WorldWideScience

Sample records for spore development pathogenicity

  1. Validated modified Lycopodium spore method development for ...

    African Journals Online (AJOL)

    Validated modified lycopodium spore method has been developed for simple and rapid quantification of herbal powdered drugs. Lycopodium spore method was performed on ingredients of Shatavaryadi churna, an ayurvedic formulation used as immunomodulator, galactagogue, aphrodisiac and rejuvenator. Estimation of ...

  2. Large-spored Alternaria pathogens in section Porri disentangled

    Science.gov (United States)

    Woudenberg, J.H.C.; Truter, M.; Groenewald, J.Z.; Crous, P.W.

    2014-01-01

    The omnipresent fungal genus Alternaria was recently divided into 24 sections based on molecular and morphological data. Alternaria sect. Porri is the largest section, containing almost all Alternaria species with medium to large conidia and long beaks, some of which are important plant pathogens (e.g. Alternaria porri, A. solani and A. tomatophila). We constructed a multi-gene phylogeny on parts of the ITS, GAPDH, RPB2, TEF1 and Alt a 1 gene regions, which, supplemented with morphological and cultural studies, forms the basis for species recognition in sect. Porri. Our data reveal 63 species, of which 10 are newly described in sect. Porri, and 27 species names are synonymised. The three known Alternaria pathogens causing early blight on tomato all cluster in one clade, and are synonymised under the older name, A. linariae. Alternaria protenta, a species formerly only known as pathogen on Helianthus annuus, is also reported to cause early blight of potato, together with A. solani and A. grandis. Two clades with isolates causing purple blotch of onion are confirmed as A. allii and A. porri, but the two species cannot adequately be distinguished based on the number of beaks and branches as suggested previously. This is also found among the pathogens of Passifloraceae, which are reduced from four to three species. In addition to the known pathogen of sweet potato, A. bataticola, three more species are delineated of which two are newly described. A new Alternaria section is also described, comprising two large-spored Alternaria species with concatenate conidia. PMID:25492985

  3. Large-spored Alternaria pathogens in section Porri disentangled

    NARCIS (Netherlands)

    Woudenberg, J.H.C.; Truter, M.; Groenewald, J.Z.; Crous, P.W.

    2014-01-01

    The omnipresent fungal genus Alternaria was recently divided into 24 sections based on molecular and morphological data. Alternaria sect. Porri is the largest section, containing almost all Alternaria species with medium to large conidia and long beaks, some of which are important plant pathogens

  4. Large-spored Alternaria pathogens in section Porri disentangled

    NARCIS (Netherlands)

    Woudenberg, J H C; Truter, M; Groenewald, J Z; Crous, P W

    The omnipresent fungal genus Alternaria was recently divided into 24 sections based on molecular and morphological data. Alternaria sect. Porri is the largest section, containing almost all Alternaria species with medium to large conidia and long beaks, some of which are important plant pathogens

  5. Metabolomes of Potato Root Exudates: Compounds That Stimulate Resting Spore Germination of the Soil-Borne Pathogen Spongospora subterranea.

    Science.gov (United States)

    Balendres, Mark A; Nichols, David S; Tegg, Robert S; Wilson, Calum R

    2016-10-12

    Root exudation has importance in soil chemical ecology influencing rhizosphere microbiota. Prior studies reported root exudates from host and nonhost plants stimulated resting spore germination of Spongospora subterranea, the powdery scab pathogen of potato, but the identities of stimulatory compounds were unknown. This study showed that potato root exudates stimulated S. subterranea resting spore germination, releasing more zoospores at an earlier time than the control. We detected 24 low molecular weight organic compounds within potato root exudates and identified specific amino acids, sugars, organic acids, and other compounds that were stimulatory to S. subterranea resting spore germination. Given that several stimulatory compounds are commonly found in exudates of diverse plant species, we support observations of nonhost-specific stimulation. We provide knowledge of S. subterranea resting spore biology and chemical ecology that may be useful in formulating new disease management strategies.

  6. Spore Acquisition and Survival of Ambrosia Beetles Associated with the Laurel Wilt Pathogen in Avocados after Exposure to Entomopathogenic Fungi.

    Science.gov (United States)

    Avery, Pasco B; Bojorque, Verónica; Gámez, Cecilia; Duncan, Rita E; Carrillo, Daniel; Cave, Ronald D

    2018-04-25

    Laurel wilt is a disease threatening the avocado industry in Florida. The causative agent of the disease is a fungus vectored by ambrosia beetles that bore into the trees. Until recently, management strategies for the vectors of the laurel wilt fungus relied solely on chemical control and sanitation practices. Beneficial entomopathogenic fungi (EPF) are the most common and prevalent natural enemies of pathogen vectors. Laboratory experiments demonstrated that commercial strains of EPF can increase the mortality of the primary vector, Xyleborus glabratus , and potential alternative vectors, Xylosandrus crassiusculus , Xyleborus volvulus and Xyleborus bispinatus (Coleoptera: Curculionidae: Scolytinae). Our study provides baseline data for three formulated commercially-available entomopathogenic fungi used as potential biocontrol agents against X. crassiusculus , X. volvulus and X. bispinatus. The specific objectives were to determine: (1) the mean number of viable spores acquired per beetle species adult after being exposed to formulated fungal products containing different strains of EPF ( Isaria fumosorosea , Metarhizium brunneum and Beauveria bassiana ); and (2) the median and mean survival times using paper disk bioassays. Prior to being used in experiments, all fungal suspensions were adjusted to 2.4 × 10⁶ viable spores/mL. The number of spores acquired by X. crassiusculus was significantly higher after exposure to B. bassiana , compared to the other fungal treatments. For X. volvulus , the numbers of spores acquired per beetle were significantly different amongst the different fungal treatments, and the sequence of spore acquisition rates on X. volvulus from highest to lowest was I. fumosorosea > M. brunneum > B. bassiana . After X. bispinatus beetles were exposed to the different suspensions, the rates of acquisition of spores per beetle amongst the different fungal treatments were similar. Survival estimates (data pooled across two tests) indicated an

  7. Spore Acquisition and Survival of Ambrosia Beetles Associated with the Laurel Wilt Pathogen in Avocados after Exposure to Entomopathogenic Fungi

    Directory of Open Access Journals (Sweden)

    Pasco B. Avery

    2018-04-01

    Full Text Available Laurel wilt is a disease threatening the avocado industry in Florida. The causative agent of the disease is a fungus vectored by ambrosia beetles that bore into the trees. Until recently, management strategies for the vectors of the laurel wilt fungus relied solely on chemical control and sanitation practices. Beneficial entomopathogenic fungi (EPF are the most common and prevalent natural enemies of pathogen vectors. Laboratory experiments demonstrated that commercial strains of EPF can increase the mortality of the primary vector, Xyleborus glabratus, and potential alternative vectors, Xylosandrus crassiusculus, Xyleborus volvulus and Xyleborus bispinatus (Coleoptera: Curculionidae: Scolytinae. Our study provides baseline data for three formulated commercially-available entomopathogenic fungi used as potential biocontrol agents against X. crassiusculus, X. volvulus and X. bispinatus. The specific objectives were to determine: (1 the mean number of viable spores acquired per beetle species adult after being exposed to formulated fungal products containing different strains of EPF (Isaria fumosorosea, Metarhizium brunneum and Beauveria bassiana; and (2 the median and mean survival times using paper disk bioassays. Prior to being used in experiments, all fungal suspensions were adjusted to 2.4 × 106 viable spores/mL. The number of spores acquired by X. crassiusculus was significantly higher after exposure to B. bassiana, compared to the other fungal treatments. For X. volvulus, the numbers of spores acquired per beetle were significantly different amongst the different fungal treatments, and the sequence of spore acquisition rates on X. volvulus from highest to lowest was I. fumosorosea > M. brunneum > B. bassiana. After X. bispinatus beetles were exposed to the different suspensions, the rates of acquisition of spores per beetle amongst the different fungal treatments were similar. Survival estimates (data pooled across two tests indicated an

  8. Isolation and Characterization of Cryptococcus neoformans Spores Reveal a Critical Role for Capsule Biosynthesis Genes in Spore Biogenesis▿

    Science.gov (United States)

    Botts, Michael R.; Giles, Steven S.; Gates, Marcellene A.; Kozel, Thomas R.; Hull, Christina M.

    2009-01-01

    Spores are essential particles for the survival of many organisms, both prokaryotic and eukaryotic. Among the eukaryotes, fungi have developed spores with superior resistance and dispersal properties. For the human fungal pathogens, however, relatively little is known about the role that spores play in dispersal and infection. Here we present the purification and characterization of spores from the environmental fungus Cryptococcus neoformans. For the first time, we purified spores to homogeneity and assessed their morphological, stress resistance, and surface properties. We found that spores are morphologically distinct from yeast cells and are covered with a thick spore coat. Spores are also more resistant to environmental stresses than yeast cells and display a spore-specific configuration of polysaccharides on their surfaces. Surprisingly, we found that the surface of the spore reacts with antibodies to the polysaccharide glucuronoxylomannan, the most abundant component of the polysaccharide capsule required for C. neoformans virulence. We explored the role of capsule polysaccharide in spore development by assessing spore formation in a series of acapsular strains and determined that capsule biosynthesis genes are required for proper sexual development and normal spore formation. Our findings suggest that C. neoformans spores may have an adapted cell surface that facilitates persistence in harsh environments and ultimately allows them to infect mammalian hosts. PMID:19181873

  9. Fate of pathogenic Bacillus cereus spores after ingestion by protist grazers

    DEFF Research Database (Denmark)

    Winding, Anne; Santos, Susana; Hendriksen, Niels Bohse

    was initially investigated in microcosms inoculated with pure cultures of the protists Acanthamoeba castellanii, Tetrahymena pyriformis and Cercomonas sp. as grazers. Individual protist cultures were fed with fluorescently labelled (CellTracker™RedCMTPX) B. cereus spores or vegetative cells as the only food...

  10. In vitro spore germination and gametophytic growth development of ...

    African Journals Online (AJOL)

    The effects of sucrose, pH and plant growth hormones on spore germination percentage and gametophyte growths of Pteris tripartita were studied. Various morphological structures of gametophytes were observed namely, filamentous, spatulate and heart stages in the MS culture medium with hormones. After 15 days, the ...

  11. Progress in Bacillus subtilis Spore Surface Display Technology towards Environment, Vaccine Development, and Biocatalysis.

    Science.gov (United States)

    Chen, Huayou; Ullah, Jawad; Jia, Jinru

    2017-01-01

    Spore surface display is the most desirable with enhanced effects, low cost, less time consuming and the most promising technology for environmental, medical, and industrial development. Spores have various applications in industry due to their ability to survive in harsh industrial processes including heat resistance, alkaline tolerance, chemical tolerance, easy recovery, and reusability. Yeast and bacteria, including gram-positive and -negative, are the most frequently used organisms for the display of various proteins (eukaryotic and prokaryotic), but unlike spores, they can rupture easily due to nutritive properties, susceptibility to heat, pH, and chemicals. Hence, spores are the best choice to avoid these problems, and they have various applications over nonspore formers due to amenability for laboratory purposes. Various strains of Clostridium and Bacillus are spore formers, but the most suitable choice for display is Bacillus subtilis because, according to the WHO, it is safe to humans and considered as "GRAS" (generally recognized as safe). This review focuses on the application of spore surface display towards industries, vaccine development, the environment, and peptide library construction, with cell surface display for enhanced protein expression and high enzymatic activity. Different vectors, coat proteins, and statistical analyses can be used for linker selection to obtain greater expression and high activity of the displayed protein. © 2017 S. Karger AG, Basel.

  12. Development of a selective medium for the determination of the spore concentrations of Botrytis cinerea in the air.

    Science.gov (United States)

    Gielen, S; Aerts, R; Seels, B

    2003-01-01

    Gray mold, caused by Botrytis cinerea, is an important disease that causes world-wide extensive damage to a wide range of economically important crops. When it is necessary to determine the spore concentration of Botrytis cinerea in a certain area, it is important to develop a method that can capture the spores of Botrytis cinerea and that can identify them. For the identification and enumeration of the plant pathogen Botrytis cinerea in the environment the easiest method available for the moment is the use of a selective medium. Several selective media for the isolation of Botrytis spp. have been developed by other research groups. All these media contain fungicides that are usually non-toxic towards Botrytis species and tannic acid, which is oxidized to produce a brown pigment that visualises the growth of Botrytis cinerea on the selective media. It seemed that different isolates of Botrytis cinerea that are found in nature have different sensitivities towards the different fungicide concentrations that are used in the selective media. Making the "optimal" selective media for Botrytis cinerea, we have to take in consideration that so many as possible Botrytis cinerea isolates must be able to germinate and grow on this selective medium and that the contamination of other micro-organisms on the selective medium must be minimized. Before the final composition of our selective medium for Botrytis cinerea, different combinations of fungicide concentrations were tried out of the following three fungicides: Rubigan, maneb and PCNB (pentachloronitrobenzene). All these selective media with different fungicides concentrations were tested out for spore germination and mycelium growth of Botrytis cinerea. Because it was obvious that the percentage Botrytis cinerea that germinated on PDA (Potato Dextrose Agar) was higher than on the selective medium a few experiments were executed in which the percentage of spore germination on PDA was compared with the percentage of spore

  13. Development of bioprocess for high density cultivation yield of the probiotic Bacillus coagulans and its spores

    Directory of Open Access Journals (Sweden)

    Kavita R. Pandey

    2016-09-01

    Full Text Available Bacillus coagulans is a spore forming lactic acid bacterium. Spore forming bacteria, have been extensively studied and commercialized as probiotics. Probiotics are produced by fermentation technology. There is a limitation to biomass produced by conventional modes of fermentation. With the great demand generated by range of probiotic products, biomass is becoming very valuable for several pharmaceutical, dairy and probiotic companies. Thus, there is a need to develop high cell density cultivation processes for enhanced biomass accumulation. The bioprocess development was carried out in 6.6 L bench top lab scale fermentor. Four different cultivation strategies were employed to develop a bioprocess for higher growth and sporulation efficiencies of probiotic B. coagulans. Batch fermentation of B. coagulans yielded 18 g L-1 biomass (as against 8.0 g L-1 productivity in shake flask with 60% spore efficiency. Fed-batch cultivation was carried out for glucose, which yielded 25 g L-1 of biomass. C/N ratio was very crucial in achieving higher spore titres. Maximum biomass yield recorded was 30 g L-1, corresponding to 3.8 × 1011 cells mL-1 with 81% of cells in sporulated stage. The yield represents increment of 85 times the productivity and 158 times the spore titres relative to the highest reported values for high density cultivation of B. coagulans.

  14. Development of a new technique using glass beads for dry dispersion of airborne fungal spores.

    Science.gov (United States)

    Shimasaki, Noriko; Okaue, Akira; Kikuno, Ritsuko; Okuda, Shunji; Abe, Keiko

    2015-01-01

    To evaluate the removal of airborne microbes by air cleaners, a technique for generating airborne fungal spores in the dry state in a test chamber (dry dispersion) become necessary. The Society of Indoor Environment Japan (SIEJ) published SIEJ Standard Method No. 20110001 (SIEJ standard),in which an aerial ultrasonic oscillator was used as the device for dry dispersion. However, a more versatile apparatus is also necessary from a practical point of view. Therefore, we developed a new device using glass beads for the dispersion. Glass beads and a fungal sheet containing spores of Wallemia sebi were set in a midget impinger, which was connected to a compressor and a compact test chamber (1 m(3)). Air was blown into the impinger from the compressor. The spores on the fungal sheet were released by impingement of the glass beads when the beads were induced to float by the air blown into the impinger, and the spores were introduced to the chamber by the airflow. This newly developed technique can be used in a compact chamber system and could be applicable as an improved method for generating airborne fungal spores in the dry state in the SIEJ standard.

  15. 'Omics' for microbial food stability: Proteomics for the development of predictive models for bacterial spore stress survival and outgrowth.

    Science.gov (United States)

    Abhyankar, Wishwas; Stelder, Sacha; de Koning, Leo; de Koster, Chris; Brul, Stanley

    2017-01-02

    Bacterial spores are ubiquitous in nature. They are stress resistant entities that are a concern to microbiological food stability due to their environmental stress resistance. In addition germinating and outgrowing spores at undesired times and places pose a significant health burden. The challenge is amplified due to the heterogeneous germination and outgrowth behaviour of isogenic spore populations. We discuss the role of different 'omics' techniques, proteomics in particular, to study spore biology in detail. With examples, the use of label-based and label-free quantitative proteomics approaches in understanding the spore physiology is demonstrated. Also the need of genomics, single cell analyses and analysis of cellular physiology is discussed briefly. Certainly accurate comprehensive data obtained from omics methods and molecular physiology will underpin the development of robust molecular models of bacterial spore germination and outgrowth. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Alternative Excision Repair of Ultraviolet B- and C-Induced DNA Damage in Dormant and Developing Spores of Bacillus subtilis

    Science.gov (United States)

    Ramírez-Guadiana, Fernando H.; Barraza-Salas, Marcelo; Ramírez-Ramírez, Norma; Ortiz-Cortés, Mayte; Setlow, Peter

    2012-01-01

    The nucleotide excision repair (NER) and spore photoproduct lyase DNA repair pathways are major determinants of Bacillus subtilis spore resistance to UV radiation. We report here that a putative ultraviolet (UV) damage endonuclease encoded by ywjD confers protection to developing and dormant spores of B. subtilis against UV DNA damage. In agreement with its predicted function, a His6-YwjD recombinant protein catalyzed the specific incision of UV-irradiated DNA in vitro. The maximum expression of a reporter gene fusion to the ywjD opening reading frame occurred late in sporulation, and this maximal expression was dependent on the forespore-specific RNA polymerase sigma factor, σG. Although the absence of YwjD and/or UvrA, an essential protein of the NER pathway, sensitized developing spores to UV-C, this effect was lower when these cells were treated with UV-B. In contrast, UV-B but not UV-C radiation dramatically decreased the survival of dormant spores deficient in both YwjD and UvrA. The distinct range of lesions generated by UV-C and UV-B and the different DNA photochemistry in developing and dormant spores may cause these differences. We postulate that in addition to the UvrABC repair system, developing and dormant spores of B. subtilis also rely on an alternative excision repair pathway involving YwjD to deal with the deleterious effects of various UV photoproducts. PMID:22961846

  17. In vitro spore germination and gametophytic growth development of ...

    African Journals Online (AJOL)

    SAM

    2014-06-04

    Jun 4, 2014 ... gametophytes were observed namely, filamentous, spatulate and heart stages in the MS culture medium with hormones. After 15 days, the .... However, gametophytic generation is essential in the fern life cycle and very ..... Deng YN, Cheng X, Jiao Y, Chen GJ (2009). The Gametophyte. Development and ...

  18. Effect of Essential Oils on Germination and Growth of Some Pathogenic and Spoilage Spore-Forming Bacteria.

    Science.gov (United States)

    Voundi, Stève Olugu; Nyegue, Maximilienne; Lazar, Iuliana; Raducanu, Dumitra; Ndoye, Florentine Foe; Marius, Stamate; Etoa, François-Xavier

    2015-06-01

    The use of essential oils as a food preservative has increased due to their capacity to inhibit vegetative growth of some bacteria. However, only limited data are available on their effect on bacterial spores. The aim of the present study was to evaluate the effect of some essential oils on the growth and germination of three Bacillus species and Geobacillus stearothermophilus. Essential oils were chemically analyzed using gas chromatography and gas chromatography coupled to mass spectrometry. The minimal inhibitory and bactericidal concentrations of vegetative growth and spore germination were assessed using the macrodilution method. Germination inhibitory effect of treated spores with essential oils was evaluated on solid medium, while kinetic growth was followed using spectrophotometry in the presence of essential oils. Essential oil from Drypetes gossweileri mainly composed of benzyl isothiocyanate (86.7%) was the most potent, with minimal inhibitory concentrations ranging from 0.0048 to 0.0097 mg/mL on vegetative cells and 0.001 to 0.002 mg/mL on spore germination. Furthermore, essential oil from D. gossweileri reduced 50% of spore germination after treatment at 1.25 mg/mL, and its combination with other oils improved both bacteriostatic and bactericidal activities with additive or synergistic effects. Concerning the other essential oils, the minimal inhibitory concentration ranged from 5 to 0.63 mg/mL on vegetative growth and from 0.75 to 0.09 mg/mL on the germination of spores. Spectrophotometric evaluation showed an inhibitory effect of essential oils on both germination and outgrowth. From these results, it is concluded that some of the essential oils tested might be a valuable tool for bacteriological control in food industries. Therefore, further research regarding their use as food preservatives should be carried out.

  19. Loss of Abaxial Leaf Epicuticular Wax in Medicago truncatula irg1/palm1 Mutants Results in Reduced Spore Differentiation of Anthracnose and Nonhost Rust Pathogens[W

    Science.gov (United States)

    Uppalapati, Srinivasa Rao; Ishiga, Yasuhiro; Doraiswamy, Vanthana; Bedair, Mohamed; Mittal, Shipra; Chen, Jianghua; Nakashima, Jin; Tang, Yuhong; Tadege, Million; Ratet, Pascal; Chen, Rujin; Schultheiss, Holger; Mysore, Kirankumar S.

    2012-01-01

    To identify genes that confer nonhost resistance to biotrophic fungal pathogens, we did a forward-genetics screen using Medicago truncatula Tnt1 retrotransposon insertion lines. From this screen, we identified an inhibitor of rust germ tube differentation1 (irg1) mutant that failed to promote preinfection structure differentiation of two rust pathogens, Phakopsora pachyrhizi and Puccinia emaculata, and one anthracnose pathogen, Colletotrichum trifolii, on the abaxial leaf surface. Cytological and chemical analyses revealed that the inhibition of rust preinfection structures in irg1 mutants is due to complete loss of the abaxial epicuticular wax crystals and reduced surface hydrophobicity. The composition of waxes on abaxial leaf surface of irg1 mutants had >90% reduction of C30 primary alcohols and a preferential increase of C29 and C31 alkanes compared with the wild type. IRG1 encodes a Cys(2)His(2) zinc finger transcription factor, PALM1, which also controls dissected leaf morphology in M. truncatula. Transcriptome analysis of irg1/palm1 mutants revealed downregulation of eceriferum4, an enzyme implicated in primary alcohol biosynthesis, and MYB96, a major transcription factor that regulates wax biosynthesis. Our results demonstrate that PALM1 plays a role in regulating epicuticular wax metabolism and transport and that epicuticular wax influences spore differentiation of host and nonhost fungal pathogens. PMID:22294617

  20. Loss of abaxial leaf epicuticular wax in Medicago truncatula irg1/palm1 mutants results in reduced spore differentiation of anthracnose and nonhost rust pathogens.

    Science.gov (United States)

    Uppalapati, Srinivasa Rao; Ishiga, Yasuhiro; Doraiswamy, Vanthana; Bedair, Mohamed; Mittal, Shipra; Chen, Jianghua; Nakashima, Jin; Tang, Yuhong; Tadege, Million; Ratet, Pascal; Chen, Rujin; Schultheiss, Holger; Mysore, Kirankumar S

    2012-01-01

    To identify genes that confer nonhost resistance to biotrophic fungal pathogens, we did a forward-genetics screen using Medicago truncatula Tnt1 retrotransposon insertion lines. From this screen, we identified an inhibitor of rust germ tube differentation1 (irg1) mutant that failed to promote preinfection structure differentiation of two rust pathogens, Phakopsora pachyrhizi and Puccinia emaculata, and one anthracnose pathogen, Colletotrichum trifolii, on the abaxial leaf surface. Cytological and chemical analyses revealed that the inhibition of rust preinfection structures in irg1 mutants is due to complete loss of the abaxial epicuticular wax crystals and reduced surface hydrophobicity. The composition of waxes on abaxial leaf surface of irg1 mutants had >90% reduction of C30 primary alcohols and a preferential increase of C29 and C31 alkanes compared with the wild type. IRG1 encodes a Cys(2)His(2) zinc finger transcription factor, PALM1, which also controls dissected leaf morphology in M. truncatula. Transcriptome analysis of irg1/palm1 mutants revealed downregulation of eceriferum4, an enzyme implicated in primary alcohol biosynthesis, and MYB96, a major transcription factor that regulates wax biosynthesis. Our results demonstrate that PALM1 plays a role in regulating epicuticular wax metabolism and transport and that epicuticular wax influences spore differentiation of host and nonhost fungal pathogens.

  1. Inactivation Strategies for Clostridium perfringens Spores and Vegetative Cells.

    Science.gov (United States)

    Talukdar, Prabhat K; Udompijitkul, Pathima; Hossain, Ashfaque; Sarker, Mahfuzur R

    2017-01-01

    Clostridium perfringens is an important pathogen to human and animals and causes a wide array of diseases, including histotoxic and gastrointestinal illnesses. C. perfringens spores are crucial in terms of the pathogenicity of this bacterium because they can survive in a dormant state in the environment and return to being live bacteria when they come in contact with nutrients in food or the human body. Although the strategies to inactivate C. perfringens vegetative cells are effective, the inactivation of C. perfringens spores is still a great challenge. A number of studies have been conducted in the past decade or so toward developing efficient inactivation strategies for C. perfringens spores and vegetative cells, which include physical approaches and the use of chemical preservatives and naturally derived antimicrobial agents. In this review, different inactivation strategies applied to control C. perfringens cells and spores are summarized, and the potential limitations and challenges of these strategies are discussed. Copyright © 2016 American Society for Microbiology.

  2. Rapid onsite assessment of spore viability.

    Energy Technology Data Exchange (ETDEWEB)

    Branda, Steven; Lane, Todd W.; VanderNoot, Victoria A.; Gaucher, Sara P.; Jokerst, Amanda S.

    2005-12-01

    This one year LDRD addresses problems of threat assessment and restoration of facilities following a bioterror incident like the incident that closed down mail facilities in late 2001. Facilities that are contaminated with pathogenic spores such as B. anthracis spores must be shut down while they are treated with a sporicidal agent and the effectiveness of the treatment is ascertained. This process involves measuring the viability of spore test strips, laid out in a grid throughout the facility; the CDC accepted methodologies require transporting the samples to a laboratory and carrying out a 48 hr outgrowth experiment. We proposed developing a technique that will ultimately lead to a fieldable microfluidic device that can rapidly assess (ideally less than 30 min) spore viability and effectiveness of sporicidal treatment, returning facilities to use in hours not days. The proposed method will determine viability of spores by detecting early protein synthesis after chemical germination. During this year, we established the feasibility of this approach and gathered preliminary results that should fuel a future more comprehensive effort. Such a proposal is currently under review with the NIH. Proteomic signatures of Bacillus spores and vegetative cells were assessed by both slab gel electrophoresis as well as microchip based gel electrophoresis employing sensitive laser-induced fluorescence detection. The conditions for germination using a number of chemical germinants were evaluated and optimized and the time course of protein synthesis was ascertained. Microseparations were carried out using both viable spores and spores inactivated by two different methods. A select number of the early synthesis proteins were digested into peptides for analysis by mass spectrometry.

  3. Development of a transformation system for Mycosphaerella pathogens of banana: a tool for the study of host/pathogen interactions.

    Science.gov (United States)

    Balint-Kurti, P J; May, G D; Churchill, A C

    2001-02-05

    A genetic transformation system has been developed for three Mycosphaerella pathogens of banana and plantain (Musa spp.). Mycosphaerella fijiensis and Mycosphaerella musicola, the causal agents of black and yellow Sigatoka, respectively, and Mycosphaerella eumusae, which causes Septoria leaf spot of banana, were transformed with a construct carrying a synthetic gene encoding green fluorescent protein (GFP). Most single-spored transformants that expressed GFP constitutively were mitotically stable in the absence of selection for hygromycin B resistance. Transformants of all three species were pathogenic on the susceptible banana cultivar Grand Nain, and growth in planta was comparable to wild-type strains. GFP expression by transformants allowed us to observe extensive fungal growth within leaf tissue that eventually turned necrotic, at which point the fungi grew saprophytically on the dead tissue. Leaf chlorosis and necrosis were often observed in advance of saprophytic growth of the mycelium on necrotic tissue, which supports previous reports suggesting secretion of a phytotoxin.

  4. Antifungal effect of gaseous nitric oxide on mycelium growth, sporulation and spore germination of the postharvest horticulture pathogens, Aspergillus niger, Monilinia fructicola and Penicillium italicum.

    Science.gov (United States)

    Lazar, E E; Wills, R B H; Ho, B T; Harris, A M; Spohr, L J

    2008-06-01

    To evaluate the antifungal activity of nitric oxide (NO) against the growth of the postharvest horticulture pathogens Aspergillus niger, Monilinia fructicola and Penicillium italicum under in vitro conditions. Different volumes of NO gas were injected into the Petri dish headspace to obtain the desired concentrations of 50-500 microl l(-1). The growth of the fungi was measured for 8 days of incubation in air at 25 degrees C. All concentrations of NO were found to produce an antifungal effect on spore germination, sporulation and mycelial growth of the three fungi, with the most effective concentration for A. niger and P. italicum being 100 and 500 microl l(-1) for M. fructicola. Short-term exposure to a low concentration of NO gas was able to inhibit the subsequent growth of A. niger, M. fructicola and P. italicum. NO gas has potential use as a natural fungicide to inhibit microbial growth on postharvest fruit and vegetables.

  5. Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage

    Directory of Open Access Journals (Sweden)

    Jin Su Choi

    2014-03-01

    Full Text Available Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

  6. Development of an eco-friendly approach for biogenesis of silver nanoparticles using spores of Bacillus athrophaeus.

    Science.gov (United States)

    Hosseini-Abari, Afrouzossadat; Emtiazi, Giti; Ghasemi, Seyed Mahdi

    2013-12-01

    The biological synthesis methods have been emerging as a promising new approach for production of nanoparticles due to their simplicity and non-toxicity. In the present study, spores of Bacillus athrophaeus were used to achieve the objective of developing a green synthesis method of silver nanoparticles. Enzyme assay revealed that the spores and their heat inactivated forms (microcapsules) were highly active and their enzymatic contents differed from the vegetative cells. Laccase, glucose oxidase, and alkaline phosphatase activities were detected in the dormant forms, but not in the vegetative cells. Although no nanoparticle was produced by active cells of B. athrophaeus, both spores and microcapsules were efficiently capable of reducing the silver ions (Ag⁺) to elemental silver (Ag⁰) leading to the formation of nanoparticles from silver nitrate (AgNO₃). The presence of biologically synthesized silver nanoparticles was determined by obtaining broad spectra with maximum absorbance at 400 nm in UV-visible spectroscopy. The X-ray diffraction analysis pattern revealed that the nanoscale particles have crystalline nature with various topologies, as confirmed by transmission electron microscopy (TEM). The TEM micrograph showed the nanocrystal structures with dimensions ranging from 5 to 30 nm. Accordingly, the spore mixture could be employed as a factory for detoxification of heavy metals and subsequent production of nanoparticles. This research introduces an environmental friendly and cost effective biotechnological process for the extracellular synthesis of silver nanoparticles using the bacterial spores.

  7. Survival of foodborne pathogenic bacteria (Bacillus cereus, Escherichia coli O157:H7, Salmonella enterica serovar Typhimurium, Staphylococcus aureus, and Listeria monocytogenes) and Bacillus cereus spores in fermented alcoholic beverages (beer and refined rice wine).

    Science.gov (United States)

    Kim, S A; Kim, N H; Lee, S H; Hwang, I G; Rhee, M S

    2014-03-01

    Only limited information is available on the microbiological safety of fermented alcoholic beverages because it is still a common belief that such beverages do not provide a favorable environment for bacterial growth and survival. Thus, in this study, we examined the survival of major foodborne pathogens and spores in fermented alcoholic beverages. Foodborne pathogens (Bacillus cereus, Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica serovar Typhimurium, and Staphylococcus aureus) and B. cereus spores (initial population, 3 to 4 log CFU/ml) were inoculated separately into three types of beer and refined rice wine, which were then stored at 5 and 22°C. Bacterial counts were assayed periodically for up to 28 days. Vegetative B. cereus counts decreased rapidly, whereas B. cereus spore counts remained constant (P > 0.05) for a long period of time in all beverages. Vegetative B. cereus cells formed spores in beer at 5 and 22°C, and the spores survived for long periods. Among vegetative cells, E. coli O157:H7 had the highest survival (only 1.49 to 1.56 log reduction during 28 days in beer at 5°C). Beer and refined rice wine supported microbial survival from several days to several weeks. Our results appear to contradict the common belief that pathogens cannot survive in alcoholic beverages. Long-term survival of pathogens (especially B. cereus and E. coli O157:H7) in beer and refined rice wine should be taken into consideration by the manufacturers of these beverages. This study provides basic information that should help further research into microbial survival in alcoholic beverages and increase the microbiological safety regulation of fermented alcoholic beverages.

  8. Development and fine structure of sclerotia and spores of the actinomycete Chainia olivacea.

    Science.gov (United States)

    Sharples, G P; Williams, S T

    1976-01-01

    Sclerotia and spores of Chainia olivacea were studied by transmission and scanning electron microscopy. Sclerotia formed by repeated branching of several hyphea. Branch tips were delimited by septa and increased in size, becoming filled with lipid-like inclusions. In mautre sclerotia, empty cells and intra-hyphal growth were observed. An electron-dense fibrillar material was deposited between hyphae and on the sclerotium surface. The similarities between these and the sclerotia of certain fungi are discussed. Spores were formed in a manner similar to that in Streptomyces species. Large inter-sporal pads were formed during ingrowth of the septa delimiting the spores.

