was established that the presence of extracellular matrix is an important factor responsible for high level of cleaning difficulty characteristic for surface attached spores. In overall, the results of this study suggest that the developed model system simulates actual farm conditions for

  20. In vitro spore germination and gametophytic growth development of ...

    African Journals Online (AJOL)

    SAM

    2014-06-04

    Jun 4, 2014 ... gametophytes were observed namely, filamentous, spatulate and heart stages in the MS culture medium with hormones. After 15 days, the .... However, gametophytic generation is essential in the fern life cycle and very ..... Deng YN, Cheng X, Jiao Y, Chen GJ (2009). The Gametophyte. Development and ...

  1. Development of a transformation system for Mycosphaerella pathogens of banana: a tool for the study of host/pathogen interactions.

    Science.gov (United States)

    Balint-Kurti, P J; May, G D; Churchill, A C

    2001-02-05

    A genetic transformation system has been developed for three Mycosphaerella pathogens of banana and plantain (Musa spp.). Mycosphaerella fijiensis and Mycosphaerella musicola, the causal agents of black and yellow Sigatoka, respectively, and Mycosphaerella eumusae, which causes Septoria leaf spot of banana, were transformed with a construct carrying a synthetic gene encoding green fluorescent protein (GFP). Most single-spored transformants that expressed GFP constitutively were mitotically stable in the absence of selection for hygromycin B resistance. Transformants of all three species were pathogenic on the susceptible banana cultivar Grand Nain, and growth in planta was comparable to wild-type strains. GFP expression by transformants allowed us to observe extensive fungal growth within leaf tissue that eventually turned necrotic, at which point the fungi grew saprophytically on the dead tissue. Leaf chlorosis and necrosis were often observed in advance of saprophytic growth of the mycelium on necrotic tissue, which supports previous reports suggesting secretion of a phytotoxin.

  2. Effect of high hydrostatic pressure on mycelial development, spore viability and enzyme activity of Penicillium Roqueforti.

    Science.gov (United States)

    Martínez-Rodríguez, Yamile; Acosta-Muñiz, Carlos; Olivas, Guadalupe I; Guerrero-Beltrán, José; Rodrigo-Aliaga, Dolores; Mujica-Paz, Hugo; Welti-Chanes, Jorge; Sepulveda, David R

    2014-01-03

    This study investigated the effect of high hydrostatic pressure treatments on mycelial development, spore viability, and total proteolytic and lipolytic activity of Penicillium roqueforti PV-LYO 10 D. Fungus growing in liquid medium was pressure-treated at 300, 400, and 500 MPa for 10 min at 20°C following seven days of incubation at 25°C and analyzed periodically up to day 9 after treatments to evaluate the effect on fungal growth. Mycelial mass of P. roqueforti was significantly affected at all pressure treatments evaluated, being 15.48%, 22.28%, 30.03%, and 12.53% lower than controls on day 1, 3, 6, and 9 after 300 MPa treatment, respectively. In a similar way, at 400 and 500 MPa, mycelial mass was 31.08% and 60.34% lower than controls one day after treatments and 49.74% and 80.85% lower on day 9, respectively. The viability of P. roqueforti spores decreased by 36.53% at 300 MPa, and complete inactivation took place at ≥400 MPa from an initial count of 7 log cfu/mL. Total proteolytic activity was not significantly affected at 300 MPa but was reduced by 18.22% at 400 MPa and by 43.18% at 500 MPa. Total lipolytic activity also decreased as the intensity of the pressure treatments increased. 21.69%, 39.12%, and 56.26% activity reductions were observed when treatments of 300, 400 and 500 MPa were applied, respectively. The results from this study show that pressure treatments are able to control growth, inactivate spores, and alter enzyme activity of P. roqueforti, which could be of interest in extending the shelf-life of blue-veined cheeses and other food products. © 2013.

  3. The development and structure of thick-walled, multicellular, aerial spores in Diheterospora chlamydosporia (=Verticillium chlamydosporium).

    Science.gov (United States)

    Cambell, W P; Griffiths, D A

    1975-07-01

    The aerial, thick-walled spores in Diheterospara chlamydosporia arose as terminal swellings on erect hyphae. Repeated septation of the continuously swelling spore resulted in a multicellular structure. Immediately after the onset of septation secondary wall material was laid down between the two-layered primary wall and the plasmalemma. The presence of secondary wall material indicates that the multicellular spore is a dictyochlamydospore and not an aleuriospore. The relationship between chlamydospores and aleuriospores in other fungi is discussed.

  4. Development of an eco-friendly approach for biogenesis of silver nanoparticles using spores of Bacillus athrophaeus.

    Science.gov (United States)

    Hosseini-Abari, Afrouzossadat; Emtiazi, Giti; Ghasemi, Seyed Mahdi

    2013-12-01

    The biological synthesis methods have been emerging as a promising new approach for production of nanoparticles due to their simplicity and non-toxicity. In the present study, spores of Bacillus athrophaeus were used to achieve the objective of developing a green synthesis method of silver nanoparticles. Enzyme assay revealed that the spores and their heat inactivated forms (microcapsules) were highly active and their enzymatic contents differed from the vegetative cells. Laccase, glucose oxidase, and alkaline phosphatase activities were detected in the dormant forms, but not in the vegetative cells. Although no nanoparticle was produced by active cells of B. athrophaeus, both spores and microcapsules were efficiently capable of reducing the silver ions (Ag⁺) to elemental silver (Ag⁰) leading to the formation of nanoparticles from silver nitrate (AgNO₃). The presence of biologically synthesized silver nanoparticles was determined by obtaining broad spectra with maximum absorbance at 400 nm in UV-visible spectroscopy. The X-ray diffraction analysis pattern revealed that the nanoscale particles have crystalline nature with various topologies, as confirmed by transmission electron microscopy (TEM). The TEM micrograph showed the nanocrystal structures with dimensions ranging from 5 to 30 nm. Accordingly, the spore mixture could be employed as a factory for detoxification of heavy metals and subsequent production of nanoparticles. This research introduces an environmental friendly and cost effective biotechnological process for the extracellular synthesis of silver nanoparticles using the bacterial spores.

  5. Ultrastructure and properties of Paecilomyces lilacinus spores

    Energy Technology Data Exchange (ETDEWEB)

    Holland, R.J.; Gunasekera, T.S. [Macquarie Univ., Dept. of Biological Sciences, Sydney (Australia); Williams, K.L. [Proteome Systems Ltd., Sydney (Australia); Nevalainen, K.M.H. [Dept. of Biological Sciences, Macquarie University, Sydney (Australia)

    2002-10-01

    Strains of the filamentous soil fungus Paecilomyces lilacinus are currently being developed for use as biological control agents against root-knot, cyst, and other plant-parasitic nematodes. The inoculum applied in the field consists mainly of spores. This study was undertaken to examine the size, ultrastructure, and rodlet layers of P. lilacinus spores and the effect of the culture method on structural and functional spore properties. A rodlet layer was identified on aerial spores only. Other differences noted between aerial spores and those produced in submerged culture included the size and appearance of spores and thickness of spore coat layers when examined with transmission electron microscopy. The two spore types differed in UV tolerance, with aerial spores being less sensitive to environmentally relevant UV radiation. Also, viability after drying and storage was better with the aerial spores. Both spore types exhibited similar nematophagous ability. (author)

  6. Ultrastructure and properties of Paecilomyces lilacinus spores

    International Nuclear Information System (INIS)

    Holland, R.J.; Gunasekera, T.S.; Williams, K.L.; Nevalainen, K.M.H.

    2002-01-01

    Strains of the filamentous soil fungus Paecilomyces lilacinus are currently being developed for use as biological control agents against root-knot, cyst, and other plant-parasitic nematodes. The inoculum applied in the field consists mainly of spores. This study was undertaken to examine the size, ultrastructure, and rodlet layers of P. lilacinus spores and the effect of the culture method on structural and functional spore properties. A rodlet layer was identified on aerial spores only. Other differences noted between aerial spores and those produced in submerged culture included the size and appearance of spores and thickness of spore coat layers when examined with transmission electron microscopy. The two spore types differed in UV tolerance, with aerial spores being less sensitive to environmentally relevant UV radiation. Also, viability after drying and storage was better with the aerial spores. Both spore types exhibited similar nematophagous ability. (author)

  7. Development of a Quantitative PCR Assay for Thermophilic Spore-Forming Geobacillus stearothermophilus in Canned Food.

    Science.gov (United States)

    Nakano, Miyo

    2015-01-01

    The thermophilic spore forming bacteria Geobacillus stearothermophilus is recognized as a major cause of spoilage in canned food. A quantitative real-time PCR assay was developed to specifically detect and quantify the species G. stearothermophilus in samples from canned food. The selected primer pairs amplified a 163-bp fragment of the 16S rRNA gene in a specific PCR assay with a detection limit of 12.5 fg of pure culture DNA, corresponding to DNA extracted from approximately 0.7 CFU/mL of G. stearothermophilus. Analysis showed that the bacterial species G. stearothermophilus was not detected in any canned food sample. Our approach presented here will be useful for tracking or quantifying species G. stearotethermophilus in canned food and ingredients.

  8. The Conserved Spore Coat Protein SpoVM Is Largely Dispensable in Clostridium difficile Spore Formation.

    Science.gov (United States)

    Ribis, John W; Ravichandran, Priyanka; Putnam, Emily E; Pishdadian, Keyan; Shen, Aimee

    2017-01-01

    The spore-forming bacterial pathogen Clostridium difficile is a leading cause of health care-associated infections in the United States. In order for this obligate anaerobe to transmit infection, it must form metabolically dormant spores prior to exiting the host. A key step during this process is the assembly of a protective, multilayered proteinaceous coat around the spore. Coat assembly depends on coat morphogenetic proteins recruiting distinct subsets of coat proteins to the developing spore. While 10 coat morphogenetic proteins have been identified in Bacillus subtilis , only two of these morphogenetic proteins have homologs in the Clostridia : SpoIVA and SpoVM. C. difficile SpoIVA is critical for proper coat assembly and functional spore formation, but the requirement for SpoVM during this process was unknown. Here, we show that SpoVM is largely dispensable for C. difficile spore formation, in contrast with B. subtilis . Loss of C. difficile SpoVM resulted in modest decreases (~3-fold) in heat- and chloroform-resistant spore formation, while morphological defects such as coat detachment from the forespore and abnormal cortex thickness were observed in ~30% of spoVM mutant cells. Biochemical analyses revealed that C. difficile SpoIVA and SpoVM directly interact, similarly to their B. subtilis counterparts. However, in contrast with B. subtilis , C. difficile SpoVM was not essential for SpoIVA to encase the forespore. Since C. difficile coat morphogenesis requires SpoIVA-interacting protein L (SipL), which is conserved exclusively in the Clostridia , but not the more broadly conserved SpoVM, our results reveal another key difference between C. difficile and B. subtilis spore assembly pathways. IMPORTANCE The spore-forming obligate anaerobe Clostridium difficile is the leading cause of antibiotic-associated diarrheal disease in the United States. When C. difficile spores are ingested by susceptible individuals, they germinate within the gut and

  9. Using Oxytetracycline, Amikacin and Erythromycin in Controlling Mycelial Growth and Spore Germination of Rhytisma acerinum as Pathogen in Tar Spot Disease at Acer velutinum Boiss in Vitro

    Directory of Open Access Journals (Sweden)

    Sh. Mehdi Karami

    2017-08-01

    Full Text Available Introduction : There are seven species and sub-species of Acer sp. in the Northern forest of Iran. One of the most important diseases of this tree in all over the world is tar spot. Two species of fungi, which cause this disease, are Rhytisma acerinum and R. punctatum from the category of Ascomycetidae. Studies on the Acer platinum sp. show that causative agent of this disease is R.punctatum which cause the early fall and make leaves turning yellow especially in the plant nurseries and forested areas. Therefore, investigating the use of antibiotics in treating this disease in the forest areas is necessary. The objective of the current research was to use Oxytetracycline, Amikacin and Erythromycin in Controlling mycelial growth and spore germination of R. acerinum as Pathogen in tar spot disease at Acer velutinum Boiss in vitro. Materials and methods: To control the disease of Maple tar spot in the condition of light and darkness, the medium containing oxytetracycline, Amikacin and Erythromycin were used. Four different dosage of 50, 100, 200, 500 microliter, of oxytetracycline 10% in the light and dark conditions in 100cc of distilled water and Amikacin 5% in four different dose of, 100, 200, 400 and 1000 microliter, light and dark conditions in 100 cc of distilled water and for erythromycin 5% four different dose of, 100, 200, 400 and 1000 microliter in 100 cc of distilled water in light and dark conditions each in three repetitions of medium were prepared. In this step, to evaluate the effect of light on the rate of the growth of mycelium and fungal colonies of R. acerinum, for each of the treatments with the different dosage, half of the repetitions were under the light condition and another half in dark condition (incubator. Then, after the growth, radiant growth was measured over one week. To investigate the fungi spore germination, above steps, were performed, as well. Results and Discussion: The results showed that among the mentioned

  10. Carbon dioxide is a powerful inducer of monokaryotic hyphae and spore development in Cryptococcus gattii and carbonic anhydrase activity is dispensable in this dimorphic transition.

    Science.gov (United States)

    Ren, Ping; Chaturvedi, Vishnu; Chaturvedi, Sudha

    2014-01-01

    Cryptococcus gattii is unique among human pathogenic fungi with specialized ecological niche on trees. Since leaves concentrate CO2, we investigated the role of this gaseous molecule in C. gattii biology and virulence. We focused on the genetic analyses of β-carbonic anhydrase (β-CA) encoded by C. gattii CAN1 and CAN2 as later is critical for CO2 sensing in a closely related pathogen C. neoformans. High CO2 conditions induced robust development of monokaryotic hyphae and spores in C. gattii. Conversely, high CO2 completely repressed hyphae development in sexual mating. Both CAN1 and CAN2 were dispensable for CO2 induced morphogenetic transitions. However, C. gattii CAN2 was essential for growth in ambient air similar to its reported role in C. neoformans. Both can1 and can2 mutants retained full pathogenic potential in vitro and in vivo. These results provide insight into C. gattii adaptation for arboreal growth and production of infectious propagules by β-CA independent mechanism(s).

  11. High fungal spore burden with predominance of Aspergillus in hospital air of a tertiary care hospital in Chandigarh

    Directory of Open Access Journals (Sweden)

    S M Rudramurthy

    2016-01-01

    Full Text Available The prevalence of fungal spores in the hospital air is essential to understand the hospital-acquired fungal infections. Air conditioners (ACs used in hospitals may either reduce spores in air or be colonised by fungi and aid in its dissemination. The present study was conducted to assess the fungal spore burden in AC and non-AC areas. We found a high fungal spore count in air irrespective of whether the area was AC or non-AC. The most predominant species isolated were Aspergillus flavus and Aspergillus fumigatus. Such high concentrations of pathogenic fungi in air may predispose individuals to develop disease.

  12. Mapping of Proteomic Composition on the Surfaces of Bacillus spores by Atomic Force Microscopy-based Immunolabeling

    Energy Technology Data Exchange (ETDEWEB)

    Plomp, M; Malkin, A J

    2008-06-02

    Atomic force microscopy provides a unique capability to image high-resolution architecture and structural dynamics of pathogens (e.g. viruses, bacteria and bacterial spores) at near molecular resolution in native conditions. Further development of atomic force microscopy in order to enable the correlation of pathogen protein surface structures with specific gene products is essential to understand the mechanisms of the pathogen life cycle. We have applied an AFM-based immunolabeling technique for the proteomic mapping of macromolecular structures through the visualization of the binding of antibodies, conjugated with nanogold particles, to specific epitopes on Bacillus spore surfaces. This information is generated while simultaneously acquiring the surface morphology of the pathogen. The immunospecificity of this labeling method was established through the utilization of specific polyclonal and monoclonal antibodies that target spore coat and exosporium epitopes of Bacillus atrophaeus and Bacillus anthracis spores.

  13. Development of method for evaluating cell hardness and correlation between bacterial spore hardness and durability

    Directory of Open Access Journals (Sweden)

    Nakanishi Koichi

    2012-06-01

    Full Text Available Abstract Background Despite the availability of conventional devices for making single-cell manipulations, determining the hardness of a single cell remains difficult. Here, we consider the cell to be a linear elastic body and apply Young’s modulus (modulus of elasticity, which is defined as the ratio of the repulsive force (stress in response to the applied strain. In this new method, a scanning probe microscope (SPM is operated with a cantilever in the “contact-and-push” mode, and the cantilever is applied to the cell surface over a set distance (applied strain. Results We determined the hardness of the following bacterial cells: Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and five Bacillus spp. In log phase, these strains had a similar Young’s modulus, but Bacillus spp. spores were significantly harder than the corresponding vegetative cells. There was a positive, linear correlation between the hardness of bacterial spores and heat or ultraviolet (UV resistance. Conclusions Using this technique, the hardness of a single vegetative bacterial cell or spore could be determined based on Young’s modulus. As an application of this technique, we demonstrated that the hardness of individual bacterial spores was directly proportional to heat and UV resistance, which are the conventional measures of physical durability. This technique allows the rapid and direct determination of spore durability and provides a valuable and innovative method for the evaluation of physical properties in the field of microbiology.

  14. Biomarkers of Aspergillus spores

    Science.gov (United States)

    Sulc, Miroslav; Peslova, Katerina; Zabka, Martin; Hajduch, Marian; Havlicek, Vladimir

    2009-02-01

    We applied both matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) mass spectrometric and 1D sodium dodecylsulfate polyacrylamide gel electrophoretic (1D-PAGE) approaches for direct analysis of intact fungal spores of twenty four Aspergillus species. In parallel, we optimized various protocols for protein extraction from Aspergillus spores using acidic conditions, step organic gradient and variable sonication treatment. The MALDI-TOF mass spectra obtained from optimally prepared samples provided a reproducible fingerprint demonstrating the capability of the MALDI-TOF approach to type and characterize different fungal strains within the Aspergillus genus. Mass spectra of intact fungal spores provided signals mostly below 20 kDa. The minimum material amount represented 0.3 [mu]g (10,000 spores). Proteins with higher molecular weight were detected by 1D-PAGEE Eleven proteins were identified from three selected strains in the range 5-25 kDa by the proteomic approach. Hemolysin and hydrophobin have the highest relevance in host-pathogen interactions.

  15. Small acid soluble proteins for rapid spore identification.

    Energy Technology Data Exchange (ETDEWEB)

    Branda, Steven S.; Lane, Todd W.; VanderNoot, Victoria A.; Jokerst, Amanda S.

    2006-12-01

    This one year LDRD addressed the problem of rapid characterization of bacterial spores such as those from the genus Bacillus, the group that contains pathogenic spores such as B. anthracis. In this effort we addressed the feasibility of using a proteomics based approach to spore characterization using a subset of conserved spore proteins known as the small acid soluble proteins or SASPs. We proposed developing techniques that built on our previous expertise in microseparations to rapidly characterize or identify spores. An alternative SASP extraction method was developed that was amenable to both the subsequent fluorescent labeling required for laser-induced fluorescence detection and the low ionic strength requirements for isoelectric focusing. For the microseparations, both capillary isoelectric focusing and chip gel electrophoresis were employed. A variety of methods were evaluated to improve the molecular weight resolution for the SASPs, which are in a molecular weight range that is not well resolved by the current methods. Isoelectric focusing was optimized and employed to resolve the SASPs using UV absorbance detection. Proteomic signatures of native wild type Bacillus spores and clones genetically engineered to produce altered SASP patterns were assessed by slab gel electrophoresis, capillary isoelectric focusing with absorbance detection as well as microchip based gel electrophoresis employing sensitive laser-induced fluorescence detection.

  16. A two-step transport pathway allows the mother cell to nurture the developing spore in Bacillus subtilis.

    Science.gov (United States)

    Ramírez-Guadiana, Fernando H; Meeske, Alexander J; Rodrigues, Christopher D A; Barajas-Ornelas, Rocío Del Carmen; Kruse, Andrew C; Rudner, David Z

    2017-09-01

    One of the hallmarks of bacterial endospore formation is the accumulation of high concentrations of pyridine-2,6-dicarboxylic acid (dipicolinic acid or DPA) in the developing spore. This small molecule comprises 5-15% of the dry weight of dormant spores and plays a central role in resistance to both wet heat and desiccation. DPA is synthesized in the mother cell at a late stage in sporulation and must be translocated across two membranes (the inner and outer forespore membranes) that separate the mother cell and forespore. The enzymes that synthesize DPA and the proteins required to translocate it across the inner forespore membrane were identified over two decades ago but the factors that transport DPA across the outer forespore membrane have remained mysterious. Here, we report that SpoVV (formerly YlbJ) is the missing DPA transporter. SpoVV is produced in the mother cell during the morphological process of engulfment and specifically localizes in the outer forespore membrane. Sporulating cells lacking SpoVV produce spores with low levels of DPA and cells engineered to express SpoVV and the DPA synthase during vegetative growth accumulate high levels of DPA in the culture medium. SpoVV resembles concentrative nucleoside transporters and mutagenesis of residues predicted to form the substrate-binding pocket supports the idea that SpoVV has a similar structure and could therefore function similarly. These findings provide a simple two-step transport mechanism by which the mother cell nurtures the developing spore. DPA produced in the mother cell is first translocated into the intermembrane space by SpoVV and is then imported into the forespore by the SpoVA complex. This pathway is likely to be broadly conserved as DPA synthase, SpoVV, and SpoVA proteins can be found in virtually all endospore forming bacteria.

  17. Practical aspects of temperature intervention in germination and post-germination development of bacterial spores

    International Nuclear Information System (INIS)

    Stastna, J.; Vinter, V.; Babicka, J.

    1974-01-01

    Temperature dependence of germination and post-germination growth was studied in the spores of B a c i l l u s c e r e u s NCIB 8122. It was found that a temperature of 5 0 C slowed down germination, with the cells showing the capacity of synthetizing only a limited amount of proteins. The synthesis of the cellular wall, however, went on for another few hours. Thick-walled, less permeable and less metabolically active cells formed having an altered ultrastructure. A prolonged cultivation at 30 0 C resulted in the reduction of living cells while the low cultivation temperature (5 0 C) was found to have a protective effect. Pre-irradiation with 30g krad of gamma radiation increased the sensitivity of surviving cells to the cultivation conditions. Spores in the post-germination period were found to be much more resistent and alternating use of low and higher temperatures had little effect on growth

  18. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  19. Detection of Bacillus spores using PCR and FTA filters.

    Science.gov (United States)

    Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

    2004-05-01

    Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

  20. Spore germination and gametophyte development of Cyathea atrovirens (Langsd. & Fisch. Domin (Cyatheaceae under different pH conditions

    Directory of Open Access Journals (Sweden)

    C. Rechenmacher

    Full Text Available Cyathea atrovirens (Langsd. & Fisch. Domin, an intensely exploited tree fern, is found inside forests in several succession stages, as well as in swamps, roadsides and unused fields in the Rio dos Sinos basin, in the state of Rio Grande do Sul, southern Brazil. This study evaluated the in vitro germination and gametophyte development of C.atrovirens under different pH conditions, as well as spore viability after different storage times at 7 ºC. The lowest germination rate of spores was obtained at pH 7.0. At pH 5.0 to 6.5, laminar gametophyte development started at 20 to 30 days of culture. Antheridia and archegonia were first observed at 35 and 128 days, respectively. Storage at 7 ºC did not affect germination rates. The capability of germination at different pH levels may explain the occurrence of the species in a wide range of habitats. The present study contributes to the understanding of the full life-cycle of C. atrovirens and to the analysis of the influence of abiotic components, providing information for the cultivation, management and conservation of the species.

  1. Uracil incorporation in the forespore and the mother cell during spore development in Bacillus subtilis

    International Nuclear Information System (INIS)

    Ryter, A.; Whitehouse, R.

    1978-01-01

    The transcriptional activity of the two genomes of the sporangium during spore formation was determined by pulse-labeling bacteria with 3 H-uracil at different times of sporulation and preparing them for high resolution autoradiography. The quantitative analysis of autoradiographs shows that uracile incorporation in the whole sporangium decreases considerably between stages II and IV. However, the variations of the transpcriptional activity are not identical in the mother cell and in the forespore. The one of the mother cell decreases rapidly between stages II and III and then remains stable until the end of stage IV, whereas that of the forespore which is low at stage II increases as the forespore grows ovoid and then quickly diminishes. It is very weak at the beginning of stage IV and negligible at the end of this stage. (orig.) [de

  2. Validated modified Lycopodium spore method development for standardisation of ingredients of an ayurvedic powdered formulation Shatavaryadi churna.

    Science.gov (United States)

    Kumar, Puspendra; Jha, Shivesh; Naved, Tanveer

    2013-01-01

    Validated modified lycopodium spore method has been developed for simple and rapid quantification of herbal powdered drugs. Lycopodium spore method was performed on ingredients of Shatavaryadi churna, an ayurvedic formulation used as immunomodulator, galactagogue, aphrodisiac and rejuvenator. Estimation of diagnostic characters of each ingredient of Shatavaryadi churna individually was carried out. Microscopic determination, counting of identifying number, measurement of area, length and breadth of identifying characters were performed using Leica DMLS-2 microscope. The method was validated for intraday precision, linearity, specificity, repeatability, accuracy and system suitability, respectively. The method is simple, precise, sensitive, and accurate, and can be used for routine standardisation of raw materials of herbal drugs. This method gives the ratio of individual ingredients in the powdered drug so that any adulteration of genuine drug with its adulterant can be found out. The method shows very good linearity value between 0.988-0.999 for number of identifying character and area of identifying character. Percentage purity of the sample drug can be determined by using the linear equation of standard genuine drug.

  3. Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practica

    NARCIS (Netherlands)

    Lievens, B.; Thomma, B.P.H.J.

    2005-01-01

    The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection,

  4. Administration of Brevibacillus laterosporus spores as a poultry feed additive to inhibit house fly development in feces: a new eco-sustainable concept.

    Science.gov (United States)

    Ruiu, L; Satta, A; Floris, I

    2014-03-01

    The success of a microbial pesticide application against house flies developing in manure should accomplish the uniform mixing of active ingredients with this breeding medium, thus enhancing residual effects. The oral administration of the entomopathogenic bacterium Brevibacillus laterosporus to caged poultry species allows the homogeneous incorporation of its active ingredients with fly breeding media. Feces from treated broilers or hens show toxicity against exposed fly adults and larvae. Insecticidal effects are concentration-dependent with a lethal median concentration (LC50) value of 1.34 × 10(8) and 0.61 × 10(8) spores/g of feces for adults and larvae, respectively. Manure toxicity against flies was maintained as long as chickens were fed a diet containing adequate concentrations of B. laterosporus spores. Toxicity significantly decreased after spore administration to birds was interrupted. When poultry diet contained 10(10) spores/g, mortality of flies reared on feces exceeded 80%. The use of B. lateroporus spores as a feed additive in poultry production systems fostering a more integrated approach to farming is discussed.

  5. Spore: Spawning Evolutionary Misconceptions?

    Science.gov (United States)

    Bean, Thomas E.; Sinatra, Gale M.; Schrader, P. G.

    2010-10-01

    The use of computer simulations as educational tools may afford the means to develop understanding of evolution as a natural, emergent, and decentralized process. However, special consideration of developmental constraints on learning may be necessary when using these technologies. Specifically, the essentialist (biological forms possess an immutable essence), teleological (assignment of purpose to living things and/or parts of living things that may not be purposeful), and intentionality (assumption that events are caused by an intelligent agent) biases may be reinforced through the use of computer simulations, rather than addressed with instruction. We examine the video game Spore for its depiction of evolutionary content and its potential to reinforce these cognitive biases. In particular, we discuss three pedagogical strategies to mitigate weaknesses of Spore and other computer simulations: directly targeting misconceptions through refutational approaches, targeting specific principles of scientific inquiry, and directly addressing issues related to models as cognitive tools.

  6. Inactivation of Clostridium perfringens spores adhered onto stainless steel surface by agents used in a clean-in-place procedure.

    Science.gov (United States)

    Alzubeidi, Yasmeen S; Udompijitkul, Pathima; Talukdar, Prabhat K; Sarker, Mahfuzur R

    2018-07-20

    Enterotoxigenic Clostridium perfringens, a leading foodborne pathogen can be cross-contaminated from food processing stainless steel (SS) surfaces to the finished food products. This is mostly due to the high resistance of C. perfringens spores adhered onto SS surfaces to various disinfectants commonly used in food industries. In this study, we aimed to investigate the survivability and adherence of C. perfringens spores onto SS surfaces and then validate the effectiveness of a simulated Clean-in-Place (CIP) regime on inactivation of spores adhered onto SS surfaces. Our results demonstrated that, 1) C. perfringens spores adhered firmly onto SS surfaces and survived for at-least 48 h, unlike their vegetative cells who died within 30 min, after aerobic incubation at refrigerated and ambient temperatures; 2) Spores exhibited higher levels of hydrophobicity than vegetative cells, suggesting a correlation between cell surface hydrophobicity and adhesion to solid surfaces; 3) Intact spores were more hydrophobic than the decoated spores, suggesting a positive role of spore coat components on spores' hydrophobicity and thus adhesion onto SS surfaces; and finally 4) The CIP regime (NaOH + HNO 3 ) successfully inactivated C. perfringens spores adhered onto SS surfaces, and most of the effect of CIP regime appeared to be due to the NaOH. Collectively, our current findings may well contribute towards developing a strategy to control cross-contamination of C. perfringens spores into food products, which should help reducing the risk of C. perfringens-associated food poisoning outbreaks. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Development of Spore Protein of Myxobolus koi as an Immunostimulant for Prevent of Myxobolusis on Gold Fish (Cyprinus carpio Linn) by Oral Immunisation

    Science.gov (United States)

    Mahasri, Gunanti

    2017-02-01

    Production of Gold fish (Cyprinus carpio Linn) in Indonesia has always increased from 2013 to 2015 year by year with increasing average 2% per year. The amount of production was respectively 571.892 tonnes, 1129.273 tonnes, and 1186.674 tonnes. There were almost no problems to sale of gold fish because it had a good enough prospect. The aims of this research were Isolation of spore protein of Myxobolus koi by using SDS-PAGE to analyze immun respons and survival rate gold fish that immunized with spore protein of Myxobolus koi. The method of this research used experimental method, and belonged to 4 treatments that are: Controle = the group of gold fish not immunized with protein spore of Myxobolus koi neither infected by Myxobolus koi (T1). The group immunized and infested by spore of Myxobolus koi (T2), The group which immunized and not infested by Myxobolus koi (T3), and The group only infested by Myxobolus koi (T4). The dose of immunostimulant was 5 ml in 1 kg of food. The result showed that there were two bands of whole spore protein with molecule weight (MW) 150 kDa and 72 kDa and one band of crude protein Myxobolus koi with molecule weight 73 kD and the optical density point was 0.132 on the first day and increased to 0.769 on the 56 th day. The result also showed that the immun respons and survival rate increased from 27% to 86% in chellence test. The protein spore of Myxobolus koi can used to develops material for immunostimulant and to prevent the myxobolusis.

  8. Microbiological method for radiation sterilization (III). Development of identification software of spore-forming bacteria by using BBL CRYSTAL GP identification kit

    International Nuclear Information System (INIS)

    Hironiwa, Takayuki; Yamamoto, Yoko; Koshikawa, Tomihiko

    2004-01-01

    The part III in this title series describes the development of software for identification of spore-forming bacteria using the commercially available BBL CRYSTAL GP Identification Kit (Becton, Dickinson and Co., Ltd.), which is essentially for identification of Gram positive bacteria and is not always suitable for the spore-former in the radiation sterilization of medical devices. Isolation and identification of a spore-forming bacterium have to be confirmed by phase-contrast microscopy. The bacteria cultured overnight are to be inoculated in the Kit and cultured for 18-24 hr at 35-37 deg C with the lid attached by substrates for identification. Here, 30 substrates and probability of positive reactions to the substrates have been tested for spore-formers to make the computer software for final identification. The system is possible to identify 13 spp. of Bacillus, 4 of Paenibacillus, 2 of Brevibaccilus and 1 of Virgibacillus, which are the usual bioburden. For possible misidentification, re-isolation of the bacterium, prolonged culture, concentrated inoculation and re-consideration for ranking of identification the software provides are necessary as well as other identification approaches. Thus, as described in this series, the radio-resistance of, and radiation dose for, the bioburden can be evaluated more easily than hitherto, with use of the kits in radiation sterilization. (N.I.)

  9. Development and application of a new method for specific and sensitive enumeration of spores of nonproteolytic Clostridium botulinum types B, E, and F in foods and food materials.

    Science.gov (United States)

    Peck, Michael W; Plowman, June; Aldus, Clare F; Wyatt, Gary M; Izurieta, Walter Penaloza; Stringer, Sandra C; Barker, Gary C

    2010-10-01

    The highly potent botulinum neurotoxins are responsible for botulism, a severe neuroparalytic disease. Strains of nonproteolytic Clostridium botulinum form neurotoxins of types B, E, and F and are the main hazard associated with minimally heated refrigerated foods. Recent developments in quantitative microbiological risk assessment (QMRA) and food safety objectives (FSO) have made food safety more quantitative and include, as inputs, probability distributions for the contamination of food materials and foods. A new method that combines a selective enrichment culture with multiplex PCR has been developed and validated to enumerate specifically the spores of nonproteolytic C. botulinum. Key features of this new method include the following: (i) it is specific for nonproteolytic C. botulinum (and does not detect proteolytic C. botulinum), (ii) the detection limit has been determined for each food tested (using carefully structured control samples), and (iii) a low detection limit has been achieved by the use of selective enrichment and large test samples. The method has been used to enumerate spores of nonproteolytic C. botulinum in 637 samples of 19 food materials included in pasta-based minimally heated refrigerated foods and in 7 complete foods. A total of 32 samples (5 egg pastas and 27 scallops) contained spores of nonproteolytic C. botulinum type B or F. The majority of samples contained <100 spores/kg, but one sample of scallops contained 444 spores/kg. Nonproteolytic C. botulinum type E was not detected. Importantly, for QMRA and FSO, the construction of probability distributions will enable the frequency of packs containing particular levels of contamination to be determined.

  10. A method for the determination of bacterial spore DNA content based on isotopic labelling, spore germination and diphenylamine assay; ploidy of spores of several Bacillus species

    International Nuclear Information System (INIS)

    Hauser, P.M.; Karamata, D.

    1992-01-01

    A reliable method for measuring the spore DNA content, based on radioactive DNA labelling, spore germination in absence of DNA replication and diphenylamine assay, was developed. The accuracy of the method, within 10 - 15%, is adequate for determining the number of chromosomes per spore, provided that the genome size is known. B subtilis spores were shown to be invariably monogenomic, while those of larger bacilli Bacillus megaterium, Bacillus cereus and Bacillus thuringiensis, often, if not invariably, contain two genomes. Attempts to modify the spore DNA content of B subtilis by altering the richness of the sporulation medium, the sporulation conditions (liquid or solid medium), or by mutation, were apparently unsuccessful. An increase of spore size with medium richness, not accompanied by an increase in DNA content, was observed. The implication of the apparently species-specific spore ploidy and the influence of the sporulation conditions on spore size and shape are discussed

  11. Use of bacterial spores in monitoring water quality and treatment

    Science.gov (United States)

    Because Clostridium perfringens spores are both specific to sewage contamination and environmentally stable, they are considered as possible conservative indicators of human fecal contamination and possible surrogates for environmentally stable pathogens. This review discusses th...

  12. Waterline ATS B. globigii spore water disinfection data

    Data.gov (United States)

    U.S. Environmental Protection Agency — Disinfection of B. globigii spores (a non-pathogenic surrogate for B. anthracis) in clean and dirty water using the ATS-Waterline system, which uses ultraviolet...

  13. Role of gut pathogens in development of irritable bowel syndrome

    Directory of Open Access Journals (Sweden)

    Madhusudan Grover

    2014-01-01

    Full Text Available Acute infectious gastroenteritis is one of the most commonly identifiable risk factors for the development of irritable bowel syndrome (IBS. A number of bacterial, viral and parasitic pathogens have been found to be associated with the development of IBS and other functional gastrointestinal (GI disorders. Epidemiological studies have identified demographic and acute enteritis-related risk factors for the development of post-infectious-IBS (PI-IBS. Immune dysregulation, alterations in barrier function, serotonergic and mast cell activation have been identified as potential pathophysiological mechanisms. Additionally, variations in host genes involved in barrier function, antigen presentation and cytokine response have been associated with PI-IBS development. However, it is unknown whether specific pathogens have unique effects on long-term alterations in gut physiology or different pathogens converge to cause common alterations resulting in similar phenotype. The role of microbial virulence and pathogenicity factors in development of PI-IBS is also largely unknown. Additionally, alterations in host gut sensation, motility, secretion, and barrier function in PI-IBS need to be elucidated. Finally, both GI infections and antibiotics used to treat these infections can cause long-term alterations in host commensal microbiota. It is plausible that alteration in the commensal microbiome persists in a subset of patients predisposing them to develop PI-IBS.

  14. Investigation of spore coat display of Bacillus subtilis β-galactosidase for developing of whole cell biocatalyst.

    Science.gov (United States)

    Tavassoli, Setareh; Hinc, Krzysztof; Iwanicki, Adam; Obuchowski, Michal; Ahmadian, Gholamreza

    2013-03-01

    The production of highly efficient, recyclable and cost-effective enzymes is one of the most important goals in industrial biotechnology. Bacterial spores are highly resistant to harsh environmental conditions, easy to produce and are suitable for manipulation of genetic materials. These features make them a very efficient tool for biotechnology. Here, we show the use bacterial spores for presentation of functional enzyme. Spore coat display was used to produce a biocatalyst, which expresses β-galactiosidase (LacA). This enzyme is commonly used to produce lactose-free milk for lactose intolerant individuals. The lacA gene from Bacillus subtilis strain 168 was expressed on the surface of B. subtilis RH101(ΔcotC) spores using CotC as protein carrier. Presence of LacA protein is verified by western blotting. Results of β-galactiosidase assay show that the expressed enzyme retained its activity in condition of freezing and drying, as well as after recovery from the reaction's mixture.

  15. Developing cryotherapy to eliminate graft-transmissible pathogens in citrus

    Science.gov (United States)

    This article summarizes research being conducted as part of a project funded by the California Citrus Research Board to develop cryotherapy (freezing buds in liquid nitrogen, and then recovering them) as a viable method for elimination of graft transmissible pathogens from Citrus. There are current...

  16. A fluorescence in situ staining method for investigating spores and vegetative cells of Clostridia by confocal laser scanning microscopy and structured illuminated microscopy.

    Science.gov (United States)

    D'Incecco, P; Ong, L; Gras, S; Pellegrino, L

    2018-04-18

    Non-pathogenic spore-forming Clostridia are of increasing interest due to their application in biogas production and their capability to spoil different food products. The life cycle for Clostridium includes a spore stage that can assist in survival under environmentally stressful conditions, such as extremes of temperature or pH. Due to their size, spores can be investigated by a range of microscopic techniques, many of which involve sample pre-treatment. We have developed a quick, simple and non-destructive fluorescent staining procedure that allows a clear differentiation between spores and vegetative cells and effectively stains spores, allowing recovery and tracking in subsequent experiments. Hoechst 34580, Propidium iodide and wheat germ agglutinin WGA 488 were used in combination to stain four strains of Clostridia at different life cycle stages. Staining was conducted without drying the sample, preventing changes induced by dehydration and cells observed by confocal laser scanner microscopy or using a super-resolution microscope equipped with a 3D-structured illumination module. Dual staining with Hoechst/Propidium iodide differentiated spores from vegetative cells, provided information on the viability of cells and was successfully applied to follow spore production induced by heating. Super-resolution microscopy of spores probed by Hoechst 34580 also allowed chromatin to be visualised. Direct staining of a cheese specimen using Nile Red and Fast Green allowed in situ observation of spores within the cheese and their position within the cheese matrix. The proposed staining method has broad applicability and can potentially be applied to follow Clostridium spore behaviour in a range of different environments. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Interactions between intestinal pathogens, enteropathy and malnutrition in developing countries.

    Science.gov (United States)

    Prendergast, Andrew J; Kelly, Paul

    2016-06-01

    This review focuses on recent data highlighting the interactions between intestinal pathogens, enteropathy and malnutrition in developing countries, which drive morbidity and mortality and hinder the long-term developmental potential of children. Diarrhoea remains the second commonest cause of death in children below 5 years, and malnutrition underlies 45% of all child deaths. Even in the absence of diarrhoea, subclinical pathogen carriage and enteropathy are almost universal in developing countries. Here, we review recent studies addressing the causes and consequences of diarrhoea; emerging data on environmental influences that govern postnatal development of the gut and microbiota; current concepts of environmental enteric dysfunction; and recent intervention trials in the field. We highlight the interactions between these processes, whereby intestinal pathogens drive a cycle of gut damage, malabsorption, chronic inflammation and failed mucosal regeneration, leading to malnutrition and susceptibility to further enteric infections. Efforts to improve child survival and long-term developmental potential need to address the overlapping and interacting effects of diarrhoea, enteropathy and malnutrition. Recent insights from human and animal studies suggest potential targets for intervention.

  18. Phosphorescence In Bacillus Spores

    National Research Council Canada - National Science Library

    Reinisch, Lou; Swartz, Barry A; Bronk, Burt V

    2003-01-01

    .... Our present work attempts to build on this approach for environmental applications. We have measured a change in the fluorescence spectra of suspensions of Bacillus bacteria between the vegetative bacteria and their spores at room temperature...

  19. Development of Protective Immunity in New Zealand White Rabbits Challenged with Bacillus anthracis Spores and Treated with Antibiotics and Obiltoxaximab, a Monoclonal Antibody against Protective Antigen.

    Science.gov (United States)

    Henning, Lisa N; Carpenter, Sarah; Stark, Gregory V; Serbina, Natalya V

    2018-02-01

    The recommended management of inhalational anthrax, a high-priority bioterrorist threat, includes antibiotics and antitoxins. Obiltoxaximab, a chimeric monoclonal antibody against anthrax protective antigen (PA), is licensed under the U.S. Food and Drug Administration's (FDA's) Animal Rule for the treatment of inhalational anthrax. Because of spore latency, disease reemergence after treatment cessation is a concern, and there is a need to understand the development of endogenous protective immune responses following antitoxin-containing anthrax treatment regimens. Here, acquired protective immunity was examined in New Zealand White (NZW) rabbits challenged with a targeted lethal dose of Bacillus anthracis spores and treated with antibiotics, obiltoxaximab, or a combination of both. Survivors of the primary challenge were rechallenged 9 months later and monitored for survival. Survival rates after primary and rechallenge for controls and animals treated with obiltoxaximab, levofloxacin, or a combination of both were 0, 65, 100, and 95%, and 0, 100, 95, and 89%, respectively. All surviving immune animals had circulating antibodies to PA and serum toxin-neutralizing titers prior to rechallenge. Following rechallenge, systemic bacteremia and toxemia were not detected in most animals, and the levels of circulating anti-PA IgG titers increased starting at 5 days postrechallenge. We conclude that treatment with obiltoxaximab, alone or combined with antibiotics, significantly improves the survival of rabbits that received a lethal inhalation B. anthracis spore challenge dose and does not interfere with the development of immunity. Survivors of primary challenge are protected against reexposure, have rare incidents of systemic bacteremia and toxemia, and have evidence of an anamnestic response. Copyright © 2018 Henning et al.

  20. The Influence of Sporulation Conditions on the Spore Coat Protein Composition of Bacillus subtilis Spores.

    Science.gov (United States)

    Abhyankar, Wishwas R; Kamphorst, Kiki; Swarge, Bhagyashree N; van Veen, Henk; van der Wel, Nicole N; Brul, Stanley; de Koster, Chris G; de Koning, Leo J

    2016-01-01

    Spores are of high interest to the food and health sectors because of their extreme resistance to harsh conditions, especially against heat. Earlier research has shown that spores prepared on solid agar plates have a higher heat resistance than those prepared under a liquid medium condition. It has also been shown that the more mature a spore is, the higher is its heat resistance most likely mediated, at least in part, by the progressive cross-linking of coat proteins. The current study for the first time assesses, at the proteomic level, the effect of two commonly used sporulation conditions on spore protein presence. 14 N spores prepared on solid Schaeffer's-glucose (SG) agar plates and 15 N metabolically labeled spores prepared in shake flasks containing 3-( N -morpholino) propane sulfonic acid (MOPS) buffered defined liquid medium differ in their coat protein composition as revealed by LC-FT-MS/MS analyses. The former condition mimics the industrial settings while the latter conditions mimic the routine laboratory environment wherein spores are developed. As seen previously in many studies, the spores prepared on the solid agar plates show a higher thermal resistance than the spores prepared under liquid culture conditions. The 14 N: 15 N isotopic ratio of the 1:1 mixture of the spore suspensions exposes that most of the identified inner coat and crust proteins are significantly more abundant while most of the outer coat proteins are significantly less abundant for the spores prepared on solid SG agar plates relative to the spores prepared in the liquid MOPS buffered defined medium. Sporulation condition-specific differences and variation in isotopic ratios between the tryptic peptides of expected cross-linked proteins suggest that the coat protein cross-linking may also be condition specific. Since the core dipicolinic acid content is found to be similar in both the spore populations, it appears that the difference in wet heat resistance is connected to the

  1. The Influence of Sporulation Conditions on the Spore Coat Protein Composition of Bacillus subtilis Spores

    Science.gov (United States)

    Abhyankar, Wishwas R.; Kamphorst, Kiki; Swarge, Bhagyashree N.; van Veen, Henk; van der Wel, Nicole N.; Brul, Stanley; de Koster, Chris G.; de Koning, Leo J.

    2016-01-01

    Spores are of high interest to the food and health sectors because of their extreme resistance to harsh conditions, especially against heat. Earlier research has shown that spores prepared on solid agar plates have a higher heat resistance than those prepared under a liquid medium condition. It has also been shown that the more mature a spore is, the higher is its heat resistance most likely mediated, at least in part, by the progressive cross-linking of coat proteins. The current study for the first time assesses, at the proteomic level, the effect of two commonly used sporulation conditions on spore protein presence. 14N spores prepared on solid Schaeffer’s-glucose (SG) agar plates and 15N metabolically labeled spores prepared in shake flasks containing 3-(N-morpholino) propane sulfonic acid (MOPS) buffered defined liquid medium differ in their coat protein composition as revealed by LC-FT-MS/MS analyses. The former condition mimics the industrial settings while the latter conditions mimic the routine laboratory environment wherein spores are developed. As seen previously in many studies, the spores prepared on the solid agar plates show a higher thermal resistance than the spores prepared under liquid culture conditions. The 14N:15N isotopic ratio of the 1:1 mixture of the spore suspensions exposes that most of the identified inner coat and crust proteins are significantly more abundant while most of the outer coat proteins are significantly less abundant for the spores prepared on solid SG agar plates relative to the spores prepared in the liquid MOPS buffered defined medium. Sporulation condition-specific differences and variation in isotopic ratios between the tryptic peptides of expected cross-linked proteins suggest that the coat protein cross-linking may also be condition specific. Since the core dipicolinic acid content is found to be similar in both the spore populations, it appears that the difference in wet heat resistance is connected to the

  2. The influence of sporulation conditions on the spore coat protein composition of Bacillus subtilis spores.

    Directory of Open Access Journals (Sweden)

    Wishwas R. Abhyankar

    2016-10-01

    Full Text Available Spores are of high interest to the food and health sectors because of their extreme resistance to harsh conditions, especially against heat. Earlier research has shown that spores prepared on solid agar plates have a higher heat resistance than those prepared under a liquid medium condition. It has also been shown that the more mature a spore is, the higher is its heat resistance most likely mediated, at least in part, by the progressive cross-linking of coat proteins. The current study for the first time assesses, at the proteomic level, the effect of two commonly used sporulation conditions on spore protein presence. 14N spores prepared on solid SG agar plates and 15N metabolically labelled spores prepared in shake flasks containing MOPS buffered defined liquid medium differ in their coat protein composition as revealed by LC-FT-MS/MS analyses. The former condition mimics the industrial settings while the latter conditions mimic the routine laboratory environment wherein spores are developed. As seen previously in many studies, the spores prepared on the solid agar plates show a higher thermal resistance than the spores prepared under liquid culture conditions. The 14N: 15N isotopic ratio of the 1:1 mixture of the spore suspensions exposes that most of the identified inner coat and crust proteins are significantly more abundant while most of the outer coat proteins are significantly less abundant for the spores prepared on solid SG agar plates relative to the spores prepared in the liquid MOPS buffered defined medium. Sporulation condition-specific differences and variation in isotopic ratios between the tryptic peptides of expected cross-linked proteins suggest that the coat protein cross-linking may also be condition specific. Since the core dipicolinic acid content is found to be similar in both the spore populations, it appears that the difference in wet heat resistance is connected to the differences in the coat protein composition and

  3. Multi-Probe Investigation of Proteomic Structure of Pathogens

    International Nuclear Information System (INIS)

    Malkin, A J; Plomp, M; Leighton, T J; Vogelstein, B; Wheeler, K E

    2008-01-01

    Complete genome sequences are available for understanding biotransformation, environmental resistance and pathogenesis of microbial, cellular and pathogen systems. The present technological and scientific challenges are to unravel the relationships between the organization and function of protein complexes at cell, microbial and pathogens surfaces, to understand how these complexes evolve during the bacterial, cellular and pathogen life cycles, and how they respond to environmental changes, chemical stimulants and therapeutics. In particular, elucidating the molecular structure and architecture of human pathogen surfaces is essential to understanding mechanisms of pathogenesis, immune response, physicochemical interactions, environmental resistance and development of countermeasures against bioterrorist agents. The objective of this project was to investigate the architecture, proteomic structure, and function of bacterial spores through a combination of high-resolution in vitro atomic force microscopy (AFM) and AFM-based immunolabeling with threat-specific antibodies. Particular attention in this project was focused on spore forming Bacillus species including the Sterne vaccine strain of Bacillus anthracis and the spore forming near-neighbor of Clostridium botulinum, C. novyi-NT. Bacillus species, including B. anthracis, the causative agent of inhalation anthrax are laboratory models for elucidating spore structure/function. Even though the complete genome sequence is available for B. subtilis, cereus, anthracis and other species, the determination and composition of spore structure/function is not understood. Prof. B. Vogelstein and colleagues at the John Hopkins University have recently developed a breakthrough bacteriolytic therapy for cancer treatment (1). They discovered that intravenously injected Clostridium novyi-NT spores germinate exclusively within the avascular regions of tumors in mice and destroy advanced cancerous lesions. The bacteria were also

  4. Current pathogenic Escherichia coli foodborne outbreak cases and therapy development.

    Science.gov (United States)

    Yang, Shih-Chun; Lin, Chih-Hung; Aljuffali, Ibrahim A; Fang, Jia-You

    2017-08-01

    Food contamination by pathogenic microorganisms has been a serious public health problem and a cause of huge economic losses worldwide. Foodborne pathogenic Escherichia coli (E. coli) contamination, such as that with E. coli O157 and O104, is very common, even in developed countries. Bacterial contamination may occur during any of the steps in the farm-to-table continuum from environmental, animal, or human sources and cause foodborne illness. To understand the causes of the foodborne outbreaks by E. coli and food-contamination prevention measures, we collected and investigated the past 10 years' worldwide reports of foodborne E. coli contamination cases. In the first half of this review article, we introduce the infection and symptoms of five major foodborne diarrheagenic E. coli pathotypes: enteropathogenic E. coli (EPEC), Shiga toxin-producing E. coli/enterohemorrhagic E. coli (STEC/EHEC), Shigella/enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), and enterotoxigenic E. coli (ETEC). In the second half of this review article, we introduce the foodborne outbreak cases caused by E. coli in natural foods and food products. Finally, we discuss current developments that can be applied to control and prevent bacterial food contamination.

  5. Size matters for violent discharge height and settling speed of Sphagnum spores: important attributes for dispersal potential.

    Science.gov (United States)

    Sundberg, Sebastian

    2010-02-01

    Initial release height and settling speed of diaspores are biologically controlled components which are key to modelling wind dispersal. Most Sphagnum (peat moss) species have explosive spore liberation. In this study, how capsule and spore sizes affect the height to which spores are propelled were measured, and how spore size and spore number of discharged particles relate to settling speed in the aspherical Sphagnum spores. Spore discharge and spore cloud development were filmed in a closed chamber (nine species). Measurements were taken from snapshots at three stages of cloud development. Settling speed of spores (14 species) and clusters were timed in a glass tube. The maximum discharge speed measured was 3.6 m s(-1). Spores reached a maximum height of 20 cm (average: 15 cm) above the capsule. The cloud dimensions at all stages were related positively to capsule size (R(2) = 0.58-0.65). Thus species with large shoots (because they have large capsules) have a dispersal advantage. Half of the spores were released as singles and the rest as clusters (usually two to four spores). Single spores settled at 0.84-1.86 cm s(-1), about 52 % slower than expected for spherical spores with the same diameters. Settling speed displayed a positive curvilinear relationship with spore size, close to predictions by Stokes' law for spherical spores with 68 % of the actual diameters. Light-coloured spores settled slower than dark spores. Settling speed of spore clusters agrees with earlier studies. Effective spore discharge and small, slowly settling spores appear particularly important for species in forested habitats. The spore discharge heights in Sphagnum are among the greatest for small, wind-dispersed propagules. The discharge heights and the slow settling of spores affect dispersal distances positively and may help to explain the wide distribution of most boreal Sphagnum species.

  6. Fifth international fungus spore conference

    Energy Technology Data Exchange (ETDEWEB)

    Timberlake, W.E.

    1993-04-01

    This folio contains the proceedings of the Fifth International Fungal Spore Conference held August 17-21, 1991 at the Unicoi State Park at Helen, Georgia. The volume contains abstracts of each oral presentation as well as a collection of abstracts describing the poster sessions. Presentations were organized around the themes (1) Induction of Sporulation, (2) Nuclear Division, (3) Spore Formation, (4) Spore Release and Dispersal, and (4) Spore Germination.

  7. High-Resolution Spore Coat Architecture and Assembly of Bacillus Spores

    Energy Technology Data Exchange (ETDEWEB)

    Malkin, A J; Elhadj, S; Plomp, M

    2011-03-14

    Elucidating the molecular architecture of bacterial and cellular surfaces and its structural dynamics is essential to understanding mechanisms of pathogenesis, immune response, physicochemical interactions, environmental resistance, and provide the means for identifying spore formulation and processing attributes. I will discuss the application of in vitro atomic force microscopy (AFM) for studies of high-resolution coat architecture and assembly of several Bacillus spore species. We have demonstrated that bacterial spore coat structures are phylogenetically and growth medium determined. We have proposed that strikingly different species-dependent coat structures of bacterial spore species are a consequence of sporulation media-dependent nucleation and crystallization mechanisms that regulate the assembly of the outer spore coat. Spore coat layers were found to exhibit screw dislocations and two-dimensional nuclei typically observed on inorganic and macromolecular crystals. This presents the first case of non-mineral crystal growth patterns being revealed for a biological organism, which provides an unexpected example of nature exploiting fundamental materials science mechanisms for the morphogenetic control of biological ultrastructures. We have discovered and validated, distinctive formulation-specific high-resolution structural spore coat and dimensional signatures of B. anthracis spores (Sterne strain) grown in different formulation condition. We further demonstrated that measurement of the dimensional characteristics of B. anthracis spores provides formulation classification and sample matching with high sensitivity and specificity. I will present data on the development of an AFM-based immunolabeling technique for the proteomic mapping of macromolecular structures on the B. anthracis surfaces. These studies demonstrate that AFM can probe microbial surface architecture, environmental dynamics and the life cycle of bacterial and cellular systems at near

  8. [Development and comparative evaluation of up-converting phosphor technology based lateral flow assay for rapid detection of Yersinia pestis, Bacillus anthracis spore and Brucella spp].

    Science.gov (United States)

    Li, Chunfeng; Zhang, Pingping; Wang, Xiaoying; Liu, Xiao; Zhao, Yong; Sun, Chongyun; Wang, Chengbin; Yang, Ruifu; Zhou, Lei

    2015-01-01

    To develop an up-converting phosphor technology based lateral flow (UPT-LF) assay for rapid and quantitative detection of Yersinia pestis, Bacillus anthracis spore and Brucella spp.and make the comparison with BioThreat Alert (BTA) test strips (Tetracore Inc., USA). Using up-converting phosphor nano-particles (UCP-NPs) as the bio-marker, three double-antibody-sandwich model based UPT-LF strips including Plague-UPT-LF, Anthrax-UPT-LF, Brucella-UPT-LF were prepared and its sensitivity, accuracy, linearity and specificity were determined by detecting 10(10), 10(9), 10(8), 10(7), 10(6), 10(5) and 0 CFU/ml series of concentrations of Y.pestis, B.anthracis, Brucella standards and other 27 kinds of 10(9) CFU/ml series of contrations of bacteria strains.Furthermore, the speed, sensitivity and accuracy of bacteria standards and simulated sample detection were compared between UPT-LF and BTA system. The detection limit of Plague-UPT-LF, Anthrax-UPT-LF and Brucella-LF was 10(5) CFU/ml. The CV of series of bacteria concentrations was ≤ 15%, and the r between lg (T/C-cut-off) and lg (concentration) was 0.996,0.998 and 0.999 (F values were 1 647.57, 743.51 and 1 822.17. All the P values were Brucella-LF were excellent, while that of Anthrax-UPT-LF was a little bit regretful because of non-specific reaction with two isolates of B. subtilis and one B.cereus. On-site evaluation showed the detection time of UPT-LF for all Y.pestis, B.anthracis spore and Brucella spp.was 33, 36 and 37 min, while BTA was 115, 115 and 111 min, which revealed the higher detection speed and sensitivity of UPT-LF comparing with BTA. The negative rate of two methods for blank standard was both 5/5, the sensitivity of UPT-LF for Y.pestis,B.anthracis spore and Brucella spp. was all 10(5) CFU/ml, then BTA was 10(6), 10(6) and 10(5) CFU/ml, respectively. The detection rate of UPT-LF for all three bacteria analog positive samples was 16/16, while BTA for B.anthracis was 7/16 only. The good performance

  9. Production of cross-kingdom oxylipins by pathogenic fungi: An update on their role in development and pathogenicity.

    Science.gov (United States)

    Fischer, Gregory J; Keller, Nancy P

    2016-03-01

    Oxylipins are a class of molecules derived from the incorporation of oxygen into polyunsaturated fatty acid substrates through the action of oxygenases. While extensively investigated in the context of mammalian immune responses, over the last decade it has become apparent that oxylipins are a common means of communication among and between plants, animals, and fungi to control development and alter host-microbe interactions. In fungi, some oxylipins are derived nonenzymatically while others are produced by lipoxygenases, cyclooxygenases, and monooxygenases with homology to plant and human enzymes. Recent investigations of numerous plant and human fungal pathogens have revealed oxylipins to be involved in the establishment and progression of disease. This review highlights oxylipin production by pathogenic fungi and their role in fungal development and pathogen/host interactions.

  10. A Novel Spectroscopic Methodology for the Investigation of Individual Bacillus Spores

    National Research Council Canada - National Science Library

    Alexander, Troy A; Pellegrino, Paul; Gillespie, James B

    2005-01-01

    A methodology has been developed for the investigation of bacterial spores. Specifically, this method has been used to probe the spore coat composition of two different Bacillus stearothermophilus variants...

  11. Dothistroma septosporum: spore production and weather conditions

    Energy Technology Data Exchange (ETDEWEB)

    Dvorak, M.; Drapela, K.; Kankovsky, L.

    2012-11-01

    Dartmouth's septosporum, the causal agent of Dothistroma needle blight is a widespread fungus which infects more than 80 species of coniferous trees through the entire world. Spreading of the infection is strongly affected by climatic factors of each locality where it is recorded. We attempt to describe the concrete limiting climatic factors necessary for the releasing of conidia of D. septosporum and to find out the timing of its spore production within the year. For this purpose we used an automatic volumetric spore trap and an automatic meteorological station. We found that a minimum daily average temperature of 10 degree centigrade was necessary for any spore production, as well as a long period of high air humidity. The values obtained in the present study were a little bit higher than those previously published, which may arise questions about a possible changing trend of the behaviour in the development of the Dothistroma needle blight causal agent. We used autoregressive integrated moving average (ARIMA) models to predict the spore counts on the base of previous values of spore counts and dew point. For a locality from Hackerovka, the best ARIMA model was 1,0,0; and for a locality from Lanzhot, the best was 3,1,0. (Author) 19 refs.

  12. Spore formation and toxin production in Clostridium difficile biofilms.

    Directory of Open Access Journals (Sweden)

    Ekaterina G Semenyuk

    Full Text Available The ability to grow as a biofilm can facilitate survival of bacteria in the environment and promote infection. To better characterize biofilm formation in the pathogen Clostridium difficile, we established a colony biofilm culture method for this organism on a polycarbonate filter, and analyzed the matrix and the cells in biofilms from a variety of clinical isolates over several days of biofilm culture. We found that biofilms readily formed in all strains analyzed, and that spores were abundant within about 6 days. We also found that extracellular DNA (eDNA, polysaccharide and protein was readily detected in the matrix of all strains, including the major toxins A and/or B, in toxigenic strains. All the strains we analyzed formed spores. Apart from strains 630 and VPI10463, which sporulated in the biofilm at relatively low frequencies, the frequencies of biofilm sporulation varied between 46 and 65%, suggesting that variations in sporulation levels among strains is unlikely to be a major factor in variation in the severity of disease. Spores in biofilms also had reduced germination efficiency compared to spores obtained by a conventional sporulation protocol. Transmission electron microscopy revealed that in 3 day-old biofilms, the outermost structure of the spore is a lightly staining coat. However, after 6 days, material that resembles cell debris in the matrix surrounds the spore, and darkly staining granules are closely associated with the spores surface. In 14 day-old biofilms, relatively few spores are surrounded by the apparent cell debris, and the surface-associated granules are present at higher density at the coat surface. Finally, we showed that biofilm cells possess 100-fold greater resistance to the antibiotic metronidazole then do cells cultured in liquid media. Taken together, our data suggest that C. difficile cells and spores in biofilms have specialized properties that may facilitate infection.

  13. Spore formation and toxin production in Clostridium difficile biofilms.

    Science.gov (United States)

    Semenyuk, Ekaterina G; Laning, Michelle L; Foley, Jennifer; Johnston, Pehga F; Knight, Katherine L; Gerding, Dale N; Driks, Adam

    2014-01-01

    The ability to grow as a biofilm can facilitate survival of bacteria in the environment and promote infection. To better characterize biofilm formation in the pathogen Clostridium difficile, we established a colony biofilm culture method for this organism on a polycarbonate filter, and analyzed the matrix and the cells in biofilms from a variety of clinical isolates over several days of biofilm culture. We found that biofilms readily formed in all strains analyzed, and that spores were abundant within about 6 days. We also found that extracellular DNA (eDNA), polysaccharide and protein was readily detected in the matrix of all strains, including the major toxins A and/or B, in toxigenic strains. All the strains we analyzed formed spores. Apart from strains 630 and VPI10463, which sporulated in the biofilm at relatively low frequencies, the frequencies of biofilm sporulation varied between 46 and 65%, suggesting that variations in sporulation levels among strains is unlikely to be a major factor in variation in the severity of disease. Spores in biofilms also had reduced germination efficiency compared to spores obtained by a conventional sporulation protocol. Transmission electron microscopy revealed that in 3 day-old biofilms, the outermost structure of the spore is a lightly staining coat. However, after 6 days, material that resembles cell debris in the matrix surrounds the spore, and darkly staining granules are closely associated with the spores surface. In 14 day-old biofilms, relatively few spores are surrounded by the apparent cell debris, and the surface-associated granules are present at higher density at the coat surface. Finally, we showed that biofilm cells possess 100-fold greater resistance to the antibiotic metronidazole then do cells cultured in liquid media. Taken together, our data suggest that C. difficile cells and spores in biofilms have specialized properties that may facilitate infection.

  14. Surface Modified Long Period Fiber Grating Sensor for Rapid Detection of Aspergillus Niger Fungal Spores

    Science.gov (United States)

    Gambhir, Monika; Gupta, Shilpi; John, Priya; Mahakud, Ramakanta; Kumar, Jitendra; Prakash, Om

    2018-03-01

    We present development of a compact and label-free sensor based on the surface modification of copper vapor laser fabricated long period fiber gratings for detection of airborne Aspergillus niger (A. niger) fungal spores. Surface of sensors were functionalized with monoclonal glucose oxidases IgG1 for target-specific covalent binding. In process of functionalization and binding of 103 cfu/ml of pathogenic A. niger fungal spores, notable shorter wave transition in resonance wavelength from 1562.93 nm to 1555.97 nm, and significant reduction in peak loss from 61.72 dB to 57.48 dB were recorded. The implementation was cost effective and yielded instantaneous results.

  15. Intestinal Pathogenic Escherichia coli: Insights for Vaccine Development

    Directory of Open Access Journals (Sweden)

    Maricarmen Rojas-Lopez

    2018-03-01

    Full Text Available Diarrheal diseases are one of the major causes of mortality among children under five years old and intestinal pathogenic Escherichia coli (InPEC plays a role as one of the large causative groups of these infections worldwide. InPECs contribute significantly to the burden of intestinal diseases, which are a critical issue in low- and middle-income countries (Asia, Africa and Latin America. Intestinal pathotypes such as enteropathogenic E. coli (EPEC and enterotoxigenic E. coli (ETEC are mainly endemic in developing countries, while ETEC strains are the major cause of diarrhea in travelers to these countries. On the other hand, enterohemorrhagic E. coli (EHEC are the cause of large outbreaks around the world, mainly affecting developed countries and responsible for not only diarrheal disease but also severe clinical complications like hemorrhagic colitis and hemolytic uremic syndrome (HUS. Overall, the emergence of antibiotic resistant strains, the annual cost increase in the health care system, the high incidence of traveler diarrhea and the increased number of HUS episodes have raised the need for effective preventive treatments. Although the use of antibiotics is still important in treating such infections, non-antibiotic strategies are either a crucial option to limit the increase in antibiotic resistant strains or absolutely necessary for diseases such as those caused by EHEC infections, for which antibiotic therapies are not recommended. Among non-antibiotic therapies, vaccine development is a strategy of choice but, to date, there is no effective licensed vaccine against InPEC infections. For several years, there has been a sustained effort to identify efficacious vaccine candidates able to reduce the burden of diarrheal disease. The aim of this review is to summarize recent milestones and insights in vaccine development against InPECs.

  16. Comparative analysis of immune effects in mice model: Clonorchis sinensis cysteine protease generated from recombinant Escherichia coli and Bacillus subtilis spores.

    Science.gov (United States)

    Wu, Zhanshuai; Tang, Zeli; Shang, Mei; Zhao, Lu; Zhou, Lina; Kong, Xiangzhan; Lin, Zhipeng; Sun, Hengchang; Chen, Tingjin; Xu, Jin; Li, Xuerong; Huang, Yan; Yu, Xinbing

    2017-07-01

    Clonorchiasis remains a nonnegligible public health problem in endemic areas. Cysteine protease of Clonorchis sinensis (CsCP) plays indispensable roles in the parasitic physiology and pathology, and has been exploited as a promising drug and vaccine candidate. In recent years, development of spore-based vaccines against multiple pathogens has attracted many investigators' interest. In previous studies, the recombinant Escherichia coli (BL21) and Bacillus subtilis spores expressing CsCP have been successfully constructed, respectively. In this study, the immune effects of CsCP protein purified from recombinant BL21 (rCsCP) and B. subtilis spores presenting CsCP (B.s-CsCP) in Balb/c mice model were conducted with comparative analysis. Levels of specific IgG, IgG1 and IgG2a were significantly increased in sera from both rCsCP and B.s-CsCP intraperitoneally immunized mice. Additionally, recombinant spores expressing abundant fusion CsCP (0.03125 pg/spore) could strongly enhance the immunogenicity of CsCP with significantly higher levels of IgG and isotypes. Compared with rCsCP alone, intraperitoneal administration of mice with spores expressing CsCP achieved a better effect of fighting against C. sinensis infection by slowing down the process of fibrosis. Our results demonstrated that a combination of Th1/Th2 immune responses could be elicited by rCsCP, while spores displaying CsCP prominently induced Th1-biased specific immune responses, and the complex cytokine network maybe mediates protective immune responses against C. sinensis. This work further confirmed that the usage of B. subtilis spores displaying CsCP is an effective way to against C. sinensis.

  17. Influence of Cultivars and Seed Thermal Treatment on the Development of Fungal Pathogens in Carrot and Onion Plants

    Directory of Open Access Journals (Sweden)

    Martin Koudela

    2016-01-01

    Full Text Available Carrot and onion are vegetables representing an important segment of fresh market. They suffer from serious fungal diseases that can inflict great damage on crops, i.e. alternaria leaf blight, peronospora downy mildew, and botrytis neck rot. The resistance of selected carrot and onion cultivars important for the production of vegetables in the Czech Republic was tested by exposure to targeted infection by the above fungal pathogens. The exposure of eleven carrot cultivars to spores of Alternaria dauci showed that the most resistant and sensitive cultivars were Katrin, Cortina F1, Afalon F1 and Favorit, Tinga, Berlika F1, respectively. A targeted infection of onion cultivars with Botrytis aclada clustered them into three groups: Amfora F1, Bolero, Tosca, Triumf F1 (strong resistance, Avalon, Grenada (medium resistance, Alice, Karmen, Všetana (low resistance. Similar groups were distinguished also after the infection with Peronospora destructor: Avalon, Bolero, Tosca (strong resistance, Alice, Amfora F1, Grenada, Karmen, Triumf F1 (medium resistance,Všetana (low resistance. Hot water treatment of carrot seeds applied after the inoculation with A. dauci decreased the development of the infection 1.3-2.3-fold, whereas the protective effect observed with onion seeds against the infection by P. destructor and B. aclada was lower.

  18. Role of visible light-activated photocatalyst on the reduction of anthrax spore-induced mortality in mice.

    Directory of Open Access Journals (Sweden)

    Jyh-Hwa Kau

    Full Text Available BACKGROUND: Photocatalysis of titanium dioxide (TiO(2 substrates is primarily induced by ultraviolet light irradiation. Anion-doped TiO(2 substrates were shown to exhibit photocatalytic activities under visible-light illumination, relative environmentally-friendly materials. Their anti-spore activity against Bacillus anthracis, however, remains to be investigated. We evaluated these visible-light activated photocatalysts on the reduction of anthrax spore-induced pathogenesis. METHODOLOGY/PRINCIPAL FINDINGS: Standard plating method was used to determine the inactivation of anthrax spore by visible light-induced photocatalysis. Mouse models were further employed to investigate the suppressive effects of the photocatalysis on anthrax toxin- and spore-mediated mortality. We found that anti-spore activities of visible light illuminated nitrogen- or carbon-doped titania thin films significantly reduced viability of anthrax spores. Even though the spore-killing efficiency is only approximately 25%, our data indicate that spores from photocatalyzed groups but not untreated groups have a less survival rate after macrophage clearance. In addition, the photocatalysis could directly inactivate lethal toxin, the major virulence factor of B. anthracis. In agreement with these results, we found that the photocatalyzed spores have tenfold less potency to induce mortality in mice. These data suggest that the photocatalysis might injury the spores through inactivating spore components. CONCLUSION/SIGNIFICANCE: Photocatalysis induced injuries of the spores might be more important than direct killing of spores to reduce pathogenicity in the host.

  19. Development and Application of a New Method for Specific and Sensitive Enumeration of Spores of Nonproteolytic Clostridium botulinum Types B, E, and F in Foods and Food Materials ▿

    Science.gov (United States)

    Peck, Michael W.; Plowman, June; Aldus, Clare F.; Wyatt, Gary M.; Penaloza Izurieta, Walter; Stringer, Sandra C.; Barker, Gary C.

    2010-01-01

    The highly potent botulinum neurotoxins are responsible for botulism, a severe neuroparalytic disease. Strains of nonproteolytic Clostridium botulinum form neurotoxins of types B, E, and F and are the main hazard associated with minimally heated refrigerated foods. Recent developments in quantitative microbiological risk assessment (QMRA) and food safety objectives (FSO) have made food safety more quantitative and include, as inputs, probability distributions for the contamination of food materials and foods. A new method that combines a selective enrichment culture with multiplex PCR has been developed and validated to enumerate specifically the spores of nonproteolytic C. botulinum. Key features of this new method include the following: (i) it is specific for nonproteolytic C. botulinum (and does not detect proteolytic C. botulinum), (ii) the detection limit has been determined for each food tested (using carefully structured control samples), and (iii) a low detection limit has been achieved by the use of selective enrichment and large test samples. The method has been used to enumerate spores of nonproteolytic C. botulinum in 637 samples of 19 food materials included in pasta-based minimally heated refrigerated foods and in 7 complete foods. A total of 32 samples (5 egg pastas and 27 scallops) contained spores of nonproteolytic C. botulinum type B or F. The majority of samples contained <100 spores/kg, but one sample of scallops contained 444 spores/kg. Nonproteolytic C. botulinum type E was not detected. Importantly, for QMRA and FSO, the construction of probability distributions will enable the frequency of packs containing particular levels of contamination to be determined. PMID:20709854

  20. The Capricious Nature of Bacterial Pathogens: Phasevarions and Vaccine Development

    Directory of Open Access Journals (Sweden)

    Aimee Tan

    2016-12-01

    Full Text Available Infectious diseases are a leading cause of morbidity and mortality worldwide, and vaccines are one of the most successful and cost-effective tools for disease prevention. One of the key considerations for rational vaccine development is the selection of appropriate antigens. Antigens must induce a protective immune response, and this response should be directed to stably expressed antigens so the target microbe can always be recognized by the immune system. Antigens with variable expression, due to environmental signals or phase variation (i.e., high frequency, random switching of expression, are not ideal vaccine candidates because variable expression could lead to immune evasion. Phase variation is often mediated by the presence of highly mutagenic simple tandem DNA repeats, and genes containing such sequences can be easily identified, and their use discounted as vaccine antigens reconsidered. Recent research has identified phase variably expressed DNA methyltransferases that act as global epigenetic regulators. These phase variable regulons, known as phasevarions, are associated with altered virulence phenotypes and/or expression of vaccine candidates. As such, genes encoding candidate vaccine antigens that have no obvious mechanism of phase variation may be subject to indirect, epigenetic control as part of a phasevarion. Bioinformatic and experimental studies are required to elucidate the distribution and mechanism of action of these DNA methyltransferases, and most importantly, whether they mediate epigenetic regulation of potential and current vaccine candidates. This process is essential to define the stably expressed antigen target profile of bacterial pathogens and thereby facilitate efficient, rational selection of vaccine antigens.

  1. Macroalgal spore dysfunction: ocean acidification delays and weakens adhesion.

    Science.gov (United States)

    Guenther, Rebecca; Miklasz, Kevin; Carrington, Emily; Martone, Patrick T

    2018-04-01

    Early life stages of marine organisms are predicted to be vulnerable to ocean acidification. For macroalgae, reproduction and population persistence rely on spores to settle, adhere and continue the algal life cycle, yet the effect of ocean acidification on this critical life stage has been largely overlooked. We explicitly tested the biomechanical impact of reduced pH on early spore adhesion. We developed a shear flume to examine the effect of reduced pH on spore attachment time and strength in two intertidal rhodophyte macroalgae, one calcified (Corallina vancouveriensis) and one noncalcified (Polyostea robusta). Reduced pH delayed spore attachment of both species by 40%-52% and weakened attachment strength in C. vancouveriensis, causing spores to dislodge at lower flow-induced shear forces, but had no effect on the attachment strength of P. robusta. Results are consistent with our prediction that reduced pH disrupts proper curing and gel formation of spore adhesives (anionic polysaccharides and glycoproteins) via protonation and cation displacement, although experimental verification is needed. Our results demonstrate that ocean acidification negatively, and differentially, impacts spore adhesion in two macroalgae. If results hold in field conditions, reduced ocean pH has the potential to impact macroalgal communities via spore dysfunction, regardless of the physiological tolerance of mature thalli. © 2017 Phycological Society of America.

  2. Natural attenuation in a surface water channel and a coastal aquifer by monitoring presence and removal of indicator bacteria, pathogens and antibiotic resistance gene: model development

    Science.gov (United States)

    Masciopinto, Costantino; Visino, Fabrizio; Luprano, Maria Laura; Levantesi, Caterina; Tandoi, Valter

    2015-04-01

    The spreading of microbial contamination into the environment, represents a very relevant problem, which leads to an increasing health concern. For this reason, it is important to identify and characterize the extent of natural depuration in water environmental particularly for reducing the presence of faecal contamination indicator bacteria, pathogens and antibiotic resistance genes (ARG). In this study, the presence of the above reported microbial parameters was analyzed in a surface water channel and in a coastal aquifer in southern Italy (Ostuni) southern Italy, both affected by Ostuni municipal treatment plant effluents and by local run-off. Several samples were collected from surface water, flowing in channels, and from wells in our study area. In particular, the water samples were analyzed to detect 7 fecal contamination indicators (E. coli, total coliforms, Clostridium p. spores, somatic coliphages, Enterococci and heterotrophic bacteria), Salmonella spp and the presence of ARGs. The water samples were also tested for chemical constituents. Finally a mathematical model has been developed in order to simulate pathogen migration pathways in the fractured groundwater and corresponding possible mitigation of pathogens in pumping wells.

  3. Development of a Selective Medium for the Fungal Pathogen Fusarium graminearum Using Toxoflavin Produced by the Bacterial Pathogen Burkholderia glumae

    Directory of Open Access Journals (Sweden)

    Boknam Jung

    2013-12-01

    Full Text Available The ascomycete fungus Fusarium graminearum is a major causal agent for Fusarium head blight in cereals and produces mycotoxins such as trichothecenes and zearalenone. Isolation of the fungal strains from air or cereals can be hampered by various other airborne fungal pathogens and saprophytic fungi. In this study, we developed a selective medium specific to F. graminearum using toxoflavin produced by the bacterial pathogen Burkholderia glumae. F. graminearum was resistant to toxoflavin, while other fungi were sensitive to this toxin. Supplementing toxoflavin into medium enhanced the isolation of F. graminearum from rice grains by suppressing the growth of saprophytic fungal species. In addition, a medium with or without toxoflavin exposed to wheat fields for 1 h had 84% or 25%, respectively, of colonies identified as F. graminearum. This selection medium provides an efficient tool for isolating F. graminearum, and can be adopted by research groups working on genetics and disease forecasting.

  4. A Cumulative Spore Killing Approach: Synergistic Sporicidal Activity of Dilute Peracetic Acid and Ethanol at Low pH Against Clostridium difficile and Bacillus subtilis Spores.

    Science.gov (United States)

    Nerandzic, Michelle M; Sankar C, Thriveen; Setlow, Peter; Donskey, Curtis J

    2016-01-01

    Background.  Alcohol-based hand sanitizers are the primary method of hand hygiene in healthcare settings, but they lack activity against bacterial spores produced by pathogens such as Clostridium difficile and Bacillus anthracis. We previously demonstrated that acidification of ethanol induced rapid sporicidal activity, resulting in ethanol formulations with pH 1.5-2 that were as effective as soap and water washing in reducing levels of C difficile spores on hands. We hypothesized that the addition of dilute peracetic acid (PAA) to acidified ethanol would enhance sporicidal activity while allowing elevation of the pH to a level likely to be well tolerated on skin (ie, >3). Methods.  We tested the efficacy of acidified ethanol solutions alone or in combination with PAA against C difficile and Bacillus subtilis spores in vitro and against nontoxigenic C difficile spores on hands of volunteers. Results.  Acidification of ethanol induced rapid sporicidal activity against C difficile and to a lesser extent B subtilis. The addition of dilute PAA to acidified ethanol resulted in synergistic enhancement of sporicidal activity in a dose-dependent fashion in vitro. On hands, the addition of 1200-2000 ppm PAA enhanced the effectiveness of acidified ethanol formulations, resulting in formulations with pH >3 that were as effective as soap and water washing. Conclusions.  Acidification and the addition of dilute PAA induced rapid sporicidal activity in ethanol. Our findings suggest that it may be feasible to develop effective sporicidal ethanol formulations that are safe and tolerable on skin.

  5. Sensitizing Clostridium difficile Spores With Germinants on Skin and Environmental Surfaces Represents a New Strategy for Reducing Spores via Ambient Mechanisms

    Directory of Open Access Journals (Sweden)

    Michelle Marie Nerandzic

    2017-10-01

    Full Text Available Background: Clostridium difficile is a leading cause of healthcare-associated infections worldwide. Prevention of C. difficile transmission is challenging because spores are not killed by alcohol-based hand sanitizers or many commonly used disinfectants. One strategy to control spores is to induce germination, thereby rendering the spores more susceptible to benign disinfection measures and ambient stressors. Methods/Results: C. difficile spores germinated on skin after a single application of cholic acid-class bile salts and co-germinants; for 4 C. difficile strains, recovery of viable spores from skin was reduced by ~0.3 log10CFU to 2 log10CFU after 2 hours and ~1 log10CFU to >2.5 log 10CFU after 24 hours. The addition of taurocholic acid to 70% and 30% ethanol significantly enhanced reduction of viable spores on skin and on surfaces. Desiccation, and to a lesser extent the presence of oxygen, were identified as the stressors responsible for reductions of germinated spores on skin and surfaces. Additionally, germinated spores became susceptible to killing by pH 1.5 hydrochloric acid, suggesting that germinated spores that remain viable on skin and surfaces might be killed by gastric acid after ingestion. Antibiotic-treated mice did not become colonized after exposure to germinated spores, whereas 100% of mice became colonized after exposure to the same quantity of dormant spores. Conclusions: Germination could provide a new approach to reduce C. difficile spores on skin and in the environment and to render surviving spores less capable of causing infection. Our findings suggest that it may be feasible to develop alcohol-based hand sanitizers containing germinants that reduce spores on hands.

  6. A Spore Counting Method and Cell Culture Model for Chlorine Disinfection Studies of Encephalitozoon syn. Septata intestinalis

    OpenAIRE

    Wolk, D. M.; Johnson, C. H.; Rice, E. W.; Marshall, M. M.; Grahn, K. F.; Plummer, C. B.; Sterling, C. R.

    2000-01-01

    The microsporidia have recently been recognized as a group of pathogens that have potential for waterborne transmission; however, little is known about the effects of routine disinfection on microsporidian spore viability. In this study, in vitro growth of Encephalitozoon syn. Septata intestinalis, a microsporidium found in the human gut, was used as a model to assess the effect of chlorine on the infectivity and viability of microsporidian spores. Spore inoculum concentrations were determine...

  7. Strategy to inactivate Clostridium perfringens spores in meat products.

    Science.gov (United States)

    Akhtar, Saeed; Paredes-Sabja, Daniel; Torres, J Antonio; Sarker, Mahfuzur R

    2009-05-01

    The current study aimed to develop an inactivation strategy for Clostridium perfringens spores in meat through a combination of spore activation at low pressure (100-200 MPa, 7 min) and elevated temperature (80 degrees C, 10 min); spore germination at high temperatures (55, 60 or 65 degrees C); and inactivation of germinated spores with elevated temperatures (80 and 90 degrees C, 10 and 20 min) and high pressure (586 MPa, at 23 and 73 degrees C, 10 min). Low pressures (100-200 MPa) were insufficient to efficiently activate C. perfringens spores for germination. However, C. perfringens spores were efficiently activated with elevated temperature (80 degrees C, 10 min), and germinated at temperatures lethal for vegetative cells (>or= 55 degrees C) when incubated for 60 min with a mixture of L-asparagine and KCl (AK) in phosphate buffer (pH 7) and in poultry meat. Inactivation of spores (approximately 4 decimal reduction) in meat by elevated temperatures (80-90 degrees C for 20 min) required a long germination period (55 degrees C for 60 min). However, similar inactivation level was reached with shorter germination period (55 degrees C for 15 min) when spore contaminated-meat was treated with pressure-assisted thermal processing (568 MPa, 73 degrees C, 10 min). Therefore, the most efficient strategy to inactivate C. perfringens spores in poultry meat containing 50 mM AK consisted: (i) a primary heat treatment (80 degrees C, 10 min) to pasteurize and denature the meat proteins and to activate C. perfringens spores for germination; (ii) cooling of the product to 55 degrees C in about 20 min and further incubation at 55 degrees C for about 15 min for spore germination; and (iii) inactivation of germinated spores by pressure-assisted thermal processing (586 MPa at 73 degrees C for 10 min). Collectively, this study demonstrates the feasibility of an alternative and novel strategy to inactivate C. perfringens spores in meat products formulated with germinants specific for C

  8. Dynamic phase microscopy, a new method to detect viable and killed spores and to estimate the heterogeneity of spore populations

    Science.gov (United States)

    Tychinsky, Vladimir P.; Mulyukin, Andrey L.; Lisovskii, Vitalii V.; Nikolaev, Yury A.; Kretushev, Aleksander V.; Vyshenskaya, Tatyana V.; Suzina, Nataliya E.; Duda, Vitalii I.; El-Registan, Galina I.

    reversible: after cessation of heating, PT values became similar to dormant spores. So, DPM allowed us to track the first, reversible stage of activation, when a spore maintains the attributes of the dormant state. Under the conditions that favor germination (in the presence of nutrients), irreversible changes in the PT and spore diameter, d, were detectable in a single germinating spore and spore population. In addition, DPM allowed an easy estimation of the heterogeneity of spore populations. It is a great advantage of DPM that it makes possible to reveal the ability of spores to respond to various stimuli with or without further germination and outgrowth - the salient feature of a living cell. DPM may have a high potential in general microbiology and astrobiology, enabling to: (1) estimate the heterogeneity of spore populations either under standard conditions and subjected to solar radiation and simulated extraterrestrial factors; (2) to track a response of spores to changing conditions at the early germination stage, even if they do not enter further outgrowth; (3) to develop some approaches for monitoring studies and appraisal of the physiological state of dormant cells in situ, in samples of dry soils, permafrost, etc. regarded as models for searching life beyond the Earth.

  9. Spore Coat Architecture of Clostridium novyi-NT spores

    Energy Technology Data Exchange (ETDEWEB)

    Plomp, M; McCafferey, J; Cheong, I; Huang, X; Bettegowda, C; Kinzler, K; Zhou, S; Vogelstein, B; Malkin, A

    2007-05-07

    Spores of the anaerobic bacterium Clostridium novyi-NT are able to germinate in and destroy hypoxic regions of tumors in experimental animals. Future progress in this area will benefit from a better understanding of the germination and outgrowth processes that are essential for the tumorilytic properties of these spores. Towards this end, we have used both transmission electron microscopy and atomic force microscopy to determine the structure of dormant as well as germinating spores. We found that the spores are surrounded by an amorphous layer intertwined with honeycomb parasporal layers. Moreover, the spore coat layers had apparently self-assembled and this assembly was likely to be governed by crystal growth principles. During germination and outgrowth, the honeycomb layers as well as the underlying spore coat and undercoat layers sequentially dissolved until the vegetative cell was released. In addition to their implications for understanding the biology of C. novyi-NT, these studies document the presence of proteinaceous growth spirals in a biological organism.

  10. Optical and structural properties of plasma-treated Cordyceps bassiana spores as studied by circular dichroism, absorption, and fluorescence spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Geon Joon, E-mail: gjlee@kw.ac.kr; Sim, Geon Bo; Choi, Eun Ha [Plasma Bioscience Research Center/Department of Electrical and Biological Physics, Kwangwoon University, Seoul 139-701 (Korea, Republic of); Kwon, Young-Wan [KU-KIST Graduate School of Converging Science and Technology, Korea University, Seoul 136-701 (Korea, Republic of); Kim, Jun Young; Jang, Siun; Kim, Seong Hwan, E-mail: piceae@naver.com [Department of Microbiology and Institute of Basic Sciences, Dankook University, Cheonan 330-714 (Korea, Republic of)

    2015-01-14

    To understand the killing mechanism of fungal spores by plasma treatment, the optical, structural, and biological properties of the insect pathogenic fungus Cordyceps bassiana spores were studied. A nonthermal atmospheric-pressure plasma jet (APPJ) was used to treat the spores in aqueous solution. Optical emission spectra of the APPJ acquired in air indicated emission peaks corresponding to hydroxyl radicals and atomic oxygen. When the APPJ entered the aqueous solution, additional reactive species were derived from the interaction of plasma radicals with the aqueous solution. Fluorescence and absorption spectroscopy confirmed the generation of hydroxyl radicals and hydrogen peroxide in the plasma-activated water (PAW). Spore counting showed that plasma treatment significantly reduced spore viability. Absorption spectroscopy, circular dichroism (CD) spectroscopy, and agarose gel electrophoresis of the DNA extracted from plasma-treated spores showed a reduction in spore DNA content. The magnitude of the dip in the CD spectrum was lower in the plasma-treated spores than in the control, indicating that plasma treatment causes structural modifications and/or damage to cellular components. Tryptophan fluorescence intensity was lower in the plasma-treated spores than in the control, suggesting that plasma treatment modified cell wall proteins. Changes in spore viability and DNA content were attributed to structural modification of the cell wall by reactive species coming from the APPJ and the PAW. Our results provided evidence that the plasma radicals and the derived reactive species play critical roles in fungal spore inactivation.

  11. CONTROL OF POSTHARVEST TOMATO ROT BY SPORE SUSPENSION AND ANTIFUNGAL METABOLITES OF TRICHODERMA HARZIANUM

    Directory of Open Access Journals (Sweden)

    Momein H. El-Katatny

    2012-06-01

    Full Text Available Rot of cherry tomato (Lycopersicon esculentum fruits caused by several fungal pathogens is a detrimental disease leading to substantial yield loses worldwide. Alternaria isolates were the most common fungal species isolated from healthy or rotten fruits. Trichoderma harzianum spore suspension and culture filtrate were tested for their antagonistic activity on controlling tomato fruit rot. T. harzianum isolates suppressed or interfered with the growth of different postharvest tomato fungal pathogens albeit at different degrees. Their culture filtrate inhibited pathogen spore germination possibly due to the released extracellular diffusible metabolite(s. Besides, aberrant morphology of conidia was observed with deformation of hyphal tips. Furthermore, the resulting mycelia appeared desiccated with coagulated protoplasm leading to complete collapse of protoplasm in presence of T. harzianum culture filtrate. Application of T. harzianum spores to tomato fruits decreased disease severity significantly with the most profound effect at higher spore concentrations (108 cells per ml. Similarly, culture filtrate of T. harzianum prevented pathogen spore germination on the surface of tomato fruits leading to decreased incidence of rot symptoms at high culture filtrate concentrations. This work provides strong evidence that T. harzianum is a competent antagonist and its spore suspension and culture filtrate can be used efficiently to control postharvest tomato rot.

  12. The search and identification of the new immunodiagnostic targets of bacillus anthracis spore

    International Nuclear Information System (INIS)

    Biketov, S.; Dunaytsev, I.; Baranova, E.; Marinin, L.; Dyatlov, I.

    2009-01-01

    Spores of Bacillus anthracis have been used as bio warfare agent to bio terrorize purposes. As efficiency of anti-epidemic measures included urgent prevention and treatment is determined by terms within which the bio agent is identified. Direct and rapid spore detection by antibodies based detection system is very attractive alternative to current PCR-based assays or routine phenotyping which are the most accurate but are also complex, time-consumption and expensive. The main difficulty with respect to such kind of anthrax spores detection is a cross-reaction with spores of closely related bacteria. For development of species-specific antibodies to anthrax spores recombinant scFvs or hybridoma technique were used. In both case surface spore antigens contained species-specific epitopes are need. Among exosporium proteins only ExsF(BxpB), ExsK and SoaA are specific to B.cereus group. On the surface of B. anthracis spores, a unique tetrasaccharides containing an novel monosaccharide - anthrose, was discovered. It was shown that anthrose can be serving as species-specific target for B. anthracis spores detection. We have revealed that EA1 isolated from spore of Russians strain STI-1 contain carbohydrate which formed species-specific epitopes and determine immunogenicity of this antigen. Antibodies to this antigen specifically recognized the surface target of B. anthracis spores and do not reacted with others Bacillus spore. Based on these antibodies we developed the test-systems in different formats for rapid direct detection and identification of B. anthracis spores. The results of trial these test-systems with using more than 50 different Bacillus strains were indicated that carbohydrate of EA1 isolated from spore is effective immunodiagnostic target for anthrax spores bio detection.(author)

  13. Cell cycle and cell death are not necessary for appressorium formation and plant infection in the fungal plant pathogen Colletotrichum gloeosporioides

    Directory of Open Access Journals (Sweden)

    Barhoom Sima

    2008-02-01

    Full Text Available Abstract Background In order to initiate plant infection, fungal spores must germinate and penetrate into the host plant. Many fungal species differentiate specialized infection structures called appressoria on the host surface, which are essential for successful pathogenic development. In the model plant pathogen Magnaporthe grisea completion of mitosis and autophagy cell death of the spore are necessary for appressoria-mediated plant infection; blocking of mitosis prevents appressoria formation, and prevention of autophagy cell death results in non-functional appressoria. Results We found that in the closely related plant pathogen Colletotrichum gloeosporioides, blocking of the cell cycle did not prevent spore germination and appressoria formation. The cell cycle always lagged behind the morphogenetic changes that follow spore germination, including germ tube and appressorium formation, differentiation of the penetrating hypha, and in planta formation of primary hyphae. Nuclear division was arrested following appressorium formation and was resumed in mature appressoria after plant penetration. Unlike in M. grisea, blocking of mitosis had only a marginal effect on appressoria formation; development in hydroxyurea-treated spores continued only for a limited number of cell divisions, but normal numbers of fully developed mature appressoria were formed under conditions that support appressoria formation. Similar results were also observed in other Colletotrichum species. Spores, germ tubes, and appressoria retained intact nuclei and remained viable for several days post plant infection. Conclusion We showed that in C. gloeosporioides the differentiation of infection structures including appressoria precedes mitosis and can occur without nuclear division. This phenomenon was also found to be common in other Colletotrichum species. Spore cell death did not occur during plant infection and the fungus primary infection structures remained viable

  14. Development and amplification of multiple co-dominant genetic markers from single spores of arbuscular mycorrhizal fungi by nested multiplex PCR

    DEFF Research Database (Denmark)

    Holtgrewe-Stukenbrock, Eva; Rosendahl, Søren

    2005-01-01

    Multiple co-dominant genetic markers from single spores of the arbuscular mycorrhizal (AM) fungi Glomus mosseae, Glomus caledonium, and Glomus geosporum were amplified by nested multiplex PCR using a combination of primers for simultaneous amplification of five loci in one PCR. Subsequently, each...... marker was amplified separately in nested PCR using specific primers. Polymorphic loci within the three putative single copy genes GmFOX2, GmTOR2, and GmGIN1 were characterized by sequencing and single strand conformation polymorphisms (SSCP). Primers specific for the LSU rDNA D2 region were included...... are homokaryotic. All isolates of G. mosseae had unique genotypes. The amplification of multiple co-dominant genetic markers from single spores by the nested multiplex PCR approach provides an important tool for future studies of AM fungi population genetics and evolution....

  15. Pollen and spore monitoring in the world.

    Science.gov (United States)

    Buters, J T M; Antunes, C; Galveias, A; Bergmann, K C; Thibaudon, M; Galán, C; Schmidt-Weber, C; Oteros, J

    2018-01-01

    Ambient air quality monitoring is a governmental duty that is widely carried out in order to detect non-biological ("chemical") components in ambient air, such as particles of monitoring networks are publicly funded and air quality data are open to the public. The situation for biological particles that have detrimental effects on health, as is the case of pollen and fungal spores, is however very different. Most pollen and spore monitoring networks are not publicly funded and data are not freely available. The information regarding which biological particle is being monitored, where and by whom, is consequently often not known, even by aerobiologists themselves. This is a considerable problem, as local pollen data are an important tool for the prevention of allergic symptoms. The aim of this study was to review pollen monitoring stations throughout the world and to create an interactive visualization of their distribution. The method employed to collect information was based on: (a) a review of the recent and historical bibliography related to pollen and fungal spore monitoring, and (b) personal surveys of the managers of national and regional monitoring networks. The interactive application was developed using the R programming language. We have created an inventory of the active pollen and spore monitoring stations in the world. There are at least 879 active pollen monitoring stations in the world, most of which are in Europe (> 500). The prevalent monitoring method is based on the Hirst principle (> 600 stations). The inventory is visualised as an interactive and on-line map. It can be searched, its appearance can be adjusted to the users' needs and it is updated regularly, as new stations or changes to those that already exist can be submitted online. The map shows the current situation of pollen and spore monitoring and facilitates collaboration among those individuals who are interested in pollen and spore counts. It might also help to improve the

  16. Nanoscale Structural and Mechanical Analysis of Bacillus anthracis Spores Inactivated with Rapid Dry Heating

    Science.gov (United States)

    Felker, Daniel L.; Burggraf, Larry W.

    2014-01-01

    Effective killing of Bacillus anthracis spores is of paramount importance to antibioterrorism, food safety, environmental protection, and the medical device industry. Thus, a deeper understanding of the mechanisms of spore resistance and inactivation is highly desired for developing new strategies or improving the known methods for spore destruction. Previous studies have shown that spore inactivation mechanisms differ considerably depending upon the killing agents, such as heat (wet heat, dry heat), UV, ionizing radiation, and chemicals. It is believed that wet heat kills spores by inactivating critical enzymes, while dry heat kills spores by damaging their DNA. Many studies have focused on the biochemical aspects of spore inactivation by dry heat; few have investigated structural damages and changes in spore mechanical properties. In this study, we have inactivated Bacillus anthracis spores with rapid dry heating and performed nanoscale topographical and mechanical analysis of inactivated spores using atomic force microscopy (AFM). Our results revealed significant changes in spore morphology and nanomechanical properties after heat inactivation. In addition, we also found that these changes were different under different heating conditions that produced similar inactivation probabilities (high temperature for short exposure time versus low temperature for long exposure time). We attributed the differences to the differential thermal and mechanical stresses in the spore. The buildup of internal thermal and mechanical stresses may become prominent only in ultrafast, high-temperature heat inactivation when the experimental timescale is too short for heat-generated vapor to efficiently escape from the spore. Our results thus provide direct, visual evidences of the importance of thermal stresses and heat and mass transfer to spore inactivation by very rapid dry heating. PMID:24375142

  17. Handling technique of spore-forming bacteria in radiation sterilization. 1. Preparation of spores

    International Nuclear Information System (INIS)

    Koshikawa, Tomihiko

    1994-01-01

    This paper deals with a handling technique of spore-forming bacteria in radiation sterilization. An explanation is given under three sections: (1) life cycle of spore-forming bacteria, medium to form bacterial spores, and colony and purification methods of bacterial spores; (2) methods for measuring the number of bacterial spores and resistance against gamma radiation (D values); and (3) a test method for identifying spore-forming bacteria and a simple identification method. (N.K.)

  18. The Pathogen-Host Interactions database (PHI-base): additions and future developments.

    Science.gov (United States)

    Urban, Martin; Pant, Rashmi; Raghunath, Arathi; Irvine, Alistair G; Pedro, Helder; Hammond-Kosack, Kim E

    2015-01-01

    Rapidly evolving pathogens cause a diverse array of diseases and epidemics that threaten crop yield, food security as well as human, animal and ecosystem health. To combat infection greater comparative knowledge is required on the pathogenic process in multiple species. The Pathogen-Host Interactions database (PHI-base) catalogues experimentally verified pathogenicity, virulence and effector genes from bacterial, fungal and protist pathogens. Mutant phenotypes are associated with gene information. The included pathogens infect a wide range of hosts including humans, animals, plants, insects, fish and other fungi. The current version, PHI-base 3.6, available at http://www.phi-base.org, stores information on 2875 genes, 4102 interactions, 110 host species, 160 pathogenic species (103 plant, 3 fungal and 54 animal infecting species) and 181 diseases drawn from 1243 references. Phenotypic and gene function information has been obtained by manual curation of the peer-reviewed literature. A controlled vocabulary consisting of nine high-level phenotype terms permits comparisons and data analysis across the taxonomic space. PHI-base phenotypes were mapped via their associated gene information to reference genomes available in Ensembl Genomes. Virulence genes and hotspots can be visualized directly in genome browsers. Future plans for PHI-base include development of tools facilitating community-led curation and inclusion of the corresponding host target(s). © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. A Clostridium difficile alanine racemase affects spore germination and accommodates serine as a substrate.

    Science.gov (United States)

    Shrestha, Ritu; Lockless, Steve W; Sorg, Joseph A

    2017-06-23

    Clostridium difficile has become one of the most common bacterial pathogens in hospital-acquired infections in the United States. Although C. difficile is strictly anaerobic, it survives in aerobic environments and transmits between hosts via spores. C. difficile spore germination is triggered in response to certain bile acids and glycine. Although glycine is the most effective co-germinant, other amino acids can substitute with varying efficiencies. Of these, l-alanine is an effective co-germinant and is also a germinant for most bacterial spores. Many endospore-forming bacteria embed alanine racemases into their spore coats, and these enzymes are thought to convert the l-alanine germinant into d-alanine, a spore germination inhibitor. Although the C. difficile Alr2 racemase is the sixth most highly expressed gene during C. difficile spore formation, a previous study reported that Alr2 has little to no role in germination of C. difficile spores in rich medium. Here, we hypothesized that Alr2 could affect C. difficile l-alanine-induced spore germination in a defined medium. We found that alr2 mutant spores more readily germinate in response to l-alanine as a co-germinant. Surprisingly, d-alanine also functioned as a co-germinant. Moreover, we found that Alr2 could interconvert l- and d-serine and that Alr2 bound to l- and d-serine with ∼2-fold weaker affinity to that of l- and d-alanine. Finally, we demonstrate that l- and d-serine are also co-germinants for C. difficile spores. These results suggest that C. difficile spores can respond to a diverse set of amino acid co-germinants and reveal that Alr2 can accommodate serine as a substrate. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. A Generic Method for Fungal Spore Detection: The use of a monoclonal antibody and surface plasmon resonance

    DEFF Research Database (Denmark)

    Skottrup, Peter; Hearty, Stephen; Frøkiær, Hanne

    causing wheat yellow rust. We have developed mabs towards intact whole spores and used a subtractive inhibition format for detection of spores in solution. The antibody was incubated with different spore concentrations and the remaining free antibody was quantified using a BIAcore® 3000 sensor. Decreasing...

  1. Architecture and assembly of the Bacillus subtilis spore coat.

    Science.gov (United States)

    Plomp, Marco; Carroll, Alicia Monroe; Setlow, Peter; Malkin, Alexander J

    2014-01-01

    Bacillus spores are encased in a multilayer, proteinaceous self-assembled coat structure that assists in protecting the bacterial genome from stresses and consists of at least 70 proteins. The elucidation of Bacillus spore coat assembly, architecture, and function is critical to determining mechanisms of spore pathogenesis, environmental resistance, immune response, and physicochemical properties. Recently, genetic, biochemical and microscopy methods have provided new insight into spore coat architecture, assembly, structure and function. However, detailed spore coat architecture and assembly, comprehensive understanding of the proteomic composition of coat layers, and specific roles of coat proteins in coat assembly and their precise localization within the coat remain in question. In this study, atomic force microscopy was used to probe the coat structure of Bacillus subtilis wild type and cotA, cotB, safA, cotH, cotO, cotE, gerE, and cotE gerE spores. This approach provided high-resolution visualization of the various spore coat structures, new insight into the function of specific coat proteins, and enabled the development of a detailed model of spore coat architecture. This model is consistent with a recently reported four-layer coat assembly and further adds several coat layers not reported previously. The coat is organized starting from the outside into an outermost amorphous (crust) layer, a rodlet layer, a honeycomb layer, a fibrous layer, a layer of "nanodot" particles, a multilayer assembly, and finally the undercoat/basement layer. We propose that the assembly of the previously unreported fibrous layer, which we link to the darkly stained outer coat seen by electron microscopy, and the nanodot layer are cotH- and cotE- dependent and cotE-specific respectively. We further propose that the inner coat multilayer structure is crystalline with its apparent two-dimensional (2D) nuclei being the first example of a non-mineral 2D nucleation crystallization

  2. Architecture and Assembly of the Bacillus subtilis Spore Coat

    Science.gov (United States)

    Plomp, Marco; Carroll, Alicia Monroe; Setlow, Peter; Malkin, Alexander J.

    2014-01-01

    Bacillus spores are encased in a multilayer, proteinaceous self-assembled coat structure that assists in protecting the bacterial genome from stresses and consists of at least 70 proteins. The elucidation of Bacillus spore coat assembly, architecture, and function is critical to determining mechanisms of spore pathogenesis, environmental resistance, immune response, and physicochemical properties. Recently, genetic, biochemical and microscopy methods have provided new insight into spore coat architecture, assembly, structure and function. However, detailed spore coat architecture and assembly, comprehensive understanding of the proteomic composition of coat layers, and specific roles of coat proteins in coat assembly and their precise localization within the coat remain in question. In this study, atomic force microscopy was used to probe the coat structure of Bacillus subtilis wild type and cotA, cotB, safA, cotH, cotO, cotE, gerE, and cotE gerE spores. This approach provided high-resolution visualization of the various spore coat structures, new insight into the function of specific coat proteins, and enabled the development of a detailed model of spore coat architecture. This model is consistent with a recently reported four-layer coat assembly and further adds several coat layers not reported previously. The coat is organized starting from the outside into an outermost amorphous (crust) layer, a rodlet layer, a honeycomb layer, a fibrous layer, a layer of “nanodot” particles, a multilayer assembly, and finally the undercoat/basement layer. We propose that the assembly of the previously unreported fibrous layer, which we link to the darkly stained outer coat seen by electron microscopy, and the nanodot layer are cotH- and cotE- dependent and cotE-specific respectively. We further propose that the inner coat multilayer structure is crystalline with its apparent two-dimensional (2D) nuclei being the first example of a non-mineral 2D nucleation crystallization

  3. Quantification of Nonproteolytic Clostridium botulinum Spore Loads in Food Materials.

    Science.gov (United States)

    Barker, Gary C; Malakar, Pradeep K; Plowman, June; Peck, Michael W

    2016-01-04

    We have produced data and developed analysis to build representations for the concentration of spores of nonproteolytic Clostridium botulinum in materials that are used during the manufacture of minimally processed chilled foods in the United Kingdom. Food materials are categorized into homogenous groups which include meat, fish, shellfish, cereals, fresh plant material, dairy liquid, dairy nonliquid, mushroom and fungi, and dried herbs and spices. Models are constructed in a Bayesian framework and represent a combination of information from a literature survey of spore loads from positive-control experiments that establish a detection limit and from dedicated microbiological tests for real food materials. The detection of nonproteolytic C. botulinum employed an optimized protocol that combines selective enrichment culture with multiplex PCR, and the majority of tests on food materials were negative. Posterior beliefs about spore loads center on a concentration range of 1 to 10 spores kg(-1). Posterior beliefs for larger spore loads were most significant for dried herbs and spices and were most sensitive to the detailed results from control experiments. Probability distributions for spore loads are represented in a convenient form that can be used for numerical analysis and risk assessments. Copyright © 2016 Barker et al.

  4. Necrotrophic pathogens use the salicylic acid signaling pathway to promote disease development in tomato.

    Science.gov (United States)

    Rahman, Taha Abd El; Oirdi, Mohamed El; Gonzalez-Lamothe, Rocio; Bouarab, Kamal

    2012-12-01

    Plants use different immune pathways to combat pathogens. The activation of the jasmonic acid (JA)-signaling pathway is required for resistance against necrotrophic pathogens; however, to combat biotrophic pathogens, the plants activate mainly the salicylic acid (SA)-signaling pathway. SA can antagonize JA signaling and vice versa. NPR1 (noninducible pathogenesis-related 1) is considered a master regulator of SA signaling. NPR1 interacts with TGA transcription factors, ultimately leading to the activation of SA-dependent responses. SA has been shown to promote disease development caused by the necrotrophic pathogen Botrytis cinerea through NPR1, by suppressing the expression of two JA-dependent defense genes, proteinase inhibitors I and II. We show here that the transcription factor TGA1.a contributes to disease development caused by B. cinerea in tomato by suppressing the expression of proteinase inhibitors I and II. Finally, we present evidence that the SA-signaling pathway contributes to disease development caused by another necrotrophic pathogen, Alternaria solani, in tomato. Disease development promoted by SA through NPR1 requires the TGA1.a transcription factor. These data highlight how necrotrophs manipulate the SAsignaling pathway to promote their disease in tomato.

  5. Calcineurin orchestrates dimorphic transitions, antifungal drug responses and host-pathogen interactions of the pathogenic mucoralean fungus Mucor circinelloides.

    Science.gov (United States)

    Lee, Soo Chan; Li, Alicia; Calo, Silvia; Inoue, Makoto; Tonthat, Nam K; Bain, Judith M; Louw, Johanna; Shinohara, Mari L; Erwig, Lars P; Schumacher, Maria A; Ko, Dennis C; Heitman, Joseph

    2015-09-01

    Calcineurin plays essential roles in virulence and growth of pathogenic fungi and is a target of the natural products FK506 and Cyclosporine A. In the pathogenic mucoralean fungus Mucor circinelloides, calcineurin mutation or inhibition confers a yeast-locked phenotype indicating that calcineurin governs the dimorphic transition. Genetic analysis in this study reveals that two calcineurin A catalytic subunits (out of three) are functionally diverged. Homology modeling illustrates modes of resistance resulting from amino substitutions in the interface between each calcineurin subunit and the inhibitory drugs. In addition, we show how the dimorphic transition orchestrated by calcineurin programs different outcomes during host-pathogen interactions. For example, when macrophages phagocytose Mucor yeast, subsequent phagosomal maturation occurs, indicating host cells respond appropriately to control the pathogen. On the other hand, upon phagocytosis of spores, macrophages fail to form mature phagosomes. Cytokine production from immune cells differs following exposure to yeast versus spores (which germinate into hyphae). Thus, the morphogenic transition can be targeted as an efficient treatment option against Mucor infection. In addition, genetic analysis (including gene disruption and mutational studies) further strengthens the understanding of calcineurin and provides a foundation to develop antifungal agents targeting calcineurin to deploy against Mucor and other pathogenic fungi. © 2015 John Wiley & Sons Ltd.

  6. Fighting Ebola with novel spore decontamination technologies for the military.

    Science.gov (United States)

    Doona, Christopher J; Feeherry, Florence E; Kustin, Kenneth; Olinger, Gene G; Setlow, Peter; Malkin, Alexander J; Leighton, Terrance

    2015-01-01

    Recently, global public health organizations such as Doctors without Borders (MSF), the World Health Organization (WHO), Public Health Canada, National Institutes of Health (NIH), and the U.S. government developed and deployed Field Decontamination Kits (FDKs), a novel, lightweight, compact, reusable decontamination technology to sterilize Ebola-contaminated medical devices at remote clinical sites lacking infra-structure in crisis-stricken regions of West Africa (medical waste materials are placed in bags and burned). The basis for effectuating sterilization with FDKs is chlorine dioxide (ClO2) produced from a patented invention developed by researchers at the US Army Natick Soldier RD&E Center (NSRDEC) and commercialized as a dry mixed-chemical for bacterial spore decontamination. In fact, the NSRDEC research scientists developed an ensemble of ClO2 technologies designed for different applications in decontaminating fresh produce; food contact and handling surfaces; personal protective equipment; textiles used in clothing, uniforms, tents, and shelters; graywater recycling; airplanes; surgical instruments; and hard surfaces in latrines, laundries, and deployable medical facilities. These examples demonstrate the far-reaching impact, adaptability, and versatility of these innovative technologies. We present herein the unique attributes of NSRDEC's novel decontamination technologies and a Case Study of the development of FDKs that were deployed in West Africa by international public health organizations to sterilize Ebola-contaminated medical equipment. FDKs use bacterial spores as indicators of sterility. We review the properties and structures of spores and the mechanisms of bacterial spore inactivation by ClO2. We also review mechanisms of bacterial spore inactivation by novel, emerging, and established non-thermal technologies for food preservation, such as high pressure processing, irradiation, cold plasma, and chemical sanitizers, using an array of Bacillus

  7. Generation of Reactive Oxygen Species via NOXa Is Important for Development and Pathogenicity of Mycosphaerella graminicola.

    Science.gov (United States)

    Choi, Yoon-E; Lee, Changsu; Goodwin, Stephen B

    2016-03-01

    The ascomycete fungus Mycosphaerella graminicola (synonym Zymoseptoria tritici) is an important pathogen of wheat causing economically significant losses. The primary nutritional mode of this fungus is thought to be hemibiotrophic. This pathogenic lifestyle is associated with an early biotrophic stage of nutrient uptake followed by a necrotrophic stage aided possibly by production of a toxin or reactive oxygen species (ROS). In many other fungi, the genes CREA and AREA are important during the biotrophic stage of infection, while the NOXa gene product is important during necrotrophic growth. To test the hypothesis that these genes are important for pathogenicity of M. graminicola, we employed an over-expression strategy for the selected target genes CREA, AREA, and NOXa, which might function as regulators of nutrient acquisition or ROS generation. Increased expressions of CREA, AREA, and NOXa in M. graminicola were confirmed via quantitative real-time PCR and strains were subsequently assayed for pathogenicity. Among them, the NOXa over-expression strain, NO2, resulted in significantly increased virulence. Moreover, instead of the usual filamentous growth, we observed a predominance of yeast-like growth of NO2 which was correlated with ROS production. Our data indicate that ROS generation via NOXa is important to pathogenicity as well as development in M. graminicola.

  8. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY THE EMERGING PATHOGEN HEPATITIS E IN WATER SAMPLES

    Science.gov (United States)

    Hepatitis E virus (HEV) is an emerging pathogen that causes significant illness in the developing world. Like the hepatitis A virus, it is transmitted via the fecal-oral route and can cause short-term, acute hepatitis. In addition, hepatitis E has been found to cause a signific...

  9. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY THE MERGING PATHOGEN HEPATITIS E IN WATER SAMPLES

    Science.gov (United States)

    Hepatitis E virus (HEV) is an emerging pathogen that causes significant illness in the developing world. Like the hepatitis A virus, it is transmitted via the fecal-oral route and can cause short-term, acute hepatitis. In addition, hepatitis E has been found to cause a signific...

  10. Development of pathogen risk assessment models for the evaluation of sludge management alternatives

    International Nuclear Information System (INIS)

    Yeager, J.G.; Sheridan, R.E.; Ward, R.L.

    1979-01-01

    The constraints imposed on sewage treatment and disposal by clean air and water legislation make it clear that, in the near future, there will be increasing amounts of sewage sludge and fewer alternatives for its disposal. Additionally, this legislation has encouraged the use of waste management procedures which emphasize the recycling of waste materials. Decisions regarding optimal methods of sludge handling will primarily be controlled by economic considerations including the intrinsic value of the sludge, the cost of transporting sludge and sludge products, and the degree of treatment necessary to make the sludge suitable for particular applications. One principal reason to treat sludge is to inactivate pathogens. However, the actual health risks posed by pathogenic species that result from different methods of sludge utilization and how these risks are affected by different treatment processes are poorly understood. Therefore, computerized models are being developed to describe pathogen transport through environmental pathways and to help predict the risk of certain sludge utilization practices

  11. A novel method for standardized application of fungal spore coatings for mosquito exposure bioassays.

    Science.gov (United States)

    Farenhorst, Marit; Knols, Bart G J

    2010-01-20

    Interest in the use of fungal entomopathogens against malaria vectors is growing. Fungal spores infect insects via the cuticle and can be applied directly on the insect to evaluate infectivity. For flying insects such as mosquitoes, however, application of fungal suspensions on resting surfaces is more realistic and representative of field settings. For this type of exposure, it is essential to apply specific amounts of fungal spores homogeneously over a surface for testing the effects of fungal dose and exposure time. Contemporary methods such as spraying or brushing spore suspensions onto substrates do not produce the uniformity and consistency that standardized laboratory assays require. Two novel fungus application methods using equipment developed in the paint industry are presented and compared. Wired, stainless steel K-bars were tested and optimized for coating fungal spore suspensions onto paper substrates. Different solvents and substrates were evaluated. Two types of coating techniques were compared, i.e. manual and automated coating. A standardized bioassay set-up was designed for testing coated spores against malaria mosquitoes. K-bar coating provided consistent applications of spore layers onto paper substrates. Viscous Ondina oil formulations were not suitable and significantly reduced spore infectivity. Evaporative Shellsol T solvent dried quickly and resulted in high spore infectivity to mosquitoes. Smooth proofing papers were the most effective substrate and showed higher infectivity than cardboard substrates. Manually and mechanically applied spore coatings showed similar and reproducible effects on mosquito survival. The standardized mosquito exposure bioassay was effective and consistent in measuring effects of fungal dose and exposure time. K-bar coating is a simple and consistent method for applying fungal spore suspensions onto paper substrates and can produce coating layers with accurate effective spore concentrations. The mosquito bioassay

  12. A novel method for standardized application of fungal spore coatings for mosquito exposure bioassays

    Directory of Open Access Journals (Sweden)

    Knols Bart GJ

    2010-01-01

    Full Text Available Abstract Background Interest in the use of fungal entomopathogens against malaria vectors is growing. Fungal spores infect insects via the cuticle and can be applied directly on the insect to evaluate infectivity. For flying insects such as mosquitoes, however, application of fungal suspensions on resting surfaces is more realistic and representative of field settings. For this type of exposure, it is essential to apply specific amounts of fungal spores homogeneously over a surface for testing the effects of fungal dose and exposure time. Contemporary methods such as spraying or brushing spore suspensions onto substrates do not produce the uniformity and consistency that standardized laboratory assays require. Two novel fungus application methods using equipment developed in the paint industry are presented and compared. Methods Wired, stainless steel K-bars were tested and optimized for coating fungal spore suspensions onto paper substrates. Different solvents and substrates were evaluated. Two types of coating techniques were compared, i.e. manual and automated coating. A standardized bioassay set-up was designed for testing coated spores against malaria mosquitoes. Results K-bar coating provided consistent applications of spore layers onto paper substrates. Viscous Ondina oil formulations were not suitable and significantly reduced spore infectivity. Evaporative Shellsol T solvent dried quickly and resulted in high spore infectivity to mosquitoes. Smooth proofing papers were the most effective substrate and showed higher infectivity than cardboard substrates. Manually and mechanically applied spore coatings showed similar and reproducible effects on mosquito survival. The standardized mosquito exposure bioassay was effective and consistent in measuring effects of fungal dose and exposure time. Conclusions K-bar coating is a simple and consistent method for applying fungal spore suspensions onto paper substrates and can produce coating layers

  13. Photometric immersion refractometry of bacterial spores.

    Science.gov (United States)

    Gerhardt, P; Beaman, T C; Corner, T R; Greenamyre, J T; Tisa, L S

    1982-01-01

    Photometric immersion refractometry was used to determine the average apparent refractive index (n) of five types of dormant Bacillus spores representing a 600-fold range in moist-heat resistance determined as a D100 value. The n of a spore type increased as the molecular size of various immersion solutes decreased. For comparison of the spore types, the n of the entire spore and of the isolated integument was determined by use of bovine serum albumin, which is excluded from permeating into them. The n of the sporoplast (the structures bounded by the outer pericortex membrane) was determined by use of glucose, which was shown to permeate into the spore only as deeply as the pericortex membrane. Among the various spore types, an exponential increase in the heat resistance correlated with the n of the entire spore and of the sporoplast, but not of the isolated perisporoplast integument. Correlation of the n with the solids content of the entire spore provided a method of experimentally obtaining the refractive index increment (dn/dc), which was constant for the various spore types and enables the calculation of solids and water content from an n. Altogether, the results showed that the total water content is distributed unequally within the dormant spore, with less water in the sporoplast than in the perisporoplast integument, and that the sporoplast becomes more refractile and therefore more dehydrated as the heat resistance becomes greater among the various spore types. PMID:6802796

  14. Radiosensitivity of spores of Paenibacillus larvae ssp. larvae in honey

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, Wanderley Mendes de [Ministerio da Agricultura, Pecuaria e Abastecimento, Rio de Janeiro, RJ (Brazil). Servico de Inspecao de Produtos de Origem Animal]. E-mail: sipa-rj@agricultura.gov.br; Vital, Helio de Carvalho [Centro Tecnologico do Exercito CTEx, Rio de Janeiro, RJ (Brazil). Div. de Defesa Quimica, Biologica e Nuclear]. E-mail: vital@ctex.eb.br; Schuch, Dulce Maria Tocchetto [Ministerio da Agricultura, Pecuaria e Abastecimento, Porto Alegre, RS (Brazil)]. E-mail: micro-lara-rs@agricultura.gov.br

    2007-07-01

    Irradiation, usually used in combination with other conventional methods of conservation, has been proven to be an efficient tool to ensure the safety of many types of foods by destroying pathogenic microorganisms and extending their shelf-lives. This work has investigated the efficacy of gamma irradiation to inactivate spores of the bacterium Paenibacillus larvae that causes the 'American foulbrood', a highly contagious disease still exotic in Brazil that kills bees and contaminates honey, preventing its commercialization and causing great economical losses. In this study, 60 g samples of two types of honey inoculated with 3.5x10{sup 3} spores/mL of that bacterium were irradiated with doses of 0, 5, 7.5, 10, 12.5 and 15 kGy and counted. The analyses indicated a mean reduction of 97.5{+-}0.7% in the number of viable spores exposed to 5 kGy. The application of doses of 7.5 kGy or higher yielded no viable spores above the detection threshold (10/mL). In addition the value of D{sub 10} (3.1{+-}0.3 kGy) was estimated and the logarithm of the population of viable spores of Paenibacillus larvae subsp. larvae was determined as linear and quadratic polynomial functions of the radiation dose. The results indicated that the dose of 10 kGy could be insufficient to assure complete sterilization of honey in some cases while suggesting that 25 kGy would perform such task adequately. (author)

  15. Development of Quorum-Based Anti-Virulence Therapeutics Targeting Gram-Negative Bacterial Pathogens

    Directory of Open Access Journals (Sweden)

    Wen Shan Yew

    2013-08-01

    Full Text Available Quorum sensing is a cell density-dependent signaling phenomenon used by bacteria for coordination of population-wide phenotypes, such as expression of virulence genes, antibiotic resistance and biofilm formation. Lately, disruption of bacterial communication has emerged as an anti-virulence strategy with enormous therapeutic potential given the increasing incidences of drug resistance in pathogenic bacteria. The quorum quenching therapeutic approach promises a lower risk of resistance development, since interference with virulence generally does not affect the growth and fitness of the bacteria and, hence, does not exert an associated selection pressure for drug-resistant strains. With better understanding of bacterial communication networks and mechanisms, many quorum quenching methods have been developed against various clinically significant bacterial pathogens. In particular, Gram-negative bacteria are an important group of pathogens, because, collectively, they are responsible for the majority of hospital-acquired infections. Here, we discuss the current understanding of existing quorum sensing mechanisms and present important inhibitory strategies that have been developed against this group of pathogenic bacteria.

  16. Cave Entrance dependent Spore Dispersion of Filamentous Fungi Isolated from Various Sediments of Iron Ore Cave in Brazil: a colloquy on human threats while caving

    Directory of Open Access Journals (Sweden)

    Erika Linzi Silva Taylor

    2014-04-01

    Full Text Available Caves are stable environments with characteristics favoring the development of fungi. The fungal community present in a cave also includes pathogenic and opportunistic species out of which some are also served as energy sources in such energy stared ecosystems. Studies on microbial diversity and their role on such energy starved ecosystem are scarce. The present study was aimed to identify the cultivable filamentous fungi present in the various sediment of an iron ore cave and to recognize them as pathogenic and/or opportunistic species. Further the impact of cave entrance on the spore depositions on various distances dependent sediments were analyzed. The results suggest a diverse microbial community inhabiting the cave and an influence of cave entrance over spore deposition on various sediments. We counted a total of 4,549 filamentous fungi that included 34 species of 12 genera: Acremonium, Aspergillus, Cladosporium, Fusarium, Geotrichum, Paecilomyces, Purpureocillium, Penicillium, Torula, Trichoderma, Mucor and Rhizopus. A positive significant relation was observed between spore deposition and distance from cave entrance (p= 0.001. Areas of potential mycoses risks were recognized. This is the first study on microbiological community of an iron ore cave in the country.

  17. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  18. Environmental Persistence Influences Infection Dynamics for a Butterfly Pathogen.

    Directory of Open Access Journals (Sweden)

    Dara A Satterfield

    Full Text Available Many pathogens, including those infecting insects, are transmitted via dormant stages shed into the environment, where they must persist until encountering a susceptible host. Understanding how abiotic conditions influence environmental persistence and how these factors influence pathogen spread are crucial for predicting patterns of infection risk. Here, we explored the consequences of environmental transmission for infection dynamics of a debilitating protozoan parasite (Ophryocystis elektroscirrha that infects monarch butterflies (Danaus plexippus. We first conducted an experiment to observe the persistence of protozoan spores exposed to natural conditions. Experimental results showed that, contrary to our expectations, pathogen doses maintained high infectivity even after 16 days in the environment, although pathogens did yield infections with lower parasite loads after environmental exposure. Because pathogen longevity exceeded the time span of our experiment, we developed a mechanistic model to better explore environmental persistence for this host-pathogen system. Model analysis showed that, in general, longer spore persistence led to higher infection prevalence and slightly smaller monarch population sizes. The model indicated that typical parasite doses shed onto milkweed plants must remain viable for a minimum of 3 weeks for prevalence to increase during the summer-breeding season, and for 11 weeks or longer to match levels of infection commonly reported from the wild, assuming moderate values for parasite shedding rate. Our findings showed that transmission stages of this butterfly pathogen are long-lived and indicated that this is a necessary condition for the protozoan to persist in local monarch populations. This study provides a modeling framework for future work examining the dynamics of an ecologically important pathogen in an iconic insect.

  19. Effects of steam autoclave treatment on Geobacillus stearothermophilus spores.

    Science.gov (United States)

    Huesca-Espitia, L C; Suvira, M; Rosenbeck, K; Korza, G; Setlow, B; Li, W; Wang, S; Li, Y-Q; Setlow, P

    2016-11-01

    To determine the mechanism of autoclave killing of Geobacillus stearothermophilus spores used in biological indicators (BIs) for steam autoclave sterilization, and rates of loss of spore viability and a spore enzyme used in BIs. Spore viability, dipicolinic acid (DPA) release, nucleic acid staining, α-glucosidase activity, protein structure and mutagenesis were measured during autoclaving of G. stearothermophilus spores. Loss of DPA and increases in spore core nucleic acid staining were slower than loss of spore viability. Spore core α-glucosidase was also lost more slowly than spore viability, although soluble α-glucosidase in spore preparations was lost more rapidly. However, spores exposed to an effective autoclave sterilization lost all viability and α-glucosidase activity. Apparently killed autoclaved spores were not recovered by artificial germination in supportive media, much spore protein was denatured during autoclaving, and partially killed autoclave-treated spore preparations did not acquire mutations. These results indicate that autoclave-killed spores cannot be revived, spore killing by autoclaving is likely by protein damage, and spore core α-glucosidase activity is lost more slowly than spore viability. This work provides insight into the mechanism of autoclave killing of spores of an organism used in BIs, and that a spore enzyme in a BI is more stable to autoclaving than spore viability. © 2016 The Society for Applied Microbiology.

  20. Arbuscular mycorrhizal fungi spore propagation using single spore as starter inoculum and a plant host.

    Science.gov (United States)

    Selvakumar, G; Shagol, C C; Kang, Y; Chung, B N; Han, S G; Sa, T M

    2018-06-01

    The propagation of pure cultures of arbuscular mycorrhizal fungal (AMF) is an essential requirement for their large-scale agricultural application and commercialization as biofertilizers. The present study aimed to propagate AMF using the single-spore inoculation technique and compare their propagation ability with the known reference spores. Arbuscular mycorrhizal fungal spores were collected from salt-affected Saemangeum reclaimed soil in South Korea. The technique involved inoculation of sorghum-sudangrass (Sorghum bicolor L.) seedlings with single, healthy spores on filter paper followed by the transfer of successfully colonized seedlings to 1-kg capacity pots containing sterilized soil. After the first plant cycle, the contents were transferred to 2·5-kg capacity pots containing sterilized soil. Among the 150 inoculated seedlings, only 27 seedlings were colonized by AMF spores. After 240 days, among the 27 seedlings, five inoculants resulted in the production of over 500 spores. The 18S rDNA sequencing of spores revealed that the spores produced through single-spore inoculation method belonged to Gigaspora margarita, Claroideoglomus lamellosum and Funneliformis mosseae. Furthermore, indigenous spore F. mosseae M-1 reported a higher spore count than the reference spores. The AMF spores produced using the single-spore inoculation technique may serve as potential bio-inoculants with an advantage of being more readily adopted by farmers due to the lack of requirement of a skilled technique in spore propagation. The results of the current study describe the feasible and cost-effective method to mass produce AMF spores for large-scale application. The AMF spores obtained from this method can effectively colonize plant roots and may be easily introduced to the new environment. © 2018 The Society for Applied Microbiology.

  1. PATHOGENICITY, DEVELOPMENT AND REPRODUCTION OF THE ENTOMOPATHOGENIC NEMATODE Steinernema sp., IN MEALWORM Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yuliantoro Baliadi

    2011-10-01

    Full Text Available The pathogenicity, development and reproduction of Steinernema sp., isolate Skpr-20/Str, were studied using Tenebrio molitor. Results revealed that pathogenicity, development and reproduction were significantly influenced by nematode doses. Although the number of invading IJs increased with increasing dose, percentage penetration declined. The IJs reached adulthood within 3 days. Females laid eggs from day 4-7. All eggs remaining inside uterus develop inside the maternal body. The first female bearing endotokia matricida was observed on day 5. In a sand-based assay, nematode was more pathogenic at lower dose instead of higher ones, where optimum dose was 80 nematodes per larva and average number of progeny per female was 5438. Under crowded conditions, development proceeds to IJ stage instead of the J3. The average length and width decreased with increasing of nematode doses. The IJ produced in cadavers infested with 640 nematodes per larva was significantly smaller (492 ± 6.4 µm than offspring from other doses. The number of days which nematodes first emerged from the cadavers decreased with increasing dose. IJ first emerged at the average of 10-13 days at high IJ densities. It is concluded that the wide experimental characteristic of EPNs is also true for Steinernema sp., isolate Skpr-20/Str.

  2. Altered immunological response in mice subjected to stress and exposed to fungal spores

    Science.gov (United States)

    Kurup, Viswanath P.; Choi, Hongyung; Kumar, Anoopa; Murali, Pazhayannur S.; Mishra, S. K.; Pierson, Duane L.

    1992-01-01

    Space flight and related factors such as stress appear to have an adverse effect on astronauts' immune systems. The presence of potentially pathogenic microbes including several genera of fungi reported from spacecraft environment may be a cause of concern in such situations. In order to study the role of such organisms in causing opportunistic or allergic diseases in crewmembers, we have tried to develop an animal model. BALB/c mice were suspended upside down for varying periods of time to induce stress, and their lymphocyte functions were evaluated. These studies indicate that the stress resulted in lowered mitogen induced lymphocyte stimulation as represented by 3H-thymidine uptake. We have also studied the ability of these animals to respond to Aspergillus fumigatus spores. The results of the study clearly demonstrate a definite down-regulation in T-cell proliferation and a higher incidence of infection with A. fumigatus.

  3. Expression and display of UreA of Helicobacter acinonychis on the surface of Bacillus subtilis spores

    Directory of Open Access Journals (Sweden)

    De Felice Maurilio

    2010-01-01

    Full Text Available Abstract Background The bacterial endospore (spore has recently been proposed as a new surface display system. Antigens and enzymes have been successfully exposed on the surface layers of the Bacillus subtilis spore, but only in a few cases the efficiency of expression and the effective surface display and have been determined. We used this heterologous expression system to produce the A subunit of the urease of the animal pathogen Helicobater acinonychis. Ureases are multi-subunit enzymes with a central role in the virulence of various bacterial pathogens and necessary for colonization of the gastric mucosa by the human pathogen H. pylori. The urease subunit UreA has been recognized as a major antigen, able to induce high levels of protection against challenge infections. Results We expressed UreA from H. acinonychis on the B. subtilis spore coat by using three different spore coat proteins as carriers and compared the efficiency of surface expression and surface display obtained with the three carriers. A combination of western-, dot-blot and immunofluorescence microscopy allowed us to conclude that, when fused to CotB, UreA is displayed on the spore surface (ca. 1 × 103 recombinant molecules per spore, whereas when fused to CotC, although most efficiently expressed (7-15 × 103 recombinant molecules per spore and located in the coat layer, it is not displayed on the surface. Experiments with CotG gave results similar to those with CotC, but the CotG-UreA recombinant protein appeared to be partially processed. Conclusion UreA was efficiently expressed on the spore coat of B. subtilis when fused to CotB, CotC or CotG. Of these three coat proteins CotC allows the highest efficiency of expression, whereas CotB is the most appropriate for the display of heterologous proteins on the spore surface.