  9. Growth, Survival and Spore Formation of the Pathogenic Aquatic Oomycete Aphanomyces astaci and Fungus Fusarium avenaceum Are Inhibited by Zanthoxylum rhoifolium Bark Extracts In Vitro

    Directory of Open Access Journals (Sweden)

    Caterina Pagliarulo

    2018-02-01

    Full Text Available This study aimed to evaluate the in vitro activity of Zanthoxylum rhoifolium bark (Zr-b extracts against pathogenic aquatic oomycete/fungal isolates that cause different diseases in native European crayfish resulting in an elevated mortality rate and severe economic repercussions. n-hexane, chloroform, chloroform–methanol (9:1 and methanol extracts of Zr-b were used to evaluate the antifungal activity against the strain UEF88662 of Aphanomyces astaci (oomycete and the strain SMM2 of Fusarium avenaceum (fungus. The anti-oomycete and antifungal activity was quantitatively evaluated by growth, survival and sporulation microbiological assays. The extracts tested demonstrated a dose-dependent inhibitory effect on oomycete and fungal growth and survival, as well as on the production of oomycete and fungal spores. This work presents alternatives for the treatment and prevention of the spreading of Aphanomyces astaci and Fusarium avenaceum, the etiological agents of the diseases crayfish plague and brown spot disease, respectively. The antifungal properties of Zanthoxylum rhoifolium bark extracts warrant further research on their use in the prevention and treatment of both oomycete and fungal diseases. The antifungal properties of Zanthoxylum rhoifolium bark extracts, shown in vitro, indicate the possibility of their use in new therapeutic and prophylactic strategies, providing perspectives for the design of in vivo studies.

  10. High fungal spore burden with predominance of Aspergillus in hospital air of a tertiary care hospital in Chandigarh

    Directory of Open Access Journals (Sweden)

    S M Rudramurthy

    2016-01-01

    Full Text Available The prevalence of fungal spores in the hospital air is essential to understand the hospital-acquired fungal infections. Air conditioners (ACs used in hospitals may either reduce spores in air or be colonised by fungi and aid in its dissemination. The present study was conducted to assess the fungal spore burden in AC and non-AC areas. We found a high fungal spore count in air irrespective of whether the area was AC or non-AC. The most predominant species isolated were Aspergillus flavus and Aspergillus fumigatus. Such high concentrations of pathogenic fungi in air may predispose individuals to develop disease.

  11. Development of method for evaluating cell hardness and correlation between bacterial spore hardness and durability

    Science.gov (United States)

    2012-01-01

    Background Despite the availability of conventional devices for making single-cell manipulations, determining the hardness of a single cell remains difficult. Here, we consider the cell to be a linear elastic body and apply Young’s modulus (modulus of elasticity), which is defined as the ratio of the repulsive force (stress) in response to the applied strain. In this new method, a scanning probe microscope (SPM) is operated with a cantilever in the “contact-and-push” mode, and the cantilever is applied to the cell surface over a set distance (applied strain). Results We determined the hardness of the following bacterial cells: Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and five Bacillus spp. In log phase, these strains had a similar Young’s modulus, but Bacillus spp. spores were significantly harder than the corresponding vegetative cells. There was a positive, linear correlation between the hardness of bacterial spores and heat or ultraviolet (UV) resistance. Conclusions Using this technique, the hardness of a single vegetative bacterial cell or spore could be determined based on Young’s modulus. As an application of this technique, we demonstrated that the hardness of individual bacterial spores was directly proportional to heat and UV resistance, which are the conventional measures of physical durability. This technique allows the rapid and direct determination of spore durability and provides a valuable and innovative method for the evaluation of physical properties in the field of microbiology. PMID:22676476

  12. Development of method for evaluating cell hardness and correlation between bacterial spore hardness and durability

    Directory of Open Access Journals (Sweden)

    Nakanishi Koichi

    2012-06-01

    Full Text Available Abstract Background Despite the availability of conventional devices for making single-cell manipulations, determining the hardness of a single cell remains difficult. Here, we consider the cell to be a linear elastic body and apply Young’s modulus (modulus of elasticity, which is defined as the ratio of the repulsive force (stress in response to the applied strain. In this new method, a scanning probe microscope (SPM is operated with a cantilever in the “contact-and-push” mode, and the cantilever is applied to the cell surface over a set distance (applied strain. Results We determined the hardness of the following bacterial cells: Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and five Bacillus spp. In log phase, these strains had a similar Young’s modulus, but Bacillus spp. spores were significantly harder than the corresponding vegetative cells. There was a positive, linear correlation between the hardness of bacterial spores and heat or ultraviolet (UV resistance. Conclusions Using this technique, the hardness of a single vegetative bacterial cell or spore could be determined based on Young’s modulus. As an application of this technique, we demonstrated that the hardness of individual bacterial spores was directly proportional to heat and UV resistance, which are the conventional measures of physical durability. This technique allows the rapid and direct determination of spore durability and provides a valuable and innovative method for the evaluation of physical properties in the field of microbiology.

  13. Mapping of Proteomic Composition on the Surfaces of Bacillus spores by Atomic Force Microscopy-based Immunolabeling

    Energy Technology Data Exchange (ETDEWEB)

    Plomp, M; Malkin, A J

    2008-06-02

    Atomic force microscopy provides a unique capability to image high-resolution architecture and structural dynamics of pathogens (e.g. viruses, bacteria and bacterial spores) at near molecular resolution in native conditions. Further development of atomic force microscopy in order to enable the correlation of pathogen protein surface structures with specific gene products is essential to understand the mechanisms of the pathogen life cycle. We have applied an AFM-based immunolabeling technique for the proteomic mapping of macromolecular structures through the visualization of the binding of antibodies, conjugated with nanogold particles, to specific epitopes on Bacillus spore surfaces. This information is generated while simultaneously acquiring the surface morphology of the pathogen. The immunospecificity of this labeling method was established through the utilization of specific polyclonal and monoclonal antibodies that target spore coat and exosporium epitopes of Bacillus atrophaeus and Bacillus anthracis spores.

  14. Induction of Rhizopus oryzae germination under starvation using host metabolites increases spore susceptibility to heat stress.

    Science.gov (United States)

    Turgeman, Tidhar; Kakongi, Nathan; Schneider, Avishai; Vinokur, Yakov; Teper-Bamnolker, Paula; Carmeli, Shmuel; Levy, Maggie; Skory, Christopher D; Lichter, Amnon; Eshel, Dani

    2014-03-01

    Sweetpotato is a nutritional source worldwide. Soft rot caused by Rhizopus spp. is a major limiting factor in the storage of produce, rendering it potentially unsafe for human consumption. In this study, Rhizopus oryzae was used to develop a concept of postharvest disease control by weakening the pathogen through induction of spore germination under starvation conditions. We isolated the sweetpotato active fractions (SPAFs) that induce spore germination and used them at a low dose to enhance spore weakening caused by starvation. Germination in SPAF at 1 mg/ml weakened the pathogen spores by delaying their ability to form colonies on rich media and by increasing their sensitivity to heat stress. The weakening effect was also supported by reduced metabolic activity, as detected by Alarmar Blue fluorescent dye assays. Spores incubated with SPAF at 1 mg/ml showed DNA fragmentation in some of their nuclei, as observed by TUNEL assay. In addition, these spores exhibited changes in ultrastructural morphology (i.e., shrinkage of germ tubes, nucleus deformation, and vacuole formation) which are hallmarks of programmed cell death. We suggest that induction of spore germination under starvation conditions increases their susceptibility to stress and, therefore, might be considered a new strategy for pathogen control.

  15. Small acid soluble proteins for rapid spore identification.

    Energy Technology Data Exchange (ETDEWEB)

    Branda, Steven S.; Lane, Todd W.; VanderNoot, Victoria A.; Jokerst, Amanda S.

    2006-12-01

    This one year LDRD addressed the problem of rapid characterization of bacterial spores such as those from the genus Bacillus, the group that contains pathogenic spores such as B. anthracis. In this effort we addressed the feasibility of using a proteomics based approach to spore characterization using a subset of conserved spore proteins known as the small acid soluble proteins or SASPs. We proposed developing techniques that built on our previous expertise in microseparations to rapidly characterize or identify spores. An alternative SASP extraction method was developed that was amenable to both the subsequent fluorescent labeling required for laser-induced fluorescence detection and the low ionic strength requirements for isoelectric focusing. For the microseparations, both capillary isoelectric focusing and chip gel electrophoresis were employed. A variety of methods were evaluated to improve the molecular weight resolution for the SASPs, which are in a molecular weight range that is not well resolved by the current methods. Isoelectric focusing was optimized and employed to resolve the SASPs using UV absorbance detection. Proteomic signatures of native wild type Bacillus spores and clones genetically engineered to produce altered SASP patterns were assessed by slab gel electrophoresis, capillary isoelectric focusing with absorbance detection as well as microchip based gel electrophoresis employing sensitive laser-induced fluorescence detection.

  16. A two-step transport pathway allows the mother cell to nurture the developing spore in Bacillus subtilis.

    Directory of Open Access Journals (Sweden)

    Fernando H Ramírez-Guadiana

    2017-09-01

    Full Text Available One of the hallmarks of bacterial endospore formation is the accumulation of high concentrations of pyridine-2,6-dicarboxylic acid (dipicolinic acid or DPA in the developing spore. This small molecule comprises 5-15% of the dry weight of dormant spores and plays a central role in resistance to both wet heat and desiccation. DPA is synthesized in the mother cell at a late stage in sporulation and must be translocated across two membranes (the inner and outer forespore membranes that separate the mother cell and forespore. The enzymes that synthesize DPA and the proteins required to translocate it across the inner forespore membrane were identified over two decades ago but the factors that transport DPA across the outer forespore membrane have remained mysterious. Here, we report that SpoVV (formerly YlbJ is the missing DPA transporter. SpoVV is produced in the mother cell during the morphological process of engulfment and specifically localizes in the outer forespore membrane. Sporulating cells lacking SpoVV produce spores with low levels of DPA and cells engineered to express SpoVV and the DPA synthase during vegetative growth accumulate high levels of DPA in the culture medium. SpoVV resembles concentrative nucleoside transporters and mutagenesis of residues predicted to form the substrate-binding pocket supports the idea that SpoVV has a similar structure and could therefore function similarly. These findings provide a simple two-step transport mechanism by which the mother cell nurtures the developing spore. DPA produced in the mother cell is first translocated into the intermembrane space by SpoVV and is then imported into the forespore by the SpoVA complex. This pathway is likely to be broadly conserved as DPA synthase, SpoVV, and SpoVA proteins can be found in virtually all endospore forming bacteria.

  17. A two-step transport pathway allows the mother cell to nurture the developing spore in Bacillus subtilis.

    Science.gov (United States)

    Ramírez-Guadiana, Fernando H; Meeske, Alexander J; Rodrigues, Christopher D A; Barajas-Ornelas, Rocío Del Carmen; Kruse, Andrew C; Rudner, David Z

    2017-09-01

    One of the hallmarks of bacterial endospore formation is the accumulation of high concentrations of pyridine-2,6-dicarboxylic acid (dipicolinic acid or DPA) in the developing spore. This small molecule comprises 5-15% of the dry weight of dormant spores and plays a central role in resistance to both wet heat and desiccation. DPA is synthesized in the mother cell at a late stage in sporulation and must be translocated across two membranes (the inner and outer forespore membranes) that separate the mother cell and forespore. The enzymes that synthesize DPA and the proteins required to translocate it across the inner forespore membrane were identified over two decades ago but the factors that transport DPA across the outer forespore membrane have remained mysterious. Here, we report that SpoVV (formerly YlbJ) is the missing DPA transporter. SpoVV is produced in the mother cell during the morphological process of engulfment and specifically localizes in the outer forespore membrane. Sporulating cells lacking SpoVV produce spores with low levels of DPA and cells engineered to express SpoVV and the DPA synthase during vegetative growth accumulate high levels of DPA in the culture medium. SpoVV resembles concentrative nucleoside transporters and mutagenesis of residues predicted to form the substrate-binding pocket supports the idea that SpoVV has a similar structure and could therefore function similarly. These findings provide a simple two-step transport mechanism by which the mother cell nurtures the developing spore. DPA produced in the mother cell is first translocated into the intermembrane space by SpoVV and is then imported into the forespore by the SpoVA complex. This pathway is likely to be broadly conserved as DPA synthase, SpoVV, and SpoVA proteins can be found in virtually all endospore forming bacteria.

  18. DNA capturing machinery through spore-displayed proteins.

    Science.gov (United States)

    Park, T J; Lee, S J; Pan, J-G; Jung, H-C; Park, J Y; Park, J P; Lee, S Y

    2011-10-01

    The purpose of this study was to develop a general method for the facile development of a new DNA biosensor which utilizes streptavidin-displayed spores as a molecular machinery. Fluorescence spectroscopy was used as a monitoring tool for the streptavidin displayed on the surface of Bacillus thuringiensis spores and as a diagnosis method for DNA detection. As a proof-of-concept, four pathogenic bacteria including Pseudomonas aeruginosa, Acinetobacter baumannii, Escherichia coli and Klebsiella pneumonia were used for the detection of pathogenic species. In addition, a set of mutant variants of Wilson's disease were also used for the detection of single nucleotide polymorphism (SNP) in this system. This strategy, utilizing streptavidin-displayed spores, is capable of capturing DNA targets for the detection of pathogenic bacteria and for mutation analysis in Wilson's disease. This approach could be useful as a simple platform for developing sensitive spore-based biosensors for any desired DNA targets in diagnostic applications. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  19. Updates on Clostridium difficile spore biology.

    Science.gov (United States)

    Gil, Fernando; Lagos-Moraga, Sebastián; Calderón-Romero, Paulina; Pizarro-Guajardo, Marjorie; Paredes-Sabja, Daniel

    2017-06-01

    Clostridium difficile is a Gram-positive, anaerobic spore former, and an important nosocomial pathogenic bacterium. C. difficile spores are the morphotype of transmission and recurrence of the disease. The formation of C. difficile spores and their subsequent germination are essential processes during the infection. Recent in vitro and in vivo work has shed light on how spores are formed and the timing of in vivo sporulation in a mouse model. Advances have also been made in our understanding of the machineries involved in spore germination, and how antibiotic-induced dysbiosis affects the metabolism of bile salts and thus impacts C. difficile germination in vivo. Studies have also attempted to identify how C. difficile spores interact with the host's intestinal mucosa. Spore resistance has also been revisited by several groups highlighting the extreme resistance of this morphotype to traditional food processing regimes and disinfectants used in clinical settings. Therefore, the aim of this review is to summarize recent advances on spore formation/germination in vitro and in vivo, spore-host interactions, and spore resistance that contribute to our knowledge of the role of C. difficile spores in the infectious process. Copyright © 2017. Published by Elsevier Ltd.

  20. Practical aspects of temperature intervention in germination and post-germination development of bacterial spores

    International Nuclear Information System (INIS)

    Stastna, J.; Vinter, V.; Babicka, J.

    1974-01-01

    Temperature dependence of germination and post-germination growth was studied in the spores of B a c i l l u s c e r e u s NCIB 8122. It was found that a temperature of 5 0 C slowed down germination, with the cells showing the capacity of synthetizing only a limited amount of proteins. The synthesis of the cellular wall, however, went on for another few hours. Thick-walled, less permeable and less metabolically active cells formed having an altered ultrastructure. A prolonged cultivation at 30 0 C resulted in the reduction of living cells while the low cultivation temperature (5 0 C) was found to have a protective effect. Pre-irradiation with 30g krad of gamma radiation increased the sensitivity of surviving cells to the cultivation conditions. Spores in the post-germination period were found to be much more resistent and alternating use of low and higher temperatures had little effect on growth

  1. Agrobacterium-mediated disruption of a nonribosomal peptide synthetase gene in the invertebrate pathogen Metarhizium anisopliae reveals a peptide spore factor

    Science.gov (United States)

    Numerous secondary metabolites have been isolated from the insect pathogenic fungus Metarhizium anisopliae, but the roles of these compounds as virulence factors in disease development are poorly understood. We targeted for disruption by Agrobacterium tumefaciens-mediated transformation a putative n...

  2. Spore germination, early development and some notes on the effects of in vitro culture medium on Frullania ericoides (Nees Mont. (Frullaniaceae, Marchantiophyta

    Directory of Open Access Journals (Sweden)

    Juliana da Costa Silva-e-Costa

    Full Text Available ABSTRACT In bryophytes, establishment can occur by a sexual or asexual process, but the production of spores enables colonization of a wider range of habitats and substrates than can asexual propagules. Successful germination is critical for establishment in a new environment. This paper addresses germination and sporeling development in Frullania ericoides, a leafy liverwort species. Fresh spores were inoculated in vitro in different culture strengths of Knop’s nutrient solution (one-fourth strength, half strength, full strength, one and a half strength and double strength, in order to evaluate the effects of this solution on spore germination and on the development of external protonema. On the first assessment, spore germination was observed at all the concentrations. Germination was endosporic, with cell division and proliferation, resulting in a globular protonema, within the spore wall. Beginning at the fourth week, the development of tightly concave primordial leaves was observed in all but the double-strength medium. Throughout the period of study, the treatments with lower concentrations exhibited external protonema with greater lengths. The double-strength treatment was statistically different from other treatments in at least two parameters. The results of this study demonstrate the potential of in vitro culture techniques for bryophyte spore studies and germplasm preservation.

  3. Reduction of Clostridium sporogenes spore outgrowth in natural sausage casings using nisin.

    Science.gov (United States)

    Wijnker, J J; Weerts, E A W S; Breukink, E J; Houben, J H; Lipman, L J A

    2011-08-01

    Preservation of natural sausage casings using dry salt or saturated brine is regarded as sufficient to inactivate vegetative pathogenic non-spore-forming bacteria present on the casings. Although the outgrowth of bacterial spores is prevented by salt or saturated brine preservation, these spores will remain present and develop into vegetative cells when conditions are more favourable. To prevent subsequent outgrowth additional preservation measures should be implemented. In the experiments described the use of nisin was evaluated to reduce outgrowth of spores in desalinated casings. The bacteriocin nisin was chosen because of its known efficacy against spore-forming bacteria and their spores in various foodstuffs. Clostridium spore suspensions (Clostridium sporogenes, ATCC 3584) were used in two concentrations to inoculate three nisin concentrations (10, 50, 100 μg/mL) in water containing gamma-irradiated casings. Additionally, the binding of nisin to casings, using (14)C-labeled nisin Z and subsequent availability of nisin were evaluated. Results demonstrate that nisin is partly reversibly bound to casings and can reduce the outgrowth of Clostridium spores in the model used by approximately 1 log(10) (90%). However, the biological relevance of these results needs to be determined further by conducting industrial trials before any recommendation can be made on the practical implementation of nisin in the preservation of natural sausage casings. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Lyophilized spore dispenser

    Science.gov (United States)

    Jessup, A. D. (Inventor)

    1973-01-01

    A lyophilized spore dispenser is provided which produces a finely divided, monoparticulate cloud of bacterial spores. The spores are contained within a tightly sealed chamber, and a turbulator orifice connected to an air supply source provides a jet of air which stirs up the spores and causes the spores to be suspended in eddy currents within the chamber. This air jet also produces a positive pressure within the chamber which forces the spores out of an injection orifice.

  5. Coupling Spore Traps and Quantitative PCR Assays for Detection of the Downy Mildew Pathogens of Spinach (Peronospora effusa) and Beet (P. schachtii)

    Science.gov (United States)

    Klosterman, Steven J.; Anchieta, Amy; McRoberts, Neil; Koike, Steven T.; Subbarao, Krishna V.; Voglmayr, Hermann; Choi, Young-Joon; Thines, Marco; Martin, Frank N.

    2016-01-01

    Downy mildew of spinach (Spinacia oleracea), caused by Peronospora effusa, is a production constraint on production worldwide, including in California, where the majority of U.S. spinach is grown. The aim of this study was to develop a real-time quantitative polymerase chain reaction (qPCR) assay for detection of airborne inoculum of P. effusa in California. Among oomycete ribosomal DNA (rDNA) sequences examined for assay development, the highest nucleotide sequence identity was observed between rDNA sequences of P. effusa and P. schachtii, the cause of downy mildew on sugar beet and Swiss chard in the leaf beet group (Beta vulgaris subsp. vulgaris). Single-nucleotide polymorphisms were detected between P. effusa and P. schachtii in the 18S rDNA regions for design of P. effusa- and P. schachtii-specific TaqMan probes and reverse primers. An allele-specific probe and primer amplification method was applied to determine the frequency of both P. effusa and P. schachtii rDNA target sequences in pooled DNA samples, enabling quantification of rDNA of P. effusa from impaction spore trap samples collected from spinach production fields. The rDNA copy numbers of P. effusa were, on average, ≈3,300-fold higher from trap samples collected near an infected field compared with those levels recorded at a site without a nearby spinach field. In combination with disease-conducive weather forecasting, application of the assays may be helpful to time fungicide applications for disease management. PMID:24964150

  6. Bacillus cereus spore damage recovery and diversity in spore germination and carbohydrate utilisation

    NARCIS (Netherlands)

    Warda, Alicja K.

    2016-01-01

    Bacterial spores are extremely robust survival vehicles that are highly resistant towards environmental stress conditions including heat, UV radiation and other stresses commonly applied during food production and preservation. Spores, including those of the toxin-producing food-borne human pathogen

  7. Detection of Bacillus spores using PCR and FTA filters.

    Science.gov (United States)

    Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A

    2004-05-01

    Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.

  8. Gene expression profiling of human alveolar macrophages infected by B. anthracis spores demonstrates TNF-α and NF-κb are key components of the innate immune response to the pathogen

    Directory of Open Access Journals (Sweden)

    Hurst Robert E

    2009-09-01

    Full Text Available Abstract Background Bacillus anthracis, the etiologic agent of anthrax, has recently been used as an agent of bioterrorism. The innate immune system initially appears to contain the pathogen at the site of entry. Because the human alveolar macrophage (HAM plays a key role in lung innate immune responses, studying the HAM response to B. anthracis is important in understanding the pathogenesis of the pulmonary form of this disease. Methods In this paper, the transcriptional profile of B. anthracis spore-treated HAM was compared with that of mock-infected cells, and differentially expressed genes were identified by Affymetrix microarray analysis. A portion of the results were verified by Luminex protein analysis. Results The majority of genes modulated by spores were upregulated, and a lesser number were downregulated. The differentially expressed genes were subjected to Ingenuity Pathway analysis, the Database for Annotation, Visualization and Integrated Discovery (DAVID analysis, the Promoter Analysis and Interaction Network Toolset (PAINT and Oncomine analysis. Among the upregulated genes, we identified a group of chemokine ligand, apoptosis, and, interestingly, keratin filament genes. Central hubs regulating the activated genes were TNF-α, NF-κB and their ligands/receptors. In addition to TNF-α, a broad range of cytokines was induced, and this was confirmed at the level of translation by Luminex multiplex protein analysis. PAINT analysis revealed that many of the genes affected by spores contain the binding site for c-Rel, a member of the NF-κB family of transcription factors. Other transcription regulatory elements contained in many of the upregulated genes were c-Myb, CP2, Barbie Box, E2F and CRE-BP1. However, many of the genes are poorly annotated, indicating that they represent novel functions. Four of the genes most highly regulated by spores have only previously been associated with head and neck and lung carcinomas. Conclusion The

  9. Recent developments in pathogen detection arrays: implications for fungal plant pathogens and use in practica

    NARCIS (Netherlands)

    Lievens, B.; Thomma, B.P.H.J.

    2005-01-01

    The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection,

  10. Spore: Spawning Evolutionary Misconceptions?

    Science.gov (United States)

    Bean, Thomas E.; Sinatra, Gale M.; Schrader, P. G.

    2010-10-01

    The use of computer simulations as educational tools may afford the means to develop understanding of evolution as a natural, emergent, and decentralized process. However, special consideration of developmental constraints on learning may be necessary when using these technologies. Specifically, the essentialist (biological forms possess an immutable essence), teleological (assignment of purpose to living things and/or parts of living things that may not be purposeful), and intentionality (assumption that events are caused by an intelligent agent) biases may be reinforced through the use of computer simulations, rather than addressed with instruction. We examine the video game Spore for its depiction of evolutionary content and its potential to reinforce these cognitive biases. In particular, we discuss three pedagogical strategies to mitigate weaknesses of Spore and other computer simulations: directly targeting misconceptions through refutational approaches, targeting specific principles of scientific inquiry, and directly addressing issues related to models as cognitive tools.

  11. Development and validation of a quasi-Gaussian plume model for the transport of botanical spores

    NARCIS (Netherlands)

    Skelsey, P.; Holtslag, A. A. M.; van der Werf, Wopke

    2008-01-01

    Aerial dispersal of inoculum is the primary means of movement for many plant diseases. one of the challenges of modem decision support for plant health is to provide predictions of the influx of viable pathogen inoculum from sources outside a crop. Such prediction in a practical setting requires

  12. Development and validation of a quasi-Gaussian plume model for the transport of botanical spores

    NARCIS (Netherlands)

    Skelsey, P.; Holtslag, A.A.M.; Werf, van der W.

    2008-01-01

    Aerial dispersal of inoculum is the primary means of movement for many plant diseases. One of the challenges of modern decision support for plant health is to provide predictions of the influx of viable pathogen inoculum from sources outside a crop. Such prediction in a practical setting requires

  13. Removal of Bacillus anthracis sterne spore from commercial unpasteurized liquid egg white

    Science.gov (United States)

    Thermal pasteurization used by the egg industry for controlling vegetative cells of pathogens is ineffective for destroying endospores. There is a strong need in the agri-industries to develop effective intervention strategies to eliminate the possible bioterrorism threat from spore forming bacteria...

  14. Infection of Tribolium castaneum with Bacillus thuringiensis: Quantification of Bacterial Replication within Cadavers, Transmission via Cannibalism, and Inhibition of Spore Germination

    Science.gov (United States)

    Milutinović, Barbara; Höfling, Christina; Futo, Momir; Scharsack, Jörn P.

    2015-01-01

    Reproduction within a host and transmission to the next host are crucial for the virulence and fitness of pathogens. Nevertheless, basic knowledge about such parameters is often missing from the literature, even for well-studied bacteria, such as Bacillus thuringiensis, an endospore-forming insect pathogen, which infects its hosts via the oral route. To characterize bacterial replication success, we made use of an experimental oral infection system for the red flour beetle Tribolium castaneum and developed a flow cytometric assay for the quantification of both spore ingestion by the individual beetle larvae and the resulting spore load after bacterial replication and resporulation within cadavers. On average, spore numbers increased 460-fold, showing that Bacillus thuringiensis grows and replicates successfully in insect cadavers. By inoculating cadaver-derived spores and spores from bacterial stock cultures into nutrient medium, we next investigated outgrowth characteristics of vegetative cells and found that cadaver-derived bacteria showed reduced growth compared to bacteria from the stock cultures. Interestingly, this reduced growth was a consequence of inhibited spore germination, probably originating from the host and resulting in reduced host mortality in subsequent infections by cadaver-derived spores. Nevertheless, we further showed that Bacillus thuringiensis transmission was possible via larval cannibalism when no other food was offered. These results contribute to our understanding of the ecology of Bacillus thuringiensis as an insect pathogen. PMID:26386058

  15. Infection of Tribolium castaneum with Bacillus thuringiensis: quantification of bacterial replication within cadavers, transmission via cannibalism, and inhibition of spore germination.

    Science.gov (United States)

    Milutinović, Barbara; Höfling, Christina; Futo, Momir; Scharsack, Jörn P; Kurtz, Joachim

    2015-12-01

    Reproduction within a host and transmission to the next host are crucial for the virulence and fitness of pathogens. Nevertheless, basic knowledge about such parameters is often missing from the literature, even for well-studied bacteria, such as Bacillus thuringiensis, an endospore-forming insect pathogen, which infects its hosts via the oral route. To characterize bacterial replication success, we made use of an experimental oral infection system for the red flour beetle Tribolium castaneum and developed a flow cytometric assay for the quantification of both spore ingestion by the individual beetle larvae and the resulting spore load after bacterial replication and resporulation within cadavers. On average, spore numbers increased 460-fold, showing that Bacillus thuringiensis grows and replicates successfully in insect cadavers. By inoculating cadaver-derived spores and spores from bacterial stock cultures into nutrient medium, we next investigated outgrowth characteristics of vegetative cells and found that cadaver-derived bacteria showed reduced growth compared to bacteria from the stock cultures. Interestingly, this reduced growth was a consequence of inhibited spore germination, probably originating from the host and resulting in reduced host mortality in subsequent infections by cadaver-derived spores. Nevertheless, we further showed that Bacillus thuringiensis transmission was possible via larval cannibalism when no other food was offered. These results contribute to our understanding of the ecology of Bacillus thuringiensis as an insect pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Microbiological method for radiation sterilization (III). Development of identification software of spore-forming bacteria by using BBL CRYSTAL GP identification kit

    International Nuclear Information System (INIS)

    Hironiwa, Takayuki; Yamamoto, Yoko; Koshikawa, Tomihiko

    2004-01-01

    The part III in this title series describes the development of software for identification of spore-forming bacteria using the commercially available BBL CRYSTAL GP Identification Kit (Becton, Dickinson and Co., Ltd.), which is essentially for identification of Gram positive bacteria and is not always suitable for the spore-former in the radiation sterilization of medical devices. Isolation and identification of a spore-forming bacterium have to be confirmed by phase-contrast microscopy. The bacteria cultured overnight are to be inoculated in the Kit and cultured for 18-24 hr at 35-37 deg C with the lid attached by substrates for identification. Here, 30 substrates and probability of positive reactions to the substrates have been tested for spore-formers to make the computer software for final identification. The system is possible to identify 13 spp. of Bacillus, 4 of Paenibacillus, 2 of Brevibaccilus and 1 of Virgibacillus, which are the usual bioburden. For possible misidentification, re-isolation of the bacterium, prolonged culture, concentrated inoculation and re-consideration for ranking of identification the software provides are necessary as well as other identification approaches. Thus, as described in this series, the radio-resistance of, and radiation dose for, the bioburden can be evaluated more easily than hitherto, with use of the kits in radiation sterilization. (N.I.)

  17. Development of saliva-based exposure assays for detecting exposure to waterborne pathogens

    Science.gov (United States)

    Identifying which pathogens we are exposed to can be challenging because many types of pathogens can be found in water and many pathogens have similar symptoms. EPA scientists have developed a simple way to measure human exposure to waterborne pathogens.

  18. A method for the determination of bacterial spore DNA content based on isotopic labelling, spore germination and diphenylamine assay; ploidy of spores of several Bacillus species

    International Nuclear Information System (INIS)

    Hauser, P.M.; Karamata, D.

    1992-01-01

    A reliable method for measuring the spore DNA content, based on radioactive DNA labelling, spore germination in absence of DNA replication and diphenylamine assay, was developed. The accuracy of the method, within 10 - 15%, is adequate for determining the number of chromosomes per spore, provided that the genome size is known. B subtilis spores were shown to be invariably monogenomic, while those of larger bacilli Bacillus megaterium, Bacillus cereus and Bacillus thuringiensis, often, if not invariably, contain two genomes. Attempts to modify the spore DNA content of B subtilis by altering the richness of the sporulation medium, the sporulation conditions (liquid or solid medium), or by mutation, were apparently unsuccessful. An increase of spore size with medium richness, not accompanied by an increase in DNA content, was observed. The implication of the apparently species-specific spore ploidy and the influence of the sporulation conditions on spore size and shape are discussed

  19. Spore Preparation Protocol for Enrichment of Clostridia from Murine Intestine.

    Science.gov (United States)

    Velazquez, Eric M; Rivera-Chávez, Fabian; Bäumler, Andreas J

    2017-05-20

    In recent years, many spore-forming commensal Clostridia found in the gut have been discovered to promote host physiology, immune development, and protection against infections. We provide a detailed protocol for rapid enrichment of spore-forming bacteria from murine intestine. Briefly, contents from the intestinal cecum are collected aerobically, diluted and finally treated with chloroform to enrich for Clostridia spores.

  20. Waterline ATS B. globigii spore water disinfection data

    Data.gov (United States)

    U.S. Environmental Protection Agency — Disinfection of B. globigii spores (a non-pathogenic surrogate for B. anthracis) in clean and dirty water using the ATS-Waterline system, which uses ultraviolet...

  1. Role of gut pathogens in development of irritable bowel syndrome

    Directory of Open Access Journals (Sweden)

    Madhusudan Grover

    2014-01-01

    Full Text Available Acute infectious gastroenteritis is one of the most commonly identifiable risk factors for the development of irritable bowel syndrome (IBS. A number of bacterial, viral and parasitic pathogens have been found to be associated with the development of IBS and other functional gastrointestinal (GI disorders. Epidemiological studies have identified demographic and acute enteritis-related risk factors for the development of post-infectious-IBS (PI-IBS. Immune dysregulation, alterations in barrier function, serotonergic and mast cell activation have been identified as potential pathophysiological mechanisms. Additionally, variations in host genes involved in barrier function, antigen presentation and cytokine response have been associated with PI-IBS development. However, it is unknown whether specific pathogens have unique effects on long-term alterations in gut physiology or different pathogens converge to cause common alterations resulting in similar phenotype. The role of microbial virulence and pathogenicity factors in development of PI-IBS is also largely unknown. Additionally, alterations in host gut sensation, motility, secretion, and barrier function in PI-IBS need to be elucidated. Finally, both GI infections and antibiotics used to treat these infections can cause long-term alterations in host commensal microbiota. It is plausible that alteration in the commensal microbiome persists in a subset of patients predisposing them to develop PI-IBS.