  4. Expression and display of UreA of Helicobacter acinonychis on the surface of Bacillus subtilis spores.

    Science.gov (United States)

    Hinc, Krzysztof; Isticato, Rachele; Dembek, Marcin; Karczewska, Joanna; Iwanicki, Adam; Peszyńska-Sularz, Grazyna; De Felice, Maurilio; Obuchowski, Michał; Ricca, Ezio

    2010-01-18

    The bacterial endospore (spore) has recently been proposed as a new surface display system. Antigens and enzymes have been successfully exposed on the surface layers of the Bacillus subtilis spore, but only in a few cases the efficiency of expression and the effective surface display and have been determined. We used this heterologous expression system to produce the A subunit of the urease of the animal pathogen Helicobater acinonychis. Ureases are multi-subunit enzymes with a central role in the virulence of various bacterial pathogens and necessary for colonization of the gastric mucosa by the human pathogen H. pylori. The urease subunit UreA has been recognized as a major antigen, able to induce high levels of protection against challenge infections. We expressed UreA from H. acinonychis on the B. subtilis spore coat by using three different spore coat proteins as carriers and compared the efficiency of surface expression and surface display obtained with the three carriers. A combination of western-, dot-blot and immunofluorescence microscopy allowed us to conclude that, when fused to CotB, UreA is displayed on the spore surface (ca. 1 x 10(3) recombinant molecules per spore), whereas when fused to CotC, although most efficiently expressed (7-15 x 10(3) recombinant molecules per spore) and located in the coat layer, it is not displayed on the surface. Experiments with CotG gave results similar to those with CotC, but the CotG-UreA recombinant protein appeared to be partially processed. UreA was efficiently expressed on the spore coat of B. subtilis when fused to CotB, CotC or CotG. Of these three coat proteins CotC allows the highest efficiency of expression, whereas CotB is the most appropriate for the display of heterologous proteins on the spore surface.

  5. Development of Novel Antibiotics for the Treatment of Acinetobacter and Related Pathogens

    Science.gov (United States)

    2012-07-07

    8217]’ . [ugmL ’] Staphylococcus aureus Enterococcus faecalis JH2-2 32 ATCC 12608 2 ATCC 12608+10% serum 2 Bacillus subtilis ATCC 12608 +50% serum...March 1, 2009 to February 28, 2012 4. TITLE AND SUBTITLE Development of Novel Antibiotics for the Treatment of Acinetobacter and Related Pathogens...novel antibacterial agents. 15. SUBJECT TERMS antibiotics , compound screening, complex small molecules 16. SECURITY CLASSIFICATION OF: a. REPORT U

  6. Pathogenic specifics of development of vegetative dysfunction in adolescents in relation to their morphological status

    OpenAIRE

    O. Skyba

    2017-01-01

    Exploring the mechanisms of vegetative regulation in children and adolescents of different somatotypes has a prognostic value in regard to the character of adaptive reactions of the organism, as it facilitates the identification of the risk factors of pathological processes and states of vegetative systems, which may cause chronic illness in adulthood. The author defines the pathogenic specifics of development of vegetative dysfunction in adolescents in relation to their morphological status....

  7. Characterization of small-spored Alternaria from Argentinean crops through a polyphasic approach

    DEFF Research Database (Denmark)

    da Cruz Cabral, Lucía; Rodriguero, Marcela; Stenglein, Sebastián

    2017-01-01

    exporter of agricultural products, so it is essential to thoroughly understand the physiological behaviour of this pathogen in a food safety context. Thus, the objective of this work was to characterize small-spored Alternaria spp. obtained from tomato fruits, pepper fruits, wheat grains and blueberries...

  8. Proteomic Analysis of Bacillus cereus Spores

    National Research Council Canada - National Science Library

    Schwandt, Kerrie

    2002-01-01

    .... All of the identified proteins were plausible spore components, and included chaperonins, sporulation regulators, ribosomal proteins, proteases, and metabolic enzymes involved in energy production...

  9. Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Hagan, Bethany S.; Bruckner-Lea, Cynthia J.

    2002-12-01

    This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

  10. Development of genetic methods for detection of pathogenic microorganisms in irradiated food

    International Nuclear Information System (INIS)

    2010-01-01

    The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment

  11. Invasive forest pathogens: Summary of issues, critical needs, and future goals for Forest Service Research and Development

    Science.gov (United States)

    Ned B. Klopfenstein; Jennifer Juzwik; Michael E. Ostry; Mee-Sook Kim; Paul J. Zambino; Robert C. Venette; Bryce A. Richardson; John E. Lundquist; D. Jean Lodge; Jessie A. Glaeser; Susan J. Frankel; William J. Otrosina; Pauline Spaine; Brian W. Geils

    2010-01-01

    Invasive pathogens have caused immeasurable ecological and economic damage to forest ecosystems. Damage will undoubtedly increase over time due to increased introductions and evolution of invasive pathogens in concert with complex environmental disturbances, such as climate change. Forest Service Research and Development must fulfill critical roles and responsibilities...

  12. Reinforcement of Bacillus subtilis spores by cross-linking of outer coat proteins during maturation.

    Science.gov (United States)

    Abhyankar, Wishwas; Pandey, Rachna; Ter Beek, Alexander; Brul, Stanley; de Koning, Leo J; de Koster, Chris G

    2015-02-01

    Resistance characteristics of bacterial endospores towards various environmental stresses such as chemicals and heat are in part attributed to their coat proteins. Heat resistance is developed in a late stage of sporulation and during maturation of released spores. Using our gel-free proteomic approach and LC-FT-ICR-MS/MS analysis we have monitored the efficiency of the tryptic digestion of proteins in the coat during spore maturation over a period of eight days, using metabolically (15)N labeled mature spores as reference. The results showed that during spore maturation the loss of digestion efficiency of outer coat and crust proteins synchronized with the increase in heat resistance. This implicates that spore maturation involves chemical cross-linking of outer coat and crust layer proteins leaving the inner coat layer proteins unmodified. It appears that digestion efficiencies of spore surface proteins can be linked to their location within the coat and crust layers. We also attempted to study a possible link between spore maturation and the observed heterogeneity in spore germination. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Electron Beam Irradiation Dose Dependently Damages the Bacillus Spore Coat and Spore Membrane

    Directory of Open Access Journals (Sweden)

    S. E. Fiester

    2012-01-01

    Full Text Available Effective control of spore-forming bacilli begs suitable physical or chemical methods. While many spore inactivation techniques have been proven effective, electron beam (EB irradiation has been frequently chosen to eradicate Bacillus spores. Despite its widespread use, there are limited data evaluating the effects of EB irradiation on Bacillus spores. To study this, B. atrophaeus spores were purified, suspended in sterile, distilled water, and irradiated with EB (up to 20 kGy. Irradiated spores were found (1 to contain structural damage as observed by electron microscopy, (2 to have spilled cytoplasmic contents as measured by spectroscopy, (3 to have reduced membrane integrity as determined by fluorescence cytometry, and (4 to have fragmented genomic DNA as measured by gel electrophoresis, all in a dose-dependent manner. Additionally, cytometry data reveal decreased spore size, increased surface alterations, and increased uptake of propidium iodide, with increasing EB dose, suggesting spore coat alterations with membrane damage, prior to loss of spore viability. The present study suggests that EB irradiation of spores in water results in substantial structural damage of the spore coat and inner membrane, and that, along with DNA fragmentation, results in dose-dependent spore inactivation.

  14. Distinction of broken cellular wall Ganoderma lucidum spores and G. lucidum spores using FTIR microspectroscopy

    Science.gov (United States)

    Chen, Xianliang; Liu, Xingcun; Sheng, Daping; Huang, Dake; Li, Weizu; Wang, Xin

    2012-11-01

    In this paper, FTIR microspectroscopy was used to identify broken cellular wall Ganoderma lucidum spores and G. lucidum spores. For IR spectra, broken cellular wall G. lucidum spores and G. lucidum spores were mainly different in the regions of 3000-2800, 1660-1600, 1400-1200 and 1100-1000 cm-1. For curve fitting, the results showed the differences in the protein secondary structures and the polysaccharide structures/content between broken cellular wall G. lucidum spores and G. lucidum spores. Moreover, the value of A1078/A1741 might be a potentially useful factor to distinguish broken cellular wall G. lucidum spores from G. lucidum spores. Additionally, FTIR microspectroscopy could identify broken cellular wall G. lucidum spores and G. lucidum spores accurately when it was combined with hierarchical cluster analysis. The result suggests FTIR microspectroscopy is very simple and efficient for distinction of broken cellular wall G. lucidum spores and G. lucidum spores. The result also indicates FTIR microspectroscopy may be useful for TCM identification.

  15. Distinction of broken cellular wall Ganoderma lucidum spores and G. lucidum spores using FTIR microspectroscopy.

    Science.gov (United States)

    Chen, Xianliang; Liu, Xingcun; Sheng, Daping; Huang, Dake; Li, Weizu; Wang, Xin

    2012-11-01

    In this paper, FTIR microspectroscopy was used to identify broken cellular wall Ganoderma lucidum spores and G. lucidum spores. For IR spectra, broken cellular wall G. lucidum spores and G. lucidum spores were mainly different in the regions of 3000-2800, 1660-1600, 1400-1200 and 1100-1000 cm(-1). For curve fitting, the results showed the differences in the protein secondary structures and the polysaccharide structures/content between broken cellular wall G. lucidum spores and G. lucidum spores. Moreover, the value of A1078/A1741 might be a potentially useful factor to distinguish broken cellular wall G. lucidum spores from G. lucidum spores. Additionally, FTIR microspectroscopy could identify broken cellular wall G. lucidum spores and G. lucidum spores accurately when it was combined with hierarchical cluster analysis. The result suggests FTIR microspectroscopy is very simple and efficient for distinction of broken cellular wall G. lucidum spores and G. lucidum spores. The result also indicates FTIR microspectroscopy may be useful for TCM identification. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Recent progress in Bacillus subtilis spore-surface display: concept, progress, and future.

    Science.gov (United States)

    Wang, He; Wang, Yunxiang; Yang, Ruijin

    2017-02-01

    With the increased knowledge on spore structure and advances in biotechnology engineering, the newly developed spore-surface display system confers several inherent advantages over other microbial cell-surface display systems including enhanced stability and high safety. Bacillus subtilis is the most commonly used Bacillus species for spore-surface display. The expression of heterologous antigen or protein on the surface of B. subtilis spores has now been practiced for over a decade with noteworthy success. As an update and supplement to other previous reviews, we comprehensively summarize recent studies in the B. subtilis spore-surface display technique. We focus on its benefits as well as the critical factors affecting its display efficiency and offer suggestions for the future success of this field.

  17. Fighting Ebola through Novel Spore Decontamination Technologies for the Military

    Directory of Open Access Journals (Sweden)

    Christopher J. Doona

    2015-08-01

    Full Text Available AbstractRecently, global public health organizations such as Doctors without Borders (MSF, the World Health Organization (WHO, Public Health Canada, National Institutes of Health (NIH, and the U.S. government developed and deployed Field Decontamination Kits (FDKs, a novel, lightweight, compact, reusable decontamination technology to sterilize Ebola-contaminated medical devices at remote clinical sites lacking infra-structure in crisis-stricken regions of West Africa (medical waste materials are placed in bags and burned. The basis for effectuating sterilization with FDKs is chlorine dioxide (ClO2 produced from a patented invention developed by researchers at the US Army – Natick Soldier RD&E Center (NSRDEC and commercialized as a dry mixed-chemical for bacterial spore decontamination. In fact, the NSRDEC research scientists developed an ensemble of ClO2 technologies designed for different applications in decontaminating fresh produce; food contact and handling surfaces; personal protective equipment; textiles used in clothing, uniforms, tents, and shelters; graywater recycling; airplanes; surgical instruments; and hard surfaces in latrines, laundries, and deployable medical facilities. These examples demonstrate the far-reaching impact, adaptability, and versatility of these innovative technologies. We present herein the unique attributes of NSRDEC’s novel decontamination technologies and a Case Study of the development of FDKs that were deployed in West Africa by international public health organizations to sterilize Ebola-contaminated medical equipment. FDKs use bacterial spores as indicators of sterility. We review the properties and structures of spores and the mechanisms of bacterial spore inactivation by ClO2. We also review mechanisms of bacterial spore inactivation by novel, emerging, and established nonthermal technologies for food preservation, such as high pressure processing, irradiation, cold plasma, and chemical sanitizers

  18. Sphagnum moss disperses spores with vortex rings.

    Science.gov (United States)

    Whitaker, Dwight L; Edwards, Joan

    2010-07-23

    Sphagnum spores, which have low terminal velocities, are carried by turbulent wind currents to establish colonies many kilometers away. However, spores that are easily kept aloft are also rapidly decelerated in still air; thus, dispersal range depends strongly on release height. Vascular plants grow tall to lift spores into sufficient wind currents for dispersal, but nonvascular plants such as Sphagnum cannot grow sufficiently high. High-speed videos show that exploding capsules of Sphagnum generate vortex rings to efficiently carry spores high enough to be dispersed by turbulent air currents. Spores launched ballistically at similar speeds through still air would travel a few millimeters and not easily reach turbulent air. Vortex rings are used by animals; here, we report vortex rings generated by plants.

  19. In vitro mutagenesis of commercial fern, Asplenium nidus from spores

    International Nuclear Information System (INIS)

    Norazlina Noordin

    2004-01-01

    Asplenium is a largest, most diverse fern genera. One of the common species is Asplenium nidus, well known as Bird's-nest fern, a medium to large fern with erect, stout, unbranched rhizomes. In creating variability of ferns for the benefit of the ornamental plant industry, in vitro mutagenesis is used. In this study, spores of Asplenium nidus were collected from frond bearing mature sporangia. Spores were cultured in modified 1/2 MS basal medium supplemented with various combinations of 6-Benzylaminopurine (BAP) and Naphtalene Acetic Acid (NAA). Spore cultures were incubated in incubation room at 24 degree C with 16 hours photoperiod (3500 lux). It was found that, the most effective combinations were 1 mg/1 BAP + 0. 1 mg/1 NAA and 2mg/1 BAP + 0. 1 mg/1 NAA. Prothallus was formed after 10 days of cultures and gametophytes were formed 1 month later. These gametophytes were irradiated with Gamma ray at doses of 0, 20, 90, 120, 150 and 180 Gy. From the preliminary result obtained from this study, for generating variations and desired phenotypic expression for Asplenium nidus, recommended doses for in vitro mutagenesis using spores are between 90 Gy to 150 Gy. Gametophytes were subcultured at monthly interval to ensure further development and propagation. Frequent monitoring for any changes in the morphology of the irradiated Asplenium nidus plants were carried out. (Author)

  20. Differential effects of lesion mimic mutants in barley on disease development by facultative pathogens

    Science.gov (United States)

    McGrann, Graham R. D.; Steed, , Andrew; Burt, Christopher; Nicholson, Paul; Brown, James K. M.

    2015-01-01

    Lesion mimic mutants display spontaneous necrotic spots and chlorotic leaves as a result of mis-regulated cell death programmes. Typically these mutants have increased resistance to biotrophic pathogens but their response to facultative fungi that cause necrotrophic diseases is less well studied. The effect of altered cell death regulation on the development of disease caused by Ramularia collo-cygni, Fusarium culmorum and Oculimacula yallundae was explored using a collection of barley necrotic (nec) lesion mimic mutants. nec8 mutants displayed lower levels of all three diseases compared to nec9 mutants, which had increased R. collo-cygni but decreased F. culmorum disease symptoms. nec1 mutants reduced disease development caused by both R. collo-cygni and F. culmorum. The severity of the nec1-induced lesion mimic phenotype and F. culmorum symptom development was reduced by mutation of the negative cell death regulator MLO. The significant reduction in R. collo-cygni symptoms caused by nec1 was completely abolished in the presence of the mlo-5 allele and both symptoms and fungal biomass were greater than in the wild-type. These results indicate that physiological pathways involved in regulation of cell death interact with one another in their effects on different fungal pathogens. PMID:25873675

  1. Adsorption of β-galactosidase of Alicyclobacillus acidocaldarius on wild type and mutants spores of Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Sirec Teja

    2012-08-01

    Full Text Available Abstract Background The Bacillus subtilis spore has long been used as a surface display system with potential applications in a variety of fields ranging from mucosal vaccine delivery, bioremediation and biocatalyst development. More recently, a non-recombinant approach of spore display has been proposed and heterologous proteins adsorbed on the spore surface. We used the well-characterized β-galactosidase from the thermoacidophilic bacterium Alicyclobacillus acidocaldarius as a model to study enzyme adsorption, to analyze whether and how spore-adsorption affects the properties of the enzyme and to improve the efficiency of the process. Results We report that purified β-galactosidase molecules were adsorbed to purified spores of a wild type strain of B. subtilis retaining ca. 50% of their enzymatic activity. Optimal pH and temperature of the enzyme were not altered by the presence of the spore, that protected the adsorbed β-galactosidase from exposure to acidic pH conditions. A collection of mutant strains of B. subtilis lacking a single or several spore coat proteins was compared to the isogenic parental strain for the adsorption efficiency. Mutants with an altered outermost spore layer (crust were able to adsorb 60-80% of the enzyme, while mutants with a severely altered or totally lacking outer coat adsorbed 100% of the β-galactosidase molecules present in the adsorption reaction. Conclusion Our results indicate that the spore surface structures, the crust and the outer coat layer, have an negative effect on the adhesion of the β-galactosidase. Electrostatic forces, previously suggested as main determinants of spore adsorption, do not seem to play an essential role in the spore-β-galactosidase interaction. The analysis of mutants with altered spore surface has shown that the process of spore adsorption can be improved and has suggested that such improvement has to be based on a better understanding of the spore surface structure

  2. Prevalence of Vibrio cholerae in Coastal Alternative Supplies of Drinking Water and Association with Bacillus-Like Spore Formers

    Directory of Open Access Journals (Sweden)

    Md. Asaduzzaman Shishir

    2018-02-01

    Full Text Available The scarcity of hygienic drinking water is a normal phenomenon in the coastal areas of Bangladesh due to the high salinity of ground water. The inhabitants of this locality, therefore, live on alternative supplies of water including rain-fed pond water, and rainwater with persistent complex microbial interactions therein, often contaminated with life-threatening pathogens. Hence, this study was aimed at analyzing the prevalence of Vibrio cholerae (Vc in the alternative drinking waters of Mathbaria, a coastal subdistrict neighboring the Bay of Bengal, the efficacy of pond sand filter (PSF and the co-association among Bacillus-like spore formers (Sf and Vc. Vc presumably entrapped into the membrane filter was enriched in alkaline peptone water medium and was isolated on selective thiosulfate-citrate-bile salts-sucrose and taurocholate-tellurite-gelatin agar media. They were finally identified by immunochromatographic one step rapid test and serology test. A total of 26% Vc positive samples were obtained out of 100 [ponds—48, household (HH—29, and PSFs—23] where 13% cases were pathogenic (Vc O1 and 13% were non-pathogenic (Vc non-O1/non-O139. The distribution of Vc as observed was 33, 26, and 13.8% in waters derived from pond surface, PSF, and HH reservoirs, respectively, and for pathogenic type, it was 62.5%, 50%, and nil, respectively. Although none of the samples was identified with pathogenic Vc O139, the statistics represents a significant and augmentative risk of cholera outbreak in the focused area. The antibiotic sensitivity pattern in this study resembled the trend observed during last few years for Vc. The PSF demonstrated its inability to remove Vc from any of the samples and in addition, the filter itself was evidenced to be the source of pathogens and spores in further contamination and transmission. The development of biofilm in the PSF could be hypothesized as the reservoir in contaminating pathogen-free water samples. From the

  3. Prevalence of Vibrio cholerae in Coastal Alternative Supplies of Drinking Water and Association with Bacillus-Like Spore Formers.

    Science.gov (United States)

    Shishir, Md Asaduzzaman; Mamun, Md Al; Mian, Md Mahmuduzzaman; Ferdous, Umme Tamanna; Akter, Noor Jahan; Suravi, Rajia Sultana; Datta, Suvamoy; Kabir, Md Ehsanul

    2018-01-01

    The scarcity of hygienic drinking water is a normal phenomenon in the coastal areas of Bangladesh due to the high salinity of ground water. The inhabitants of this locality, therefore, live on alternative supplies of water including rain-fed pond water, and rainwater with persistent complex microbial interactions therein, often contaminated with life-threatening pathogens. Hence, this study was aimed at analyzing the prevalence of Vibrio cholerae ( Vc ) in the alternative drinking waters of Mathbaria, a coastal subdistrict neighboring the Bay of Bengal, the efficacy of pond sand filter (PSF) and the co-association among Bacillus -like spore formers (Sf) and Vc . Vc presumably entrapped into the membrane filter was enriched in alkaline peptone water medium and was isolated on selective thiosulfate-citrate-bile salts-sucrose and taurocholate-tellurite-gelatin agar media. They were finally identified by immunochromatographic one step rapid test and serology test. A total of 26% Vc positive samples were obtained out of 100 [ponds-48, household (HH)-29, and PSFs-23] where 13% cases were pathogenic ( Vc O1) and 13% were non-pathogenic ( Vc non-O1/non-O139). The distribution of Vc as observed was 33, 26, and 13.8% in waters derived from pond surface, PSF, and HH reservoirs, respectively, and for pathogenic type, it was 62.5%, 50%, and nil, respectively. Although none of the samples was identified with pathogenic Vc O139, the statistics represents a significant and augmentative risk of cholera outbreak in the focused area. The antibiotic sensitivity pattern in this study resembled the trend observed during last few years for Vc . The PSF demonstrated its inability to remove Vc from any of the samples and in addition, the filter itself was evidenced to be the source of pathogens and spores in further contamination and transmission. The development of biofilm in the PSF could be hypothesized as the reservoir in contaminating pathogen-free water samples. From the test of

  4. Rapid Detection of Bacillus anthracis Spores Using Immunomagnetic Separation and Amperometry

    Directory of Open Access Journals (Sweden)

    David F. Waller

    2016-12-01

    Full Text Available Portable detection and quantitation methods for Bacillus anthracis (anthrax spores in pure culture or in environmental samples are lacking. Here, an amperometric immunoassay has been developed utilizing immunomagnetic separation to capture the spores and remove potential interferents from test samples followed by amperometric measurement on a field-portable instrument. Antibody-conjugated magnetic beads and antibody-conjugated glucose oxidase were used in a sandwich format for the capture and detection of target spores. Glucose oxidase activity of spore pellets was measured indirectly via amperometry by applying a bias voltage after incubation with glucose, horseradish peroxidase, and the electron mediator 2,2′-azino-bis (3-ethylbenzthiazoline-6-sulphonic acid. Target capture was mediated by polyclonal antisera, whereas monoclonal antibodies were used for signal generation. This strategy maximized sensitivity (500 target spores, 5000 cfu/mL, while also providing a good specificity for Bacillus anthracis spores. Minimal signal deviation occurs in the presence of environmental interferents including soil and modified pH conditions, demonstrating the strengths of immunomagnetic separation. The simultaneous incubation of capture and detection antibodies and rapid substrate development (5 min result in short sample-to-signal times (less than an hour. With attributes comparable or exceeding that of ELISA and LFDs, amperometry is a low-cost, low-weight, and practical method for detecting anthrax spores in the field.

  5. A Generic Method for Fungal Spore Detection: The use of a monoclonal antibody and surface plasmon resonance

    DEFF Research Database (Denmark)

    Skottrup, Peter; Hearty, Stephen; Frøkiær, Hanne

    2005-01-01

    This study describes a biosensing principle for detection of fungal spores using surface plasmon resonance (SPR). The approach involves the use of a monoclonal antibody (mab) and a SPR sensor for label-free detection of the model organism Puccinia striiformis f.sp. tritici (Pst) a biotrophic fungus...... causing wheat yellow rust. We have developed mabs towards intact whole spores and used a subtractive inhibition format for detection of spores in solution. The antibody was incubated with different spore concentrations and the remaining free antibody was quantified using a BIAcore® 3000 sensor. Decreasing...

  6. TGF-ß Regulates Cathepsin Activation during Normal and Pathogenic Development.

    Science.gov (United States)

    Flanagan-Steet, Heather; Christian, Courtney; Lu, Po-Nien; Aarnio-Peterson, Megan; Sanman, Laura; Archer-Hartmann, Stephanie; Azadi, Parastoo; Bogyo, Matthew; Steet, Richard A

    2018-03-13

    Cysteine cathepsins play roles during development and disease beyond their function in lysosomal protein turnover. Here, we leverage a fluorescent activity-based probe (ABP), BMV109, to track cysteine cathepsins in normal and diseased zebrafish embryos. Using this probe in a model of mucolipidosis II, we show that loss of carbohydrate-dependent lysosomal sorting alters the activity of several cathepsin proteases. The data support a pathogenic mechanism where TGF-ß signals enhance the proteolytic processing of pro-Ctsk by modulating the expression of chondroitin 4-sulfate (C4-S). In MLII, elevated C4-S corresponds with TGF-ß-mediated increases in chst11 expression. Inhibiting chst11 impairs the proteolytic activation of Ctsk and alleviates the MLII phenotypes. These findings uncover a regulatory loop between TGF-ß signaling and Ctsk activation that is altered in the context of lysosomal disease. This work highlights the power of ABPs to identify mechanisms underlying pathogenic development in living animals. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Protection of Bacillus pumilus spores by catalases.

    Science.gov (United States)

    Checinska, Aleksandra; Burbank, Malcolm; Paszczynski, Andrzej J

    2012-09-01

    Bacillus pumilus SAFR-032, isolated at spacecraft assembly facilities of the National Aeronautics and Space Administration Jet Propulsion Laboratory, is difficult to kill by the sterilization method of choice, which uses liquid or vapor hydrogen peroxide. We identified two manganese catalases, YjqC and BPUM_1305, in spore protein extracts of several B. pumilus strains by using PAGE and mass spectrometric analyses. While the BPUM_1305 catalase was present in six of the B. pumilus strains tested, YjqC was not detected in ATCC 7061 and BG-B79. Furthermore, both catalases were localized in the spore coat layer along with laccase and superoxide dismutase. Although the initial catalase activity in ATCC 7061 spores was higher, it was less stable over time than the SAFR-032 enzyme. We propose that synergistic activity of YjqC and BPUM_1305, along with other coat oxidoreductases, contributes to the enhanced resistance of B. pumilus spores to hydrogen peroxide. We observed that the product of the catalase reaction, gaseous oxygen, forms expanding vesicles on the spore surface, affecting the mechanical integrity of the coat layer, resulting in aggregation of the spores. The accumulation of oxygen gas and aggregations may play a crucial role in limiting further exposure of Bacilli spore surfaces to hydrogen peroxide or other toxic chemicals when water is present.

  8. Development of Ash Dieback in South-Eastern Germany and the Increasing Occurrence of Secondary Pathogens

    Directory of Open Access Journals (Sweden)

    Heike D. Lenz

    2016-02-01

    Full Text Available Since its first identification in Poland in 2006, the ascomycete Hymenoscyphus fraxineus has caused massive dieback of Fraxinus excelsior in the countries of eastern, northern and central Europe. This work shows the development, expansion, and severity of the disease in south-eastern Germany for a period of four years, starting in 2010. Differences between habitats, as well as age classes have been captured. The presence and the amount of potentially resistant trees were proven over the years, to determine how high the resistance level might be. Typical disease symptoms are the wilting of leaves, necrotic lesions in the bark and reddish discolorations of branches and stems. In addition, stem necroses also appear by infection with species of Armillaria. Therefore, special attention has been given to Armillaria species in affected ash stands but also to other secondary pathogens, like ash bark beetles. It is shown that breeding galleries of Hylesinus fraxini are only found in trees that have recently died and thus Hylesinus fraxini is still acting as a secondary opportunistic pathogen. In contrast, Armillaria spp. can be considered as serious pathogens of weakened ash trees. In different ash stands, typical symptoms of infection can be found. A relationship between stem base necrotic lesions and vitality was examined. It is shown that necrotic lesions severely contribute to accelerating the mortality of ash trees. In addition to the high infection pressure by H. fraxineus, the high inoculum of Armillaria in the soil facilitates further infections and, thus, likewise endangers the survival of potentially resistant trees. In the following years, forest conversion and seed harvest in affected ash stands will have to be urgently considered to avoid tree gaps on a large scale. Furthermore, infection assays of potentially resistant trees with ensuing breeding programmes should be initially started for the conservation of this ecologically and

  9. Development of a chick bioassay for determination of infectivity of viral pathogens in poultry litter.

    Science.gov (United States)

    Islam, A F M F; Walkden-Brown, S W; Groves, P J; Wells, B

    2013-01-01

    To develop a chicken bioassay to detect infective viral pathogens in poultry litter and to determine the effects of type of chicken and age of exposure, as well as the effect of simulated litter transportation, on the level of viral infectivity detected. A 5 × 2 × 2 factorial design, plus negative controls. Five chicken litters, including two with deliberate contamination (one transported and one not), two chicken types (specific-pathogen-free (SPF) Leghorns and Cobb broilers) and two ages at initial exposure (days 1 and 8). Two replicates of each treatment combination. The 10 chickens in each of 22 isolators were either exposed (20 isolators) or not (2 isolators) to 8 L of previously used or deliberately contaminated poultry litter in two deep scratch trays. At day 35 post-exposure, sera were assayed for antibodies against chicken anaemia virus (CAV), infectious bronchitis virus (IBV), infectious bursal disease virus (IBDV), Newcastle disease virus (NDV) and fowl adenovirus (FAV). Spleen samples were tested for Marek's disease virus (MDV) using real-time polymerase chain reaction. The bioassay detected CAV, IBDV and FAV, but not NDV, IBV or MDV, in chickens exposed to infected litters. Infection in SPF chickens was detected with greater sensitivity than in the broiler chickens. Sensitivity increased with age at exposure in broiler but not SPF chickens. Simulated transportation for 24 h had little effect on pathogen detection. A bioassay based on the exposure of day-old SPF chickens to poultry litter and measurement of seroconversion at day 35 post-exposure is a useful semi-quantitative assay for viral infectivity in poultry litter, with overnight transportation of litter having little effect on the level of viral infectivity detected. This bioassay has applications in research on litter treatment protocols. © 2013 The Authors. Australian Veterinary Journal © 2013 Australian Veterinary Association.

  10. NanoSIMS analysis of Bacillus spores for forensics

    Energy Technology Data Exchange (ETDEWEB)

    Weber, P K; Davisson, M L; Velsko, S P

    2010-02-23

    The threat associated with the potential use of radiological, nuclear, chemical and biological materials in terrorist acts has resulted in new fields of forensic science requiring the application of state-of-the-science analytical techniques. Since the anthrax letter attacks in the United States in the fall of 2001, there has been increased interest in physical and chemical characterization of bacterial spores. While molecular methods are powerful tools for identifying genetic differences, other methods may be able to differentiate genetically identical samples based on physical and chemical properties, as well as provide complimentary information, such as methods of production and approximate date of production. Microanalysis has the potential to contribute significantly to microbial forensics. Bacillus spores are highly structured, consisting of a core, cortex, coat, and in some species, an exosporium. This structure provides a template for constraining elemental abundance differences at the nanometer scale. The primary controls on the distribution of major elements in spores are likely structural and physiological. For example, P and Ca are known to be abundant in the spore core because that is where P-rich nucleic acids and Cadipicolinic acid are located, respectively. Trace elements are known to bind to the spore coat but the controls on these elements are less well understood. Elemental distributions and abundances may be directly related to spore production, purification and stabilization methodologies, which are of particular interest for forensic investigation. To this end, we are developing a high-resolution secondary ion mass spectrometry method using a Cameca NanoSIMS 50 to study the distribution and abundance of trace elements in bacterial spores. In this presentation we will review and compare methods for preparing and analyzing samples, as well as review results on the distribution and abundance of elements in bacterial spores. We use NanoSIMS to

  11. Mycosphaerella fijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control.

    Science.gov (United States)

    Churchill, Alice C L

    2011-05-01

    Banana (Musa spp.) is grown throughout the tropical and subtropical regions of the world. The fruits are a key staple food in many developing countries and a source of income for subsistence farmers. Bananas are also a major, multibillion-dollar export commodity for consumption primarily in developed countries, where few banana cultivars are grown. The fungal pathogen Mycosphaerella fijiensis causes black leaf streak disease (BLSD; aka black Sigatoka leaf spot) on the majority of edible banana cultivars grown worldwide. The fact that most of these cultivars are sterile and unsuitable for the breeding of resistant lines necessitates the extensive use of fungicides as the primary means of disease control. BLSD is a significant threat to the food security of resource-poor populations who cannot afford fungicides, and increases the environmental and health hazards where large-acreage monocultures of banana (Cavendish subgroup, AAA genome) are grown for export. Mycosphaerella fijiensis M. Morelet is a sexual, heterothallic fungus having Pseudocercospora fijiensis (M. Morelet) Deighton as the anamorph stage. It is a haploid, hemibiotrophic ascomycete within the class Dothideomycetes, order Capnodiales and family Mycosphaerellaceae. Its taxonomic placement is based on DNA phylogeny, morphological analyses and cultural characteristics. Mycosphaerella fijiensis is a leaf pathogen that causes reddish-brown streaks running parallel to the leaf veins, which aggregate to form larger, dark-brown to black compound streaks. These streaks eventually form fusiform or elliptical lesions that coalesce, form a water-soaked border with a yellow halo and, eventually, merge to cause extensive leaf necrosis. The disease does not kill the plants immediately, but weakens them by decreasing the photosynthetic capacity of leaves, causing a reduction in the quantity and quality of fruit, and inducing the premature ripening of fruit harvested from infected plants. Although Musa spp. are the

  12. New insights in the bacterial spore resistance to extreme terrestrial and extraterrestrial factors

    Science.gov (United States)

    Moeller, Ralf; Horneck, Gerda; Reitz, Guenther

    Based on their unique resistance to various space parameters, Bacillus endospores are one of the model systems used for astrobiological studies. The extremely high resistance of bacterial endospores to environmental stress factors has intrigued researchers since long time and many characteristic spore features, especially those involved in the protection of spore DNA, have already been uncovered. The disclosure of the complete genomic sequence of Bacillus subtilis 168, one of the often used astrobiological model system, and the rapid development of tran-scriptional microarray techniques have opened new opportunities of gaining further insights in the enigma of spore resistance. Spores of B. subtilis were exposed to various extreme ter-restrial and extraterrestrial stressors to reach a better understanding of the DNA protection and repair strategies, which them to cope with the induced DNA damage. Following physical stress factors of environmental importance -either on Earth or in space -were selected for this thesis: (i) mono-and polychromatic UV radiation, (ii) ionizing radiation, (iii) exposure to ultrahigh vacuum; and (iv) high shock pressures simulating meteorite impacts. To reach a most comprehensive understanding of spore resistance to those harsh terrestrial or simulated extraterrestrial conditions, a standardized experimental protocol of the preparation and ana-lyzing methods was established including the determination of the following spore responses: (i) survival, (ii) induced mutations, (iii) DNA damage, (iv) role of different repair pathways by use of a set of repair deficient mutants, and (v) transcriptional responses during spore germi-nation by use of genome-wide transcriptome analyses and confirmation by RT-PCR. From this comprehensive set of data on spore resistance to a variety of environmental stress parameters a model of a "built-in" transcriptional program of bacterial spores in response to DNA damaging treatments to ensure DNA restoration

  13. Ptaquiloside in bracken spores from Britain

    DEFF Research Database (Denmark)

    Rasmussen, Lars Holm; Schmidt, Bjørn; Sheffield, Elizabeth

    2013-01-01

    Secondary metabolites from bracken fern (Pteridium aquilinum (L.) Kuhn) are suspected of causing cancer in humans. The main carcinogen is the highly water-soluble norsesquiterpene glucoside ptaquiloside, which may be ingested by humans through food, e.g. via contaminated water, meat or milk. It has...... been postulated that carcinogens could also be ingested through breathing air containing bracken spores. Ptaquiloside has not previously been identified in bracken spores. The aim of the study was to determine whether ptaquiloside is present in bracken spores, and if so, to estimate its content...

  14. The transcription factor Rbf1 is the master regulator for b-mating type controlled pathogenic development in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Kai Heimel

    Full Text Available In the phytopathogenic basidiomycete Ustilago maydis, sexual and pathogenic development are tightly connected and controlled by the heterodimeric bE/bW transcription factor complex encoded by the b-mating type locus. The formation of the active bE/bW heterodimer leads to the formation of filaments, induces a G2 cell cycle arrest, and triggers pathogenicity. Here, we identify a set of 345 bE/bW responsive genes which show altered expression during these developmental changes; several of these genes are associated with cell cycle coordination, morphogenesis and pathogenicity. 90% of the genes that show altered expression upon bE/bW-activation require the zinc finger transcription factor Rbf1, one of the few factors directly regulated by the bE/bW heterodimer. Rbf1 is a novel master regulator in a multilayered network of transcription factors that facilitates the complex regulatory traits of sexual and pathogenic development.

  15. Decontamination of materials contaminated with Bacillus anthracis and Bacillus thuringiensis Al Hakam spores using PES-Solid, a solid source of peracetic acid.

    Science.gov (United States)

    Buhr, T L; Wells, C M; Young, A A; Minter, Z A; Johnson, C A; Payne, A N; McPherson, D C

    2013-08-01

    To develop test methods and evaluate survival of Bacillus anthracis Ames, B. anthracis ∆Sterne and B. thuringiensis Al Hakam spores after exposure to PES-Solid (a solid source of peracetic acid), including PES-Solid formulations with bacteriostatic surfactants. Spores (≥ 7 logs) were dried on seven different test materials and treated with three different PES-Solid formulations (or preneutralized controls) at room temperature for 15 min. There was either no spore survival or less than 1 log (<10 spores) of spore survival in 56 of 63 test combinations (strain, formulation and substrate). Less than 2.7 logs (<180 spores) survived in the remaining seven test combinations. The highest spore survival rates were seen on water-dispersible chemical agent resistant coating (CARC-W) and Naval ship topcoat (NTC). Electron microscopy and Coulter analysis showed that all spore structures were intact after spore inactivation with PES-Solid. Three PES-Solid formulations inactivated Bacillus spores that were dried on seven different materials. A test method was developed to show that PES-Solid formulations effectively inactivate Bacillus spores on different materials. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  16. The development of high hydrostatic pressure processes as an alternative to other pathogen reduction methods.

    Science.gov (United States)

    Demazeau, G; Rivalain, N

    2011-06-01

    In biology, scientist's interest for high hydrostatic pressure (HHP) has increased over the last 20 years, for both research and industrial developments, mainly because of the low energy associated with its application in liquid phase and its capacity to inactivate pathogens. It is now considered as an interesting alternative to heat treatments for the inactivation of contaminants in many products, from foods to pharmaceutical preparations. This last statement implies different objectives according to the type of product. The therapeutic properties of pharmaceutical preparations or other biological media of physiological importance are in general associated with specific and well-defined molecules such as proteins. Their activity mainly depends on their spatial conformation, maintained by weak chemical bonds that are often pressure sensitive. In this case, the optimization of a HHP process can be more complex than for foods, for which the organoleptic molecules are less pressure sensitive, and the evaluation of their preservation is more subjective and highly dependent on the consumers acceptance. The objective of this review is therefore to underline how, even if the basic concept for the optimization of a pathogen reduction process using HHP is the same whatever the product, major differences arise from the product itself and its final use. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  17. Development of Rare Bacterial Monosaccharide Analogs for Metabolic Glycan Labeling in Pathogenic Bacteria.

    Science.gov (United States)

    Clark, Emily L; Emmadi, Madhu; Krupp, Katharine L; Podilapu, Ananda R; Helble, Jennifer D; Kulkarni, Suvarn S; Dube, Danielle H

    2016-12-16

    Bacterial glycans contain rare, exclusively bacterial monosaccharides that are frequently linked to pathogenesis and essentially absent from human cells. Therefore, bacterial glycans are intriguing molecular targets. However, systematic discovery of bacterial glycoproteins is hampered by the presence of rare deoxy amino sugars, which are refractory to traditional glycan-binding reagents. Thus, the development of chemical tools that label bacterial glycans is a crucial step toward discovering and targeting these biomolecules. Here, we explore the extent to which metabolic glycan labeling facilitates the studying and targeting of glycoproteins in a range of pathogenic and symbiotic bacterial strains. We began with an azide-containing analog of the naturally abundant monosaccharide N-acetylglucosamine and discovered that it is not broadly incorporated into bacterial glycans, thus revealing a need for additional azidosugar substrates to broaden the utility of metabolic glycan labeling in bacteria. Therefore, we designed and synthesized analogs of the rare deoxy amino d-sugars N-acetylfucosamine, bacillosamine, and 2,4-diacetamido-2,4,6-trideoxygalactose and established that these analogs are differentially incorporated into glycan-containing structures in a range of pathogenic and symbiotic bacterial species. Further application of these analogs will refine our knowledge of the glycan repertoire in diverse bacteria and may find utility in treating a variety of infectious diseases with selectivity.

  18. Mucorales spores induce a proinflammatory cytokine response in human mononuclear phagocytes and harbor no rodlet hydrophobins.

    Science.gov (United States)

    Wurster, Sebastian; Thielen, Vanessa; Weis, Philipp; Walther, Paul; Elias, Johannes; Waaga-Gasser, Ana Maria; Dragan, Mariola; Dandekar, Thomas; Einsele, Hermann; Löffler, Jürgen; Ullmann, Andrew J

    2017-11-17

    Mucormycoses are life-threatening infections in immunocompromised patients. This study characterizes the response of human mononuclear cells to different Mucorales and Ascomycota. PBMC, monocytes, and monocyte derived dendritic cells (moDCs) from healthy donors were stimulated with resting and germinated stages of Mucorales and Ascomycota. Cytokine response and expression of activation markers were studied. Both inactivated germ tubes and resting spores of Rhizopus arrhizus and other human pathogenic Mucorales species significantly stimulated mRNA synthesis and secretion of proinflammatory cytokines. Moreover, R. arrhizus spores induced the upregulation of co-stimulatory molecules on moDCs and a specific T-helper cell response. Removal of rodlet hydrophobins by hydrofluoric acid treatment of A. fumigatus conidia resulted in enhanced immunogenicity, whereas the cytokine response of PBMCs to dormant R. arrhizus spores was not influenced by hydrofluoric acid. Scanning electron micrographs of Mucorales spores did not exhibit any morphological correlates of rodlet hydrophobins. Taken together, this study revealed striking differences in the response of human mononuclear cells to resting stages of Ascomycota and Mucorales, which may be explained by absence of an immunoprotective hydrophobin layer in Mucorales spores.

  19. A Clostridium difficile-Specific, Gel-Forming Protein Required for Optimal Spore Germination

    Directory of Open Access Journals (Sweden)

    M. Lauren Donnelly

    2017-01-01

    Full Text Available Clostridium difficile is a Gram-positive spore-forming obligate anaerobe that is a leading cause of antibiotic-associated diarrhea worldwide. In order for C. difficile to initiate infection, its aerotolerant spore form must germinate in the gut of mammalian hosts. While almost all spore-forming organisms use transmembrane germinant receptors to trigger germination, C. difficile uses the pseudoprotease CspC to sense bile salt germinants. CspC activates the related subtilisin-like protease CspB, which then proteolytically activates the cortex hydrolase SleC. Activated SleC degrades the protective spore cortex layer, a step that is essential for germination to proceed. Since CspC incorporation into spores also depends on CspA, a related pseudoprotease domain, Csp family proteins play a critical role in germination. However, how Csps are incorporated into spores remains unknown. In this study, we demonstrate that incorporation of the CspC, CspB, and CspA germination regulators into spores depends on CD0311 (renamed GerG, a previously uncharacterized hypothetical protein. The reduced levels of Csps in gerG spores correlate with reduced responsiveness to bile salt germinants and increased germination heterogeneity in single-spore germination assays. Interestingly, asparagine-rich repeat sequences in GerG’s central region facilitate spontaneous gel formation in vitro even though they are dispensable for GerG-mediated control of germination. Since GerG is found exclusively in C. difficile, our results suggest that exploiting GerG function could represent a promising avenue for developing C. difficile-specific anti-infective therapies.

  20. The immunological characteristics and probiotic function of recombinant Bacillus subtilis spore expressing Clonorchis sinensis cysteine protease.

    Science.gov (United States)

    Tang, Zeli; Shang, Mei; Chen, Tingjin; Ren, Pengli; Sun, Hengchang; Qu, Hongling; Lin, Zhipeng; Zhou, Lina; Yu, Jinyun; Jiang, Hongye; Zhou, Xinyi; Li, Xuerong; Huang, Yan; Xu, Jin; Yu, Xinbing

    2016-12-19

    Clonorchiasis, a food-borne zoonosis, is caused by Clonorchis sinensis. The intestinal tract and bile ducts are crucial places for C. sinensis metacercariae to develop into adult worms. The endospore of Bacillus subtilis is an ideal oral immunization vehicle for delivery of heterologous antigens to intestine. Cysteine protease of C. sinensis (CsCP) is an endogenous key component in the excystment of metacercariae and other physiological or pathological processes. We constructed a fusion gene of CotC (a coat protein)-CsCP and obtained B. subtilis spores with recombinant plasmid of pEB03-CotC-CsCP (B.s-CotC-CsCP). CotC-CsCP expressed on spores' surface was detected by Western blotting and immunofluorescence. Immunological characteristics of recombinant spore coat protein were evaluated in a mouse model. The levels of CsCP-specific antibodies were detected by ELISA. Effects of recombinant spores on mouse intestine were evaluated by histological staining. The activities of biochemical enzymes in serum were assayed by microplate. Liver sections of infected mice were evaluated by Ishak score after Masson's trichrome. The B.s-CotC-CsCP spores displayed CsCP on their coat. Specific IgG and isotypes were significantly induced by coat proteins of B.s-CotC-CsCP spores after subcutaneous immunization. IgA levels in intestinal mucus and bile of B.s-CotC-CsCP orally treated mice significantly increased. Additionally, more IgA-secreting cells were observed in enteraden and lamina propria regions of the mouse jejunum, and an increased amount of acidic mucins in intestines were also observed. There were no significant differences in enzyme levels of serum among groups. No inflammatory injury was observed in the intestinal tissues of each group. The degree of liver fibrosis was significantly reduced after oral immunization with B.s-CotC-CsCP spores. Bacillus subtilis spores maintained the original excellent immunogenicity of CsCP expressed on their surface. Both local and systemic

  1. The regulated synthesis of a Bacillus anthracis spore coat protein that affects spore surface properties.

    Science.gov (United States)

    Aronson, A; Goodman, B; Smith, Z

    2014-05-01

    Examine the regulation of a spore coat protein and the effects on spore properties. A c. 23 kDa band in coat/exosporial extracts of Bacillus anthracis Sterne spores varied in amount depending upon the conditions of sporulation. It was identified by MALDI as a likely orthologue of ExsB of Bacillus cereus. Little if any was present in an exosporial preparation with a location to the inner coat/cortex region established by spore fractionation and immunogold labelling of electron micrograph sections. Because of its predominant location in the inner coat, it has been renamed Cotγ. It was relatively deficient in spores produced at 37°C and when acidic fermentation products were produced a difference attributable to transcriptional regulation. The deficiency or absence of Cotγ resulted in a less robust exosporium positioned more closely to the coat. These spores were less hydrophobic and germinated somewhat more rapidly. Hydrophobicity and appearance were rescued in the deletion strain by introduction of the cotγ gene. The deficiency or lack of a protein largely found in the inner coat altered spore hydrophobicity and surface appearance. The regulated synthesis of Cotγ may be a paradigm for other spore coat proteins with unknown functions that modulate spore properties in response to environmental conditions. © 2014 The Society for Applied Microbiology.

  2. Sensitivity of thermally treated Bacillus subtilis spores to subsequent irradiation

    International Nuclear Information System (INIS)

    Mostafa, S.A.; El-Zawahry, Y.A.; Awny, N.M.

    1986-01-01

    B. subtilis spores exposed to thermal treatment at 70 or 80 0 C for 1 hr were more sensitive to subsequent radiation exposure than non-heated spores. Deactivation of previously heated spores by increasing dose of 0-radiation followed an exponential function while, for non-heated spores a shoulder followed by exponential deactivation was noticed. Combined heat-radiation treatment exhibited a synergistic effect on spore deactivation at low irradiation doses, while at high irradiation doses, the effect was more or less additive. Added values of spore injury was higher for B. subtilis spores that received heat and radiation separately than the observed injury for spores that received combined treatment (heat followed by radiation). Results of spore deactivation and injury due to heat followed by radiation treatment are discussed in comparison to those of spores that received radiation-heat sequence

  3. Modeling Thermal Inactivation of Bacillus Spores

    Science.gov (United States)

    2009-03-01

    information is preserved and replicated by the Watson - Crick base pairing in which 4-3 complementary bases recognize each other. One incorrect amino acid can...hydrolysis reactions to take place with the spore’s DNA and other proteins. These chemical reactions degrade the DNA and proteins to such an extent that the... DNA cannot be repaired or replicated, thus causing spore death. We further assert that damage to a spore is based on a certain initial DNA information

  4. Is Low Efficacy of Fungicides always a Consequence of Fungicide Resistance Development in Pathogen Populations?

    Directory of Open Access Journals (Sweden)

    Brankica Tanović

    2011-01-01

    Full Text Available Efficacy of four fungicides with different modes of action (vinclozolin, pyrimethanil, benomyland fenhexamid in control of B. cinerea in raspberry, was investigated in the paper.The trials were conducted at two localities in commercial raspberry plantations. In the caseof unsatisfactory fungicide efficacy, qualitative and/or quantitative test of the susceptibilityof the isolates to particular fungicide was performed, to determine whether the low efficacyis a consequence of resistance development in the pathogen population. At both localities,pyrimethanil and fenhexamid demonstrated the highest efficacy (73.2-89.6%, whilethe efficacy of vinclozolin was statistically significantly lower (48.7-63.4% at both localities.However, qualitative and quantitative test of susceptibility to vinclozolin showed that all theisolates were susceptible to vinclozolin and that the reason for unsatisfactory efficacy shouldbe primarily sought in inadequate fungicide application

  5. Novel Sample Preparation Method for Safe and Rapid Detection of Bacillus anthracis Spores in Environmental Powders and Nasal Swabs

    OpenAIRE

    Luna, Vicki A.; King, Debra; Davis, Carisa; Rycerz, Tony; Ewert, Matthew; Cannons, Andrew; Amuso, Philip; Cattani, Jacqueline

    2003-01-01

    Bacillus anthracis spores have been used as a biological weapon in the United States. We wanted to develop a safe, rapid method of sample preparation that provided safe DNA for the detection of spores in environmental and clinical specimens. Our method reproducibly detects B. anthracis in samples containing

  6. Thermophilic spore-forming bacteria isolated from spoiled canned food and their heat resistance. Results of a French ten-year survey.

    Science.gov (United States)

    André, S; Zuber, F; Remize, F

    2013-07-15

    Thermal processing of Low Acid Canned Foods (LACF), which are safe and shelf-stable at ambient temperature for several years, results in heat inactivation of all vegetative microorganisms and the partial or total inactivation of spores. Good Manufacturing Hygienic Practices include stability tests for managing the pathogen risk related to surviving mesophilic bacterial spores. LACF are also often submitted to additional incubation conditions, typically 55 °C for 7 days, to monitor spoilage by thermophiles. In this study we identified the bacterial species responsible for non-stability after prolonged at 55 °C of incubation of LACF from 455 samples collected from 122 French canneries over 10 years. Bacteria were identified by microsequencing or a recent developed tool for group-specific PCR detection (SporeTraQ™). A single species was identified for 93% of examined samples. Three genera were responsible for more than 80% of all non-stability cases: mostly Moorella (36%) and Geobacillus (35%), and less frequently Thermoanaerobacterium (10%). The other most frequent bacterial genera identified were Bacillus, Thermoanaerobacter, Caldanaerobius, Anoxybacillus, Paenibacillus and Clostridium. Species frequency was dependent on food category, i.e. vegetables, ready-made meals containing meat, seafood or other recipes, products containing fatty duck, and related to the intensity of the thermal treatment applied in these food categories. The spore heat resistance parameters (D or δ and z values) from 36 strains isolated in this study were determined. Taken together, our results single out the species most suitable for use as indicators for thermal process settings. This extensively-documented survey of the species that cause non-stability at 55 °C in LACF will help canneries to improve the management of microbial contamination. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. [Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

    Science.gov (United States)

    Iván, Kristóf; Maráz, Anna

    2015-12-20

    Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

  8. Aspergillosis in the common sea fan Gorgonia ventalina: isolation of waterborne hyphae and spores.

    Science.gov (United States)

    Troeger, Victoria J; Sammarco, Paul W; Caruso, John H

    2014-07-03

    The octocoral disease aspergillosis is caused by the terrestrial fungus Aspergillus sydowii. The possibility of secondary (horizontal) transmission of aspergillosis among common sea fans Gorgonia ventalina would require waterborne transmission of hyphae and/or spores. A laboratory filtration experiment confirmed that fungal hyphae and spores were shed into the water by infected fans. This suggests that secondary infection might be possible in this species. It remains to be determined whether healthy fans actually develop aspergillosis after contact with hyphae-laden water.

  9. Lethality of chlorine, chlorine dioxide, and a commercial fruit and vegetable sanitizer to vegetative cells and spores of Bacillus cereus and spores of Bacillus thuringiensis.

    Science.gov (United States)

    Beuchat, Larry R; Pettigrew, Charles A; Tremblay, Mario E; Roselle, Brian J; Scouten, Alan J

    2004-08-01

    Chlorine, ClO2, and a commercial raw fruit and vegetable sanitizer were evaluated for their effectiveness in killing vegetative cells and spores of Bacillus cereus and spores of Bacillus thuringiensis. The ultimate goal was to use one or both species as a potential surrogate(s) for Bacillus anthracis in studies that focus on determining the efficacy of sanitizers in killing the pathogen on food contact surfaces and foods. Treatment with alkaline (pH 10.5 to 11.0) ClO2 (200 microg/ml) produced by electrochemical technologies reduced populations of a five-strain mixture of vegetative cells and a five-strain mixture of spores of B. cereus by more than 5.4 and more than 6.4 log CFU/ml respectively, within 5 min. This finding compares with respective reductions of 4.5 and 1.8 log CFU/ml resulting from treatment with 200 microg/ml of chlorine. Treatment with a 1.5% acidified (pH 3.0) solution of Fit powder product was less effective, causing 2.5- and 0.4-log CFU/ml reductions in the number of B. cereus cells and spores, respectively. Treatment with alkaline ClO2 (85 microg/ml), acidified (pH 3.4) ClO2 (85 microg/ml), and a mixture of ClO2 (85 microg/ml) and Fit powder product (0.5%) (pH 3.5) caused reductions in vegetative cell/spore populations of more than 5.3/5.6, 5.3/5.7, and 5.3/6.0 log CFU/ml, respectively. Treatment of B. cereus and B. thuringiensis spores in a medium (3.4 mg/ml of organic and inorganic solids) in which cells had grown and produced spores with an equal volume of alkaline (pH 12.1) ClO2 (400 microg/ml) for 30 min reduced populations by 4.6 and 5.2 log CFU/ml, respectively, indicating high lethality in the presence of materials other than spores that would potentially react with and neutralize the sporicidal activity of ClO2.

  10. Food sensing: selection and characterization of DNA aptamers to Alicyclobacillus spores for trapping and detection from orange juice.

    Science.gov (United States)

    Hünniger, Tim; Fischer, Christin; Wessels, Hauke; Hoffmann, Antonia; Paschke-Kratzin, Angelika; Haase, Ilka; Fischer, Markus

    2015-03-04

    The quality of the beverage industry's products has to be constantly monitored to fulfill consumers' high expectations. The thermo-acidophilic Gram-positive Alicyclobacillus spp. are not pathogenic, but their heat-resistant endospores can survive juice-processing conditions and have become a major economic concern for the fruit juice industry. Current detection methods rely on cultivation, isolation, and organism identification, which can take up to a week, resulting in economic loss. This work presents the selection and identification of DNA aptamers targeting Alicyclobacillus spores by spore-SELEX (systematic evolution of ligands by exponential enrichment) in orange-juice-simulating buffer. The selection process was verified by various techniques, including flow cytometric binding assays, radioactive binding assays, and agarose gel electrophoresis. The subsequent aptamer characterization included the determination of dissociations constants and selectivity by different techniques, such as surface plasmon resonance spectroscopy and fluorescence microscopy. In summary, 10 different aptamers with an affinity to Alicyclobacillus spp. have been developed, analyzed, and characterized in terms of affinity and specificity.

  11. Enzyme-driven Bacillus spore coat degradation leading to spore killing.

    Science.gov (United States)

    Mundra, Ruchir V; Mehta, Krunal K; Wu, Xia; Paskaleva, Elena E; Kane, Ravi S; Dordick, Jonathan S

    2014-04-01

    The bacillus spore coat confers chemical and biological resistance, thereby protecting the core from harsh environments. The primarily protein-based coat consists of recalcitrant protein crosslinks that endow the coat with such functional protection. Proteases are present in the spore coat, which play a putative role in coat degradation in the environment. However these enzymes are poorly characterized. Nonetheless given the potential for proteases to catalyze coat degradation, we screened 10 commercially available proteases for their ability to degrade the spore coats of B. cereus and B. anthracis. Proteinase K and subtilisin Carlsberg, for B. cereus and B. anthracis spore coats, respectively, led to a morphological change in the otherwise impregnable coat structure, increasing coat permeability towards cortex lytic enzymes such as lysozyme and SleB, thereby initiating germination. Specifically in the presence of lysozyme, proteinase K resulted in 14-fold faster enzyme induced germination and exhibited significantly shorter lag times, than spores without protease pretreatment. Furthermore, the germinated spores were shown to be vulnerable to a lytic enzyme (PlyPH) resulting in effective spore killing. The spore surface in response to proteolytic degradation was probed using scanning electron microscopy (SEM), which provided key insights regarding coat degradation. The extent of coat degradation and spore killing using this enzyme-based pretreatment approach is similar to traditional, yet far harsher, chemical decoating methods that employ detergents and strong denaturants. Thus the enzymatic route reduces the environmental burden of chemically mediated spore killing, and demonstrates that a mild and environmentally benign biocatalytic spore killing is achievable. © 2013 Wiley Periodicals, Inc.

  12. Studying Host-Pathogen Interactions In 3-D: Organotypic Models For Infectious Disease And Drug Development

    Science.gov (United States)

    Nickerson, Cheryl A.; Richter, Emily G.; Ott, C. Mark

    2006-01-01

    Representative, reproducible and high-throughput models of human cells and tissues are critical for a meaningful evaluation of host-pathogen interactions and are an essential component of the research developmental pipeline. The most informative infection models - animals, organ explants and human trials - are not suited for extensive evaluation of pathogenesis mechanisms and screening of candidate drugs. At the other extreme, more cost effective and accessible infection models such as conventional cell culture and static co-culture may not capture physiological and three-dimensional aspects of tissue biology that are important in assessing pathogenesis, and effectiveness and cytotoxicity of therapeutics. Our lab has used innovative bioengineering technology to establish biologically meaningful 3-D models of human tissues that recapitulate many aspects of the differentiated structure and function of the parental tissue in vivo, and we have applied these models to study infectious disease. We have established a variety of different 3-D models that are currently being used in infection studies - including small intestine, colon, lung, placenta, bladder, periodontal ligament, and neuronal models. Published work from our lab has shown that our 3-D models respond to infection with bacterial and viral pathogens in ways that reflect the infection process in vivo. By virtue of their physiological relevance, 3-D cell cultures may also hold significant potential as models to provide insight into the neuropathogenesis of HIV infection. Furthermore, the experimental flexibility, reproducibility, cost-efficiency, and high throughput platform afforded by these 3-D models may have important implications for the design and development of drugs with which to effectively treat neurological complications of HIV infection.

  13. Increased levels of airborne fungal spores to Populus tremuloides grown under elevated atmospheric CO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Klinoromos, J. N. [Guelph Univ., ON (Canada). Dept. of Botany; Rillig, M. C.; Allen, M. F. [San Diego State Univ., CA (United States). Dept. of Biology; Zak, D. R. [Michigan Univ., Ann Arbor, MI (United States). School of Natural Resources and Environment; Pregitzer, K. S.; Kubiske, M. E. [Michigan Technological Univ., Houghton, MI (United States). School of Forestry and Wood Products

    1997-10-01

    The objective of this study was to test the hypothesis that soil fungi sporulation would be facilitated by increase levels of CO{sub 2} concentration, leading to higher concentrations of fungal population in the atmosphere. Results showed that airborne fungal propagules were increased fourfold under twice-ambient CO{sub 2} concentration, and the decomposing leaf litter, the main source of fungal propagules, produced a fivefold increase of spores under elevated CO{sub 2} conditions. These results confirm the hypothesis that CO{sub 2} concentrations have a direct effect on microbial functions, which in turn will affect decomposition and plant pathogen dynamics. Since there is increasing evidence for causal relationship and exposure to aeroallergens and development of asthma in humans, there is a compelling need to study fungal epidemiology in the context of a globally changing environment. 28 refs., 3 figs.

  14. A quantum dot-spore nanocomposite pH sensor.

    Science.gov (United States)

    Zhang, Xingya; Li, Zheng; Zhou, Tao; Zhou, Qian; Zeng, Zhiming; Xu, Xiangdong; Hu, Yonggang

    2016-04-01

    A new quantum dot (QD)-based pH sensor design is investigated. The sensor is synthesized based on the self-assembly of green QDs onto treated spores to form QD@spore nanocomposites. The nanocomposites are characterized using laser scanning confocal microscopy, transmission electron microscope, and fluorescence spectroscopy, among others. Fluorescence measurements showed that these nanocomposites are sensitive to pH in a broad pH range of 5.0-10.0. The developed pH sensors have been satisfactorily applied for pH estimation of real samples and are comparable with those of the commercial assay method, indicating the potential practical application of the pH sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Developing hygiene protocols against mechanically transmitted pathogens in greenhouse tomato production systems

    Science.gov (United States)

    Greenhouse tomato propagation and production require intensive crop work that promotes the spread of mechanically transmitted pathogens (e.g. fungi, bacteria, viruses and viroids). Therefore, a clean seed program is very important to prevent any un-intentional introduction of seed-borne pathogens t...

  16. Spore Heat Activation Requirements and Germination Responses Correlate with Sequences of Germinant Receptors and with the Presence of a Specific spoVA2mob Operon in Foodborne Strains of Bacillus subtilis.

    Science.gov (United States)

    Krawczyk, Antonina O; de Jong, Anne; Omony, Jimmy; Holsappel, Siger; Wells-Bennik, Marjon H J; Kuipers, Oscar P; Eijlander, Robyn T

    2017-04-01

    Spore heat resistance, germination, and outgrowth are problematic bacterial properties compromising food safety and quality. Large interstrain variation in these properties makes prediction and control of spore behavior challenging. High-level heat resistance and slow germination of spores of some natural Bacillus subtilis isolates, encountered in foods, have been attributed to the occurrence of the spoVA 2mob operon carried on the Tn 1546 transposon. In this study, we further investigate the correlation between the presence of this operon in high-level-heat-resistant spores and their germination efficiencies before and after exposure to various sublethal heat treatments (heat activation, or HA), which are known to significantly improve spore responses to nutrient germinants. We show that high-level-heat-resistant spores harboring spoVA 2mob required higher HA temperatures for efficient germination than spores lacking spoVA 2mob The optimal spore HA requirements additionally depended on the nutrients used to trigger germination, l-alanine (l-Ala), or a mixture of l-asparagine, d-glucose, d-fructose, and K + (AGFK). The distinct HA requirements of these two spore germination pathways are likely related to differences in properties of specific germinant receptors. Moreover, spores that germinated inefficiently in AGFK contained specific changes in sequences of the GerB and GerK germinant receptors, which are involved in this germination response. In contrast, no relation was found between transcription levels of main germination genes and spore germination phenotypes. The findings presented in this study have great implications for practices in the food industry, where heat treatments are commonly used to inactivate pathogenic and spoilage microbes, including bacterial spore formers. IMPORTANCE This study describes a strong variation in spore germination capacities and requirements for a heat activation treatment, i.e., an exposure to sublethal heat that increases

  17. The Influence of Sporulation Conditions on the Spore Coat Protein Composition of Bacillus subtilis Spores

    NARCIS (Netherlands)

    Abhyankar, Wishwas R.; Kamphorst, Kiki; Swarge, Bhagyashree N.; van Veen, Henk; van der Wel, Nicole N.; Brul, Stanley; de Koster, Chris G.; de Koning, Leo J.

    2016-01-01

    Spores are of high interest to the food and health sectors because of their extreme resistance to harsh conditions, especially against heat. Earlier research has shown that spores prepared on solid agar plates have a higher heat resistance than those prepared under a liquid medium condition. It has

  18. Muricholic acids inhibit Clostridium difficile spore germination and growth.

    Directory of Open Access Journals (Sweden)

    Michael B Francis

    Full Text Available Infections caused by Clostridium difficile have increased steadily over the past several years. While studies on C. difficile virulence and physiology have been hindered, in the past, by lack of genetic approaches and suitable animal models, newly developed technologies and animal models allow these processes to be studied in detail. One such advance is the generation of a mouse-model of C. difficile infection. The development of this system is a major step forward in analyzing the genetic requirements for colonization and infection. While important, it is equally as important in understanding what differences exist between mice and humans. One of these differences is the natural bile acid composition. Bile acid-mediated spore germination is an important step in C. difficile colonization. Mice produce several different bile acids that are not found in humans. These muricholic acids have the potential to impact C. difficile spore germination. Here we find that the three muricholic acids (α-muricholic acid, β-muricholic acid and ω-muricholic acid inhibit C. difficile spore germination and can impact the growth of vegetative cells. These results highlight an important difference between humans and mice and may have an impact on C. difficile virulence in the mouse-model of C. difficile infection.

  19. Pathogen intelligence

    Directory of Open Access Journals (Sweden)

    Michael eSteinert

    2014-01-01

    Full Text Available Different species inhabit different sensory worlds and thus have evolved diverse means of processing information, learning and memory. In the escalated arms race with host defense, each pathogenic bacterium not only has evolved its individual cellular sensing and behaviour, but also collective sensing, interbacterial communication, distributed information processing, joint decision making, dissociative behaviour, and the phenotypic and genotypic heterogeneity necessary for epidemiologic success. Moreover, pathogenic populations take advantage of dormancy strategies and rapid evolutionary speed, which allow them to save co-generated intelligent traits in a collective genomic memory. This review discusses how these mechanisms add further levels of complexity to bacterial pathogenicity and transmission, and how mining for these mechanisms could help to develop new anti-infective strategies.