  2. Developing cryotherapy to eliminate graft-transmissible pathogens in citrus

    Science.gov (United States)

    This article summarizes research being conducted as part of a project funded by the California Citrus Research Board to develop cryotherapy (freezing buds in liquid nitrogen, and then recovering them) as a viable method for elimination of graft transmissible pathogens from Citrus. There are current...

  3. Can Insects Develop Resistance to Insect Pathogenic Fungi?

    Science.gov (United States)

    Yaroslavtseva, Olga N.; Greig, Carolyn; Kryukov, Vadim Y.; Grizanova, Ekaterina V.; Mukherjee, Krishnendu; Vilcinskas, Andreas; Glupov, Viktor V.; Butt, Tariq M.

    2013-01-01

    Microevolutionary adaptations and mechanisms of fungal pathogen resistance were explored in a melanic population of the Greater wax moth, Galleria mellonella. Under constant selective pressure from the insect pathogenic fungus Beauveria bassiana, 25th generation larvae exhibited significantly enhanced resistance, which was specific to this pathogen and not to another insect pathogenic fungus, Metarhizium anisopliae. Defense and stress management strategies of selected (resistant) and non-selected (susceptible) insect lines were compared to uncover mechanisms underpinning resistance, and the possible cost of those survival strategies. We hypothesize that the insects developed a transgenerationally primed resistance to the fungus B. bassiana, a costly trait that was achieved not by compromising life-history traits but rather by prioritizing and re-allocating pathogen-species-specific augmentations to integumental front-line defenses that are most likely to be encountered by invading fungi. Specifically during B. bassiana infection, systemic immune defenses are suppressed in favour of a more limited but targeted repertoire of enhanced responses in the cuticle and epidermis of the integument (e.g. expression of the fungal enzyme inhibitor IMPI, and cuticular phenoloxidase activity). A range of putative stress-management factors (e.g. antioxidants) is also activated during the specific response of selected insects to B. bassiana but not M. anisopliae. This too occurs primarily in the integument, and probably contributes to antifungal defense and/or helps ameliorate the damage inflicted by the fungus or the host’s own immune responses. PMID:23560083

  4. [Bacterial spore--a new vaccine vehicle--a review].

    Science.gov (United States)

    Wang, Yanchun; Zhang, Zhaoshan

    2008-03-01

    Bacterial spores are robust and dormant life forms with formidable resistance properties. Spores of the genus Bacillus have been used for a long time as probiotics for oral bacteriotherapy both in humans and animals. Recently, genetically modified B. subtilis spores and B. anthracis spores have been used as indestructible delivery vehicles for vaccine antigens. They were used as vaccine vehicles or spore vaccine for oral immunization against tetanus and anthrax, and the results were very exciting. Unlike many second generation vaccine systems currently under development, bacterial spores offer heat stability and the flexibility for genetic manipulation. At the same time, they can elicit mucosal immune response by oral and nasal administration. This review focuses on the use of recombinant spores as vaccine delivery vehicles.

  5. Phosphorescence In Bacillus Spores

    National Research Council Canada - National Science Library

    Reinisch, Lou; Swartz, Barry A; Bronk, Burt V

    2003-01-01

    .... Our present work attempts to build on this approach for environmental applications. We have measured a change in the fluorescence spectra of suspensions of Bacillus bacteria between the vegetative bacteria and their spores at room temperature...

  6. The influence of microsporidian pathogens from commercially available lady beetles on larval development of the green lacewing, Chrysoperla carnea, in the absence of infection.

    Science.gov (United States)

    Fletcher, A; Bjørnson, S

    2018-02-02

    In North America, more than 70 species of natural enemies are available for pest control, including the aphid predators, Adalia bipunctata L. (two-spotted lady beetle) and Hippodamia convergens Guérin-Méneville (convergent lady beetle), and the generalist predator Chrysoperla carnea Stephens (green lacewing). The two lady beetle species are known to host microsporidian pathogens: Nosema adaliae was originally described from Adalia bipunctata and Tubulinosema hippodamiae from H. convergens. Microsporidia are spore-forming pathogens that typically produce chronic, debilitating disease. Because the spores of both pathogens are transovarially transmitted through beetle eggs, the predation behavior of lacewing larvae provides an opportunity for the transmission of these pathogens when infected lady beetles and lacewings share the same local environment. In this study, uninfected and microsporidia-infected eggs from A. bipunctata and H. convergens were offered to C. carnea larvae. The development of larvae that consumed N. adaliae-infected eggs was not affected, but larval development was prolonged by almost 3 days for those that consumed two or more T. hippodamiae-infected eggs. Prolonged larval development is considered to be costly because larvae remain vulnerable to cannibalization by sibling larvae or other predators. Longevity did not differ significantly between sexes of C. carnea, and the sex ratio of newly eclosed adults did not differ from the previously reported sex ratio of 1♂: 1♀. Upon examination by light microscopy at the end of the trial, two C. carnea larvae were infected with N. adaliae and none were infected with T. hippodamiae, suggesting that T. hippodamiae influenced lacewing larval development without establishing an infection. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. Ultraviolet-Resistant Bacterial Spores

    Science.gov (United States)

    Venkateswaran, Kasthuri; Newcombe, David; LaDuc, Myron T.; Osman, Shariff R.

    2007-01-01

    A document summarizes a study in which it was found that spores of the SAFR-032 strain of Bacillus pumilus can survive doses of ultraviolet (UV) radiation, radiation, and hydrogen peroxide in proportions much greater than those of other bacteria. The study was part of a continuing effort to understand the survivability of bacteria under harsh conditions and develop means of sterilizing spacecraft to prevent biocontamination of Mars that could interfere with the search for life there.

  8. Conservation of Male Sterility 2 function during spore and pollen wall development supports an evolutionarily early recruitment of a core component in the sporopollenin biosynthetic pathway.

    Science.gov (United States)

    Wallace, Simon; Chater, Caspar C; Kamisugi, Yasuko; Cuming, Andrew C; Wellman, Charles H; Beerling, David J; Fleming, Andrew J

    2015-01-01

    The early evolution of plants required the acquisition of a number of key adaptations to overcome physiological difficulties associated with survival on land. One of these was a tough sporopollenin wall that enclosed reproductive propagules and provided protection from desiccation and UV-B radiation. All land plants possess such walled spores (or their derived homologue, pollen). We took a reverse genetics approach, consisting of knock-out and complementation experiments to test the functional conservation of the sporopollenin-associated gene MALE STERILTY 2 (which is essential for pollen wall development in Arabidopsis thaliana) in the bryophyte Physcomitrella patens. Knock-outs of a putative moss homologue of the A. thaliana MS2 gene, which is highly expressed in the moss sporophyte, led to spores with highly defective walls comparable to that observed in the A. thaliana ms2 mutant, and extremely compromised germination. Conversely, the moss MS2 gene could not rescue the A. thaliana ms2 phenotype. The results presented here suggest that a core component of the biochemical and developmental pathway required for angiosperm pollen wall development was recruited early in land plant evolution but the continued increase in pollen wall complexity observed in angiosperms has been accompanied by divergence in MS2 gene function. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  9. Molecular mechanisms of pathogenicity: how do pathogenic microorganisms develop cross-kingdom host jumps?

    NARCIS (Netherlands)

    Baarlen, P. van; Belkum, A. van; Summerbell, R.C.; Crous, P.W.; Thomma, B.P.

    2007-01-01

    It is common knowledge that pathogenic viruses can change hosts, with avian influenza, the HIV, and the causal agent of variant Creutzfeldt-Jacob encephalitis as well-known examples. Less well known, however, is that host jumps also occur with more complex pathogenic microorganisms such as bacteria

  10. Mucosal delivery of antigens using adsorption to bacterial spores.

    Science.gov (United States)

    Huang, Jen-Min; Hong, Huynh A; Van Tong, Hoang; Hoang, Tran H; Brisson, Alain; Cutting, Simon M

    2010-01-22

    The development of new-generation vaccines has followed a number of strategic avenues including the use of live recombinant bacteria. Of these, the use of genetically engineered bacterial spores has been shown to offer promise as both a mucosal as well as a heat-stable vaccine delivery system. Spores of the genus Bacillus are currently in widespread use as probiotics enabling a case to be made for their safety. In this work we have discovered that the negatively charged and hydrophobic surface layer of spores provides a suitable platform for adsorption of protein antigens. Binding can be promoted under conditions of low pH and requires a potent combination of electrostatic and hydrophobic interactions between spore and immunogen. Using appropriately adsorbed spores we have shown that mice immunised mucosally can be protected against challenge with tetanus toxin, Clostridium perfringens alpha toxin and could survive challenge with anthrax toxin. In some cases protection is actually greater than using a recombinant vaccine. Remarkably, killed or inactivated spores appear equally effective as live spores. The spore appears to present a bound antigen in its native conformation promoting a cellular (T(h)1-biased) response coupled with a strong antibody response. Spores then, should be considered as mucosal adjuvants, most similar to particulate adjuvants, by enhancing responses against soluble antigens. The broad spectrum of immune responses elicited coupled with the attendant benefits of safety suggest that spore adsorption could be appropriate for improving the immunogenicity of some vaccines as well as the delivery of biotherapeutic molecules.

  11. Multi-Probe Investigation of Proteomic Structure of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Malkin, A J; Plomp, M; Leighton, T J; Vogelstein, B; Wheeler, K E

    2008-01-24

    Complete genome sequences are available for understanding biotransformation, environmental resistance and pathogenesis of microbial, cellular and pathogen systems. The present technological and scientific challenges are to unravel the relationships between the organization and function of protein complexes at cell, microbial and pathogens surfaces, to understand how these complexes evolve during the bacterial, cellular and pathogen life cycles, and how they respond to environmental changes, chemical stimulants and therapeutics. In particular, elucidating the molecular structure and architecture of human pathogen surfaces is essential to understanding mechanisms of pathogenesis, immune response, physicochemical interactions, environmental resistance and development of countermeasures against bioterrorist agents. The objective of this project was to investigate the architecture, proteomic structure, and function of bacterial spores through a combination of high-resolution in vitro atomic force microscopy (AFM) and AFM-based immunolabeling with threat-specific antibodies. Particular attention in this project was focused on spore forming Bacillus species including the Sterne vaccine strain of Bacillus anthracis and the spore forming near-neighbor of Clostridium botulinum, C. novyi-NT. Bacillus species, including B. anthracis, the causative agent of inhalation anthrax are laboratory models for elucidating spore structure/function. Even though the complete genome sequence is available for B. subtilis, cereus, anthracis and other species, the determination and composition of spore structure/function is not understood. Prof. B. Vogelstein and colleagues at the John Hopkins University have recently developed a breakthrough bacteriolytic therapy for cancer treatment (1). They discovered that intravenously injected Clostridium novyi-NT spores germinate exclusively within the avascular regions of tumors in mice and destroy advanced cancerous lesions. The bacteria were also

  12. Developments in Micro- and Nanotechnology for Foodborne Pathogen Detection.

    Science.gov (United States)

    Carlson, Krista; Misra, Manoranjan; Mohanty, Swomitra

    2018-01-01

    In response to the potential hazards associated with the globalization of the food industry, research has been focused on the development of new sensing techniques to provide the means of contamination detection at any stage in the food supply chain. The demand for on-site detection is growing as pre-emptive sensing of pathogens could eliminate foodborne-related outbreaks and associated healthcare costs. Reduction in food waste is also a driver for point-of-use (POU) sensing, from both an economic and environmental standpoint. The following review discusses the latest advancements in platforms that have the greatest potential for inexpensive, real-time detection, and identification of foodborne pathogens. Specific focus has been placed on the development techniques, which utilize micro- and nanoscale technology. Sample preparation-free techniques are also discussed, as the growing demand to enable POU sensing at any stage in the food supply chain will be a major driver toward the advancements of these nondestructive methods.

  13. Current pathogenic Escherichia coli foodborne outbreak cases and therapy development.

    Science.gov (United States)

    Yang, Shih-Chun; Lin, Chih-Hung; Aljuffali, Ibrahim A; Fang, Jia-You

    2017-08-01

    Food contamination by pathogenic microorganisms has been a serious public health problem and a cause of huge economic losses worldwide. Foodborne pathogenic Escherichia coli (E. coli) contamination, such as that with E. coli O157 and O104, is very common, even in developed countries. Bacterial contamination may occur during any of the steps in the farm-to-table continuum from environmental, animal, or human sources and cause foodborne illness. To understand the causes of the foodborne outbreaks by E. coli and food-contamination prevention measures, we collected and investigated the past 10 years' worldwide reports of foodborne E. coli contamination cases. In the first half of this review article, we introduce the infection and symptoms of five major foodborne diarrheagenic E. coli pathotypes: enteropathogenic E. coli (EPEC), Shiga toxin-producing E. coli/enterohemorrhagic E. coli (STEC/EHEC), Shigella/enteroinvasive E. coli (EIEC), enteroaggregative E. coli (EAEC), and enterotoxigenic E. coli (ETEC). In the second half of this review article, we introduce the foodborne outbreak cases caused by E. coli in natural foods and food products. Finally, we discuss current developments that can be applied to control and prevent bacterial food contamination.

  14. Development of a multi-pathogen enrichment broth for simultaneous growth of five common foodborne pathogens.

    Science.gov (United States)

    Chen, Juan; Tang, Junni; Bhunia, Arun K; Tang, Cheng; Wang, Changting; Shi, Hui

    2015-01-01

    The objective of the present study was to formulate a multi-pathogen enrichment broth which could support the simultaneous growth of five common foodborne pathogens (Salmonella enterica, Staphylococcus aureus, Shigella flexneri, Listeria monocytogenes and Escherichia coli O157:H7). The formulated broth SSSLE was composed of potassium tellurite, bile salt, lithium chloride, and sodium chloride as growth-inhibitors; glucose, esculin, mannitol and sodium pyruvate as growth-promoters. Compared with the respective specific selective enrichment broths, the individual growth pattern of each target pathogen in SSSLE was equal, or even better, except in the case of S. flexneri. In mixed-culture experiments, the gram-negative bacteria showed higher growth capabilities than the gram-positive bacteria after 8-h enrichment; however, the cell numbers after 24-h enrichment indicated that SSSLE could support the concurrent growth of five target pathogens irrespective of whether pathogens were inoculated initially at equal or unequal levels. For natural food samples under the high background flora, the final cell numbers enriched in SSSLE for five targets were enough to be detected by multiplex PCR. In conclusion, SSSLE was capable of supporting the growth of five target pathogens concurrently. The new broth formulated in this study has the potential of saving time, efforts and costs in multi-pathogen enrichment procedures.

  15. Development of an aquatic pathogen database (AquaPathogen X) and its utilization in tracking emerging fish virus pathogens in North America

    Science.gov (United States)

    Emmenegger, E.J.; Kentop, E.; Thompson, T.M.; Pittam, S.; Ryan, A.; Keon, D.; Carlino, J.A.; Ranson, J.; Life, R.B.; Troyer, R.M.; Garver, K.A.; Kurath, G.

    2011-01-01

    The AquaPathogen X database is a template for recording information on individual isolates of aquatic pathogens and is freely available for download (http://wfrc.usgs.gov). This database can accommodate the nucleotide sequence data generated in molecular epidemiological studies along with the myriad of abiotic and biotic traits associated with isolates of various pathogens (e.g. viruses, parasites and bacteria) from multiple aquatic animal host species (e.g. fish, shellfish and shrimp). The cataloguing of isolates from different aquatic pathogens simultaneously is a unique feature to the AquaPathogen X database, which can be used in surveillance of emerging aquatic animal diseases and elucidation of key risk factors associated with pathogen incursions into new water systems. An application of the template database that stores the epidemiological profiles of fish virus isolates, called Fish ViroTrak, was also developed. Exported records for two aquatic rhabdovirus species emerging in North America were used in the implementation of two separate web-accessible databases: the Molecular Epidemiology of Aquatic Pathogens infectious haematopoietic necrosis virus (MEAP-IHNV) database (http://gis.nacse.org/ihnv/) released in 2006 and the MEAP- viral haemorrhagic septicaemia virus (http://gis.nacse.org/vhsv/) database released in 2010.

  16. Size matters for violent discharge height and settling speed of Sphagnum spores: important attributes for dispersal potential.

    Science.gov (United States)

    Sundberg, Sebastian

    2010-02-01

    Initial release height and settling speed of diaspores are biologically controlled components which are key to modelling wind dispersal. Most Sphagnum (peat moss) species have explosive spore liberation. In this study, how capsule and spore sizes affect the height to which spores are propelled were measured, and how spore size and spore number of discharged particles relate to settling speed in the aspherical Sphagnum spores. Spore discharge and spore cloud development were filmed in a closed chamber (nine species). Measurements were taken from snapshots at three stages of cloud development. Settling speed of spores (14 species) and clusters were timed in a glass tube. The maximum discharge speed measured was 3.6 m s(-1). Spores reached a maximum height of 20 cm (average: 15 cm) above the capsule. The cloud dimensions at all stages were related positively to capsule size (R(2) = 0.58-0.65). Thus species with large shoots (because they have large capsules) have a dispersal advantage. Half of the spores were released as singles and the rest as clusters (usually two to four spores). Single spores settled at 0.84-1.86 cm s(-1), about 52 % slower than expected for spherical spores with the same diameters. Settling speed displayed a positive curvilinear relationship with spore size, close to predictions by Stokes' law for spherical spores with 68 % of the actual diameters. Light-coloured spores settled slower than dark spores. Settling speed of spore clusters agrees with earlier studies. Effective spore discharge and small, slowly settling spores appear particularly important for species in forested habitats. The spore discharge heights in Sphagnum are among the greatest for small, wind-dispersed propagules. The discharge heights and the slow settling of spores affect dispersal distances positively and may help to explain the wide distribution of most boreal Sphagnum species.

  17. High-Resolution Spore Coat Architecture and Assembly of Bacillus Spores

    Energy Technology Data Exchange (ETDEWEB)

    Malkin, A J; Elhadj, S; Plomp, M

    2011-03-14

    Elucidating the molecular architecture of bacterial and cellular surfaces and its structural dynamics is essential to understanding mechanisms of pathogenesis, immune response, physicochemical interactions, environmental resistance, and provide the means for identifying spore formulation and processing attributes. I will discuss the application of in vitro atomic force microscopy (AFM) for studies of high-resolution coat architecture and assembly of several Bacillus spore species. We have demonstrated that bacterial spore coat structures are phylogenetically and growth medium determined. We have proposed that strikingly different species-dependent coat structures of bacterial spore species are a consequence of sporulation media-dependent nucleation and crystallization mechanisms that regulate the assembly of the outer spore coat. Spore coat layers were found to exhibit screw dislocations and two-dimensional nuclei typically observed on inorganic and macromolecular crystals. This presents the first case of non-mineral crystal growth patterns being revealed for a biological organism, which provides an unexpected example of nature exploiting fundamental materials science mechanisms for the morphogenetic control of biological ultrastructures. We have discovered and validated, distinctive formulation-specific high-resolution structural spore coat and dimensional signatures of B. anthracis spores (Sterne strain) grown in different formulation condition. We further demonstrated that measurement of the dimensional characteristics of B. anthracis spores provides formulation classification and sample matching with high sensitivity and specificity. I will present data on the development of an AFM-based immunolabeling technique for the proteomic mapping of macromolecular structures on the B. anthracis surfaces. These studies demonstrate that AFM can probe microbial surface architecture, environmental dynamics and the life cycle of bacterial and cellular systems at near

  18. Fifth international fungus spore conference

    Energy Technology Data Exchange (ETDEWEB)

    Timberlake, W.E.

    1993-04-01

    This folio contains the proceedings of the Fifth International Fungal Spore Conference held August 17-21, 1991 at the Unicoi State Park at Helen, Georgia. The volume contains abstracts of each oral presentation as well as a collection of abstracts describing the poster sessions. Presentations were organized around the themes (1) Induction of Sporulation, (2) Nuclear Division, (3) Spore Formation, (4) Spore Release and Dispersal, and (4) Spore Germination.

  19. [Development and comparative evaluation of up-converting phosphor technology based lateral flow assay for rapid detection of Yersinia pestis, Bacillus anthracis spore and Brucella spp].

    Science.gov (United States)

    Li, Chunfeng; Zhang, Pingping; Wang, Xiaoying; Liu, Xiao; Zhao, Yong; Sun, Chongyun; Wang, Chengbin; Yang, Ruifu; Zhou, Lei

    2015-01-01

    To develop an up-converting phosphor technology based lateral flow (UPT-LF) assay for rapid and quantitative detection of Yersinia pestis, Bacillus anthracis spore and Brucella spp.and make the comparison with BioThreat Alert (BTA) test strips (Tetracore Inc., USA). Using up-converting phosphor nano-particles (UCP-NPs) as the bio-marker, three double-antibody-sandwich model based UPT-LF strips including Plague-UPT-LF, Anthrax-UPT-LF, Brucella-UPT-LF were prepared and its sensitivity, accuracy, linearity and specificity were determined by detecting 10(10), 10(9), 10(8), 10(7), 10(6), 10(5) and 0 CFU/ml series of concentrations of Y.pestis, B.anthracis, Brucella standards and other 27 kinds of 10(9) CFU/ml series of contrations of bacteria strains.Furthermore, the speed, sensitivity and accuracy of bacteria standards and simulated sample detection were compared between UPT-LF and BTA system. The detection limit of Plague-UPT-LF, Anthrax-UPT-LF and Brucella-LF was 10(5) CFU/ml. The CV of series of bacteria concentrations was ≤ 15%, and the r between lg (T/C-cut-off) and lg (concentration) was 0.996,0.998 and 0.999 (F values were 1 647.57, 743.51 and 1 822.17. All the P values were Brucella-LF were excellent, while that of Anthrax-UPT-LF was a little bit regretful because of non-specific reaction with two isolates of B. subtilis and one B.cereus. On-site evaluation showed the detection time of UPT-LF for all Y.pestis, B.anthracis spore and Brucella spp.was 33, 36 and 37 min, while BTA was 115, 115 and 111 min, which revealed the higher detection speed and sensitivity of UPT-LF comparing with BTA. The negative rate of two methods for blank standard was both 5/5, the sensitivity of UPT-LF for Y.pestis,B.anthracis spore and Brucella spp. was all 10(5) CFU/ml, then BTA was 10(6), 10(6) and 10(5) CFU/ml, respectively. The detection rate of UPT-LF for all three bacteria analog positive samples was 16/16, while BTA for B.anthracis was 7/16 only. The good performance

  20. Bacteria, mould and yeast spore inactivation studies by scanning electron microscope observations.

    Science.gov (United States)

    Rozali, Siti N M; Milani, Elham A; Deed, Rebecca C; Silva, Filipa V M

    2017-12-18

    Spores are the most resistant form of microbial cells, thus difficult to inactivate. The pathogenic or food spoilage effects of certain spore-forming microorganisms have been the primary basis of sterilization and pasteurization processes. Thermal sterilization is the most common method to inactivate spores present on medical equipment and foods. High pressure processing (HPP) is an emerging and commercial non-thermal food pasteurization technique. Although previous studies demonstrated the effectiveness of thermal and non-thermal spore inactivation, the in-depth mechanisms of spore inactivation are as yet unclear. Live and dead forms of two food spoilage bacteria, a mould and a yeast were examined using scanning electron microscopy before and after the inactivation treatment. Alicyclobacillus acidoterrestris and Geobacillus stearothermophilus bacteria are indicators of acidic foods pasteurization and sterilization processes, respectively. Neosartorya fischeri is a phyto-pathogenic mould attacking fruits. Saccharomyces cerevisiae is a yeast with various applications for winemaking, brewing, baking and the production of biofuel from crops (e.g. sugar cane). Spores of the four microbial species were thermally inactivated. Spores of S. cerevisiae were observed in the ascus and free form after thermal and HPP treatments. Different forms of damage and cell destruction were observed for each microbial spore. Thermal treatment inactivated bacterial spores of A. acidoterrestris and G. stearothermophilus by attacking the inner core of the spore. The heat first altered the membrane permeability allowing the release of intracellular components. Subsequently, hydration of spores, physicochemical modifications of proteins, flattening and formation of indentations occurred, with subsequent spore death. Regarding N. fischeri, thermal inactivation caused cell destruction and leakage of intracellular components. Both thermal and HPP treatments of S. cerevisiae free spores attacked

  1. Development of a proxy for past surface UV-B irradiation : A thermally assisted hydrolysis and methylation py-GC/MS method for the analysis of pollen and spores

    NARCIS (Netherlands)

    Blokker, Peter; Yeloff, Dan; Boelen, Peter; Broekman, Rob A; Rozema, Jelte

    2005-01-01

    A method was developed for the analysis of the UV-absorbing sporopollenin monomers p-coumaric acid and ferulic acid in very low numbers of pollen. This enables the analysis of pollen or spores from cultured plants, from herbarium collections, and from sediment, soil, and peat cores. The method

  2. Development of In situ hybridization and real-time PCR assays for the detection of Hepatospora eriocheir, a microsporidian pathogen in the Chinese mitten crab Eriocheir sinensis.

    Science.gov (United States)

    Ding, Z F; Chen, J Q; Lin, J; Zhu, X S; Xu, G H; Wang, R L; Meng, Q G; Wang, W

    2017-07-01

    A microsporidian parasite, Hepatospora eriocheir, is an emerging pathogen for the Chinese mitten crab Eriocheir sinensis. Currently, there is scant information about the way it transmits infection in the crustacean of commercial importance, including its pathogenesis, propagation and infection route in vivo. In this study, chromogenic in situ hybridization (ISH) and quantitative real-time PCR (qPCR) assays were developed to address this pressing need, and we provided an advance in the detection methods available. Pathogens can be seen in situ with associated lesions using ISH. Positive hybridization signals were noted inside the epithelial cells of the hepatopancreas, and putative free parasite spores were observed within the tubule lumen, which were associated with lesions detected by electron microscopy and haematoxylin and eosin (H&E) analysis. qPCR allows the determination of parasite loads in infected tissues, which is important for understanding disease progression and transmission. The hepatopancreas displayed the biggest statistical copy numbers among different tissues of infected crabs, confirming a tissue-specific pathogen infection characteristic. The qPCR assay also proved to be suitable for the diagnosis of asymptomatic carrier crabs. Combination of the two methods could facilitate the study of H. eriocheir infection mechanism in E. sinensis, enhance the early diagnosis of the pathogen and improve the management of microsporidian diseases in commercial crustaceans. © 2016 John Wiley & Sons Ltd.

  3. A Novel Spectroscopic Methodology for the Investigation of Individual Bacillus Spores

    National Research Council Canada - National Science Library

    Alexander, Troy A; Pellegrino, Paul; Gillespie, James B

    2005-01-01

    A methodology has been developed for the investigation of bacterial spores. Specifically, this method has been used to probe the spore coat composition of two different Bacillus stearothermophilus variants...

  4. Production of cross-kingdom oxylipins by pathogenic fungi: An update on their role in development and pathogenicity.

    Science.gov (United States)

    Fischer, Gregory J; Keller, Nancy P

    2016-03-01

    Oxylipins are a class of molecules derived from the incorporation of oxygen into polyunsaturated fatty acid substrates through the action of oxygenases. While extensively investigated in the context of mammalian immune responses, over the last decade it has become apparent that oxylipins are a common means of communication among and between plants, animals, and fungi to control development and alter host-microbe interactions. In fungi, some oxylipins are derived nonenzymatically while others are produced by lipoxygenases, cyclooxygenases, and monooxygenases with homology to plant and human enzymes. Recent investigations of numerous plant and human fungal pathogens have revealed oxylipins to be involved in the establishment and progression of disease. This review highlights oxylipin production by pathogenic fungi and their role in fungal development and pathogen/host interactions.

  5. Dothistroma septosporum: spore production and weather conditions

    Energy Technology Data Exchange (ETDEWEB)

    Dvorak, M.; Drapela, K.; Kankovsky, L.

    2012-11-01

    Dartmouth's septosporum, the causal agent of Dothistroma needle blight is a widespread fungus which infects more than 80 species of coniferous trees through the entire world. Spreading of the infection is strongly affected by climatic factors of each locality where it is recorded. We attempt to describe the concrete limiting climatic factors necessary for the releasing of conidia of D. septosporum and to find out the timing of its spore production within the year. For this purpose we used an automatic volumetric spore trap and an automatic meteorological station. We found that a minimum daily average temperature of 10 degree centigrade was necessary for any spore production, as well as a long period of high air humidity. The values obtained in the present study were a little bit higher than those previously published, which may arise questions about a possible changing trend of the behaviour in the development of the Dothistroma needle blight causal agent. We used autoregressive integrated moving average (ARIMA) models to predict the spore counts on the base of previous values of spore counts and dew point. For a locality from Hackerovka, the best ARIMA model was 1,0,0; and for a locality from Lanzhot, the best was 3,1,0. (Author) 19 refs.

  6. Intestinal Pathogenic Escherichia coli: Insights for Vaccine Development

    Directory of Open Access Journals (Sweden)

    Maricarmen Rojas-Lopez

    2018-03-01

    Full Text Available Diarrheal diseases are one of the major causes of mortality among children under five years old and intestinal pathogenic Escherichia coli (InPEC plays a role as one of the large causative groups of these infections worldwide. InPECs contribute significantly to the burden of intestinal diseases, which are a critical issue in low- and middle-income countries (Asia, Africa and Latin America. Intestinal pathotypes such as enteropathogenic E. coli (EPEC and enterotoxigenic E. coli (ETEC are mainly endemic in developing countries, while ETEC strains are the major cause of diarrhea in travelers to these countries. On the other hand, enterohemorrhagic E. coli (EHEC are the cause of large outbreaks around the world, mainly affecting developed countries and responsible for not only diarrheal disease but also severe clinical complications like hemorrhagic colitis and hemolytic uremic syndrome (HUS. Overall, the emergence of antibiotic resistant strains, the annual cost increase in the health care system, the high incidence of traveler diarrhea and the increased number of HUS episodes have raised the need for effective preventive treatments. Although the use of antibiotics is still important in treating such infections, non-antibiotic strategies are either a crucial option to limit the increase in antibiotic resistant strains or absolutely necessary for diseases such as those caused by EHEC infections, for which antibiotic therapies are not recommended. Among non-antibiotic therapies, vaccine development is a strategy of choice but, to date, there is no effective licensed vaccine against InPEC infections. For several years, there has been a sustained effort to identify efficacious vaccine candidates able to reduce the burden of diarrheal disease. The aim of this review is to summarize recent milestones and insights in vaccine development against InPECs.

  7. Comparative analysis of immune effects in mice model: Clonorchis sinensis cysteine protease generated from recombinant Escherichia coli and Bacillus subtilis spores.

    Science.gov (United States)

    Wu, Zhanshuai; Tang, Zeli; Shang, Mei; Zhao, Lu; Zhou, Lina; Kong, Xiangzhan; Lin, Zhipeng; Sun, Hengchang; Chen, Tingjin; Xu, Jin; Li, Xuerong; Huang, Yan; Yu, Xinbing

    2017-07-01

    Clonorchiasis remains a nonnegligible public health problem in endemic areas. Cysteine protease of Clonorchis sinensis (CsCP) plays indispensable roles in the parasitic physiology and pathology, and has been exploited as a promising drug and vaccine candidate. In recent years, development of spore-based vaccines against multiple pathogens has attracted many investigators' interest. In previous studies, the recombinant Escherichia coli (BL21) and Bacillus subtilis spores expressing CsCP have been successfully constructed, respectively. In this study, the immune effects of CsCP protein purified from recombinant BL21 (rCsCP) and B. subtilis spores presenting CsCP (B.s-CsCP) in Balb/c mice model were conducted with comparative analysis. Levels of specific IgG, IgG1 and IgG2a were significantly increased in sera from both rCsCP and B.s-CsCP intraperitoneally immunized mice. Additionally, recombinant spores expressing abundant fusion CsCP (0.03125 pg/spore) could strongly enhance the immunogenicity of CsCP with significantly higher levels of IgG and isotypes. Compared with rCsCP alone, intraperitoneal administration of mice with spores expressing CsCP achieved a better effect of fighting against C. sinensis infection by slowing down the process of fibrosis. Our results demonstrated that a combination of Th1/Th2 immune responses could be elicited by rCsCP, while spores displaying CsCP prominently induced Th1-biased specific immune responses, and the complex cytokine network maybe mediates protective immune responses against C. sinensis. This work further confirmed that the usage of B. subtilis spores displaying CsCP is an effective way to against C. sinensis.