  20. A Novel Protocol for Decoating and Permeabilizing Bacterial Spores for Epifluorescent Microscopy

    Science.gov (United States)

    LaDuc, Myron T.; Mohapatra, Bidyut

    2014-01-01

    Based on previously reported procedures for permeabilizing vegetative bacterial cells, and numerous trial-and-error attempts with bacterial endospores, a protocol was developed for effectively permeabilizing bacterial spores, which facilitated the applicability of fluorescent in situ hybridization (FISH) microscopy. Bacterial endospores were first purified from overgrown, sporulated suspensions of B. pumilus SAFR-032. Purified spores at a concentration of approx equals 10 million spores/mL then underwent proteinase-K treatment, in a solution of 468.5 µL of 100 mM Tris-HCl, 30 µL of 10% SDS, and 1.5 microL of 20 mg/mL proteinase-K for ten minutes at 35 ºC. Spores were then harvested by centrifugation (15,000 g for 15 minutes) and washed twice with sterile phosphate-buffered saline (PBS) solution. This washing process consisted of resuspending the spore pellets in 0.5 mL of PBS, vortexing momentarily, and harvesting again by centrifugation. Treated and washed spore pellets were then resuspended in 0.5 mL of decoating solution, which consisted of 4.8 g urea, 3 mL Milli-Q water, 1 mL 0.5M Tris, 1 mL 1M dithiothreitol (DTT), and 2 mL 10% sodium-dodecylsulfate (SDS), and were incubated at 65 ºC for 15 minutes while being shaken at 165 rpm. Decoated spores were then, once again, washed twice with sterile PBS, and subjected to lysozyme/mutanolysin treatment (7 mg/mL lysozyme and 7U mutanolysin) for 15 minutes at 35 C. Spores were again washed twice with sterile PBS, and spore pellets were resuspended in 1-mL of 2% SDS. This treatment, facilitating inner membrane permeabilization, lasted for ten minutes at room temperature. Permeabilized spores were washed two final times with PBS, and were resuspended in 200 mkcroL of sterile PBS. At this point, the spores were permeable and ready for downstream processing, such as oligonucleotideprobe infiltration, hybridization, and microscopic evaluation. FISH-microscopic imagery confirmed the effective and efficient (˜50

  1. Back-trajectories show export of airborne fungal spores (Ganoderma sp.) from forests to agricultural and urban areas in England

    Science.gov (United States)

    Sadyś, M.; Skjøth, C. A.; Kennedy, R.

    2014-02-01

    We propose here the hypothesis that all of United Kingdom (UK) is likely to be affected by Ganoderma sp. spores, an important plant pathogen. We suggest that the main sources of this pathogen, which acts as a bioaerosol, are the widely scattered woodlands in the country, although remote sources must not be neglected. The hypothesis is based on related studies on bioaerosols and supported by new observations from a non-forest site and model calculations to support our hypothesis.

  2. Inactivation of food-borne pathogens by combined high hydrostatic pressure and irradiation- a model study

    International Nuclear Information System (INIS)

    Kamat, Anu; Thomas, Paul; Kesavan, P.C.; Fotedar, R.

    1997-01-01

    Application of radiation or high pressure as a food processing method is comparatively recent development in food industry. To investigate the response to hydrostatic pressure, cells of pathogens at logarithmic phase were exposed to 200 MPa for various time intervals in saline as model system. The cells of Salmonella were observed to be most sensitive whereas Listeria monocytogenes were most resistant as revealed by 7 and 2 log cycle inactivation respectively in 10 min. The cells of Bacillus cereus and Yersinia enterocolitica showed 3 long cycles reduction by the same treatment. Bacterial spores because of their resistant nature, are inactivated only at high radiation doses, which are technologically unfeasible. Studies carried out to examine the effectiveness of combination of pressure and radiation clearly suggested that combination treatment given in either sequence reduces the bacterial spore load more effectively than the individual treatment per se. (author)

  3. Children developing asthma by school-age display aberrant immune responses to pathogenic airway bacteria as infants

    DEFF Research Database (Denmark)

    Larsen, Jeppe Madura; Pedersen, Susanne Brix; Thysen, Anna Hammerich

    2014-01-01

    Asthma is a highly prevalent chronic lung disease that commonly originates in early childhood. Colonisation of neonatal airways with the pathogenic bacterial strains H. influenzae, M. catarrhalis and S. pneumoniae is associated with increased risk of later childhood asthma. We hypothesized that c...... that children developing asthma have an abnormal immune response to pathogenic bacteria in infancy. We aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years.......Asthma is a highly prevalent chronic lung disease that commonly originates in early childhood. Colonisation of neonatal airways with the pathogenic bacterial strains H. influenzae, M. catarrhalis and S. pneumoniae is associated with increased risk of later childhood asthma. We hypothesized...

  4. The endogenous development and pathogenicity of Eimeria anseris (Kotlan, 1932) in domestic goslings.

    Science.gov (United States)

    Song, Hongqin; Liu, Dandan; Xu, Jinjun; Wu, Lili; Dai, Yabin; Liu, Mei; Tao, Jianping

    2017-01-01

    Twenty-one, 25-day-old, artificially reared, coccidia-free goslings (Anser cygnoides var. domestica) were inoculated orally with 0.5 × 10 4 , 1 × 10 4 , or 100 × 10 4 sporulated oocysts of Eimeria anseris and sacrificed at intervals from 24 to 216 h post-inoculation (HPI). Nine uninfected goslings served as negative controls. Parts of the visceral organs from goslings, including the intestines, kidneys, and liver, were fixed, sectioned, and observed microscopically. The results revealed that two generations of meronts occurred in the life cycle of E. anseris. The first generation of meronts developed at 24-96 HPI and the second generation at 90-128 HPI. Each meront contained 4-10 merozoites. Development of gamonts began at 128 HPI and mature oocysts appeared at 168 HPI. Developmental stages presented mainly in the epithelial cells of crypts and lamina propria in the posterior parts of the jejunum and ileum. Parasites localized mostly in the cytoplasm and occasionally in the nuclei of host cells. Histological lesions were pronounced in the jejunum and ileum. Desquamation and necrosis of the epithelium of intestine and crypts, infiltration of inflammatory cells, and hemorrhage and mucosal edema were associated with aggregates of endogenous stages. The infected goslings mainly showed severe diarrhea, depression, anorexia, and emaciation, suggesting that E. anseris is highly pathogenic in goslings.

  5. Indicator and Pathogen Removal by Low Impact Development Best Management Practices

    Directory of Open Access Journals (Sweden)

    Jian Peng

    2016-12-01

    Full Text Available Microbial contamination in urban stormwater is one of the most widespread and challenging water quality issues in developed countries. Low impact development (LID best management practices (BMPs restore pre-urban hydrology by treating and/or harvesting urban runoff and stormwater, and can be designed to remove many contaminants including pathogens. One particular type of LID BMP, stormwater biofilters (i.e., vegetated media filters, also known as bioinfiltration, bioretention, or rain gardens, is becoming increasingly popular in urban environments due to its multiple co-benefits (e.g., improved hydrology, water quality, local climate and aesthetics. However, increased understanding of the factors influencing microbial removal in biofilters is needed to effectively design and implement biofilters for microbial water quality improvement. This paper aims to provide a holistic view of microbial removal in biofilter systems, and reviews the effects of various design choices such as filter media, vegetation, infauna, submerged zones, and hydraulic retention time on microbial removal. Limitations in current knowledge and recommendations for future research are also discussed.

  6. Influence of Bacillus polymyxa on the growth and development of Fusarium oxysporum f. sp. tulipae

    Directory of Open Access Journals (Sweden)

    Alicja Saniewska

    2013-12-01

    Full Text Available Antagonistic effect of Bacillus polymyxa, strain S13, toward Fusarium oxysporum f. sp. tulipae was evaluated iii vitro and in vivo. The growth of the pathogen was greatly inhibited in dual cultures with Bacillus polymyxa on potato dextrose agar. Suspension of B. polymyxa and its filtrate substantially inhibited spore germination and development of Fusarium oxysporuum f. sp. tulipae on tulip bulbs.

  7. Indole and 3-indolylacetonitrile inhibit spore maturation in Paenibacillus alvei

    Directory of Open Access Journals (Sweden)

    Cho Moo

    2011-05-01

    Full Text Available Abstract Background Bacteria use diverse signaling molecules to ensure the survival of the species in environmental niches. A variety of both Gram-positive and Gram-negative bacteria produce large quantities of indole that functions as an intercellular signal controlling diverse aspects of bacterial physiology. Results In this study, we sought a novel role of indole in a Gram-positive bacteria Paenibacillus alvei that can produce extracellular indole at a concentration of up to 300 μM in the stationary phase in Luria-Bertani medium. Unlike previous studies, our data show that the production of indole in P. alvei is strictly controlled by catabolite repression since the addition of glucose and glycerol completely turns off the indole production. The addition of exogenous indole markedly inhibits the heat resistance of P. alvei without affecting cell growth. Observation of cell morphology with electron microscopy shows that indole inhibits the development of spore coats and cortex in P. alvei. As a result of the immature spore formation of P. alvei, indole also decreases P. alvei survival when exposed to antibiotics, low pH, and ethanol. Additionally, indole derivatives also influence the heat resistance; for example, a plant auxin, 3-indolylacetonitrile dramatically (2900-fold decreased the heat resistance of P. alvei, while another auxin 3-indoleacetic acid had a less significant influence on the heat resistance of P. alvei. Conclusions Together, our results demonstrate that indole and plant auxin 3-indolylacetonitrile inhibit spore maturation of P. alvei and that 3-indolylacetonitrile presents an opportunity for the control of heat and antimicrobial resistant spores of Gram-positive bacteria.

  8. Seasonal variation of [i]Ganoderma[/i] spore concentrations in urban and suburban districts of the city of Szczecin, Poland

    Directory of Open Access Journals (Sweden)

    Agnieszka Grinn-Gofroń

    2015-02-01

    Full Text Available According to recent studies,[i] Ganoderma[/i] may be the third genus, after [i]Alternaria[/i] and [i]Cladosporium[/i], the spores of which cause symptoms of allergy, and concentration is related to meteorological factors. The aerobiology of [i]Ganoderma[/i] spores in Szczecin in urban and suburban districts was examined using Lanzoni Volumetric Spore Traps in 2008–2010. [i]Ganoderma[/i] spores were present in the atmosphere on more than 90% of the days from June through September with peak concentrations in June, July and September. The number of days with spores was lower in the suburban district, while the total number of spores collected was higher there than in the urban district. Correlation and multiple regression analyses revealed weak relationships between [i]Ganoderma[/i] and meteorological conditions, while testing the significance of differences between the districts showed that urban development did not have a clear impact on the values of meteorological parameters. A significantly higher abundance of spores in the suburbs of Szczecin seemed to be conditioned by the closeness of potential area sources. This study indicates that a single measuring site in the city centre insufficiently reflected the dynamics and level of [i]Ganoderma[/i] spore concentration in peripheral districts.

  9. Seasonal variation of Ganoderma spore concentrations in urban and suburban districts of the city of Szczecin, Poland.

    Science.gov (United States)

    Grinn-Gofroń, Agnieszka; Strzelczak, Agnieszka; Przestrzelska, Katarzyna

    2015-01-01

    According to recent studies, Ganoderma may be the third genus, after Alternaria and Cladosporium, the spores of which cause symptoms of allergy, and concentration is related to meteorological factors. The aerobiology of Ganoderma spores in Szczecin in urban and suburban districts was examined using Lanzoni Volumetric Spore Traps in 2008-2010. Ganoderma spores were present in the atmosphere on more than 90% of the days from June through September with peak concentrations in June, July and September. The number of days with spores was lower in the suburban district, while the total number of spores collected was higher there than in the urban district. Correlation and multiple regression analyses revealed weak relationships between Ganoderma and meteorological conditions, while testing the significance of differences between the districts showed that urban development did not have a clear impact on the values of meteorological parameters. A significantly higher abundance of spores in the suburbs of Szczecin seemed to be conditioned by the closeness of potential area sources. This study indicates that a single measuring site in the city centre insufficiently reflected the dynamics and level of Ganoderma spore concentration in peripheral districts.

  10. The role of strigolactones during plant interactions with the pathogenic fungus Fusarium oxysporum.

    Science.gov (United States)

    Foo, Eloise; Blake, Sara N; Fisher, Brendan J; Smith, Jason A; Reid, James B

    2016-06-01

    Strigolactones (SLs) do not influence spore germination or hyphal growth of Fusarium oxysporum. Mutant studies revealed no role for SLs but a role for ethylene signalling in defence against this pathogen in pea. Strigolactones (SLs) play important roles both inside the plant as a hormone and outside the plant as a rhizosphere signal in interactions with mycorrhizal fungi and parasitic weeds. What is less well understood is any potential role SLs may play in interactions with disease causing microbes such as pathogenic fungi. In this paper we investigate the influence of SLs on the hemibiotrophic pathogen Fusarium oxysporum f.sp. pisi both directly via their effects on fungal growth and inside the plant through the use of a mutant deficient in SL. Given that various stereoisomers of synthetic and naturally occuring SLs can display different biological activities, we used (+)-GR24, (-)-GR24 and the naturally occurring SL, (+)-strigol, as well as a racemic mixture of 5-deoxystrigol. As a positive control, we examined the influence of a plant mutant with altered ethylene signalling, ein2, on disease development. We found no evidence that SLs influence spore germination or hyphal growth of Fusarium oxysporum and that, while ethylene signalling influences pea susceptibility to this pathogen, SLs do not.

  11. Computational fluid dynamics modeling of Bacillus anthracis spore deposition in rabbit and human respiratory airways

    Energy Technology Data Exchange (ETDEWEB)

    Kabilan, S.; Suffield, S. R.; Recknagle, K. P.; Jacob, R. E.; Einstein, D. R.; Kuprat, A. P.; Carson, J. P.; Colby, S. M.; Saunders, J. H.; Hines, S. A.; Teeguarden, J. G.; Straub, T. M.; Moe, M.; Taft, S. C.; Corley, R. A.

    2016-09-01

    Three-dimensional computational fluid dynamics and Lagrangian particle deposition models were developed to compare the deposition of aerosolized Bacillus anthracis spores in the respiratory airways of a human with that of the rabbit, a species commonly used in the study of anthrax disease. The respiratory airway geometries for each species were derived respectively from computed tomography (CT) and µCT images. Both models encompassed airways that extended from the external nose to the lung with a total of 272 outlets in the human model and 2878 outlets in the rabbit model. All simulations of spore deposition were conducted under transient, inhalation–exhalation breathing conditions using average species-specific minute volumes. Two different exposure scenarios were modeled in the rabbit based upon experimental inhalation studies. For comparison, human simulations were conducted at the highest exposure concentration used during the rabbit experimental exposures. Results demonstrated that regional spore deposition patterns were sensitive to airway geometry and ventilation profiles. Due to the complex airway geometries in the rabbit nose, higher spore deposition efficiency was predicted in the nasal sinus compared to the human at the same air concentration of anthrax spores. In contrast, higher spore deposition was predicted in the lower conducting airways of the human compared to the rabbit lung due to differences in airway branching pattern. This information can be used to refine published and ongoing biokinetic models of inhalation anthrax spore exposures, which currently estimate deposited spore concentrations based solely upon exposure concentrations and inhaled doses that do not factor in species-specific anatomy and physiology for deposition.

  12. Formation and characterization of non-growth states in Clostridium thermocellum: spores and L-forms

    Directory of Open Access Journals (Sweden)

    Mearls Elizabeth B

    2012-08-01

    Full Text Available Abstract Background Clostridium thermocellum is an anaerobic thermophilic bacterium that exhibits high levels of cellulose solublization and produces ethanol as an end product of its metabolism. Using cellulosic biomass as a feedstock for fuel production is an attractive prospect, however, growth arrest can negatively impact ethanol production by fermentative microorganisms such as C. thermocellum. Understanding conditions that lead to non-growth states in C. thermocellum can positively influence process design and culturing conditions in order to optimize ethanol production in an industrial setting. Results We report here that Clostridium thermocellum ATCC 27405 enters non-growth states in response to specific growth conditions. Non-growth states include the formation of spores and a L-form-like state in which the cells cease to grow or produce the normal end products of metabolism. Unlike other sporulating organisms, we did not observe sporulation of C. thermocellum in low carbon or nitrogen environments. However, sporulation did occur in response to transfers between soluble and insoluble substrates, resulting in approximately 7% mature spores. Exposure to oxygen caused a similar sporulation response. Starvation conditions during continuous culture did not result in spore formation, but caused the majority of cells to transition to a L-form state. Both spores and L-forms were determined to be viable. Spores exhibited enhanced survival in response to high temperature and prolonged storage compared to L-forms and vegetative cells. However, L-forms exhibited faster recovery compared to both spores and stationary phase cells when cultured in rich media. Conclusions Both spores and L-forms cease to produce ethanol, but provide other advantages for C. thermocellum including enhanced survival for spores and faster recovery for L-forms. Understanding the conditions that give rise to these two different non-growth states, and the implications that

  13. Effects of produced water discharges on the colonization potential of Macrocystis pyrifera spores

    International Nuclear Information System (INIS)

    Lewis, R.J.; Reed, D.C.

    1993-01-01

    Point sources of pollution (e.g. industrial outfalls) may produce ecological impacts at distant locations if pollutants affect dispersive propagules. The authors used laboratory experiments to determine how exposure to produced water (PW; aqueous fraction of petroleum production that is typically discharged into coastal waters) in the water column influences the colonization potential of giant kelp (Macrocystis pyrifera) spores on the bottom. Spores were maintained in suspension in 18 L containers and exposed to one of five concentrations of PW (0 to 10%) for varying amounts of time. Spore swimming generally decreased with increasing PW concentration and exposure duration, with the specific pattern of decrease differing between experimental trials done at different dates. The effect of exposure duration in the water column on the ability of swimming spores to attach to plastic dishes placed the bottom varied with PW concentration. Spores placed in 1 and 10% PW showed a steady decline in their ability to attach with increased exposure; lower concentrations of PW had no such effects. The proportion of spores that germinated after attachment varied tremendously with exposure duration and date of experimental trial. A low proportion of spores that settled during the first 12 h germinated, indicative of a short period of precompetency. Surprisingly, water column exposure to high concentrations of PW during the first 12 h reduced this precompetent period and greatly improved germination success. The magnitude of this enhancement, however, varied among dates. Delayed expression of PW effects were not observed in developing gametophytes; survival of individuals that successfully germinated and gamete production was not affected by previous exposure to PW as a spore

  14. Assembly of an Oxalate Decarboxylase Produced under σK Control into the Bacillus subtilis Spore Coat

    Science.gov (United States)

    Costa, Teresa; Steil, Leif; Martins, Lígia O.; Völker, Uwe; Henriques, Adriano O.

    2004-01-01

    Over 30 polypeptides are synthesized at various times during sporulation in Bacillus subtilis, and they are assembled at the surface of the developing spore to form a multilayer protein structure called the coat. The coat consists of three main layers, an amorphous undercoat close to the underlying spore cortex peptidoglycan, a lamellar inner layer, and an electron-dense striated outer layer. The product of the B. subtilis oxdD gene was previously shown to have oxalate decarboxylase activity when it was produced in Escherichia coli and to be a spore constituent. In this study, we found that OxdD specifically associates with the spore coat structure, and in this paper we describe regulation of its synthesis and assembly. We found that transcription of oxdD is induced during sporulation as a monocistronic unit under the control of σK and is negatively regulated by GerE. We also found that localization of a functional OxdD-green fluorescent protein (GFP) at the surface of the developing spore depends on the SafA morphogenetic protein, which localizes at the interface between the spore cortex and coat layers. OxdD-GFP localizes around the developing spore in a cotE mutant, which does not assemble the spore outer coat layer, but it does not persist in spores produced by the mutant. Together, the data suggest that OxdD-GFP is targeted to the interior layers of the coat. Additionally, we found that expression of a multicopy allele of oxdD resulted in production of spores with increased levels of OxdD that were able to degrade oxalate but were sensitive to lysozyme. PMID:14973022

  15. [Survival of Bacillus anthracis spores in various tannery baths].

    Science.gov (United States)

    Mendrycka, M; Mierzejewski, J

    2000-01-01

    The influence of tannery baths: liming, deliming, bating, pickling, tanning, retannage on the survival and on the germination dynamism of B. anthracis spores (Sterne strain) was investigated. The periods and the conditions of this influence were established according to technological process of cow hide tannage. Practically after every bath some part of the spores remained vital. The most effective killing of spores occurred after pickling, liming and deliming. Inversely, the most viable spores remained after bating and retannage process. The lack of correlation that was observed between survival and germination of spores after retannage bath can be explained by different mechanism of spores germination inhibition and their killing.

  16. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

    Science.gov (United States)

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Viability of Clostridium sporogenes spores after CaO hygienization of meat waste

    Directory of Open Access Journals (Sweden)

    Justyna Bauza-Kaszewska

    2014-09-01

    Full Text Available The occurrence of the pathogenic species [i]C. perfringens[/i] and [i]C. botulinum spores[/i] in animal by-products poses a potential epidemiological hazard. Strong entero- and neurotoxins produced by these bacteria adversely affect human health. To inactivate pathogens present in animal by-products, waste must be subjected to various methods of sanitization. The aim of the presented study was to estimate the effect of different doses of CaO on the viability of spores [i] Clostridium sporogenes[/i] in meat wastes category 3. During the research, two doses of burnt lime were added to the poultry mince meat and meat mixed with swine blood contaminated with [i]Clostridium sporogenes[/i] spore suspension. Half of the samples collected for microbiological analyses were buffered to achieve the pH level ~7, the other were examined without pH neutralization. To estimate the spore number, 10-fold dilution series in peptone water was prepared and heat-treated at 80 °C for 10 min. After cooling-down, one milliliter of each dilution was pour-plated onto DRCM medium solidified with agar. Statistical analysis were performed using the Statistica software. Application of 70% CaO caused complete inactivation of [i]Clostridium spores[/i] in meat wastes after 48 hours. The highest temperature achieved during the experiment was 67 °C. Rapid alkalization of the biomass resulted in increasing pH to values exceeding 12. The effect of liming was not dependent on the meat wastes composition nor CaO dose. The experiment proved the efficiency of liming as a method of animal by-products sanitization. Application of the obtained results may help reduce the epidemiological risk and ensure safety to people handling meat wastes at each stage of their processing and utilization.

  18. The effects of meteorological factors on the occurrence of Ganoderma sp. spores in the air

    Science.gov (United States)

    Grinn-Gofroń, Agnieszka; Strzelczak, Agnieszka

    2011-03-01

    Ganoderma sp. is an airborne fungal spore type known to trigger respiratory allergy symptoms in sensitive patients. Aiming to reduce the risk for allergic individuals, we analysed fungal spore circulation in Szczecin, Poland, and its dependence on meteorological conditions. Statistical models for the airborne spore concentrations of Ganoderma sp.—one of the most abundant fungal taxa in the area—were developed. Aerobiological sampling was conducted over 2004-2008 using a volumetric Lanzoni trap. Simultaneously, the following meteorological parameters were recorded: daily level of precipitation, maximum and average wind speed, relative humidity and maximum, minimum, average and dew point temperatures. These data were used as the explaining variables. Due to the non-linearity and non-normality of the data set, the applied modelling techniques were artificial neural networks (ANN) and mutlivariate regression trees (MRT). The obtained classification and MRT models predicted threshold conditions above which Ganoderma sp. appeared in the air. It turned out that dew point temperature was the main factor influencing the presence or absence of Ganoderma sp. spores. Further analysis of spore seasons revealed that the airborne fungal spore concentration depended only slightly on meteorological factors.

  19. Evaluation of minor pathogen intramammary infection, susceptibility parameters, and somatic cell counts on the development of new intramammary infections with major mastitis pathogens.

    Science.gov (United States)

    Reyher, K K; Dohoo, I R; Scholl, D T; Keefe, G P

    2012-07-01

    Major mastitis pathogens such as Staphylococcus aureus, Streptococcus uberis, Streptococcus dysgalactiae, and coliforms are usually considered more virulent and damaging to the udder than minor mastitis pathogens such as Corynebacterium spp. and coagulase-negative staphylococci (CNS). The current literature comprises several studies (n=38) detailing analyses with conflicting results as to whether intramammary infections (IMI) with the minor pathogens decrease, increase, or have no effect on the risk of a quarter acquiring a new IMI (NIMI) with a major pathogen. The Canadian Bovine Mastitis Research Network has a large mastitis database derived from a 2-yr data collection on a national cohort of dairy farms, and data from this initiative were used to further investigate the effect of IMI with minor pathogens on the acquisition of new major pathogen infections (defined as a culture-positive quarter sample in a quarter that had been free of that major pathogen in previous samples in the sampling period). Longitudinal milk samplings of clinically normal udders taken over several 6-wk periods as well as samples from cows pre-dry-off and postcalving were used to this end (n=80,397 quarter milk samples). The effects of CNS and Corynebacterium spp. on the major mastitis pathogens Staph. aureus, Strep. uberis, Strep. dysgalactiae, and coliform bacteria (Escherichia coli and Klebsiella spp.) were investigated using risk ratio analyses and multilevel logistic regression models. Quarter-, cow- and herd-level susceptibility parameters were also evaluated and were able to account for the increased susceptibility that exists within herds, cows and quarters, removing it from estimates for the effects of the minor pathogens. Increased quarter-level susceptibility was associated with increased risk of major pathogen NIMI for all pathogens except the coliforms. Increased somatic cell count was consistently associated with elevated risk of new major pathogen infections, but this was

  20. Impact of genetic changes, pathogenicity and antigenicity on Enterovirus- A71 vaccine development.

    Science.gov (United States)

    Yee, Pinn Tsin Isabel; Laa Poh, Chit

    2017-06-01

    Enterovirus-A71 (EV-A71) is an etiological agent of the hand, foot and mouth disease (HFMD). EV-A71 infection produces high fever and ulcers in children. Some EV-A71 strains produce severe infections leading to pulmonary edema and death. Although the protective efficacy of the inactivated vaccine (IV) was ≥90% against mild HFMD, there was approximately 80% protection against severe HFMD. The monovalent EV-A71 IV elicits humoral immunity but lacks long-term immunogenicity. Spontaneous mutations of the EV-A71 genome could lead to antigenicity changes and the virus may not be neutralized by antibodies elicited by the IV. A better alternative would be the live attenuated vaccine (LAV) that elicits cellular and humoral immunity. The LAV induces excellent antigenicity and chances of reversion is reduced by presence of multiple mutations which could reduce pathogenicity. Besides CV-A16, outbreaks have been caused by CV-A6 and CV-A10, hence the development of bivalent and trivalent vaccines is required. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Using next-generation sequencing to develop molecular diagnostics for Pseudoperonospora cubensis, the cucurbit downy mildew pathogen

    Science.gov (United States)

    Advances in Next Generation Sequencing (NGS) allow for rapid development of genomics resources needed to generate molecular diagnostics assays for infectious agents. NGS approaches are particularly helpful for organisms that cannot be cultured, such as the downy mildew pathogens, a group of biotrop...

  2. Development of a rapid and simple Agrobacterium tumefaciens mediated transformation system for the fungal pathogen Heterobasidion annosum

    Science.gov (United States)

    Nicklas Samils; Malin Elfstrand; Daniel L. Lindner Czederpiltz; Jan Fahleson; Ake Olson; Christina Dixelius; Jan Stenlid

    2006-01-01

    Heterobasidion annosum causes root and butt-rot in trees and is the most serious forest pathogen in the northern hemisphere. We developed a rapid and simple Agrobacterium-mediated method of gene delivery into H. annosum to be used in functional studies of candidate genes and for visualization of mycelial interactions. Heterobasidion annosum TC 32-1 was cocultivated at...

  3. Equol, a Clinically Important Metabolite, Inhibits the Development and Pathogenicity of Magnaporthe oryzae, the Causal Agent of Rice Blast Disease

    Directory of Open Access Journals (Sweden)

    Jiaoyu Wang

    2017-10-01

    Full Text Available Equol, a metabolite of soybean isoflavone daidzein, has been proven to have various bioactivities related to human health, but little is known on its antifungal activity to plant fungal pathogens. Magnaporthe oryzae is a phytopathogenic fungus that causes rice blast, a devastating disease on rice. Here, we demonstrated that equol influences the development and pathogenicity of M. oryzae. Equol showed a significant inhibition to the mycelial growth, conidial generation and germination, and appressorial formation of M. oryzae. As a result, equol greatly reduced the virulence of M. oryzae on rice and barley leaves. The antifungal activity of equol was also found in several other plant fungal pathogens. These findings expand our knowledge on the bioactivities of equol.

  4. Handling technique of spore-forming bacteria in radiation sterilization. 2. Determination of numbers and radiation resistance of spores

    International Nuclear Information System (INIS)

    Koshikawa, Tomihiko

    1994-01-01

    Stepwise ten-fold dilution of bacterial solution is required in the determination of bacterial spores. For this, the selection of diluted solution is important according to the purpose of experiment. First, the preparation of suspension of bacterial spores and selection of diluted solution are presented. Then, a method for determining the number of bacterial spores in materials is outlined in terms of dilution methods of bacterial solution (shaking and homogenization) and application method of diluted solution to the plating medium. Finally, a method for determining radiation resistance of spore-forming bacteria is explained according to the measurement conditions (suspension of bacterial spores and filters applied with bacterial spores). (N.K.)

  5. Handling technique of spore-forming bacteria in radiation sterilization. 2. Determination of numbers and radiation resistance of spores

    Energy Technology Data Exchange (ETDEWEB)

    Koshikawa, Tomihiko [Japan Radioisotope Association, Shiga (Japan). Koka Laboratory

    1994-12-01

    Stepwise ten-fold dilution of bacterial solution is required in the determination of bacterial spores. For this, the selection of diluted solution is important according to the purpose of experiment. First, the preparation of suspension of bacterial spores and selection of diluted solution are presented. Then, a method for determining the number of bacterial spores in materials is outlined in terms of dilution methods of bacterial solution (shaking and homogenization) and application method of diluted solution to the plating medium. Finally, a method for determining radiation resistance of spore-forming bacteria is explained according to the measurement conditions (suspension of bacterial spores and filters applied with bacterial spores). (N.K.).

  6. Bacterial spores as possible contaminants of biomedical materials and devices. [Bacillus anthracis, clostridium botulinum, C. perfringens, C. tetani

    Energy Technology Data Exchange (ETDEWEB)

    Grecz, N; Kang, T

    1973-01-01

    Destruction of spores on biomedical devices in drugs, and biologicals is essential for prevention of infection of patients with pathogenic sporeformers. Of particular concern are Clostridium tetani, C. perfringens, C. botulinum, Bacillus anthracis and other sporeforming pathogens. Spores are ubiquitous in nature and contamination of biomedical devices varies depending on manufacturing process, handling, raw materials and other variables. In the last 20 years the number of cases per year of specific notifiable diseases in the United States was as follows: tetanus, 120 to 500 cases, botulism, 7 to 47 cases, and anthrax, 2 to 10 cases. Gas gangrene is caused by a mixed flora consisting predominantly of sporeformers. C botulinum, which usually acts as saprophytic agent of food poisoning, may also initiate pathogenic processes; there are nine cases on record in the United States of botulism wound infections almost half of which ended in death. The spores of these organisms are distinguished by high radiation resistance and their erradication often requires severe radiation treatments. Representative bacterial spores in various suspending media show D/sub 10/ values (dose necessary to destroy 90 percent of a given population) ranging from approximately 0.1 to 0.4 Mrad. Some viruses show D/sub 10/ values up to greater than 1 Mrad. The D/sub 10/-values of spores vary depending on physical, chemical and biological factors. This variability is important in evaluation and selection of biological indicator organisms. Radiation sterilization of biomedical devices and biomedical materials must provide safety from infectious microorganisms including radiation resistant spores and viruses.

  7. Ontogenetic characterization of sporangium and spore of Huperzia serrata: an anti-aging disease fern.

    Science.gov (United States)

    Long, Hua; Li, Jing; Li, You-You; Xie, De-Yu; Peng, Qing-Zhong; Li, Li

    2016-12-01

    Huperzia serrata is a medicinal plant used in Traditional Chinese Medicine, which has been used to prevent against aging diseases. It is mainly propagated by spores and grows extremely slowly. Due to severe harvest, it is a highly endangered species. In this report, we characterize ontogenesis of sporangia and spores that are associated with propagation. A wild population of H. serrata plants is localized in western Hunan province, China and protected by Chinese Government to study its development (e.g. sporangia and spores) and ecology. Both field and microscopic observations were conducted for a few of years. The development of sporangia from their initiation to maturation took nearly 1 year. Microscopic observations showed that the sporangial walls were developed from epidermal cells via initiation, cell division, and maturation. The structure of the mature sporangial wall is composed of one layer of epidermis, two middle layers of cells, and one layer of tapetum. Therefore, the sporangium is the eusporangium type. Spore development is characterized into six stages, initiation from epidermal cell and formation of sporogenous cells, primary sporogenous cell, secondary sporogenous cell, spore mother cell, tetrad, and maturation. The sporangial development of H. serrata belongs to the eusporangium type. The development takes approximately 1 year period from the initiation to the maturation. These data are useful for improving propagation of this medicinal plant in the future.

  8. The influence of sporulation conditions on the spore coat protein composition of Bacillus subtilis spores.

    OpenAIRE

    Wishwas R. Abhyankar; Wishwas R. Abhyankar; Kiki Kamphorst; Bhagyashree N. Swarge; Bhagyashree N. Swarge; Henk van Veen; Nicole N. van der Wel; Stanley Brul; Chris G. de Koster; Leo J. de Koning

    2016-01-01

    Spores are of high interest to the food and health sectors because of their extreme resistance to harsh conditions, especially against heat. Earlier research has shown that spores prepared on solid agar plates have a higher heat resistance than those prepared under a liquid medium condition. It has also been shown that the more mature a spore is, the higher is its heat resistance most likely mediated, at least in part, by the progressive cross-linking of coat proteins. The current study for t...

  9. The Influence of Sporulation Conditions on the Spore Coat Protein Composition of Bacillus subtilis Spores

    OpenAIRE

    Abhyankar, Wishwas R.; Kamphorst, Kiki; Swarge, Bhagyashree N.; van Veen, Henk; van der Wel, Nicole N.; Brul, Stanley; de Koster, Chris G.; de Koning, Leo J.

    2016-01-01

    Spores are of high interest to the food and health sectors because of their extreme resistance to harsh conditions, especially against heat. Earlier research has shown that spores prepared on solid agar plates have a higher heat resistance than those prepared under a liquid medium condition. It has also been shown that the more mature a spore is, the higher is its heat resistance most likely mediated, at least in part, by the progressive cross-linking of coat proteins. The current study for t...

  10. MYT3, a Myb-like transcription factor, affects fungal development and pathogenicity of Fusarium graminearum.

    Directory of Open Access Journals (Sweden)

    Yongsoo Kim

    Full Text Available We previously characterized members of the Myb protein family, MYT1 and MYT2, in Fusarium graminearum. MYT1 and MYT2 are involved in female fertility and perithecium size, respectively. To expand knowledge of Myb proteins in F. graminearum, in this study, we characterized the functions of the MYT3 gene, which encodes a putative Myb-like transcription factor containing two Myb DNA-binding domains and is conserved in the subphylum Pezizomycotina of Ascomycota. MYT3 proteins were localized in nuclei during most developmental stages, suggesting the role of MYT3 as a transcriptional regulator. Deletion of MYT3 resulted in impairment of conidiation, germination, and vegetative growth compared to the wild type, whereas complementation of MYT3 restored the wild-type phenotype. Additionally, the Δmyt3 strain grew poorly on nitrogen-limited media; however, the mutant grew robustly on minimal media supplemented with ammonium. Moreover, expression level of nitrate reductase gene in the Δmyt3 strain was decreased in comparison to the wild type and complemented strain. On flowering wheat heads, the Δmyt3 strain exhibited reduced pathogenicity, which corresponded with significant reductions in trichothecene production and transcript levels of trichothecene biosynthetic genes. When the mutant was selfed, mated as a female, or mated as a male for sexual development, perithecia were not observed on the cultures, indicating that the Δmyt3 strain lost both male and female fertility. Taken together, these results demonstrate that MYT3 is required for pathogenesis and sexual development in F. graminearum, and will provide a robust foundation to establish the regulatory networks for all Myb-like proteins in F. graminearum.

  11. Spore analysis and tetrad dissection of Schizosaccharomyces pombe

    DEFF Research Database (Denmark)

    Ekwall, Karl; Thon, Genevieve

    2017-01-01

    Here we describe the processing of Schizosaccharomyces pombe spores in batches (random spore analysis) or through tetrad dissections. Spores are usually prepared from matings between haploid strains (producing zygotic asci) or from sporulating diploids (producing azygotic asci). In random spore...

  12. Dendritic Cells Endocytose Bacillus Anthracis Spores: Implications for Anthrax Pathogenesis

    National Research Council Canada - National Science Library

    Brittingham, Katherine C; Ruthel, Gordon; Panchal, Rekha G; Fuller, Claudette L; Ribot, Wilson J

    2005-01-01

    Phagocytosis of inhaled Bacillus anthracis spores and subsequent trafficking to lymph nodes are decisive events in the progression of inhaled anthrax because they initiate germination and dissemination of spores...

  13. Comparison of hand hygiene procedures for removing Bacillus cereus spores.

    Science.gov (United States)

    Sasahara, Teppei; Hayashi, Shunji; Hosoda, Kouichi; Morisawa, Yuji; Hirai, Yoshikazu

    2014-01-01

    Bacillus cereus is a spore-forming bacterium. B. cereus occasionally causes nosocomial infections, in which hand contamination with the spores plays an important role. Therefore, hand hygiene is the most important practice for controlling nosocomial B. cereus infections. This study aimed to determine the appropriate hand hygiene procedure for removing B. cereus spores. Thirty volunteers' hands were experimentally contaminated with B. cereus spores, after which they performed 6 different hand hygiene procedures. We compared the efficacy of the procedures in removing the spores from hands. The alcohol-based hand-rubbing procedures scarcely removed them. The soap washing procedures reduced the number of spores by more than 2 log10. Extending the washing time increased the spore-removing efficacy of the washing procedures. There was no significant difference in efficacy between the use of plain soap and antiseptic soap. Handwashing with soap is appropriate for removing B. cereus spores from hands. Alcohol-based hand-rubbing is not effective.

  14. Fifth international fungus spore conference. [Abstracts]: Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    Timberlake, W.E.

    1993-04-01

    This folio contains the proceedings of the Fifth International Fungal Spore Conference held August 17-21, 1991 at the Unicoi State Park at Helen, Georgia. The volume contains abstracts of each oral presentation as well as a collection of abstracts describing the poster sessions. Presentations were organized around the themes (1) Induction of Sporulation, (2) Nuclear Division, (3) Spore Formation, (4) Spore Release and Dispersal, and (4) Spore Germination.

  15. COXIELLA BURNETII PATHOGENICITY MOLECULAR BASIS

    Directory of Open Access Journals (Sweden)

    Yu. A. Panferova

    2016-01-01

    Full Text Available Coxiella burnetii is an obligate intracellular gram-negative bacterial pathogen, an ethiological agent of Q-fever, a zoonotic disease, elapsing as an acute (mostly atypical pneumonia or a chronic (mostly endocarditis form. The host range is represented by wide range of mammal, avian and arthropod species, but the main source of human infection are farm animals. The main route of infection is aerosolic. In case of contact with organism pathogen binds with phagocytal monocytic-macrophagal cell line. C. burnetii promotes maturation of specific phagolysosome-like compartment in host cell, called coxiella-containing vacuole, within this vacuole pathogen becames metabolically activated and actively replicates. Coxiella persists as metabolically inactive spore-like form in environment. Internalisation of C. burnetii occurs using actin-mediated phagocytosis and zipper mechanism. After internalization of bacteria maturation of phagolysosome-like compartment and large coxiella-containing vacuole formation occure, and vacuole can occupy nearly the whole cytoplasm of the host cell. Survivance of infected cells is important for chronic infection with C. burnetii. C. burnetii elongate the viability of host cell by two ways: it actively inhibits apoptotic signal cascades and induce pro-survival factors. Exceptthat C. burnetii involves autophagic pathway during coxiella-containing vacuole formation, and induction of autophagy promotes pathogen replication. During infection C. burnetii translocates effector substrates from bacterial cytosole to euca ryotic host cell cytosole using type IV secretion system, where effectors modulate host cell proteins. Overall approximately 130 secreted effectors of type IV transport system, but function of most of them remains unknown to date. Specific sec reted proteins for variety of strains and isolates were identified, confirmed that certain pathotypes of C. burnetii can exist. Identification and

  16. Imaging bacterial spores by soft-x-ray microscopy

    International Nuclear Information System (INIS)

    Stead, A.D.; Ford, T.W.; Judge, J.

    1997-01-01

    Bacterial spores are able to survive dehydration, but neither the physiological nor structural basis of this have been fully elucidated. Furthermore, once hydrated, spores often require activation before they will germinate. Several treatments can be used to activate spores, but in the case of Bacillus subtlis the most effective is heat treatment. The physiological mechanism associated with activation is also not understood, but some workers suggest that the loss of calcium from the spores may be critical. However, just prior to germination, the spores change from being phase bright to phase dark when viewed by light microscopy. Imaging spores by soft x-ray microscopy is possible without fixation. Thus, in contrast to electron microscopy, it is possible to compare the structure of dehydrated and hydrated spores in a manner not possible previously. A further advantage is that it is possible to monitor individual spores by phase contrast light microscopy immediately prior to imaging with soft x-rays; whereas, with both electron microscopy and biochemical studies, it is a population of spores being studied without knowledge of the phase characteristics of individual spores. This study has therefore tried to compare dehydrated and hydrated spores and to determine if there is a mass loss from individual spores as they pass the transition from being phase bright to phase dark

  17. Use of yeast spores for microencapsulation of enzymes.

    Science.gov (United States)

    Shi, Libing; Li, Zijie; Tachikawa, Hiroyuki; Gao, Xiao-Dong; Nakanishi, Hideki

    2014-08-01

    Here, we report a novel method to produce microencapsulated enzymes using Saccharomyces cerevisiae spores. In sporulating cells, soluble secreted proteins are transported to the spore wall. Previous work has shown that the spore wall is capable of retaining soluble proteins because its outer layers work as a diffusion barrier. Accordingly, a red fluorescent protein (RFP) fusion of the α-galactosidase, Mel1, expressed in spores was observed in the spore wall even after spores were subjected to a high-salt wash in the presence of detergent. In vegetative cells, however, the cell wall cannot retain the RFP fusion. Although the spore wall prevents diffusion of proteins, it is likely that smaller molecules, such as sugars, pass through it. In fact, spores can contain much higher α-galactosidase activity to digest melibiose than vegetative cells. When present in the spore wall, the enzyme acquires resistance to environmental stresses including enzymatic digestion and high temperatures. The outer layers of the spore wall are required to retain enzymes but also decrease accessibility of the substrates. However, mutants with mild spore wall defects can retain and stabilize the enzyme while still permitting access to the substrate. In addition to Mel1, we also show that spores can retain the invertase. Interestingly the encapsulated invertase has significantly lower activity toward raffinose than toward sucrose.This suggests that substrate selectivity could be altered by the encapsulation.

  18. Imaging bacterial spores by soft-x-ray microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Stead, A.D.; Ford, T.W. [Univ. of London, Surrey (United Kingdom); Judge, J. [Unilever plc, Sharnbrook (United Kingdom)] [and others

    1997-04-01

    Bacterial spores are able to survive dehydration, but neither the physiological nor structural basis of this have been fully elucidated. Furthermore, once hydrated, spores often require activation before they will germinate. Several treatments can be used to activate spores, but in the case of Bacillus subtlis the most effective is heat treatment. The physiological mechanism associated with activation is also not understood, but some workers suggest that the loss of calcium from the spores may be critical. However, just prior to germination, the spores change from being phase bright to phase dark when viewed by light microscopy. Imaging spores by soft x-ray microscopy is possible without fixation. Thus, in contrast to electron microscopy, it is possible to compare the structure of dehydrated and hydrated spores in a manner not possible previously. A further advantage is that it is possible to monitor individual spores by phase contrast light microscopy immediately prior to imaging with soft x-rays; whereas, with both electron microscopy and biochemical studies, it is a population of spores being studied without knowledge of the phase characteristics of individual spores. This study has therefore tried to compare dehydrated and hydrated spores and to determine if there is a mass loss from individual spores as they pass the transition from being phase bright to phase dark.

  19. Expression and characterization of a novel spore wall protein from ...

    African Journals Online (AJOL)

    Microsporidia are obligate intracellular, eukaryotic, spore-forming parasites. The environmentally resistant spores, which harbor a rigid cell wall, are critical for their survival outside their host cells and host-to-host transmission. The spore wall comprises two major layers: the exospore and the endospore. In Nosema ...

  20. Pathogenic factors associated with development of disseminated intravascular coagulopathy (DIC) in a tertiary academic hospital in South Africa.

    Science.gov (United States)

    Mayne, Elizabeth S; Mayne, Anthony L H; Louw, Susan J

    2018-01-01

    Disseminated intravascular coagulopathy (DIC) is a thrombotic microangiopathy arising from consumption of both coagulation factors and platelets. DIC is triggered by a number of clinical conditions including severe infection, trauma and obstetric complications. Early diagnosis and treatment of the underlying condition is paramount. A high clinical index of suspicion is needed to ensure that patients at risk of developing DIC are appropriately investigated. In order to establish the clinical conditions most frequently associated with DIC, we reviewed all DIC screens received at a tertiary hospital in Johannesburg, South Africa over a 1 year period. The commonest clinical condition associated with DIC in our population was infection with 84% of patients infected with an identified pathogen. The most frequently diagnosed pathogen was HIV followed by Mycobacterium tuberculosis and other bacterial infections. In the majority of cases, bacteria were isolated from blood cultures. In 47 patients, HIV was the only pathogen which could be isolated. A relative risk ratio of 2.73 and an odds ratio of 29.97 was attributed to HIV for development of a DIC. A malignancy was present in 51 of the patients of which approximately 60% had co-existing infection. No cause could be attributed in 30 patients. Infection was identified in the majority of the patients diagnosed with DIC in this study. HIV showed the highest relative risk ratio of all pathogens although previous studies have not suggested that HIV was strongly associated with DIC. In almost half of the HIV infected patients, there was no other pathogen isolated despite extensive investigation. This suggests that HIV has a strong association with the development of DIC, warranting further research into the relationship between HIV and disseminated microvascular thrombosis.

  1. DISTRIBUTION ET ABONDANCE DE SPORES DE CHAMPIGNONS ...

    African Journals Online (AJOL)

    AISA

    (PCR) des racines échantillonnées et le comptage directe des spores des sols échantillonnés ont permis ... cowpea, sing the PCR technique, reveal that this plant was an efficient host for ..... genes from vesicular-arbuscular endomy- ...

  2. Pollen and spores of terrestrial plants

    Science.gov (United States)

    Bernhardt, Christopher E.; Willard, Debra A.; Shennan, Ian; Long, Antony J.; Horton, Benjamin P.

    2015-01-01

    Pollen and spores are valuable tools in reconstructing past sea level and climate because of their ubiquity, abundance, and durability as well as their reciprocity with source vegetation to environmental change (Cronin, 1999; Traverse, 2007; Willard and Bernhardt, 2011). Pollan is found in many sedimentary environments, from freshwater to saltwater, terrestrial to marine. It can be abundant in a minimal amount of sample material, for example half a gram, as concentrations can be as high as four million grains per gram (Traverse, 2007). The abundance of pollen in a sample lends it to robust statistical analysis for the quantitative reconstruction of environments. The outer cell wall is resistant to decay in sediments and allows palynomorphs (pollen and spores) to record changes in plant communities and sea level over millions of years. These characteristics make pollen and spores a powerful tool to use in sea-level research.This chapter describes the biology of pollen and spores and how they are transported and preserved in sediments. We present a methodology for isolating pollen from sediments and a general language and framework to identify pollen as well as light micrographs of a selection of common pollen grains, We then discuss their utility in sea-level research.

  3. Detecting bacterial spores in soup manufacturing

    NARCIS (Netherlands)

    van Zuijlen, A.C.M.; Oomes, S.J.C.M.; Vos, P.; Brul, S.

    2009-01-01

    Spores from mesophilic aerobic sporeforming bacteria (Bacillus) are sometimes able to survive the thermal process of commercial sterile products and sporadically cause spoilage or food poisoning. Because of an increasing demand for more fresh products, ideally the processing temperatures should be

  4. Paleozoic in situ spores and pollen. Lycopsida

    Czech Academy of Sciences Publication Activity Database

    Bek, Jiří

    2017-01-01

    Roč. 296, 1/6 (2017), s. 1-111 ISSN 0375-0299 R&D Projects: GA ČR GAP210/12/2053 Institutional support: RVO:67985831 Keywords : in situ spores * reproductive organs * Lycopsida * Paleozoic Sub ject RIV: DB - Geology ; Mineralogy OBOR OECD: Paleontology Impact factor: 1.333, year: 2016

  5. Can spores survive in interstellar space

    Energy Technology Data Exchange (ETDEWEB)

    Weber, P.; Greenberg, J.M.

    1985-08-01

    Inactivation of spores (Bacillus subtilis) has been investigated in the laboratory by vacuum ultraviolet radiation in simulated interstellar conditions. Damage produced at the normal interstellar particle temperature of 10 K is less than at higher temperatures: the major damage being produced by radiation in the 2,000-3,000 A range. The results place constraints on the panspermia hypothesis. (author).

  6. Modeling to control spores in raw milk

    NARCIS (Netherlands)

    Vissers, M.

    2007-01-01

    A modeling approach was used to identify measures at the farm that reduce transmission of microorganisms to raw milk. Butyric acid bacteria (BAB) and Bacillus cereus were used as case-studies. Minimizing the concentration of BAB spores in raw milk is important to prevent late-blowing of Gouda-type

  7. Phospholipase Cδ regulates germination of Dictyostelium spores

    NARCIS (Netherlands)

    Dijken, Peter van; Haastert, Peter J.M. van

    2001-01-01

    Background: Many eukaryotes, including plants and fungi make spores that resist severe environmental stress. The micro-organism Dictyostelium contains a single phospholipase C gene (PLC); deletion of the gene has no effect on growth, cell movement and differentiation. In this report we show that PLC

  8. Development of recombinant antibody technology for application in plant pathogen diagnosis

    NARCIS (Netherlands)

    Griep, R.

    1999-01-01

    This thesis describes the applicability of the novel phage display technique to select plant-pathogen-specific monoclonal antibodies (MAbs) from combinatorial antibody libraries. The retrieved MAbs are so specific that they can be used as diagnostic tools in sensitive immunoassays for the

  9. Development of a European resource on the origins of pathogens of aquaculture: The Europa Project

    DEFF Research Database (Denmark)

    Snow, M.; Barja, J.; Colquhoun, D.

    2004-01-01

    This workshop described the EUROPA project, an EU-funded program aimed at creating a web-based database of molecular sequence data-sets related to significant pathogens of aquaculture. The project aims to focus the efforts of fish health researchers into generating large, evolving and readily ava...

  10. Natural Diversity in Heat Resistance of Bacteria and Bacterial Spores: Impact on Food Safety and Quality.

    Science.gov (United States)

    den Besten, Heidy M W; Wells-Bennik, Marjon H J; Zwietering, Marcel H

    2018-03-25

    Heat treatments are widely used in food processing often with the aim of reducing or eliminating spoilage microorganisms and pathogens in food products. The efficacy of applying heat to control microorganisms is challenged by the natural diversity of microorganisms with respect to their heat robustness. This review gives an overview of the variations in heat resistances of various species and strains, describes modeling approaches to quantify heat robustness, and addresses the relevance and impact of the natural diversity of microorganisms when assessing heat inactivation. This comparison of heat resistances of microorganisms facilitates the evaluation of which (groups of) organisms might be troublesome in a production process in which heat treatment is critical to reducing the microbial contaminants, and also allows fine-tuning of the process parameters. Various sources of microbiological variability are discussed and compared for a range of species, including spore-forming and non-spore-forming pathogens and spoilage organisms. This benchmarking of variability factors gives crucial information about the most important factors that should be included in risk assessments to realistically predict heat inactivation of bacteria and spores as part of the measures for controlling shelf life and safety of food products.

  11. Pathogenic specifics of development of vegetative dysfunction in adolescents in relation to their morphological status

    Directory of Open Access Journals (Sweden)

    O. Skyba

    2017-02-01

    Full Text Available Exploring the mechanisms of vegetative regulation in children and adolescents of different somatotypes has a prognostic value in regard to the character of adaptive reactions of the organism, as it facilitates the identification of the risk factors of pathological processes and states of vegetative systems, which may cause chronic illness in adulthood. The author defines the pathogenic specifics of development of vegetative dysfunction in adolescents in relation to their morphological status. Cardiointervalography and anthropometric, mathematical and statistical methods of research were used. Based on the results of cardiointervalography, the structure of initial vegetative tonus was established, which was characterized by prevalence of eutonia (38.4 ± 4.9%. The specific weight with background eutonia of adolescent boys and girls tended to be higher among the representatives of the thoracic and muscular somatotypes, compared to adolescents of the alimentive and osseous somatotypes (Р < 0.001–0.05. The established specifics indicate that thoracic and muscular somatotypes ensure optimal adaptation of organisms to the environment. Sympathicotonia was measured among the majority of boys of extreme constitutional variants (alimentive and osseous somatotypes (36.3% and 30.0% respectively, which demonstrates the activation of adaptive mechanisms in the abovementioned category of examined adolescents, while among girls this phenomenon was evident among the representatives of the osseous and thoracic somatotypes (38.5% and 30.8% respectively. We found that the majority of examined adolescents (53.4% had a normal vegetative reactivity. Gender differences in the structure of vegetative reactivity of adolescents could well be explained by the higher number of girls of asympaticotonic type (19.2% compared to boys (7.3%, Р < 0.05. Furthermore, we found that hypersympathicotonic and asympathicotonic types of vegetative reactivity were characteristic of

  12. Development and validation of a mathematical model for growth of pathogens in cut melons.

    Science.gov (United States)

    Li, Di; Friedrich, Loretta M; Danyluk, Michelle D; Harris, Linda J; Schaffner, Donald W

    2013-06-01

    Many outbreaks of foodborne illness associated with the consumption of fresh-cut melons have been reported. The objective of our research was to develop a mathematical model that predicts the growth rate of Salmonella on fresh-cut cantaloupe over a range of storage temperatures and to validate that model by using Salmonella and Escherichia coli O157:H7 on cantaloupe, honeydew, and watermelon, using both new data and data from the published studies. The growth of Salmonella on honeydew and watermelon and E. coli O157:H7 on cantaloupe, honeydew, and watermelon was monitored at temperatures of 4 to 25°C. The Ratkowsky (or square-root model) was used to describe Salmonella growth on cantaloupe as a function of storage temperature. Our results show that the levels of Salmonella on fresh-cut cantaloupe with an initial load of 3 log CFU/g can reach over 7 log CFU/g at 25°C within 24 h. No growth was observed at 4°C. A linear correlation was observed between the square root of Salmonella growth rate and temperature, such that √growth rate = 0.026 × (T - 5.613), R(2) = 0.9779. The model was generally suitable for predicting the growth of both Salmonella and E. coli O157:H7 on cantaloupe, honeydew, and watermelon, for both new data and data from the published literature. When compared with existing models for growth of Salmonella, the new model predicts a theoretic minimum growth temperature similar to the ComBase Predictive Models and Pathogen Modeling Program models but lower than other food-specific models. The ComBase Prediction Models results are very similar to the model developed in this study. Our research confirms that Salmonella can grow quickly and reach high concentrations when cut cantaloupe is stored at ambient temperatures, without visual signs of spoilage. Our model provides a fast and cost-effective method to estimate the effects of storage temperature on fresh-cut melon safety and could also be used in subsequent quantitative microbial risk

  13. Effectiveness of various cleaning and disinfectant products on Clostridium difficile spores of PCR ribotypes 010, 014 and 027

    NARCIS (Netherlands)

    Kenters, N.; Huijskens, E.G.; Wit, S.C.J. de; Sanders, I.; Rosmalen, J. van; Kuijper, E.J.; Voss, A.

    2017-01-01

    BACKGROUND: In healthcare facilities, Clostridium difficile infections spread by transmission of bacterial spores. Appropriate sporicidal disinfectants are needed to prevent development of clusters and outbreaks. In this study different cleaning/disinfecting wipes and sprays were tested for their

  14. Effectiveness of various cleaning and disinfectant products on Clostridium difficile spores of PCR ribotypes 010, 014 and 027

    NARCIS (Netherlands)

    Kenters, N.; E. Huijskens (Elisabeth); de Wit, S.C.J.; Sanders, I.G.J.M.; J.M. van Rosmalen (Joost); E. Kuijper; Voss, A.

    2017-01-01

    textabstractBackground: In healthcare facilities, Clostridium difficile infections spread by transmission of bacterial spores. Appropriate sporicidal disinfectants are needed to prevent development of clusters and outbreaks. In this study different cleaning/disinfecting wipes and sprays were tested

  15. Computational Fluid Dynamics Modeling of Bacillus anthracis Spore Deposition in Rabbit and Human Respiratory Airways

    Energy Technology Data Exchange (ETDEWEB)

    Kabilan, Senthil; Suffield, Sarah R.; Recknagle, Kurtis P.; Jacob, Rick E.; Einstein, Daniel R.; Kuprat, Andrew P.; Carson, James P.; Colby, Sean M.; Saunders, James H.; Hines, Stephanie; Teeguarden, Justin G.; Straub, Tim M.; Moe, M.; Taft, Sarah; Corley, Richard A.

    2016-09-30

    Three-dimensional computational fluid dynamics and Lagrangian particle deposition models were developed to compare the deposition of aerosolized Bacillus anthracis spores in the respiratory airways of a human with that of the rabbit, a species commonly used in the study of anthrax disease. The respiratory airway geometries for each species were derived from computed tomography (CT) or µCT images. Both models encompassed airways that extended from the external nose to the lung with a total of 272 outlets in the human model and 2878 outlets in the rabbit model. All simulations of spore deposition were conducted under transient, inhalation-exhalation breathing conditions using average species-specific minute volumes. The highest exposure concentration was modeled in the rabbit based upon prior acute inhalation studies. For comparison, human simulation was also conducted at the same concentration. Results demonstrated that regional spore deposition patterns were sensitive to airway geometry and ventilation profiles. Due to the complex airway geometries in the rabbit nose, higher spore deposition efficiency was predicted in the upper conducting airways compared to the human at the same air concentration of anthrax spores. As a result, higher particle deposition was predicted in the conducting airways and deep lung of the human compared to the rabbit lung due to differences in airway branching pattern. This information can be used to refine published and ongoing biokinetic models of inhalation anthrax spore exposures, which currently estimate deposited spore concentrations based solely upon exposure concentrations and inhaled doses that do not factor in species-specific anatomy and physiology.

  16. Effective Thermal Inactivation of the Spores of Bacillus cereus Biofilms Using Microwave.

    Science.gov (United States)

    Park, Hyong Seok; Yang, Jungwoo; Choi, Hee Jung; Kim, Kyoung Heon

    2017-07-28

    Microwave sterilization was performed to inactivate the spores of biofilms of Bacillus cereus involved in foodborne illness. The sterilization conditions, such as the amount of water and the operating temperature and treatment time, were optimized using statistical analysis based on 15 runs of experimental results designed by the Box-Behnken method. Statistical analysis showed that the optimal conditions for the inactivation of B. cereus biofilms were 14 ml of water, 108°C of temperature, and 15 min of treatment time. Interestingly, response surface plots showed that the amount of water is the most important factor for microwave sterilization under the present conditions. Complete inactivation by microwaves was achieved in 5 min, and the inactivation efficiency by microwave was obviously higher than that by conventional steam autoclave. Finally, confocal laser scanning microscopy images showed that the principal effect of microwave treatment was cell membrane disruption. Thus, this study can contribute to the development of a process to control food-associated pathogens.

  17. Deposition of Bacillus subtilis spores using an airbrush-spray or spots to study surface decontamination by pulsed light.

    Science.gov (United States)

    Levy, Caroline; Bornard, Isabelle; Carlin, Frédéric

    2011-02-01

    Microbial contamination on surfaces of food processing equipment is a major concern in industries. A new method to inoculate a single-cell layer (monolayer) of microorganisms onto polystyrene was developed, using a deposition with an airbrush. A homogeneous dispersion of Bacillus subtilis DSM 402 spores sprayed on the surface was observed using both plate count and scanning electron microscopy. No clusters were found, even with high spore concentrations (10(7) spores/inoculated surface). A monolayer of microorganisms was also obtained after deposition of 10 μL droplets containing 3×10(4) spores/spot on polystyrene disks, but not with a higher spore concentration. Pulsed light (PL) applied to monolayers of B. subtilis spores allowed log reductions higher than 6. As a consequence of clusters formation in spots of 10 μL containing more than 3×10(5) spores, log reductions obtained by PL were significantly lower. The comparative advantages of spot and spray depositions were discussed. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Kang Zhang

    2018-05-01

    Full Text Available A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea. A novel pathogenicity-related gene BcKMO, which encodes kynurenine 3-monooxygenase (KMO, was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO-complementing mutant (BCG183/BcKMO were similar to those of the wild-type (WT strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/BcKMO. Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H2O2, and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP and mitogen-activated protein kinase (MAPK signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1, Pka2, PkaR, Bcg2, Bcg3, bmp1, and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea. Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea.

  19. The Kynurenine 3-Monooxygenase Encoding Gene, BcKMO, Is Involved in the Growth, Development, and Pathogenicity of Botrytis cinerea.

    Science.gov (United States)

    Zhang, Kang; Yuan, Xuemei; Zang, Jinping; Wang, Min; Zhao, Fuxin; Li, Peifen; Cao, Hongzhe; Han, Jianmin; Xing, Jihong; Dong, Jingao

    2018-01-01

    A pathogenic mutant, BCG183, was obtained by screening the T-DNA insertion library of Botrytis cinerea . A novel pathogenicity-related gene BcKMO , which encodes kynurenine 3-monooxygenase (KMO), was isolated and identified via thermal asymmetric interlaced PCR, bioinformatics analyses, and KMO activity measurement. The mutant BCG183 grew slowly, did not produce conidia and sclerotia, had slender hyphae, and presented enhanced pathogenicity. The phenotype and pathogenicity of the BcKMO -complementing mutant (BCG183/ BcKMO ) were similar to those of the wild-type (WT) strain. The activities of polymethylgalacturonase, polygalacturonase, and toxins were significantly higher, whereas acid production was significantly decreased in the mutant BCG183, when compared with those in the WT and BCG183/ BcKMO . Moreover, the sensitivity of mutant BCG183 to NaCl and KCl was remarkably increased, whereas that to fluconazole, Congo Red, menadione, H 2 O 2 , and SQ22536 and U0126 [cAMP-dependent protein kinase (cAMP) and mitogen-activated protein kinase (MAPK) signaling pathways inhibitors, respectively] were significantly decreased compared with the other strains. Furthermore, the key genes involved in the cAMP and MAPK signaling pathways, Pka1 , Pka2 , PkaR , Bcg2 , Bcg3 , bmp1 , and bmp3, were significantly upregulated or downregulated in the mutant BCG183. BcKMO expression levels were also upregulated or downregulated in the RNAi mutants of the key genes involved in the cAMP and MAPK signaling pathways. These findings indicated that BcKMO positively regulates growth and development, but negatively regulates pathogenicity of B. cinerea . Furthermore, BcKMO was found to be involved in controlling cell wall degrading enzymes activity, toxins activity, acid production, and cell wall integrity, and participate in cAMP and MAPK signaling pathways of B. cinerea .

  20. Identification of a Novel Lipoprotein Regulator of Clostridium difficile Spore Germination.

    Directory of Open Access Journals (Sweden)

    Kelly A Fimlaid

    2015-10-01

    Full Text Available Clostridium difficile is a Gram-positive spore-forming pathogen and a leading cause of nosocomial diarrhea. C. difficile infections are transmitted when ingested spores germinate in the gastrointestinal tract and transform into vegetative cells. Germination begins when the germinant receptor CspC detects bile salts in the gut. CspC is a subtilisin-like serine pseudoprotease that activates the related CspB serine protease through an unknown mechanism. Activated CspB cleaves the pro-SleC zymogen, which allows the activated SleC cortex hydrolase to degrade the protective cortex layer. While these regulators are essential for C. difficile spores to outgrow and form toxin-secreting vegetative cells, the mechanisms controlling their function have only been partially characterized. In this study, we identify the lipoprotein GerS as a novel regulator of C. difficile spore germination using targeted mutagenesis. A gerS mutant has a severe germination defect and fails to degrade cortex even though it processes SleC at wildtype levels. Using complementation analyses, we demonstrate that GerS secretion, but not lipidation, is necessary for GerS to activate SleC. Importantly, loss of GerS attenuates the virulence of C. difficile in a hamster model of infection. Since GerS appears to be conserved exclusively in related Peptostreptococcaeace family members, our results contribute to a growing body of work indicating that C. difficile has evolved distinct mechanisms for controlling the exit from dormancy relative to B. subtilis and other spore-forming organisms.

  1. Roles of Forkhead-box Transcription Factors in Controlling Development, Pathogenicity, and Stress Response in Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Jaejin Park

    2014-06-01

    Full Text Available Although multiple transcription factors (TFs have been characterized via mutagenesis to understand their roles in controlling pathogenicity and infection-related development in Magnaporthe oryzae, the causal agent of rice blast, if and how forkhead-box (FOX TFs contribute to these processes remain to be characterized. Four putative FOX TF genes were identified in the genome of M. oryzae, and phylogenetic analysis suggested that two of them (MoFKH1 and MoHCM1 correspond to Ascomycota-specific members of the FOX TF family while the others (MoFOX1 and MoFOX2 are Pezizomycotina-specific members. Deletion of MoFKH1 (ΔMofkh1 resulted in reduced mycelial growth and conidial germination, abnormal septation and stress response, and reduced virulence. Similarly, ΔMohcm1 exhibited reduced mycelial growth and conidial germination. Conidia of ΔMofkh1 and ΔMohcm1 were more sensitive to one or both of the cell cycle inhibitors hydroxyurea and benomyl, suggesting their role in cell cycle control. On the other hand, loss of MoFOX1 (ΔMofox1 did not show any noticeable changes in development, pathogenicity, and stress response. Deletion of MoFOX2 was not successful even after repeated attempts. Taken together, these results suggested that MoFKH1 and Mo-HCM1 are important in fungal development and that MoFKH1 is further implicated in pathogenicity and stress response in M. oryzae.