  8. Role of visible light-activated photocatalyst on the reduction of anthrax spore-induced mortality in mice.

    Directory of Open Access Journals (Sweden)

    Jyh-Hwa Kau

    Full Text Available BACKGROUND: Photocatalysis of titanium dioxide (TiO(2 substrates is primarily induced by ultraviolet light irradiation. Anion-doped TiO(2 substrates were shown to exhibit photocatalytic activities under visible-light illumination, relative environmentally-friendly materials. Their anti-spore activity against Bacillus anthracis, however, remains to be investigated. We evaluated these visible-light activated photocatalysts on the reduction of anthrax spore-induced pathogenesis. METHODOLOGY/PRINCIPAL FINDINGS: Standard plating method was used to determine the inactivation of anthrax spore by visible light-induced photocatalysis. Mouse models were further employed to investigate the suppressive effects of the photocatalysis on anthrax toxin- and spore-mediated mortality. We found that anti-spore activities of visible light illuminated nitrogen- or carbon-doped titania thin films significantly reduced viability of anthrax spores. Even though the spore-killing efficiency is only approximately 25%, our data indicate that spores from photocatalyzed groups but not untreated groups have a less survival rate after macrophage clearance. In addition, the photocatalysis could directly inactivate lethal toxin, the major virulence factor of B. anthracis. In agreement with these results, we found that the photocatalyzed spores have tenfold less potency to induce mortality in mice. These data suggest that the photocatalysis might injury the spores through inactivating spore components. CONCLUSION/SIGNIFICANCE: Photocatalysis induced injuries of the spores might be more important than direct killing of spores to reduce pathogenicity in the host.

  9. Spore germination of fungi belonging to Aspergillus species under deep-sea conditions

    Digital Repository Service at National Institute of Oceanography (India)

    Damare, S.; Nagarajan, M.; Raghukumar, C.

    of fungal spores in the deep sea may face several obstacles like the mycostatic effect of seawater (Kirk, 1980), low temperature, elevated hydrostatic pressure and low nutrient conditions. A defining characteristic of spores is their ability to develop... hyphal colony. The first step in this is the spore germina- tion, which can be defined as the sequence of events that converts the resting/dormant spore into a rapidly growing germ tube from which the myce- lium is produced by elongation, septum formation...

  10. Macroalgal spore dysfunction: ocean acidification delays and weakens adhesion.

    Science.gov (United States)

    Guenther, Rebecca; Miklasz, Kevin; Carrington, Emily; Martone, Patrick T

    2018-04-01

    Early life stages of marine organisms are predicted to be vulnerable to ocean acidification. For macroalgae, reproduction and population persistence rely on spores to settle, adhere and continue the algal life cycle, yet the effect of ocean acidification on this critical life stage has been largely overlooked. We explicitly tested the biomechanical impact of reduced pH on early spore adhesion. We developed a shear flume to examine the effect of reduced pH on spore attachment time and strength in two intertidal rhodophyte macroalgae, one calcified (Corallina vancouveriensis) and one noncalcified (Polyostea robusta). Reduced pH delayed spore attachment of both species by 40%-52% and weakened attachment strength in C. vancouveriensis, causing spores to dislodge at lower flow-induced shear forces, but had no effect on the attachment strength of P. robusta. Results are consistent with our prediction that reduced pH disrupts proper curing and gel formation of spore adhesives (anionic polysaccharides and glycoproteins) via protonation and cation displacement, although experimental verification is needed. Our results demonstrate that ocean acidification negatively, and differentially, impacts spore adhesion in two macroalgae. If results hold in field conditions, reduced ocean pH has the potential to impact macroalgal communities via spore dysfunction, regardless of the physiological tolerance of mature thalli. © 2017 Phycological Society of America.

  11. Strategies for Wheat Stripe Rust Pathogenicity Identified by Transcriptome Sequencing.

    Directory of Open Access Journals (Sweden)

    Diana P Garnica

    Full Text Available Stripe rust caused by the fungus Puccinia striiformis f.sp. tritici (Pst is a major constraint to wheat production worldwide. The molecular events that underlie Pst pathogenicity are largely unknown. Like all rusts, Pst creates a specialized cellular structure within host cells called the haustorium to obtain nutrients from wheat, and to secrete pathogenicity factors called effector proteins. We purified Pst haustoria and used next-generation sequencing platforms to assemble the haustorial transcriptome as well as the transcriptome of germinated spores. 12,282 transcripts were assembled from 454-pyrosequencing data and used as reference for digital gene expression analysis to compare the germinated uredinospores and haustoria transcriptomes based on Illumina RNAseq data. More than 400 genes encoding secreted proteins which constitute candidate effectors were identified from the haustorial transcriptome, with two thirds of these up-regulated in this tissue compared to germinated spores. RT-PCR analysis confirmed the expression patterns of 94 effector candidates. The analysis also revealed that spores rely mainly on stored energy reserves for growth and development, while haustoria take up host nutrients for massive energy production for biosynthetic pathways and the ultimate production of spores. Together, these studies substantially increase our knowledge of potential Pst effectors and provide new insights into the pathogenic strategies of this important organism.

  12. Natural attenuation in a surface water channel and a coastal aquifer by monitoring presence and removal of indicator bacteria, pathogens and antibiotic resistance gene: model development

    Science.gov (United States)

    Masciopinto, Costantino; Visino, Fabrizio; Luprano, Maria Laura; Levantesi, Caterina; Tandoi, Valter

    2015-04-01

    The spreading of microbial contamination into the environment, represents a very relevant problem, which leads to an increasing health concern. For this reason, it is important to identify and characterize the extent of natural depuration in water environmental particularly for reducing the presence of faecal contamination indicator bacteria, pathogens and antibiotic resistance genes (ARG). In this study, the presence of the above reported microbial parameters was analyzed in a surface water channel and in a coastal aquifer in southern Italy (Ostuni) southern Italy, both affected by Ostuni municipal treatment plant effluents and by local run-off. Several samples were collected from surface water, flowing in channels, and from wells in our study area. In particular, the water samples were analyzed to detect 7 fecal contamination indicators (E. coli, total coliforms, Clostridium p. spores, somatic coliphages, Enterococci and heterotrophic bacteria), Salmonella spp and the presence of ARGs. The water samples were also tested for chemical constituents. Finally a mathematical model has been developed in order to simulate pathogen migration pathways in the fractured groundwater and corresponding possible mitigation of pathogens in pumping wells.

  13. Recent progress in developing proximity ligation assays for pathogen detection.

    Science.gov (United States)

    Greenwood, Christina; Johnson, Gemma; Dhillon, Harvinder S; Bustin, Stephen

    2015-01-01

    The effective management of infectious diseases depends on the early detection of the microbes responsible, since pathogens are most effectively eliminated in the initial stages of infection. Current immunodiagnostic methods lack the sensitivity for earliest possible diagnosis. Nucleic acid-based tests (NATs) are more sensitive, but the detection of microbial DNA does not definitively prove the presence of a viable microorganism capable of causing a given infection. Proximity assays combine the specificity of antibody-based detection of proteins with the sensitivity and dynamic range of NATs, and their use may allow earlier as well as more clinically relevant detection than is possible with current NATs or immunoassays. However, the full potential of proximity assays for pathogen detection remains to be fulfilled, mainly due to the challenges associated with identifying suitable antibodies and antibody combinations, sensitivity issues arising from non-specific interactions of proximity probes and the longer incubation times required to carry out the assays.

  14. Pollen and spore monitoring in the world.

    Science.gov (United States)

    Buters, J T M; Antunes, C; Galveias, A; Bergmann, K C; Thibaudon, M; Galán, C; Schmidt-Weber, C; Oteros, J

    2018-01-01

    Ambient air quality monitoring is a governmental duty that is widely carried out in order to detect non-biological ("chemical") components in ambient air, such as particles of world and to create an interactive visualization of their distribution. The method employed to collect information was based on: (a) a review of the recent and historical bibliography related to pollen and fungal spore monitoring, and (b) personal surveys of the managers of national and regional monitoring networks. The interactive application was developed using the R programming language. We have created an inventory of the active pollen and spore monitoring stations in the world. There are at least 879 active pollen monitoring stations in the world, most of which are in Europe (> 500). The prevalent monitoring method is based on the Hirst principle (> 600 stations). The inventory is visualised as an interactive and on-line map. It can be searched, its appearance can be adjusted to the users' needs and it is updated regularly, as new stations or changes to those that already exist can be submitted online. The map shows the current situation of pollen and spore monitoring and facilitates collaboration among those individuals who are interested in pollen and spore counts. It might also help to improve the monitoring of biological particles up to the current level employed for non-biological components.

  15. Development of a Selective Medium for the Fungal Pathogen Fusarium graminearum Using Toxoflavin Produced by the Bacterial Pathogen Burkholderia glumae

    Directory of Open Access Journals (Sweden)

    Boknam Jung

    2013-12-01

    Full Text Available The ascomycete fungus Fusarium graminearum is a major causal agent for Fusarium head blight in cereals and produces mycotoxins such as trichothecenes and zearalenone. Isolation of the fungal strains from air or cereals can be hampered by various other airborne fungal pathogens and saprophytic fungi. In this study, we developed a selective medium specific to F. graminearum using toxoflavin produced by the bacterial pathogen Burkholderia glumae. F. graminearum was resistant to toxoflavin, while other fungi were sensitive to this toxin. Supplementing toxoflavin into medium enhanced the isolation of F. graminearum from rice grains by suppressing the growth of saprophytic fungal species. In addition, a medium with or without toxoflavin exposed to wheat fields for 1 h had 84% or 25%, respectively, of colonies identified as F. graminearum. This selection medium provides an efficient tool for isolating F. graminearum, and can be adopted by research groups working on genetics and disease forecasting.

  16. Sensitizing Clostridium difficile Spores With Germinants on Skin and Environmental Surfaces Represents a New Strategy for Reducing Spores via Ambient Mechanisms

    Directory of Open Access Journals (Sweden)

    Michelle Marie Nerandzic

    2017-10-01

    Full Text Available Background: Clostridium difficile is a leading cause of healthcare-associated infections worldwide. Prevention of C. difficile transmission is challenging because spores are not killed by alcohol-based hand sanitizers or many commonly used disinfectants. One strategy to control spores is to induce germination, thereby rendering the spores more susceptible to benign disinfection measures and ambient stressors. Methods/Results: C. difficile spores germinated on skin after a single application of cholic acid-class bile salts and co-germinants; for 4 C. difficile strains, recovery of viable spores from skin was reduced by ~0.3 log10CFU to 2 log10CFU after 2 hours and ~1 log10CFU to >2.5 log 10CFU after 24 hours. The addition of taurocholic acid to 70% and 30% ethanol significantly enhanced reduction of viable spores on skin and on surfaces. Desiccation, and to a lesser extent the presence of oxygen, were identified as the stressors responsible for reductions of germinated spores on skin and surfaces. Additionally, germinated spores became susceptible to killing by pH 1.5 hydrochloric acid, suggesting that germinated spores that remain viable on skin and surfaces might be killed by gastric acid after ingestion. Antibiotic-treated mice did not become colonized after exposure to germinated spores, whereas 100% of mice became colonized after exposure to the same quantity of dormant spores. Conclusions: Germination could provide a new approach to reduce C. difficile spores on skin and in the environment and to render surviving spores less capable of causing infection. Our findings suggest that it may be feasible to develop alcohol-based hand sanitizers containing germinants that reduce spores on hands.

  17. Food Sensing: Aptamer-Based Trapping of Bacillus cereus Spores with Specific Detection via Real Time PCR in Milk.

    Science.gov (United States)

    Fischer, Christin; Hünniger, Tim; Jarck, Jan-Hinnerk; Frohnmeyer, Esther; Kallinich, Constanze; Haase, Ilka; Hahn, Ulrich; Fischer, Markus

    2015-09-16

    Aerobic spores pose serious problems for both food product manufacturers and consumers. Milk is particularly at risk and thus an important issue of preventive consumer protection and quality assurance. The spore-former Bacillus cereus is a food poisoning Gram-positive pathogen which mainly produces two different types of toxins, the diarrhea inducing and the emetic toxins. Reliable and rapid analytical assays for the detection of B. cereus spores are required, which could be achieved by combining in vitro generated aptamers with highly specific molecular biological techniques. For the development of routine bioanalytical approaches, already existing aptamers with high affinity to B. cereus spores have been characterized by surface plasmon resonance (SPR) spectroscopy and fluorescence microscopy in terms of their dissociation constants and selectivity. Dissociation constants in the low nanomolar range (from 5.2 to 52.4 nM) were determined. Subsequently, the characterized aptamers were utilized for the establishment and validation of an aptamer-based trapping technique in both milk simulating buffer and milk with fat contents between 0.3 and 3.5%. Thereby, enrichment factors of up to 6-fold could be achieved. It could be observed that trapping protocol and characterized aptamers were fully adaptable to the application in milk. Due to the fact that aptamer selectivity is limited, a highly specific real time PCR assay was utilized following trapping to gain a higher degree of selectivity.

  18. Development of an oligonucleotide-based microarray to detect multiple foodborne pathogens.

    Science.gov (United States)

    Suo, Biao; He, Yiping; Paoli, George; Gehring, Andrew; Tu, Shu-I; Shi, Xianming

    2010-04-01

    Escherichia coli O157:H7, Salmonella enterica, Listeria monocytogenes and Campylobacter jejuni are considered important pathogens causing the most food-related human illnesses worldwide. Current methods for pathogen detection have limitations in the effectiveness of identifying multiple foodborne pathogens. In this study, a pathogen detection microarray was developed using various 70-mer oligonucleotides specifically targeting the above pathogens. To reduce the cost of detection, each microarray chip was designed and fabricated to accommodate 12 identical arrays which could be used for screening up to 12 different samples. To achieve high detection sensitivity and specificity, target-specific DNA amplification instead of whole genome random amplification was used prior to microarray analysis. Combined with 14-plex PCR amplification of target sequences, the microarray unambiguously distinguished all 4 pathogens with a detection sensitivity of 1 x 10(-4) ng (approximately 20 copies) of each genomic DNA. Applied the assay to 39 fresh meat samples, 16 samples were found to be contaminated by either 1 or 2 of these pathogens. The co-occurrences of Salmonella and E. coli O157:H7, Salmonella and L. monocytogenes in the same meat samples were also observed. Overall, the microarray combined with multiplex PCR method was able to effectively screen single or multiple pathogens in food samples and to provide important genotypic information related to pathogen virulence.

  19. Lipoxygenase Activity Accelerates Programmed Spore Germination in Aspergillus fumigatus

    Directory of Open Access Journals (Sweden)

    Gregory J. Fischer

    2017-05-01

    Full Text Available The opportunistic human pathogen Aspergillus fumigatus initiates invasive growth through a programmed germination process that progresses from dormant spore to swollen spore (SS to germling (GL and ultimately invasive hyphal growth. We find a lipoxygenase with considerable homology to human Alox5 and Alox15, LoxB, that impacts the transitions of programmed spore germination. Overexpression of loxB (OE::loxB increases germination with rapid advance to the GL stage. However, deletion of loxB (ΔloxB or its signal peptide only delays progression to the SS stage in the presence of arachidonic acid (AA; no delay is observed in minimal media. This delay is remediated by the addition of the oxygenated AA oxylipin 5-hydroxyeicosatetraenoic acid (5-HETE that is a product of human Alox5. We propose that A. fumigatus acquisition of LoxB (found in few fungi enhances germination rates in polyunsaturated fatty acid-rich environments.

  20. Dynamic phase microscopy, a new method to detect viable and killed spores and to estimate the heterogeneity of spore populations

    Science.gov (United States)

    Tychinsky, Vladimir P.; Mulyukin, Andrey L.; Lisovskii, Vitalii V.; Nikolaev, Yury A.; Kretushev, Aleksander V.; Vyshenskaya, Tatyana V.; Suzina, Nataliya E.; Duda, Vitalii I.; El-Registan, Galina I.

    reversible: after cessation of heating, PT values became similar to dormant spores. So, DPM allowed us to track the first, reversible stage of activation, when a spore maintains the attributes of the dormant state. Under the conditions that favor germination (in the presence of nutrients), irreversible changes in the PT and spore diameter, d, were detectable in a single germinating spore and spore population. In addition, DPM allowed an easy estimation of the heterogeneity of spore populations. It is a great advantage of DPM that it makes possible to reveal the ability of spores to respond to various stimuli with or without further germination and outgrowth - the salient feature of a living cell. DPM may have a high potential in general microbiology and astrobiology, enabling to: (1) estimate the heterogeneity of spore populations either under standard conditions and subjected to solar radiation and simulated extraterrestrial factors; (2) to track a response of spores to changing conditions at the early germination stage, even if they do not enter further outgrowth; (3) to develop some approaches for monitoring studies and appraisal of the physiological state of dormant cells in situ, in samples of dry soils, permafrost, etc. regarded as models for searching life beyond the Earth.

  1. Comparative characterization of silver nanoparticles synthesized by spore extract of Bacillus subtilis and Geobacillus stearothermophilus

    Directory of Open Access Journals (Sweden)

    Seyed Mahdi Ghasemi

    2018-01-01

    Full Text Available Objective(s: Silver nanostructures have gathered remarkable attention due to their applications in diversefields. Researchers have recently demonstrated that bacterial spores are capable of reducing silver ions toelemental silver leading to formation of nanoparticles.Materials and Methods: In this study, spores of Bacillus subtilis and Geobacillus stearothermophilus wereemployed to produce silver nanoparticles (SNPs from silver nitrate (AgNO3 through a green synthesismethod. The production of SNPs by spores, heat inactivated spores (microcapsule and spore extracts wasmonitored and compared at wavelengths between 300 to 700 nm. The biosynthesized SNPs by spore extractswere characterized and confirmed by XRD and TEM analyses.Results: UV-Visible spectroscopy showed that the spore extracts were able to synthesize more SNPs thanthe other forms. The XRD pattern also revealed that the silver nanometals have crystalline structure withvarious topologies. The TEM micrographs showed polydispersed nanocrystal with dimensions ranging from30 to 90 nm and 15 to 50 nm produced by spore extracts of B. subtilis and G. stearothermophilus, respectively.Moreover, these biologically synthesized nanoparticles exhibited antimicrobial activity against differentopportunistic pathogens.Conclusion: This study suggests the bacterial spore extract as a safe, efficient, cost effective and eco-friendlymaterial for biosynthesis of SNPs.

  2. Spore Coat Architecture of Clostridium novyi-NT spores

    Energy Technology Data Exchange (ETDEWEB)

    Plomp, M; McCafferey, J; Cheong, I; Huang, X; Bettegowda, C; Kinzler, K; Zhou, S; Vogelstein, B; Malkin, A

    2007-05-07

    Spores of the anaerobic bacterium Clostridium novyi-NT are able to germinate in and destroy hypoxic regions of tumors in experimental animals. Future progress in this area will benefit from a better understanding of the germination and outgrowth processes that are essential for the tumorilytic properties of these spores. Towards this end, we have used both transmission electron microscopy and atomic force microscopy to determine the structure of dormant as well as germinating spores. We found that the spores are surrounded by an amorphous layer intertwined with honeycomb parasporal layers. Moreover, the spore coat layers had apparently self-assembled and this assembly was likely to be governed by crystal growth principles. During germination and outgrowth, the honeycomb layers as well as the underlying spore coat and undercoat layers sequentially dissolved until the vegetative cell was released. In addition to their implications for understanding the biology of C. novyi-NT, these studies document the presence of proteinaceous growth spirals in a biological organism.

  3. Optical and structural properties of plasma-treated Cordyceps bassiana spores as studied by circular dichroism, absorption, and fluorescence spectroscopy

    Science.gov (United States)

    Lee, Geon Joon; Sim, Geon Bo; Choi, Eun Ha; Kwon, Young-Wan; Kim, Jun Young; Jang, Siun; Kim, Seong Hwan

    2015-01-01

    To understand the killing mechanism of fungal spores by plasma treatment, the optical, structural, and biological properties of the insect pathogenic fungus Cordyceps bassiana spores were studied. A nonthermal atmospheric-pressure plasma jet (APPJ) was used to treat the spores in aqueous solution. Optical emission spectra of the APPJ acquired in air indicated emission peaks corresponding to hydroxyl radicals and atomic oxygen. When the APPJ entered the aqueous solution, additional reactive species were derived from the interaction of plasma radicals with the aqueous solution. Fluorescence and absorption spectroscopy confirmed the generation of hydroxyl radicals and hydrogen peroxide in the plasma-activated water (PAW). Spore counting showed that plasma treatment significantly reduced spore viability. Absorption spectroscopy, circular dichroism (CD) spectroscopy, and agarose gel electrophoresis of the DNA extracted from plasma-treated spores showed a reduction in spore DNA content. The magnitude of the dip in the CD spectrum was lower in the plasma-treated spores than in the control, indicating that plasma treatment causes structural modifications and/or damage to cellular components. Tryptophan fluorescence intensity was lower in the plasma-treated spores than in the control, suggesting that plasma treatment modified cell wall proteins. Changes in spore viability and DNA content were attributed to structural modification of the cell wall by reactive species coming from the APPJ and the PAW. Our results provided evidence that the plasma radicals and the derived reactive species play critical roles in fungal spore inactivation.

  4. Optical and structural properties of plasma-treated Cordyceps bassiana spores as studied by circular dichroism, absorption, and fluorescence spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Geon Joon, E-mail: gjlee@kw.ac.kr; Sim, Geon Bo; Choi, Eun Ha [Plasma Bioscience Research Center/Department of Electrical and Biological Physics, Kwangwoon University, Seoul 139-701 (Korea, Republic of); Kwon, Young-Wan [KU-KIST Graduate School of Converging Science and Technology, Korea University, Seoul 136-701 (Korea, Republic of); Kim, Jun Young; Jang, Siun; Kim, Seong Hwan, E-mail: piceae@naver.com [Department of Microbiology and Institute of Basic Sciences, Dankook University, Cheonan 330-714 (Korea, Republic of)

    2015-01-14

    To understand the killing mechanism of fungal spores by plasma treatment, the optical, structural, and biological properties of the insect pathogenic fungus Cordyceps bassiana spores were studied. A nonthermal atmospheric-pressure plasma jet (APPJ) was used to treat the spores in aqueous solution. Optical emission spectra of the APPJ acquired in air indicated emission peaks corresponding to hydroxyl radicals and atomic oxygen. When the APPJ entered the aqueous solution, additional reactive species were derived from the interaction of plasma radicals with the aqueous solution. Fluorescence and absorption spectroscopy confirmed the generation of hydroxyl radicals and hydrogen peroxide in the plasma-activated water (PAW). Spore counting showed that plasma treatment significantly reduced spore viability. Absorption spectroscopy, circular dichroism (CD) spectroscopy, and agarose gel electrophoresis of the DNA extracted from plasma-treated spores showed a reduction in spore DNA content. The magnitude of the dip in the CD spectrum was lower in the plasma-treated spores than in the control, indicating that plasma treatment causes structural modifications and/or damage to cellular components. Tryptophan fluorescence intensity was lower in the plasma-treated spores than in the control, suggesting that plasma treatment modified cell wall proteins. Changes in spore viability and DNA content were attributed to structural modification of the cell wall by reactive species coming from the APPJ and the PAW. Our results provided evidence that the plasma radicals and the derived reactive species play critical roles in fungal spore inactivation.

  5. The search and identification of the new immunodiagnostic targets of bacillus anthracis spore

    International Nuclear Information System (INIS)

    Biketov, S.; Dunaytsev, I.; Baranova, E.; Marinin, L.; Dyatlov, I.

    2009-01-01

    Spores of Bacillus anthracis have been used as bio warfare agent to bio terrorize purposes. As efficiency of anti-epidemic measures included urgent prevention and treatment is determined by terms within which the bio agent is identified. Direct and rapid spore detection by antibodies based detection system is very attractive alternative to current PCR-based assays or routine phenotyping which are the most accurate but are also complex, time-consumption and expensive. The main difficulty with respect to such kind of anthrax spores detection is a cross-reaction with spores of closely related bacteria. For development of species-specific antibodies to anthrax spores recombinant scFvs or hybridoma technique were used. In both case surface spore antigens contained species-specific epitopes are need. Among exosporium proteins only ExsF(BxpB), ExsK and SoaA are specific to B.cereus group. On the surface of B. anthracis spores, a unique tetrasaccharides containing an novel monosaccharide - anthrose, was discovered. It was shown that anthrose can be serving as species-specific target for B. anthracis spores detection. We have revealed that EA1 isolated from spore of Russians strain STI-1 contain carbohydrate which formed species-specific epitopes and determine immunogenicity of this antigen. Antibodies to this antigen specifically recognized the surface target of B. anthracis spores and do not reacted with others Bacillus spore. Based on these antibodies we developed the test-systems in different formats for rapid direct detection and identification of B. anthracis spores. The results of trial these test-systems with using more than 50 different Bacillus strains were indicated that carbohydrate of EA1 isolated from spore is effective immunodiagnostic target for anthrax spores bio detection.(author)

  6. Deposition of Bacteria and Bacterial Spores by Bathroom Hot Air Hand Dryers.

    Science.gov (United States)

    Del Carmen Huesca-Espitia, Luz; Aslanzadeh, Jaber; Feinn, Richard; Joseph, Gabrielle; Murray, Thomas S; Setlow, Peter

    2018-02-09

    Hot air hand dryers in multiple men's and women's bathrooms in 3 basic science research areas in an academic health center were screened for their deposition on plates of: i) total bacteria, some of which were identified; and ii) a kanamycin resistant Bacillus subtilis strain, PS533, spores of which are produced in large amounts in one basic science research laboratory. Plates exposed to hand dryer air for 30 seconds averaged 18-60 colonies/plate but interior hand dryer nozzle surfaces had minimal bacterial levels, plates exposed to bathroom air for 2 minutes with hand dryers off averaged ≤1 colony, and plates exposed to bathroom air moved by a small fan for 20 minutes had averages of 15 and 12 colonies/plate in two buildings tested. Retrofitting hand dryers with HEPA filters reduced bacterial deposition by hand dryers ∼4-fold, and potential human pathogens were recovered from plates exposed to hand dryer air whether or not a HEPA filter was present, and from bathroom air moved by a small fan. Spore-forming colonies, identified as B. subtilis PS533 averaged ∼2.5-5% of bacteria deposited by hand dryers throughout basic research areas examined regardless of distance from the spore forming laboratory, and these were almost certainly deposited as spores. Comparable results were obtained when bathroom air was sampled for spores. These results indicate that many kinds of bacteria, including potential pathogens and spores, can be deposited on hands exposed to bathroom hand dryers, and that spores could be dispersed throughout buildings and deposited on hands by hand dryers. Importance While there is evidence that bathroom hand dryers can disperse bacteria from hands or deposit bacteria on surfaces, including recently washed hands, there is less information on: i) the organisms dispersed by hand dryers; ii) if hand dryers provide a reservoir of bacteria or simply blow large amounts of bacterially contaminated air; and iii) if bacterial spores are deposited on

  7. Canine bacterial urinary tract infections: new developments in old pathogens.

    Science.gov (United States)

    Thompson, Mary F; Litster, Annette L; Platell, Joanne L; Trott, Darren J

    2011-10-01

    Uncomplicated bacterial urinary tract infections (UTIs) occur commonly in dogs. Persistent or recurrent infections are reported less frequently. They typically occur in dogs with an underlying disease and are sometimes asymptomatic, especially in dogs with predisposing chronic disease. Escherichia coli is the organism most frequently cultured in both simple and complicated UTIs. Organisms such as Enterococcus spp. and Pseudomonas spp. are less common in uncomplicated UTI, but become increasingly prominent in dogs with recurrent UTI. The ability of bacteria to acquire resistance to antimicrobials and/or to evade host immune defence mechanisms is vital for persistence in the urinary tract. Antimicrobial therapy limitations and bacterial strains with such abilities require novel control strategies. Sharing of resistant bacteria between humans and dogs has been recently documented and is of particular concern for E. coli O25b:H4-ST131 strains that are both virulent and multi-drug resistant. The epidemiology of complicated UTIs, pathogenic traits of uropathogens and new therapeutic concepts are outlined in this review. Copyright © 2011. Published by Elsevier Ltd.

  8. Nanoscale Structural and Mechanical Analysis of Bacillus anthracis Spores Inactivated with Rapid Dry Heating

    Science.gov (United States)

    Felker, Daniel L.; Burggraf, Larry W.

    2014-01-01

    Effective killing of Bacillus anthracis spores is of paramount importance to antibioterrorism, food safety, environmental protection, and the medical device industry. Thus, a deeper understanding of the mechanisms of spore resistance and inactivation is highly desired for developing new strategies or improving the known methods for spore destruction. Previous studies have shown that spore inactivation mechanisms differ considerably depending upon the killing agents, such as heat (wet heat, dry heat), UV, ionizing radiation, and chemicals. It is believed that wet heat kills spores by inactivating critical enzymes, while dry heat kills spores by damaging their DNA. Many studies have focused on the biochemical aspects of spore inactivation by dry heat; few have investigated structural damages and changes in spore mechanical properties. In this study, we have inactivated Bacillus anthracis spores with rapid dry heating and performed nanoscale topographical and mechanical analysis of inactivated spores using atomic force microscopy (AFM). Our results revealed significant changes in spore morphology and nanomechanical properties after heat inactivation. In addition, we also found that these changes were different under different heating conditions that produced similar inactivation probabilities (high temperature for short exposure time versus low temperature for long exposure time). We attributed the differences to the differential thermal and mechanical stresses in the spore. The buildup of internal thermal and mechanical stresses may become prominent only in ultrafast, high-temperature heat inactivation when the experimental timescale is too short for heat-generated vapor to efficiently escape from the spore. Our results thus provide direct, visual evidences of the importance of thermal stresses and heat and mass transfer to spore inactivation by very rapid dry heating. PMID:24375142

  9. Three non-aspartate amino acid mutations in the ComA Response regulator receiver motif severely decrease surfactin production, competence development and spore formation in Bacillus subtilis.

    Science.gov (United States)

    Wang, Xiaoyu; Luo, Chuping; Liu, Youzhou; Nie, Yafeng; Liu, Yongfeng; Zhang, Rongsheng; Chen, Zhiyi

    2010-02-01

    Bacillus subtilis strains produce a broad spectrum of bioactive peptides. The lipopeptide surfactin belongs to one wellknown class, which includes amphiphilic membrane-active biosurfactants and peptide antibiotics. Both the srfA promoter and the ComP-ComA signal transduction system are an important part of the factor that results in the production of surfactin. Bs-M49, obtained by means of low-energy ion implantation in wild-type Bs-916, produced significantly lower levels of surfactin, and had no obvious effects against R. solani. Occasionally, we found strain Bs- M49 decreased spore formation and the development of competence. Blast comparison of the sequences from Bs- 916 and M49 indicate that there is no difference in the srfA operon promoter PsrfA, but there are differences in the coding sequence of the comA gene. These differences result in three missense mutations within the M49 ComA protein. RT-PCR analyses results showed that the expression levels of selected genes involved in competence and sporulation in both the wild-type Bs-916 and mutant M49 strains were significantly different. When we integrated the comA ORF into the chromosome of M49 at the amyE locus, M49 restored hemolytic activity and antifungal activity. Then, HPLC analyses results also showed the comA-complemented strain had a similar ability to produce surfactin with wild-type strain Bs-916. These data suggested that the mutation of three key amino acids in ComA greatly affected the biological activity of Bacillus subtilis. ComA protein 3D structure prediction and motif search prediction indicated that ComA has two obvious motifs common to response regulator proteins, which are the Nterminal response regulator receiver motif and the Cterminal helix-turn-helix motif. The three residues in the ComA N-terminal portion may be involved in phosphorylation activation mechanism. These structural prediction results implicate that three mutated residues in the ComA protein may play an important role in

  10. A Clostridium difficile alanine racemase affects spore germination and accommodates serine as a substrate.

    Science.gov (United States)

    Shrestha, Ritu; Lockless, Steve W; Sorg, Joseph A

    2017-06-23

    Clostridium difficile has become one of the most common bacterial pathogens in hospital-acquired infections in the United States. Although C. difficile is strictly anaerobic, it survives in aerobic environments and transmits between hosts via spores. C. difficile spore germination is triggered in response to certain bile acids and glycine. Although glycine is the most effective co-germinant, other amino acids can substitute with varying efficiencies. Of these, l-alanine is an effective co-germinant and is also a germinant for most bacterial spores. Many endospore-forming bacteria embed alanine racemases into their spore coats, and these enzymes are thought to convert the l-alanine germinant into d-alanine, a spore germination inhibitor. Although the C. difficile Alr2 racemase is the sixth most highly expressed gene during C. difficile spore formation, a previous study reported that Alr2 has little to no role in germination of C. difficile spores in rich medium. Here, we hypothesized that Alr2 could affect C. difficile l-alanine-induced spore germination in a defined medium. We found that alr2 mutant spores more readily germinate in response to l-alanine as a co-germinant. Surprisingly, d-alanine also functioned as a co-germinant. Moreover, we found that Alr2 could interconvert l- and d-serine and that Alr2 bound to l- and d-serine with ∼2-fold weaker affinity to that of l- and d-alanine. Finally, we demonstrate that l- and d-serine are also co-germinants for C. difficile spores. These results suggest that C. difficile spores can respond to a diverse set of amino acid co-germinants and reveal that Alr2 can accommodate serine as a substrate. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. The Food Production Environment and the Development of Antimicrobial Resistance in Human Pathogens of Animal Origin

    Directory of Open Access Journals (Sweden)

    Manjusha Lekshmi

    2017-03-01

    Full Text Available Food-borne pathogens are a serious human health concern worldwide, and the emergence of antibiotic-resistant food pathogens has further confounded this problem. Once-highly-efficacious antibiotics are gradually becoming ineffective against many important pathogens, resulting in severe treatment crises. Among several reasons for the development and spread of antimicrobial resistance, their overuse in animal food production systems for purposes other than treatment of infections is prominent. Many pathogens of animals are zoonotic, and therefore any development of resistance in pathogens associated with food animals can spread to humans through the food chain. Human infections by antibiotic-resistant pathogens such as Campylobacter spp., Salmonella spp., Escherichia coli and Staphylococcus aureus are increasing. Considering the human health risk due to emerging antibiotic resistance in food animal–associated bacteria, many countries have banned the use of antibiotic growth promoters and the application in animals of antibiotics critically important in human medicine. Concerted global efforts are necessary to minimize the use of antimicrobials in food animals in order to control the development of antibiotic resistance in these systems and their spread to humans via food and water.