  2. Adaptation of the spore discharge mechanism in the basidiomycota.

    Directory of Open Access Journals (Sweden)

    Jessica L Stolze-Rybczynski

    Full Text Available Spore discharge in the majority of the 30,000 described species of Basidiomycota is powered by the rapid motion of a fluid droplet, called Buller's drop, over the spore surface. In basidiomycete yeasts, and phytopathogenic rusts and smuts, spores are discharged directly into the airflow around the fungal colony. Maximum discharge distances of 1-2 mm have been reported for these fungi. In mushroom-forming species, however, spores are propelled over much shorter ranges. In gilled mushrooms, for example, discharge distances of <0.1 mm ensure that spores do not collide with opposing gill surfaces. The way in which the range of the mechanism is controlled has not been studied previously.In this study, we report high-speed video analysis of spore discharge in selected basidiomycetes ranging from yeasts to wood-decay fungi with poroid fruiting bodies. Analysis of these video data and mathematical modeling show that discharge distance is determined by both spore size and the size of the Buller's drop. Furthermore, because the size of Buller's drop is controlled by spore shape, these experiments suggest that seemingly minor changes in spore morphology exert major effects upon discharge distance.This biomechanical analysis of spore discharge mechanisms in mushroom-forming fungi and their relatives is the first of its kind and provides a novel view of the incredible variety of spore morphology that has been catalogued by traditional taxonomists for more than 200 years. Rather than representing non-selected variations in micromorphology, the new experiments show that changes in spore architecture have adaptive significance because they control the distance that the spores are shot through air. For this reason, evolutionary modifications to fruiting body architecture, including changes in gill separation and tube diameter in mushrooms, must be tightly linked to alterations in spore morphology.

  3. Development of a Nordic system for measuring the inactivation of pathogens during composting

    DEFF Research Database (Denmark)

    Christensen, Kasper Kjellberg; Møller, Kaare; Hockenhull, John

    The report presents the results of a study initiated to prepare a full-scale investigation for evaluating the inactivation of pathogens during composting of biodegradable waste by means of a direct evaluation. On the basis of the presented study it is recommended to include the direct procees...... evaluation in the Nordic full-scale investigation for evaluating the sanitary aspects of composting biodegradable waste...

  4. Label-Free Detection of Bacillus anthracis Spore Uptake in Macrophage Cells Using Analytical Optical Force Measurements.

    Science.gov (United States)

    Hebert, Colin G; Hart, Sean; Leski, Tomasz A; Terray, Alex; Lu, Qin

    2017-10-03

    Understanding the interaction between macrophage cells and Bacillus anthracis spores is of significant importance with respect to both anthrax disease progression, spore detection for biodefense, as well as understanding cell clearance in general. While most detection systems rely on specific molecules, such as nucleic acids or proteins and fluorescent labels to identify the target(s) of interest, label-free methods probe changes in intrinsic properties, such as size, refractive index, and morphology, for correlation with a particular biological event. Optical chromatography is a label free technique that uses the balance between optical and fluidic drag forces within a microfluidic channel to determine the optical force on cells or particles. Here we show an increase in the optical force experienced by RAW264.7 macrophage cells upon the uptake of both microparticles and B. anthracis Sterne 34F2 spores. In the case of spores, the exposure was detected in as little as 1 h without the use of antibodies or fluorescent labels of any kind. An increase in the optical force was also seen in macrophage cells treated with cytochalasin D, both with and without a subsequent exposure to spores, indicating that a portion of the increase in the optical force arises independent of phagocytosis. These results demonstrate the capability of optical chromatography to detect subtle biological differences in a rapid and sensitive manner and suggest future potential in a range of applications, including the detection of biological threat agents for biodefense and pathogens for the prevention of sepsis and other diseases.

  5. Detection and differentiation of bacterial spores in a mineral matrix by Fourier transform infrared spectroscopy (FTIR and chemometrical data treatment

    Directory of Open Access Journals (Sweden)

    Brandes Ammann Andrea

    2011-07-01

    Full Text Available Abstract Background Fourier transform infrared spectroscopy (FTIR has been used as analytical tool in chemistry for many years. In addition, FTIR can also be applied as a rapid and non-invasive method to detect and identify microorganisms. The specific and fingerprint-like spectra allow - under optimal conditions - discrimination down to the species level. The aim of this study was to develop a fast and reproducible non-molecular method to differentiate pure samples of Bacillus spores originating from different species as well as to identify spores in a simple matrix, such as the clay mineral, bentonite. Results We investigated spores from pure cultures of seven different Bacillus species by FTIR in reflection or transmission mode followed by chemometrical data treatment. All species investigated (B. atrophaeus, B. brevis, B. circulans, B. lentus, B. megaterium, B. subtilis, B. thuringiensis are typical aerobic soil-borne spore formers. Additionally, a solid matrix (bentonite and mixtures of benonite with spores of B. megaterium at various wt/wt ratios were included in the study. Both hierarchical cluster analysis and principal component analysis of the spectra along with multidimensional scaling allowed the discrimination of different species and spore-matrix-mixtures. Conclusions Our results show that FTIR spectroscopy is a fast method for species-level discrimination of Bacillus spores. Spores were still detectable in the presence of the clay mineral bentonite. Even a tenfold excess of bentonite (corresponding to 2.1 × 1010 colony forming units per gram of mineral matrix still resulted in an unambiguous identification of B. megaterium spores.

  6. Monitoring of fungal spores in the indoor air of preschool institution facilities in Novi Sad

    Directory of Open Access Journals (Sweden)

    Novaković Milana S.

    2013-01-01

    Full Text Available Fungal spores can cause a range of health problems in humans such as respiratory diseases and mycotoxicoses. Since children are the most vulnerable, the presence of fungal spores in the facilities of preschool and school institutions should be investigated readily. In order to estimate air contamination by fungal spores, air sampling was conducted in eight facilities of the preschool institution in Novi Sad during February and March, 2007. Sedimentation plate method was used for the detection of viable fungal spores, mostly being members of subdv. Deuteromycota (Fungi imperfecti. In 32 samples a total of 148 colonies were developed, among which five genera were identified: Penicillium, Cladosporium, Aspergillus, Alternaria and Acremonium while non-sporulating fungal colonies were labeled as sterile mycelia. Most frequently recorded genera were Penicillium with 46 colonies and Cladosporium with 44 colonies. The genera Aspergillus and Alternaria were represented with 3 colonies each and Acremonium with only 1 colony. The greatest number of colonies emerged in the samples from the day care facilities “Vendi” (58 colonies and “Panda” (49 colonies. Most diverse samples were obtained from the day care center “Zvončica”, with presence of all identified genera. These results showed notable presence of fungal spores in the indoor air of Preschool institution facilities and indicated the need for further, more complete seasonal research. Obtained information is considered useful for the evaluation of potential mycofactors that endanger health of children. [Projekat Ministarstva nauke Republike Srbije, br. III43002

  7. A Waking Review: Old and Novel Insights into the Spore Germination in Streptomyces

    Directory of Open Access Journals (Sweden)

    Jan Bobek

    2017-11-01

    Full Text Available The complex development undergone by Streptomyces encompasses transitions from vegetative mycelial forms to reproductive aerial hyphae that differentiate into chains of single-celled spores. Whereas their mycelial life – connected with spore formation and antibiotic production – is deeply investigated, spore germination as the counterpoint in their life cycle has received much less attention. Still, germination represents a system of transformation from metabolic zero point to a new living lap. There are several aspects of germination that may attract our attention: (1 Dormant spores are strikingly well-prepared for the future metabolic restart; they possess stable transcriptome, hydrolytic enzymes, chaperones, and other required macromolecules stabilized in a trehalose milieu; (2 Germination itself is a specific sequence of events leading to a complete morphological remodeling that include spore swelling, cell wall reconstruction, and eventually germ tube emergences; (3 Still not fully unveiled are the strategies that enable the process, including a single cell’s signal transduction and gene expression control, as well as intercellular communication and the probability of germination across the whole population. This review summarizes our current knowledge about the germination process in Streptomyces, while focusing on the aforementioned points.

  8. A Waking Review: Old and Novel Insights into the Spore Germination in Streptomyces.

    Science.gov (United States)

    Bobek, Jan; Šmídová, Klára; Čihák, Matouš

    2017-01-01

    The complex development undergone by Streptomyces encompasses transitions from vegetative mycelial forms to reproductive aerial hyphae that differentiate into chains of single-celled spores. Whereas their mycelial life - connected with spore formation and antibiotic production - is deeply investigated, spore germination as the counterpoint in their life cycle has received much less attention. Still, germination represents a system of transformation from metabolic zero point to a new living lap. There are several aspects of germination that may attract our attention: (1) Dormant spores are strikingly well-prepared for the future metabolic restart; they possess stable transcriptome, hydrolytic enzymes, chaperones, and other required macromolecules stabilized in a trehalose milieu; (2) Germination itself is a specific sequence of events leading to a complete morphological remodeling that include spore swelling, cell wall reconstruction, and eventually germ tube emergences; (3) Still not fully unveiled are the strategies that enable the process, including a single cell's signal transduction and gene expression control, as well as intercellular communication and the probability of germination across the whole population. This review summarizes our current knowledge about the germination process in Streptomyces , while focusing on the aforementioned points.

  9. Protection of Bacillus pumilus Spores by Catalases

    OpenAIRE

    Checinska, Aleksandra; Burbank, Malcolm; Paszczynski, Andrzej J.

    2012-01-01

    Bacillus pumilus SAFR-032, isolated at spacecraft assembly facilities of the National Aeronautics and Space Administration Jet Propulsion Laboratory, is difficult to kill by the sterilization method of choice, which uses liquid or vapor hydrogen peroxide. We identified two manganese catalases, YjqC and BPUM_1305, in spore protein extracts of several B. pumilus strains by using PAGE and mass spectrometric analyses. While the BPUM_1305 catalase was present in six of the B. pumilus strains teste...

  10. Efforts to identify spore forming bacillus

    Energy Technology Data Exchange (ETDEWEB)

    Zuleiha, M.S.; Hilmy, N. (National Atomic Energy Agency, Jakarta (Indonesia). Pasar Djumat Research Centre)

    1982-04-01

    Efforts to identify 47 species of radioresistant spore forming bacillus sp. isolated from locally produced medical devices have been carried out. The identifications was conducted using 19 kinds of biochemical tests and compared to species to bacillus subtilis W. T.; bacillus pumilus E 601 and bacillus sphaericus Csub(I)A. The results showed that bacillus sp. examined could be divided into 6 groups, i.e. bacillus cereus; bacillus subtilis; bacillus stearothermophylus; bacillus coagulans; bacillus sphaericus and bacillus circulans.

  11. Efforts to identify spore forming bacillus

    International Nuclear Information System (INIS)

    Zuleiha, M.S.; Hilmy, Nazly

    1982-01-01

    Efforts to identify 47 species of radioresistant spore forming bacillus sp. isolated from locally produced medical devices have been carried out. The identifications was conducted using 19 kinds of biochemical tests and compared to species to bacillus subtilis W. T.; bacillus pumilus E 601 and bacillus sphaericus Csub(I)A. The results showed that bacillus sp. examined could be divided into 6 groups, i.e. bacillus cereus; bacillus subtilis; bacillus stearothermophylus; bacillus coagulans; bacillus sphaericus and bacillus circulans. (author)

  12. Targeted Disruption of Melanin Biosynthesis Genes in the Human Pathogenic Fungus Lomentospora prolificans and Its Consequences for Pathogen Survival

    Directory of Open Access Journals (Sweden)

    Ayat Al-Laaeiby

    2016-03-01

    Full Text Available The dematiaceous (melanised fungus Lomentospora (Scedosporium prolificans is a life-threatening opportunistic pathogen of immunocompromised humans, resistant to anti-fungal drugs. Melanin has been shown to protect human pathogenic fungi against antifungal drugs, oxidative killing and environmental stresses. To determine the protective role of melanin in L. prolificans to oxidative killing (H2O2, UV radiation and the polyene anti-fungal drug amphotericin B, targeted gene disruption was used to generate mutants of the pathogen lacking the dihydroxynaphthalene (DHN-melanin biosynthetic enzymes polyketide synthase (PKS1, tetrahydroxynapthalene reductase (4HNR and scytalone dehydratase (SCD1. Infectious propagules (spores of the wild-type strain 3.1 were black/brown, whereas spores of the PKS-deficient mutant ΔLppks1::hph were white. Complementation of the albino mutant ΔLppks1::hph restored the black-brown spore pigmentation, while the 4HNR-deficient mutant ΔLp4hnr::hph and SCD-deficient mutant ΔLpscd1::hph both produced orange-yellow spores. The mutants ΔLppks1::hph and ΔLp4hnr::hph showed significant reductions in spore survival following H2O2 treatment, while spores of ΔLpscd1::hph and the ΔLppks1::hph complemented strain ΔLppks1::hph:PKS showed spore survivals similar to strain 3.1. Spores of the mutants ΔLp4hnr::hph and ΔLpscd1::hph and complemented strain ΔLppks1::hph:PKS showed spore survivals similar to 3.1 following exposure to UV radiation, but survival of ΔLppks1::hph spores was significantly reduced compared to the wild-type strain. Strain 3.1 and mutants ΔLp4hnr::hph and ΔLppks1::hph:PKS were resistant to amphotericin B while, paradoxically, the PKS1- and SCD1-deficient mutants showed significant increases in growth in the presence of the antifungal drug. Taken together, these results show that while melanin plays a protective role in the survival of the pathogen to oxidative killing and UV radiation, melanin does not

  13. Targeted Disruption of Melanin Biosynthesis Genes in the Human Pathogenic Fungus Lomentospora prolificans and Its Consequences for Pathogen Survival.

    Science.gov (United States)

    Al-Laaeiby, Ayat; Kershaw, Michael J; Penn, Tina J; Thornton, Christopher R

    2016-03-24

    The dematiaceous (melanised) fungus Lomentospora (Scedosporium) prolificans is a life-threatening opportunistic pathogen of immunocompromised humans, resistant to anti-fungal drugs. Melanin has been shown to protect human pathogenic fungi against antifungal drugs, oxidative killing and environmental stresses. To determine the protective role of melanin in L. prolificans to oxidative killing (H₂O₂), UV radiation and the polyene anti-fungal drug amphotericin B, targeted gene disruption was used to generate mutants of the pathogen lacking the dihydroxynaphthalene (DHN)-melanin biosynthetic enzymes polyketide synthase (PKS1), tetrahydroxynapthalene reductase (4HNR) and scytalone dehydratase (SCD1). Infectious propagules (spores) of the wild-type strain 3.1 were black/brown, whereas spores of the PKS-deficient mutant ΔLppks1::hph were white. Complementation of the albino mutant ΔLppks1::hph restored the black-brown spore pigmentation, while the 4HNR-deficient mutant ΔLp4hnr::hph and SCD-deficient mutant ΔLpscd1::hph both produced orange-yellow spores. The mutants ΔLppks1::hph and ΔLp4hnr::hph showed significant reductions in spore survival following H₂O₂ treatment, while spores of ΔLpscd1::hph and the ΔLppks1::hph complemented strain ΔLppks1::hph:PKS showed spore survivals similar to strain 3.1. Spores of the mutants ΔLp4hnr::hph and ΔLpscd1::hph and complemented strain ΔLppks1::hph:PKS showed spore survivals similar to 3.1 following exposure to UV radiation, but survival of ΔLppks1::hph spores was significantly reduced compared to the wild-type strain. Strain 3.1 and mutants ΔLp4hnr::hph and ΔLppks1::hph:PKS were resistant to amphotericin B while, paradoxically, the PKS1- and SCD1-deficient mutants showed significant increases in growth in the presence of the antifungal drug. Taken together, these results show that while melanin plays a protective role in the survival of the pathogen to oxidative killing and UV radiation, melanin does not

  14. The development of pathogen resistance in Daphnia magna: implications for disease spread in age-structured populations.

    Science.gov (United States)

    Garbutt, Jennie S; O'Donoghue, Anna J P; McTaggart, Seanna J; Wilson, Philip J; Little, Tom J

    2014-11-01

    Immunity in vertebrates is well established to develop with time, but the ontogeny of defence in invertebrates is markedly less studied. Yet, age-specific capacity for defence against pathogens, coupled with age structure in populations, has widespread implications for disease spread. Thus, we sought to determine the susceptibility of hosts of different ages in an experimental invertebrate host-pathogen system. In a series of experiments, we show that the ability of Daphnia magna to resist its natural bacterial pathogen Pasteuria ramosa changes with host age. Clonal differences make it difficult to draw general conclusions, but the majority of observations indicate that resistance increases early in the life of D. magna, consistent with the idea that the defence system develops with time. Immediately following this, at about the time when a daphnid would be most heavily investing in reproduction, resistance tends to decline. Because many ecological factors influence the age structure of Daphnia populations, our results highlight a broad mechanism by which ecological context can affect disease epidemiology. We also show that a previously observed protective effect of restricted maternal food persists throughout the entire juvenile period, and that the protective effect of prior treatment with a small dose of the pathogen ('priming') persists for 7 days, observations that reinforce the idea that immunity in D. magna can change over time. Together, our experiments lead us to conclude that invertebrate defence capabilities have an ontogeny that merits consideration with respect to both their immune systems and the epidemic spread of infection. © 2014. Published by The Company of Biologists Ltd.

  15. Spore membrane(s) as the site of damage within heated Clostridium perfringens spores.

    Science.gov (United States)

    Flowers, R S; Adams, D M

    1976-02-01

    Clostridium perfringens spores were injured by ultrahigh-temperature treatment at 105 C for 5 min. Injury was manifested as an increased sensitivity to polymyxin and neomycin. Since many of the survivors could not germinate normally the ultrahigh-temperature-treated spores were sensitized to and germinated by lysozyme. Polymyxin reportedly acts upon the cell membrane. Neomycin may inhibit protein synthesis and has surface-active properties. Injured spores were increasingly sensitive to known surface-active agents, sodium lauryl sulfate, sodium deoxycholate, and Roccal, a quaternary ammonium compound. Injured spores sensitive to polymyxin and neomycin also were osmotically fragile and died during outgrowth in a liquid medium unless the medium was supplemented with 20% sucrose, 10% dextran, or 10% polyvinylpyrrolidone. The results suggested that a spore structure destined to become cell membrane or cell wall was the site of injury. Repair of injury during outgrowth in the presence of protein, deoxyribonucleic acid, ribonucleic acid and cell wall synthesis inhibitors was consistent with this hypothesis.

  16. Developmental Testing of Liquid and Gaseous/Vaporous Decontamination on Bacterial Spores and Other Biological Warfare Agents on Military Relevant Surfaces

    Science.gov (United States)

    2016-02-11

    Vaporous Decontamination on Bacterial Spores and Other Biological Warfare Agents on Military-Relevant Surfaces 5a. CONTRACT NUMBER 5b. GRANT... DECONTAMINATION ON BACTERIAL SPORES AND OTHER BIOLOGICAL WARFARE AGENTS ON MILITARY-RELEVANT SURFACES Page Paragraph 1. SCOPE...surfaces before and after decontamination . The protocol in this TOP is based on the developed test methodologies from Edgewood Chemical Biological

  17. Hygiene Aspects of the Biogas Process with Emphasis on Spore-Forming Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Bagge, Elisabeth

    2009-07-01

    Biogas is a renewable source of energy which can be obtained from processing of biowaste. The digested residues can be used as fertiliser. Biowaste intended for biogas production contains pathogenic micro-organisms. A pre-pasteurisation step at 70 deg C for 60 min before anaerobic digestion reduces non spore-forming bacteria such as Salmonella spp. To maintain the standard of the digested residues it must be handled in a strictly hygienic manner to avoid recontamination and re-growth of bacteria. The risk of contamination is particularly high when digested residues are transported in the same vehicles as the raw material. However, heat treatment at 70 deg C for 60 min will not reduce spore-forming bacteria such as Bacillus spp. and Clostridium spp. Spore-forming bacteria, including those that cause serious diseases, can be present in substrate intended for biogas production. The number of species and the quantity of Bacillus spp. and Clostridium spp. in manure, slaughterhouse waste and in samples from different stages during the biogas process were investigated. The number of species of clostridia seemed to decrease following digestion, likewise the quantity. However, Bacillus spp. seemed to pass unaffected through the biogas process. In laboratory-scale experiments the effects on clostridia during pasteurisation and digestion were investigated. Pathogenic clostridia were inoculated in substrates from homogenisation tanks and digester tanks. The inoculated clostridia remained after pasteurisation, but the impacts of digestion differ between different species. Culture followed by identification of C. chauvoei by PCR in samples from cattle died from blackleg, is faster and safer than culture followed by biochemical identification of C. chauvoei. However, for environmental samples the PCR method is not practically applicable for detection of C. chauvoei. To avoid spreading of diseases via biogas plants when digested residues are spread on arable land, a pasteurisation

  18. Development of bioassay for pathogenecity testing of Ureaplasma urealyticum as part of host-pathogen communication

    Directory of Open Access Journals (Sweden)

    Purnomo Soeharso

    2005-12-01

    Full Text Available Bioassay of Ureaplasma urealyticum is necessary for detection as well as determination of pathogenic factors in order to understand the pathogenesis of diseases associate with ureaplasma infection. Cultivation and verification of ureaplasma is the first step of this study in the purpose of discovering sensitive method for ureaplasma detection. Cultivation of ureaplasma either in liquid or in solid media are able to detect the existence of ureaplasma in samples analyzed. However, application of PCR using specific primers to be compatible with urease gene (ure would confirm the presence of ureaplasma. The pathogenicity of ureaplasma is potentially monitored using reporter gene as a marker for gene expression. IceC was chosen as reporter gene for ureaplasma pathogenic determination as the gene has great sensitivity, easily detectable and quantitated in simple method of ice nucleation assay. Transposon 916 (Tn916 was selected as a vector for iceC gene to transform ureaplasma. The application of recombinant Tn916-iceC which is considered as pUI, allow detection of ureaplasma activities when transform ureaplasma is tested by ice nucleation assay. It was expected that ureaplasma transformation is the manifestation of mutagenesis which interfere genes responsible for bacterial pathogenicity, in order pathogenesis of bacterial infection to be analyzed accurately. IgA1 protease is considered to be an important factor for ureaplasma pathogenicity as the enzyme is required for successful colonization. Identification of iga gene and  determination of IgA1 protease activity are important for understanding the pathogenesis of ureaplasma infection. Putative iga gene of Mycoplasma genitalium was used as a reference to identify the presence of iga nucleotide sequence in U. urealyticum. Convincing evidence were obtained after PCR amplification of ureaplasma DNA using primers designed to be compatible with putative iga gene of M. genitalium followed by the

  19. Dynamics of Spore Coat Morphogenesis in Bacillus subtilis

    Science.gov (United States)

    McKenney, Peter T.; Eichenberger, Patrick

    2011-01-01

    SUMMARY Spores of Bacillus subtilis are encased in a protective coat made up of at least 70 proteins. The structure of the spore coat has been examined using a variety of genetic, imaging and biochemical techniques, however, the majority of these studies have focused on mature spores. In this study we use a library of 41 spore coat proteins fused to the Green Fluorescent Protein (GFP) to examine spore coat morphogenesis over the time-course of sporulation. We found considerable diversity in the localization dynamics of coat proteins and were able to establish 6 classes based on localization kinetics. Localization dynamics correlate well with the known transcriptional regulators of coat gene expression. Previously, we described the existence of multiple layers in the mature spore coat. Here, we find that the spore coat initially assembles a scaffold that is organized into multiple layers on one pole of the spore. The coat then encases the spore in multiple coordinated waves. Encasement is driven, at least partially, by transcription of coat genes and deletion of sporulation transcription factors arrests encasement. We also identify the trans-compartment SpoIIIAH-SpoIIQ channel as necessary for encasement. This is the first demonstration of a forespore contribution to spore coat morphogenesis. PMID:22171814

  20. Asynchronous spore germination in isogenic natural isolates of Saccharomyces paradoxus.

    Science.gov (United States)

    Stelkens, Rike B; Miller, Eric L; Greig, Duncan

    2016-05-01

    Spores from wild yeast isolates often show great variation in the size of colonies they produce, for largely unknown reasons. Here we measure the colonies produced from single spores from six different wild Saccharomyces paradoxus strains. We found remarkable variation in spore colony sizes, even among spores that were genetically identical. Different strains had different amounts of variation in spore colony sizes, and variation was not affected by the number of preceding meioses, or by spore maturation time. We used time-lapse photography to show that wild strains also have high variation in spore germination timing, providing a likely mechanism for the variation in spore colony sizes. When some spores from a laboratory strain make small colonies, or no colonies, it usually indicates a genetic or meiotic fault. Here, we demonstrate that in wild strains spore colony size variation is normal. We discuss and assess potential adaptive and non-adaptive explanations for this variation. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. A simple identification method for spore-forming bacteria showing high resistance against γ-rays

    International Nuclear Information System (INIS)

    Koshikawa, Tomihiko; Sone, Koji; Kobayashi, Toshikazu

    1993-01-01

    A simple identification method was developed for spore-forming bacteria which are highly resistant against γ-rays. Among 23 species of Bacillus studied, the spores of Bacillus megaterium, B. cereus, B. thuringiensis, B. pumilus and B. aneurinolyticus showed high resistance against γ-rays as compared with other spores of Bacillus species. Combination of the seven kinds of biochemical tests, namely, the citrate utilization test, nitrate reduction test, starch hydrolysis test, Voges-Proskauer reaction test, gelatine hydrolysis test, mannitol utilization test and xylose utilization test showed a characteristic pattern for each species of Bacillus. The combination pattern of each the above tests with a few supplementary test, if necessary, was useful to identify Bacillus species showing high radiation resistance against γ-rays. The method is specific for B. megaterium, B. thuringiensis and B. pumilus, and highly selective for B. aneurinolyticus and B. cereus. (author)

  2. Growth and sporulation of a pyrimidine spore color mutant of Sordaria fimicola.

    Science.gov (United States)

    el-Ani, A S

    1967-04-07

    A nonautonomous spore color mutant of Sordaria fimicola is a pyrimidine auxotroph that produces hyaline nonviable ascospores. Uracil, uridine, and cytidine are more effective growth factors than cytosine and thymine and, in high concentrations, render the mutant self-fertile by inducing the ascospores to resume development and maturation. Crosses with the unlinked arginine non-autonomus spore color mutant st-59 yielded the double mutant st-59 pyr that requires both arginine and a pyrimidine for growth, which indicates a lack of suppression of the pyrimidine requirement by the arginine locus.

  3. An insight into spore dispersal of Ganoderma boninense on oil palm.

    Science.gov (United States)

    Sanderson, F R

    2005-01-01

    The disease of oil palm caused by Ganoderma boninense, although universally referred to as Ganoderma basal stem rot, occurs in three very distinct phases, with basal stem rot only part of the disease cycle. G. boninense also causes a seedling disease and an upper stem rot. An understanding of spore dispersal provides an insight into where spores of G. boninense have a role in the infection process. This role will be discussed in relation to each of these three infection phases. This understanding is a critical component of developing a successful disease control strategy.

  4. Development of oligonucleotide microarrays for simultaneous multi-species identification of Phellinus tree-pathogenic fungi.

    Science.gov (United States)

    Tzean, Yuh; Shu, Po-Yao; Liou, Ruey-Fen; Tzean, Shean-Shong

    2016-03-01

    Polyporoid Phellinus fungi are ubiquitously present in the environment and play an important role in shaping forest ecology. Several species of Phellinus are notorious pathogens that can affect a broad variety of tree species in forest, plantation, orchard and urban habitats; however, current detection methods are overly complex and lack the sensitivity required to identify these pathogens at the species level in a timely fashion for effective infestation control. Here, we describe eight oligonucleotide microarray platforms for the simultaneous and specific detection of 17 important Phellinus species, using probes generated from the internal transcribed spacer regions unique to each species. The sensitivity, robustness and efficiency of this Phellinus microarray system was subsequently confirmed against template DNA from two key Phellinus species, as well as field samples collected from tree roots, trunks and surrounding soil. This system can provide early, specific and convenient detection of Phellinus species for forestry, arboriculture and quarantine inspection, and could potentially help to mitigate the environmental and economic impact of Phellinus-related diseases. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  5. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    Science.gov (United States)

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This m

  6. The infrared spectral transmittance of Aspergillus niger spore aggregated particle swarm

    Science.gov (United States)

    Zhao, Xinying; Hu, Yihua; Gu, Youlin; Li, Le

    2015-10-01

    Microorganism aggregated particle swarm, which is quite an important composition of complex media environment, can be developed as a new kind of infrared functional materials. Current researches mainly focus on the optical properties of single microorganism particle. As for the swarm, especially the microorganism aggregated particle swarm, a more accurate simulation model should be proposed to calculate its extinction effect. At the same time, certain parameters deserve to be discussed, which helps to better develop the microorganism aggregated particle swarm as a new kind of infrared functional materials. In this paper, take Aspergillus Niger spore as an example. On the one hand, a new calculation model is established. Firstly, the cluster-cluster aggregation (CCA) model is used to simulate the structure of Aspergillus Niger spore aggregated particle. Secondly, the single scattering extinction parameters for Aspergillus Niger spore aggregated particle are calculated by using the discrete dipole approximation (DDA) method. Thirdly, the transmittance of Aspergillus Niger spore aggregated particle swarm is simulated by using Monte Carlo method. On the other hand, based on the model proposed above, what influences can wavelength causes has been studied, including the spectral distribution of scattering intensity of Aspergillus Niger spore aggregated particle and the infrared spectral transmittance of the aggregated particle swarm within the range of 8-14μm incident infrared wavelengths. Numerical results indicate that the scattering intensity of Aspergillus Niger spore aggregated particle reduces with the increase of incident wavelengths at each scattering angle. Scattering energy mainly concentrates on the scattering angle between 0-40°, forward scattering has an obvious effect. In addition, the infrared transmittance of Aspergillus Niger spore aggregated particle swarm goes up with the increase of incident wavelengths. However, some turning points of the trend are

  7. Cross inoculation of anthracnose pathogens infecting various tropical fruits

    Science.gov (United States)

    Suparman; Rahmiyah, M.; Pujiastuti, Y.; Gunawan, B.; Arsi

    2018-01-01

    Anthracnose disease is very important disease of tropical fruits causing significant yield losses. The disease is caused by Colletotrichum spp. and infects almost all tropical fruit species, especially the succulent ones. Various species of Colletotrichum infect various tropical fruits and there are possibilities for cross inoculation to occur among tropical fruits which might cause severe infection. An experimental research was conducted to examine the effect of cross inoculation of anthracnose pathogen among papaya, eggplant, chili and common bean on the infection development and severity of the disease on each inoculated fruit species. Colletotrichum spp. were isolated from naturally infected papaya, eggplant, chili and common bean. Each fungal isolate was purified and identified to determine the species name. The spores of each isolate were then used to separately inoculate healthy and sterilized papaya, eggplant, chili and common bean. The results showed that cross infection developed on chili, eggplant and papaya but not on bean. Chili showed the highest susceptibility to all Colletotrichum isolates and significantly different from eggplant and papaya. The anthracnose pathogen isolated from common bean showed no pathogenicity to other hosts and might be used as cross protection inoculant to the disease in the other hosts.

  8. Atmospheric mold spore counts in relation to meteorological parameters

    Science.gov (United States)

    Katial, R. K.; Zhang, Yiming; Jones, Richard H.; Dyer, Philip D.

    Fungal spore counts of Cladosporium, Alternaria, and Epicoccum were studied during 8 years in Denver, Colorado. Fungal spore counts were obtained daily during the pollinating season by a Rotorod sampler. Weather data were obtained from the National Climatic Data Center. Daily averages of temperature, relative humidity, daily precipitation, barometric pressure, and wind speed were studied. A time series analysis was performed on the data to mathematically model the spore counts in relation to weather parameters. Using SAS PROC ARIMA software, a regression analysis was performed, regressing the spore counts on the weather variables assuming an autoregressive moving average (ARMA) error structure. Cladosporium was found to be positively correlated (Pmodel was derived for Cladosporium spore counts using the annual seasonal cycle and significant weather variables. The model for Alternaria and Epicoccum incorporated the annual seasonal cycle. Fungal spore counts can be modeled by time series analysis and related to meteorological parameters controlling for seasonallity; this modeling can provide estimates of exposure to fungal aeroallergens.

  9. A study of Ganoderma lucidum spores by FTIR microspectroscopy

    Science.gov (United States)

    Wang, Xin; Chen, Xianliang; Qi, Zeming; Liu, Xingcun; Li, Weizu; Wang, Shengyi

    2012-06-01

    In order to obtain unique information of Ganoderma lucidum spores, FTIR microspectroscopy was used to study G. lucidum spores from Anhui Province (A), Liaoning Province (B) and Shangdong Province (C) of China. IR micro-spectra were acquired with high-resolution and well-reproducibility. The IR spectra of G. lucidum spores from different areas were similar and mainly made up of the absorption bands of polysaccharide, sterols, proteins, fatty acids, etc. The results of curve fitting indicated the protein secondary structures were dissimilar among the above G. lucidum spores. To identify G. lucidum spores from different areas, the H1078/H1640 value might be a potentially useful factor, furthermore FTIR microspectroscopy could realize this identification efficiently with the help of hierarchical cluster analysis. The result indicates FTIR microspectroscopy is an efficient tool for identification of G. lucidum spores from different areas. The result also suggests FTIR microspectroscopy is a potentially useful tool for the study of TCM.

  10. A spore counting method and cell culture model for chlorine disinfection studies of Encephalitozoon syn. Septata intestinalis.

    Science.gov (United States)

    Wolk, D M; Johnson, C H; Rice, E W; Marshall, M M; Grahn, K F; Plummer, C B; Sterling, C R

    2000-04-01

    The microsporidia have recently been recognized as a group of pathogens that have potential for waterborne transmission; however, little is known about the effects of routine disinfection on microsporidian spore viability. In this study, in vitro growth of Encephalitozoon syn. Septata intestinalis, a microsporidium found in the human gut, was used as a model to assess the effect of chlorine on the infectivity and viability of microsporidian spores. Spore inoculum concentrations were determined by using spectrophotometric measurements (percent transmittance at 625 nm) and by traditional hemacytometer counting. To determine quantitative dose-response data for spore infectivity, we optimized a rabbit kidney cell culture system in 24-well plates, which facilitated calculation of a 50% tissue culture infective dose (TCID(50)) and a minimal infective dose (MID) for E. intestinalis. The TCID(50) is a quantitative measure of infectivity and growth and is the number of organisms that must be present to infect 50% of the cell culture wells tested. The MID is as a measure of a system's permissiveness to infection and a measure of spore infectivity. A standardized MID and a standardized TCID(50) have not been reported previously for any microsporidian species. Both types of doses are reported in this paper, and the values were used to evaluate the effects of chlorine disinfection on the in vitro growth of microsporidia. Spores were treated with chlorine at concentrations of 0, 1, 2, 5, and 10 mg/liter. The exposure times ranged from 0 to 80 min at 25 degrees C and pH 7. MID data for E. intestinalis were compared before and after chlorine disinfection. A 3-log reduction (99.9% inhibition) in the E. intestinalis MID was observed at a chlorine concentration of 2 mg/liter after a minimum exposure time of 16 min. The log(10) reduction results based on percent transmittance-derived spore counts were equivalent to the results based on hemacytometer-derived spore counts. Our data

  11. Spore communities of arbuscular mycorrhizal fungi and mycorrhizal associations in different ecosystems, south Australia

    Directory of Open Access Journals (Sweden)

    Z. I. Antoniolli

    2002-09-01

    Full Text Available Communities of arbuscular mycorrhizal fungi (AMF were surveyed in different South Australian ecosystems. The soil was wet-sieved for spore extraction, followed by the determination of presence and abundance of AMF species as well as the percentage of root colonization. Mycorrhizal associations were common and there was substantial fungal diversity in different ecosystems. Spores were most abundant in the permanent pasture system and less abundant under continuous wheat. The incidence of mycorrhizal associations in different plant species and the occurrence of Arum and Paris type colonization generally conformed with previous information. Spores of seventeen AMF were verified throughout seasonal changes in 1996 and 1997 in the permanent pasture and on four host species (Lolium perenne, Plantago lanceolata, Sorghum sp. and Trifolium subterraneum , set up with the same soils under greenhouse conditions. Glomus mosseae was the dominant spore type at all sampling times and in all trap cultures. Mycorrhizal diversity was significantly affected by different sampling times in trap cultures but not in field-collected soil. P. lanceolata, Sorghum sp. and T. subterraneum as hosts for trap cultures showed no differences in richness and diversity of AMF spores that developed in association with their roots. Abundance and diversity were lowest, however, in association with L. perenne , particularly in December 1996. Results show that the combination of spore identification from field-collected soil and trap cultures is essential to study population and diversity of AMF. The study provides baseline data for ongoing monitoring of mycorrhizal populations using conventional methods and material for the determination of the symbiotic effectiveness of AMF key members.

  12. Spore coat protein of Bacillus subtilis. Structure and precursor synthesis.

    Science.gov (United States)

    Munoz, L; Sadaie, Y; Doi, R H

    1978-10-10

    The coat protein of Bacillus subtilis spores comprises about 10% of the total dry weight of spores and 25% of the total spore protein. One protein with a molecular weight of 13,000 to 15,000 comprises a major portion of the spore coat. This mature spore coat protein has histidine at its NH2 terminus and is relatively rich in hydrophobic amino acids. Netropsin, and antibiotic which binds to A-T-rich regions of DNA and inhibits sporulation, but not growth, decreased the synthesis of this spore coat protein by 75%. A precursor spore coat protein with a molecular weight of 25,000 is made initially at t1 of sporulation and is converted to the mature spore coat protein with a molecular weight of 13,500 at t2 - t3. These data indicate that the spore coat protein gene is expressed very early in sporulation prior to the modifications of RNA polymerase which have been noted.

  13. Surface tension propulsion of fungal spores by use of microdroplets

    OpenAIRE

    Noblin, Xavier; Yang, Sylvia; Dumais, Jacques

    2010-01-01

    Many edible mushrooms eject their spores (about 10 microns in size) at high speed (about 1 m/s) using surface tension forces in a few microseconds. Basically the coalescence of a droplet with the spore generates the necessary momentum to eject the spore. We have detailed this mechanism in \\cite{noblin2}. In this article, we give some details about the high speed movies (up to 250000 fps) of mushrooms' spores ejection attached to this submission. This video was submitted as part of the Gallery...

  14. Management of foliar and soilborne pathogens of cowpea ( Vigna ...

    African Journals Online (AJOL)

    White and pink garlic extracts were tested for their antifungal potentials on mycelial radial growth, spores and sclerotial production of Macrophomina phaseolina (Tassi) Goid, Colletotrichum destructivum O gara and Colletotrichum capsici (Syd) Butler and Bisby pathogens of cowpea in vitro. Water or ethanol extracts of ...

  15. Predictive modeling of Bacillus cereus spores in farm tank milk during grazing and housing periods

    NARCIS (Netherlands)

    Vissers, M.M.M.; Giffel, M.C.T.; Driehuis, F.; Jong, de P.; Lankveld, J.M.G.

    2007-01-01

    The shelf life of pasteurized dairy products depends partly on the concentration of Bacillus cereus spores in raw milk. Based on a translation of contamination pathways into chains of unit-operations, 2 simulation models were developed to quantitatively identify factors that have the greatest effect

  16. A rapid colorimetric assay for mold spore germination using XTT tetrazolium salt

    Science.gov (United States)

    Carol A. Clausen; Vina W. Yang

    2011-01-01

    Current laboratory test methods to measure efficacy of new mold inhibitors are time consuming, some require specialized test equipment and ratings are subjective. Rapid, simple quantitative assays to measure the efficacy of mold inhibitors are needed. A quantitative, colorimetric microassay was developed using XTT tetrazolium salt to metabolically assess mold spore...

  17. Optimization of Verticillium lecanii spore production in solid-state fermentation on sugarcane bagasse

    NARCIS (Netherlands)

    Shi, Y.; Xu, X.; Zhu, Y.

    2009-01-01

    Verticillium lecanii is an entomopathogen with high potential in biological control of pests. We developed a solid-state fermentation with sugarcane bagasse as carrier absorbing liquid medium to propagate V. lecanii spores. Using statistical experimental design, we optimized the medium composition

  18. Maternal parentage influences spore production but not spore pigmentation in the anisogamous and hermaphroditic fungus Neurospora crassa

    DEFF Research Database (Denmark)

    Zimmerman, Kolea; Levitis, Daniel; Pringle, Anne

    2014-01-01

    . In this fungus, pigmented spores are viable and unpigmented spores are inviable. These results show that while both parents influence all these traits, maternal influence is strongest on both fertility and mortality traits until the spores are physiologically independent of the maternal cytoplasm.......In this study, we tested the hypothesis that maternal effects on offspring production and quality are greater than paternal effects in both offspring number (fertility) and offspring viability (mortality). We used the model filamentous fungus Neurospora crassa. This fungus is anisogamous......, and various ascospore characteristics. Mixed effects models of these data show that the female parent accounts for the majority of variation in perithecial production, number of spores produced, and spore germination. Surprisingly, both sexes equally influence the percentage of spores that are pigmented...

  19. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Science.gov (United States)

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  20. The basics and advances of immunomodulators and antigen presentation: a key to development of potent memory response against pathogens.

    Science.gov (United States)

    Garai, Preeti; Gogoi, Mayuri; Gopal, Ganesh; Radhakrishnan, Yashwanth; Nandakumar, Krishnadas Subhadramma; Chakravortty, Dipshikha

    2014-10-01

    Immunomodulators are agents, which can modulate the immune response to specific antigens, while causing least toxicity to the host system. Being part of the modern vaccine formulations, these compounds have contributed remarkably to the field of therapeutics. Despite the successful record maintained by these agents, the requirement of novel immunomodulators keeps increasing due to the increasing severity of diseases. Hence, research regarding the same holds great importance. In this review, we discuss the role of immunomodulators in improving performance of various vaccines used for counteracting most threatening infectious diseases, mechanisms behind their action and criteria for development of novel immunomodulators. Understanding the molecular mechanisms underlying immune response is a prerequisite for development of effective therapeutics as these are often exploited by pathogens for their own propagation. Keeping this in mind, the present research in the field of immunotherapy focuses on developing immunomodulators that would not only enhance the protection against pathogen, but also generate a long-term memory response. With the introduction of advanced formulations including combination of different kinds of immunomodulators, one can expect tremendous success in near future.

  1. Development and application of an eDNA method to detect and quantify a pathogenic parasite in aquatic ecosystems.

    Science.gov (United States)

    Huver, J R; Koprivnikar, J; Johnson, P T J; Whyard, S

    2015-06-01

    Approaches based on organismal DNA found in the environment (eDNA) have become increasingly utilized for ecological studies and biodiversity inventories as an alternative to traditional field survey methods. Such DNA-based techniques have largely been used to establish the presence of free-living organisms, but have much potential for detecting and quantifying infectious agents in the environment, which is necessary to evaluate disease risk. We developed an eDNA method to examine the distribution and abundance of the trematode Ribeiroia ondatrae, a pathogenic parasite known to cause malformations in North American amphibians. In addition to comparing this eDNA approach to classical host necropsy, we examined the detectability of R. ondatrae in water samples subject to different degradation conditions (time and temperature). Our test exhibited high specificity and sensitivity to R. ondatrae, capable of detecting as little as 14 fg (femtograms) of this parasite's DNA (1/2500th of a single infectious stage) from field water samples. Compared to our results from amphibian host necropsy, quantitative PCR was -90% concordant with respect to R. ondatrae detection from 15 field sites and was also a significant predictor of host infection abundance. DNA was still detectable in lab samples after 21 days at 25°C, indicating that our method is robust to field conditions. By comparing the advantages and disadvantages of eDNA vs. traditional survey methods for determining pathogen presence and abundance in the field, we found that the lower cost and effort associated with eDNA approaches provide many advantages. The development of alternative tools is critical for disease ecology, as wildlife management and conservation efforts require reliable establishment and monitoring of pathogens.

  2. The Convergence of High-Consequence Livestock and Human Pathogen Research and Development: A Paradox of Zoonotic Disease

    Directory of Open Access Journals (Sweden)

    Julia M. Michelotti

    2018-05-01

    Full Text Available The World Health Organization (WHO estimates that zoonotic diseases transmitted from animals to humans account for 75 percent of new and emerging infectious diseases. Globally, high-consequence pathogens that impact livestock and have the potential for human transmission create research paradoxes and operational challenges for the high-containment laboratories that conduct work with them. These specialized facilities are required for conducting all phases of research on high-consequence pathogens (basic, applied, and translational with an emphasis on both the generation of fundamental knowledge and product development. To achieve this research mission, a highly-trained workforce is required and flexible operational methods are needed. In addition, working with certain pathogens requires compliance with regulations such as the Centers for Disease Control (CDC and the U.S. Department of Agriculture (USDA Select Agent regulations, which adds to the operational burden. The vast experience from the existing studies at Plum Island Animal Disease Center, other U.S. laboratories, and those in Europe and Australia with biosafety level 4 (BSL-4 facilities designed for large animals, clearly demonstrates the valuable contribution this capability brings to the efforts to detect, prepare, prevent and respond to livestock and potential zoonotic threats. To raise awareness of these challenges, which include biosafety and biosecurity issues, we held a workshop at the 2018 American Society for Microbiology (ASM Biothreats conference to further discuss the topic with invited experts and audience participants. The workshop covered the subjects of research funding and metrics, economic sustainment of drug and vaccine development pipelines, workforce turnover, and the challenges of maintaining operational readiness of high containment laboratories.

  3. Spore-Forming Bacteria that Resist Sterilization

    Science.gov (United States)

    LaDuc, Myron; Venkateswaran, Kasthuri

    2003-01-01

    A report presents a phenotypic and genotypic characterization of a bacterial species that has been found to be of the genus Bacillus and has been tentatively named B. odysseensis because it was isolated from surfaces of the Mars Odyssey spacecraft as part of continuing research on techniques for sterilizing spacecraft to prevent contamination of remote planets by terrestrial species. B. odysseensis is a Gram-positive, facultatively anaerobic, rod-shaped bacterium that forms round spores. The exosporium has been conjectured to play a role in the elevated resistance to sterilization. Research on the exosporium is proposed as a path toward improved means of sterilization, medical treatment, and prevention of biofouling.

  4. Elastic and inelastic light scattering from single bacterial spores in an optical trap allows the monitoring of spore germination dynamics

    OpenAIRE

    Peng, Lixin; Chen, De; Setlow, Peter; Li, Yong-qing

    2009-01-01

    Raman scattering spectroscopy and elastic light scattering intensity (ESLI) were used to simultaneously measure levels of Ca-dipicolinic acid (CaDPA) and changes in spore morphology and refractive index during germination of individual B. subtilis spores with and without the two redundant enzymes (CLEs), CwlJ and SleB, that degrade spores’ peptidoglycan cortex. Conclusions from these measurements include: 1) CaDPA release from individual wild-type germinating spores was biphasic; in a first h...

  5. Inhibiting Inosine Hydrolase and Alanine Racemase to Enhance the Germination of Bacillus anthracis Sterne Spores: Potential Spore Decontamination Strategies

    Science.gov (United States)

    2015-06-19

    decontamination strategies>> Maryline DEFEZ 1𔃼, Melissa HUNTER3J Susan WELKOS :~J Christopher COTE3 1 University Grenoble-Alpes, Grenoble, France. 1...inosine hydrolase and alanine racemase to enhance the germination of Bacillus anthracis Sterne spores potential spore decontamination strategies 5a...8217 • Accidentally in Humans • Natural reservoir is soil • Anthrax Disease Cycle: - animals infected by soilborne spores in food and water or bites from certain

  6. Development of a user-friendly delivery method for the fungus Metarhizium anisopliae to control the ectoparasitic mite Varroa destructor in honey bee, Apis mellifera, colonies.

    Science.gov (United States)

    Kanga, Lambert H B; Adamczyk, John; Patt, Joseph; Gracia, Carlos; Cascino, John

    2010-12-01

    A user-friendly method to deliver Metarhizium spores to honey bee colonies for control of Varroa mites was developed and tested. Patty blend formulations protected the fungal spores at brood nest temperatures and served as an improved delivery system of the fungus to bee hives. Field trials conducted in 2006 in Texas using freshly harvested spores indicated that patty blend formulations of 10 g of conidia per hive (applied twice) significantly reduced the numbers of mites per adult bee, mites in sealed brood cells, and residual mites at the end of the 47-day experimental period. Colony development in terms of adult bee populations and brood production also improved. Field trials conducted in 2007 in Florida using less virulent spores produced mixed results. Patty blends of 10 g of conidia per hive (applied twice) were less successful in significantly reducing the number of mites per adult bee. However, hive survivorship and colony strength were improved, and the numbers of residual mites were significantly reduced at the end of the 42-day experimental period. The overall results from 2003 to 2008 field trials indicated that it was critical to have fungal spores with good germination, pathogenicity and virulence. We determined that fungal spores (1 × 10(10) viable spores per gram) with 98% germination and high pathogenicity (95% mite mortality at day 7) provided successful control of mite populations in established honey bee colonies at 10 g of conidia per hive (applied twice). Overall, microbial control of Varroa mite with M. anisopliae is feasible and could be a useful component of an integrated pest management program.

  7. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  8. [Ebola hemorrhagic fever: Properties of the pathogen and development of vaccines and chemotherapeutic agents].

    Science.gov (United States)

    Kiselev, O I; Vasin, A V; Shevyryova, M P; Deeva, E G; Sivak, K V; Egorov, V V; Tsvetkov, V B; Egorov, A Yu; Romanovskaya-Romanko, E A; Stepanova, L A; Komissarov, A B; Tsybalova, L M; Ignatjev, G M

    2015-01-01

    Ebola hemorrhagic fever (EHF) epidemic currently ongoing in West Africa is not the first among numerous epidemics in the continent. Yet it seems to be the worst EHF epidemic outbreak caused by Ebola virus Zaire since 1976 as regards its extremely large scale and rapid spread in the population. Experiments to study the agent have continued for more than 20 years. The EHF virus has a relatively simple genome with seven genes and additional reading frame resulting from RNA editing. While being of a relatively low genetic capacity, the virus can be ranked as a standard for pathogenicity with the ability to evade the host immune response in uttermost perfection. The EHF virus has similarities with retroviruses, but belongs to (-)RNA viruses of a nonretroviral origin. Genetic elements of the virus, NIRV, were detected in animal and human genomes. EHF virus glycoprotein (GP) is a class I fusion protein and shows more similarities than distinctions in tertiary structure with SIV and HIV gp41 proteins and even influenza virus hemagglutinin. EHF is an unusual infectious disease, and studying the molecular basis of its pathogenesis may contribute to new findings in therapy of severe conditions leading to a fatal outcome.

  9. Development of carboxymethyl cellulose-based hydrogel and nanosilver composite as antimicrobial agents for UTI pathogens.

    Science.gov (United States)

    Alshehri, Saad M; Aldalbahi, Ali; Al-Hajji, Abdullah Baker; Chaudhary, Anis Ahmad; Panhuis, Marc In Het; Alhokbany, Norah; Ahamad, Tansir

    2016-03-15

    Silver nanoparticles (AgNPs) containing hydrogel composite were first synthesized by preparing a new hydrogel from carboxymethyl cellulose (CMC), polyvinyl alcohol (PVA), and the cross-linker ethylene glycol diglycidyl ether (EGDE), followed by the incorporation of AgNPs by microwave radiation. The resulting neat hydrogels and AgNPs-hydrogel composites were characterized using spectral, thermal, microscopic analysis and X-ray diffraction (XRD) analyses. The SEM and TEM results demonstrated that the synthesized AgNPs were spherical with diameters ranging from 8 to 14nm. In addition, the XRD analysis confirmed the nanocrystalline phase of silver with face-centered cubic (FCC) crystal structure. Energy dispersive spectroscopy (EDS) analysis of the AgNPs confirmed the presence of an elemental silver signal, and no peaks of any other impurities were detected. Additionally, the antibacterial activities of the neat hydrogel and AgNPs-hydrogel composites were measured by Kirby-Bauer method against urinary tract infection (UTI) pathogens. The rheology measurement revealed that the values of storage modulus (G') were higher than that of loss modulus (G″). The AgNPs-hydrogel composites exhibited higher antibacterial activity against Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Proteus vulgaris, Staphylococcus aureus and Proteus mirabilis compared to the corresponding neat hydrogel. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Microfungal spores (Ustilago maydis and U. digitariae) immobilised chitosan microcapsules for heavy metal removal.

    Science.gov (United States)

    Sargın, İdris; Arslan, Gulsin; Kaya, Murat

    2016-03-15

    Designing effective chitosan-based biosorbents from unexploited biomass for heavy metal removal has received much attention over the past decade. Ustilago, loose smut, is a ubiquitous fungal plant pathogen infecting over 4000 species including maize and weed. This study aimed to establish whether the spores of the phytopathogenic microfungi Ustilago spores can be immobilised in cross-linked chitosan matrix, and it reports findings on heavy metal sorption performance of chitosan/Ustilago composite microcapsules. Immobilisation of Ustilago maydis and U. digitariae spores (from maize and weed) in chitosan microcapsules was achieved via glutaraldehyde cross-linking. The cross-linked microcapsules were characterised using scanning electron microscopy, FT-IR spectroscopy and thermogravimetric analysis. Sorption capacities of chitosan-U. maydis and chitosan-U. digitariae microcapsules were investigated and compared to cross-linked chitosan beads: Cu(II): 66.72, 69.26, 42.57; Cd(II): 49.46, 53.96, 7.87; Cr(III): 35.88, 49.40, 43.68; Ni(II): 41.67, 33.46, 16.43 and Zn(II): 30.73, 60.81, 15.04mg/g, respectively. Sorption experiments were conducted as a function of initial metal ion concentration (2-10mg/L), contact time (60-480min), temperature (25, 35 and 45°C), amount of the sorbent (0.05-0.25g) and pH of the metal solution. The microcapsules with spores exhibited better performance over the plain chitosan beads, demonstrating their potential use in water treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Caspase dependent programmed cell death in developing embryos: a potential target for therapeutic intervention against pathogenic nematodes.

    Directory of Open Access Journals (Sweden)

    Alok Das Mohapatra

    2011-09-01

    Full Text Available BACKGROUND: Successful embryogenesis is a critical rate limiting step for the survival and transmission of parasitic worms as well as pathology mediated by them. Hence, blockage of this important process through therapeutic induction of apoptosis in their embryonic stages offers promise for developing effective anti-parasitic measures against these extra cellular parasites. However, unlike in the case of protozoan parasites, induction of apoptosis as a therapeutic approach is yet to be explored against metazoan helminth parasites. METHODOLOGY/PRINCIPAL FINDINGS: For the first time, here we developed and evaluated flow cytometry based assays to assess several conserved features of apoptosis in developing embryos of a pathogenic filarial nematode Setaria digitata, in-vitro as well as ex-vivo. We validated programmed cell death in developing embryos by using immuno-fluorescence microscopy and scoring expression profile of nematode specific proteins related to apoptosis [e.g. CED-3, CED-4 and CED-9]. Mechanistically, apoptotic death of embryonic stages was found to be a caspase dependent phenomenon mediated primarily through induction of intracellular ROS. The apoptogenicity of some pharmacological compounds viz. DEC, Chloroquine, Primaquine and Curcumin were also evaluated. Curcumin was found to be the most effective pharmacological agent followed by Primaquine while Chloroquine displayed minimal effect and DEC had no demonstrable effect. Further, demonstration of induction of apoptosis in embryonic stages by lipid peroxidation products [molecules commonly associated with inflammatory responses in filarial disease] and demonstration of in-situ apoptosis of developing embryos in adult parasites in a natural bovine model of filariasis have offered a framework to understand anti-fecundity host immunity operational against parasitic helminths. CONCLUSIONS/SIGNIFICANCE: Our observations have revealed for the first time, that induction of apoptosis in

  12. In vitro propagation of Cyathea atrovirens (Cyatheaceae): spore storage and sterilization conditions.

    Science.gov (United States)

    Vargas, Isabel Beatriz de; Droste, Annette

    2014-03-01

    Cyathea atrovirens occurs in a wide range of habitats in Brazil, Paraguay, Uruguay and Argentina. In the Brazilian State of Rio Grande do Sul, this commonly found species is a target of intense exploitation, because of its ornamental characteristics. The in vitro culture is an important tool for propagation which may contribute toward the reduction of extractivism. However, exogenous contamination of spores is an obstacle for the success of aseptic long-term cultures. This study evaluated the influence of different sterilization methods combined with storage conditions on the contamination of the in vitro cultures and the gametophytic development of C. atrovirens, in order to establish an efficient propagation protocol. Spores were obtained from plants collected in Novo Hamburgo, State of Rio Grande do Sul, Brazil. In the first experiment, spores stored at 7 degrees C were surface sterilized with 0.5, 0.8 and 2% of sodium hypochlorite (NaClO) for 15 minutes and sown in Meyer's culture medium. The cultures were maintained in a growth room at 26 +/- 1 degrees C for a 12-h photoperiod and photon flux density of 100 micromol/m2/s provided by cool white fluorescent light. Contamination was assessed at 60 days, and gametophytic development was scored at 30, 60, 120 and 130 days of in vitro culture, analyzing 300 individuals for each treatment. There was no significant difference in culture contamination among the different sodium hypochlorite concentrations tested, and all treatments allowed for the development of cordiform gametophytes at 130 days of culture. In the second experiment, spores stored at 7 and -20 degrees C were divided into two groups. Half of the spores were surface sterilized with 2% of NaClO for 15 minutes and the other half was not sterilized. All spores were sown in Meyer's medium supplemented with one of the following antibiotics: nystatin, Micostatin and actidione. The culture conditions and the procedures used for evaluating contamination and

  13. Absence of transient elevated uv resistance during germination of Bacillus subtilis spores lacking small, acid-soluble spore proteins α and β

    International Nuclear Information System (INIS)

    Setlow, B.; Setlow, P.

    1988-01-01

    Dormant spores of various Bacillus species are much more resistant to UV irradiation than are the corresponding vegetative cells. This elevated spore UV resistance appears to have two causes. First, UV irradiation of spores does not produce the pyrimidine dimers formed in vegetative-cell DNA, but rather produces several other photoproducts, the most predominant of which is termed the spore photoproduct, a 5-thyminyl-5,6-dihydrothymine adduct (1, 10). Second, spores have at least two mechanisms which efficiently repair this spore photoproduct during spore germination, including one which monomerizes the adduct back to two thymines. This study shows that germinating spores of bacillus subtilis mutants which lack small, acid-soluble spore proteins α and β did not exhibit the transient elevated UV resistance seen during germination of wild-type spores

  14. A Gompertz regression model for fern spores germination

    Directory of Open Access Journals (Sweden)

    Gabriel y Galán, Jose María

    2015-06-01

    Full Text Available Germination is one of the most important biological processes for both seed and spore plants, also for fungi. At present, mathematical models of germination have been developed in fungi, bryophytes and several plant species. However, ferns are the only group whose germination has never been modelled. In this work we develop a regression model of the germination of fern spores. We have found that for Blechnum serrulatum, Blechnum yungense, Cheilanthes pilosa, Niphidium macbridei and Polypodium feuillei species the Gompertz growth model describe satisfactorily cumulative germination. An important result is that regression parameters are independent of fern species and the model is not affected by intraspecific variation. Our results show that the Gompertz curve represents a general germination model for all the non-green spore leptosporangiate ferns, including in the paper a discussion about the physiological and ecological meaning of the model.La germinación es uno de los procesos biológicos más relevantes tanto para las plantas con esporas, como para las plantas con semillas y los hongos. Hasta el momento, se han desarrollado modelos de germinación para hongos, briofitos y diversas especies de espermatófitos. Los helechos son el único grupo de plantas cuya germinación nunca ha sido modelizada. En este trabajo se desarrolla un modelo de regresión para explicar la germinación de las esporas de helechos. Observamos que para las especies Blechnum serrulatum, Blechnum yungense, Cheilanthes pilosa, Niphidium macbridei y Polypodium feuillei el modelo de crecimiento de Gompertz describe satisfactoriamente la germinación acumulativa. Un importante resultado es que los parámetros de la regresión son independientes de la especie y que el modelo no está afectado por variación intraespecífica. Por lo tanto, los resultados del trabajo muestran que la curva de Gompertz puede representar un modelo general para todos los helechos leptosporangiados

  15. Pathogenicity of entomopathogenic fungus Metarhizium anisopliae (Deuteromycetes) to Ixodes scapularis (Acari: Ixodidae)

    Science.gov (United States)

    Zhioua, E.; Browning, M.; Johnson, P.W.; Ginsberg, H.S.; LeBrun, R.A.

    1997-01-01

    The entomopathogenic fungus Metarhizium anisopliae is highly pathogenic to the black-legged tick, Ixodes scapularis. Spore concentrations of 108/ml for engorged larvae and 107/ml for engorged females resulted in 100% tick mortality, 2 wk post-infection. The LC50 value for engorged larvae (concentration to kill 50% of ticks) was 107 spores/ml. Metarhizium anisopliae shows considerable potential as a microbial control agent for the management of Ixodes scapularis.

  16. Live-imaging of Bacillus subtilis spore germination and outgrowth

    NARCIS (Netherlands)

    Pandey, R.

    2014-01-01

    Spores of Gram-positive bacteria such as Bacillus and Clostridium cause huge economic losses to the food industry. In food products, spores survive under food preservation conditions and subsequent germination and outgrowth eventually causes food spoilage. Therefore efforts are being made to

  17. Thermal Inactivation of Bacillus anthracis Spores Using Rapid Resistive Heating

    Science.gov (United States)

    2016-03-24

    agents. There is motivation for using thermal decontamination of B.a. spores for agent defeat scenarios. Spore-forming microorganisms are much...the top soil on Gruinard Island for over 40 years after the British detonated experimental anthrax bombs on the island during World War II (U.S

  18. DNA repair in ultraviolet-irradiated spores of Bacillus subtilis

    International Nuclear Information System (INIS)

    Wang, T.C.V.

    1976-01-01

    It has been shown previously by others that at least two independent repair mechanisms are present in Bacillus subtilis for removing ''spore photoproduct'' from DNA of ultraviolet (254 nm)-irradiated spores after germination. One of these, designated as ''spore repair,'' is shown in this study to restore ''spore photoproduct'' to two thymine residues, leaving the DNA backbone intact at the end of the process in vivo. The circumstances under which this repair can occur and some characteristics of its energy requirements have been clarified. The second repair process is identified as excision repair, which can excise both ''spore photoproduct'' from DNA of irradiated spores and cyclobutane-type pyrimidine dimers from DNA of irradiated vegetative cells. In this study it is shown that the gene hcr 1 affects an enzyme activity for the incision step initiating this repair, while the gene hcr 42 affects a step subsequent to incision in the mechanism. In addition a third, independent repair system, termed ''germinative excision repair,'' is discovered and shown to be specific for excising only cyclobutane-type pyrimidine dimers but not ''spore photoproduct.'' This repair system is responsible for the observed high ultraviolet-resistance and temporary capacity for host cell reactivation on recently germinated spores of Bacillus subtilis HCR - strains

  19. Inhibition of spore germination of Alternaria tenuis by sulfur dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Couey, H.M.

    1962-08-01

    As a part of a continuing study of SO/sub 2/ fumigation of table grapes, the effect of SO/sub 2/ on spores of an isolate of A. tenuis Auct. causing decay of table grapes was determined. The amount of SO/sub 2/ required to inhibit completely spore germination depended on availability of moisture and the temperature. At 20/sup 0/C, wet spores required 20-min exposure to 100 ppm SO/sub 2/ to prevent germination, but spores equilibrated at 90% relative humidity (RH) required 10-min exposure to 1000 ppm SO/sub 2/. Dry spores at 60% RH were unaffected by a 20-min exposure to 4000 ppm SO/sub 2/. Increasing the temperature in the range 5-20/sup 0/C increased effectiveness of the SO/sub 2/ treatment. A comparison of Alternaria with Botrytis cinerea Fr. (studied earlier) showed that wet spores of these organisms were about equally sensitive to SO/sub 2/, but that dry Alternaria spores were more resistant to SO/sub 2/ than dry Botrytis spores under comparable conditions.

  20. LEVELS AND TYPES OF AEROBIC SPORE FORMING BACTERIA ...

    African Journals Online (AJOL)

    The four companies whose packaged product were studied had an average plate total spore counts as follows: Company A=6.2x 103; Company B= 3.1x 104; Company C= 6.0x 104 and Company D= 3.1x102 colony forming units per gram, respectively. Identification tests showed that among the aerobic spore formers were ...

  1. Breaking the spores of Ganoderma lucidum by fermentation with ...

    African Journals Online (AJOL)

    In this paper, fermentation of G. lucidum with Lactobacillus plantarum was applied to break down the sporoderm. Scanning electron microscope (SEM) was used to characterize the spores. The broken spores were found on the 3rd day and complete breaking on the 5th day of fermentation. Lactic acid, acetic acid and ...

  2. The Role of the Electrostatic Force in Spore Adhesion

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Eunhyea [Georgia Institute of Technology; Yiacoumi, Sotira [Georgia Institute of Technology; Lee, Ida [University of Tennessee, Knoxville (UTK); Tsouris, Costas [ORNL

    2010-01-01

    Electrostatic force is investigated as one of the components of the adhesion force between Bacillus thuringiensis (Bt) spores and planar surfaces. The surface potentials of a Bt spore and a mica surface are experimentally obtained using a combined atomic force microscopy (AFM)-scanning surface potential microscopy technique. On the basis of experimental information, the surface charge density of the spores is estimated at 0.03 {micro}C/cm{sup 2} at 20% relative humidity and decreases with increasing humidity. The Coulombic force is introduced for the spore-mica system (both charged, nonconductive surfaces), and an electrostatic image force is introduced to the spore-gold system because gold is electrically conductive. The Coulombic force for spore-mica is repulsive because the components are similarly charged, while the image force for the spore-gold system is attractive. The magnitude of both forces decreases with increasing humidity. The electrostatic forces are added to other force components, e.g., van der Waals and capillary forces, to obtain the adhesion force for each system. The adhesion forces measured by AFM are compared to the estimated values. It is shown that the electrostatic (Coulombic and image) forces play a significant role in the adhesion force between spores and planar surfaces.