  12. Architecture and Assembly of the Bacillus subtilis Spore Coat

    Science.gov (United States)

    Plomp, Marco; Carroll, Alicia Monroe; Setlow, Peter; Malkin, Alexander J.

    2014-01-01

    Bacillus spores are encased in a multilayer, proteinaceous self-assembled coat structure that assists in protecting the bacterial genome from stresses and consists of at least 70 proteins. The elucidation of Bacillus spore coat assembly, architecture, and function is critical to determining mechanisms of spore pathogenesis, environmental resistance, immune response, and physicochemical properties. Recently, genetic, biochemical and microscopy methods have provided new insight into spore coat architecture, assembly, structure and function. However, detailed spore coat architecture and assembly, comprehensive understanding of the proteomic composition of coat layers, and specific roles of coat proteins in coat assembly and their precise localization within the coat remain in question. In this study, atomic force microscopy was used to probe the coat structure of Bacillus subtilis wild type and cotA, cotB, safA, cotH, cotO, cotE, gerE, and cotE gerE spores. This approach provided high-resolution visualization of the various spore coat structures, new insight into the function of specific coat proteins, and enabled the development of a detailed model of spore coat architecture. This model is consistent with a recently reported four-layer coat assembly and further adds several coat layers not reported previously. The coat is organized starting from the outside into an outermost amorphous (crust) layer, a rodlet layer, a honeycomb layer, a fibrous layer, a layer of “nanodot” particles, a multilayer assembly, and finally the undercoat/basement layer. We propose that the assembly of the previously unreported fibrous layer, which we link to the darkly stained outer coat seen by electron microscopy, and the nanodot layer are cotH- and cotE- dependent and cotE-specific respectively. We further propose that the inner coat multilayer structure is crystalline with its apparent two-dimensional (2D) nuclei being the first example of a non-mineral 2D nucleation crystallization

  13. Architecture and assembly of the Bacillus subtilis spore coat.

    Science.gov (United States)

    Plomp, Marco; Carroll, Alicia Monroe; Setlow, Peter; Malkin, Alexander J

    2014-01-01

    Bacillus spores are encased in a multilayer, proteinaceous self-assembled coat structure that assists in protecting the bacterial genome from stresses and consists of at least 70 proteins. The elucidation of Bacillus spore coat assembly, architecture, and function is critical to determining mechanisms of spore pathogenesis, environmental resistance, immune response, and physicochemical properties. Recently, genetic, biochemical and microscopy methods have provided new insight into spore coat architecture, assembly, structure and function. However, detailed spore coat architecture and assembly, comprehensive understanding of the proteomic composition of coat layers, and specific roles of coat proteins in coat assembly and their precise localization within the coat remain in question. In this study, atomic force microscopy was used to probe the coat structure of Bacillus subtilis wild type and cotA, cotB, safA, cotH, cotO, cotE, gerE, and cotE gerE spores. This approach provided high-resolution visualization of the various spore coat structures, new insight into the function of specific coat proteins, and enabled the development of a detailed model of spore coat architecture. This model is consistent with a recently reported four-layer coat assembly and further adds several coat layers not reported previously. The coat is organized starting from the outside into an outermost amorphous (crust) layer, a rodlet layer, a honeycomb layer, a fibrous layer, a layer of "nanodot" particles, a multilayer assembly, and finally the undercoat/basement layer. We propose that the assembly of the previously unreported fibrous layer, which we link to the darkly stained outer coat seen by electron microscopy, and the nanodot layer are cotH- and cotE- dependent and cotE-specific respectively. We further propose that the inner coat multilayer structure is crystalline with its apparent two-dimensional (2D) nuclei being the first example of a non-mineral 2D nucleation crystallization

  14. Bacillus amyloliquefaciens Spore Production Under Solid-State Fermentation of Lignocellulosic Residues.

    Science.gov (United States)

    Berikashvili, Violet; Sokhadze, Kakha; Kachlishvili, Eva; Elisashvili, Vladimir; Chikindas, Michael L

    2017-12-16

    This study was conducted to elucidate cultivation conditions determining Bacillus amyloliquefaciens B-1895 growth and enhanced spore formation during the solid-state fermentation (SSF) of agro-industrial lignocellulosic biomasses. Among the tested growth substrates, corncobs provided the highest yield of spores (47 × 10 10 spores g -1 biomass) while the mushroom spent substrate and sunflower oil mill appeared to be poor growth substrates for spore formation. Maximum spore yield (82 × 10 10 spores g -1 biomass) was achieved when 15 g corncobs were moistened with 60 ml of the optimized nutrient medium containing 10 g peptone, 2 g KH 2 PO 4 , 1 g MgSO 4 ·7H 2 O, and 1 g NaCl per 1 l of distilled water. The cheese whey usage for wetting of lignocellulosic substrate instead water promoted spore formation and increased the spore number to 105 × 10 10 spores g -1 . Addition to the cheese whey of optimized medium components favored sporulation process. The feasibility of developed medium and strategy was shown in scaled up SSF of corncobs in polypropylene bags since yield of 10 × 10 11 spores per gram of dry biomass was achieved. In the SSF of lignocellulose, B. amyloliquefaciens B-1895 secreted comparatively high cellulase and xylanase activities to ensure good growth of the bacterial culture.

  15. Predicting Development of an Epidemics on Cultivar Mixtures

    DEFF Research Database (Denmark)

    Østergård, Hanne

    1983-01-01

    A mathematical model for the development of an epidemic on a plant cultivar mixture illustrates the influence of the infection efficiency, spore production rate, proportion of deposited spores, frequency of autodeposition, and composition of the mixture on the genetic composition of the pathogen......), and finally mixing fields instead of plants. A relation was found between the long-term rate of disease increase of a pathotype and its number of virulence genes, and this relation was used for evaluating the different strategies....

  16. Improvement of Biological Indicators by Uniformly Distributing Bacillus subtilis Spores in Monolayers To Evaluate Enhanced Spore Decontamination Technologies.

    Science.gov (United States)

    Raguse, Marina; Fiebrandt, Marcel; Stapelmann, Katharina; Madela, Kazimierz; Laue, Michael; Lackmann, Jan-Wilm; Thwaite, Joanne E; Setlow, Peter; Awakowicz, Peter; Moeller, Ralf

    2016-01-22

    Novel decontamination technologies, including cold low-pressure plasma and blue light (400 nm), are promising alternatives to conventional surface decontamination methods. However, the standardization of the assessment of such sterilization processes remains to be accomplished. Bacterial endospores of the genera Bacillus and Geobacillus are frequently used as biological indicators (BIs) of sterility. Ensuring standardized and reproducible BIs for reliable testing procedures is a significant problem in industrial settings. In this study, an electrically driven spray deposition device was developed, allowing fast, reproducible, and homogeneous preparation of Bacillus subtilis 168 spore monolayers on glass surfaces. A detailed description of the structural design as well as the operating principle of the spraying device is given. The reproducible formation of spore monolayers of up to 5 × 10(7) spores per sample was verified by scanning electron microscopy. Surface inactivation studies revealed that monolayered spores were inactivated by UV-C (254 nm), low-pressure argon plasma (500 W, 10 Pa, 100 standard cubic cm per min), and blue light (400 nm) significantly faster than multilayered spores were. We have thus succeeded in the uniform preparation of reproducible, highly concentrated spore monolayers with the potential to generate BIs for a variety of nonpenetrating surface decontamination techniques. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  17. Sterilization of hydrogen peroxide resistant bacterial spores with stabilized chlorine dioxide.

    Science.gov (United States)

    Friedline, Anthony; Zachariah, Malcolm; Middaugh, Amy; Heiser, Matt; Khanna, Neeraj; Vaishampayan, Parag; Rice, Charles V

    2015-01-01

    Bacillus pumilus SAFR-032 spores isolated from a clean room environment are known to exhibit enhanced resistance to peroxide, desiccation, UV radiation and chemical disinfection than other spore-forming bacteria. The survival of B. pumilus SAFR-032 spores to standard clean room sterilization practices requires development of more stringent disinfection agents. Here, we report the effects of a stabilized chlorine dioxide-based biocidal agent against spores of B. pumilus SAFR-032 and Bacillus subtilis ATCC 6051. Viability was determined via CFU measurement after exposure. Chlorine dioxide demonstrated efficacy towards sterilization of spores of B. pumilus SAFR-032 equivalent or better than exposure to hydrogen peroxide. These results indicate efficacy of chlorine dioxide delivered through a stabilized chlorine dioxide product as a means of sterilization of peroxide- and UV-resistant spores.

  18. Fighting Ebola with novel spore decontamination technologies for the military

    Science.gov (United States)

    Doona, Christopher J.; Feeherry, Florence E.; Kustin, Kenneth; Olinger, Gene G.; Setlow, Peter; Malkin, Alexander J.; Leighton, Terrance

    2015-01-01

    Recently, global public health organizations such as Doctors without Borders (MSF), the World Health Organization (WHO), Public Health Canada, National Institutes of Health (NIH), and the U.S. government developed and deployed Field Decontamination Kits (FDKs), a novel, lightweight, compact, reusable decontamination technology to sterilize Ebola-contaminated medical devices at remote clinical sites lacking infra-structure in crisis-stricken regions of West Africa (medical waste materials are placed in bags and burned). The basis for effectuating sterilization with FDKs is chlorine dioxide (ClO2) produced from a patented invention developed by researchers at the US Army Natick Soldier RD&E Center (NSRDEC) and commercialized as a dry mixed-chemical for bacterial spore decontamination. In fact, the NSRDEC research scientists developed an ensemble of ClO2 technologies designed for different applications in decontaminating fresh produce; food contact and handling surfaces; personal protective equipment; textiles used in clothing, uniforms, tents, and shelters; graywater recycling; airplanes; surgical instruments; and hard surfaces in latrines, laundries, and deployable medical facilities. These examples demonstrate the far-reaching impact, adaptability, and versatility of these innovative technologies. We present herein the unique attributes of NSRDEC’s novel decontamination technologies and a Case Study of the development of FDKs that were deployed in West Africa by international public health organizations to sterilize Ebola-contaminated medical equipment. FDKs use bacterial spores as indicators of sterility. We review the properties and structures of spores and the mechanisms of bacterial spore inactivation by ClO2. We also review mechanisms of bacterial spore inactivation by novel, emerging, and established non-thermal technologies for food preservation, such as high pressure processing, irradiation, cold plasma, and chemical sanitizers, using an array of Bacillus

  19. A novel method for standardized application of fungal spore coatings for mosquito exposure bioassays.

    Science.gov (United States)

    Farenhorst, Marit; Knols, Bart G J

    2010-01-20

    Interest in the use of fungal entomopathogens against malaria vectors is growing. Fungal spores infect insects via the cuticle and can be applied directly on the insect to evaluate infectivity. For flying insects such as mosquitoes, however, application of fungal suspensions on resting surfaces is more realistic and representative of field settings. For this type of exposure, it is essential to apply specific amounts of fungal spores homogeneously over a surface for testing the effects of fungal dose and exposure time. Contemporary methods such as spraying or brushing spore suspensions onto substrates do not produce the uniformity and consistency that standardized laboratory assays require. Two novel fungus application methods using equipment developed in the paint industry are presented and compared. Wired, stainless steel K-bars were tested and optimized for coating fungal spore suspensions onto paper substrates. Different solvents and substrates were evaluated. Two types of coating techniques were compared, i.e. manual and automated coating. A standardized bioassay set-up was designed for testing coated spores against malaria mosquitoes. K-bar coating provided consistent applications of spore layers onto paper substrates. Viscous Ondina oil formulations were not suitable and significantly reduced spore infectivity. Evaporative Shellsol T solvent dried quickly and resulted in high spore infectivity to mosquitoes. Smooth proofing papers were the most effective substrate and showed higher infectivity than cardboard substrates. Manually and mechanically applied spore coatings showed similar and reproducible effects on mosquito survival. The standardized mosquito exposure bioassay was effective and consistent in measuring effects of fungal dose and exposure time. K-bar coating is a simple and consistent method for applying fungal spore suspensions onto paper substrates and can produce coating layers with accurate effective spore concentrations. The mosquito bioassay

  20. A novel method for standardized application of fungal spore coatings for mosquito exposure bioassays

    Directory of Open Access Journals (Sweden)

    Knols Bart GJ

    2010-01-01

    Full Text Available Abstract Background Interest in the use of fungal entomopathogens against malaria vectors is growing. Fungal spores infect insects via the cuticle and can be applied directly on the insect to evaluate infectivity. For flying insects such as mosquitoes, however, application of fungal suspensions on resting surfaces is more realistic and representative of field settings. For this type of exposure, it is essential to apply specific amounts of fungal spores homogeneously over a surface for testing the effects of fungal dose and exposure time. Contemporary methods such as spraying or brushing spore suspensions onto substrates do not produce the uniformity and consistency that standardized laboratory assays require. Two novel fungus application methods using equipment developed in the paint industry are presented and compared. Methods Wired, stainless steel K-bars were tested and optimized for coating fungal spore suspensions onto paper substrates. Different solvents and substrates were evaluated. Two types of coating techniques were compared, i.e. manual and automated coating. A standardized bioassay set-up was designed for testing coated spores against malaria mosquitoes. Results K-bar coating provided consistent applications of spore layers onto paper substrates. Viscous Ondina oil formulations were not suitable and significantly reduced spore infectivity. Evaporative Shellsol T solvent dried quickly and resulted in high spore infectivity to mosquitoes. Smooth proofing papers were the most effective substrate and showed higher infectivity than cardboard substrates. Manually and mechanically applied spore coatings showed similar and reproducible effects on mosquito survival. The standardized mosquito exposure bioassay was effective and consistent in measuring effects of fungal dose and exposure time. Conclusions K-bar coating is a simple and consistent method for applying fungal spore suspensions onto paper substrates and can produce coating layers

  1. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY THE MERGING PATHOGEN HEPATITIS E IN WATER SAMPLES

    Science.gov (United States)

    Hepatitis E virus (HEV) is an emerging pathogen that causes significant illness in the developing world. Like the hepatitis A virus, it is transmitted via the fecal-oral route and can cause short-term, acute hepatitis. In addition, hepatitis E has been found to cause a signific...

  2. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY THE EMERGING PATHOGEN HEPATITIS E IN WATER SAMPLES

    Science.gov (United States)

    Hepatitis E virus (HEV) is an emerging pathogen that causes significant illness in the developing world. Like the hepatitis A virus, it is transmitted via the fecal-oral route and can cause short-term, acute hepatitis. In addition, hepatitis E has been found to cause a signific...

  3. NONINDIGENOUS PATHOGENIC SHRIMP VIRUS INTRODUCTIONS INTO THE UNITED STATES: DEVELOPING A QUALITATIVE ECOLOGICAL RISK ASSESSMENT

    Science.gov (United States)

    Nonindigenous Pathogenic Shrimp Virus Introductions into the United States: Developing a Qualitative Ecological Risk Assessment. Austin, R.K.; van der Schalie, W.R.; U.S. Environmental Protection Agency, Washington, DC; Menzie, C.; Menzie-Cura and Associates, Chelmsford, MA; Fair...

  4. Interaction between pathogens and water in disease development in agriculture and forest ecosystems

    Directory of Open Access Journals (Sweden)

    Anna Maria Vettraino

    2006-07-01

    Full Text Available The present paper reports on the role of water in plant pathology as possible stress factor and vector of pathogen. The latter aspect is considered in a scenario of general risk of introduction and spread of invasive plant pathogens. In addition to peculiar epidemiology aspects, the possible diagnostic methodologies and control methods are considered. The role of water as stress factor is analysed in a general frame of climatic global changes that could enhance the risk of severe drought events. Within this frame some model pathosystems are described where water plays a role as co-factor or inciting factor in disease development.

  5. Photometric immersion refractometry of bacterial spores.

    Science.gov (United States)

    Gerhardt, P; Beaman, T C; Corner, T R; Greenamyre, J T; Tisa, L S

    1982-01-01

    Photometric immersion refractometry was used to determine the average apparent refractive index (n) of five types of dormant Bacillus spores representing a 600-fold range in moist-heat resistance determined as a D100 value. The n of a spore type increased as the molecular size of various immersion solutes decreased. For comparison of the spore types, the n of the entire spore and of the isolated integument was determined by use of bovine serum albumin, which is excluded from permeating into them. The n of the sporoplast (the structures bounded by the outer pericortex membrane) was determined by use of glucose, which was shown to permeate into the spore only as deeply as the pericortex membrane. Among the various spore types, an exponential increase in the heat resistance correlated with the n of the entire spore and of the sporoplast, but not of the isolated perisporoplast integument. Correlation of the n with the solids content of the entire spore provided a method of experimentally obtaining the refractive index increment (dn/dc), which was constant for the various spore types and enables the calculation of solids and water content from an n. Altogether, the results showed that the total water content is distributed unequally within the dormant spore, with less water in the sporoplast than in the perisporoplast integument, and that the sporoplast becomes more refractile and therefore more dehydrated as the heat resistance becomes greater among the various spore types. PMID:6802796

  6. Radiosensitivity of spores of Paenibacillus larvae ssp. larvae in honey

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, Wanderley Mendes de [Ministerio da Agricultura, Pecuaria e Abastecimento, Rio de Janeiro, RJ (Brazil). Servico de Inspecao de Produtos de Origem Animal]. E-mail: sipa-rj@agricultura.gov.br; Vital, Helio de Carvalho [Centro Tecnologico do Exercito CTEx, Rio de Janeiro, RJ (Brazil). Div. de Defesa Quimica, Biologica e Nuclear]. E-mail: vital@ctex.eb.br; Schuch, Dulce Maria Tocchetto [Ministerio da Agricultura, Pecuaria e Abastecimento, Porto Alegre, RS (Brazil)]. E-mail: micro-lara-rs@agricultura.gov.br

    2007-07-01

    Irradiation, usually used in combination with other conventional methods of conservation, has been proven to be an efficient tool to ensure the safety of many types of foods by destroying pathogenic microorganisms and extending their shelf-lives. This work has investigated the efficacy of gamma irradiation to inactivate spores of the bacterium Paenibacillus larvae that causes the 'American foulbrood', a highly contagious disease still exotic in Brazil that kills bees and contaminates honey, preventing its commercialization and causing great economical losses. In this study, 60 g samples of two types of honey inoculated with 3.5x10{sup 3} spores/mL of that bacterium were irradiated with doses of 0, 5, 7.5, 10, 12.5 and 15 kGy and counted. The analyses indicated a mean reduction of 97.5{+-}0.7% in the number of viable spores exposed to 5 kGy. The application of doses of 7.5 kGy or higher yielded no viable spores above the detection threshold (10/mL). In addition the value of D{sub 10} (3.1{+-}0.3 kGy) was estimated and the logarithm of the population of viable spores of Paenibacillus larvae subsp. larvae was determined as linear and quadratic polynomial functions of the radiation dose. The results indicated that the dose of 10 kGy could be insufficient to assure complete sterilization of honey in some cases while suggesting that 25 kGy would perform such task adequately. (author)

  7. Development of Quorum-Based Anti-Virulence Therapeutics Targeting Gram-Negative Bacterial Pathogens

    Directory of Open Access Journals (Sweden)

    Wen Shan Yew

    2013-08-01

    Full Text Available Quorum sensing is a cell density-dependent signaling phenomenon used by bacteria for coordination of population-wide phenotypes, such as expression of virulence genes, antibiotic resistance and biofilm formation. Lately, disruption of bacterial communication has emerged as an anti-virulence strategy with enormous therapeutic potential given the increasing incidences of drug resistance in pathogenic bacteria. The quorum quenching therapeutic approach promises a lower risk of resistance development, since interference with virulence generally does not affect the growth and fitness of the bacteria and, hence, does not exert an associated selection pressure for drug-resistant strains. With better understanding of bacterial communication networks and mechanisms, many quorum quenching methods have been developed against various clinically significant bacterial pathogens. In particular, Gram-negative bacteria are an important group of pathogens, because, collectively, they are responsible for the majority of hospital-acquired infections. Here, we discuss the current understanding of existing quorum sensing mechanisms and present important inhibitory strategies that have been developed against this group of pathogenic bacteria.

  8. Comparative development and tissue tropism of Nosema apis and Nosema ceranae.

    Science.gov (United States)

    Huang, Wei-Fone; Solter, Leellen F

    2013-05-01

    The two etiological agents of nosema disease in honey bees, Nosema apis and Nosema ceranae (Microsporidia: Nosematidae), reproduce in the midgut tissues of the host. N. apis is tissue specific but the development and tissue tropism of N. ceranae is not well understood. Our investigations compared development of the two phylogenetically related pathogens in all major host tissues. Using microscopy, PCR and qPCR quantification to evaluate tissue tropism of infected bees in communal cages and of individually restrained infected bees, we found no detectable spores in cephalic or other body tissues except midgut tissues. Nosema DNA was detected in Malpighian tubules but the tubules could not be separated from the alimentary tract without release of spores from the midgut. Nosema DNA was not detected in hemolymph sampled from the head capsule or the abdomen of infected bees. We confirmed that N. ceranae only develops in midgut tissues. Spores of both species released from host midgut cells accumulated in the hindgut lumen, and we noted differences in numbers and ratios of spore types and in growth curves between the two pathogens. N. apis reached a consistent level of spore production after 12 days post inoculation (dpi); N. ceranae spore production increased linearly from 12 to 20 dpi and the number of mature N. ceranae spores was consistently higher. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Kinetics of Inactivation of Bacillus subtilis subsp. niger Spores and Staphylococcus albus on Paper by Chlorine Dioxide Gas in an Enclosed Space.

    Science.gov (United States)

    Wang, Tao; Wu, Jinhui; Qi, Jiancheng; Hao, Limei; Yi, Ying; Zhang, Zongxing

    2016-05-15

    Bacillus subtilis subsp. niger spore and Staphylococcus albus are typical biological indicators for the inactivation of airborne pathogens. The present study characterized and compared the behaviors of B. subtilis subsp. niger spores and S. albus in regard to inactivation by chlorine dioxide (ClO2) gas under different gas concentrations and relative humidity (RH) conditions. The inactivation kinetics under different ClO2 gas concentrations (1 to 5 mg/liter) were determined by first-order and Weibull models. A new model (the Weibull-H model) was established to reveal the inactivation tendency and kinetics for ClO2 gas under different RH conditions (30 to 90%). The results showed that both the gas concentration and RH were significantly (P 70%). Compared with the first-order model, the Weibull and Weibull-H models demonstrated a better fit for the experimental data, indicating nonlinear inactivation behaviors of the vegetative bacteria and spores following exposure to ClO2 gas. The times to achieve a six-log reduction of B. subtilis subsp. niger spore and S. albus were calculated based on the established models. Clarifying the kinetics of inactivation of B. subtilis subsp. niger spores and S. albus by ClO2 gas will allow the development of ClO2 gas treatments that provide an effective disinfection method. Chlorine dioxide (ClO2) gas is a novel and effective fumigation agent with strong oxidization ability and a broad biocidal spectrum. The antimicrobial efficacy of ClO2 gas has been evaluated in many previous studies. However, there are presently no published models that can be used to describe the kinetics of inactivation of airborne pathogens by ClO2 gas under different gas concentrations and RH conditions. The first-order and Weibull (Weibull-H) models established in this study can characterize and compare the behaviors of Bacillus subtilis subsp. niger spores and Staphylococcus albus in regard to inactivation by ClO2 gas, determine the kinetics of inactivation of

  10. Assessment of mould spore exposure and relations to symptoms in wood trimmers

    NARCIS (Netherlands)

    Eduard, W.

    1993-01-01

    Relationships between exposure to mould spores, IgG antibodies against moulds and respiratory and febrile symptoms were studied among wood trimmers. A new method for quantitative assessment of mould spore exposure by scanning electron microscopy was developed. This method was validated by

  11. RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY

    Directory of Open Access Journals (Sweden)

    A. Y. Prosekov

    2016-01-01

    Full Text Available Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail. The produced sequence and the database sequences have no homologues. Two primer of20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left and CAGTTTCGATCCTCCTCCAG (right primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing  pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system.

  12. Cave Entrance dependent Spore Dispersion of Filamentous Fungi Isolated from Various Sediments of Iron Ore Cave in Brazil: a colloquy on human threats while caving

    Directory of Open Access Journals (Sweden)

    Erika Linzi Silva Taylor

    2014-04-01

    Full Text Available Caves are stable environments with characteristics favoring the development of fungi. The fungal community present in a cave also includes pathogenic and opportunistic species out of which some are also served as energy sources in such energy stared ecosystems. Studies on microbial diversity and their role on such energy starved ecosystem are scarce. The present study was aimed to identify the cultivable filamentous fungi present in the various sediment of an iron ore cave and to recognize them as pathogenic and/or opportunistic species. Further the impact of cave entrance on the spore depositions on various distances dependent sediments were analyzed. The results suggest a diverse microbial community inhabiting the cave and an influence of cave entrance over spore deposition on various sediments. We counted a total of 4,549 filamentous fungi that included 34 species of 12 genera: Acremonium, Aspergillus, Cladosporium, Fusarium, Geotrichum, Paecilomyces, Purpureocillium, Penicillium, Torula, Trichoderma, Mucor and Rhizopus. A positive significant relation was observed between spore deposition and distance from cave entrance (p= 0.001. Areas of potential mycoses risks were recognized. This is the first study on microbiological community of an iron ore cave in the country.

  13. Spore liberation in mosses revisited.

    Science.gov (United States)

    Gallenmüller, Friederike; Langer, Max; Poppinga, Simon; Kassemeyer, Hanns-Heinz; Speck, Thomas

    2018-02-01

    The ability to perform hygroscopic movements has evolved in many plant lineages and relates to a multitude of different functions such as seed burial, flower protection or regulation of diaspore release. In most mosses, spore release is controlled by hygroscopic movements of the peristome teeth and also of the spore capsule. Our study presents, for the first time, temporally and spatially well-resolved kinematic analyses of these complex shape changes in response to humidity conditions and provides insights into the sophisticated functional morphology and anatomy of the peristome teeth. In Brachythecium populeum the outer teeth of the peristome perform particularly complex hygroscopic movements during hydration and desiccation. Hydration induces fast inward dipping followed by partial re-straightening of the teeth. In their final shape, wet teeth close the capsule. During desiccation, the teeth perform an outward flicking followed by a re-straightening which opens the capsule. We present a kinematic analysis of these shape changes and of the underlying functional anatomy of the teeth. These teeth are shown to be composed of two layers which show longitudinal gradients in their material composition, structure and geometry. We hypothesize that these gradients result in (i) differences in swelling/shrinking capacity and velocity between the two layers composing the teeth, and in (ii) a gradient of velocity of swelling and shrinking from the tip to the base of the teeth. We propose these processes explain the observed movements regulating capsule opening or closing. This hypothesis is corroborated by experiments with isolated layers of peristome teeth. During hydration and desiccation, changes to the shape and mass of the whole spore capsule accompany the opening and closing. Results are discussed in relation to their significance for humidity-based regulation of spore release.

  14. Intestinal calcium and bile salts facilitate germination of Clostridium difficile spores.

    Directory of Open Access Journals (Sweden)

    Travis J Kochan

    2017-07-01

    Full Text Available Clostridium difficile (C. difficile is an anaerobic gram-positive pathogen that is the leading cause of nosocomial bacterial infection globally. C. difficile infection (CDI typically occurs after ingestion of infectious spores by a patient that has been treated with broad-spectrum antibiotics. While CDI is a toxin-mediated disease, transmission and pathogenesis are dependent on the ability to produce viable spores. These spores must become metabolically active (germinate in order to cause disease. C. difficile spore germination occurs when spores encounter bile salts and other co-germinants within the small intestine, however, the germination signaling cascade is unclear. Here we describe a signaling role for Ca2+ during C. difficile spore germination and provide direct evidence that intestinal Ca2+ coordinates with bile salts to stimulate germination. Endogenous Ca2+ (released from within the spore and a putative AAA+ ATPase, encoded by Cd630_32980, are both essential for taurocholate-glycine induced germination in the absence of exogenous Ca2+. However, environmental Ca2+ replaces glycine as a co-germinant and circumvents the need for endogenous Ca2+ fluxes. Cd630_32980 is dispensable for colonization in a murine model of C. difficile infection and ex vivo germination in mouse ileal contents. Calcium-depletion of the ileal contents prevented mutant spore germination and reduced WT spore germination by 90%, indicating that Ca2+ present within the gastrointestinal tract plays a critical role in C. difficile germination, colonization, and pathogenesis. These data provide a biological mechanism that may explain why individuals with inefficient intestinal calcium absorption (e.g., vitamin D deficiency, proton pump inhibitor use are more prone to CDI and suggest that modulating free intestinal calcium is a potential strategy to curb the incidence of CDI.

  15. Comparison of ePlex Respiratory Pathogen Panel with Laboratory-Developed Real-Time PCR Assays for Detection of Respiratory Pathogens.

    Science.gov (United States)

    Nijhuis, R H T; Guerendiain, D; Claas, E C J; Templeton, K E

    2017-06-01

    Infections of the respiratory tract can be caused by a diversity of pathogens, both viral and bacterial. Rapid microbiological diagnosis ensures appropriate antimicrobial therapy as well as effective implementation of isolation precautions. The ePlex respiratory pathogen panel (RP panel) is a novel molecular biology-based assay, developed by GenMark Diagnostics, Inc. (Carlsbad, CA), to be performed within a single cartridge for the diagnosis of 25 respiratory pathogens (viral and bacterial). The objective of this study was to compare the performance of the RP panel with those of laboratory-developed real-time PCR assays, using a variety of previously collected clinical respiratory specimens. A total of 343 clinical specimens as well as 29 external quality assessment (EQA) specimens and 2 different Middle East respiratory syndrome coronavirus isolates have been assessed in this study. The RP panel showed an agreement of 97.4% with the real-time PCR assay regarding 464 pathogens found in the clinical specimens. All pathogens present in clinical samples and EQA samples with a threshold cycle ( C T ) value of panel. The RP panel detected 17 additional pathogens, 7 of which could be confirmed by discrepant testing. In conclusion, this study shows excellent performance of the RP panel in comparison to real-time PCR assays for the detection of respiratory pathogens. The ePlex system provided a large amount of useful diagnostic data within a short time frame, with minimal hands-on time, and can therefore potentially be used for rapid diagnostic sample-to-answer testing, in either a laboratory or a decentralized setting. Copyright © 2017 Nijhuis et al.

  16. Effect of synthetic detergents on germination of fern spores

    Energy Technology Data Exchange (ETDEWEB)

    Devi, Y.; Devi, S.

    1986-12-01

    Synthetic detergents constitute one of the most important water pollutants by contaminating the lakes and rivers through domestic and industrial use. Considerable information is now available for the adverse effects of detergents an aquatic fauna including fish, algae, and higher aquatic plants. Marked inhibition of germination in orchids and brinjals and of seedlings growth in raddish suggest that rapidly growing systems could be sensitive to detergent polluted water. The present study of the effect of linear alkyl benzene sulphonate on germination of the spores of a fern, Diplazium esculentum aims at the understanding of the effects of water pollution on pteridophytes and the development of spore germination assay for phytoxicity evaluation.

  17. Effects of steam autoclave treatment on Geobacillus stearothermophilus spores.

    Science.gov (United States)

    Huesca-Espitia, L C; Suvira, M; Rosenbeck, K; Korza, G; Setlow, B; Li, W; Wang, S; Li, Y-Q; Setlow, P

    2016-11-01

    To determine the mechanism of autoclave killing of Geobacillus stearothermophilus spores used in biological indicators (BIs) for steam autoclave sterilization, and rates of loss of spore viability and a spore enzyme used in BIs. Spore viability, dipicolinic acid (DPA) release, nucleic acid staining, α-glucosidase activity, protein structure and mutagenesis were measured during autoclaving of G. stearothermophilus spores. Loss of DPA and increases in spore core nucleic acid staining were slower than loss of spore viability. Spore core α-glucosidase was also lost more slowly than spore viability, although soluble α-glucosidase in spore preparations was lost more rapidly. However, spores exposed to an effective autoclave sterilization lost all viability and α-glucosidase activity. Apparently killed autoclaved spores were not recovered by artificial germination in supportive media, much spore protein was denatured during autoclaving, and partially killed autoclave-treated spore preparations did not acquire mutations. These results indicate that autoclave-killed spores cannot be revived, spore killing by autoclaving is likely by protein damage, and spore core α-glucosidase activity is lost more slowly than spore viability. This work provides insight into the mechanism of autoclave killing of spores of an organism used in BIs, and that a spore enzyme in a BI is more stable to autoclaving than spore viability. © 2016 The Society for Applied Microbiology.

  18. Environmental Persistence Influences Infection Dynamics for a Butterfly Pathogen.

    Directory of Open Access Journals (Sweden)

    Dara A Satterfield

    Full Text Available Many pathogens, including those infecting insects, are transmitted via dormant stages shed into the environment, where they must persist until encountering a susceptible host. Understanding how abiotic conditions influence environmental persistence and how these factors influence pathogen spread are crucial for predicting patterns of infection risk. Here, we explored the consequences of environmental transmission for infection dynamics of a debilitating protozoan parasite (Ophryocystis elektroscirrha that infects monarch butterflies (Danaus plexippus. We first conducted an experiment to observe the persistence of protozoan spores exposed to natural conditions. Experimental results showed that, contrary to our expectations, pathogen doses maintained high infectivity even after 16 days in the environment, although pathogens did yield infections with lower parasite loads after environmental exposure. Because pathogen longevity exceeded the time span of our experiment, we developed a mechanistic model to better explore environmental persistence for this host-pathogen system. Model analysis showed that, in general, longer spore persistence led to higher infection prevalence and slightly smaller monarch population sizes. The model indicated that typical parasite doses shed onto milkweed plants must remain viable for a minimum of 3 weeks for prevalence to increase during the summer-breeding season, and for 11 weeks or longer to match levels of infection commonly reported from the wild, assuming moderate values for parasite shedding rate. Our findings showed that transmission stages of this butterfly pathogen are long-lived and indicated that this is a necessary condition for the protozoan to persist in local monarch populations. This study provides a modeling framework for future work examining the dynamics of an ecologically important pathogen in an iconic insect.

  19. Development of a Novel Listeria Enrichment Broth for the Isolation of Pathogenic Listeria.

    Science.gov (United States)

    Liu, Dongxin; Wang, Yan; Wang, Yi; Zhang, Lu; Luo, Lijuan; Liu, Kai; Ye, Changyun

    2017-10-01

    Listeriosis, the disease caused by pathogenic Listeria species, can present severe symptoms in susceptible people. The goal of this study was to develop a novel enrichment broth, Listeria allose enrichment broth (LAEB), to improve isolation of Listeria monocytogenes and Listeria ivanovii from samples through incorporating a specific carbohydrate and reducing inhibitor concentrations. Other coexisting bacteria, particularly Listeria innocua, can interfere with the isolation of pathogenic Listeria in such ways as overgrowth of L. innocua and the generation of inhibitory metabolites. The incorporation of allose into the novel LAEB was effective for slowing the growth of L. innocua and other nontarget microorganisms. We determined that 35°C and pH 7.0 under aerobic conditions are optimal for Listeria growth in this medium. The novelty of the use of LAEB is the single enrichment procedure at 35°C for 24 h, obviating the need for a secondary enrichment medium. In 50 simulated samples, the sensitivity of the LAEB method (86%) was higher than that of the International Organization for Standardization (EN ISO) method (70%). In 142 naturally contaminated samples tested, the isolation rate for pathogenic Listeria with the LAEB method was 26.0% (37 of 142 samples), which was significantly higher than the 17.6% (25 of 142 samples) for the EN ISO method. Higher isolation rates and a quicker and easier protocol make the novel LAEB method an appropriate alternative for the isolation of pathogenic Listeria.

  20. Arbuscular mycorrhizal fungi spore propagation using single spore as starter inoculum and a plant host.

    Science.gov (United States)

    Gopal, Selvakumar; Shagol, Charlotte C; Kang, Yeongyeong; Chung, Bong Nam; Han, Seung Gab; Tong-Min, Sa

    2018-02-02

    The propagation of pure cultures of AMF is an essential requirement for their large scale agricultural application and commercialization as biofertilizers. The present study aimed to propagate AMF using the single spore inoculation technique and compare their propagation ability with the known reference spores. Arbuscular mycorrhizal fungal spores were collected from the salt-affected Saemangeum reclaimed soil in South Korea. The technique involved inoculation of Sorghum-Sudan grass (Sorghum bicolor L.) seedlings with single, healthy spores on filter paper followed by the transfer of successfully colonized seedlings to 1 kg capacity pots containing sterilized soil. After the first plant cycle, the contents were transferred to 2.5 kg capacity pots containing sterilized soil. Among the 150 inoculants, only 27 seedlings were colonized by AMF spores. After 240 days, five inoculants among the 27 seedlings resulted in the production of over 500 spores. The 18S rDNA sequencing of spores revealed that the spores produced through single spore inoculation method belonged to Gigaspora margarita, Claroideoglomus lamellosum, and Funneliformis mosseae. Furthermore, indigenous spore Funneliformis mosseae M-1 reported a higher spore count than the reference spores. The AMF spores produced using single spore inoculation technique may serve as potential bio-inoculants with an advantage of being more readily adopted by farmers due to the lack of requirement of a skilled technique in spore propagation. The results of the current study describes the feasible and cost effective method to mass produce AMF spores for large scale application. The AMF spores obtained from this method can effectively colonize plant roots and may be easily introduced to the new environment. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  1. Seed rot fungal pathogen of post harvest irvingia gabonensis in the ...

    African Journals Online (AJOL)

    %), Fusarium moniliforme (12.67%), Penicillium notatum (14.48%) and Rhizopus nigricans (24.70%) as the associated pathogens. The distribution, pathogenicity and spore germination kinetics were discussed and control measures proffered.

  2. Pathogenic specifics of development of vegetative dysfunction in adolescents in relation to their morphological status

    OpenAIRE

    O. Skyba

    2017-01-01

    Exploring the mechanisms of vegetative regulation in children and adolescents of different somatotypes has a prognostic value in regard to the character of adaptive reactions of the organism, as it facilitates the identification of the risk factors of pathological processes and states of vegetative systems, which may cause chronic illness in adulthood. The author defines the pathogenic specifics of development of vegetative dysfunction in adolescents in relation to their morphological status....

  3. Pseudomonas baetica: pathogenicity for marine fish and development of protocols for rapid diagnosis.

    Science.gov (United States)

    López, Jose R; Lorenzo, Laura; Marcelino-Pozuelo, Cinta; Marin-Arjona, M Carmen; Navas, Jose I

    2017-02-01

    Pseudomonas baetica is a pathogen isolated in 2012 from wedge sole (Dicologoglossa cuneata). The aims of this study were (i) to determine the influence of temperature on its virulence, and (ii) to develop specific protocols for rapid diagnosis. Virulence assays carried out by bath using Senegalese sole fry showed that virulence is strongly influenced by temperature: LD50 at 14°C was 8.5 × 105 cfu ml-1 while at 20°C no mortalities were recorded. On the other hand, the high mortality rates observed in virulence assays involving intraperitoneal injection of 2.5 × 105 cfu g-1 suggest that P. baetica may be pathogenic for the five fish species tested (wedge sole, Senegalese sole, sea bream, European sea bass and meagre). Two PCR protocols, using specific primers targeting the gyrB and rpoD genes, were developed for rapid diagnosis from pure cultures. An additional protocol, using both primer sets, was also optimized for detection from fish tissue samples. Specificity was tested using 81 strains from 66 bacterial species, taxonomically and/or ecologically related; only the P. baetica strains showed the expected DNA amplicons. A specific dot-blot assay using polyclonal antibodies was also developed for differentiation of P. baetica from related species. Altogether, the protocols described here will constitute useful tools for diagnosis and clarify the relevance of this pathogen. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Characterization of small-spored Alternaria from Argentinean crops through a polyphasic approach

    DEFF Research Database (Denmark)

    da Cruz Cabral, Lucía; Rodriguero, Marcela; Stenglein, Sebastián

    2017-01-01

    exporter of agricultural products, so it is essential to thoroughly understand the physiological behaviour of this pathogen in a food safety context. Thus, the objective of this work was to characterize small-spored Alternaria spp. obtained from tomato fruits, pepper fruits, wheat grains and blueberries...

  5. Heat-induced oxidative injury contributes to inhibition of Botrytis cinerea spore germination and growth

    Science.gov (United States)

    The inhibitory effect of a heat treatment (HT) on Botrytis cinerea, a major postharvest fungal pathogen, and the possible mode of action were investigated. Spore germination and germ tube elongation of B. cinerea were both increasingly and significantly inhibited by a HT (43 degrees C) for 10, 20 o...

  6. Soya bean tempe extracts show antibacterial activity against Bacillus cereus cells and spores

    NARCIS (Netherlands)

    Roubos-van den Hil, P.J.; Dalmas, E.; Nout, M.J.R.; Abee, T.

    2010-01-01

    Aims: Tempe, a Rhizopus ssp.-fermented soya bean food product, was investigated for bacteriostatic and/or bactericidal effects against cells and spores of the food-borne pathogen Bacillus cereus. Methods and results: Tempe extract showed a high antibacterial activity against B. cereus ATCC 14579

  7. Impact of sorbic acid and other mild preservation stresses on germination and outgrowth of Bacillus cereus spores

    OpenAIRE

    Melis, van, C.C.J.

    2013-01-01

      Weak organic acids such as sorbic acid, lactate, and acetic acid are widely used by the food industry as preservatives to control growth of micro-organisms. With the current trend towards milder processing of food products, opportunities arise for spore-forming spoilage and pathogenic microorganisms such as Bacillus cereus, that may survive the use of milder heating regimes. Dormant spores produced by B. cereus can survive processing conditions and their subsequent outgrowth increases ...

  8. Recent progress in Bacillus subtilis spore-surface display: concept, progress, and future.

    Science.gov (United States)

    Wang, He; Wang, Yunxiang; Yang, Ruijin

    2017-02-01

    With the increased knowledge on spore structure and advances in biotechnology engineering, the newly developed spore-surface display system confers several inherent advantages over other microbial cell-surface display systems including enhanced stability and high safety. Bacillus subtilis is the most commonly used Bacillus species for spore-surface display. The expression of heterologous antigen or protein on the surface of B. subtilis spores has now been practiced for over a decade with noteworthy success. As an update and supplement to other previous reviews, we comprehensively summarize recent studies in the B. subtilis spore-surface display technique. We focus on its benefits as well as the critical factors affecting its display efficiency and offer suggestions for the future success of this field.

  9. Distinction of broken cellular wall Ganoderma lucidum spores and G. lucidum spores using FTIR microspectroscopy

    Science.gov (United States)

    Chen, Xianliang; Liu, Xingcun; Sheng, Daping; Huang, Dake; Li, Weizu; Wang, Xin

    2012-11-01

    In this paper, FTIR microspectroscopy was used to identify broken cellular wall Ganoderma lucidum spores and G. lucidum spores. For IR spectra, broken cellular wall G. lucidum spores and G. lucidum spores were mainly different in the regions of 3000-2800, 1660-1600, 1400-1200 and 1100-1000 cm-1. For curve fitting, the results showed the differences in the protein secondary structures and the polysaccharide structures/content between broken cellular wall G. lucidum spores and G. lucidum spores. Moreover, the value of A1078/A1741 might be a potentially useful factor to distinguish broken cellular wall G. lucidum spores from G. lucidum spores. Additionally, FTIR microspectroscopy could identify broken cellular wall G. lucidum spores and G. lucidum spores accurately when it was combined with hierarchical cluster analysis. The result suggests FTIR microspectroscopy is very simple and efficient for distinction of broken cellular wall G. lucidum spores and G. lucidum spores. The result also indicates FTIR microspectroscopy may be useful for TCM identification.

  10. Electron Beam Irradiation Dose Dependently Damages the Bacillus Spore Coat and Spore Membrane

    Directory of Open Access Journals (Sweden)

    S. E. Fiester

    2012-01-01

    Full Text Available Effective control of spore-forming bacilli begs suitable physical or chemical methods. While many spore inactivation techniques have been proven effective, electron beam (EB irradiation has been frequently chosen to eradicate Bacillus spores. Despite its widespread use, there are limited data evaluating the effects of EB irradiation on Bacillus spores. To study this, B. atrophaeus spores were purified, suspended in sterile, distilled water, and irradiated with EB (up to 20 kGy. Irradiated spores were found (1 to contain structural damage as observed by electron microscopy, (2 to have spilled cytoplasmic contents as measured by spectroscopy, (3 to have reduced membrane integrity as determined by fluorescence cytometry, and (4 to have fragmented genomic DNA as measured by gel electrophoresis, all in a dose-dependent manner. Additionally, cytometry data reveal decreased spore size, increased surface alterations, and increased uptake of propidium iodide, with increasing EB dose, suggesting spore coat alterations with membrane damage, prior to loss of spore viability. The present study suggests that EB irradiation of spores in water results in substantial structural damage of the spore coat and inner membrane, and that, along with DNA fragmentation, results in dose-dependent spore inactivation.

  11. Development of an Automated Microfluidic System for DNA Collection, Amplification, and Detection of Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Hagan, Bethany S.; Bruckner-Lea, Cynthia J.

    2002-12-01

    This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.

  12. Development of a magnetic nanoparticles microarray for simultaneous and simple detection of foodborne pathogens.

    Science.gov (United States)

    Li, Song; Liu, Hongna; Deng, Yan; Lin, Lin; He, Nongyue

    2013-07-01

    Foodborne diseases are a widespread and growing public health problem affecting both developed and developing countries, microbiologically contaminated food and water are the major causes of diarrhoeal diseases. Methods based on polymerase chain reaction (PCR) and microarrays are rapid and sensitive enough to detect very small quantities of microorganisms, however, the requirement for expensive equipments limits their application. In the present paper, we describe a method based on multiplex PCR and magnetic nanoparticles labelling for simultaneous detection of four major foodborne pathogens, including Escherichia coli O157:H7, Salmonella enterica, Vibrio cholera and Campylobacter jejuni. The process utilizes an oligonucleotide array onto which 5' biotinylated single strand PCR products were hybridized and visualized with streptavidin-coated magnetic nanoparticles (SA-MNPs), the signal from which could be detected by the naked eye, microscope or CCD camera. By employing SA-MNPs as visible labels, the microarray unambiguously distinguished all 4 pathogens with detection sensitivity up to 316 CFU/mL. Due to its high sensitivity, specificity and simple detection procedure, the magnetic bead assay provides a powerful tool for the detection and identification of foodborne pathogens in a modestly equipped laboratory.

  13. Sensitivity of Dormant and Germinating B, Anthracis Spores to Polycationic Compound

    Science.gov (United States)

    2005-06-01

    practical problems such as food spoilage , degradation of industrial materials, and "sick building syndrome" resulting from colonization of ventilation systems...species of Clostridium and Bacillus are of concern to the food industry due to their potential for spoilage of or toxin production in improperly...1.2. While most spore-forming bacterial species are classified as non-pathogenic or opportunistically pathogenic, Bacillus anthracis is well-known a

  14. Development of genetic methods for detection of pathogenic microorganisms in irradiated food

    International Nuclear Information System (INIS)

    2010-01-01

    The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment

  15. Statistical approaches to developing a multiplex immunoassay for determining human exposure to environmental pathogens.

    Science.gov (United States)

    Augustine, Swinburne A J; Simmons, Kaneatra J; Eason, Tarsha N; Griffin, Shannon M; Curioso, Clarissa L; Wymer, Larry J; Shay Fout, G; Grimm, Ann C; Oshima, Kevin H; Dufour, Al

    2015-10-01

    There are numerous pathogens that can be transmitted through water. Identifying and understanding the routes and magnitude of exposure or infection to these microbial contaminants are critical to assessing and mitigating risk. Conventional approaches of studying immunological responses to exposure or infection such as Enzyme-Linked Immunosorbent Assays (ELISAs) and other monoplex antibody-based immunoassays can be very costly, laborious, and consume large quantities of patient sample. A major limitation of these approaches is that they can only be used to measure one analyte at a time. Multiplex immunoassays provide the ability to study multiple pathogens simultaneously in microliter volumes of samples. However, there are several challenges that must be addressed when developing these multiplex immunoassays such as selection of specific antigens and antibodies, cross-reactivity, calibration, protein-reagent interferences, and the need for rigorous optimization of protein concentrations. In this study, a Design of Experiments (DOE) approach was used to optimize reagent concentrations for coupling selected antigens to Luminex™ xMAP microspheres for use in an indirect capture, multiplex immunoassay to detect human exposure or infection from pathogens that are potentially transmitted through water. Results from Helicobacter pylori, Campylobacter jejuni, Escherichia coli O157:H7, and Salmonella typhimurium singleplexes were used to determine the mean concentrations that would be applied to the multiplex assay. Cut-offs to differentiate between exposed and non-exposed individuals were determined using finite mixed modeling (FMM). The statistical approaches developed facilitated the detection of Immunoglobulin G (IgG) antibodies to H. pylori, C. jejuni, Toxoplasma gondii, hepatitis A virus, rotavirus and noroviruses (VA387 and Norwalk strains) in fifty-four diagnostically characterized plasma samples. Of the characterized samples, the detection rate was 87.5% for H

  16. Development of a European resource on the origins of pathogens of aquaculture: The Europa Project

    DEFF Research Database (Denmark)

    Snow, M.; Barja, J.; Colquhoun, D.

    2004-01-01

    This workshop described the EUROPA project, an EU-funded program aimed at creating a web-based database of molecular sequence data-sets related to significant pathogens of aquaculture. The project aims to focus the efforts of fish health researchers into generating large, evolving and readily...... available data-sets suited to the purpose of molecular epidemiology. This workshop reviewed the progress of this project, demonstrated the scope of the database developed to date, and sought input regarding the future development of this resource....

  17. Fighting Ebola through Novel Spore Decontamination Technologies for the Military

    Directory of Open Access Journals (Sweden)

    Christopher J. Doona

    2015-08-01

    Full Text Available AbstractRecently, global public health organizations such as Doctors without Borders (MSF, the World Health Organization (WHO, Public Health Canada, National Institutes of Health (NIH, and the U.S. government developed and deployed Field Decontamination Kits (FDKs, a novel, lightweight, compact, reusable decontamination technology to sterilize Ebola-contaminated medical devices at remote clinical sites lacking infra-structure in crisis-stricken regions of West Africa (medical waste materials are placed in bags and burned. The basis for effectuating sterilization with FDKs is chlorine dioxide (ClO2 produced from a patented invention developed by researchers at the US Army – Natick Soldier RD&E Center (NSRDEC and commercialized as a dry mixed-chemical for bacterial spore decontamination. In fact, the NSRDEC research scientists developed an ensemble of ClO2 technologies designed for different applications in decontaminating fresh produce; food contact and handling surfaces; personal protective equipment; textiles used in clothing, uniforms, tents, and shelters; graywater recycling; airplanes; surgical instruments; and hard surfaces in latrines, laundries, and deployable medical facilities. These examples demonstrate the far-reaching impact, adaptability, and versatility of these innovative technologies. We present herein the unique attributes of NSRDEC’s novel decontamination technologies and a Case Study of the development of FDKs that were deployed in West Africa by international public health organizations to sterilize Ebola-contaminated medical equipment. FDKs use bacterial spores as indicators of sterility. We review the properties and structures of spores and the mechanisms of bacterial spore inactivation by ClO2. We also review mechanisms of bacterial spore inactivation by novel, emerging, and established nonthermal technologies for food preservation, such as high pressure processing, irradiation, cold plasma, and chemical sanitizers

  18. Artificial neural network models of relationships between Alternaria spores and meteorological factors in Szczecin (Poland)

    Science.gov (United States)

    Grinn-Gofroń, Agnieszka; Strzelczak, Agnieszka

    2008-11-01

    Alternaria is an airborne fungal spore type known to trigger respiratory allergy symptoms in sensitive patients. Aiming to reduce the risk for allergic individuals, we constructed predictive models for the fungal spore circulation in Szczecin, Poland. Monthly forecasting models were developed for the airborne spore concentrations of Alternaria, which is one of the most abundant fungal taxa in the area. Aerobiological sampling was conducted over 2004-2007, using a Lanzoni trap. Simultaneously, the following meteorological parameters were recorded: daily level of precipitation; maximum and average wind speed; relative humidity; and maximum, minimum, average, and dew point temperature. The original factors as well as with lags (up to 3 days) were used as the explaining variables. Due to non-linearity and non-normality of the data set, the modelling technique applied was the artificial neural network (ANN) method. The final model was a split model with classification (spore presence or absence) followed by regression for spore seasons and log(x+1) transformed Alternaria spore concentration. All variables except maximum wind speed and precipitation were important factors in the overall classification model. In the regression model for spore seasons, close relationships were noted between Alternaria spore concentration and average and maximum temperature (on the same day and 3 days previously), humidity (with lag 1) and maximum wind speed 2 days previously. The most important variable was humidity recorded on the same day. Our study illustrates a novel approach to modelling of time series with short spore seasons, and indicates that the ANN method provides the possibility of forecasting Alternaria spore concentration with high accuracy.

  19. Bacillus subtilis Spore Inner Membrane Proteome

    NARCIS (Netherlands)

    Zheng, L.; Abhyankar, W.; Ouwerling, N.; Dekker, H.L.; van Veen, H.; van der Wel, N.N.; Roseboom, W.; de Koning, L.J.; Brul, S.; de Koster, C.G.

    2016-01-01

    The endospore is the dormant form of Bacillus subtilis and many other Firmicutes. By sporulation, these spore formers can survive very harsh physical and chemical conditions. Yet, they need to go through germination to return to their growing form. The spore inner membrane (IM) has been shown to

  20. What can spores do for us?

    NARCIS (Netherlands)

    Wolken, W.A.M.; Tramper, J.; Werf, van der M.J.

    2003-01-01

    Many organisms have the ability to form spores, a remarkable phase in their life cycles. Compared with vegetative cells, spores have several advantages (e.g. resistance to toxic compounds, temperature, desiccation and radiation) making them well suited to various applications. The applications of

  1. Sphagnum moss disperses spores with vortex rings.

    Science.gov (United States)

    Whitaker, Dwight L; Edwards, Joan

    2010-07-23

    Sphagnum spores, which have low terminal velocities, are carried by turbulent wind currents to establish colonies many kilometers away. However, spores that are easily kept aloft are also rapidly decelerated in still air; thus, dispersal range depends strongly on release height. Vascular plants grow tall to lift spores into sufficient wind currents for dispersal, but nonvascular plants such as Sphagnum cannot grow sufficiently high. High-speed videos show that exploding capsules of Sphagnum generate vortex rings to efficiently carry spores high enough to be dispersed by turbulent air currents. Spores launched ballistically at similar speeds through still air would travel a few millimeters and not easily reach turbulent air. Vortex rings are used by animals; here, we report vortex rings generated by plants.

  2. Ptaquiloside in bracken spores from Britain.

    Science.gov (United States)

    Rasmussen, Lars Holm; Schmidt, Bjørn; Sheffield, Elizabeth

    2013-03-01

    Secondary metabolites from bracken fern (Pteridium aquilinum (L.) Kuhn) are suspected of causing cancer in humans. The main carcinogen is the highly water-soluble norsesquiterpene glucoside ptaquiloside, which may be ingested by humans through food, e.g. via contaminated water, meat or milk. It has been postulated that carcinogens could also be ingested through breathing air containing bracken spores. Ptaquiloside has not previously been identified in bracken spores. The aim of the study was to determine whether ptaquiloside is present in bracken spores, and if so, to estimate its content in a collection of spores from Britain. Ptaquiloside was present in all samples, with a maximum of 29 μg g(-1), which is very low compared to other parts of the fern. Considering the low abundance of spores in breathing air under normal conditions, this exposure route is likely to be secondary to milk or drinking water. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. A Generic Method for Fungal Spore Detection: The use of a monoclonal antibody and surface plasmon resonance

    DEFF Research Database (Denmark)

    Skottrup, Peter; Hearty, Stephen; Frøkiær, Hanne

    This study describes a biosensing principle for detection of fungal spores using surface plasmon resonance (SPR). The approach involves the use of a monoclonal antibody (mab) and a SPR sensor for label-free detection of the model organism Puccinia striiformis f.sp. tritici (Pst) a biotrophic fungus...... causing wheat yellow rust. We have developed mabs towards intact whole spores and used a subtractive inhibition format for detection of spores in solution. The antibody was incubated with different spore concentrations and the remaining free antibody was quantified using a BIAcore® 3000 sensor. Decreasing...... binding of mab to the sensor surface was observed as the Pst urediniospore concentration was increased. The detection range for the assay was 1.7 x 106 – 5.3 x 104 spores/ml. This study describes the first use of SPR for detection of fungal spores and the generic principle has the potential to be used...

  4. A Generic Method for Fungal Spore Detection: The use of a monoclonal antibody and surface plasmon resonance

    DEFF Research Database (Denmark)

    Skottrup, Peter Durand; Hearty, Stephen; Frøkiær, Hanne

    This study describes a biosensing principle for detection of fungal spores using surface plasmon resonance (SPR). The approach involves the use of a monoclonal antibody (mab) and a SPR sensor for label-free detection of the model organism Puccinia striiformis f.sp. tritici (Pst) a biotrophic fungus...... causing wheat yellow rust. We have developed mabs towards intact whole spores and used a subtractive inhibition format for detection of spores in solution. The antibody was incubated with different spore concentrations and the remaining free antibody was quantified using a BIAcore® 3000 sensor....... Decreasing binding of mab to the sensor surface was observed as the Pst urediniospore concentration was increased. The detection range for the assay was 1.7 x 106 – 5.3 x 104 spores/ml. This study describes the first use of SPR for detection of fungal spores and the generic principle has the potential...

  5. A Generic Method for Fungal Spore Detection: The use of a monoclonal antibody and surface plasmon resonance

    DEFF Research Database (Denmark)

    Skottrup, Peter; Hearty, Stephen; Frøkiær, Hanne

    2005-01-01

    This study describes a biosensing principle for detection of fungal spores using surface plasmon resonance (SPR). The approach involves the use of a monoclonal antibody (mab) and a SPR sensor for label-free detection of the model organism Puccinia striiformis f.sp. tritici (Pst) a biotrophic fungus...... causing wheat yellow rust. We have developed mabs towards intact whole spores and used a subtractive inhibition format for detection of spores in solution. The antibody was incubated with different spore concentrations and the remaining free antibody was quantified using a BIAcore® 3000 sensor. Decreasing...... binding of mab to the sensor surface was observed as the Pst urediniospore concentration was increased. The detection range for the assay was 1.7 x 106 – 5.3 x 104 spores/ml. This study describes the first use of SPR for detection of fungal spores and the generic principle has the potential to be used...

  6. In vitro mutagenesis of commercial fern, Asplenium nidus from spores

    International Nuclear Information System (INIS)

    Norazlina Noordin

    2004-01-01

    Asplenium is a largest, most diverse fern genera. One of the common species is Asplenium nidus, well known as Bird's-nest fern, a medium to large fern with erect, stout, unbranched rhizomes. In creating variability of ferns for the benefit of the ornamental plant industry, in vitro mutagenesis is used. In this study, spores of Asplenium nidus were collected from frond bearing mature sporangia. Spores were cultured in modified 1/2 MS basal medium supplemented with various combinations of 6-Benzylaminopurine (BAP) and Naphtalene Acetic Acid (NAA). Spore cultures were incubated in incubation room at 24 degree C with 16 hours photoperiod (3500 lux). It was found that, the most effective combinations were 1 mg/1 BAP + 0. 1 mg/1 NAA and 2mg/1 BAP + 0. 1 mg/1 NAA. Prothallus was formed after 10 days of cultures and gametophytes were formed 1 month later. These gametophytes were irradiated with Gamma ray at doses of 0, 20, 90, 120, 150 and 180 Gy. From the preliminary result obtained from this study, for generating variations and desired phenotypic expression for Asplenium nidus, recommended doses for in vitro mutagenesis using spores are between 90 Gy to 150 Gy. Gametophytes were subcultured at monthly interval to ensure further development and propagation. Frequent monitoring for any changes in the morphology of the irradiated Asplenium nidus plants were carried out. (Author)

  7. Multigeneration Cross-Contamination of Mail with Bacillus anthracis Spores.

    Directory of Open Access Journals (Sweden)

    Jason Edmonds

    Full Text Available The release of biological agents, including those which could be used in biowarfare or bioterrorism in large urban areas, has been a concern for governments for nearly three decades. Previous incidents from Sverdlosk and the postal anthrax attack of 2001 have raised questions on the mechanism of spread of Bacillus anthracis spores as an aerosol or contaminant. Prior studies have demonstrated that Bacillus atrophaeus is easily transferred through simulated mail handing, but no reports have demonstrated this ability with Bacillus anthracis spores, which have morphological differences that may affect adhesion properties between spore and formite. In this study, equipment developed to simulate interactions across three generations of envelopes subjected to tumbling and mixing was used to evaluate the potential for cross-contamination of B. anthracis spores in simulated mail handling. In these experiments, we found that the potential for cross-contamination through letter tumbling from one generation to the next varied between generations while the presence of a fluidizer had no statistical impact on the transfer of material. Likewise, the presence or absence of a fluidizer had no statistically significant impact on cross-contamination levels or reaerosolization from letter opening.

  8. Isolation, amplification and characterization of foodborne pathogen disease bacteria gene for rapid kit test development

    Science.gov (United States)

    Nurjayadi, M.; Santoso, I.; Kartika, I. R.; Kurniadewi, F.; Saamia, V.; Sofihan, W.; Nurkhasanah, D.

    2017-07-01

    There is a lot of public concern over food safety. Food-safety cases recently, including many food poisoning cases in both the developed and developing countries, considered to be the national security threats which involved police investigation. Quick and accurate detection methods are needed to handle the food poisoning cases with a big number of sufferers at the same time. Therefore, the research is aimed to develop a specific, sensitive, and rapid result molecular detection tool for foodborne pathogen bacteria. We, thus, propose genomic level approach with Polymerase Chain Reaction. The research has successfully produced a specific primer to perform amplification to fim-C S. typhi, E. coli, and pef Salmonella typhimurium genes. The electrophoresis result shows that amplification products are 95 base pairs, 121 base pairs, and 139 base pairs; and all three genes are in accordance with the size of the in silico to third genes bacteria. In conclusion, the research has been successfully designed a specific detection tool to three foodborne pathogen bacteria genes. Further stages test and the uses of Real-time PCR in the detection are still in the trial process for better detection method.

  9. Adsorption of β-galactosidase of Alicyclobacillus acidocaldarius on wild type and mutants spores of Bacillus subtilis

    Directory of Open Access Journals (Sweden)

    Sirec Teja

    2012-08-01

    Full Text Available Abstract Background The Bacillus subtilis spore has long been used as a surface display system with potential applications in a variety of fields ranging from mucosal vaccine delivery, bioremediation and biocatalyst development. More recently, a non-recombinant approach of spore display has been proposed and heterologous proteins adsorbed on the spore surface. We used the well-characterized β-galactosidase from the thermoacidophilic bacterium Alicyclobacillus acidocaldarius as a model to study enzyme adsorption, to analyze whether and how spore-adsorption affects the properties of the enzyme and to improve the efficiency of the process. Results We report that purified β-galactosidase molecules were adsorbed to purified spores of a wild type strain of B. subtilis retaining ca. 50% of their enzymatic activity. Optimal pH and temperature of the enzyme were not altered by the presence of the spore, that protected the adsorbed β-galactosidase from exposure to acidic pH conditions. A collection of mutant strains of B. subtilis lacking a single or several spore coat proteins was compared to the isogenic parental strain for the adsorption efficiency. Mutants with an altered outermost spore layer (crust were able to adsorb 60-80% of the enzyme, while mutants with a severely altered or totally lacking outer coat adsorbed 100% of the β-galactosidase molecules present in the adsorption reaction. Conclusion Our results indicate that the spore surface structures, the crust and the outer coat layer, have an negative effect on the adhesion of the β-galactosidase. Electrostatic forces, previously suggested as main determinants of spore adsorption, do not seem to play an essential role in the spore-β-galactosidase interaction. The analysis of mutants with altered spore surface has shown that the process of spore adsorption can be improved and has suggested that such improvement has to be based on a better understanding of the spore surface structure

  10. Children developing asthma by school-age display aberrant immune responses to pathogenic airway bacteria as infants

    DEFF Research Database (Denmark)

    Larsen, Jeppe Madura; Pedersen, Susanne Brix; Thysen, Anna Hammerich

    2014-01-01

    Asthma is a highly prevalent chronic lung disease that commonly originates in early childhood. Colonisation of neonatal airways with the pathogenic bacterial strains H. influenzae, M. catarrhalis and S. pneumoniae is associated with increased risk of later childhood asthma. We hypothesized that c...... that children developing asthma have an abnormal immune response to pathogenic bacteria in infancy. We aimed to assess the bacterial immune response in asymptomatic infants and the association with later development of asthma by age 7 years....