  3. Architecture and Assembly of the Bacillus subtilis Spore Coat

    Science.gov (United States)

    2014-09-26

    with chromosomal DNA was as described [32]. Table 1. 8. subtifis strains used in this study. Stra in Genotype Phenotype• PS832 wild type PS3394...of the morphology of fully hydrated and air dried spores demonstrate that surface ridges on dehydrated spores mostly disappear or decrease in size

  4. Longitudinal assessment of dairy farm management practices associated with the presence of psychrotolerant Bacillales spores in bulk tank milk on 10 New York State dairy farms.

    Science.gov (United States)

    Masiello, S N; Kent, D; Martin, N H; Schukken, Y H; Wiedmann, M; Boor, K J

    2017-11-01

    The ability of certain spore-forming bacteria in the order Bacillales (e.g., Bacillus spp., Paenibacillus spp.) to survive pasteurization in spore form and grow at refrigeration temperatures results in product spoilage and limits the shelf life of high temperature, short time (HTST)-pasteurized fluid milk. To facilitate development of strategies to minimize contamination of raw milk with psychrotolerant Bacillales spores, we conducted a longitudinal study of 10 New York State dairy farms, which included yearlong monthly assessments of the frequency and levels of bulk tank raw milk psychrotolerant spore contamination, along with administration of questionnaires to identify farm management practices associated with psychrotolerant spore presence over time. Milk samples were first spore pasteurized (80°C for 12 min) and then analyzed for sporeformer counts on the initial day of spore pasteurization (SP), and after refrigerated storage (6°C) for 7, 14, and 21 d after SP. Overall, 41% of samples showed sporeformer counts of >20,000 cfu/mL at d 21, with Bacillus and Paenibacillus spp. being predominant causes of high sporeformer counts. Statistical analyses identified 3 management factors (more frequent cleaning of the bulk tank area, the use of a skid steer to scrape the housing area, and segregating problem cows during milking) that were all associated with lower probabilities of d-21 Bacillales spore detection in SP-treated bulk tank raw milk. Our data emphasize that appropriate on-farm measures to improve overall cleanliness and cow hygiene will reduce the probability of psychrotolerant Bacillales spore contamination of bulk tank raw milk, allowing for consistent production of raw milk with reduced psychrotolerant spore counts, which will facilitate production of HTST-pasteurized milk with extended refrigerated shelf life. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  5. Custom database development and biomarker discovery methods for MALDI-TOF mass spectrometry-based identification of high-consequence bacterial pathogens.

    Science.gov (United States)

    Tracz, Dobryan M; Tyler, Andrea D; Cunningham, Ian; Antonation, Kym S; Corbett, Cindi R

    2017-03-01

    A high-quality custom database of MALDI-TOF mass spectral profiles was developed with the goal of improving clinical diagnostic identification of high-consequence bacterial pathogens. A biomarker discovery method is presented for identifying and evaluating MALDI-TOF MS spectra to potentially differentiate biothreat bacteria from less-pathogenic near-neighbour species. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  6. Presence survival spores of Bacillus thuringiensis varieties in grain warehouse

    Directory of Open Access Journals (Sweden)

    Sánchez-Yáñez Juan Manuel

    2016-08-01

    Full Text Available Genus Bacillus thuringiensis (Bt synthesized spores and crystals toxic to pest-insects in agriculture. Bt is comospolitan then possible to isolate some subspecies or varieties from warehouse. The aims of study were: i to isolate Bt varieties from grain at werehouse ii to evaluate Bt toxicity on Spodoptera frugiperda and Shit-ophilus zeamaisese iii to analyze Bt spores persistence in Zea mays grains at werehouse compared to same Bt on grains exposed to sun radiation. Results showed that at werehouse were recovered more than one variety of Bt spores. According to each isolate Bt1 o Bt2 were toxic to S. frugiperda or S. zeamaisese. One those Bt belong to var morrisoni. At werehouse these spores on Z. mays grains surviving more time, while the same spores exposed to boicide sun radiation they died.

  7. Removal of dissolved heavy metals and radionuclides by microbial spores

    International Nuclear Information System (INIS)

    Revis, N.W.; Hadden, C.T.; Edenborn, H.

    1997-01-01

    Microbial systems have been shown to remove specific heavy metals from contaminated aqueous waste to levels acceptable to EPA for environmental release. However, systems capable of removing a variety of heavy metals from aqueous waste to environmentally acceptable levels remain to be reported. The present studies were performed to determine the specificity of spores of the bacterium Bacillus megaterium for the adsorption of dissolved metals and radionuclides from aqueous waste. The spores effectively adsorbed eight heavy metals from a prepared metal mix and from a plating rinse waste to EPA acceptable levels for waste water. These results suggest that spores have multiple binding sites for the adsorption of heavy metals. Spores were also effective in adsorbing the radionuclides 85 strontium and 197 cesium. The presence of multiple sites in spores for the adsorption of heavy metals and radionuclides makes this biosorbent a good candidate for the treatment of aqueous wastes associated with the plating and nuclear industries. 17 refs., 4 tabs

  8. Disinfection and regrowth potential of bacillus subtilis spores by ozone, ultraviolet rays and gamma irradiation

    International Nuclear Information System (INIS)

    Kim, Hae Yeon; Lee, O Mi; Kim, Tae Hun; Lee, Myun Joo; Yu, Seung Ho

    2009-01-01

    Chlorination has been the most commonly adopted disinfection process for the treatment of drinking water. However, Cryptosporidium parvum oocysts and Giardia lamblia cysts were not treated effectively by the common chlorine-based disinfectants. Additionally the regrowth of pathogenic microorganisms is associated with hygienic and aesthetic problems for the consumers of drinking water. Study on alternative disinfection processes such as ozone, UV-C, VUV and gamma irradiation were conducted. Bacillus subtilis spores have been used as a surrogate microorganism for Cryptosporidium parvum oocysts and Giardia lamblia cyst. Inactivation efficiency by ozone was from 30% to 96% within the range of 5 min to 120 min exposures. Inactivation efficiencies by UV-C and VUV were 95.18%, 95.07% at 30 sec, respectively. Inactivation efficiency at gamma irradiation dose of 2 kGy was 99.4%. Microbial regrowths after ozone, UV-C, VUV and gamma irradiation disinfections were also evaluated for 4 days. Bacillus subtilis spores after ozone treatment for 120 min exposure at the rate of 1.68 mg · min -1 showed 96.02% disinfection efficiency and significant microbial regrowth. Bacillus subtilis spores after UV-C (99.25% disinfection efficiency) and VUV (99.67% disinfection efficiency) treatments for 5 min showed gradual regrowth. However, inactivation efficiency of gamma irradiation at dose of 1 kGy was 98.8% and the disinfected sample showed no microbial regrowth for 4 days. Therefore, gamma irradiation is the most effective process for the disinfection of pathogenic microorganisms such as oocysts of protozoan parasites among four disinfection process

  9. Disinfection and regrowth potential of bacillus subtilis spores by ozone, ultraviolet rays and gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hae Yeon; Lee, O Mi; Kim, Tae Hun; Lee, Myun Joo; Yu, Seung Ho [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2009-06-15

    Chlorination has been the most commonly adopted disinfection process for the treatment of drinking water. However, Cryptosporidium parvum oocysts and Giardia lamblia cysts were not treated effectively by the common chlorine-based disinfectants. Additionally the regrowth of pathogenic microorganisms is associated with hygienic and aesthetic problems for the consumers of drinking water. Study on alternative disinfection processes such as ozone, UV-C, VUV and gamma irradiation were conducted. Bacillus subtilis spores have been used as a surrogate microorganism for Cryptosporidium parvum oocysts and Giardia lamblia cyst. Inactivation efficiency by ozone was from 30% to 96% within the range of 5 min to 120 min exposures. Inactivation efficiencies by UV-C and VUV were 95.18%, 95.07% at 30 sec, respectively. Inactivation efficiency at gamma irradiation dose of 2 kGy was 99.4%. Microbial regrowths after ozone, UV-C, VUV and gamma irradiation disinfections were also evaluated for 4 days. Bacillus subtilis spores after ozone treatment for 120 min exposure at the rate of 1.68 mg {center_dot} min{sup -1} showed 96.02% disinfection efficiency and significant microbial regrowth. Bacillus subtilis spores after UV-C (99.25% disinfection efficiency) and VUV (99.67% disinfection efficiency) treatments for 5 min showed gradual regrowth. However, inactivation efficiency of gamma irradiation at dose of 1 kGy was 98.8% and the disinfected sample showed no microbial regrowth for 4 days. Therefore, gamma irradiation is the most effective process for the disinfection of pathogenic microorganisms such as oocysts of protozoan parasites among four disinfection process.

  10. Decontamination Options for Drinking Water Contaminated with Bacillus anthracis Spores

    Energy Technology Data Exchange (ETDEWEB)

    Raber, E; Burklund, A

    2010-02-16

    Five parameters were evaluated with surrogates of Bacillus anthracis spores to determine effective decontamination options for use in a contaminated drinking water supply. The parameters were: (1) type of Bacillus spore surrogate (B. thuringiensis or B. atrophaeus); (2) spore concentration in suspension (10{sup 2} to 10{sup 6} spores/ml); (3) chemical characteristics of decontaminant [sodium dicholor-s-triazinetrione dihydrate (Dichlor), hydrogen peroxide, potassium peroxymonosulfate (Oxone), sodium hypochlorite, and VirkonS{reg_sign}]; (4) decontaminant concentration (0.01% to 5%); and (5) decontaminant exposure time (10 min to 24 hr). Results from 162 suspension tests with appropriate controls are reported. Hydrogen peroxide at a concentration of 5%, and Dichlor and sodium hypochlorite at a concentration of 2%, were effective at spore inactivation regardless of spore type tested, spore exposure time, or spore concentration evaluated. This is the first reported study of Dichlor as an effective decontaminant for B. anthracis spore surrogates. Dichlor's desirable characteristics of high oxidation potential, high level of free chlorine, and more neutral pH than that of other oxidizers evaluated appear to make it an excellent alternative. All three oxidizers were effective against B. atrophaeus spores in meeting EPA's biocide standard of greater than a 6 log kill after a 10-minute exposure time and at lower concentrations than typically reported for biocide use. Solutions of 5% VirkonS{reg_sign} and Oxone were less effective decontaminants than other options evaluated in this study and did not meet the EPA's efficacy standard for biocides. Differences in methods and procedures reported by other investigators make quantitative comparisons among studies difficult.

  11. Characterizing aeroallergens by infrared spectroscopy of fungal spores and pollen.

    Directory of Open Access Journals (Sweden)

    Boris Zimmermann

    Full Text Available Fungal spores and plant pollen cause respiratory diseases in susceptible individuals, such as asthma, allergic rhinitis and hypersensitivity pneumonitis. Aeroallergen monitoring networks are an important part of treatment strategies, but unfortunately traditional analysis is time consuming and expensive. We have explored the use of infrared spectroscopy of pollen and spores for an inexpensive and rapid characterization of aeroallergens.The study is based on measurement of spore and pollen samples by single reflectance attenuated total reflectance Fourier transform infrared spectroscopy (SR-ATR FTIR. The experimental set includes 71 spore (Basidiomycota and 121 pollen (Pinales, Fagales and Poales samples. Along with fresh basidiospores, the study has been conducted on the archived samples collected within the last 50 years.The spectroscopic-based methodology enables clear spectral differentiation between pollen and spores, as well as the separation of confamiliar and congeneric species. In addition, the analysis of the scattering signals inherent in the infrared spectra indicates that the FTIR methodology offers indirect estimation of morphology of pollen and spores. The analysis of fresh and archived spores shows that chemical composition of spores is well preserved even after decades of storage, including the characteristic taxonomy-related signals. Therefore, biochemical analysis of fungal spores by FTIR could provide economical, reliable and timely methodologies for improving fungal taxonomy, as well as for fungal identification and monitoring. This proof of principle study shows the potential for using FTIR as a rapid tool in aeroallergen studies. In addition, the presented method is ready to be immediately implemented in biological and ecological studies for direct measurement of pollen and spores from flowers and sporocarps.

  12. VeA of Aspergillus niger increases spore dispersing capacity by impacting conidiophore architecture.

    Science.gov (United States)

    Wang, Fengfeng; Dijksterhuis, Jan; Wyatt, Timon; Wösten, Han A B; Bleichrodt, Robert-Jan

    2015-01-01

    Aspergillus species are highly abundant fungi worldwide. Their conidia are among the most dominant fungal spores in the air. Conidia are formed in chains on the vesicle of the asexual reproductive structure called the conidiophore. Here, it is shown that the velvet protein VeA of Aspergillus niger maximizes the diameter of the vesicle and the spore chain length. The length and width of the conidiophore stalk and vesicle were reduced nearly twofold in a ΔveA strain. The latter implies a fourfold reduced surface area to develop chains of spores. Over and above this, the conidial chain length was approximately fivefold reduced. The calculated 20-fold reduction in formation of conidia by ΔveA fits the 8- to 17-fold decrease in counted spore numbers. Notably, morphology of the ΔveA conidiophores of A. niger was very similar to that of wild-type Aspergillus sydowii. This suggests that VeA is key in conidiophore architecture diversity in the fungal kingdom. The finding that biomass formation of the A. niger ΔveA strain was reduced twofold shows that VeA not only impacts dispersion capacity but also colonization capacity of A. niger.

  13. Reduced spore germination explains sensitivity of reef-building algae to climate change stressors.

    Directory of Open Access Journals (Sweden)

    Alexandra Ordoñez

    Full Text Available Reduced seawater pH and changes in carbonate chemistry associated with ocean acidification (OA decrease the recruitment of crustose coralline algae (CCAcf., an important coral-reef builder. However, it is unclear whether the observed decline in recruitment is driven by impairment of spore germination, or post-settlement processes (e.g. space competition. To address this, we conducted an experiment using a dominant CCA, Porolithon cf. onkodes to test the independent and combined effects of OA, warming, and irradiance on its germination success and early development. Elevated CO2 negatively affected several processes of spore germination, including formation of the germination disc, initial growth, and germling survival. The magnitude of these effects varied depending on the levels of temperature and irradiance. For example, the combination of high CO2 and high temperature reduced formation of the germination disc, but this effect was independent of irradiance levels, while spore abnormalities increased under high CO2 and high temperature particularly in combination with low irradiance intensity. This study demonstrates that spore germination of CCA is impacted by the independent and interactive effects of OA, increasing seawater temperature and irradiance intensity. For the first time, this provides a mechanism for how the sensitivity of critical early life history processes to global change may drive declines of adult populations of key marine calcifiers.

  14. The effects of salinity and temperature shock on Kappaphycus alvarezii seaweed spores release

    Science.gov (United States)

    Harwinda, F. K.; Satyantini, W. H.; Masithah, E. W.

    2018-04-01

    One of the reproductive aspects of development step that is considered as the solution of this issue is seaweed sporulation technique through which is induced through salinity and temperature shock. This study aims to determine the effect of combination and interaction of salinity and temperature shock on the release of K. alvarezii spores in order to produce superior seeds. This research was conducted using Complete Randomized Design Factorial which consists of nine combinations of treatments and three replications. The used treatment in this study is the combination of different environmental factors such as salinity shock and temperature shock. The data were analyzed using ANOVA (Analysis of Variance) followed by Duncan Multiple Range Test. The results showed that salinity (31 ppt, 33 ppt, and 35 ppt) and temperature (30°C, 32°C, and 34°C). shock affected the osmoregulation system and the release of K. alvarezii spores. The salinity shock and temperature shock had interaction with K. alvarezii spore release on the sixth and seventh day with the best treatment at 32°C temperature and 31 ppt salinity and released 5413 cells/ml spores on the seventh day.

  15. Development of a greenhouse-based inoculation protocol for the fungus Colletotrichum cereale pathogenic to annual bluegrass (Poa annua

    Directory of Open Access Journals (Sweden)

    Lisa A. Beirn

    2015-08-01

    Full Text Available The fungus Colletotrichum cereale incites anthracnose disease on Poa annua (annual bluegrass turfgrass. Anthracnose disease is geographically widespread throughout the world and highly destructive to cool-season turfgrasses, with infections by C. cereale resulting in extensive turf loss. Comprehensive research aimed at controlling turfgrass anthracnose has been performed in the field, but knowledge of the causal organism and its basic biology is still needed. In particular, the lack of a reliable greenhouse-based inoculation protocol performed under controlled environmental conditions is an obstacle to the study of C. cereale and anthracnose disease. Our objective was to develop a consistent and reproducible inoculation protocol for the two major genetic lineages of C. cereale. By adapting previously successful field-based protocols and combining with components of existing inoculation procedures, the method we developed consistently produced C. cereale infection on two susceptible P. annua biotypes. Approximately 7 to 10 days post-inoculation, plants exhibited chlorosis and thinning consistent with anthracnose disease symptomology. Morphological inspection of inoculated plants revealed visual signs of the fungus (appressoria and acervuli, although acervuli were not always present. After stringent surface sterilization of inoculated host tissue, C. cereale was consistently re-isolated from symptomatic tissue. Real-time PCR detection analysis based on the Apn2 marker confirmed the presence of the pathogen in host tissue, with both lineages of C. cereale detected from all inoculated plants. When a humidifier was not used, no infection developed for any biotypes or fungal isolates tested. The inoculation protocol described here marks significant progress for in planta studies of C. cereale, and will enable scientifically reproducible investigations of the biology, infectivity and lifestyle of this important grass pathogen.

  16. Survival of Spores of Trichoderma longibrachiatum in Space: data from the Space Experiment SPORES on EXPOSE-R

    Science.gov (United States)

    Neuberger, Katja; Lux-Endrich, Astrid; Panitz, Corinna

    2015-01-01

    In the space experiment `Spores in artificial meteorites' (SPORES), spores of the fungus Trichoderma longibrachiatum were exposed to low-Earth orbit for nearly 2 years on board the EXPOSE-R facility outside of the International Space Station. The environmental conditions tested in space were: space vacuum at 10-7-10-4 Pa or argon atmosphere at 105 Pa as inert gas atmosphere, solar extraterrestrial ultraviolet (UV) radiation at λ > 110 nm or λ > 200 nm with fluences up to 5.8 × 108 J m-2, cosmic radiation of a total dose range from 225 to 320 mGy, and temperature fluctuations from -25 to +50°C, applied isolated or in combination. Comparable control experiments were performed on ground. After retrieval, viability of spores was analysed by two methods: (i) ethidium bromide staining and (ii) test of germination capability. About 30% of the spores in vacuum survived the space travel, if shielded against insolation. However, in most cases no significant decrease was observed for spores exposed in addition to the full spectrum of solar UV irradiation. As the spores were exposed in clusters, the outer layers of spores may have shielded the inner part. The results give some information about the likelihood of lithopanspermia, the natural transfer of micro-organisms between planets. In addition to the parameters of outer space, sojourn time in space seems to be one of the limiting parameters.

  17. A nonnative and a native fungal plant pathogen similarly stimulate ectomycorrhizal development but are perceived differently by a fungal symbiont.

    Science.gov (United States)

    Zampieri, Elisa; Giordano, Luana; Lione, Guglielmo; Vizzini, Alfredo; Sillo, Fabiano; Balestrini, Raffaella; Gonthier, Paolo

    2017-03-01

    The effects of plant symbionts on host defence responses against pathogens have been extensively documented, but little is known about the impact of pathogens on the symbiosis and if such an impact may differ for nonnative and native pathogens. Here, this issue was addressed in a study of the model system comprising Pinus pinea, its ectomycorrhizal symbiont Tuber borchii, and the nonnative and native pathogens Heterobasidion irregulare and Heterobasidion annosum, respectively. In a 6-month inoculation experiment and using both in planta and gene expression analyses, we tested the hypothesis that H. irregulare has greater effects on the symbiosis than H. annosum. Although the two pathogens induced the same morphological reaction in the plant-symbiont complex, with mycorrhizal density increasing exponentially with pathogen colonization of the host, the number of target genes regulated in T. borchii in plants inoculated with the native pathogen (i.e. 67% of tested genes) was more than twice that in plants inoculated with the nonnative pathogen (i.e. 27% of genes). Although the two fungal pathogens did not differentially affect the amount of ectomycorrhizas, the fungal symbiont perceived their presence differently. The results may suggest that the symbiont has the ability to recognize a self/native and a nonself/nonnative pathogen, probably through host plant-mediated signal transduction. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  18. Inactivation of certain insect pathogens by ultraviolet radiation

    International Nuclear Information System (INIS)

    Krieg, A.; Groener, A.; Huber, J.; Zimmermann, G.

    1981-01-01

    The UV-sensitivity of two baculoviruses (granulosis virus, nuclear polyhedrosis virus) and two entomopathogenic microorganisms (Bacillus thuringiensis, Beauveria bassiana) was determined by radiation tests. In the far UV (254 nm) the stability, measured at an inactivation rate of 99%, was in declining order: nuclear polyhedra >= conidia of B. bassiana > granula > spores of B. thuringiensis >= vegetative cells of B. thuringiensis. In the near UV (285-380 nm) the following order could be found: conidia of B. bassiana >= nuclear polyhedra > spores of B. thuringiensis >= granula > vegetative cells of B. thuringiensis. Far UV had a much higher germicidal effect for all pathogens tested than near UV. (orig.) [de

  19. Inactivation of certain insect pathogens by ultraviolet radiation

    Energy Technology Data Exchange (ETDEWEB)

    Krieg, A.; Groener, A.; Huber, J.; Zimmermann, G.

    1981-01-01

    The UV-sensitivity of two baculoviruses (granulosis virus, nuclear polyhedrosis virus) and two entomopathogenic microorganisms (Bacillus thuringiensis, Beauveria bassiana) was determined by radiation tests. In the far UV (254 nm) the stability, measured at an inactivation rate of 99%, was in declining order: nuclear polyhedra >= conidia of B. bassiana > granula > spores of B. thuringiensis >= vegetative cells of B. thuringiensis. In the near UV (285-380 nm) the following order could be found: conidia of B. bassiana >= nuclear polyhedra > spores of B. thuringiensis >= granula > vegetative cells of B. thuringiensis. Far UV had a much higher germicidal effect for all pathogens tested than near UV.

  20. Mycobacterium biofilms: factors involved in development, dispersal, and therapeutic strategies against biofilm-relevant pathogens.

    Science.gov (United States)

    Xiang, Xiaohong; Deng, Wanyan; Liu, Minqiang; Xie, Jianping

    2014-01-01

    Many bacteria can develop biofilm (BF), a multicellular structure largely combining bacteria and their extracellular polymeric substances (EPS). The formation of biofilm results in an alternative existence in which microbes ensure their survival in adverse environments. Biofilm-relevant infections are more persistent, resistant to most antibiotics, and more recalcitrant to host immunity. Mycobacterium tuberculosis, the causative agent of tuberculosis, can develop biofilm, though whether M. tuberculosis can form biofilm within tuberculosis patients has yet to be determined. Here, we summarize the factors involved in the development and dispersal of mycobacterial biofilms, as well as underlying regulatory factors and inhibitors against biofilm to deepen our understanding of their development and to elucidate potential novel modes of action for future antibiotics. Key factors in biofilm formation identified as drug targets represent a novel and promising avenue for developing better antibiotics.

  1. Autophagy in plant pathogenic fungi.

    Science.gov (United States)

    Liu, Xiao-Hong; Xu, Fei; Snyder, John Hugh; Shi, Huan-Bin; Lu, Jian-Ping; Lin, Fu-Cheng

    2016-09-01

    Autophagy is a conserved cellular process that degrades cytoplasmic constituents in vacuoles. Plant pathogenic fungi develop special infection structures and/or secrete a range of enzymes to invade their plant hosts. It has been demonstrated that monitoring autophagy processes can be extremely useful in visualizing the sequence of events leading to pathogenicity of plant pathogenic fungi. In this review, we introduce the molecular mechanisms involved in autophagy. In addition, we explore the relationship between autophagy and pathogenicity in plant pathogenic fungi. Finally, we discuss the various experimental strategies available for use in the study of autophagy in plant pathogenic fungi. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Development of a Commercial Prototype of the Autonomous Pathogen Detection System Final Report CRADA No. TC-02077-04

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Haigh, P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-09-27

    This was a collaborative effort between The Regents of the University of California, Lawrence Livermore National Laboratory (LLNL), and GE Ion Track, Inc. (GEIT) to develop a commercial prototype of the Autonomous Pathogen Detection System (APDS), an instrument that monitors the air for all three biological threat agents (bacteria, viruses and toxins). This was originally a one year CRADA project, with the cost of the work at LLNL being funded by the Department of Homeland Security's Office of National Laboratories. The original project consisted of five major tasks and deliverables. The CRADA was then amended, converting the CRADA from a programmatically funded CRADA to a funds-in CRADA, extending the project for an additional 14 months, and adding four new tasks and deliverable to the project.

  3. Elastic and inelastic light scattering from single bacterial spores in an optical trap allows the monitoring of spore germination dynamics

    Science.gov (United States)

    Peng, Lixin; Chen, De; Setlow, Peter; Li, Yong-qing

    2009-01-01

    Raman scattering spectroscopy and elastic light scattering intensity (ESLI) were used to simultaneously measure levels of Ca-dipicolinic acid (CaDPA) and changes in spore morphology and refractive index during germination of individual B. subtilis spores with and without the two redundant enzymes (CLEs), CwlJ and SleB, that degrade spores’ peptidoglycan cortex. Conclusions from these measurements include: 1) CaDPA release from individual wild-type germinating spores was biphasic; in a first heterogeneous slow phase, Tlag, CaDPA levels decreased ∼15% and in the second phase ending at Trelease, remaining CaDPA was released rapidly; 2) in L-alanine germination of wild-type spores and spores lacking SleB: a) the ESLI rose ∼2-fold shortly before Tlag at T1; b) following Tlag, the ESLI again rose ∼2-fold at T2 when CaDPA levels had decreased ∼50%; and c) the ESLI reached its maximum value at ∼Trelease and then decreased; 3) in CaDPA germination of wild-type spores: a) Tlag increased and the first increase in ESLI occurred well before Tlag, consistent with different pathways for CaDPA and L-alanine germination; b) at Trelease the ESLI again reached its maximum value; 4) in L-alanine germination of spores lacking both CLEs and unable to degrade their cortex, the time ΔTrelease (Trelease–Tlag) for excretion of ≥75% of CaDPA was ∼15-fold higher than that for wild-type or sleB spores; and 5) spores lacking only CwlJ exhibited a similar, but not identical ESLI pattern during L-alanine germination to that seen with cwlJ sleB spores, and the high value for ΔTrelease. PMID:19374431

  4. Using Spores for Fusarium spp. Classification by MALDI-Based Intact Cell/Spore Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Wolfgang Winkler

    2012-01-01

    Full Text Available Fusarium is a widespread genus of filamentous fungi and a member of the soil microbial community. Certain subspecies are health threatening because of their mycotoxin production that affects the human and animal food chain. Thus, for early and effective pest control, species identification is of particular interest; however, differentiation on the subspecies level is challenging and time-consuming for this fungus. In the present study, we show the possibilities of intact cell mass spectrometry for spore analysis of 22 different Fusarium strains belonging to six Fusarium subspecies. We found that species differentiation is possible if mass spectrometric analyses are performed under well-defined conditions with fixed parameters. A critical point for analysis is a proper sample preparation of spores, which increases the quality of mass spectra with respect to signal intensity and m/z value variations. It was concluded that data acquistion has to be performed automatically; otherwise, user-specific variations are introduced generating data which cannot fit the existing datasets. Data that show clearly that matrix-assisted laser desorption ionization-based intact cell/intact spore mass spectrometry (IC/ISMS can be applied to differentiate closely related Fusarium spp. are presented. Results show a potential to build a database on Fusarium species for accurate species identification, for fast response in the case of infections in the cornfield. We furthermore demonstrate the high precision of our approach in classification of intact Fusarium species according to the location of their collection.

  5. Pathogen inactivation techniques.

    Science.gov (United States)

    Pelletier, J P R; Transue, S; Snyder, E L

    2006-01-01

    The desire to rid the blood supply of pathogens of all types has led to the development of many technologies aimed at the same goal--eradication of the pathogen(s) without harming the blood cells or generating toxic chemical agents. This is a very ambitious goal, and one that has yet to be achieved. One approach is to shun the 'one size fits all' concept and to target pathogen-reduction agents at the Individual component types. This permits the development of technologies that might be compatible with, for example, plasma products but that would be cytocidal and thus incompatible with platelet concentrates or red blood cell units. The technologies to be discussed include solvent detergent and methylene blue treatments--designed to inactivate plasma components and derivatives; psoralens (S-59--amotosalen) designed to pathogen-reduce units of platelets; and two products aimed at red blood cells, S-303 (a Frale--frangible anchor-linker effector compound) and Inactine (a binary ethyleneimine). A final pathogen-reduction material that might actually allow one material to inactivate all three blood components--riboflavin (vitamin B2)--is also under development. The sites of action of the amotosalen (S-59), the S-303 Frale, Inactine, and riboflavin are all localized in the nucleic acid part of the pathogen. Solvent detergent materials act by dissolving the plasma envelope, thus compromising the integrity of the pathogen membrane and rendering it non-infectious. By disrupting the pathogen's ability to replicate or survive, its infectivity is removed. The degree to which bacteria and viruses are affected by a particular pathogen-reducing technology relates to its Gram-positive or Gram-negative status, to the sporulation characteristics for bacteria, and the presence of lipid or protein envelopes for viruses. Concerns related to photoproducts and other breakdown products of these technologies remain, and the toxicology of pathogen-reduction treatments is a major ongoing area

  6. Arthropods vector grapevine trunk disease pathogens.

    Science.gov (United States)

    Moyo, P; Allsopp, E; Roets, F; Mostert, L; Halleen, F

    2014-10-01

    Arthropod-mediated dispersal of pathogens is known in many cropping systems but has never been demonstrated for grapevine trunk disease pathogens. Arthropods from vineyards were screened for the presence of pathogens associated with Petri disease and esca using cultural and molecular techniques. The ability of the most abundant pathogen-carrying species to inoculate healthy grapevine vascular tissues was also determined. Millipedes and ants were allowed to associate with a DsRed- Express-transformed Phaeomoniella chlamydospora, after which they were exposed to freshly pruned healthy grapevines under controlled conditions and wounds were monitored for subsequent infection. In addition, the possibility of millipede excreta, commonly found on pruning wounds in the field, to act as inoculum source was determined. A diverse arthropod fauna was associated with declining grapevines and many of these carried trunk disease pathogens. However, spiders, the ant Crematogaster peringueyi, and the millipede Ommattoiulus moreleti were the most abundant pathogen carriers. The ant and millipede species fed on pruning wound sap and effectively transmitted trunk disease pathogens. Millipede excreta contained viable spores of Phaeomoniella chlamydospora and may serve as an inoculum source. Numerous arthropods, including beneficial predators, are potential vectors of grapevine trunk disease pathogens. Our results highlight the need for an integrated approach, including targeted management of ants and millipedes at the time of pruning, to limit the spread of grapevine trunk diseases.

  7. Development of electrochemical biosensor for detection of pathogenic microorganism in Asian dust events.

    Science.gov (United States)

    Yoo, Min-Sang; Shin, Minguk; Kim, Younghun; Jang, Min; Choi, Yoon-E; Park, Si Jae; Choi, Jonghoon; Lee, Jinyoung; Park, Chulhwan

    2017-05-01

    We developed a single-walled carbon nanotubes (SWCNTs)-based electrochemical biosensor for the detection of Bacillus subtilis, one of the microorganisms observed in Asian dust events, which causes respiratory diseases such as asthma and pneumonia. SWCNTs plays the role of a transducer in biological antigen/antibody reaction for the electrical signal while 1-pyrenebutanoic acid succinimidyl ester (1-PBSE) and ant-B. subtilis were performed as a chemical linker and an acceptor, respectively, for the adhesion of target microorganism in the developed biosensor. The detection range (10 2 -10 10  CFU/mL) and the detection limit (10 2  CFU/mL) of the developed biosensor were identified while the response time was 10 min. The amount of target B. subtilis was the highest in the specificity test of the developed biosensor, compared with the other tested microorganisms (Staphylococcus aureus, Flavobacterium psychrolimnae, and Aquabacterium commune). In addition, target B. subtilis detected by the developed biosensor was observed by scanning electron microscope (SEM) analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Development and Deployment of Systems-Based Approaches for the Management of Soilborne Plant Pathogens.

    Science.gov (United States)

    Chellemi, D O; Gamliel, A; Katan, J; Subbarao, K V

    2016-03-01

    Biological suppression of soilborne diseases with minimal use of outside interventive actions has been difficult to achieve in high input conventional crop production systems due to the inherent risk of pest resurgence. This review examines previous approaches to the management of soilborne disease as precursors to the evolution of a systems-based approach, in which plant disease suppression through natural biological feedback mechanisms in soil is incorporated into the design and operation of cropping systems. Two case studies are provided as examples in which a systems-based approach is being developed and deployed in the production of high value crops: lettuce/strawberry production in the coastal valleys of central California (United States) and sweet basil and other herb crop production in Israel. Considerations for developing and deploying system-based approaches are discussed and operational frameworks and metrics to guide their development are presented with the goal of offering a credible alternative to conventional approaches to soilborne disease management.

  9. Host–Pathogen Interactions

    NARCIS (Netherlands)

    Smits, M.A.; Schokker, D.J.

    2011-01-01

    The outcome of an infection is determined by numerous interactions between hosts and pathogens occurring at many different biological levels, ranging from molecule to population. To develop new control strategies for infectious diseases in livestock species, appropriate methodologies are needed

  10. Mechanism of Bacillus subtilis spore inactivation by and resistance to supercritical CO2 plus peracetic acid.

    Science.gov (United States)

    Setlow, B; Korza, G; Blatt, K M S; Fey, J P; Setlow, P

    2016-01-01

    Determine how supercritical CO2 (scCO2 ) plus peracetic acid (PAA) inactivates Bacillus subtilis spores, factors important in spore resistance to scCO2 -PAA, and if spores inactivated by scCO2 -PAA are truly dead. Spores of wild-type B. subtilis and isogenic mutants lacking spore protective proteins were treated with scCO2 -PAA in liquid or dry at 35°C. Wild-type wet spores (aqueous suspension) were more susceptible than dry spores. Treated spores were examined for viability (and were truly dead), dipicolinic acid (DPA), mutations, permeability to nucleic acid stains, germination under different conditions, energy metabolism and outgrowth. ScCO2 -PAA-inactivated spores retained DPA, and survivors had no notable DNA damage. However, DPA was released from inactivated spores at a normally innocuous temperature (85°C), and colony formation from treated spores was salt sensitive. The inactivated spores germinated but did not outgrow, and these germinated spores had altered plasma membrane permeability and defective energy metabolism. Wet or dry coat-defective spores had increased scCO2 -PAA sensitivity, and dry spores but not wet spores lacking DNA protective proteins were more scCO2 -PAA sensitive. These findings suggest that scCO2 -PAA inactivates spores by damaging spores' inner membrane. The spore coat provided scCO2 -PAA resistance for both wet and dry spores. DNA protective proteins provided scCO2 -PAA resistance only for dry spores. These results provide information on mechanisms of spore inactivation of and resistance to scCO2 -PAA, an agent with increasing use in sterilization applications. © 2015 The Society for Applied Microbiology.

  11. The steroid catabolic pathway of the intracellular pathogen Rhodococcus equi is important for pathogenesis and a target for vaccine development.

    Directory of Open Access Journals (Sweden)

    R van der Geize

    2011-08-01

    Full Text Available Rhodococcus equi causes fatal pyogranulomatous pneumonia in foals and immunocompromised animals and humans. Despite its importance, there is currently no effective vaccine against the disease. The actinobacteria R. equi and the human pathogen Mycobacterium tuberculosis are related, and both cause pulmonary diseases. Recently, we have shown that essential steps in the cholesterol catabolic pathway are involved in the pathogenicity of M. tuberculosis. Bioinformatic analysis revealed the presence of a similar cholesterol catabolic gene cluster in R. equi. Orthologs of predicted M. tuberculosis virulence genes located within this cluster, i.e. ipdA (rv3551, ipdB (rv3552, fadA6 and fadE30, were identified in R. equi RE1 and inactivated. The ipdA and ipdB genes of R. equi RE1 appear to constitute the α-subunit and β-subunit, respectively, of a heterodimeric coenzyme A transferase. Mutant strains RE1ΔipdAB and RE1ΔfadE30, but not RE1ΔfadA6, were impaired in growth on the steroid catabolic pathway intermediates 4-androstene-3,17-dione (AD and 3aα-H-4α(3'-propionic acid-5α-hydroxy-7aβ-methylhexahydro-1-indanone (5α-hydroxy-methylhexahydro-1-indanone propionate; 5OH-HIP. Interestingly, RE1ΔipdAB and RE1ΔfadE30, but not RE1ΔfadA6, also displayed an attenuated phenotype in a macrophage infection assay. Gene products important for growth on 5OH-HIP, as part of the steroid catabolic pathway, thus appear to act as factors involved in the pathogenicity of R. equi. Challenge experiments showed that RE1ΔipdAB could be safely administered intratracheally to 2 to 5 week-old foals and oral immunization of foals even elicited a substantial protective immunity against a virulent R. equi strain. Our data show that genes involved in steroid catabolism are promising targets for the development of a live-attenuated vaccine against R. equi infections.

  12. Galectin-3 functions as an alarmin: pathogenic role for sepsis development in murine respiratory tularemia.

    Directory of Open Access Journals (Sweden)

    Bibhuti B Mishra

    Full Text Available Sepsis is a complex immune disorder with a mortality rate of 20-50% and currently has no therapeutic interventions. It is thus critical to identify and characterize molecules/factors responsible for its development. We have recently shown that pulmonary infection with Francisella results in sepsis development. As extensive cell death is a prominent feature of sepsis, we hypothesized that host endogenous molecules called alarmins released from dead or dying host cells cause a hyperinflammatory response culminating in sepsis development. In the current study we investigated the role of galectin-3, a mammalian β-galactoside binding lectin, as an alarmin in sepsis development during F. novicida infection. We observed an upregulated expression and extracellular release of galectin-3 in the lungs of mice undergoing lethal pulmonary infection with virulent strain of F. novicida but not in those infected with a non-lethal, attenuated strain of the bacteria. In comparison with their wild-type C57Bl/6 counterparts, F. novicida infected galectin-3 deficient (galectin-3(-/- mice demonstrated significantly reduced leukocyte infiltration, particularly neutrophils in their lungs. They also exhibited a marked decrease in inflammatory cytokines, vascular injury markers, and neutrophil-associated inflammatory mediators. Concomitantly, in-vitro pre-treatment of primary neutrophils and macrophages with recombinant galectin-3 augmented F. novicida-induced activation of these cells. Correlating with the reduced inflammatory response, F. novicida infected galectin-3(-/- mice exhibited improved lung architecture with reduced cell death and improved survival over wild-type mice, despite similar bacterial burden. Collectively, these findings suggest that galectin-3 functions as an alarmin by augmenting the inflammatory response in sepsis development during pulmonary F. novicida infection.

  13. Two Rab5 Homologs Are Essential for the Development and Pathogenicity of the Rice Blast Fungus Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Cheng D. Yang

    2017-05-01

    Full Text Available The rice blast fungus, Magnaporthe oryzae, infects many economically important cereal crops, particularly rice. It has emerged as an important model organism for studying the growth, development, and pathogenesis of filamentous fungi. RabGTPases are important molecular switches in regulation of intracellular membrane trafficking in all eukaryotes. MoRab5A and MoRab5B are Rab5 homologs in M. oryzae, but their functions in the fungal development and pathogenicity are unknown. In this study, we have employed a genetic approach and demonstrated that both MoRab5A and MoRab5B are crucial for vegetative growth and development, conidiogenesis, melanin synthesis, vacuole fusion, endocytosis, sexual reproduction, and plant pathogenesis in M. oryzae. Moreover, both MoRab5A and MoRab5B show similar localization in hyphae and conidia. To further investigate possible functional redundancy between MoRab5A and MoRab5B, we overexpressed MoRAB5A and MoRAB5B, respectively, in MoRab5B:RNAi and MoRab5A:RNAi strains, but neither could rescue each other’s defects caused by the RNAi. Taken together, we conclude that both MoRab5A and MoRab5B are necessary for the development and pathogenesis of the rice blast fungus, while they may function independently.

  14. Microgravity as a biological tool to examine host-pathogen interactions and to guide development of therapeutics and preventatives that target pathogenic bacteria.

    Science.gov (United States)

    Higginson, Ellen E; Galen, James E; Levine, Myron M; Tennant, Sharon M

    2016-11-01

    Space exploration programs have long been interested in the effects of spaceflight on biology. This research is important not only in its relevance to future deep space exploration, but also because it has allowed investigators to ask questions about how gravity impacts cell behavior here on Earth. In the 1980s, scientists designed and built the first rotating wall vessel, capable of mimicking the low shear environment found in space. This vessel has since been used to investigate growth of both microorganisms and human tissue cells in low shear modeled microgravity conditions. Bacterial behavior has been shown to be altered both in space and under simulated microgravity conditions. In some cases, bacteria appear attenuated, whereas in others virulence is enhanced. This has consequences not only for manned spaceflight, but poses larger questions about the ability of bacteria to sense the world around them. By using the microgravity environment as a tool, we can exploit this phenomenon in the search for new therapeutics and preventatives against pathogenic bacteria for use both in space and on Earth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Bacteriocins: Novel Solutions to Age Old Spore-Related Problems?

    Directory of Open Access Journals (Sweden)

    Kevin eEgan

    2016-04-01

    Full Text Available Bacteriocins are ribosomally synthesized antimicrobial peptides produced by bacteria, which have the ability to kill or inhibit other bacteria. Many bacteriocins are produced by food grade lactic acid bacteria (LAB. Indeed, the prototypic bacteriocin, nisin, is produced by Lactococcus lactis, and is licensed in over 50 countries. With consumers becoming more concerned about the levels of chemical preservatives present in food, bacteriocins offer an alternative, more natural, approach, while ensuring both food safety and product shelf life. Bacteriocins also show additive/synergistic effects when used in combination with other treatments, such as heating, high pressure, organic compounds, and as part of food packaging. These features are particularly attractive from the perspective of controlling sporeforming bacteria. Bacterial spores are common contaminants of food products, and their outgrowth may cause food spoilage or food-borne illness. They are of particular concern to the food industry due to their thermal and chemical resistance in their dormant state. However, when spores germinate they lose the majority of their resistance traits, making them susceptible to a variety of food processing treatments. Bacteriocins represent one potential treatment as they may inhibit spores in the post-germination/outgrowth phase of the spore cycle. Spore eradication and control in food is critical, as they are able to spoil and in certain cases compromise the safety of food by producing dangerous toxins. Thus, understanding the mechanisms by which bacteriocins exert their sporostatic/sporicidal activity against bacterial spores will ultimately facilitate their optimal use in food. This review will focus on the use of bacteriocins alone, or in combination with other innovative processing methods to control spores in food, the current knowledge and gaps therein with regard to bacteriocin-spore interactions and discuss future research approaches to enable

  16. Sterilization Resistance of Bacterial Spores Explained with Water Chemistry.

    Science.gov (United States)

    Friedline, Anthony W; Zachariah, Malcolm M; Middaugh, Amy N; Garimella, Ravindranath; Vaishampayan, Parag A; Rice, Charles V

    2015-11-05

    Bacterial spores can survive for long periods without nutrients and in harsh environmental conditions. This survival is influenced by the structure of the spore, the presence of protective compounds, and water retention. These compounds, and the physical state of water in particular, allow some species of bacterial spores to survive sterilization schemes with hydrogen peroxide and UV light. The chemical nature of the spore core and its water has been a subject of some contention and the chemical environment of the water impacts resistance paradigms. Either the spore has a glassy core, where water is immobilized along with other core components, or the core is gel-like with mobile water diffusion. These properties affect the movement of peroxide and radical species, and hence resistance. Deuterium solid-state NMR experiments are useful for examining the nature of the water inside the spore. Previous work in our lab with spores of Bacillus subtilis indicate that, for spores, the core water is in a more immobilized state than expected for the gel-like core theory, suggesting a glassy core environment. Here, we report deuterium solid-state NMR observations of the water within UV- and peroxide-resistant spores from Bacillus pumilus SAFR-032. Variable-temperature NMR experiments indicate no change in the line shape after heating to 50 °C, but an overall decrease in signal after heating to 100 °C. These results show glass-like core dynamics within B. pumilus SAFR-032 that may be the potential source of its known UV-resistance properties. The observed NMR traits can be attributed to the presence of an exosporium containing additional labile deuterons that can aid in the deactivation of sterilizing agents.

  17. Antitumor effects and mechanisms of Ganoderma extracts and spores oil.

    Science.gov (United States)

    Chen, Chun; Li, Peng; Li, Ye; Yao, Guan; Xu, Jian-Hua

    2016-11-01

    Ganoderma lucidum is a popular herbal medicine used in China to promote health. Modern studies have disclosed that the active ingredients of Ganoderma can exhibit several effects, including antitumor effects and immunomodulation. The present study evaluated the antitumor effects of self-prepared Ganoderma extracts and spores oil, and investigated the possible underlying mechanisms by observing the effects of the extracts and oil on topoisomerases and the cell cycle. The results showed that Ganoderma extracts and spores oil presented dose-dependent inhibitory effects on tumor cells. The half maximal inhibitory concentration (IC 50 ) values of Ganoderma extracts on HL60, K562 and SGC-7901 cells for 24 h were 0.44, 0.39 and 0.90 mg/ml, respectively; for Ganoderma spores oil, the IC 50 values were 1.13, 2.27 and 6.29 mg/ml, respectively. In the in vivo study, the inhibitory rates of Ganoderma extracts (4 g/kg/d, intragastrically) on S180 and H22 cells were 39.1 and 44.6%, respectively, and for Ganoderma spores oil (1.2 g/kg/d, intragastrically) the inhibitory rates were 30.9 and 44.9%, respectively. Ganoderma extracts and spores oil inhibited the activities of topoisomerase I and II. Ganoderma spores oil was shown block the cell cycle at the transition between the G1 and S phases and induce a marked decrease in cyclin D1 levels in K562 cells, with no significant change in cyclin E level. These results suggest that the Ganoderma extracts and spores oil possessed antitumor effects in the in vitro and in vivo studies. The antitumor mechanisms of the extracts and spores oil were associated with inhibitory effects on topoisomerase I and II activities, and for Ganoderma spores oil, the antitumor effects may also be associated with decreased cyclin D1 levels, thus inducing G1 arrest in the cell cycle.

  18. Antitumor effects and mechanisms of Ganoderma extracts and spores oil

    Science.gov (United States)

    Chen, Chun; Li, Peng; Li, Ye; Yao, Guan; Xu, Jian-Hua

    2016-01-01

    Ganoderma lucidum is a popular herbal medicine used in China to promote health. Modern studies have disclosed that the active ingredients of Ganoderma can exhibit several effects, including antitumor effects and immunomodulation. The present study evaluated the antitumor effects of self-prepared Ganoderma extracts and spores oil, and investigated the possible underlying mechanisms by observing the effects of the extracts and oil on topoisomerases and the cell cycle. The results showed that Ganoderma extracts and spores oil presented dose-dependent inhibitory effects on tumor cells. The half maximal inhibitory concentration (IC50) values of Ganoderma extracts on HL60, K562 and SGC-7901 cells for 24 h were 0.44, 0.39 and 0.90 mg/ml, respectively; for Ganoderma spores oil, the IC50 values were 1.13, 2.27 and 6.29 mg/ml, respectively. In the in vivo study, the inhibitory rates of Ganoderma extracts (4 g/kg/d, intragastrically) on S180 and H22 cells were 39.1 and 44.6%, respectively, and for Ganoderma spores oil (1.2 g/kg/d, intragastrically) the inhibitory rates were 30.9 and 44.9%, respectively. Ganoderma extracts and spores oil inhibited the activities of topoisomerase I and II. Ganoderma spores oil was shown block the cell cycle at the transition between the G1 and S phases and induce a marked decrease in cyclin D1 levels in K562 cells, with no significant change in cyclin E level. These results suggest that the Ganoderma extracts and spores oil possessed antitumor effects in the in vitro and in vivo studies. The antitumor mechanisms of the extracts and spores oil were associated with inhibitory effects on topoisomerase I and II activities, and for Ganoderma spores oil, the antitumor effects may also be associated with decreased cyclin D1 levels, thus inducing G1 arrest in the cell cycle. PMID:27900038

  19. Bacteriocins: Novel Solutions to Age Old Spore-Related Problems?

    Science.gov (United States)

    Egan, Kevin; Field, Des; Rea, Mary C; Ross, R Paul; Hill, Colin; Cotter, Paul D

    2016-01-01

    Bacteriocins are ribosomally synthesized antimicrobial peptides produced by bacteria, which have the ability to kill or inhibit other bacteria. Many bacteriocins are produced by food grade lactic acid bacteria (LAB). Indeed, the prototypic bacteriocin, nisin, is produced by Lactococcus lactis, and is licensed in over 50 countries. With consumers becoming more concerned about the levels of chemical preservatives present in food, bacteriocins offer an alternative, more natural approach, while ensuring both food safety and product shelf life. Bacteriocins also show additive/synergistic effects when used in combination with other treatments, such as heating, high pressure, organic compounds, and as part of food packaging. These features are particularly attractive from the perspective of controlling sporeforming bacteria. Bacterial spores are common contaminants of food products, and their outgrowth may cause food spoilage or food-borne illness. They are of particular concern to the food industry due to their thermal and chemical resistance in their dormant state. However, when spores germinate they lose the majority of their resistance traits, making them susceptible to a variety of food processing treatments. Bacteriocins represent one potential treatment as they may inhibit spores in the post-germination/outgrowth phase of the spore cycle. Spore eradication and control in food is critical, as they are able to spoil and in certain cases compromise the safety of food by producing dangerous toxins. Thus, understanding the mechanisms by which bacteriocins exert their sporostatic/sporicidal activity against bacterial spores will ultimately facilitate their optimal use in food. This review will focus on the use of bacteriocins alone, or in combination with other innovative processing methods to control spores in food, the current knowledge and gaps therein with regard to bacteriocin-spore interactions and discuss future research approaches to enable spores to be more

  20. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development

    OpenAIRE

    Mansouri, Ladan; Xie, Yufen; Rappolee, Daniel A

    2012-01-01

    Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induce...

  1. New pressure and temperature effects on bacterial spores

    Science.gov (United States)

    Mathys, A.; Heinz, V.; Knorr, D.

    2008-07-01

    The mechanism of inactivation of bacterial spores by heat and pressure is still a matter of discussion. Obviously, the change of the dissociation equilibrium under pressure and temperature plays a dominant role in inactivation of microorganisms. Heat and pressure inactivation of Geobacillus. stearothermophilus spores at different initial pH-values in ACES and phosphate buffer confirmed this view. Thermal inactivation in ACES buffer at 122°C resulted in higher logarithmic reductions. Contrary, after pressure treatment at 900 MPa with 80°C phosphate buffer showed higher inactivation. These results indicated the different dissociation equilibrium shifts in buffer systems by heat and pressure. Due to preparation, storage and handling of highly concentrated spore suspensions the clumping and the formation of aggregates can hardly be avoided. Consequently, the impact of the agglomeration size distribution on the quantitative assessment of G. stearothermophilus spore inactivation was determined by using a three-fold dynamic optical backreflexion measurement. Two limiting cases have been discriminated in mathematical modelling: three dimensional, spherical packing for maximum spore count and two dimensional, circular packing for minimum spore count of a particular agglomerate. Thermal inactivation studies have been carried out in thin glass capillaries, where by using numerical simulations the non isothermal conditions were modelled and taken into account. It is shown that the shoulder formation often found in thermal spore inactivation can sufficiently be described by first-order inactivation kinetics when the agglomeration size is considered. In case of high pressure inactivation agglomerations could be strongly changed by high forces at compression and especially decompression phase. The physiological response of Bacillus licheniformis spores to high pressure was investigated using multiparameter flow cytometry. Spores were treated by high pressure at 150 MPa with 37

  2. New pressure and temperature effects on bacterial spores

    Energy Technology Data Exchange (ETDEWEB)

    Mathys, A; Knorr, D [Berlin University of Technology, Department of Food Biotechnology and Food Process Engineering, Koenigin-Luise-Str. 22, D-14195 Berlin (Germany); Heinz, V [German Institute of Food Technology, p. o. box 1165, D-49601, Quackenbrueck (Germany)], E-mail: alexander.mathys@tu-berlin.de

    2008-07-15

    The mechanism of inactivation of bacterial spores by heat and pressure is still a matter of discussion. Obviously, the change of the dissociation equilibrium under pressure and temperature plays a dominant role in inactivation of microorganisms. Heat and pressure inactivation of Geobacillus. stearothermophilus spores at different initial pH-values in ACES and phosphate buffer confirmed this view. Thermal inactivation in ACES buffer at 122 deg. C resulted in higher logarithmic reductions. Contrary, after pressure treatment at 900 MPa with 80 deg. C phosphate buffer showed higher inactivation. These results indicated the different dissociation equilibrium shifts in buffer systems by heat and pressure. Due to preparation, storage and handling of highly concentrated spore suspensions the clumping and the formation of aggregates can hardly be avoided. Consequently, the impact of the agglomeration size distribution on the quantitative assessment of G. stearothermophilus spore inactivation was determined by using a three-fold dynamic optical backreflexion measurement. Two limiting cases have been discriminated in mathematical modelling: three dimensional, spherical packing for maximum spore count and two dimensional, circular packing for minimum spore count of a particular agglomerate. Thermal inactivation studies have been carried out in thin glass capillaries, where by using numerical simulations the non isothermal conditions were modelled and taken into account. It is shown that the shoulder formation often found in thermal spore inactivation can sufficiently be described by first-order inactivation kinetics when the agglomeration size is considered. In case of high pressure inactivation agglomerations could be strongly changed by high forces at compression and especially decompression phase. The physiological response of Bacillus licheniformis spores to high pressure was investigated using multiparameter flow cytometry. Spores were treated by high pressure at 150 MPa

  3. New pressure and temperature effects on bacterial spores

    International Nuclear Information System (INIS)

    Mathys, A; Knorr, D; Heinz, V

    2008-01-01

    The mechanism of inactivation of bacterial spores by heat and pressure is still a matter of discussion. Obviously, the change of the dissociation equilibrium under pressure and temperature plays a dominant role in inactivation of microorganisms. Heat and pressure inactivation of Geobacillus. stearothermophilus spores at different initial pH-values in ACES and phosphate buffer confirmed this view. Thermal inactivation in ACES buffer at 122 deg. C resulted in higher logarithmic reductions. Contrary, after pressure treatment at 900 MPa with 80 deg. C phosphate buffer showed higher inactivation. These results indicated the different dissociation equilibrium shifts in buffer systems by heat and pressure. Due to preparation, storage and handling of highly concentrated spore suspensions the clumping and the formation of aggregates can hardly be avoided. Consequently, the impact of the agglomeration size distribution on the quantitative assessment of G. stearothermophilus spore inactivation was determined by using a three-fold dynamic optical backreflexion measurement. Two limiting cases have been discriminated in mathematical modelling: three dimensional, spherical packing for maximum spore count and two dimensional, circular packing for minimum spore count of a particular agglomerate. Thermal inactivation studies have been carried out in thin glass capillaries, where by using numerical simulations the non isothermal conditions were modelled and taken into account. It is shown that the shoulder formation often found in thermal spore inactivation can sufficiently be described by first-order inactivation kinetics when the agglomeration size is considered. In case of high pressure inactivation agglomerations could be strongly changed by high forces at compression and especially decompression phase. The physiological response of Bacillus licheniformis spores to high pressure was investigated using multiparameter flow cytometry. Spores were treated by high pressure at 150 MPa

  4. Micromotors to capture and destroy anthrax simulant spores.

    Science.gov (United States)

    Orozco, Jahir; Pan, Guoqing; Sattayasamitsathit, Sirilak; Galarnyk, Michael; Wang, Joseph

    2015-03-07

    Towards addressing the need for detecting and eliminating biothreats, we describe a micromotor-based approach for screening, capturing, isolating and destroying anthrax simulant spores in a simple and rapid manner with minimal sample processing. The B. globilli antibody-functionalized micromotors can recognize, capture and transport B. globigii spores in environmental matrices, while showing non-interactions with excess of non-target bacteria. Efficient destruction of the anthrax simulant spores is demonstrated via the micromotor-induced mixing of a mild oxidizing solution. The new micromotor-based approach paves a way to dynamic multifunctional systems that rapidly recognize, isolate, capture and destroy biological threats.

  5. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca

    2008-07-15

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.

  6. Long-term cryopreservation of non-spore-forming fungi in Microbank™ beads for plant pathological investigations.

    Science.gov (United States)

    Lakshman, Dilip K; Singh, Vimla; Camacho, Manuel E

    2018-05-01

    Long-term preservation of experimental fungi without genetic, morphological, and pathogenic changes is of paramount importance in mycological and plant pathological investigations. Several cryogenic and non-cryogenic methods are available for the preservation of fungi, but the methods can be cumbersome, hazardous, expensive, and often not suitable for long-term storage of non-spore-forming (sterile) fungi. A method of preservation of spore-forming fungi in commercially available porous beads (Micrbank™) under cryogenic condition was successfully tested for three non-spore-forming basidiomycetes genera: Rhizoctonia solani (teleomorph: Thanatephorus cucumeris) (n = 19), Ceratobasidium species (n = 1), and Waitea circinata (n = 3), and a non-spore forming ascomycetes, Sclerotinia sclerotiorum (n = 1). For comparison, spore-forming ascomycetous fungi, Alternaria alternata (n = 1), Bauveria basiana (n = 2), Botrytis cinerea (n = 1), Fusarium oxysporum f.sp. gladiolii (n = 1), Trichoderma spp. (n = 3), and Thielaviopsis basicola (n = 2) were also cryopreserved in Microbank beads. Viable fungal isolates of all test species were retrieved after five years of storage at -80 °C, which was longer than the viabilities of the corresponding isolates cryopreserved in agar plugs or colonized wheat seeds. Fungi revived from the Microbank beads maintained identical morphology and cultural characteristics of the parent isolates. Randomly selected Rhizoctonia isolates revived from the Microbank beads maintained respective pathological properties of the parent isolates; also, no mutation was detected in the internal transcribed spacer (ITS) ribosomal DNA when compared with respective cultures maintained at ambient temperature. This finding demonstrated the utility of cryopreservation in Microbank beads as a convenient alternative to conventional long-term preservation of a wide group of fungal cultures for plant pathological investigations

  7. Fungal spores in four catholic churches in the metropolitan area of Monterrey, Nuevo León State, Mexico – First study

    Directory of Open Access Journals (Sweden)

    Alejandra Rocha Estrada

    2015-05-01

    Full Text Available Introduction. About 500,000 species of fungi have been described to-date, although an estimated between 1 – 1.5 million species may occur. They have a wide distribution in nature, contributing to the decomposition of organic matter and playing a part in the biogeochemical cycles of major nutrients. A small number are considered pathogens of animals and plants. There is ample historical evidence that certain types of allergies are associated with fungi; exposure to fungal allergens occurs in both outdoor and indoor spaces. Many indoor allergens are the same as those found outside buildings, entering through windows and doors, ventilation systems, or through cracks or other fissures in the walls. Objective. To determine the diversity and abundance of fungal spores inside four churches in the metropolitan area of Monterrey city in Mexico. Materials and methods. The study was carried out from July 2009 – January 2010 using a Hirst type volumetric collector (Burkard Manufacturing Co Ltd. Results. A total of 31,629 spores from 54 taxa were registered in the four churches. The building that showed the highest amount of spores was the Santa Catarina Mártir Church with 12,766 spores, followed by Cristo Rey with 7,155 and Nuestra Señora del Roble with 6,887. Regularly high concentrations of spores were recorded from 14:00 – 20:00 hours. The highest concentration value was observed at the church of Santa Catarina Mártir at 16:00 hours with 1153 spores/m 3 air. Conclusions. The most abundant spores in the four churches studied corresponded to Cladosporium, the [i]Aspergillus/Penicillium complex[/i], [i]Coprinus[/i], [i]Ganoderma[/i], [i]Curvularia and Ustilago[/i].

  8. Spectral quality affects disease development of three pathogens on hydroponically grown plants

    Science.gov (United States)

    Schuerger, A. C.; Brown, C. S.; Sager, J. C. (Principal Investigator)

    1997-01-01

    Plants were grown under light-emitting diode (LED) arrays with various spectra to determine the effects of light quality on the development of diseases caused by tomato mosaic virus (ToMV) on pepper (Capsicum annuum L.), powdery mildew [Sphaerotheca fuliginea (Schlectend:Fr.) Pollaci] on cucumber (Cucumis sativus L.), and bacterial wilt (Pseudomonas solanacearum Smith) on tomato (Lycopersicon esculentum Mill.). One LED (660) array supplied 99% red light at 660 nm (25 nm bandwidth at half-peak height) and 1% far-red light between 700 to 800 nm. A second LED (660/735) array supplied 83% red light at 660 nm and 17% far-red light at 735 nm (25 nm bandwidth at half-peak height). A third LED (660/BF) array supplied 98% red light at 660 nm, 1% blue light (BF) between 350 to 550 nm, and 1% far-red light between 700 to 800 nm. Control plants were grown under broad-spectrum metal halide (MH) lamps. Plants were grown at a mean photon flux (300 to 800 nm) of 330 micromoles m-2 s-1 under a 12-h day/night photoperiod. Spectral quality affected each pathosystem differently. In the ToMV/pepper pathosystem, disease symptoms developed slower and were less severe in plants grown under light sources that contained blue and UV-A wavelengths (MH and 660/BF treatments) compared to plants grown under light sources that lacked blue and UV-A wavelengths (660 and 660/735 LED arrays). In contrast, the number of colonies per leaf was highest and the mean colony diameters of S. fuliginea on cucumber plants were largest on leaves grown under the MH lamp (highest amount of blue and UV-A light) and least on leaves grown under the 660 LED array (no blue or UV-A light). The addition of far-red irradiation to the primary light source in the 660/735 LED array increased the colony counts per leaf in the S. fuliginea/cucumber pathosystem compared to the red-only (660) LED array. In the P. solanacearum/tomato pathosystem, disease symptoms were less severe in plants grown under the 660 LED array, but the

  9. Development and host compatibility of plasmids for two important ruminant pathogens, Mycoplasma bovis and Mycoplasma agalactiae.

    Directory of Open Access Journals (Sweden)

    Shukriti Sharma

    Full Text Available Mycoplasma bovis is a cause of pneumonia, mastitis, arthritis and otitis media in cattle throughout the world. However, despite its clinical significance, there is a paucity of tools to genetically manipulate it, impeding our capacity to further explore the molecular basis of its virulence. To address this limitation, we developed a series of homologous and heterologous replicable plasmids from M. bovis and M. agalactiae. The shortest replicable oriC plasmid based on the region downstream of dnaA in M. bovis was 247 bp and contained two DnaA boxes, while oriC plasmids based on the region downstream of dnaA in M. agalactiae strains 5632 and PG2 were 219 bp and 217 bp in length, respectively, and contained only a single DnaA box. The efficiency of transformation in M. bovis and M. agalactiae was inversely correlated with the size of the oriC region in the construct, and, in general, homologous oriC plasmids had a higher transformation efficiency than heterologous oriC plasmids. The larger pWholeoriC45 and pMM21-7 plasmids integrated into the genomic oriC region of M. bovis, while the smaller oriC plasmids remained extrachromosomal for up to 20 serial passages in selective media. Although specific gene disruptions were not be achieved in M. bovis in this study, the oriC plasmids developed here could still be useful as tools in complementation studies and for expression of exogenous genes in both M. bovis and M. agalactiae.

  10. Affinity reagent technology development and application to rapid immunochromatographic pathogen detection

    Science.gov (United States)

    Sooter, Letha J.; Stratis-Cullum, Dimitra N.; Zhang, Yanting; Daugherty, Patrick S.; Soh, H. Tom; Pellegrino, Paul; Stagliano, Nancy

    2007-09-01

    Immunochromatography is a rapid, reliable, and cost effective method of detecting biowarfare agents. The format is similar to that of an over-the-counter pregnancy test. A sample is applied to one end of a cassette and then a control line, and possibly a sample line, are visualized at the other end of the cassette. The test is based upon a sandwich assay. For the control, a line of Protein A is immobilized on the membrane. Gold nanoparticle bound IgG flows through the membrane and binds the Protein A, creating a visible line on the membrane. For the sample, one epitope is immobilized on the membrane and another epitope is attached to gold nanoparticles. The sample binds gold bound epitope, travels through the membrane, and binds membrane bound epitope. The two epitopes are not cross-reactive, therefore a sample line is only visible if the sample is present. In order to efficiently screen for binders to a sample target, a novel, Continuous Magnetic Activated Cell Sorter (CMACS) has been developed on a disposable, microfluidic platform. The CMACS chip quickly sorts E. coli peptide libraries for target binders with high affinity. Peptide libraries, are composed of approximately ten million bacteria, each displaying a different peptide on their surface. The target of interest is conjugated to a micrometer sized magnetic particle. After the library and the target are incubated together to allow binding, the mixture is applied to the CMACS chip. In the presence of patterned nickel and an external magnet, separation occurs of the bead-bound bacteria from the bulk material. The bead fraction is added to bacterial growth media where any attached E. coli grow and divide. These cells are cloned, sequenced, and the peptides are assayed for target binding affinity. As a proof-of-principle, assays were developed for human C-reactive protein. More defense relevant targets are currently being pursued.

  11. Development and Host Compatibility of Plasmids for Two Important Ruminant Pathogens, Mycoplasma bovis and Mycoplasma agalactiae

    Science.gov (United States)

    Sharma, Shukriti; Citti, Chistine; Sagné, Eveline; Marenda, Marc S.

    2015-01-01

    Mycoplasma bovis is a cause of pneumonia, mastitis, arthritis and otitis media in cattle throughout the world. However, despite its clinical significance, there is a paucity of tools to genetically manipulate it, impeding our capacity to further explore the molecular basis of its virulence. To address this limitation, we developed a series of homologous and heterologous replicable plasmids from M. bovis and M. agalactiae. The shortest replicable oriC plasmid based on the region downstream of dnaA in M. bovis was 247 bp and contained two DnaA boxes, while oriC plasmids based on the region downstream of dnaA in M. agalactiae strains 5632 and PG2 were 219 bp and 217 bp in length, respectively, and contained only a single DnaA box. The efficiency of transformation in M. bovis and M. agalactiae was inversely correlated with the size of the oriC region in the construct, and, in general, homologous oriC plasmids had a higher transformation efficiency than heterologous oriC plasmids. The larger pWholeoriC45 and pMM21-7 plasmids integrated into the genomic oriC region of M. bovis, while the smaller oriC plasmids remained extrachromosomal for up to 20 serial passages in selective media. Although specific gene disruptions were not be achieved in M. bovis in this study, the oriC plasmids developed here could still be useful as tools in complementation studies and for expression of exogenous genes in both M. bovis and M. agalactiae. PMID:25746296

  12. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development.