  11. Prevalence of Vibrio cholerae in Coastal Alternative Supplies of Drinking Water and Association with Bacillus-Like Spore Formers

    Directory of Open Access Journals (Sweden)

    Md. Asaduzzaman Shishir

    2018-02-01

    Full Text Available The scarcity of hygienic drinking water is a normal phenomenon in the coastal areas of Bangladesh due to the high salinity of ground water. The inhabitants of this locality, therefore, live on alternative supplies of water including rain-fed pond water, and rainwater with persistent complex microbial interactions therein, often contaminated with life-threatening pathogens. Hence, this study was aimed at analyzing the prevalence of Vibrio cholerae (Vc in the alternative drinking waters of Mathbaria, a coastal subdistrict neighboring the Bay of Bengal, the efficacy of pond sand filter (PSF and the co-association among Bacillus-like spore formers (Sf and Vc. Vc presumably entrapped into the membrane filter was enriched in alkaline peptone water medium and was isolated on selective thiosulfate-citrate-bile salts-sucrose and taurocholate-tellurite-gelatin agar media. They were finally identified by immunochromatographic one step rapid test and serology test. A total of 26% Vc positive samples were obtained out of 100 [ponds—48, household (HH—29, and PSFs—23] where 13% cases were pathogenic (Vc O1 and 13% were non-pathogenic (Vc non-O1/non-O139. The distribution of Vc as observed was 33, 26, and 13.8% in waters derived from pond surface, PSF, and HH reservoirs, respectively, and for pathogenic type, it was 62.5%, 50%, and nil, respectively. Although none of the samples was identified with pathogenic Vc O139, the statistics represents a significant and augmentative risk of cholera outbreak in the focused area. The antibiotic sensitivity pattern in this study resembled the trend observed during last few years for Vc. The PSF demonstrated its inability to remove Vc from any of the samples and in addition, the filter itself was evidenced to be the source of pathogens and spores in further contamination and transmission. The development of biofilm in the PSF could be hypothesized as the reservoir in contaminating pathogen-free water samples. From the

  12. Development of a nested PCR assay to detect the pathogenic free-living amoeba Naegleria fowleri.

    Science.gov (United States)

    Réveiller, Fabienne L; Cabanes, Pierre-André; Marciano-Cabral, Francine

    2002-05-01

    Naegleria fowleri is the causative agent of primary amoebic meningoencephalitis, a fatal disease of the central nervous system that is acquired while swimming or diving in freshwater. A cDNA clone designated Mp2C15 obtained from N. fowleri was used as a probe to distinguish N. fowleri from other free-living amoebae. The Mp2C15 probe hybridized to genomic DNA from pathogenic N. fowleri and antigenically related non-pathogenic N. lovaniensis. Mp2C15 was digested with the restriction enzyme XbaI, resulting in two fragments, Mp2C15.G and Mp2C15.P. Four species of Naegleria and four species of Acanthamoeba were examined for reactivity with Mp2C15.P. Mp2C15.P was specific for N. fowleri and was used in the development of a nested PCR assay which is capable of detecting as little as 5 pg of N. fowleri DNA or five intact N. fowleri amoebae. In summary, a rapid, sensitive, and specific assay for the detection of N. fowleri was developed.

  13. Polyubiquitin is required for growth, development and pathogenicity in the rice blast fungus Magnaporthe oryzae.

    Science.gov (United States)

    Oh, Yeonyee; Franck, William L; Han, Sang-Oh; Shows, Angela; Gokce, Emine; Muddiman, David C; Dean, Ralph A

    2012-01-01

    Protein ubiquitination, which is highly selective, regulates many important biological processes including cellular differentiation and pathogenesis in eukaryotic cells. Here, we integrated pharmacological, molecular and proteomic approaches to explore the role of ubiquitination in Magnaporthe oryzae, the leading fungal disease of rice world-wide. Inhibition of ubiquitin-mediated proteolysis using the 26S proteasome inhibitor, Bortezomib, significantly attenuated conidia germination, appressorium formation and pathogenicity in M. oryzae. Gene expression analysis revealed that many genes associated with protein ubiquitination were developmentally regulated during conidia germination. Only a few, including a polyubiquitin encoding gene, MGG_01282, were more abundantly expressed during appressorium formation and under nitrogen starvation. Targeted gene deletion of MGG_01282, in addition to a significant reduction in protein ubiquitination as determined by immuno blot assays, resulted in pleiotropic effects on M. oryzae including reduced growth and sporulation, abnormal conidia morphology, reduced germination and appressorium formation, and the inability to cause disease. Mutants were also defective in sexual development and were female sterile. Using mass spectrometry, we identified 63 candidate polyubiquitinated proteins under nitrogen starvation, which included overrepresentation of proteins involved in translation, transport and protein modification. Our study suggests that ubiquitination of target proteins plays an important role in nutrient assimilation, development and pathogenicity of M. oryzae.

  14. Structures of Cryptococcus neoformans protein farnesyltransferase reveal strategies for developing inhibitors that target fungal pathogens.

    Science.gov (United States)

    Hast, Michael A; Nichols, Connie B; Armstrong, Stephanie M; Kelly, Shannon M; Hellinga, Homme W; Alspaugh, J Andrew; Beese, Lorena S

    2011-10-07

    Cryptococcus neoformans is a fungal pathogen that causes life-threatening infections in immunocompromised individuals, including AIDS patients and transplant recipients. Few antifungals can treat C. neoformans infections, and drug resistance is increasing. Protein farnesyltransferase (FTase) catalyzes post-translational lipidation of key signal transduction proteins and is essential in C. neoformans. We present a multidisciplinary study validating C. neoformans FTase (CnFTase) as a drug target, showing that several anticancer FTase inhibitors with disparate scaffolds can inhibit C. neoformans and suggesting structure-based strategies for further optimization of these leads. Structural studies are an essential element for species-specific inhibitor development strategies by revealing similarities and differences between pathogen and host orthologs that can be exploited. We, therefore, present eight crystal structures of CnFTase that define the enzymatic reaction cycle, basis of ligand selection, and structurally divergent regions of the active site. Crystal structures of clinically important anticancer FTase inhibitors in complex with CnFTase reveal opportunities for optimization of selectivity for the fungal enzyme by modifying functional groups that interact with structurally diverse regions. A substrate-induced conformational change in CnFTase is observed as part of the reaction cycle, a feature that is mechanistically distinct from human FTase. Our combined structural and functional studies provide a framework for developing FTase inhibitors to treat invasive fungal infections.

  15. NanoSIMS analysis of Bacillus spores for forensics

    Energy Technology Data Exchange (ETDEWEB)

    Weber, P K; Davisson, M L; Velsko, S P

    2010-02-23

    The threat associated with the potential use of radiological, nuclear, chemical and biological materials in terrorist acts has resulted in new fields of forensic science requiring the application of state-of-the-science analytical techniques. Since the anthrax letter attacks in the United States in the fall of 2001, there has been increased interest in physical and chemical characterization of bacterial spores. While molecular methods are powerful tools for identifying genetic differences, other methods may be able to differentiate genetically identical samples based on physical and chemical properties, as well as provide complimentary information, such as methods of production and approximate date of production. Microanalysis has the potential to contribute significantly to microbial forensics. Bacillus spores are highly structured, consisting of a core, cortex, coat, and in some species, an exosporium. This structure provides a template for constraining elemental abundance differences at the nanometer scale. The primary controls on the distribution of major elements in spores are likely structural and physiological. For example, P and Ca are known to be abundant in the spore core because that is where P-rich nucleic acids and Cadipicolinic acid are located, respectively. Trace elements are known to bind to the spore coat but the controls on these elements are less well understood. Elemental distributions and abundances may be directly related to spore production, purification and stabilization methodologies, which are of particular interest for forensic investigation. To this end, we are developing a high-resolution secondary ion mass spectrometry method using a Cameca NanoSIMS 50 to study the distribution and abundance of trace elements in bacterial spores. In this presentation we will review and compare methods for preparing and analyzing samples, as well as review results on the distribution and abundance of elements in bacterial spores. We use NanoSIMS to

  16. Development of Ash Dieback in South-Eastern Germany and the Increasing Occurrence of Secondary Pathogens

    Directory of Open Access Journals (Sweden)

    Heike D. Lenz

    2016-02-01

    Full Text Available Since its first identification in Poland in 2006, the ascomycete Hymenoscyphus fraxineus has caused massive dieback of Fraxinus excelsior in the countries of eastern, northern and central Europe. This work shows the development, expansion, and severity of the disease in south-eastern Germany for a period of four years, starting in 2010. Differences between habitats, as well as age classes have been captured. The presence and the amount of potentially resistant trees were proven over the years, to determine how high the resistance level might be. Typical disease symptoms are the wilting of leaves, necrotic lesions in the bark and reddish discolorations of branches and stems. In addition, stem necroses also appear by infection with species of Armillaria. Therefore, special attention has been given to Armillaria species in affected ash stands but also to other secondary pathogens, like ash bark beetles. It is shown that breeding galleries of Hylesinus fraxini are only found in trees that have recently died and thus Hylesinus fraxini is still acting as a secondary opportunistic pathogen. In contrast, Armillaria spp. can be considered as serious pathogens of weakened ash trees. In different ash stands, typical symptoms of infection can be found. A relationship between stem base necrotic lesions and vitality was examined. It is shown that necrotic lesions severely contribute to accelerating the mortality of ash trees. In addition to the high infection pressure by H. fraxineus, the high inoculum of Armillaria in the soil facilitates further infections and, thus, likewise endangers the survival of potentially resistant trees. In the following years, forest conversion and seed harvest in affected ash stands will have to be urgently considered to avoid tree gaps on a large scale. Furthermore, infection assays of potentially resistant trees with ensuing breeding programmes should be initially started for the conservation of this ecologically and

  17. Mycosphaerella fijiensis, the black leaf streak pathogen of banana: progress towards understanding pathogen biology and detection, disease development, and the challenges of control.

    Science.gov (United States)

    Churchill, Alice C L

    2011-05-01

    Banana (Musa spp.) is grown throughout the tropical and subtropical regions of the world. The fruits are a key staple food in many developing countries and a source of income for subsistence farmers. Bananas are also a major, multibillion-dollar export commodity for consumption primarily in developed countries, where few banana cultivars are grown. The fungal pathogen Mycosphaerella fijiensis causes black leaf streak disease (BLSD; aka black Sigatoka leaf spot) on the majority of edible banana cultivars grown worldwide. The fact that most of these cultivars are sterile and unsuitable for the breeding of resistant lines necessitates the extensive use of fungicides as the primary means of disease control. BLSD is a significant threat to the food security of resource-poor populations who cannot afford fungicides, and increases the environmental and health hazards where large-acreage monocultures of banana (Cavendish subgroup, AAA genome) are grown for export. Mycosphaerella fijiensis M. Morelet is a sexual, heterothallic fungus having Pseudocercospora fijiensis (M. Morelet) Deighton as the anamorph stage. It is a haploid, hemibiotrophic ascomycete within the class Dothideomycetes, order Capnodiales and family Mycosphaerellaceae. Its taxonomic placement is based on DNA phylogeny, morphological analyses and cultural characteristics. Mycosphaerella fijiensis is a leaf pathogen that causes reddish-brown streaks running parallel to the leaf veins, which aggregate to form larger, dark-brown to black compound streaks. These streaks eventually form fusiform or elliptical lesions that coalesce, form a water-soaked border with a yellow halo and, eventually, merge to cause extensive leaf necrosis. The disease does not kill the plants immediately, but weakens them by decreasing the photosynthetic capacity of leaves, causing a reduction in the quantity and quality of fruit, and inducing the premature ripening of fruit harvested from infected plants. Although Musa spp. are the

  18. The transcription factor Rbf1 is the master regulator for b-mating type controlled pathogenic development in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Kai Heimel

    Full Text Available In the phytopathogenic basidiomycete Ustilago maydis, sexual and pathogenic development are tightly connected and controlled by the heterodimeric bE/bW transcription factor complex encoded by the b-mating type locus. The formation of the active bE/bW heterodimer leads to the formation of filaments, induces a G2 cell cycle arrest, and triggers pathogenicity. Here, we identify a set of 345 bE/bW responsive genes which show altered expression during these developmental changes; several of these genes are associated with cell cycle coordination, morphogenesis and pathogenicity. 90% of the genes that show altered expression upon bE/bW-activation require the zinc finger transcription factor Rbf1, one of the few factors directly regulated by the bE/bW heterodimer. Rbf1 is a novel master regulator in a multilayered network of transcription factors that facilitates the complex regulatory traits of sexual and pathogenic development.

  19. Re-aerosolization of Bacillus thuringiensis spores from concrete and turf.

    Science.gov (United States)

    Bishop, A H; O'Sullivan, C M; Lane, A; Butler Ellis, M C; Sellors, W J

    2017-05-01

    Spores of Bacillus anthracis deposited on surfaces can become airborne again as a result of air currents and mechanical forces. As such, they are a potential source of infection by inhalation. Spores of Bacillus thuringiensis were used to quantify this phenomenon in a simulation of outdoor conditions. Concrete and turf surfaces were inoculated by aerosol to produce high spore densities (greater than 1 × 10 9  CFU per m 2 ) which were then subjected to the passage of air at 10 ms -1 with and without simulated walking. Re-aerosolized spores were sampled by wetted wall cyclone air samplers. The mean total re-aerosolization rate from concrete (m -2  min -1 ) was 1·16 × 10 -3 for wind alone and 3·2 × 10 -3 for wind and simulated walking while for turf the respective values were 2·7 × 10 -4 and 6·7 × 10 -4 . Following the malicious and/or accidental release of an aerosol of Bacillus anthracis spores, the immediate risk of human inhalation would decrease as the spores were deposited on surfaces or diluted by wind flow. There is, however, a concern that the deposited spores could become re-aerosolized and so present an ongoing hazard. Using an accurate simulant for B. anthracis spores a method is reported here that allowed the enumeration of re-aerosolized spores from concrete and turf by wind flow and footfall. Under the conditions used, the rates of re-aerosolization were low. These findings will need to be verified under real outdoor conditions before the true significance in terms of secondary exposure to pathogenic spores can be assessed. © 2017 Crown copyright. Letter of Applied Microbiology © 2017 The Society for Applied Microbiology. This article is published with the permission of the Controller of HMSO and the Queen's Printer for Scotland.

  20. Effect of Environment and Sugar Beet Genotype on Root Rot Development and Pathogen Profile During Storage.

    Science.gov (United States)

    Liebe, Sebastian; Varrelmann, Mark

    2016-01-01

    Storage rots represent an economically important factor impairing the storability of sugar beet by increasing sucrose losses and invert sugar content. Understanding the development of disease management strategies, knowledge about major storage pathogens, and factors influencing their occurrence is crucial. In comprehensive storage trials conducted under controlled conditions, the effects of environment and genotype on rot development and associated quality changes were investigated. Prevalent species involved in rot development were identified by a newly developed microarray. The strongest effect on rot development was assigned to environment factors followed by genotypic effects. Despite large variation in rot severity (sample range 0 to 84%), the spectrum of microorganisms colonizing sugar beet remained fairly constant across all treatments with dominant species belonging to the fungal genera Botrytis, Fusarium, and Penicillium. The intensity of microbial tissue necrotization was strongly correlated with sucrose losses (R² = 0.79 to 0.91) and invert sugar accumulation (R² = 0.91 to 0.95). A storage rot resistance bioassay was developed that could successfully reproduce the genotype ranking observed in storage trials. Quantification of fungal biomass indicates that genetic resistance is based on a quantitative mechanism. Further work is required to understand the large environmental influence on rot development in sugar beet.

  1. A Clostridium difficile-Specific, Gel-Forming Protein Required for Optimal Spore Germination

    Directory of Open Access Journals (Sweden)

    M. Lauren Donnelly

    2017-01-01

    Full Text Available Clostridium difficile is a Gram-positive spore-forming obligate anaerobe that is a leading cause of antibiotic-associated diarrhea worldwide. In order for C. difficile to initiate infection, its aerotolerant spore form must germinate in the gut of mammalian hosts. While almost all spore-forming organisms use transmembrane germinant receptors to trigger germination, C. difficile uses the pseudoprotease CspC to sense bile salt germinants. CspC activates the related subtilisin-like protease CspB, which then proteolytically activates the cortex hydrolase SleC. Activated SleC degrades the protective spore cortex layer, a step that is essential for germination to proceed. Since CspC incorporation into spores also depends on CspA, a related pseudoprotease domain, Csp family proteins play a critical role in germination. However, how Csps are incorporated into spores remains unknown. In this study, we demonstrate that incorporation of the CspC, CspB, and CspA germination regulators into spores depends on CD0311 (renamed GerG, a previously uncharacterized hypothetical protein. The reduced levels of Csps in gerG spores correlate with reduced responsiveness to bile salt germinants and increased germination heterogeneity in single-spore germination assays. Interestingly, asparagine-rich repeat sequences in GerG’s central region facilitate spontaneous gel formation in vitro even though they are dispensable for GerG-mediated control of germination. Since GerG is found exclusively in C. difficile, our results suggest that exploiting GerG function could represent a promising avenue for developing C. difficile-specific anti-infective therapies.

  2. Assessing the Impact of Germination and Sporulation Conditions on the Adhesion of Bacillus Spores to Glass and Stainless Steel by Fluid Dynamic Gauging.

    Science.gov (United States)

    Xu Zhou, Ke; Li, Nan; Christie, Graham; Wilson, D Ian

    2017-11-01

    The adhesion of spores of 3 Bacillus species with distinctive morphologies to stainless steel and borosilicate glass was studied using the fluid dynamic gauging technique. Marked differences were observed between different species of spores, and also between spores of the same species prepared under different sporulation conditions. Spores of the food-borne pathogen B. cereus were demonstrated to be capable of withstanding shear stresses greater than 1500 Pa when adhered to stainless steel, in contrast to spores of Bacillus subtilis and Bacillus megaterium, which detached in response to lower shear stress. An extended DLVO model was shown to be capable of predicting the relative differences in spore adhesion between spores of different species and different culture conditions, but did not predict absolute values of force of adhesion well. Applying the model to germinating spores showed a significant reduction in adhesion force shortly after triggering germination, indicating a potential strategy to achieve enhanced removal of spores from surfaces in response to shear stress, such as during cleaning-in-place procedures. Spore-forming bacteria are a concern to the food industry because they have the potential to cause food-borne illness and product spoilage, while being strongly adhesive to processing surfaces and resistant to cleaning-in-place procedures. This work is of significance to the food processors and manufacturers because it offers insight to the properties of spore adhesion and identifies a potential strategy to facilitate the removal of spores during cleaning procedures. © 2017 The Authors. Journal of Food Science published by Wiley Periodicals, Inc. on behalf of Institute of Food Technologists.

  3. The immunological characteristics and probiotic function of recombinant Bacillus subtilis spore expressing Clonorchis sinensis cysteine protease.

    Science.gov (United States)

    Tang, Zeli; Shang, Mei; Chen, Tingjin; Ren, Pengli; Sun, Hengchang; Qu, Hongling; Lin, Zhipeng; Zhou, Lina; Yu, Jinyun; Jiang, Hongye; Zhou, Xinyi; Li, Xuerong; Huang, Yan; Xu, Jin; Yu, Xinbing

    2016-12-19

    Clonorchiasis, a food-borne zoonosis, is caused by Clonorchis sinensis. The intestinal tract and bile ducts are crucial places for C. sinensis metacercariae to develop into adult worms. The endospore of Bacillus subtilis is an ideal oral immunization vehicle for delivery of heterologous antigens to intestine. Cysteine protease of C. sinensis (CsCP) is an endogenous key component in the excystment of metacercariae and other physiological or pathological processes. We constructed a fusion gene of CotC (a coat protein)-CsCP and obtained B. subtilis spores with recombinant plasmid of pEB03-CotC-CsCP (B.s-CotC-CsCP). CotC-CsCP expressed on spores' surface was detected by Western blotting and immunofluorescence. Immunological characteristics of recombinant spore coat protein were evaluated in a mouse model. The levels of CsCP-specific antibodies were detected by ELISA. Effects of recombinant spores on mouse intestine were evaluated by histological staining. The activities of biochemical enzymes in serum were assayed by microplate. Liver sections of infected mice were evaluated by Ishak score after Masson's trichrome. The B.s-CotC-CsCP spores displayed CsCP on their coat. Specific IgG and isotypes were significantly induced by coat proteins of B.s-CotC-CsCP spores after subcutaneous immunization. IgA levels in intestinal mucus and bile of B.s-CotC-CsCP orally treated mice significantly increased. Additionally, more IgA-secreting cells were observed in enteraden and lamina propria regions of the mouse jejunum, and an increased amount of acidic mucins in intestines were also observed. There were no significant differences in enzyme levels of serum among groups. No inflammatory injury was observed in the intestinal tissues of each group. The degree of liver fibrosis was significantly reduced after oral immunization with B.s-CotC-CsCP spores. Bacillus subtilis spores maintained the original excellent immunogenicity of CsCP expressed on their surface. Both local and systemic

  4. Isolation and analysis of bacteria associated with spores of Gigaspora margarita.

    Science.gov (United States)

    Cruz, A F; Horii, S; Ochiai, S; Yasuda, A; Ishii, T

    2008-06-01

    The aim of this work was to observe bacteria associated with the spores of Gigaspora margarita, an arbuscular mycorrhizal fungus (AMF). First, a direct analysis of DNA from sterilized spores indicated the bacteria belonging to the genus Janthinobacterium. In the second assay, two bacterial strains were isolated by osmosis from protoplasts, which were derived from spores by using two particular enzymes: lysing enzymes and yatalase. After isolation, cultivation and identification by their DNA as performed in the first experiment, the species with the closest relation were Janthinobacterium lividum (KCIGM01) and Paenibacillus polymyxa (KCIGM04) isolated with lysing enzymes and yatalase respectively. Morphologically, J. lividum was Gram negative and oval, while P. polymyxa was also oval, but Gram positive. Both strains had antagonistic effects to the pathogenic fungi Rosellimia necatrix, Pythium ultimum, Fusarium oxysporum and Rhizoctonia solani. In particular, J. lividum was much stronger in this role. However, in phosphorus (P) solubilization P. polymyxa functioned better than J. lividum. This experiment had revealed two new bacteria species (P. polymyxa and J. lividum), associated with AMF spores, which functioned to suppress diseases and to solubilize P. AMF spores could be a useful source for bacterial antagonists to soil-borne diseases and P solubilization.

  5. Mucorales spores induce a proinflammatory cytokine response in human mononuclear phagocytes and harbor no rodlet hydrophobins.

    Science.gov (United States)

    Wurster, Sebastian; Thielen, Vanessa; Weis, Philipp; Walther, Paul; Elias, Johannes; Waaga-Gasser, Ana Maria; Dragan, Mariola; Dandekar, Thomas; Einsele, Hermann; Löffler, Jürgen; Ullmann, Andrew J

    2017-11-17

    Mucormycoses are life-threatening infections in immunocompromised patients. This study characterizes the response of human mononuclear cells to different Mucorales and Ascomycota. PBMC, monocytes, and monocyte derived dendritic cells (moDCs) from healthy donors were stimulated with resting and germinated stages of Mucorales and Ascomycota. Cytokine response and expression of activation markers were studied. Both inactivated germ tubes and resting spores of Rhizopus arrhizus and other human pathogenic Mucorales species significantly stimulated mRNA synthesis and secretion of proinflammatory cytokines. Moreover, R. arrhizus spores induced the upregulation of co-stimulatory molecules on moDCs and a specific T-helper cell response. Removal of rodlet hydrophobins by hydrofluoric acid treatment of A. fumigatus conidia resulted in enhanced immunogenicity, whereas the cytokine response of PBMCs to dormant R. arrhizus spores was not influenced by hydrofluoric acid. Scanning electron micrographs of Mucorales spores did not exhibit any morphological correlates of rodlet hydrophobins. Taken together, this study revealed striking differences in the response of human mononuclear cells to resting stages of Ascomycota and Mucorales, which may be explained by absence of an immunoprotective hydrophobin layer in Mucorales spores.

  6. Sensitivity of thermally treated Bacillus subtilis spores to subsequent irradiation

    International Nuclear Information System (INIS)

    Mostafa, S.A.; El-Zawahry, Y.A.; Awny, N.M.

    1986-01-01

    B. subtilis spores exposed to thermal treatment at 70 or 80 0 C for 1 hr were more sensitive to subsequent radiation exposure than non-heated spores. Deactivation of previously heated spores by increasing dose of 0-radiation followed an exponential function while, for non-heated spores a shoulder followed by exponential deactivation was noticed. Combined heat-radiation treatment exhibited a synergistic effect on spore deactivation at low irradiation doses, while at high irradiation doses, the effect was more or less additive. Added values of spore injury was higher for B. subtilis spores that received heat and radiation separately than the observed injury for spores that received combined treatment (heat followed by radiation). Results of spore deactivation and injury due to heat followed by radiation treatment are discussed in comparison to those of spores that received radiation-heat sequence

  7. Novel Sample Preparation Method for Safe and Rapid Detection of Bacillus anthracis Spores in Environmental Powders and Nasal Swabs

    OpenAIRE

    Luna, Vicki A.; King, Debra; Davis, Carisa; Rycerz, Tony; Ewert, Matthew; Cannons, Andrew; Amuso, Philip; Cattani, Jacqueline

    2003-01-01

    Bacillus anthracis spores have been used as a biological weapon in the United States. We wanted to develop a safe, rapid method of sample preparation that provided safe DNA for the detection of spores in environmental and clinical specimens. Our method reproducibly detects B. anthracis in samples containing

  8. Development of a qualitative pathogen risk-assessment methodology for municipal-sludge landfilling

    Energy Technology Data Exchange (ETDEWEB)

    1988-04-01

    This report addresses potential risks from microbiological pathogens present in municipal sludge disposal in landfills. Municipal sludges contain a wide variety of bacteria, viruses, protozoa, helminths, and fungi. Survival characteristics of pathogens are critical factors in assessing the risks associated with potential transport of microorganisms from the sludge-soil matrix to the ground-water environment of landfills. Various models are discussed for predicting microbial die-off. The order of persistence in the environment from longest to shortest survival time appears to be helminth eggs > viruses > bacteria > protozoan cysts. Whether or not a pathogen reaches ground-water and is transported to drinking-water wells depends on a number of factors, including initial concentration of the pathogen, survival of the pathogen, number of pathogens that reach the sludge-soil interface, degree of removal through the unsaturated and saturated-soil zones, and the hydraulic gradient. The degree to which each of these factors will influence the probability of pathogens entering ground-water cannot be determined precisely. Information on the fate of pathogens at existing landfills is sorely lacking. Additional laboratory and field studies are needed to determine the degree of pathogen leaching, survival and transport in ground-water in order to estimate potential risks from pathogens at sludge landfills with reasonable validity.

  9. Development of a high- versus low-pathogenicity model of the free-living amoeba Naegleria fowleri.

    Science.gov (United States)

    Burri, Denise C; Gottstein, Bruno; Zumkehr, Béatrice; Hemphill, Andrew; Schürch, Nadia; Wittwer, Matthias; Müller, Norbert

    2012-10-01

    Species in the genus Naegleria are free-living amoebae of the soil and warm fresh water. Although around 30 species have been recognized, Naegleria fowleri is the only one that causes primary amoebic meningoencephalitis (PAM) in humans. PAM is an acute and fast progressing disease affecting the central nervous system. Most of the patients die within 1-2 weeks of exposure to the infectious water source. The fact that N. fowleri causes such fast progressing and highly lethal infections has opened many questions regarding the relevant pathogenicity factors of the amoeba. In order to investigate the pathogenesis of N. fowleri under defined experimental conditions, we developed a novel high- versus low-pathogenicity model for this pathogen. We showed that the composition of the axenic growth media influenced growth behaviour and morphology, as well as in vitro cytotoxicity and in vivo pathogenicity of N. fowleri. Trophozoites maintained in Nelson's medium were highly pathogenic for mice, demonstrated rapid in vitro proliferation, characteristic expression of surface membrane vesicles and a small cell diameter, and killed target mouse fibroblasts by both contact-dependent and -independent destruction. In contrast, N. fowleri cultured in PYNFH medium exhibited a low pathogenicity, slower growth, increased cell size and contact-dependent target cell destruction. However, cultivation of the amoeba in PYNFH medium supplemented with liver hydrolysate (LH) resulted in trophozoites that were highly pathogenic in mice, and demonstrated an intermediate proliferation rate in vitro, diminished cell diameter and contact-dependent target cell destruction. Thus, in this model, the presence of LH resulted in increased proliferation of trophozoites in vitro and enhanced pathogenicity of N. fowleri in mice. However, neither in vitro cytotoxicity mechanisms nor the presence of membrane vesicles on the surface correlated with the pathologic potential of the amoeba. This indicated that the

  10. Evaluation of the Effect of Two Volatile Organic Compounds on Barley Pathogens

    Directory of Open Access Journals (Sweden)

    Amine Kaddes

    2016-08-01

    Full Text Available This study aimed to determine the effect of Volatile Organic Compounds (VOCs on some pathogens, these VOCs were emitted during interactions of barley with Fusarium culmorum Schltdl and/or Cochliobolus sativus Shoemaker, two common root rot pathogens. Our work shows that two organic esters: methyl propanoate (MP and methyl prop-2-enoate (MA significantly reduced the development of fungi in vitro. Additional tests showed that the esters significantly inhibited spore germination of these pathogens. The activity of these VOCs on a wide range of fungal and bacterial pathogens was also tested in vitro and showed inhibitory action. The effect of the VOCs on infected barley seeds also showed plantlets growing without disease symptoms. MA and MP seem to have potential value as alternative plant protection compounds against barley bioagressors.

  11. Effect of relative humidity on the aerodynamic diameter and respiratory deposition of fungal spores

    Science.gov (United States)

    Reponen, Tiina; Willeke, Klaus; Ulevicius, Vidmantas; Reponen, Auvo; Grinshpun, Sergey A.

    Exposure to airborne fungal spores may cause respiratory symptoms. The hygroscopicity of airborne spores may significantly affect their aerodynamic diameter, and thus change their deposition pattern in the human respiratory tract. We have investigated the change in aerodynamic diameter of five different fungal species as a function of relative humidity. Liquid and dry dispersion methods were explored for the aerosolization of the fungal spores. A new system that produces non-aggregated spore aerosol directly from a moldy surface was designed and found suitable for this study. The spores were aerosolized from a mold growth on agar by ducting dry air over the surface, and spore chains in the flow were broken up by passing the entire flow through a critical orifice. Size-spectrometric measurements with an Aerodynamic Particle Sizer showed that the aerodynamic diameter of the tested fungal spores does not change significantly when the relative humidity increases from 30% to 90%. A more distinct spore size increase was found at a relative humidity of ˜ 100%. The highest change of the aerodynamic diameter was found with Cladosporium cladosporioides: it increased from 1.8 μm to 2.3 μm when the relative humidity increased from 30% to ˜ 100%. The size increase corresponds to an approximate doubling of the particle volume. In order to estimate the effect of hygroscopic growth on the respiratory deposition of spores, the mean depositions in the human respiratory tract were calculated for fungal spores with various size changes due to hygroscopic growth. A recently developed model of the International Commission of Radiological Protection was used for the respiratory deposition calculations. We found that the 27% increase in Cladosporium size results in a 20-30% increase in the respiratory deposition of these spores. We conclude that most fungal spores are only slightly hygroscopic and the hygroscopic increase does not significantly affect their respiratory deposition. Our

  12. Development and Characterization of an In Vivo Pathogenic Molecular Clone of Equine Infectious Anemia Virus

    Science.gov (United States)

    Cook, R. Frank; Leroux, Caroline; Cook, Sheila J.; Berger, Sandra L.; Lichtenstein, Drew L.; Ghabrial, Nadia N.; Montelaro, Ronald C.; Issel, Charles J.

    1998-01-01

    An infectious nonpathogenic molecular clone (19-2-6A) of equine infectious anemia virus (EIAV) was modified by substitution of a 3.3-kbp fragment amplified by PCR techniques from a pathogenic variant (EIAVPV) of the cell culture-adapted strain of EIAV (EIAVPR). This substitution consisted of coding sequences for 77 amino acids at the carboxyl terminus of the integrase, the S1 (encoding the second exon of tat), S2, and S3 (encoding the second exon of rev) open reading frames, the complete env gene (including the first exon of rev), and the 3′ long terminal repeat (LTR). Modified 19-2-6A molecular clones were designated EIAVPV3.3, and infection of a single pony (678) with viruses derived from a mixture of five of these molecular clones induced clinical signs of acute equine infectious anemia (EIA) at 23 days postinfection (dpi). As a consequence of this initial study, a single molecular clone, EIAVPV3.3#3 (redesignated EIAVUK), was selected for further study and inoculated into two ponies (613 and 614) and two horses (700 and 764). Pony 614 and the two horses developed febrile responses by 12 dpi, which was accompanied by a 48 to 64% reduction in platelet number, whereas pony 613 did not develop fever (40.6°C) until 76 dpi. EIAV could be isolated from the plasma of these animals by 5 to 7 dpi, and all became seropositive for antibodies to this virus by 21 dpi. Analysis of the complete nucleotide sequence demonstrated that the 3.3-kbp 3′ fragment of EIAVUK differed from the consensus sequence of EIAVPV by just a single amino acid residue in the second exon of the rev gene. Complete homology with the EIAVPV consensus sequence was observed in the hypervariable region of the LTR. However, EIAVUK was found to contain an unusual 68-bp nucleotide insertion/duplication in a normally conserved region of the LTR sequence. These results demonstrate that substitution of a 3.3-kbp fragment from the EIAVPV strain into the infectious nonpathogenic molecular clone 19-2-6A leads

  13. Development of simple multiplex real-time PCR assays for foodborne pathogens detection and identification on LightCycler

    Directory of Open Access Journals (Sweden)

    Avo Karus1

    2017-03-01

    Full Text Available Most acute intestinal diseases are caused by food-borne pathogens. A fast and simple real-time PCR-based procedure for simultaneous detection of food contamination by any of the five food-borne pathogens: Campylobacter jejuni, Mycobacterium bovis, Enterobacter sakazaki, Shigella boydii, Clostridium perfrigens using multiplex EvaGreen real-time PCR for LightCycler was developed and evaluated. Real-time qPCR showed excellent sensitivity. Tm calling and Melting Curve Genotyping (MCG were used for analysis of PCR product melting curves. The Melting Curve Genotyping option showed good performance for discrimination of positive samples containing DNA of single pathogen or pathogen mixtures from negative samples.