    Science.gov (United States)

    Mansouri, Ladan; Xie, Yufen; Rappolee, Daniel A

    2012-12-10

    Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induced differentiation which generates minimal necessary function by producing more differentiated product/cell. This compensatory differentiation is accompanied by a second strategy to insure organismal survival as multipotent and pluripotent stem cells differentiate into the lineages in their repertoire. During stressed differentiation, the first lineage in the repertoire is increased and later lineages are suppressed, thus prioritized differentiation occurs. Compensatory and prioritized differentiation is regulated by at least two types of stress enzymes. AMP-activated protein kinase (AMPK) which mediates loss of nuclear potency factors and stress-activated protein kinase (SAPK) that does not. SAPK mediates an increase in the first essential lineage and decreases in later lineages in placental stem cells. The clinical significance of compensatory and prioritized differentiation is that stem cell pools are depleted and imbalanced differentiation leads to gestational diseases and long term postnatal pathologies.

  13. Adaptive and Pathogenic Responses to Stress by Stem Cells during Development

    Directory of Open Access Journals (Sweden)

    Daniel A. Rappolee

    2012-12-01

    Full Text Available Cellular stress is the basis of a dose-dependent continuum of responses leading to adaptive health or pathogenesis. For all cells, stress leads to reduction in macromolecular synthesis by shared pathways and tissue and stress-specific homeostatic mechanisms. For stem cells during embryonic, fetal, and placental development, higher exposures of stress lead to decreased anabolism, macromolecular synthesis and cell proliferation. Coupled with diminished stem cell proliferation is a stress-induced differentiation which generates minimal necessary function by producing more differentiated product/cell. This compensatory differentiation is accompanied by a second strategy to insure organismal survival as multipotent and pluripotent stem cells differentiate into the lineages in their repertoire. During stressed differentiation, the first lineage in the repertoire is increased and later lineages are suppressed, thus prioritized differentiation occurs. Compensatory and prioritized differentiation is regulated by at least two types of stress enzymes. AMP-activated protein kinase (AMPK which mediates loss of nuclear potency factors and stress-activated protein kinase (SAPK that does not. SAPK mediates an increase in the first essential lineage and decreases in later lineages in placental stem cells. The clinical significance of compensatory and prioritized differentiation is that stem cell pools are depleted and imbalanced differentiation leads to gestational diseases and long term postnatal pathologies.

  14. Development of a standardized differential-reflective bioassay for microbial pathogens

    Science.gov (United States)

    Wilhelm, Jay; Auld, J. R. X.; Smith, James E.

    2008-04-01

    This research examines standardizing a method for the rapid/semi-automated identification of microbial contaminates. It introduces a method suited to test for food/water contamination, serology, urinalysis and saliva testing for any >1 micron sized molecule that can be effectively bound to an identifying marker with exclusivity. This optical biosensor method seeks to integrate the semi-manual distribution of a collected sample onto a "transparent" substrate array of binding sites that will then be applied to a standard optical data disk and run for analysis. The detection of most microbe species is possible in this platform because the relative scale is greater than the resolution of the standard-scale digital information on a standard CD or DVD. This paper explains the critical first stage in the advance of this detection concept. This work has concentrated on developing the necessary software component needed to perform highly sensitive small-scale recognition using the standard optical disk as a detection platform. Physical testing has made significant progress in demonstrating the ability to utilize a standard optical drive for the purposes of micro-scale detection through the exploitation of CIRC error correction. Testing has also shown a definable trend in the optimum scale and geometry of micro-arrayed attachment sites for the technology's concept to reach achievement.

  15. Comparison of antimicrobial activity of traditional and new developed root sealers against pathogens related root canal

    Directory of Open Access Journals (Sweden)

    Joo-Hee Shin

    2018-03-01

    Full Text Available Background/purpose: Bacterial infection is closely associated with the failure of endodontic treatment, and use of endodontic sealer with antimicrobial activity and biological compatibility is necessary for the success of root canal treatment. The purpose of this study was to investigate and to compare the antibacterial effect of two calcium silicate-based root canal sealers (Endoseal and EndoSequence BC sealer as recent development sealers and with three conventional root canal sealers (AH Plus, Sealapex, and Tubli-Seal, before or after setting, on Porphyromonas endodontalis, Porphyromonas gingivalis, and Enterococcus faecalis. Materials and methods: The sealers were soaked in phosphate buffered saline to elute its compositions after and before setting, and the elutes were performed the antimicrobial assay. Also, X-ray fluorescence analysis was carried out to compare compositions of two calcium silicate-based sealers. Results: The conventional root canal sealers have strong antibacterial activity against the Gram-negative bacteria, P. endodontalis and P. gingivalis. Endoseal sealer showed antibacterial activity against not only the Gram-negative bacteria, but also against the Gram-positive bacteria, E. faecalis. However, Endosequence BC sealer exhibited a weak antibacterial effect on all bacteria in this study. X-ray fluorescence analysis exhibited that Endoseal contained more types and more amount of the oxide compound known to have strong antimicrobial activity such as Al2O3, Fe2O3, MgO, Na2O, NiO, and SO2 than Endoseqeunce BC. Conclusion: Endoseal, which contains various types of oxide compounds, seems to be a suitable sealer for preventing bacterial infection in both treated and untreated root canals. Keywords: Root canal sealer, Antimicrobial activity, Oxide compound, E. faecalis

  16. Properties of spores of Bacillus subtilis strains which lack the major small, acid-soluble protein

    International Nuclear Information System (INIS)

    Hackett, R.H.; Setlow, P.

    1988-01-01

    Bacillus subtilis strains containing a deletion in the gene coding for the major small, acid-soluble, spore protein (SASP-gamma) grew and sporulated, and their spores initiated germination normally, but outgrowth of SASP-gamma- spores was significantly slower than that of wild-type spores. The absence of SASP-gamma had no effect on spore protoplast density or spore resistance to heat or radiation. Consequently, SASP-gamma has a different function in spores than do the other major small, acid-soluble proteins

  17. Fertile organs and in situ spores of a new dipteridaceous fern Hausmannia sinensis from the Jurassic of northern China.

    Science.gov (United States)

    Wang, Yongdong; Zhang, Hong

    2010-01-22

    As a representative fossil member of the dipteridaceous fern, genus Hausmannia was reported worldwide from the Mesozoic strata; however, little is known about the fertile structures, including sporangia and in situ spores, of this genus. In this study, a new species Hausmannia sinensis was identified from the Middle Jurassic of Nei Mongol (Inner Mongolia), northern China. The specimens are compressions and are well preserved with details of sporangia and in situ spores. The leaf laminae are broadly fan-shaped, with an almost entire margin. Primary and lateral veins dichotomously branch to form square or polygonal meshes. Each ultimate mesh bears one to two circular sori of 0.4 mm in diameter. Sori are exindusiate; each sorus contains three to six round to ovoid sporangia. The annulus is developed and oblique, with stomial region present in proximal position. Spores are trilete, circular to oval in shape. Both proximal and distal surfaces are covered with baculate to subverrucate sculptures. Spores range from 20 to 30 microm in diameter (average 28 microm), and are comparable to the dispersed genera Baculatisporites Thomas and Pflug and Apiculatisporis Potonié and Kremp. Hausmannia sinensis represents the first compression species of genus Hausmannia form Eurasia, which shows the combination of well-preserved sori, sporangia, annuli and in situ spore characters, and is therefore helpful for further understanding the diversity and evolution of the Dipteridaceae fern lineage through time.

  18. Structural Characterization of Lipopeptides Isolated from Bacillus Globigii Spores

    National Research Council Canada - National Science Library

    Williams, Bruce

    2001-01-01

    .... Bacillus globigil spores, grown in new sporulation media (NSM), were suspended and then analyzed using a MALDI-TOF mass spectrometer to screen for biomarkers with 4-methoxycinnamic acid as matrix...

  19. Analysis of Bacillus Globigii Spores Using the BioDetector

    National Research Council Canada - National Science Library

    Lee, William

    1999-01-01

    .... An automated immunoassay instrument capable of providing rapid identification of biological agents was used to analyses laboratory and field trial samples containing the field trial simulants Bacillus globigii (BG) spores...

  20. Decontamination Of Bacterial Spores by a Peptide-Mimic

    National Research Council Canada - National Science Library

    Nagarajan, R; Muller, Wayne S; Ashley, Rebekah; Mello, Charlene M

    2006-01-01

    .... In this work, we demonstrate that a peptide-mimic (cationic, amphiphilic) chemical agent, dodecylamine is capable of performing the dual functions of germinating the dormant spore as well as deactivating...

  1. Involvement of the Helicobacter pylori plasticity region and cag pathogenicity island genes in the development of gastroduodenal diseases.

    Science.gov (United States)

    Pacheco, A R; Proença-Módena, J L; Sales, A I L; Fukuhara, Y; da Silveira, W D; Pimenta-Módena, J L; de Oliveira, R B; Brocchi, M

    2008-11-01

    Infection by Helicobacter pylori is associated with the development of several gastroduodenal diseases, including gastritis, peptic ulcer disease (gastric ulcers and duodenal ulcers), and gastric adenocarcinoma. Although a number of putative virulence factors have been reported for H. pylori, there are conflicting results regarding their association with specific H. pylori-related diseases. In this work, we investigated the presence of virB11 and cagT, located in the left half of the cag pathogenicity island (cagPAI), and the jhp917-jhp918 sequences, components of the dupA gene located in the plasticity zone of H. pylori, in Brazilian isolates of H. pylori. We also examined the association between these genes and H. pylori-related gastritis, peptic ulcer disease, and gastric and duodenal ulcers in an attempt to identify a gene marker for clinical outcomes related to infection by H. pylori. The cagT gene was associated with peptic ulcer disease and gastric ulcers, whereas the virB11 gene was detected in nearly all of the samples. The dupA gene was not associated with duodenal ulcers or any gastroduodenal disease here analyzed. These results suggest that cagT could be a useful prognostic marker for the development of peptic ulcer disease in the state of São Paulo, Brazil. They also indicate that cagT is associated with greater virulence and peptic ulceration, and that this gene is an essential component of the type IV secretion system of H. pylori.

  2. The effect of chitosan on limitation of growth and development of some pathogenic fungi for ornamental plants

    Directory of Open Access Journals (Sweden)

    Alicja Saniewska

    2013-12-01

    Full Text Available The inhibitory effect of crab-shell chitosan, medium (200-800 cps and high molecular weight ( 800-2000 cps (purchased from Sigma-Aldrich Chemicals toward Alternaria alternata, Botrytis tulipae, Fiisarium oxysporum f. sp. callistephi, Fusarium oxysporum f. sp. tulipae, Phoma narcissi and Phoma poolensis was evaluated in vitro and in vivo. The chitosan evidently inhibited in vitro growth of all tested pathogens, with a marked effect at higher concentrations above 200 μg/cm3. Chitosan at a concentration of 1,25; 2,5 and 5,0 mg/cm3 didn't have inhibitory action in appearance of fungi growth on naturally contaminated Callistephus chinensis seeds. At the same concentrations, chitosan applied as bulb scales dressing of Hymenocallis narcissiflora bulbs, before inoculation or after inoculation with Phoma narcissi, inhibited the development of necrotic spots on scales. Chitosan used preventively or curatively at a concentrations of 1,25; 2,5 and 5,0 mg/cm3 indicated inhibitory effect on development of Fusarium oxysporum f. sp. tulipae on tulip bulbs. Chitosan at a concentration of 10 mg/cm3 applied preventively (first spray 12th June was very effective in the control of Puccinia antirrhini on snapdragon in the field. The strongest inhibitory effect was observed on snapdragon treated 8 times at week intervals.

  3. Host plant development, water level and water parameters shape Phragmites australis-associated oomycete communities and determine reed pathogen dynamics in a large lake.

    Science.gov (United States)

    Wielgoss, Anna; Nechwatal, Jan; Bogs, Carolin; Mendgen, Kurt

    2009-08-01

    In a 3-year-study, we analysed the population dynamics of the reed pathogen Pythium phragmitis and other reed-associated oomycetes colonizing fresh and dried reed leaves in the littoral zone of a large lake. Oomycete communities derived from internal transcribed spacer clone libraries were clearly differentiated according to substrate and seasonal influences. In fresh leaves, diverse communities consisting of P. phragmitis and other reed-associated pathogens were generally dominant. Pythium phragmitis populations peaked in spring with the emergence of young reed shoots, and in autumn after extreme flooding events. In summer it decreased with falling water levels, changing water chemistry and rising temperatures. Another Pythium species was also highly abundant in fresh leaves throughout the year and might represent a new, as-yet uncultured reed pathogen. In dried leaves, reed pathogens were rarely detected, whereas saprophytic species occurred abundantly during all seasons. Saprophyte communities were less diverse, less temperature sensitive and independent of reed development. In general, our results provide evidence for the occurrence of highly specialized sets of reed-associated oomycetes in a natural reed ecosystem. Quantitative analyses (clone abundances and quantitative real-time PCR) revealed that the reed pathogen P. phragmitis is particularly affected by changing water levels, water chemistry and the stage of reed development.

  4. Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions.

    Science.gov (United States)

    Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori

    2014-08-11

    Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.

  5. The PsB glycoprotein complex is secreted as a preassembled precursor of the spore coat in Dictyostelium discoideum.

    Science.gov (United States)

    Watson, N; McGuire, V; Alexander, S

    1994-09-01

    The PsB glycoprotein in Dictyostelium discoideum is one of a diverse group of developmentally regulated, prespore-cell-specific proteins, that contain a common O-linked oligosaccharide. This post-translational modification is dependent on the wild-type modB allele. The PsB protein exists as part of a multiprotein complex of six different proteins, which have different post-translational modifications and are held together by both covalent and non-covalent interactions (Watson et al. (1993). J. Biol. Chem. 268, 22634-22641). In this study we have used microscopic and biochemical analyses to examine the cellular localization and function of the PsB complex during development. We found that the PsB complex first accumulates in prespore vesicles in slug cells and is secreted later during culmination and becomes localized to both the extracellular matrix of the apical spore mass of mature fruiting bodies and to the inner layer of the spore coat. The PsB associated with the spore coat is covalently bound by disulfide bridges. The PsB protein always exists in a multiprotein complex, but the composition of the PsB complex changes during secretion and spore maturation. Some of the PsB complex proteins have been identified as spore coat proteins. These data demonstrate that some of the proteins that form the spore coat exist as a preassembled precursor complex. The PsB complex is secreted in a developmentally regulated manner during the process of spore differentiation, at which time proteins of the complex, as well as additional spore coat proteins, become covalently associated in at least two forms of extracellular matrix: the interspore matrix and the spore coat. These and other studies show that proteins with modB dependent O-linked oligosaccharides are involved in a wide variety of processes underlying morphogenesis in this organism. These developmental processes are the direct result of cellular mechanisms regulating protein targeting, assembly and secretion, and the

  6. Thermal inactivation kinetics of Bacillus coagulans spores in tomato juice.

    Science.gov (United States)

    Peng, Jing; Mah, Jae-Hyung; Somavat, Romel; Mohamed, Hussein; Sastry, Sudhir; Tang, Juming

    2012-07-01

    The thermal characteristics of the spores and vegetative cells of three strains of Bacillus coagulans (ATCC 8038, ATCC 7050, and 185A) in tomato juice were evaluated. B. coagulans ATCC 8038 was chosen as the target microorganism for thermal processing of tomato products due to its spores having the highest thermal resistance among the three strains. The thermal inactivation kinetics of B. coagulans ATCC 8038 spores in tomato juice between 95 and 115°C were determined independently in two different laboratories using two different heating setups. The results obtained from both laboratories were in general agreement, with z-values (z-value is defined as the change in temperature required for a 10-fold reduction of the D-value, which is defined as the time required at a certain temperature for a 1-log reduction of the target microorganisms) of 8.3 and 8.7°C, respectively. The z-value of B. coagulans 185A spores in tomato juice (pH 4.3) was found to be 10.2°C. The influence of environmental factors, including cold storage time, pH, and preconditioning, upon the thermal resistance of these bacterial spores is discussed. The results obtained showed that a storage temperature of 4°C was appropriate for maintaining the viability and thermal resistance of B. coagulans ATCC 8038 spores. Acidifying the pH of tomato juice decreased the thermal resistance of these spores. A 1-h exposure at room temperature was considered optimal for preconditioning B. coagulans ATCC 8038 spores in tomato juice.

  7. Fate of ingested Clostridium difficile spores in mice.

    Directory of Open Access Journals (Sweden)

    Amber Howerton

    Full Text Available Clostridium difficile infection (CDI is a leading cause of antibiotic-associated diarrhea, a major nosocomial complication. The infective form of C. difficile is the spore, a dormant and resistant structure that forms under stress. Although spore germination is the first committed step in CDI onset, the temporal and spatial distribution of ingested C. difficile spores is not clearly understood. We recently reported that CamSA, a synthetic bile salt analog, inhibits C. difficile spore germination in vitro and in vivo. In this study, we took advantage of the anti-germination activity of bile salts to determine the fate of ingested C. difficile spores. We tested four different bile salts for efficacy in preventing CDI. Since CamSA was the only anti-germinant tested able to prevent signs of CDI, we characterized CamSa's in vitro stability, distribution, and cytotoxicity. We report that CamSA is stable to simulated gastrointestinal (GI environments, but will be degraded by members of the natural microbiota found in a healthy gut. Our data suggest that CamSA will not be systemically available, but instead will be localized to the GI tract. Since in vitro pharmacological parameters were acceptable, CamSA was used to probe the mouse model of CDI. By varying the timing of CamSA dosage, we estimated that C. difficile spores germinated and established infection less than 10 hours after ingestion. We also showed that ingested C. difficile spores rapidly transited through the GI tract and accumulated in the colon and cecum of CamSA-treated mice. From there, C. difficile spores were slowly shed over a 96-hour period. To our knowledge, this is the first report of using molecular probes to obtain disease progression information for C. difficile infection.

  8. Detection of spore coat protein of Bacillus subtilis by immunological method

    International Nuclear Information System (INIS)

    Uchida, Aritsune; Kadota, Hajime

    1976-01-01

    The spore coat protein of Bacillus subtilis was separated, and the qualitative assay for the spore coat protein was made by use of the immunological technique. The immunological method was found to be useful for judging the maturation of spore coat in the course of sporulation. The spore coat protein antigen appeared at t 2 stage of sporulation. The addition of rifampicin at the earlier stages of sporulation inhibited the increase in content of the spore coat antigen. (auth.)

  9. Survival of Bacillus anthracis spores in fruit juices and wine.

    Science.gov (United States)

    Leishman, Oriana N; Johnson, Miranda J; Labuza, Theodore P; Diez-Gonzalez, Francisco

    2010-09-01

    Foods have been identified as a potential target for bioterrorism due to their essential nature and global distribution. Foods produced in bulk have the potential to have large batches of product intentionally contaminated, which could affect hundreds or thousands of individuals. Bacillus anthracis spores are one potential bioterrorism agent that may survive pasteurization and remain viable throughout the shelf life of fruit juices and cause disease if consumed. This project examined B. anthracis spore survival in orange, apple, and grape juices, as well as wine. Samples of beverages were inoculated with spores of two nonpathogenic B. anthracis strains at approximately 10(6) CFU/ml, and the spore count was determined periodically during storage for 30 days at 4°C. After this time, the counts of survival spores never declined more than 1 log CFU/ml in any of the beverage types. These results indicate that spores can survive, with little to no loss in viability, for at least a month in fruit juices and wine.

  10. Availability of websites offering to sell psilocybin spores and psilocybin.

    Science.gov (United States)

    Lott, Jason P; Marlowe, Douglas B; Forman, Robert F

    2009-09-01

    This study assesses the availability of websites offering to sell psilocybin spores and psilocybin, a powerful hallucinogen contained in Psilocybe mushrooms. Over a 25-month period beginning in March 2003, eight searches were conducted in Google using the term "psilocybin spores." In each search the first 100 nonsponsored links obtained were scored by two independent raters according to standardized criteria to determine whether they offered to sell psilocybin or psilocybin spores. No attempts were made to procure the products offered for sale in order to ascertain whether the marketed psilocybin was in fact "genuine" or "counterfeit." Of the 800 links examined, 58% led to websites offering to sell psilocybin spores. Additionally, evidence that whole Psilocybe mushrooms are offered for sale online was obtained. Psilocybin and psilocybin spores were found to be widely available for sale over the Internet. Online purchase of psilocybin may facilitate illicit use of this potent psychoactive substance. Additional studies are needed to assess whether websites offering to sell psilocybin and psilocybin spores actually deliver their products as advertised.

  11. Dispersal of spores following a persistent random walk.

    Science.gov (United States)

    Bicout, D J; Sache, I

    2003-03-01

    A model of a persistent random walk is used to describe the transport and deposition of the spore dispersal process. In this model, the spore particle flies along straight line trajectories, with constant speed v, which are interrupted by scattering, originating from interaction of spores with the field and wind variations, which randomly change its direction. To characterize the spore dispersal gradients, we have derived analytical expressions of the deposition probability epsilon (r|v) of airborne spores as a function of the distance r from the spore source in an infinite free space and in a disk of radius R with an absorbing edge that mimics an agricultural field surrounded with fields of nonhost plants and bare land. It is found in the free space that epsilon (r|v) approximately e(-alphar/l), with alpha a function of l(d)/l, where l and l(d) are the scattering and deposition mean free paths, respectively. In the disk, however, epsilon (r|v) is an infinite series of Bessel functions and, exhibits three regimes: absorbing (Rl(d)).

  12. Ethanol, vinegar and Origanum vulgare oil vapour suppress the development of anthracnose rot in tomato fruit.

    Science.gov (United States)

    Tzortzakis, Nikos G

    2010-08-15

    Anthracnose rot (Colletotrichum coccodes) development in vitro or in tomato (Lycopersicon esculentum L.) fruit was evaluated after treatment with absolute ethyl alcohol (AEA), vinegar (VIN), chlorine (CHL) or origanum oil (ORI) and storage at 12 degrees C and 95% relative humidity during or following exposure to the volatiles. Fruit treated with vapours reduced fungal spore germination/production, but in the case of AEA- and VIN-treated fruits, fungal mycelium development was accelerated. Fruit lesion development was suppressed after fruit exposure to pure (100% v/v) AEA or ORI vapours which were accompanied by increased fruit cracking. Exposure to pure VIN-, CHL- and ORI vapours reduced (up to 92%) spore germination in vitro, but no differences were observed in the AEA treatment. The benefits associated with volatiles-enrichment were maintained in fruit pre-exposed to vapours, resulting in suppression in spore germination and spore production. However, studies performed on fungi grown on Potato Dextrose Agar revealed fewer direct effects of volatiles on fungal colony development and spore germination per se, implying that suppression of pathogen development was due in a large part to the impact of volatiles on fruit-pathogen interactions and/or 'memory' effects on fruit tissue. Work is currently focussing on the mechanisms underlying the impacts of volatiles on fruit quality related attributes. The results of this study indicate that volatiles may be considered as an alternative to the traditional postharvest sanitizing techniques. Each commodity needs to be individually assessed, and the volatile concentration and sanitising technique optimised, before the volatile treatment is used commercially. Copyright 2010 Elsevier B.V. All rights reserved.

  13. Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

    Science.gov (United States)

    Judelson, H S; Michelmore, R W

    1990-01-01

    Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

  14. INFLUENCE OF CULTIVARS AND SEED THERMAL TREATMENT ON THE DEVELOPMENT OF FUNGAL PATHOGENS IN CARROT AND ONION PLANTS

    Czech Academy of Sciences Publication Activity Database

    Koudela, M.; Novotný, Čeněk

    2016-01-01

    Roč. 64, č. 4 (2016), s. 1181-1189 ISSN 1211-8516 R&D Projects: GA MZe QJ1210165 Institutional support: RVO:61388971 Keywords : carrot * onion * fungal pathogens * plants infection Subject RIV: EE - Microbiology, Virology

  15. Particularities of pathogenic microorganism development at anthropogenic influence and estimate of their adaptation potential by means of radiobiological method

    International Nuclear Information System (INIS)

    Shilina, Yu.V.; Gushcha, N.I.; Dyachenko, A.I.; Dmitriev, A.P.; Molozhava, O.S.; Romashko, V.M.

    2008-01-01

    Influence of anthropogenic factors on ecosystems causes their structure disturbance and reduction of species variety. Some resistance nonspecific forms of pathogenic microorganisms, which have high adaptation potential, become dominant. Thus their aggressiveness can increase. (authors)

  16. Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.

  17. Live cell imaging of germination and outgrowth of individual Bacillus subtilis spores; the effect of heat stress quantitatively analyzed with SporeTracker

    NARCIS (Netherlands)

    Pandey, R.; ter Beek, A.; Vischer, N.O.E.; Smelt, J.P.P.M.; Brul, S.; Manders, E.M.M.

    2013-01-01

    Spore-forming bacteria are a special problem for the food industry as some of them are able to survive preservation processes. Bacillus spp. spores can remain in a dormant, stress resistant state for a long period of time. Vegetative cells are formed by germination of spores followed by a more

  18. Decreased UV light resistance of spores of Bacillus subtilis strains deficient in pyrimidine dimer repair and small, acid-soluble spore proteins

    International Nuclear Information System (INIS)

    Setlow, B.; Setlow, P.

    1988-01-01

    Loss of small, acid-soluble spore protein alpha reduced spore UV resistance 30- to 50-fold in Bacillus subtilis strains deficient in pyrimidine dimer repair, but gave only a 5- to 8-fold reduction in UV resistance in repair-proficient strains. However, both repair-proficient and -deficient spores lacking this protein had identical heat and gamma-radiation resistance

  19. Diverse supramolecular structures formed by self‐assembling proteins of the B acillus subtilis spore coat

    Science.gov (United States)

    Jiang, Shuo; Wan, Qiang; Krajcikova, Daniela; Tang, Jilin; Tzokov, Svetomir B.; Barak, Imrich

    2015-01-01

    Summary Bacterial spores (endospores), such as those of the pathogens C lostridium difficile and B acillus anthracis, are uniquely stable cell forms, highly resistant to harsh environmental insults. B acillus subtilis is the best studied spore‐former and we have used it to address the question of how the spore coat is assembled from multiple components to form a robust, protective superstructure. B . subtilis coat proteins (CotY, CotE, CotV and CotW) expressed in E scherichia coli can arrange intracellularly into highly stable macro‐structures through processes of self‐assembly. Using electron microscopy, we demonstrate the capacity of these proteins to generate ordered one‐dimensional fibres, two‐dimensional sheets and three‐dimensional stacks. In one case (CotY), the high degree of order favours strong, cooperative intracellular disulfide cross‐linking. Assemblies of this kind could form exquisitely adapted building blocks for higher‐order assembly across all spore‐formers. These physically robust arrayed units could also have novel applications in nano‐biotechnology processes. PMID:25872412

  20. Reaerosolization of Spores from Flooring Surfaces To Assess the Risk of Dissemination and Transmission of Infections.

    Science.gov (United States)

    Paton, Susan; Thompson, Katy-Anne; Parks, Simon R; Bennett, Allan M

    2015-08-01

    The aim of this study was to quantify reaerosolization of microorganisms caused by walking on contaminated flooring to assess the risk to individuals accessing areas contaminated with pathogenic organisms, for example, spores of Bacillus anthracis. Industrial carpet and polyvinyl chloride (PVC) floor coverings were contaminated with aerosolized spores of Bacillus atrophaeus by using an artist airbrush to produce deposition of ∼10(3) to 10(4) CFU · cm(-2). Microbiological air samplers were used to quantify the particle size distribution of the aerosol generated when a person walked over the floorings in an environmental chamber. Results were expressed as reaerosolization factors (percent per square centimeter per liter), to represent the ratio of air concentration to surface concentration generated. Walking on carpet generated a statistically significantly higher reaerosolization factor value than did walking on PVC (t = 20.42; P flooring in order to inform the choice of appropriate respiratory protective equipment and may aid in the selection of the most suitable flooring types for use in health care environments, to reduce aerosol transmission in the event of contamination. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  1. Development and pathology of two undescribed species of microsporidia infecting the predatory mite, Phytoseiulus persimilis Athias-Henriot.

    Science.gov (United States)

    Bjøornson, S; Keddie, B A

    2000-11-01

    Two undescribed species of microsporidia were found in mass-reared Phytoseiulus persimilis Athias-Henriot from two commercial sources during a routine examination of these predators for pathogens. Both microsporidian species were described from specimens that had been prepared for transmission electron microscopy; live specimens were unavailable for examination. One microsporidium, identified as Species A, was described from two specimens obtained from a commercial insectary in North America. All observed stages of this microsporidium were uninucleate. Rounded-to-ovoid schizonts appeared to develop in direct contact with the cytoplasm of lyrate organ cells (ovarian tissue). Mature spores of Species A were elongate-ovoid and measured 2.88 x 1.21 microm. A polar filament coiled 7 to 10 times in the posterior half of the spore. Sporoblasts and spores were observed in the cytoplasm of cells of numerous tissues and in developing eggs within gravid females. A second species, identified as Species B, was described from five specimens obtained from a commercial source in Israel. All observed stages of this microsporidium were uninucleate. Schizonts of Species B were observed within the cytoplasm of cecal wall cells and within the nuclei of lyrate organ cells. Mature spores were ovoid and measured 2.65 x 1.21 microm. A polar filament coiled 3 to 4 times in the posterior half of the spore. Densely packed ribosomes often concealed the polar filament and other internal spore characteristics. Spores were observed in the cytoplasm of cells of numerous tissues and occasionally within the nuclei of lyrate organ cells. Numerous spores and presporal stages were observed within the ovary and developing eggs. The development and pathology of Species A and B were compared to those of Microsporidium phytoseiuli Bjøornson, Steiner and Keddie, a microsporidium previously described from P. persimilis obtained from a commercial source in Europe. The occurrence of three species of

  2. Rugged single domain antibody detection elements for Bacillus anthracis spores and vegetative cells.

    Directory of Open Access Journals (Sweden)

    Scott A Walper

    Full Text Available Significant efforts to develop both laboratory and field-based detection assays for an array of potential biological threats started well before the anthrax attacks of 2001 and have continued with renewed urgency following. While numerous assays and methods have been explored that are suitable for laboratory utilization, detection in the field is often complicated by requirements for functionality in austere environments, where limited cold-chain facilities exist. In an effort to overcome these assay limitations for Bacillus anthracis, one of the most recognizable threats, a series of single domain antibodies (sdAbs were isolated from a phage display library prepared from immunized llamas. Characterization of target specificity, affinity, and thermal stability was conducted for six sdAb families isolated from rounds of selection against the bacterial spore. The protein target for all six sdAb families was determined to be the S-layer protein EA1, which is present in both vegetative cells and bacterial spores. All of the sdAbs examined exhibited a high degree of specificity for the target bacterium and its spore, with affinities in the nanomolar range, and the ability to refold into functional antigen-binding molecules following several rounds of thermal denaturation and refolding. This research demonstrates the capabilities of these sdAbs and their potential for integration into current and developing assays and biosensors.

  3. Engineering Rugged Field Assays to Detect Hazardous Chemicals Using Spore-Based Bacterial Biosensors.

    Science.gov (United States)

    Wynn, Daniel; Deo, Sapna; Daunert, Sylvia

    2017-01-01

    Bacterial whole cell-based biosensors have been genetically engineered to achieve selective and reliable detection of a wide range of hazardous chemicals. Although whole-cell biosensors demonstrate many advantages for field-based detection of target analytes, there are still some challenges that need to be addressed. Most notably, their often modest shelf life and need for special handling and storage make them challenging to use in situations where access to reagents, instrumentation, and expertise are limited. These problems can be circumvented by developing biosensors in Bacillus spores, which can be engineered to address all of these concerns. In its sporulated state, a whole cell-based biosensor has a remarkably long life span and is exceptionally resistant to environmental insult. When these spores are germinated for use in analytical techniques, they show no loss in performance, even after long periods of storage under harsh conditions. In this chapter, we will discuss the development and use of whole cell-based sensors, their adaptation to spore-based biosensors, their current applications, and future directions in the field. © 2017 Elsevier Inc. All rights reserved.

  4. Nanoceria and bulk cerium oxide effects on the germination of asplenium adiantum-nigrum spores

    Directory of Open Access Journals (Sweden)

    Aranzazu Gomez-Garay

    2016-12-01

    Full Text Available Aim of study: The effect of cerium oxide engineered nanoparticles on the spore germination of the fern. Asplenium adiantum-nigrum. Area of study: France, Britanny Region, Finistére Department, Plougonvelin, in rocks near the sea. Material and methods: Asplenium spores were cultured in vitro on agar medium with Nano-CeO2 (less than 25 nm particle size and bulk-CeO2. The addition of each nano- and bulk particles ranged from 0 to 3000 mg L-1. Observations on rhizoidal and prothallial cells during first stages of gametophyte development were made. The No-Observed-Adverse-Effect concentration (NOAEC and Lowest-Observed-Adverse-Effect-Concentration (LOEC values for spore germination rate data were analyzed.  Main results: Germination was speeded up by 100 to 2000 mg L-1 nanoceria, while bulk cerium oxide had the same effect for 500 to 200 mg L-1 concentrations. Present results showed cellular damage in the protonema while rhizoid cells seemed not to be affected, as growth and membrane integrity remained. Research highlights: Both nanosized and bulk cerium oxide are toxic for the fern Asplenium adiantum-nigrum, although diverse toxicity patterns were shown for both materials. Diverse toxic effects have been observed: chloroplast membrane damage and lysis, cell wall and membrane disruption which leads to cell lysis; and alterations in morphology and development. Keywords: Nanoparticles; rhizoid; prothallus; chloroplast; fern.

  5. Nanoceria and bulk cerium oxide effects on the germination of asplenium adiantum-nigrum spores

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Garay, A.; Pintos, B.; Manzanera, J.A.; Prada, C.; Martin, L.; Gabriel y Galan, J.M.

    2016-07-01

    Aim of the study: The effect of cerium oxide engineered nanoparticles on the spore germination of the fern. Asplenium adiantum-nigrum. Area of study: France, Britanny Region, Finistére Department, Plougonvelin, in rocks near the sea. Material and methods: Asplenium spores were cultured in vitro on agar medium with Nano-CeO2 (less than 25 nm particle size) and bulk-CeO2. The addition of each nano- and bulk particles ranged from 0 to 3000 mg L-1. Observations on rhizoidal and prothallial cells during first stages of gametophyte development were made. The No-Observed-Adverse-Effect concentration (NOAEC) and Lowest-Observed-Adverse-Effect-Concentration (LOEC) values for spore germination rate data were analyzed. Main results: Germination was speeded up by 100 to 2000 mg L-1 nanoceria, while bulk cerium oxide had the same effect for 500 to 200 mg L-1 concentrations. Present results showed cellular damage in the protonema while rhizoid cells seemed not to be affected, as growth and membrane integrity remained. Research highlights: Both nanosized and bulk cerium oxide are toxic for the fern Asplenium adiantum-nigrum, although diverse toxicity patterns were shown for both materials. Diverse toxic effects have been observed: chloroplast membrane damage and lysis, cell wall and membrane disruption which leads to cell lysis; and alterations in morphology and development. (Author)

  6. Parapiptadenia rigida MYCORRHIZATION WITH SPORES OF Scleroderma citrinum

    Directory of Open Access Journals (Sweden)

    Gerusa Pauli Kist Steffen

    2017-06-01

    Full Text Available Ectomycorrhizal fungal inoculation in forestry seedlings aids plant establishment and growth in the field. The objectives of this study were: to determine the mycorrhizal capacity of the ectomycorrhizal fungus Scleroderma citrinum in Parapiptadenia rigida (red angico seedlings and to evaluate the viability of a mycorrhizal inoculation technique for forest seedlings involving the use of spores. Mature spores were inoculated in the substrate (75% soil and 25% carbonized rice husk, totaling 1.5 grams of fungal spores per liter of substrate. P. rigida seeds were sown in substrates inoculated or not inoculated with fungal spores in presence or absence of Pinus echinata and Eucalyptus citriodora essential oil: not inoculated (T1, inoculated (T2, inoculated more pine essential oil (T3, inoculated more eucalyptus essential oil (T4. Seedlings of Pinus elliottii were used for a positive control of mycorrhizal inoculation (T5 and not inoculated (T6 with fungal spores. At 90 days after sowing, the base stem diameter, height, fresh and dry weight of shoots and roots, percentage of root colonization and Dickson Index were determined. The presence of fungal structures in P. rigida and P. elliottii roots inoculated with S. citrinum spores was observed, demonstrating the occurrence of an ectomycorrhizal association. The application of pine and eucalyptus essential oils in the substrate increased the percentage of ectomycorrhizal colonization in P. rigida seedlings. The addition of S. citrinum mature spores in the substrate used for seedling production is a viable practice for ectomycorrhizal inoculation and it can be used in forest nurseries in controlled mycorrhization programs.

  7. Inactivation of bacterial spores by combination processes: ultraviolet plus gamma radiation. [Streptococcus faecium, micrococcus radiodurans, clostridium botulinum

    Energy Technology Data Exchange (ETDEWEB)

    Grecz, N; Durban, E

    1973-01-01

    Bacterial spores, viruses and some vegetative bacteria such as Streptococcus faecium and Micrococcus radiodurans are distinguished by high radiation resistance. In order to lay a theoretical basis for biomedical sterilization applications, we have investigated the combined action of uv and gamma rays. Spores of two strains of C. botulinum were selected, a highly radiation resistant strain, 33A having a D/sub 10/-value of 0.32 Mrad, and a relatively radiation sensitive strain, 51B having a D/sub 10/-value of 0.12 Mrad. Strain 33A exhibits an extensive initial ''shoulder'' in its uv as well as gamma ray survival curves; strain 51B shows only a slight shoulder. The shoulder in the gamma ray survival curve of spores of strain 33A could be reduced or completely eliminated by preirradiation with uv. Simultaneously the D/sub 10/-value for gamma inactivation of spores of 33A was reduced substantially. For example, the gamma resistance was reduced almost to half of its original D/sub 10/-value by uv-preirradiation for only one minute under an 8 watt GE germicidal lamp. The effect of uv-preirradiation on the radiation sensitive strain 51B was less pronounced. In fact, there was about seven fold higher positive interaction (synergism) between uv and gamma radiation in 33A spores than in 51B spores. The experiments suggest that interference with DNA repair enzymes in the radiation resistant strain are responsible for lethal synergism between uv and gamma radiation. A hypothesis is developed attempting to explain the combined effect of these two radiations in terms of a special summation of known DNA lesions in the cell. These observations emphasize the potential practical advantages of combining uv and gamma rays for effective sterilization of certain biomedical devices, drugs and biologicals.

  8. Detection of Bacillus anthracis spores by super-paramagnetic lateral-flow immunoassays based on "Road Closure".

    Science.gov (United States)

    Wang, Dian-Bing; Tian, Bo; Zhang, Zhi-Ping; Wang, Xu-Ying; Fleming, Joy; Bi, Li-Jun; Yang, Rui-Fu; Zhang, Xian-En

    2015-05-15

    Detection of Bacillus anthracis in the field, whether as a natural infection or as a biothreat remains challenging. Here we have developed a new lateral-flow immunochromatographic assay (LFIA) for B. anthracis spore detection based on the fact that conjugates of B. anthracis spores and super-paramagnetic particles labeled with antibodies will block the pores of chromatographic strips and form retention lines on the strips, instead of the conventionally reported test lines and control lines in classic LFIA. As a result, this new LFIA can simultaneously realize optical, magnetic and naked-eye detection by analyzing signals from the retention lines. As few as 500-700 pure B. anthracis spores can be recognized with CV values less than 8.31% within 5 min of chromatography and a total time of 20 min. For powdery sample tests, this LFIA can endure interference from 25% (w/v) milk, 10% (w/v) baking soda and 10% (w/v) starch without any sample pre-treatment, and has a corresponding detection limit of 6×10(4) spores/g milk powder, 2×10(5) spores/g starch and 5×10(5) spores/g baking soda. Compared with existing methods, this new approach is very competitive in terms of sensitivity, specificity, cost and ease of operation. This proof-of-concept study can also be extended for detection of many other large-sized analytes. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Extracellular proteases from Streptomyces phaeopurpureus ExPro138 inhibit spore adhesion, germination and appressorium formation in Colletotrichum coccodes.

    Science.gov (United States)

    Palaniyandi, S A; Yang, S H; Suh, J-W

    2013-07-01

    To study the antifungal mechanism of proteases from Streptomyces phaeopurpureus strain ExPro138 towards Colletotrichum coccodes and to evaluate its utilization as biofungicide. We screened proteolytic Streptomyces strains from the yam rhizosphere with antifungal activity. Forty proteolytic Streptomyces were isolated, among which eleven isolates showed gelatinolytic activity and antagonistic activity on C. coccodes. Of the 11 isolates, protease preparation from an isolate designated ExPro138 showed antifungal activity. 16S rDNA sequence analysis of the strain showed 99% similarity with Streptomyces phaeopurepureus (EU841588.1). Zymography analysis of the ExPro138 culture filtrate revealed that the strain produced several extracellular proteases. The protease preparation inhibited spore germination, spore adhesion to polystyrene surface and appressorium formation. Microscopic study of the interaction between ExPro138 and C. coccodes revealed that ExPro138 was mycoparasitic on C. coccodes. The protease preparation also reduced anthracnose incidence on tomato fruits compared with untreated control. This study demonstrates possibility of utilizing antifungal proteases derived from antagonistic microbes as biofungicide. Microbial proteases having the ability to inhibit spore adhesion and appressorium formation could be used to suppress infection establishment by foliar fungal pathogens at the initial stages of the infection process. Journal of Applied Microbiology © 2013 The Society for Applied Microbiology.

  10. MPLEx: a method for simultaneous pathogen inactivation and extraction of samples for multi-omics profiling

    Energy Technology Data Exchange (ETDEWEB)

    Burnum-Johnson, Kristin E.; Kyle, Jennifer E.; Eisfeld, Amie J.; Casey, Cameron P.; Stratton, Kelly G.; Gonzalez, Juan F.; Habyarimana, Fabien; Negretti, Nicholas M.; Sims, Amy C.; Chauhan, Sadhana; Thackray, Larissa B.; Halfmann, Peter J.; Walters, Kevin B.; Kim, Young-Mo; Zink, Erika M.; Nicora, Carrie D.; Weitz, Karl K.; Webb-Robertson, Bobbie-Jo M.; Nakayasu, Ernesto S.; Ahmer, Brian; Konkel, Michael E.; Motin, Vladimir; Baric, Ralph S.; Diamond, Michael S.; Kawaoka, Yoshihiro; Waters, Katrina M.; Smith, Richard D.; Metz, Thomas O.

    2017-01-01

    The continued emergence and spread of infectious agents is of increasing concern due to increased population growth and the associated increased livestock production to meet food demands, increased urbanization and land-use changes, and greater travel. A systems biology approach to infectious disease research can significantly advance our understanding of host-pathogen relationships and facilitate the development of new therapies and vaccines. Molecular characterization of infectious samples outside of appropriate biosafety containment can only take place subsequent to pathogen inactivation. Herein, we describe a modified Folch extraction using chloroform/methanol that facilitates the molecular characterization of infectious samples by enabling simultaneous pathogen inactivation and extraction of proteins, metabolites, and lipids for subsequent mass spectrometry-based multi-omics measurements. This metabolite, protein and lipid extraction (MPLEx) method resulted in complete inactivation of bacterial and viral pathogens with exposed lipid membranes, including Yersinia pestis, Salmonella Typhimurium, and Campylobacter jejuni in pure culture, and Yersinia pestis, Campylobacter jejuni, West Nile, MERS-CoV, Ebola, and influenza H7N9 viruses in infection studies. Partial inactivation was observed for pathogens without exposed lipid membranes including 99.99% inactivation of community-associated methicillin-resistant Staphylococcus aureus, 99.6% and >99% inactivation of Clostridium difficile spores and vegetative cells, respectively, and 50% inactivation of adenovirus type 5. To demonstrate that MPLEx yields biomaterial of sufficient quality for subsequent multi-omics analyses, we highlight select proteomics, metabolomics and lipidomics data from human epithelial lung cells infected with wild-type and mutant forms of influenza H7N9. We believe that MPLEx will facilitate systems biology studies of infectious samples by enabling simultaneous pathogen inactivation and multi

  11. Assessment of Clostridium perfringens spore response to high hydrostatic pressure and heat with nisin.

    Science.gov (United States)

    Gao, Yulong; Qiu, Weifen; Wu, Ding; Fu, Qiang

    2011-08-01

    The elimination of spores from low-acid foods presents food-processing and food-safety challenges to high-pressure processing (HPP) developers as bacterial spores are extremely resistant to pressure. Therefore, the effects of pressure (400-800 MPa), temperature (35-95 °C), and nisin (0-496 IU/mL) on the inactivation of Clostridium perfringens AS 64701 spores at various pressure-holding times (7.5-17.5 min) were explored. A second-order polynomal equation for HPP- and nisin-induced inactivation of C. perfringens spores was constructed with response surface methodology. Experiment results showed that the experimental values were shown to be significantly in agreement with the predicted values because the adjusted determination coefficient (R (Adj)²) was 0.9708 and the level of significance was P pressure of 654 Mpa, temperature of 74 °C, pressure-holding time of 13.6 min, and nisin concentration of 328 IU/mL. The validation of the model equation for predicting the optimum response values was verified effectively by ten test points that were not used in the establishment of the model. Compared with conventional HPP techniques, the main process advantages of HPP-nisin combination sterilization in the UHT milk are, lower pressure, temperature, natural preservative (nisin), and in a shorter treatment time. The synergistic inactivation of bacteria by HPP-nisin combination is a promising and natural method to increase the efficiency and safety of high-pressure pasteurization.

  12. Human pathogen avoidance adaptations

    NARCIS (Netherlands)

    Tybur, J.M.; Lieberman, D.

    2016-01-01

    Over the past few decades, researchers have become increasingly interested in the adaptations guiding the avoidance of disease-causing organisms. Here we discuss the latest developments in this area, including a recently developed information-processing model of the adaptations underlying pathogen

  13. Preferential inclusion of extrachromosomal genetic elements in yeast meiotic spores.

    Science.gov (United States)

    Brewer, B J; Fangman, W L

    1980-09-01

    During meiosis and sporulation in the yeast Saccharomyces cerevisiae, extrachromosomal traits are efficiently transmitted to haploid spores. Although the pattern of inheritance of chromosomal traits reflects the mechanism of regular chromosomal segregation in meiosis, it is not known what processes are reflected by the efficient inheritance of extrachromosomal traits. Because extrachromosomal genetic elements in yeast are present in multiple copies, perpetuation of an extrachromosomal trait could occur by the passive envelopment of a subset of copies or by an active sequestering of all or a subset of copies within the four spores. We show that only subsets of the four extrachromosomal nucleic acids commonly found in yeast are transmitted through meiosis--55% of mitochondrial DNA copies, 82% of the 2-micron DNA plasmids, and about 70% of the L and M double-stranded RNAs. However, electron micrographs of serial sections through yeast asci indicate that the four spore enclose only 30% of the total ascus material. Thus these extrachromosomal elements are preferentially included within the spores, indicating that their inheritance is not a random process. Transmission of mitochondrial DNA can be accounted for by the observed enclosure of 52% of the mitochondrial volume within the spores. The high transmission frequencies of the double-stranded RNAs (which exist as virus-like particles in the cytoplasm) and 2-micron DNA must indicate that either these nucleic acids are actively recruited from the cytoplasm by some mechanism or they are associated in some way with the nucleus during meiosis.

  14. Scanning Surface Potential Microscopy of Spore Adhesion on Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ida [University of Tennessee, Knoxville (UTK); Chung, Eunhyea [Georgia Institute of Technology; Kweon, Hyojin [Georgia Institute of Technology; Yiacoumi, Sotira [Georgia Institute of Technology; Tsouris, Costas [ORNL

    2012-01-01

    The adhesion of spores of Bacillus anthracis - the cause of anthrax and a likely biological threat - to solid surfaces is an important consideration in cleanup after an accidental or deliberate release. However, because of safety concerns, directly studying B. anthracis spores with advanced instrumentation is problematic. As a first step, we are examining the electrostatic potential of Bacillus thuringiensis (Bt), which is a closely related species that is often used as a simulant to study B. anthracis. Scanning surface potential microscopy (SSPM), also known as Kelvin probe force microscopy (KPFM), was used to investigate the influence of relative humidity (RH) on the surface electrostatic potential of Bt that had adhered to silica, mica, or gold substrates. AFM/SSPM side-by-side images were obtained separately in air, at various values of RH, after an aqueous droplet with spores was applied on each surface and allowed to dry before measurements. In the SSPM images, a negative potential on the surface of the spores was observed compared with that of the substrates. The surface potential decreased as the humidity increased. Spores were unable to adhere to a surface with an extremely negative potential, such as mica.

  15. Pathogenicity of Metarhizium anisopliae (Deuteromycetes) and permethrin to Ixodes scapularis (Acari: Ixodidae) nymphs

    Science.gov (United States)

    Hornbostel, V.L.; Zhioua, Elyes; Benjamin, Michael A.; Ginsberg, Howard S.; Ostfeld, Richard S.

    2005-01-01

    Effectiveness of the entomopathogenic fungus Metarhizium anisopliae, for controlling nymphal Ixodes scapularis, was tested in laboratory and field trials. In the laboratory, M. anisopliae (Metschnikoff) Sorokin strain ESC1 was moderately pathogenic, with an LC50 of 107 spores/ml and induced 70% mortality at 109 spores/ml. In a field study, however, 109 spores/ml M. anisopliae did not effectively control questing I. scapularis nymphs, and significant differences were not detected in pre- and post-treatment densities. For nymphs collected and returned to the laboratory for observation, mortality was low in treatment groups, ranging from 20 to 36%. To assess whether a chemical acaricide would synergistically enhance pathogenicity of the fungus, we challenged unfed nymphal I. scapularis with combinations of M. anisopliae and permethrin, a relatively safe pyrethroid acaricide, in two separate bioassays. Significant interactions between M. anisopliae and permethrin were not observed, supporting neither synergism nor antagonism.

  16. PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.

    Science.gov (United States)

    Prevost, S; Andre, S; Remize, F

    2010-12-01

    Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.

  17. Distribution of Paenibacillus larvae spores inside honey bee colonies and its relevance for diagnosis.

    Science.gov (United States)

    Gillard, M; Charriere, J D; Belloy, L

    2008-09-01

    One of the most important factors affecting the development of honey bee colonies is infectious diseases such as American foulbrood (AFB) caused by the spore forming Gram-positive bacterium Paenibacillus larvae. Colony inspections for AFB clinical symptoms are time consuming. Moreover, diseased cells in the early stages of the infection may easily be overlooked. In this study, we investigated whether it is possible to determine the sanitary status of a colony based on analyses of different materials collected from the hive. We analysed 237 bee samples and 67 honey samples originating from 71 colonies situated in 13 apiaries with clinical AFB occurrences. We tested whether a difference in spore load among bees inside the whole hive exists and which sample material related to its location inside the hive was the most appropriate for an early AFB diagnosis based on the culture method. Results indicated that diagnostics based on analysis of honey samples and bees collected at the hive entrance are of limited value as only 86% and 83%, respectively, of samples from AFB-symptomatic colonies were positive. Analysis of bee samples collected from the brood nest, honey chamber, and edge frame allowed the detection of all colonies showing AFB clinical symptoms. Microbiological analysis showed that more than one quarter of samples collected from colonies without AFB clinical symptoms were positive for P. larvae. Based on these results, we recommend investigating colonies by testing bee samples from the brood nest, edge frame or honey chamber for P. larvae spores.

  18. Fungal spore germination into yeast or mycelium: possible implications of dimorphism in evolution and human pathogenesis

    Science.gov (United States)

    Ghormade, Vandana; Deshpande, M. V.

    The ability of dimorphism in fungi is conventionally regarded as a reversible change between the two vegetative forms, yeast and mycelium, in response to environmental change. A zygomycetous isolate, Benjaminiella poitrasii, exhibited yeast-mycelium transition in response to the change in temperature (37-28 °C) and decrease in glucose concentration. For the first time the presence of dimorphic response during asexual and sexual spore germination is reported under the dimorphism-triggering conditions in B. poitrasii. The zygospores germinated into budding yeast when subjected to yeast-form supporting conditions. The mycelium-form favoring conditions gave rise to true mycelium. Similarly, the asexual spores displayed a dimorphic response during germination. Our observations suggest that dimorphism is an intrinsic ability present in the vegetative, asexual, and sexual forms of the fungus. As dimorphic fungi are intermediate to the unicellular yeast and the filamentous forms, understanding of the dimorphic character could be useful to trace the evolutionary relationships among taxonomically different fungi. Moreover, the implications of spore germination during the onset of pathogenesis and in drug development for human health care are discussed.

  19. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    International Nuclear Information System (INIS)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-01

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10 −1 genomic equivalent ml −1 . An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP internal

  20. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    Energy Technology Data Exchange (ETDEWEB)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Mohamed, Maizan [Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, City Campus, Pengkalan Chepa, Locked Bag 36, 16100 Kota Bharu, Kelantan (Malaysia); Yean, Chan Yean, E-mail: yeancyn@yahoo.com [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Institute for Research in Molecular Medicine (INFORMM), Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia)

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10{sup −1} genomic equivalent ml{sup −1}. An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP

  1. Gene expression profiling during asexual development of the late blight pathogen Phytophthora infestans reveals a highly dynamic transcriptome

    NARCIS (Netherlands)

    Judelson, H.S.; Ah-Fong, A.M.V.; Aux, G.; Avrova, A.O.; Bruce, C.; Cakir, C.; Cunha, da L.; Grenville-Briggs, L.; Latijnhouwers, M.; Ligterink, W.; Meijer, H.J.G.; Roberts, S.; Thurber, C.S.; Whisson, S.C.; Birch, P.R.J.; Govers, F.; Kamoun, S.; West, van P.; Windass, J.

    2008-01-01

    Much of the pathogenic success of Phytophthora infestans, the potato and tomato late blight agent, relies on its ability to generate from mycelia large amounts of sporangia, which release zoospores that encyst and form infection structures. To better understand these stages, Affymetrix GeneChips

  2. New insights into the in vitro development and virulence of Culicinomyces spp. as fungal pathogens of Aedes aegypti

    Science.gov (United States)

    Culicinomyces spp. (Hypocreales: Cordycipitaceae) are facultative fungal pathogens affecting the larval stages from a range of mosquito species and are especially notable in their ability to infect hosts through the digestive tract after conidial ingestion. While Culicinomyces spp. were studied main...

  3. Outdoor ranging of poultry: a major risk factor for the introduction and development of high pathogenicity Avian Influenza

    NARCIS (Netherlands)

    Koch, G.; Elbers, A.R.W.

    2006-01-01

    High-Pathogenicity Avian Influenza (HPAI) is an extremely infectious viral disease of poultry. Public health concerns were raised when six persons died in Hong Kong in 1997 after exposure to HPAI-infected poultry. Its danger became imminent in the recent HPAI epidemic in South-East Asia when the

  4. Developing proactive management options to sustain bristlecone and limber pine ecosystems in the presence of a non-native pathogen

    Science.gov (United States)

    A. W. Schoettle

    2004-01-01

    Limber pine and Rocky Mountain bristlecone pine are currently threatened by the non-native pathogen white pine blister rust (WPBR). Limber pine is experiencing mortality in the Northern Rocky Mountains and the infection front continues to move southward. The first report of WPBR on Rocky Mountain bristlecone pine was made in 2003 (Blodgett and Sullivan 2004), at a site...

  5. Effect of irradiation of bacteria on the formation of spores

    International Nuclear Information System (INIS)

    Szulc, M.; Tropilo, J.; Olszewski, G.

    1980-01-01

    Studies were carried out on bacteria: Bac. subtilis, Bac. cereus, Cl. perfringens, Cl. botulinum which were irradiated in two media (PBS and broth containing 1% of protein) with 100, 1000, 5000 and 10 000 X-radiation doses. The results obtained show that: all bacteria species studied (vegetative forms) are characterized by a high sensitivity to X-radiation, though distinctly lower than the species of Enterobacteriaceae family; the bacteria species studied are characterized by various sporing rate. The highest sporing rate was shown by Bac. cereus, the following: Bac. subtilis, Cl. perfringens and Cl. botulinum; increased X-radiation doses weaken sporing of Bac. subtilis and Bac. cereus. This effect could not be observed in Cl. perfringens and Cl. botulinum. (author)

  6. Effect of irradiation of bacteria on the formation of spores

    Energy Technology Data Exchange (ETDEWEB)

    Szulc, M.; Tropilo, J.; Olszewski, G.

    1980-01-01

    Studies were carried out on bacteria: Bac. subtilis, Bac. cereus, Cl. perfringens, Cl. botulinum which were irradiated in two media (PBS and broth containing 1% of protein) with 100, 1000, 5000 and 10 000 X-radiation doses. The results obtained show that: all bacteria species studied (vegetative forms) are characterized by a high sensitivity to X-radiation, though distinctly lower than the species of Enterobacteriaceae family; the bacteria species studied are characterized by various sporing rate. The highest sporing rate was shown by Bac. cereus, the following: Bac. subtilis, Cl. perfringens and Cl. botulinum; increased X-radiation doses weaken sporing of Bac. subtilis and Bac. cereus. This effect could not be observed in Cl. perfringens and Cl. botulinum.

  7. Mutagenic effect of tritated water on spores of Bacillus subtilis

    International Nuclear Information System (INIS)

    Tanooka, H.; Munakata, N.

    1978-01-01

    The mutagenic effect of tritiated water was observed with spores of Bacillus subtilis polA strain suspended in 50 mCi/ml of tritiated water for various intervals. Dose rate given by tritium beta particles to spore core was estimated to be 400 rad/hr from some assumptions and E. coli data computed by Bockrath et al. and Sands et al. The initial mutation rate was 4.2 x 10 -9 mutants/rad, as compared with 2.4 x 10 -9 mutants/rad for 60 Co γ rays and 3.3 x 10 -9 mutants/rad for 30-kVp x rays. The mutagenic effect of tritiated water on spores is most likely due to beta particle ionizing radiation damage

  8. Pollen and spores as a passive monitor of ultraviolet radiation

    Directory of Open Access Journals (Sweden)

    Wesley Toby Fraser

    2014-04-01

    Full Text Available Sporopollenin is the primary component of the outer walls of pollen and spores. The chemical composition of sporopollenin is responsive to levels of ultraviolet (UV radiation exposure, via a concomitant change in the concentration of phenolic compounds. This relationship offers the possibility of using fossil pollen and spore chemistry as a novel proxy for past UV flux. Phenolic compounds in sporopollenin can be quantified using Fourier Transform infrared spectroscopy. The high potential for preservation of pollen and spores in the geologic record, and the conservative nature of sporopollenin chemistry across the land plant phylogeny, means that this new proxy has the potential to reconstruct UV flux over much longer timescales than has previously been possible. This new tool has important implications for understanding the relationship between UV flux, solar insolation and climate in the past, as well as providing a possible means of assessing paleoaltitude, and ozone thickness.

  9. Phylogenetic placement of two species known only from resting spores

    DEFF Research Database (Denmark)

    Hajek, Ann E; Gryganskyi, Andrii; Bittner, Tonya

    2016-01-01

    resting spores, Zoophthora independentia, infecting Tipula (Lunatipula) submaculata in New York State, is now described as a new species and Tarichium porteri, described in 1942, which infects Tipula (Triplicitipula) colei in Tennessee, is transferred to the genus Zoophthora. We have shown that use......Molecular methods were used to determine the generic placement of two species of Entomophthorales known only from resting spores. Historically, these species would belong in the form-genus Tarichium, but this classification provides no information about phylogenetic relationships. Using DNA from...... of molecular methods can assist with determination of the phylogenetic relations of specimens within the form-genus Tarichium for an already described species and a new species for which only resting spores are available....

  10. Sporulation environment influences spore properties in Bacillus: evidence and insights on underlying molecular and physiological mechanisms.

    Science.gov (United States)

    Bressuire-Isoard, Christelle; Broussolle, Véronique; Carlin, Frédéric

    2018-05-17

    Bacterial spores are resistant to physical and chemical insults, which make them a major concern for public health and for industry. Spores help bacteria to survive extreme environmental conditions that vegetative cells cannot tolerate. Spore resistance and dormancy are important properties for applications in medicine, veterinary health, food safety, crop protection, and other domains. The resistance of bacterial spores results from a protective multilayered structure and from the unique composition of the spore core. The mechanisms of sporulation and germination, the first stage after breaking of dormancy, and organization of spore structure have been extensively studied in Bacillus species. This review aims to illustrate how far the structure, composition and properties of spores are shaped by the environmental conditions in which spores form. We look at the physiological and molecular mechanisms underpinning how sporulation media and environment deeply affect spore yield, spore properties like resistance to wet heat and physical and chemical agents, germination, and further growth. For example, spore core water content decreases as sporulation temperature increases, and resistance to wet heat increases. Controlling the fate of Bacillus spores is pivotal to controlling bacterial risks and process efficiencies in, for example, the food industry, and better control hinges on better understanding how sporulation conditions influence spore properties.

  11. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira.

    Science.gov (United States)

    Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. The role of water radicals in thermorestoration of bacterial spores

    Energy Technology Data Exchange (ETDEWEB)

    Friedman, Y S; Grecz, N [Illinois Inst. of Tech., Chicago (USA). Dept. of Biology

    1974-01-01

    Fully hydrated bacterial spores exposed to 0.45 Mrad showed a characteristic pattern of survival associated with thermorestoration. When temperature during radiation was controlled at -15/sup 0/ to +120/sup 0/C, the lowest viable cell counts were at 0/sup 0/C. Above 0/sup 0/C radiosurvival gradually increased by 2 to 3 log cycles reaching peak at 75/sup 0/C (Bacillus cereus T heat sensitive spores) and at 95/sup 0/C (B.stearothermophilus, heat resistant spores). Simultaneously high survival was observed in the solidly frozen state at -15/sup 0/C to -5/sup 0/C since harmful radicals produced by radiation were trapped in ice. Radiation modifying effects, i.e., protection by 2M ethanol (a scavenger of OH radicals) and sensitization by 1M sodium nitrate (a scavenger of H radicals and hydrated electrons), were studied. The results with ethanol and nitrate confirm the idea that in aqueous sytems below 50/sup 0/C the lethal action is due to oxidizing OH radicals known to attack cell DNA. However, the reversal of scavenger actions above 50/sup 0/C indicates that at those high temperatures lethal effects may also involve the reducing H and esub(aq), which at lower temperatures appear not to affect spore survival though they are known to attack proteins. In this case, it is proposed that radiation inactivation of spores at temperatures below 50/sup 0/C is due to DNA damage inflicted by OH radicals whereas spore death above 50/sup 0/C seems to involve protein /enzyme/ inactivation due to a combined action of heat plus reducing (H, esub(aq)) as well as oxidizing (OH) radical species. From the practical point of view it is important that normally radioprotective effects of such substances as ethanol or ground beef are progressively lost when radiation is carried out at temperatures above 50/sup 0/C.

  13. The role of water radicals in thermorestoration of bacterial spores

    International Nuclear Information System (INIS)

    Friedman, Y.S.; Grecz, N.

    1974-01-01

    Fully hydrated bacterial spores exposed to 0.45 Mrad showed a characteristic pattern of survival associated with thermorestoration. When temperature during radiation was controlled at -15 0 to +120 0 C, the lowest viable cell counts were at 0 0 C. Above 0 0 C radiosurvival gradually increased by 2 to 3 log cycles reaching peak at 75 0 C (Bacillus cereus T heat sensitive spores) and at 95 0 C (B.stearothermophilus, heat resistant spores). Simultaneously high survival was observed in the solidly frozen state at -15 0 C to -5 0 C since harmful radicals produced by radiation were trapped in ice. Radiation modifying effects, i.e., protection by 2M ethanol (a scavenger of OH radicals) and sensitization by 1M sodium nitrate (a scavenger of H radicals and hydrated electrons), were studied. The results with ethanol and nitrate confirm the idea that in aqueous sytems below 50 0 C the lethal action is due to oxidizing OH radicals known to attack cell DNA. However, the reversal of scavenger actions above 50 0 C indicates that at those high temperatures lethal effects may also involve the reducing H and esub(aq), which at lower temperatures appear not to affect spore survival though they are known to attack proteins. In this case, it is proposed that radiation inactivation of spores at temperatures below 50 0 C is due to DNA damage inflicted by OH radicals whereas spore death above 50 0 C seems to involve protein /enzyme/ inactivation due to a combined action of heat plus reducing (H, esub(aq)) as well as oxidizing (OH) radical species. From the practical point of view it is important that normally radioprotective effects of such substances as ethanol or ground beef are progressively lost when radiation is carried out at temperatures above 50 0 C. (F.J.)

  14. In vitro propagation of Cyathea atrovirens (Cyatheaceae: spore storage and sterilization conditions

    Directory of Open Access Journals (Sweden)

    Isabel Beatriz de Vargas

    2014-03-01

    Full Text Available Cyathea atrovirens occurs in a wide range of habitats in Brazil, Paraguay, Uruguay and Argentina. In the Brazilian State of Rio Grande do Sul, this commonly found species is a target of intense exploitation, because of its ornamental characteristics. The in vitro cultura is an important tool for propagation which may contribute toward the reduction of extractivism. However, exogenous contamination of spores is an obstacle for the success of aseptic long-term cultures. This study evaluated the influence of different sterilization methods combined with storage conditions on the contamination of the in vitro cultures and the gametophytic development of C. atrovirens, in order to establish an efficient propagation protocol. Spores were obtained from plants collected in Novo Hamburgo, State of Rio Grande do Sul, Brazil. In the first experiment, spores stored at 7oC were surface sterilized with 0.5, 0.8 and 2% of sodium hypochlorite (NaClO for 15 minutes and sown in Meyer’s culture medium. The cultures were maintained in a growth room at 26±1ºC for a 12-h photoperiod and photon flux density of 100μmol/m²/s provided by cool white fluorescent light. Contamination was assessed at 60 days, and gametophytic development was scored at 30, 60, 120 and 130 days of in vitro culture, analyzing 300 individuals for each treatment. There was no significant difference in culture contamination among the different sodium hypochlorite concentrations tested, and all treatments allowed for the development of cordiform gametophytes at 130 days of culture. In the second experiment, spores stored at 7 and -20°C were divided into two groups. Half of the spores were surface sterilized with 2% of NaClO for 15 minutes and the other half was not sterilized. All spores were sown in Meyer’s medium supplemented with one of the following antibiotics: nystatin, Micostatin® and actidione. The culture conditions and the procedures used for evaluating contamination and

  15. Discrimination of Spore-Forming Bacilli Using spoIVA

    Science.gov (United States)

    Venkateswaran, Kasthuri; LaDuc, Myron; Stuecker, Tara

    2009-01-01

    A method of discriminating between spore-forming and non-spore-forming bacteria is based on a combination of simultaneous sporulation-specific and non-sporulation-specific quantitative polymerase chain reactions (Q-PCRs). The method was invented partly in response to the observation that for the purposes of preventing or reducing biological contamination affecting many human endeavors, ultimately, only the spore-forming portions of bacterial populations are the ones that are problematic (or, at least, more problematic than are the non-spore-forming portions). In some environments, spore-forming bacteria constitute small fractions of the total bacterial populations. The use of sporulation-specific primers in Q-PCR affords the ability to assess the spore-forming fraction of a bacterial population present in an environment of interest. This assessment can provide a more thorough and accurate understanding of the bacterial contamination in the environment, thereby making it possible to focus contamination- testing, contamination-prevention, sterilization, and decontamination resources more economically and efficiently. The method includes the use of sporulation-specific primers in the form of designed, optimized deoxyribonucleic acid (DNA) oligonucleotides specific for the bacterial spoIVA gene (see table). [In "spoIVA," "IV" signifies Roman numeral four and the entire quoted name refers to gene A for the fourth stage of sporulation.] These primers are mixed into a PCR cocktail with a given sample of bacterial cells. A control PCR cocktail into which are mixed universal 16S rRNA primers is also prepared. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] Following several cycles of heating and cooling according to the PCR protocol to amplify amounts of DNA molecules, the amplification products can be analyzed to determine the types of bacterial cells present within the samples. If the amplification product is strong

  16. The Fungal Spores Survival Under the Low-Temperature Plasma

    Science.gov (United States)

    Soušková, Hana; Scholtz, V.; Julák, J.; Savická, D.

    This paper presents an experimental apparatus for the decontamination and sterilization of water suspension of fungal spores. The fungicidal effect of stabilized positive and negative corona discharges on four fungal species Aspergillus oryzae, Clacosporium sphaerospermum, Penicillium crustosum and Alternaria sp. was studied. Simultaneously, the slower growing of exposed fungal spores was observed. The obtained results are substantially different in comparison with those of the analogous experiments performed with bacteria. It may be concluded that fungi are more resistant to the low-temperature plasma.

  17. Determination of fungal spore release from wet building materials

    DEFF Research Database (Denmark)

    Kildesø, J.; Wurtz, H.; Nielsen, Kristian Fog

    2003-01-01

    The release and transport of fungal spores from water-damaged building materials is a key factor for understanding the exposure to particles of fungal origin as a possible cause of adverse health effects associated to growth of fungi indoors. In this study, the release of spores from nine species...... of typical indoor fungi has been measured under controlled conditions. The fungi were cultivated for a period of 4-6 weeks on sterilized wet wallpapered gypsum boards at a relative humidity (RH) of approximately 97%. A specially designed small chamber (P-FLEC) was placed on the gypsum board. The release...

  18. Physical determinants of radiation sensitivity in bacterial spores

    International Nuclear Information System (INIS)

    Powers, E.L.

    1982-01-01

    Several factors modifying radiation sensitivity in dry bacterial spores are described and discussed. Vacuum inducing the loss of critical structural water, very low dose rates of radiation from which the cell may recover, radiations of high linear energy transfer, and the action of temperature over long periods of time on previously irradiated cells are recognized from extensive laboratory work as important in determining survival of spores exposed to low radiation doses at low temperatures for long periods of time. Some extensions of laboratory work are proposed

  19. Oral delivery of Bacillus subtilis spore expressing enolase of Clonorchis sinensis in rat model: induce systemic and local mucosal immune responses and has no side effect on liver function.

    Science.gov (United States)

    Yu, Jinyun; Chen, Tingjin; Xie, Zhizhi; Liang, Pei; Qu, Honglin; Shang, Mei; Mao, Qiang; Ning, Dan; Tang, Zeli; Shi, Mengchen; Zhou, Lina; Huang, Yan; Yu, Xinbing

    2015-07-01

    Caused by the consumption of raw or undercooked freshwater fish containing infective metacercariae of Clonorchis sinensis, human clonorchiasis remains a major public health problem in China. In previous study, we had expressed enolase from C. sinensis (CsENO) on the surface of Bacillus subtilis spore and the recombinant spore induced a pronounced protection in terms of reduced worm burden and eggs per gram feces, suggesting B. subtilis spore as an ideal vehicle for antigen delivery by oral treatment and CsENO as a promising vaccine candidate against clonorchiasis. In the current study, we detected CsENO-specific IgG and IgA levels both in serum and in intestinal mucus from rats orally administrated with B. subtilis spore surface expressing CsENO by ELISA. Lysozyme levels in serum and in intestinal mucus were analyzed too. In addition, IgA-secreting cells in intestine epithelium of the rats were detected by immunohistochemistry assay. The intestinal villi lengths of duodenum, jejunum, and ileum were also measured. Rats orally treated with B. subtilis spore or normal saline were used as controls. Our results showed that, compared with the control groups, oral administration of B. subtilis spore expressing CsENO induced both systemic and local mucosal immune response. The recombinant spores also enhanced non-specific immune response in rats. The spores had no side effect on liver function. Moreover, it might facilitate food utilization and digestion of the rats. Our work will pave the way to clarify the involved mechanisms of protective efficacy elicited by B. subtilis spore expressing CsENO and encourage us to carry out more assessment trails of the oral treated spore to develop vaccine against clonorchiasis.

  20. Effect of gamma irradiation on thermal inactivation and injury of Bacillus subtilis spores

    International Nuclear Information System (INIS)

    El-Zawahry, Y.A.; Mostafa, S.A.; Awny, N.M.

    1986-01-01

    Bacillus subtilis spores which received preliminary irradiation doses were more sensitive to subsequent heating than non-irradiated spores. The thermal inactivation increased by increasing any of exposure temperature, thermal exposure time or preliminary irradiation dose. The thermal (D T -) value was much higher for non-irradiated spores than the D TR value for the pre-thermal irradiated spores. The radiosensitizing effect was directly proportional to the preliminary irradiation dose. The pre-thermal irradiation treatment of B. subtilis spores resulted in a synergistic effect in spore deactivation. This synergistic effect increased gradually by increasing the preliminary irradiation dose and/or the thermal temperature from 60 to 80 0 C, but decreased for 90 0 C and for the longer exposure periods at any of the examined temperature. Thermal injury of B. subtilis spores was more for the non-irradiated than for the irradiated spores

  1. FORMALDEHYDE GAS INACTIVATION OF BACILLUS ANTHRACIS, BACILLUS SUBTILIS AND GEOBACILLUS STEAROTHERMOPHILUS SPORES ON INDOOR SURFACE MATERIALS.

    Science.gov (United States)

    Research evaluated the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface material using formaldehyde gas. Spores were dried on seven types of indoor surfaces and exposed to 1100 ppm formaldehyde gas for 10 hr. Fo...

  2. Influence of heat and radiation on the germinability and viability of B. cereus BIS-59 spores

    International Nuclear Information System (INIS)

    Kamat, A.S.; Lewis, N.F.

    1983-01-01

    Spores of Bicillus cereus BIS-59, isolated in this laboratory from shrimps, exhibited an exponential gamma radiation survival curve with a d 10 value of 400 krad as compared with a D 10 value of 30 krad for the vegetative cells. The D 10 value of DPA-depleted spores was also 400 krad indicating that DPA does not influence the radiation response of these spores. Maximum germination monitored with irradiated spores was 60 percent as compared with 80 percent in case of unirradiated spores. Radiation-induced inhibition of the germination processes was not dose dependent. Heat treatment (15 min at 80 C) to spores resulted in activation of the germination process; however, increase in heating time (30 min and 60 min) increased the germination lag period. DPA-depleted spores were less heat resistant than normal spores and exhibited biphasic exponential inactivation. (author)

  3. Health monitoring of plants by their emitted volatiles: A temporary increase in the concentration of nethyl salicylate after pathogen inoculation of tomato plants at greenhouse scale

    NARCIS (Netherlands)

    Jansen, R.M.C.; Hofstee, J.W.; Verstappen, F.W.A.; Bouwmeester, H.J.; Posthumus, M.A.; Henten, van E.J.

    2011-01-01

    This paper describes a method to alert growers of the presence of a pathogen infection in their greenhouse based on the detection of pathogen-induced emissions of volatile organic compounds (VOCs) from plants. Greenhouse-grown plants were inoculated with spores of a fungus to learn more about this

  4. Foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Thomas Bintsis

    2017-06-01

    Full Text Available Foodborne pathogens are causing a great number of diseases with significant effects on human health and economy. The characteristics of the most common pathogenic bacteria (Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium perfringens, Cronobacter sakazakii, Esherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Staphylococccus aureus, Vibrio spp. and Yersinia enterocolitica, viruses (Hepatitis A and Noroviruses and parasites (Cyclospora cayetanensis, Toxoplasma gondii and Trichinella spiralis, together with some important outbreaks, are reviewed. Food safety management systems based on to classical hazard-based approach has been proved to be inefficient, and risk-based food safety approach is now suggested from leading researchers and organizations. In this context, a food safety management system should be designed in a way to estimate the risks to human health from food consumption and to identify, select and implement mitigation strategies in order to control and reduce these risks. In addition, the application of suitable food safety education programs for all involved people in the production and consumption of foods is suggested.

  5. Evaluating the Sporicidal Activity of Disinfectants against Clostridium difficile and Bacillus amyloliquefaciens Spores by Using the Improved Methods Based on ASTM E2197-11.

    Science.gov (United States)

    Uwamahoro, Marie Christine; Massicotte, Richard; Hurtubise, Yves; Gagné-Bourque, François; Mafu, Akier Assanta; Yahia, L'Hocine

    2018-01-01

    Spore-forming pathogenic bacteria, such as Clostridium difficile , are associated with nosocomial infection, leading to the increased use of sporicidal disinfectants, which impacts socioeconomic costs. However, C. difficile can be prevented using microorganisms such as Bacillus amyloliquefaciens , a prophylactic agent that has been proven to be effective against it in recent tests or it can be controlled by sporicidal disinfectants. These disinfectants against spores should be evaluated according to a known and recommended standard. Unfortunately, some newly manufactured disinfectants like Bioxy products have not yet been tested. ASTM E2197-11 is a standard test that uses stainless steel disks (1 cm in diameter) as carriers, and the performance of the test formulation is calculated by comparing the number of viable test organisms to that on the control carriers. Surface tests are preferable for evaluating disinfectants with sporicidal effects on hard surfaces. This study applies improved methods, based on the ASTM E2197-11 standard, for evaluating and comparing the sporicidal efficacies of several disinfectants against spores of C. difficile and B. amyloliquefaciens , which are used as the test organisms. With the improved method, all spores were recovered through vortexing and membrane filtration. The results show that chlorine-based products are effective in 5 min and Bioxy products at 5% w/v are effective in 10 min. Although Bioxy products may take longer to prove their effectiveness, their non-harmful effects to hospital surfaces and people have been well established in the literature.

  6. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Science.gov (United States)

    2011-01-01

    Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt), we have generated Expressed Sequence Tags (ESTs) by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores) and asexual (germinated urediniospores) stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum), 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs). Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt) and stripe rust, P. striiformis f. sp. tritici (Pst), and poplar

  7. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Directory of Open Access Journals (Sweden)

    Wynhoven Brian

    2011-03-01

    Full Text Available Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt, we have generated Expressed Sequence Tags (ESTs by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores and asexual (germinated urediniospores stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum, 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs. Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt and stripe rust, P. striiformis f. sp

  8. Observations on the migration of bacillus spores outside a contaminated facility during a decontamination efficacy study

    Science.gov (United States)

    Silvestri, Erin E.; Perkins, Sarah; Lordo, Robert; Kovacik, William; Nichols, Tonya L.; Bowling, Charlena Yoder; Griffin, Dale W.; Schaefer, Frank W.

    2015-01-01

    The potential for an intentional wide-area or indoor release of Bacillus anthracis spores remains a concern, but the fate and transport of B. anthracis spores in indoor and outdoor environments are not well understood. Some studies have examined the possibility of spore transport within ventilation systems and in buildings and transport into a building following an outdoor release. Little research exists regarding the potential for spores to migrate to the outside of a building following an indoor release.

  9. Meteorological factors associated with abundance of airborne fungal spores over natural vegetation

    Science.gov (United States)

    Crandall, Sharifa G.; Gilbert, Gregory S.

    2017-08-01

    The abundance of airborne fungal spores in agricultural and urban settings increases with greater air temperature, relative humidity, or precipitation. The same meteorological factors that affect temporal patterns in spore abundance in managed environments also vary spatially across natural habitats in association with differences in vegetation structure. Here we investigated how temporal and spatial variation in aerial spore abundance is affected by abiotic (weather) and biotic (vegetation) factors as a foundation for predicting how fungi may respond to changes in weather and land-use patterns. We measured the phenology of airborne fungal spores across a mosaic of naturally occurring vegetation types at different time scales to describe (1) how spore abundance changes over time, (2) which local meteorological variables are good predictors for airborne spore density, and (3) whether spore abundance differs across vegetation types. Using an air volumetric vacuum sampler, we collected spore samples at 3-h intervals over a 120-h period in a mixed-evergreen forest and coastal prairie to measure diurnal, nocturnal, and total airborne spore abundance across vegetation types. Spore samples were also collected at weekly and monthly intervals in mixed-evergreen forest, redwood forest, and maritime chaparral vegetation types from 12 field sites across two years. We found greater airborne spore densities during the wetter winter months compared to the drier summer months. Mean total spore abundance in the mixed-evergreen forest was twice than in the coastal prairie, but there were no significant differences in total airborne spore abundance among mixed-evergreen forest, redwood forest, and maritime chaparral vegetation types. Weekly and monthly peaks in airborne spore abundance corresponded with rain events and peaks in soil moisture. Overall, temporal patterns in meteorological factors were much more important in determining airborne fungal spore abundance than the

  10. Evolution of microbial pathogens.

    OpenAIRE

    Morschhäuser, J; Köhler, G; Ziebuhr, W; Blum-Oehler, G; Dobrindt, U; Hacker, J

    2000-01-01

    Various genetic mechanisms including point mutations, genetic rearrangements and lateral gene transfer processes contribute to the evolution of microbes. Long-term processes leading to the development of new species or subspecies are termed macroevolution, and short-term developments, which occur during days or weeks, are considered as microevolution. Both processes, macro- and microevolution need horizontal gene transfer, which is particularly important for the development of pathogenic micr...

  11. Genotyping of single spore isolates of a Pasteuria penetrans population occurring in Florida using SNP-based markers.

    Science.gov (United States)

    Joseph, S; Schmidt, L M; Danquah, W B; Timper, P; Mekete, T

    2017-02-01

    To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control. © 2016 The Society for Applied Microbiology.

  12. Immunolocalization of an alternative respiratory chain in Antonospora (Paranosema) locustae spores: mitosomes retain their role in microsporidial energy metabolism.

    Science.gov (United States)

    Dolgikh, Viacheslav V; Senderskiy, Igor V; Pavlova, Olga A; Naumov, Anton M; Beznoussenko, Galina V

    2011-04-01

    Microsporidia are a group of fungus-related intracellular parasites with severely reduced metabolic machinery. They lack canonical mitochondria, a Krebs cycle, and a respiratory chain but possess genes encoding glycolysis enzymes, a glycerol phosphate shuttle, and ATP/ADP carriers to import host ATP. The recent finding of alternative oxidase genes in two clades suggests that microsporidial mitosomes may retain an alternative respiratory pathway. We expressed the fragments of mitochondrial chaperone Hsp70 (mitHsp70), mitochondrial glycerol-3-phosphate dehydrogenase (mitG3PDH), and alternative oxidase (AOX) from the microsporidium Antonospora (Paranosema) locustae in Escherichia coli. Immunoblotting with antibodies against recombinant polypeptides demonstrated specific accumulation of both metabolic enzymes in A. locustae spores. At the same time comparable amounts of mitochondrial Hsp70 were found in spores and in stages of intracellular development as well. Immunoelectron microscopy of ultrathin cryosections of spores confirmed mitosomal localization of the studied proteins. Small amounts of enzymes of an alternative respiratory chain in merogonial and early sporogonial stages, alongside their accumulation in mature spores, suggest conspicuous changes in components and functions of mitosomes during the life cycle of microsporidia and the important role of these organelles in parasite energy metabolism, at least at the final stages of sporogenesis.

  13. Induction of prophages in spores of Bacillus subtilis by ultraviolet irradiation from synchrotron orbital radiation

    Energy Technology Data Exchange (ETDEWEB)

    Sadaie, Y.; Kada, T.; Ohta, Y. (National Inst. of Genetics, Mishima, Shizuoka (Japan)); Kobayashi, K.; Hieda, K.; Ito, T.

    1984-06-01

    Prophages were induced from Bacillus subtilis spores lysogenic with SP02 by ultraviolet (160 nm to 240 nm) irradiation from synchrotron orbital radiation (SR UV). SR UV at around 220 nm was most effective in the inactivation of spores and prophage induction from lysogenic spores, suggesting that the lesions are produced on the DNA molecule which eventually induces signals to inactivate the phage repressor.

  14. Influence of food matrix on outgrowth heterogeneity of heat damaged Bacillus cereus spores

    NARCIS (Netherlands)

    Warda, A.K.; Besten, den H.M.W.; Sha, N.; Abee, T.; Nierop Groot, M.N.

    2015-01-01

    Spoilage of heat treated foods can be caused by the presence of surviving spore-formers. It is virtually impossible to prevent contamination at the primary production level as spores are ubiquitous present in the environment and can contaminate raw products. As a result spore inactivation treatments

  15. Ascoaphaera osmophila sp.nov. An Australian Spore Cyst

    DEFF Research Database (Denmark)

    Skou, Jens-Peder; King, , J.

    1984-01-01

    Ascosphaera osmophila sp. nov. is described. Septa occur often close together and remain intact when the mycelium disintegrates. A fairly good production of mature spore cysts occurs only on media containing 10% sugar or more. A. osmophila lives in association with the mason bee, Chalicodoma...

  16. Biomarkers of Aspergillus spores: Strain typing and protein identification

    Czech Academy of Sciences Publication Activity Database

    Šulc, Miroslav; Pešlová, Kateřina; Žabka, Martin; Hajdúch, M.; Havlíček, Vladimír

    2009-01-01

    Roč. 280, 1-3 (2009), s. 162-168 ISSN 1387-3806 R&D Projects: GA MŠk LC07017; GA ČR GP203/05/P575 Institutional research plan: CEZ:AV0Z50200510 Keywords : aspergillus * spore * protein Subject RIV: EE - Microbiology, Virology Impact factor: 2.117, year: 2009

  17. Increased resistance of environmental anaerobic spores to inactivation by UV

    NARCIS (Netherlands)

    Hijnen, W.A.M.; Veer, A.J. van der; Beerendonk, E.F.; Medema, Gerriet Jan

    2004-01-01

    Water Company Europoort started a pilot plant (MP)UV study to determine the UV-fluence to meet the Dutch drinking water standards. The results of large volume sampling of this pilot plant demonstrated that environmental spores of sulphite-reducing clostridia (SSRC) were highly resistant against UV.

  18. Genotoxic action of sunlight upon Bacillus subtilis spores

    International Nuclear Information System (INIS)

    Munakata, Nobuo

    1989-01-01

    Samples of Bacillus subtilis spores dried on membrane filter were exposed to natural sunlight from solar-noon time at Tokyo. The survival and mutation induction of wild-type (UVR) and repair-deficient (UVS) spores were determined on 66 occasions since 1979. Two of the values were considered to be useful in monitoring solar UV intensity; the inverse of the time (in minutes) of exposure to kill 63% of the UVS spores ('sporocidal index') and the induced mutation frequency at 60 minutes of exposure of the UVR spores ('mutagenic index'). Both values were varied greatly due to time of a year, weather and other conditions. Estimates of year-round changes under clear skies were obtained by connecting the maximum values attained in these years. In these curves, there are more than 7-fold differences in the genotoxicity between winter and summer months, with major increases observed in early spring and decreases through autumn. Using a series of UV cut-off filters, the wavelengths most effective for the sporocidal actions were estimated to be in the range of 308 - 325 nm, shorter wavelengths being effective when the genotoxicity was higher. Sunburn meter of Robertson-Berger type seems to respond to slightly longer wavelength components of the solar spectrum. However, a reasonable correlation was obtained between the reading of the meter and the sporocidal index. (author)

  19. Adhesion of Spores of Bacillus thuringiensis on a Planar Surface

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Eunhyea [Georgia Institute of Technology; Kweon, Hyojin [Georgia Institute of Technology; Yiacoumi, Sotira [Georgia Institute of Technology; Lee, Ida [University of Tennessee, Knoxville (UTK); Joy, David Charles [ORNL; Palumbo, Anthony Vito [ORNL; Tsouris, Costas [ORNL

    2010-01-01

    Adhesion of spores of Bacillus thuringiensis (Bt) and spherical silica particles on surfaces was experimentally and theoretically investigated in this study. Topography analysis via atomic force microscopy (AFM) and electron microscopy indicates that Bt spores are rod shaped, {approx}1.3 {mu}m in length and {approx}0.8 {mu}m in diameter. The adhesion force of Bt spores and silica particles on gold-coated glass was measured at various relative humidity (RH) levels by AFM. It was expected that the adhesion force would vary with RH because the individual force components contributing to the adhesion force depend on RH. The adhesion force between a particle and a planar surface in atmospheric environments was modeled as the contribution of three major force components: capillary, van der Waals, and electrostatic interaction forces. Adhesion force measurements for Bt spore (silica particle) and the gold surface system were comparable with calculations. Modeling results show that there is a critical RH value, which depends on the hydrophobicity of the materials involved, below which the water meniscus does not form and the contribution of the capillary force is zero. As RH increases, the van der Waals force decreases while the capillary force increases to a maximum value.

  20. DNA fingerprinting of spore-forming bacterial isolates, using Bacillus ...

    African Journals Online (AJOL)

    Bc-repetitive extragenic palindromic polymerase chain reaction (Bc-Rep PCR) analysis was conducted on seven Bacillus thuringiensis isolates accessed from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) culture collection and on five local isolates of entomopathogenic spore-forming bacteria.

  1. Airway inflammation among compost workers exposed to actinomycetes spores

    Directory of Open Access Journals (Sweden)

    Kari Kulvik Heldal

    2015-05-01

    Full Text Available Objectives. To study the associations between exposure to bioaerosols and work-related symptoms, lung function and biomarkers of airway inflammation in compost workers. Materials and method. Personal full-shift exposure measurements were performed on 47 workers employed at five windrow plants (n=20 and five reactor plants (n=27. Samples were analyzed for endotoxins, bacteria, fungal and actinomycetes spores. Health examinations were performed on workers and 37 controls before and after work on the day exposure was measured. The examinations included symptoms recorded by questionnaire, lung function by spirometry and nasal dimensions by acoustic rhinometry (AR. The pneumoproteins CC16, SP-D and SP-A were measured in a blood sample drawn at the end of the day. Results. The levels of endotoxins (median 3 EU/m[sup]3[/sup] , range 0–730 EU/m[sup]3[/sup] and actinomycetes spores (median 0.2 × 10[sup]6[/sup] spores/m[sup]3[/sup] , range 0–590 × 10[sup]6[/sup] spores/m[sup]3[/sup] were significantly higher in reactor plants compared to windrow plants. However, windrow composting workers reported more symptoms than reactor composting workers, probably due to use of respiratory protection. Exposure-response relationships between actinomycetes spores exposure and respiratory effects, found as cough and nose irritation during a shift, was significantly increased (OR 4.3, 95% CI 1.1–16, OR 6.1, 95% CI 1.5–25, respectively, p<0.05 among workers exposed to 0.02–0.3 × 10[sup]6[/sup] actinomycetes spores/m 3 , and FEV1/FVC% decreased cross shift (b=–3.2, SE=1.5%, p<0.01. Effects were weaker in the highest exposed group, but these workers used respiratory protection, frequently limiting their actual exposure. No relationships were found between exposure and pneumoprotein concentrations. Conclusions. The major agent in the aerosol generated at compost plants was actinomycetes spores which was associated with work related cough symptoms and work

  2. The cellulose-binding activity of the PsB multiprotein complex is required for proper assembly of the spore coat and spore viability in Dictyostelium discoideum.

    Science.gov (United States)

    Srinivasan, S; Griffiths, K R; McGuire, V; Champion, A; Williams, K L; Alexander, S

    2000-08-01

    The terminal event of spore differentiation in the cellular slime mould Dictyostelium discoideum is the assembly of the spore coat, which surrounds the dormant amoeba and allows the organism to survive during extended periods of environmental stress. The spore coat is a polarized extracellular matrix composed of glycoproteins and cellulose. The process of spore coat formation begins by the regulated secretion of spore coat proteins from the prespore vesicles (PSVs). Four of the major spore coat proteins (SP96, PsB/SP85, SP70 and SP60) exist as a preassembled multiprotein complex within the PSVs. This complete complex has an endogenous cellulose-binding activity. Mutant strains lacking either the SP96 or SP70 proteins produce partial complexes that do not have cellulose-binding activity, while mutants lacking SP60 produce a partial complex that retains this activity. Using a combination of immunofluorescence microscopy and biochemical methods we now show that the lack of cellulose-binding activity in the SP96 and SP70 mutants results in abnormally assembled spore coats and spores with greatly reduced viability. In contrast, the SP60 mutant, in which the PsB complex retains its cellulose-binding activity, produces spores with apparently unaltered structure and viability. Thus, it is the loss of the cellulose-binding activity of the PsB complex, rather than the mere loss of individual spore coat proteins, that results in compromised spore coat structure. These results support the idea that the cellulose-binding activity associated with the complete PsB complex plays an active role in the assembly of the spore coat.

  3. The Timing of cotE Expression Affects Bacillus subtilis Spore Coat Morphology but Not Lysozyme Resistance▿

    Science.gov (United States)

    Costa, Teresa; Serrano, Mónica; Steil, Leif; Völker, Uwe; Moran, Charles P.; Henriques, Adriano O.

    2007-01-01

    The synthesis of structural components and morphogenetic factors required for the assembly of the Bacillus subtilis spore coat is governed by a mother cell-specific transcriptional cascade. The first two temporal classes of gene expression, which involve RNA polymerase sigma σE factor and the ancillary regulators GerR and SpoIIID, are deployed prior to engulfment of the prespore by the mother cell. The two last classes rely on σK, whose activation follows engulfment completion, and GerE. The cotE gene codes for a morphogenetic protein essential for the assembly of the outer coat layer and spore resistance to lysozyme. cotE is expressed first from a σE-dependent promoter and, in a second stage, from a promoter that additionally requires SpoIIID and that remains active under σK control. CotE localizes prior to engulfment completion close to the surface of the developing spore, but formation of the outer coat is a late, σK-controlled event. We have transplanted cotE to progressively later classes of mother cell gene expression. This created an early class of mutants in which cotE is expressed prior to engulfment completion and a late class in which expression of cotE follows the complete engulfment of the prespore. Mutants of the early class assemble a nearly normal outer coat structure, whereas mutants of the late class do not. Hence, the early expression of CotE is essential for outer coat assembly. Surprisingly, however, all mutants were fully resistant to lysozyme. The results suggest that CotE has genetically separable functions in spore resistance to lysozyme and spore outer coat assembly. PMID:17172339

  4. Immune response induced by oral delivery of Bacillus subtilis spores expressing enolase of Clonorchis sinensis in grass carps (Ctenopharyngodon idellus).

    Science.gov (United States)

    Jiang, Hongye; Chen, Tingjin; Sun, Hengchang; Tang, Zeli; Yu, Jinyun; Lin, Zhipeng; Ren, Pengli; Zhou, Xinyi; Huang, Yan; Li, Xuerong; Yu, Xinbing

    2017-01-01

    Clonorchiasis, caused by the consumption of raw or undercooked freshwater fish containing infective metacercariae of Clonorchis sinensisis (C.sinensis), remains a common public health problem. New effective prevention strategies are still urgent to control this food-borne infectious disease. The previous studies suggested Bacillus subtilis (B. subtilis) spores was an ideal vaccines delivery system, and the C.sinensis enolase (CsENO) was a potential vaccine candidate against clonorchiasis. In the current study, we detected CsENO-specific IgM levels by ELISA in sera, intestinal mucus and skin mucus in grass carps (Ctenopharyngodon idella) through oral administration with B. subtilis spores surface expressing CsENO. In addition, immune-related genes expression was also measured by qRT-PCR. Grass carps orally treated with B. subtilis spores or normal forages were used as controls. The results of ELISA manifested that specific IgM levels of grass carps in CsENO group in sera, intestine mucus and skin mucus almost significantly increased from week 4 post the first oral administration when compared to the two control groups. The levels of specific IgM reached its peak in intestine mucus firstly, then in sera, and last in skin mucus. qRT-PCR results showed that 5 immune-related genes expression had different degree of rising trend in CsENO group when compared to the two control groups. Our study demonstrated that orally administrated with B. subtilis spores expressing CsENO induced innate and adaptive immunity, systemic and local mucosal immunity, and humoral and cellular immunity. Our work may pave the way to clarify the exact mechanisms of protective efficacy elicited by B. subtilis spores expressing CsENO and provide new ideas for vaccine development against C. sinensis infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Development and application of sequence-tagged microsatellite site (STMS) markers in chickpea (Cicer arietinum), banana (Musa spp.) and their major pathogens, Ascochyta rabiei and Mycosphaerella fijiensis

    International Nuclear Information System (INIS)

    Winter, P.; Kaemmer, D.; Paff, T.; Geistlinger, J.; Neu, C.; Kahl, G.

    2001-01-01

    DNA markers of various kinds have found widespread application in many facets of plant breeding and plant pathogen control. Yet another marker type, sequence-tagged microsatellite (STMS) markers, provides the markers of choice for nearly every crop because of their co-dominant nature, reliability, ease of application and high polymorphic information content. We report here on the development of a whole set of STMS markers and the respective, selected primer sequences for two important crops, chickpea (Cicer arietinum L.) and banana (Musa acuminata), and for their most devastating fungal pathogens, Ascochyta rabiei and Mycosphaerella fijiensis, respectively. These markers were generated either by direct screening of size-selected genomic libraries with microsatellite-complementary oligonucleotides, or by enrichment of DNA fragments containing microsatellite sequences. A total of 69 markers for chickpea, 15 markers for M. acuminata, 19 markers for A rabiei and 11 markers for M. fijiensis, selected on the basis of their high information content and ease of use are presented here. These can be applied for mapping of the respective genomes, for various population studies, and cultivar and isolate identification. We further demonstrate that several of these markers can potentially be applied across species boundaries and thus could increase the marker repertoire also for other species of the genus Cicer, Musa and for Ascochyta-type pathogens of bean, and potentially also of lentil and pea. (author)

  6. Stingless bees (Hymenoptera, Meliponini feeding on stinkhorn spores (Fungi, Phallales: robbery or dispersal?

    Directory of Open Access Journals (Sweden)

    Marcio L. Oliveira

    2000-09-01

    Full Text Available Records about stingless bee-fungi interaction are very rare. In Brazilian Amazonia, workers of Trigona crassipes (Fabricius, 1793 and Trigona fulviventris Guérin, 1835 visiting two stinkhorn species, Dictyophora sp. and Phallus sp., respectively, were observed. The workers licked the fungi gleba, a mucilaginous mass of spores covering the pileum. Neither gleba residue nor spores were found on the body surface of these bee workers. These observations indicate that these bee species include spores as a complement in their diet. On the other hand, they also suggest that these stingless bees can, at times, facilitale spore dispersal, in case intact spores are eliminated with the feces.

  7. [Distribution and spatial ordering of biopolymer molecules in resting bacterial spores].

    Science.gov (United States)

    Duda, V I; Korolev, Iu N; El'-Registan, G I; Duzha, M V; Telegin, N L

    1978-01-01

    The presence, distribution and spatial arrangement of biopolymers in situ were studied in both a total intact spore and in a certain cellular layer using a spectroscopic technique of attenuated total refraction (ATR-IR) in the IR region. In contrast to vegetative cells, intact spores were characterized by isotropic distribution of protein components. This feature can be regarded as an index of the cryptobiotic state of spores. However, the distribution of protein components among individual layers of a spore was anisotropic. Bonds characterized by amide I and amide II bands were most often ordered in a layer which comprised cellular structures from the exosporium to the inner spore membrane.

  8. Development of gold nanoparticles coated with silica containing the antibiofilm drug cinnamaldehyde and their effects on pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    Ramasamy M

    2017-04-01

    Full Text Available Mohankandhasamy Ramasamy, Jin-Hyung Lee, Jintae Lee School of Chemical Engineering, Yeungnam University, Gyeongsan, Republic of Korea Abstract: Emerging resistance to antibiotics is a mounting worldwide health concern and increases the need for nonantibiotic strategies to combat infectious diseases caused by bacterial pathogens. In this study, the authors used the antibiofilm activity of the naturally occurring antimicrobial cinnamaldehyde (CNMA conjugated to the surface of gold nanoparticles (GNPs to deliver CNMA efficiently and eradicate biofilms of Gram-negative organisms (enterohemorrhagic Escherichia coli O157:H7, and Pseudomonas aeruginosa, Gram positive (methicillin-sensitive Staphylococcus aureus organisms, and methicillin-resistant Staphylococcus aureus bacteria. CNMA-GNPs containing 0.005% (v/v of CNMA were found to inhibit biofilm formation efficiently. The distributions of nanoparticles in biofilm cells and their biofilm disruption activities, including distorted cell morphology, were determined by transmission electron microscopy. In addition to their antibiofilm activities, CNMA-GNPs attenuated S. aureus virulence and protected Caenorhabditis elegans (C. elegans worms. Here, the authors report the antibiofilm effects of CNMA-GNPs and suggest that they could be used to treat pathogenic bacterial infections in vivo. Keywords: antibiofilm, biocompatible, Caenorhabditis elegans, cinnamaldehyde, gold nanoparticles, Staphylococcus aureus

  9. Gene expression profiling during asexual development of the late blight pathogen Phytophthora infestans reveals a highly dynamic transcriptome.

    Science.gov (United States)

    Judelson, Howard S; Ah-Fong, Audrey M V; Aux, George; Avrova, Anna O; Bruce, Catherine; Cakir, Cahid; da Cunha, Luis; Grenville-Briggs, Laura; Latijnhouwers, Maita; Ligterink, Wilco; Meijer, Harold J G; Roberts, Samuel; Thurber, Carrie S; Whisson, Stephen C; Birch, Paul R J; Govers, Francine; Kamoun, Sophien; van West, Pieter; Windass, John

    2008-04-01

    Much of the pathogenic success of Phytophthora infestans, the potato and tomato late blight agent, relies on its ability to generate from mycelia large amounts of sporangia, which release zoospores that encyst and form infection structures. To better understand these stages, Affymetrix GeneChips based on 15,650 unigenes were designed and used to profile the life cycle. Approximately half of P. infestans genes were found to exhibit significant differential expression between developmental transitions, with approximately (1)/(10) being stage-specific and most changes occurring during zoosporogenesis. Quantitative reverse-transcription polymerase chain reaction assays confirmed the robustness of the array results and showed that similar patterns of differential expression were obtained regardless of whether hyphae were from laboratory media or infected tomato. Differentially expressed genes encode potential cellular regulators, especially protein kinases; metabolic enzymes such as those involved in glycolysis, gluconeogenesis, or the biosynthesis of amino acids or lipids; regulators of DNA synthesis; structural proteins, including predicted flagellar proteins; and pathogenicity factors, including cell-wall-degrading enzymes, RXLR effector proteins, and enzymes protecting against plant defense responses. Curiously, some stage-specific transcripts do not appear to encode functional proteins. These findings reveal many new aspects of oomycete biology, as well as potential targets for crop protection chemicals.

  10. Differentiation of the emerging human pathogens Trichosporon asahii and Trichosporon asteroides from other pathogenic yeasts and moulds by using species-specific monoclonal antibodies.

    Directory of Open Access Journals (Sweden)

    Genna E Davies

    Full Text Available The fungal genus Trichosporon contains emerging opportunistic pathogens of humans, and is the third most commonly isolated non-candidal yeast from humans. Trichosporon asahii and T. asteroides are the most important species causing disseminated disease in immunocompromised patients, while inhalation of T. asahii spores is the most important cause of summer-type hypersensitivity pneumonitis in healthy individuals. Trichosporonosis is misdiagnosed as candidiasis or cryptococcosis due to a lack of awareness and the ambiguity of diagnostic tests for these pathogens. In this study, hybridoma technology was used to produce two murine monoclonal antibodies (MAbs, CA7 and TH1, for detection and differentiation of Trichosporon from other human pathogenic yeasts and moulds. The MAbs react with extracellular antigens from T. asahii and T. asteroides, but do not recognise other related Trichosporon spp., or unrelated pathogenic yeasts and moulds including Candida, Cryptococcus, Aspergillus, Fusarium, and Scedosporium spp., or the etiologic agents of mucormycosis. Immunofluorescence and Western blotting studies show that MAb CA7, an immunoglobulin G1 (IgG1, binds to a major 60 kDa glycoprotein antigen produced on the surface of hyphae, while TH1, an immunoglobulin M (IgM, binds to an antigen produced on the surface of conidia. The MAbs were used in combination with a standard mycological growth medium (Sabouraud Dextrose Agar to develop an enzyme-linked immunosorbent assay (ELISA for differentiation of T. asahii from Candida albicans and Cryptococcus neoformans in single and mixed species cultures. The MAbs represent a major advance in the identification of T. asahii and T. asteroides using standard mycological identification methods.

  11. Effect oof some antibiotics, disinfectants, and UV light on vability of vegetative cells and spores of C1. perfringend type A

    International Nuclear Information System (INIS)

    Rymkiewicz, D.

    1977-01-01

    Cells and spores of 40 strains of C1. perfringens type A, pathogenic for guinea pigs, were tested for resistance to antibiotics, drugs, disinfectants used in surgery and in bacteriological laboratories, and UV light. No correlation was found between thermoresistance of spores and their resistance to other bactericidal agents. Among the common disinfectants, iodine solution showed strong bactericidal and sporostatic activity. Good bactericidal effect was also obtained by combined action of Vescodin and UV light. Drug resistance of C1. perfringens type A strains changed clearly in the past 10 years. Strains inducing gangrene became resistant to penicillin and tetracyclines, which hitherto were commonly applied. Ampicilin can now be recommended, as the antibiotic with strong bactericidal and sporostatic action. (author)

  12. Inactivation of Bacillus subtilis spores by high pressure CO2 with high temperature.

    Science.gov (United States)

    Rao, Lei; Xu, Zhenzhen; Wang, Yongtao; Zhao, Feng; Hu, Xiaosong; Liao, Xiaojun

    2015-07-16

    The objective of this study was to investigate the inactivation of the Bacillus subtilis spores by high pressure CO2 combined with high temperature (HPCD+HT) and to analyze the clumping effect of the spores on their HPCD+HT resistance. The spores of B. subtilis were subjected to heat at 0.1 MPa and HPCD at 6.5-25 MPa, and 82 °C, 86 °C, and 91 °C for 0-120 min. The spores were effectively inactivated by HPCD+HT, but a protective effect on the spores was also found, which was closely correlated to the pressure, temperature and time. The spores treated by HPCD+HT at 6.5 and 10 MPa exhibited a two-stage inactivation curve of shoulder and log-linear regions whereas the spores at 15-25 MPa exhibited a three-stage inactivation curve of shoulder, log-linear and tailing regions, and these curves were well fitted to the Geeraerd model. Approximately 90% of pyridine-2,6-dicarboxylic acid (DPA) was released after HPCD+HT and the 90% DPA release time depend on the pressure and temperature. Moreover, the spore clumping in suspensions was examined by dynamic light scattering. The particle size of the spore suspensions increased with the increase of pressure, temperature and time, indicating the spore clumping. 0.1% Tween 80 as a surfactant inhibited the spore clumping and increased the inactivation ratio of the spores by HPCD+HT. These results indicated that the spore clumping enhanced the spores' resistance to HPCD+HT and induced a protective effect. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Three promising fungal strains pathogenic to fruit flies

    Energy Technology Data Exchange (ETDEWEB)

    Jiji, T.; Praveena, R.; Babu, Kavitha; Naseema, A.; Anitha, N. [College of Agriculture, Kerala (India)

    2006-07-01

    Pathogenicity of the fungi Paecilomyces lilacinus, isolated from Bactrocera cucurbitae, and Aspergillus candidus, isolated from B. dorsalis, was tested. Cross infectivity of P. lilacinus on B. dorsalis and A. candidus on B. cucurbitae and cross infectivity of a local isolate of B. bassiana from bhindi leaf roller (Sylepta derogata) on fruit flies (B. cucurbitae and B. dorsalis ) were also studied. These fungi were new records in these hosts. P. lilacinus at 109 spores / ml caused 96.67% and 100 % cumulative mortality in fruit flies on the second and on the third days. LC50 values of P. lilacinus on B. cucurbitae were 5.0 x 106, 8.0 x 105, 7.0 x 105 spores/ ml on second, third and fourth day, respectively. The fungus was found to cross infect B. dorsalis. LC50 values of A. candidus on B. cucurbitae were 1.29 x 108, 1.22 x 107, 2.27 x 106 spores / ml on third, fourth and fifth day, respectively. The fungus was found to be cross infective to B. cucurbitae. B. bassiana at 109 spores/ ml on B. dorsalis was found to cause 70%, 80% and 90% mortality on fourth, fifth and sixth day. LC50 values of B. bassiana on B. dorsalis were 7.0 x 108, 2.0 x 107, 5.0 x 106 spores/ ml on third, fourth and fifth day ,respectively . Formulation of P. lilacinus as wettable powder and granules and B. bassiana as wettable powder, were also prepared and their efficacy was tested on hosts. (author)

  14. Three promising fungal strains pathogenic to fruit flies

    International Nuclear Information System (INIS)

    Jiji, T.; Praveena, R.; Babu, Kavitha; Naseema, A.; Anitha, N.

    2006-01-01

    Pathogenicity of the fungi Paecilomyces lilacinus, isolated from Bactrocera cucurbitae, and Aspergillus candidus, isolated from B. dorsalis, was tested. Cross infectivity of P. lilacinus on B. dorsalis and A. candidus on B. cucurbitae and cross infectivity of a local isolate of B. bassiana from bhindi leaf roller (Sylepta derogata) on fruit flies (B. cucurbitae and B. dorsalis ) were also studied. These fungi were new records in these hosts. P. lilacinus at 109 spores / ml caused 96.67% and 100 % cumulative mortality in fruit flies on the second and on the third days. LC50 values of P. lilacinus on B. cucurbitae were 5.0 x 106, 8.0 x 105, 7.0 x 105 spores/ ml on second, third and fourth day, respectively. The fungus was found to cross infect B. dorsalis. LC50 values of A. candidus on B. cucurbitae were 1.29 x 108, 1.22 x 107, 2.27 x 106 spores / ml on third, fourth and fifth day, respectively. The fungus was found to be cross infective to B. cucurbitae. B. bassiana at 109 spores/ ml on B. dorsalis was found to cause 70%, 80% and 90% mortality on fourth, fifth and sixth day. LC50 values of B. bassiana on B. dorsalis were 7.0 x 108, 2.0 x 107, 5.0 x 106 spores/ ml on third, fourth and fifth day ,respectively . Formulation of P. lilacinus as wettable powder and granules and B. bassiana as wettable powder, were also prepared and their efficacy was tested on hosts. (author)

  15. The WOPR Protein Ros1 Is a Master Regulator of Sporogenesis and Late Effector Gene Expression in the Maize Pathogen Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Marie Tollot

    2016-06-01

    Full Text Available The biotrophic basidiomycete fungus Ustilago maydis causes smut disease in maize. Hallmarks of the disease are large tumors that develop on all aerial parts of the host in which dark pigmented teliospores are formed. We have identified a member of the WOPR family of transcription factors, Ros1, as major regulator of spore formation in U. maydis. ros1 expression is induced only late during infection and hence Ros1 is neither involved in plant colonization of dikaryotic fungal hyphae nor in plant tumor formation. However, during late stages of infection Ros1 is essential for fungal karyogamy, massive proliferation of diploid fungal cells and spore formation. Premature expression of ros1 revealed that Ros1 counteracts the b-dependent filamentation program and induces morphological alterations resembling the early steps of sporogenesis. Transcriptional profiling and ChIP-seq analyses uncovered that Ros1 remodels expression of about 30% of all U. maydis genes with 40% of these being direct targets. In total the expression of 80 transcription factor genes is controlled by Ros1. Four of the upregulated transcription factor genes were deleted and two of the mutants were affected in spore development. A large number of b-dependent genes were differentially regulated by Ros1, suggesting substantial changes in this regulatory cascade that controls filamentation and pathogenic development. Interestingly, 128 genes encoding secreted effectors involved in the establishment of biotrophic development were downregulated by Ros1 while a set of 70 "late effectors" was upregulated. These results indicate that Ros1 is a master regulator of late development in U. maydis and show that the biotrophic interaction during sporogenesis involves a drastic shift in expression of the fungal effectome including the downregulation of effectors that are essential during early stages of infection.

  16. Global transcriptome analysis of spore formation in Myxococcus xanthus reveals a locus necessary for cell differentiation

    Directory of Open Access Journals (Sweden)

    Treuner-Lange Anke

    2010-04-01

    Full Text Available Abstract Background Myxococcus xanthus is a Gram negative bacterium that can differentiate into metabolically quiescent, environmentally resistant spores. Little is known about the mechanisms involved in differentiation in part because sporulation is normally initiated at the culmination of a complex starvation-induced developmental program and only inside multicellular fruiting bodies. To obtain a broad overview of the sporulation process and to identify novel genes necessary for differentiation, we instead performed global transcriptome analysis of an artificial chemically-induced sporulation process in which addition of glycerol to vegetatively growing liquid cultures of M. xanthus leads to rapid and synchronized differentiation of nearly all cells into myxospore-like entities. Results Our analyses identified 1 486 genes whose expression was significantly regulated at least two-fold within four hours of chemical-induced differentiation. Most of the previously identified sporulation marker genes were significantly upregulated. In contrast, most genes that are required to build starvation-induced multicellular fruiting bodies, but which are not required for sporulation per se, were not significantly regulated in our analysis. Analysis of functional gene categories significantly over-represented in the regulated genes, suggested large rearrangements in core metabolic pathways, and in genes involved in protein synthesis and fate. We used the microarray data to identify a novel operon of eight genes that, when mutated, rendered cells unable to produce viable chemical- or starvation-induced spores. Importantly, these mutants displayed no defects in building fruiting bodies, suggesting these genes are necessary for the core sporulation process. Furthermore, during the starvation-induced developmental program, these genes were expressed in fruiting bodies but not in peripheral rods, a subpopulation of developing cells which do not sporulate

  17. Dynamic Predictive Model for Growth of Bacillus cereus from Spores in Cooked Beans.

    Science.gov (United States)

    Juneja, Vijay K; Mishra, Abhinav; Pradhan, Abani K

    2018-02-01

    Kinetic growth data for Bacillus cereus grown from spores were collected in cooked beans under several isothermal conditions (10 to 49°C). Samples were inoculated with approximately 2 log CFU/g heat-shocked (80°C for 10 min) spores and stored at isothermal temperatures. B. cereus populations were determined at appropriate intervals by plating on mannitol-egg yolk-polymyxin agar and incubating at 30°C for 24 h. Data were fitted into Baranyi, Huang, modified Gompertz, and three-phase linear primary growth models. All four models were fitted to the experimental growth data collected at 13 to 46°C. Performances of these models were evaluated based on accuracy and bias factors, the coefficient of determination ( R 2 ), and the root mean square error. Based on these criteria, the Baranyi model best described the growth data, followed by the Huang, modified Gompertz, and three-phase linear models. The maximum growth rates of each primary model were fitted as a function of temperature using the modified Ratkowsky model. The high R 2 values (0.95 to 0.98) indicate that the modified Ratkowsky model can be used to describe the effect of temperature on the growth rates for all four primary models. The acceptable prediction zone (APZ) approach also was used for validation of the model with observed data collected during single and two-step dynamic cooling temperature protocols. When the predictions using the Baranyi model were compared with the observed data using the APZ analysis, all 24 observations for the exponential single rate cooling were within the APZ, which was set between -0.5 and 1 log CFU/g; 26 of 28 predictions for the two-step cooling profiles also were within the APZ limits. The developed dynamic model can be used to predict potential B. cereus growth from spores in beans under various temperature conditions or during extended chilling of cooked beans.

  18. Evaluation of Various Cleaning Methods to Remove Bacillus Spores from Spacecraft Hardware Materials

    Science.gov (United States)

    Venkateswaran, Kasthuri; Chung, Shirley; Allton, Judith; Kern, Roger

    2004-09-01

    A detailed study was made of the biological cleaning effectiveness, defined in terms of the ability to remove bacterial spores, of a number of methods used to clean hardware surfaces. Aluminum (Al 6061) and titanium (Ti 6Al-4V) were chosen for the study as they were deemed the two materials most likely to be used in spacecraft extraterrestrial sampler construction. Metal coupons (1 cm × 2.5 cm) were precleaned and inoculated with 5.8 × 103 cultivable Bacillus subtilis spores, which are commonly found on spacecraft surfaces and in the assembly environments. The inoculated coupons were subsequently cleaned using: (1) 70% isopropyl alcohol wipe; (2) water wipe; (3) multiple-solvent flight-hardware cleaning procedures used at the Jet Propulsion Laboratory (JPL); (4) Johnson Space Center-developed ultrapure water rinse; and (5) a commercial, semi-aqueous, multiple-solvent (SAMS) cleaning process. The biological cleaning effectiveness was measured by agar plate assay, sterility test (growing in liquid media), and epifluorescent microscopy. None of the cleaning protocols tested completely removed viable spores from the surface of the aluminum. In contrast, titanium was capable of being cleaned to sterility by two methods, the JPL standard and the commercial SAMS cleaning process. Further investigation showed that the passivation step employed in the JPL standard method is an effective surface sterilant on both metals but not compatible with aluminum. It is recommended that titanium (Ti 6Al-4V) be considered superior to aluminum (Al 6061) for use in spacecraft sampling hardware, both for its potential to be cleaned to sterilization and for its ability to withstand the most effective cleaning protocols.

  19. Development of Loop-Mediated Isothermal Amplification (LAMP) assay for rapid detection of Fusarium oxysporum f. sp. ciceris - wilt pathogen of chickpea.

    Science.gov (United States)

    Ghosh, Raju; Nagavardhini, Avuthu; Sengupta, Anindita; Sharma, Mamta

    2015-02-11

    Fusarium oxysporum f. sp. ciceris (Foc), the causal agent of Fusarium wilt is a devastating pathogen of chickpea. In chickpea, various soil borne pathogens produce (s) similar symptoms, therefore cannot be distinguished easily at field level. There is real need for a rapid, inexpensive, and easy to operate and maintain genotyping tool to facilitate accurate disease diagnosis and surveillance for better management of Fusarium wilt outbreaks. In this study, we developed a loop-mediated isothermal amplification (LAMP) assay targeting the elongation factor 1 alpha gene sequence for visual detection of Foc. The LAMP reaction was optimal at 63°C for 60 min. When hydroxynaphthol blue (HNB) was added before amplification, samples with Foc DNA developed a characteristic sky blue colour but those without DNA or with the DNA of six other plant pathogenic fungi did not. Results obtained with LAMP and HNB were confirmed when LAMP products were subjected to gel electrophoresis. The detection limit of this LAMP assay for Foc was 10 fg of genomic DNA per reaction, while that of conventional PCR was 100 pg. In conclusion, it was found that a LAMP assay combined with HNB is simple, rapid, sensitive, and specific. The LAMP assay does not require specialized equipment, hence can be used in the field for the rapid detection of Foc. This is the first report of the use of LAMP assay for the detection of Foc. The presented LAMP method provides a specific, sensitive and rapid diagnostic tool for the distinction of Foc, with the potential to be standardized as a detection method for Foc in endemic areas and will be very useful for monitoring the disease complex in the field further suggesting the management strategies.

  20. Biocidal Energetic Materials for the Destruction of Spore Forming Bacteria

    Science.gov (United States)

    2015-07-01

    agent (GA). During a reaction the GA generates nucleation sites that promote the formation of bubbles. As the reaction wave passes, the gas pockets...studies have shown iodine producing reactive materials are effective against spore forming bacteria, but are sensitive to the relative humidity in the...testing environment. Results from tests run in relative high humidity environments show a decreased ability of iodine to effectively neutralize

  1. Modeling Radiation Effectiveness for Inactivation of Bacillus Spores

    Science.gov (United States)

    2015-09-17

    radiation . 3.6.1 Ionizing Radiation Damage. Some of the ROS’ discussed in Section 3.3 cause indirect damage to the spore’s DNA. They can produce... ionizing radiation damage has focused on the effects of charged particles in their tracks. The charged particles create radiation - induced products and...3.8.1 Reaction-Diffusion of ROS Within the Spore. A demonstrative scenario will be explored in order to simulate the indirect effects of ionizing

  2. 14C Analysis of protein extracts from Bacillus spores.

    Science.gov (United States)

    Cappuccio, Jenny A; Falso, Miranda J Sarachine; Kashgarian, Michaele; Buchholz, Bruce A

    2014-07-01

    Investigators of bioagent incidents or interdicted materials need validated, independent analytical methods that will allow them to distinguish between recently made bioagent samples versus material drawn from the archives of a historical program. Heterotrophic bacteria convert the carbon in their food sources, growth substrate or culture media, into the biomolecules they need. The F(14)C (fraction modern radiocarbon) of a variety of media, Bacillus spores, and separated proteins from Bacillus spores was measured by accelerator mass spectrometry (AMS). AMS precisely measures F(14)C values of biological materials and has been used to date the synthesis of biomaterials over the bomb pulse era (1955 to present). The F(14)C of Bacillus spores reflects the radiocarbon content of the media in which they were grown. In a survey of commercial media we found that the F(14)C value indicated that carbon sources for the media were alive within about a year of the date of manufacture and generally of terrestrial origin. Hence, bacteria and their products can be dated using their (14)C signature. Bacillus spore samples were generated onsite with defined media and carbon free purification and also obtained from archived material. Using mechanical lysis and a variety of washes with carbon free acids and bases, contaminant carbon was removed from soluble proteins to enable accurate (14)C bomb-pulse dating. Since media is contemporary, (14)C bomb-pulse dating of isolated soluble proteins can be used to distinguish between historical archives of bioagents and those produced from recent media. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  3. Antitumor effects and mechanisms of Ganoderma extracts and spores oil

    OpenAIRE

    Chen, Chun; Li, Peng; Li, Ye; Yao, Guan; Xu, Jian-Hua

    2016-01-01

    Ganoderma lucidum is a popular herbal medicine used in China to promote health. Modern studies have disclosed that the active ingredients of Ganoderma can exhibit several effects, including antitumor effects and immunomodulation. The present study evaluated the antitumor effects of self-prepared Ganoderma extracts and spores oil, and investigated the possible underlying mechanisms by observing the effects of the extracts and oil on topoisomerases and the cell cycle. The results showed that Ga...

  4. Bacterial Spores Survive Treatment with Commercial Sterilants and Disinfectants

    OpenAIRE

    Sagripanti, Jose-Luis; Bonifacino, Aylin

    1999-01-01

    This study compared the activity of commercial liquid sterilants and disinfectants on Bacillus subtilis spores deposited on three types of devices made of noncorrodible, corrodible, or polymeric material. Products like Renalin, Exspor, Wavicide-01, Cidexplus, and cupric ascorbate were tested under conditions specified for liquid sterilization. These products, at the shorter times indicated for disinfection, and popular disinfectants, like Clorox, Cavicide, and Lysol were also studied. Data ob...

  5. Sorption of 241Am by Aspergillus niger spore and hyphae

    International Nuclear Information System (INIS)

    Yuanyou Yang; Ning Liu; Jiali Liao; Jiannan Jin; Shunzhong Luo; Taiming Zhang; Pengji Zhao

    2004-01-01

    Biosorption of 241 Am by a fungus A. niger, including the spore and hyphae, was investigated. The preliminary results showed that the adsorption of 241 Am by the microorganism was efficient. More than 96% of the total 241 Am could be removed from 241 Am solutions of 5.6-111 MBq/l (C 0 ) by spore and hyphae of A. niger, with adsorbed 241 Am metal (Q) of 7.2-142.4 MBq/g biomass, and 5.2-106.5 MBq/g, respectively. The biosorption equilibrium was achieved within 1 hour and the optimum pH range was pH 1-3. No obvious effects on 241 Am adsorption by the fungus were observed at 10-45 deg C, or in solutions containing Au 3+ or Ag + , even 2000 times above the 241 Am concentration. The 241 Am biosorption by the fungus obeys the Freundlich adsorption equation. There was no significant difference between the adsorption behavior of A. niger spore and hyphae. (author)

  6. Arrhenius reconsidered: astrophysical jets and the spread of spores

    Science.gov (United States)

    Sheldon, Malkah I.; Sheldon, Robert B.

    2015-09-01

    In 1871, Lord Kelvin suggested that the fossil record could be an account of bacterial arrivals on comets. In 1903, Svante Arrhenius suggested that spores could be transported on stellar winds without comets. In 1984, Sir Fred Hoyle claimed to see the infrared signature of vast clouds of dried bacteria and diatoms. In 2012, the Polonnaruwa carbonaceous chondrite revealed fossilized diatoms apparently living on a comet. However, Arrhenius' spores were thought to perish in the long transit between stars. Those calculations, however, assume that maximum velocities are limited by solar winds to ~5 km/s. Herbig-Haro objects and T-Tauri stars, however, are young stars with jets of several 100 km/s that might provide the necessary propulsion. The central engine of bipolar astrophysical jets is not presently understood, but we argue it is a kinetic plasma instability of a charged central magnetic body. We show how to make a bipolar jet in a belljar. The instability is non-linear, and thus very robust to scaling laws that map from microquasars to active galactic nuclei. We scale up to stellar sizes and recalculate the viability/transit-time for spores carried by supersonic jets, to show the viability of the Arrhenius mechanism.

  7. Fungal spores overwhelm biogenic organic aerosols in a midlatitudinal forest

    Directory of Open Access Journals (Sweden)

    C. Zhu

    2016-06-01

    Full Text Available Both primary biological aerosol particles (PBAPs and oxidation products of biogenic volatile organic compounds (BVOCs contribute significantly to organic aerosols (OAs in forested regions. However, little is known about their relative importance in diurnal timescales. Here, we report biomarkers of PBAP and secondary organic aerosols (SOAs for their diurnal variability in a temperate coniferous forest in Wakayama, Japan. Tracers of fungal spores, trehalose, arabitol and mannitol, showed significantly higher levels in nighttime than daytime (p < 0.05, resulting from the nocturnal sporulation under near-saturated relative humidity. On the contrary, BVOC oxidation products showed higher levels in daytime than nighttime, indicating substantial photochemical SOA formation. Using tracer-based methods, we estimated that fungal spores account for 45 % of organic carbon (OC in nighttime and 22 % in daytime, whereas BVOC oxidation products account for 15 and 19 %, respectively. To our knowledge, we present for the first time highly time-resolved results that fungal spores overwhelmed BVOC oxidation products in contributing to OA especially in nighttime. This study emphasizes the importance of both PBAPs and SOAs in forming forest organic aerosols.

  8. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  9. Emerging Pathogens Initiative (EPI)

    Data.gov (United States)

    Department of Veterans Affairs — The Emerging Pathogens Initiative (EPI) database contains emerging pathogens information from the local Veterans Affairs Medical Centers (VAMCs). The EPI software...

  10. Predicting Bacillus coagulans spores inactivation in tomato pulp under nonisothermal heat treatments.

    Science.gov (United States)

    Zimmermann, Morgana; Longhi, Daniel A; Schaffner, Donald W; Aragão, Gláucia M F

    2014-05-01

    The knowledge and understanding of Bacillus coagulans inactivation during a thermal treatment in tomato pulp, as well as the influence of temperature variation during thermal processes are essential for design, calculation, and optimization of the process. The aims of this work were to predict B. coagulans spores inactivation in tomato pulp under varying time-temperature profiles with Gompertz-inspired inactivation model and to validate the model's predictions by comparing the predicted values with experimental data. B. coagulans spores in pH 4.3 tomato pulp at 4 °Brix were sealed in capillary glass tubes and heated in thermostatically controlled circulating oil baths. Seven different nonisothermal profiles in the range from 95 to 105 °C were studied. Predicted inactivation kinetics showed similar behavior to experimentally observed inactivation curves when the samples were exposed to temperatures in the upper range of this study (99 to 105 °C). Profiles that resulted in less accurate predictions were those where the range of temperatures analyzed were comparatively lower (inactivation profiles starting at 95 °C). The link between fail prediction and both lower starting temperature and magnitude of the temperature shift suggests some chemical or biological mechanism at work. Statistical analysis showed that overall model predictions were acceptable, with bias factors from 0.781 to 1.012, and accuracy factors from 1.049 to 1.351, and confirm that the models used were adequate to estimate B. coagulans spores inactivation under fluctuating temperature conditions in the range from 95 to 105 °C. How can we estimate Bacillus coagulans inactivation during sudden temperature shifts in heat processing? This article provides a validated model that can be used to predict B. coagulans under changing temperature conditions. B. coagulans is a spore-forming bacillus that spoils acidified food products. The mathematical model developed here can be used to predict the spoilage

  11. Development and Validation of a Multiplex PCR-Based Assay for the Upper Respiratory Tract Bacterial Pathogens Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis.

    Science.gov (United States)

    Post; White; Aul; Zavoral; Wadowsky; Zhang; Preston; Ehrlich

    1996-06-01

    Background: Conventional simplex polymerase chain reaction (PCR)-based assays are limited in that they only provide for the detection of a single infectious agent. Many clinical diseases, however, present in a nonspecific, or syndromic, fashion, thereby necessitating the simultaneous assessment of multiple pathogens. Panel-based molecular diagnostic testing can be accomplished by the development of multiplex PCR-based assays, which can detect, individually or severally, different pathogens that are associated with syndromic illness. As part of a larger program of panel development, an assay that can simultaneously detect Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis was developed. These organisms were chosen as they are the most common bacterial pathogens associated with both the acute and chronic forms of otitis media; they are also responsible for a high percentage of sinus infections in both children and adults. In addition, H. influenzae and S. pneumoniae are commonly associated with septic meningitits. Methods and Results: Multiple individual PCR-based assays were developed for each of the three target organisms which were then evaluated for sensitivity and specificity. Utilizing the simplex assays that met our designated performance criteria, a matrix style approach was used to develop a duplex H. influenzae-S. pneumoniae assay. The duplex assay was then used as a single component in the development of a triplex assay, wherein the various M. catarrhalis primer-probe sets were tested for compatibility with the existing assay. A single-step PCR protocol, with species-specific primers for each of the three target organisms and a liquid hybridization-gel retardation amplimer detection system, was developed, which amplifies and then discriminates among each of the amplification products according to size. This assay is able to detect all three organisms in a specific manner, either individually or severally. Dilutional experiments

  12. The role of heat resistance in thermorestoration of hydrated bacterial spores

    International Nuclear Information System (INIS)

    Friedman, Y.S.; Grecz, N.

    1973-01-01

    This study for the first time presents evidence of the distinct role played in thermorestoration by cellular determinants such as the resistance to heat and radiation, and the ionic state of spores. In the past only radiochemical determinants associated with radical annealment have been studied in hydrated systems. The basic heat resistance of spores plays a significant role in the precipitous drop in spore survival due to 0.45 Mrad radiation plus heat above 65-75 0 C for B.cereus and 75-95 0 C for B.stearothermophilus. The effect of the spores radiation resistance was not distinct except in the frozen state and at the saturation plateau of thermorestoration where the radiation resistant B.cereus showed ca. 1 log cycle higher survival than the radiation sensitive B.stearothermophilus. When spores are chemically converted into their H + and Ca ++ ionic forms, the H + spores are distinctly more responsive than Ca ++ spores to processes of radical annealment responsible for thermorestoration in hydrated spore systems. At temperatures of extensive thermorestoration of water radicals, H + spores showed higher survival than Ca ++ spores. (F.J.)

  13. Significance of air humidity and air velocity for fungal spore release into the air

    Science.gov (United States)

    Pasanen, A.-L.; Pasanen, P.; Jantunen, M. J.; Kalliokoski, P.

    Our previous field studies have shown that the presence of molds in buildings does not necessarily mean elevated airborne spore counts. Therefore, we investigated the release of fungal spores from cultures of Aspergillus fumigatus, Penicillium sp. and Cladosporium sp. at different air velocities and air humidities. Spores of A. fumigatus and Penicillium sp. were released from conidiophores already at air velocity of 0.5 ms -1, whereas Cladosporium spores required at least a velocity of 1.0 ms -1. Airborne spore counts of A. fumigatus and Penicillium sp. were usually higher in dry than moist air, being minimal at relative humidities (r.h.) above 70%, while the effect of r.h. on the release of Cladosporium sp. was ambivalent. The geometric mean diameter of released spores increased when the r.h. exceeded a certain level which depends on fungal genus. Thus, spores of all three fungi were hygroscopic but the hygroscopicity of various spores appeared at different r.h.-ranges. This study indicates that spore release is controlled by external factors and depends on fungal genus which can be one reason for considerable variation of airborne spore counts in buildings with mold problems.

  14. Genome size variation in the pine fusiform rust pathogen Cronartium quercuum f.sp. fusiforme as determined by flow cytometry

    Science.gov (United States)

    Claire L Anderson; Thomas L Kubisiak; C Dana Nelson; Jason A Smith; John M Davis

    2010-01-01

    The genome size of the pine fusiform rust pathogen Cronartium quercuum f.sp. fusiforme (Cqf) was determined by flow cytometric analysis of propidium iodide-stained, intact haploid pycniospores with haploid spores of two genetically well characterized fungal species, Sclerotinia sclerotiorum and Puccinia graminis f.sp. tritici, as size standards. The Cqf haploid genome...