  14. Studying Host-Pathogen Interactions In 3-D: Organotypic Models For Infectious Disease And Drug Development

    Science.gov (United States)

    Nickerson, Cheryl A.; Richter, Emily G.; Ott, C. Mark

    2006-01-01

    Representative, reproducible and high-throughput models of human cells and tissues are critical for a meaningful evaluation of host-pathogen interactions and are an essential component of the research developmental pipeline. The most informative infection models - animals, organ explants and human trials - are not suited for extensive evaluation of pathogenesis mechanisms and screening of candidate drugs. At the other extreme, more cost effective and accessible infection models such as conventional cell culture and static co-culture may not capture physiological and three-dimensional aspects of tissue biology that are important in assessing pathogenesis, and effectiveness and cytotoxicity of therapeutics. Our lab has used innovative bioengineering technology to establish biologically meaningful 3-D models of human tissues that recapitulate many aspects of the differentiated structure and function of the parental tissue in vivo, and we have applied these models to study infectious disease. We have established a variety of different 3-D models that are currently being used in infection studies - including small intestine, colon, lung, placenta, bladder, periodontal ligament, and neuronal models. Published work from our lab has shown that our 3-D models respond to infection with bacterial and viral pathogens in ways that reflect the infection process in vivo. By virtue of their physiological relevance, 3-D cell cultures may also hold significant potential as models to provide insight into the neuropathogenesis of HIV infection. Furthermore, the experimental flexibility, reproducibility, cost-efficiency, and high throughput platform afforded by these 3-D models may have important implications for the design and development of drugs with which to effectively treat neurological complications of HIV infection.

  15. Quantitative Proteomic Analysis of Germination of Nosema bombycis Spores under Extremely Alkaline Conditions.

    Science.gov (United States)

    Liu, Han; Chen, Bosheng; Hu, Sirui; Liang, Xili; Lu, Xingmeng; Shao, Yongqi

    2016-01-01

    The microsporidian Nosema bombycis is an obligate intracellular pathogen of the silkworm Bombyx mori , causing the epidemic disease Pebrine and extensive economic losses in sericulture. Although N. bombycis forms spores with rigid spore walls that protect against various environmental pressures, ingested spores germinate immediately under the extremely alkaline host gut condition (Lepidoptera gut pH > 10.5), which is a key developmental turning point from dormant state to infected state. However, to date this process remains poorly understood due to the complexity of the animal digestive tract and the lack of genetic tools for microsporidia. Here we show, using an in vitro spore germination model, how the proteome of N. bombycis changes during germination, analyse specific metabolic pathways employed in detail, and validate key functional proteins in vivo in silkworms. By a label-free quantitative proteomics approach that is directly based on high-resolution mass spectrometry (MS) data, a total of 1136 proteins were identified with high confidence, with 127 proteins being significantly changed in comparison to non-germinated spores. Among them, structural proteins including polar tube protein 1 and 3 and spore wall protein (SWP) 4 and 30 were found to be significantly down-regulated, but SWP9 significantly up-regulated. Some nucleases like polynucleotide kinase/phosphatase and flap endonucleases 1, together with a panel of hydrolases involved in protein degradation and RNA cleavage were overrepresented too upon germination, which implied that they might play important roles during spore germination. The differentially regulated trends of these genes were validated, respectively, by quantitative RT-PCR and 3 proteins of interest were confirmed by Western blotting analyses in vitro and in vivo . Furthermore, the pathway analysis showed that abundant up- and down-regulations appear involved in the glycolysis, pentose phosphate pathway, purine, and pyrimidine

  16. Quantitative proteomic analysis of germination of Nosema bombycis spores under extremely alkaline conditions

    Directory of Open Access Journals (Sweden)

    Yongqi Shao

    2016-09-01

    Full Text Available The microsporidian Nosema bombycis is an obligate intracellular pathogen of the silkworm Bombyx mori, causing the epidemic disease Pebrine and extensive economic losses in sericulture. Although N. bombycis forms spores with rigid spore walls that protect against various environmental pressures, ingested spores germinate immediately under the extremely alkaline host gut condition (Lepidoptera gut pH >10.5, which is a key developmental turning point from dormant state to infected state. However, to date this process remains poorly understood due to the complexity of the animal digestive tract and the lack of genetic tools for Microsporidia. Here we show, using an in vitro spore germination model, how the proteome of N. bombycis changes during germination, analyse specific metabolic pathways employed in detail, and validate key functional proteins in vivo in silkworms. By a label-free quantitative proteomics approach that is directly based on high-resolution mass spectrometry (MS data, a total of 1136 proteins were identified with high confidence, with 127 proteins being significantly changed in comparison to non-germinated spores. Among them, structural proteins including polar tube protein 1 and 3 and spore wall protein (SWP 4 and 30 were found to be significantly down-regulated, but SWP9 significantly up-regulated. Some nucleases like polynucleotide kinase/phosphatase and flap endonucleases 1, together with a panel of hydrolases involved in protein degradation and RNA cleavage were overrepresented too upon germination, which implied that they might play important roles during spore germination. The differentially regulated trends of these genes were validated respectively by quantitative RT-PCR and 3 proteins of interest were confirmed by Western blotting analyses in vitro and in vivo. Furthermore the pathway analysis showed that abundant up- and down-regulations appear involved in the glycolysis, pentose phosphate pathway, purine and

  17. Muricholic acids inhibit Clostridium difficile spore germination and growth.

    Directory of Open Access Journals (Sweden)

    Michael B Francis

    Full Text Available Infections caused by Clostridium difficile have increased steadily over the past several years. While studies on C. difficile virulence and physiology have been hindered, in the past, by lack of genetic approaches and suitable animal models, newly developed technologies and animal models allow these processes to be studied in detail. One such advance is the generation of a mouse-model of C. difficile infection. The development of this system is a major step forward in analyzing the genetic requirements for colonization and infection. While important, it is equally as important in understanding what differences exist between mice and humans. One of these differences is the natural bile acid composition. Bile acid-mediated spore germination is an important step in C. difficile colonization. Mice produce several different bile acids that are not found in humans. These muricholic acids have the potential to impact C. difficile spore germination. Here we find that the three muricholic acids (α-muricholic acid, β-muricholic acid and ω-muricholic acid inhibit C. difficile spore germination and can impact the growth of vegetative cells. These results highlight an important difference between humans and mice and may have an impact on C. difficile virulence in the mouse-model of C. difficile infection.

  18. Spore Heat Activation Requirements and Germination Responses Correlate with Sequences of Germinant Receptors and with the Presence of a Specific spoVA2mob Operon in Foodborne Strains of Bacillus subtilis.

    Science.gov (United States)

    Krawczyk, Antonina O; de Jong, Anne; Omony, Jimmy; Holsappel, Siger; Wells-Bennik, Marjon H J; Kuipers, Oscar P; Eijlander, Robyn T

    2017-04-01

    Spore heat resistance, germination, and outgrowth are problematic bacterial properties compromising food safety and quality. Large interstrain variation in these properties makes prediction and control of spore behavior challenging. High-level heat resistance and slow germination of spores of some natural Bacillus subtilis isolates, encountered in foods, have been attributed to the occurrence of the spoVA 2mob operon carried on the Tn 1546 transposon. In this study, we further investigate the correlation between the presence of this operon in high-level-heat-resistant spores and their germination efficiencies before and after exposure to various sublethal heat treatments (heat activation, or HA), which are known to significantly improve spore responses to nutrient germinants. We show that high-level-heat-resistant spores harboring spoVA 2mob required higher HA temperatures for efficient germination than spores lacking spoVA 2mob The optimal spore HA requirements additionally depended on the nutrients used to trigger germination, l-alanine (l-Ala), or a mixture of l-asparagine, d-glucose, d-fructose, and K + (AGFK). The distinct HA requirements of these two spore germination pathways are likely related to differences in properties of specific germinant receptors. Moreover, spores that germinated inefficiently in AGFK contained specific changes in sequences of the GerB and GerK germinant receptors, which are involved in this germination response. In contrast, no relation was found between transcription levels of main germination genes and spore germination phenotypes. The findings presented in this study have great implications for practices in the food industry, where heat treatments are commonly used to inactivate pathogenic and spoilage microbes, including bacterial spore formers. IMPORTANCE This study describes a strong variation in spore germination capacities and requirements for a heat activation treatment, i.e., an exposure to sublethal heat that increases

  19. Bacterial spores in food: how phenotypic variability complicates prediction of spore properties and bacterial behavior

    NARCIS (Netherlands)

    Eijlander, R.T.; Abee, T.; Kuipers, O.P.

    2011-01-01

    Bacillus spores are a known cause of food spoilage and their increased resistance poses a major challenge in efficient elimination. Recent studies on bacterial cultures at the single cell level have revealed how minor differences in essential spore properties, such as core water content or germinant

  20. Bacterial spores in food : how phenotypic variability complicates prediction of spore properties and bacterial behavior

    NARCIS (Netherlands)

    Eijlander, Robyn T.; Abee, Tjakko; Kuipers, Oscar P.

    Bacillus spores are a known cause of food spoilage and their increased resistance poses a major challenge in efficient elimination. Recent studies on bacterial cultures at the single cell level have revealed how minor differences in essential spore properties, such as core water content or germinant

  1. Bacillus cereus spore damage recovery and diversity in spore germination and carbohydrate utilisation

    NARCIS (Netherlands)

    Warda, Alicja K.

    2016-01-01

    Bacterial spores are extremely robust survival vehicles that are highly resistant towards environmental stress conditions including heat, UV radiation and other stresses commonly applied during food production and preservation. Spores, including those of the toxin-producing food-borne human

  2. Heat-induced oxidative injury contributes to inhibition of Botrytis cinerea spore germination and growth.

    Science.gov (United States)

    Zhao, Wei; Wisniewski, Michael; Wang, Wenjie; Liu, Jia; Liu, Yongsheng

    2014-03-01

    The inhibitory effect of heat treatment (HT) on Botrytis cinerea, a major postharvest fungal pathogen, and the possible mode of action were investigated. Spore germination and germ tube elongation of B. cinerea were both increasingly and significantly inhibited by HT (43 °C) for 10, 20 or 30 min. HT-induced gene expression of NADPH oxidase A, resulted in the intracellular accumulation of reactive oxygen species. HT-treated B. cinerea spores exhibited higher levels of oxidative damage to proteins and lipids, compared to the non-HT control. These findings indicate that HT resulted in oxidative damage which then played an important role in the inhibitory effect on B. cinerea. In the current study, HT was effective in controlling gray mold, caused by B. cinerea, in pear fruits. Understanding the mode of action by which HT inhibits fungal pathogens will help in the application of HT for management of postharvest fungal diseases of fruits and vegetables.

  3. A Novel Protocol for Decoating and Permeabilizing Bacterial Spores for Epifluorescent Microscopy

    Science.gov (United States)

    LaDuc, Myron T.; Mohapatra, Bidyut

    2014-01-01

    Based on previously reported procedures for permeabilizing vegetative bacterial cells, and numerous trial-and-error attempts with bacterial endospores, a protocol was developed for effectively permeabilizing bacterial spores, which facilitated the applicability of fluorescent in situ hybridization (FISH) microscopy. Bacterial endospores were first purified from overgrown, sporulated suspensions of B. pumilus SAFR-032. Purified spores at a concentration of approx equals 10 million spores/mL then underwent proteinase-K treatment, in a solution of 468.5 µL of 100 mM Tris-HCl, 30 µL of 10% SDS, and 1.5 microL of 20 mg/mL proteinase-K for ten minutes at 35 ºC. Spores were then harvested by centrifugation (15,000 g for 15 minutes) and washed twice with sterile phosphate-buffered saline (PBS) solution. This washing process consisted of resuspending the spore pellets in 0.5 mL of PBS, vortexing momentarily, and harvesting again by centrifugation. Treated and washed spore pellets were then resuspended in 0.5 mL of decoating solution, which consisted of 4.8 g urea, 3 mL Milli-Q water, 1 mL 0.5M Tris, 1 mL 1M dithiothreitol (DTT), and 2 mL 10% sodium-dodecylsulfate (SDS), and were incubated at 65 ºC for 15 minutes while being shaken at 165 rpm. Decoated spores were then, once again, washed twice with sterile PBS, and subjected to lysozyme/mutanolysin treatment (7 mg/mL lysozyme and 7U mutanolysin) for 15 minutes at 35 C. Spores were again washed twice with sterile PBS, and spore pellets were resuspended in 1-mL of 2% SDS. This treatment, facilitating inner membrane permeabilization, lasted for ten minutes at room temperature. Permeabilized spores were washed two final times with PBS, and were resuspended in 200 mkcroL of sterile PBS. At this point, the spores were permeable and ready for downstream processing, such as oligonucleotideprobe infiltration, hybridization, and microscopic evaluation. FISH-microscopic imagery confirmed the effective and efficient (˜50

  4. Influence of Bacillus polymyxa on the growth and development of Fusarium oxysporum f. sp. tulipae

    Directory of Open Access Journals (Sweden)

    Alicja Saniewska

    2013-12-01

    Full Text Available Antagonistic effect of Bacillus polymyxa, strain S13, toward Fusarium oxysporum f. sp. tulipae was evaluated iii vitro and in vivo. The growth of the pathogen was greatly inhibited in dual cultures with Bacillus polymyxa on potato dextrose agar. Suspension of B. polymyxa and its filtrate substantially inhibited spore germination and development of Fusarium oxysporuum f. sp. tulipae on tulip bulbs.

  5. Impact of sorbic acid and other mild preservation stresses on germination and outgrowth of Bacillus cereus spores

    NARCIS (Netherlands)

    Melis, van C.C.J.

    2013-01-01

    Weak organic acids such as sorbic acid, lactate, and acetic acid are widely used by the food industry as preservatives to control growth of micro-organisms. With the current trend towards milder processing of food products, opportunities arise for spore-forming spoilage and pathogenic

  6. Impact of sorbic acid and other mild preservation stresses on germination and outgrowth of Bacillus cereus spores

    NARCIS (Netherlands)

    Melis, van C.C.J.

    2013-01-01

      Weak organic acids such as sorbic acid, lactate, and acetic acid are widely used by the food industry as preservatives to control growth of micro-organisms. With the current trend towards milder processing of food products, opportunities arise for spore-forming spoilage and pathogenic

  7. Fungal communities including plant pathogens in near surface air are similar across northwestern Europe

    NARCIS (Netherlands)

    Nicolaisen, Mogens; West, Jonathan S.; Sapkota, Rumakanta; Canning, Gail G.M.; Schoen, Cor; Justesen, Annemarie F.

    2017-01-01

    Information on the diversity of fungal spores in air is limited, and also the content of airborne spores of fungal plant pathogens is understudied. In the present study, a total of 152 air samples were taken from rooftops at urban settings in Slagelse, DK, Wageningen NL, and Rothamsted, UK together

  8. Indicator and Pathogen Removal by Low Impact Development Best Management Practices

    Directory of Open Access Journals (Sweden)

    Jian Peng

    2016-12-01

    Full Text Available Microbial contamination in urban stormwater is one of the most widespread and challenging water quality issues in developed countries. Low impact development (LID best management practices (BMPs restore pre-urban hydrology by treating and/or harvesting urban runoff and stormwater, and can be designed to remove many contaminants including pathogens. One particular type of LID BMP, stormwater biofilters (i.e., vegetated media filters, also known as bioinfiltration, bioretention, or rain gardens, is becoming increasingly popular in urban environments due to its multiple co-benefits (e.g., improved hydrology, water quality, local climate and aesthetics. However, increased understanding of the factors influencing microbial removal in biofilters is needed to effectively design and implement biofilters for microbial water quality improvement. This paper aims to provide a holistic view of microbial removal in biofilter systems, and reviews the effects of various design choices such as filter media, vegetation, infauna, submerged zones, and hydraulic retention time on microbial removal. Limitations in current knowledge and recommendations for future research are also discussed.

  9. Seasonal variation of Ganoderma spore concentrations in urban and suburban districts of the city of Szczecin, Poland.

    Science.gov (United States)

    Grinn-Gofroń, Agnieszka; Strzelczak, Agnieszka; Przestrzelska, Katarzyna

    2015-01-01

    According to recent studies, Ganoderma may be the third genus, after Alternaria and Cladosporium, the spores of which cause symptoms of allergy, and concentration is related to meteorological factors. The aerobiology of Ganoderma spores in Szczecin in urban and suburban districts was examined using Lanzoni Volumetric Spore Traps in 2008-2010. Ganoderma spores were present in the atmosphere on more than 90% of the days from June through September with peak concentrations in June, July and September. The number of days with spores was lower in the suburban district, while the total number of spores collected was higher there than in the urban district. Correlation and multiple regression analyses revealed weak relationships between Ganoderma and meteorological conditions, while testing the significance of differences between the districts showed that urban development did not have a clear impact on the values of meteorological parameters. A significantly higher abundance of spores in the suburbs of Szczecin seemed to be conditioned by the closeness of potential area sources. This study indicates that a single measuring site in the city centre insufficiently reflected the dynamics and level of Ganoderma spore concentration in peripheral districts.

  10. Formation and characterization of non-growth states in Clostridium thermocellum: spores and L-forms

    Directory of Open Access Journals (Sweden)

    Mearls Elizabeth B

    2012-08-01

    Full Text Available Abstract Background Clostridium thermocellum is an anaerobic thermophilic bacterium that exhibits high levels of cellulose solublization and produces ethanol as an end product of its metabolism. Using cellulosic biomass as a feedstock for fuel production is an attractive prospect, however, growth arrest can negatively impact ethanol production by fermentative microorganisms such as C. thermocellum. Understanding conditions that lead to non-growth states in C. thermocellum can positively influence process design and culturing conditions in order to optimize ethanol production in an industrial setting. Results We report here that Clostridium thermocellum ATCC 27405 enters non-growth states in response to specific growth conditions. Non-growth states include the formation of spores and a L-form-like state in which the cells cease to grow or produce the normal end products of metabolism. Unlike other sporulating organisms, we did not observe sporulation of C. thermocellum in low carbon or nitrogen environments. However, sporulation did occur in response to transfers between soluble and insoluble substrates, resulting in approximately 7% mature spores. Exposure to oxygen caused a similar sporulation response. Starvation conditions during continuous culture did not result in spore formation, but caused the majority of cells to transition to a L-form state. Both spores and L-forms were determined to be viable. Spores exhibited enhanced survival in response to high temperature and prolonged storage compared to L-forms and vegetative cells. However, L-forms exhibited faster recovery compared to both spores and stationary phase cells when cultured in rich media. Conclusions Both spores and L-forms cease to produce ethanol, but provide other advantages for C. thermocellum including enhanced survival for spores and faster recovery for L-forms. Understanding the conditions that give rise to these two different non-growth states, and the implications that

  11. Computational fluid dynamics modeling of Bacillus anthracis spore deposition in rabbit and human respiratory airways

    Energy Technology Data Exchange (ETDEWEB)

    Kabilan, S.; Suffield, S. R.; Recknagle, K. P.; Jacob, R. E.; Einstein, D. R.; Kuprat, A. P.; Carson, J. P.; Colby, S. M.; Saunders, J. H.; Hines, S. A.; Teeguarden, J. G.; Straub, T. M.; Moe, M.; Taft, S. C.; Corley, R. A.

    2016-09-01

    Three-dimensional computational fluid dynamics and Lagrangian particle deposition models were developed to compare the deposition of aerosolized Bacillus anthracis spores in the respiratory airways of a human with that of the rabbit, a species commonly used in the study of anthrax disease. The respiratory airway geometries for each species were derived respectively from computed tomography (CT) and µCT images. Both models encompassed airways that extended from the external nose to the lung with a total of 272 outlets in the human model and 2878 outlets in the rabbit model. All simulations of spore deposition were conducted under transient, inhalation–exhalation breathing conditions using average species-specific minute volumes. Two different exposure scenarios were modeled in the rabbit based upon experimental inhalation studies. For comparison, human simulations were conducted at the highest exposure concentration used during the rabbit experimental exposures. Results demonstrated that regional spore deposition patterns were sensitive to airway geometry and ventilation profiles. Due to the complex airway geometries in the rabbit nose, higher spore deposition efficiency was predicted in the nasal sinus compared to the human at the same air concentration of anthrax spores. In contrast, higher spore deposition was predicted in the lower conducting airways of the human compared to the rabbit lung due to differences in airway branching pattern. This information can be used to refine published and ongoing biokinetic models of inhalation anthrax spore exposures, which currently estimate deposited spore concentrations based solely upon exposure concentrations and inhaled doses that do not factor in species-specific anatomy and physiology for deposition.

  12. Inactivation of food-borne pathogens by combined high hydrostatic pressure and irradiation- a model study

    International Nuclear Information System (INIS)

    Kamat, Anu; Thomas, Paul; Kesavan, P.C.; Fotedar, R.

    1997-01-01

    Application of radiation or high pressure as a food processing method is comparatively recent development in food industry. To investigate the response to hydrostatic pressure, cells of pathogens at logarithmic phase were exposed to 200 MPa for various time intervals in saline as model system. The cells of Salmonella were observed to be most sensitive whereas Listeria monocytogenes were most resistant as revealed by 7 and 2 log cycle inactivation respectively in 10 min. The cells of Bacillus cereus and Yersinia enterocolitica showed 3 long cycles reduction by the same treatment. Bacterial spores because of their resistant nature, are inactivated only at high radiation doses, which are technologically unfeasible. Studies carried out to examine the effectiveness of combination of pressure and radiation clearly suggested that combination treatment given in either sequence reduces the bacterial spore load more effectively than the individual treatment per se. (author)

  13. Back-trajectories show export of airborne fungal spores (Ganoderma sp.) from forests to agricultural and urban areas in England

    Science.gov (United States)

    Sadyś, M.; Skjøth, C. A.; Kennedy, R.

    2014-02-01

    We propose here the hypothesis that all of United Kingdom (UK) is likely to be affected by Ganoderma sp. spores, an important plant pathogen. We suggest that the main sources of this pathogen, which acts as a bioaerosol, are the widely scattered woodlands in the country, although remote sources must not be neglected. The hypothesis is based on related studies on bioaerosols and supported by new observations from a non-forest site and model calculations to support our hypothesis.

  14. The effects of meteorological factors on the occurrence of Ganoderma sp. spores in the air

    Science.gov (United States)

    Grinn-Gofroń, Agnieszka; Strzelczak, Agnieszka

    2011-03-01

    Ganoderma sp. is an airborne fungal spore type known to trigger respiratory allergy symptoms in sensitive patients. Aiming to reduce the risk for allergic individuals, we analysed fungal spore circulation in Szczecin, Poland, and its dependence on meteorological conditions. Statistical models for the airborne spore concentrations of Ganoderma sp.—one of the most abundant fungal taxa in the area—were developed. Aerobiological sampling was conducted over 2004-2008 using a volumetric Lanzoni trap. Simultaneously, the following meteorological parameters were recorded: daily level of precipitation, maximum and average wind speed, relative humidity and maximum, minimum, average and dew point temperatures. These data were used as the explaining variables. Due to the non-linearity and non-normality of the data set, the applied modelling techniques were artificial neural networks (ANN) and mutlivariate regression trees (MRT). The obtained classification and MRT models predicted threshold conditions above which Ganoderma sp. appeared in the air. It turned out that dew point temperature was the main factor influencing the presence or absence of Ganoderma sp. spores. Further analysis of spore seasons revealed that the airborne fungal spore concentration depended only slightly on meteorological factors.

  15. Detection of Bacillus anthracis spores from environmental water using bioluminescent reporter phage.

    Science.gov (United States)

    Nguyen, C; Makkar, R; Sharp, N J; Page, M A; Molineux, I J; Schofield, D A

    2017-11-01

    We investigated the ability of a temperate Bacillus anthracis reporter phage (Wβ::luxAB-2), which transduces bioluminescence to infected cells, to detect viable spores from deliberately contaminated environmental water samples. Environmental water was inoculated with spores and assayed with Wβ::luxAB-2. Bioluminescent signals directly correlated with input phage and spore concentrations. A limit of detection of 10 1 and 10 2 CFU per ml within 8 h was achieved from pond and lake water, respectively. Detection was greatly simplified by minimizing sample processing steps without spore extraction. The complex endogenous microbial flora and salt content of brackish water challenged the assay, extending the detection time to 12 h for a sensitivity of 10 2 CFU per ml. Phage-mediated bioluminescence was strictly dependent on bacterial physiology, being significantly reduced in mid/late log phase cells. This was shown to be due to an inability of the phage to adsorb. The reporter phage Wβ::luxAB-2 displays potential for simplified detection of viable spores from contaminated water samples within 12 h. A deliberate aerosol release of spores could lead to widespread contamination, leaving large areas uninhabitable until remediation. An essential requirement of this restoration process is the development of simplified detection assays in different environmental matrices. © 2017 The Society for Applied Microbiology.

  16. Role of DNA repair in Bacillus subtilis spore resistance.

    OpenAIRE

    Setlow, B; Setlow, P

    1996-01-01

    Wet-heat or hydrogen peroxide treatment of wild-type Bacillus subtilis spores did not result in induction of lacZ fusions to three DNA repair-related genes (dinR, recA, and uvrC) during spore outgrowth. However, these genes were induced during outgrowth of wild-type spores treated with dry heat or UV. Wet-heat, desiccation, dry-heat, or UV treatment of spores lacking major DNA-binding proteins (termed alpha-beta- spores) also resulted in induction of the three DNA repair genes during spore ou...

  17. A four-gene operon inBacillus cereusproduces two rare spore-decorating sugars.

    Science.gov (United States)

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Viability of Clostridium sporogenes spores after CaO hygienization of meat waste

    Directory of Open Access Journals (Sweden)

    Justyna Bauza-Kaszewska

    2014-09-01

    Full Text Available The occurrence of the pathogenic species [i]C. perfringens[/i] and [i]C. botulinum spores[/i] in animal by-products poses a potential epidemiological hazard. Strong entero- and neurotoxins produced by these bacteria adversely affect human health. To inactivate pathogens present in animal by-products, waste must be subjected to various methods of sanitization. The aim of the presented study was to estimate the effect of different doses of CaO on the viability of spores [i] Clostridium sporogenes[/i] in meat wastes category 3. During the research, two doses of burnt lime were added to the poultry mince meat and meat mixed with swine blood contaminated with [i]Clostridium sporogenes[/i] spore suspension. Half of the samples collected for microbiological analyses were buffered to achieve the pH level ~7, the other were examined without pH neutralization. To estimate the spore number, 10-fold dilution series in peptone water was prepared and heat-treated at 80 °C for 10 min. After cooling-down, one milliliter of each dilution was pour-plated onto DRCM medium solidified with agar. Statistical analysis were performed using the Statistica software. Application of 70% CaO caused complete inactivation of [i]Clostridium spores[/i] in meat wastes after 48 hours. The highest temperature achieved during the experiment was 67 °C. Rapid alkalization of the biomass resulted in increasing pH to values exceeding 12. The effect of liming was not dependent on the meat wastes composition nor CaO dose. The experiment proved the efficiency of liming as a method of animal by-products sanitization. Application of the obtained results may help reduce the epidemiological risk and ensure safety to people handling meat wastes at each stage of their processing and utilization.

  19. Handling technique of spore-forming bacteria in radiation sterilization. 2. Determination of numbers and radiation resistance of spores

    International Nuclear Information System (INIS)

    Koshikawa, Tomihiko

    1994-01-01

    Stepwise ten-fold dilution of bacterial solution is required in the determination of bacterial spores. For this, the selection of diluted solution is important according to the purpose of experiment. First, the preparation of suspension of bacterial spores and selection of diluted solution are presented. Then, a method for determining the number of bacterial spores in materials is outlined in terms of dilution methods of bacterial solution (shaking and homogenization) and application method of diluted solution to the plating medium. Finally, a method for determining radiation resistance of spore-forming bacteria is explained according to the measurement conditions (suspension of bacterial spores and filters applied with bacterial spores). (N.K.)

  20. Handling technique of spore-forming bacteria in radiation sterilization. 2. Determination of numbers and radiation resistance of spores

    Energy Technology Data Exchange (ETDEWEB)

    Koshikawa, Tomihiko [Japan Radioisotope Association, Shiga (Japan). Koka Laboratory

    1994-12-01

    Stepwise ten-fold dilution of bacterial solution is required in the determination of bacterial spores. For this, the selection of diluted solution is important according to the purpose of experiment. First, the preparation of suspension of bacterial spores and selection of diluted solution are presented. Then, a method for determining the number of bacterial spores in materials is outlined in terms of dilution methods of bacterial solution (shaking and homogenization) and application method of diluted solution to the plating medium. Finally, a method for determining radiation resistance of spore-forming bacteria is explained according to the measurement conditions (suspension of bacterial spores and filters applied with bacterial spores). (N.K.).

  1. Development of a rapid and simple Agrobacterium tumefaciens mediated transformation system for the fungal pathogen Heterobasidion annosum

    Science.gov (United States)

    Nicklas Samils; Malin Elfstrand; Daniel L. Lindner Czederpiltz; Jan Fahleson; Ake Olson; Christina Dixelius; Jan Stenlid

    2006-01-01

    Heterobasidion annosum causes root and butt-rot in trees and is the most serious forest pathogen in the northern hemisphere. We developed a rapid and simple Agrobacterium-mediated method of gene delivery into H. annosum to be used in functional studies of candidate genes and for visualization of mycelial interactions. Heterobasidion annosum TC 32-1 was cocultivated at...

  2. Using next-generation sequencing to develop molecular diagnostics for Pseudoperonospora cubensis, the cucurbit downy mildew pathogen

    Science.gov (United States)

    Advances in Next Generation Sequencing (NGS) allow for rapid development of genomics resources needed to generate molecular diagnostics assays for infectious agents. NGS approaches are particularly helpful for organisms that cannot be cultured, such as the downy mildew pathogens, a group of biotrop...

  3. Development and application of a multiplex PCR assay for rapid detection of 4 major bacterial pathogens in ducks.

    Science.gov (United States)

    Wei, B; Cha, S-Y; Kang, M; Park, I-J; Moon, O-K; Park, C-K; Jang, H-K

    2013-05-01

    Infections with Pasteurella multocida, Salmonella enterica, Riemerella anatipestifer, and Escherichia coli result in high morbidity and mortality, which cause significant economic loss in the poultry industry. It can be difficult to distinguish these pathogens based on clinical signs because these pathogens can cause similar clinical signs and coinfections can occur. Thus, rapid and sensitive detection of these 4 major bacterial pathogens are important in ducks. The aim of this study was to develop a multiplex PCR (mPCR) assay for simultaneously detecting and identifying these 4 pathogenic bacteria in a single tube reaction. The target genes used were KMT1 of P. multocida, the invasion protein gene of S. enterica, 16S rDNA of R. anatipestifer, and the alkaline phosphatase gene of E. coli. The detection limit of the assay for all bacterial DNA was 10 pg. The mPCR did not produce any nonspecific amplification products when tested against other related pathogens, including Staphylococcus aureus, Streptococcus pyogenes, Clostridium perfringens, Mycoplasma gallinarum, Mycoplasma synoviae, and Mycoplasma gallisepticum, which can also infect ducks. We applied mPCR to field samples, and the results were the same as the single PCR results. These results suggest that mPCR for the 4 bacteria is a useful and rapid technique to apply to field samples.

  4. Equol, a Clinically Important Metabolite, Inhibits the Development and Pathogenicity of Magnaporthe oryzae, the Causal Agent of Rice Blast Disease

    Directory of Open Access Journals (Sweden)

    Jiaoyu Wang

    2017-10-01

    Full Text Available Equol, a metabolite of soybean isoflavone daidzein, has been proven to have various bioactivities related to human health, but little is known on its antifungal activity to plant fungal pathogens. Magnaporthe oryzae is a phytopathogenic fungus that causes rice blast, a devastating disease on rice. Here, we demonstrated that equol influences the development and pathogenicity of M. oryzae. Equol showed a significant inhibition to the mycelial growth, conidial generation and germination, and appressorial formation of M. oryzae. As a result, equol greatly reduced the virulence of M. oryzae on rice and barley leaves. The antifungal activity of equol was also found in several other plant fungal pathogens. These findings expand our knowledge on the bioactivities of equol.

  5. MYT3, a Myb-like transcription factor, affects fungal development and pathogenicity of Fusarium graminearum.

    Directory of Open Access Journals (Sweden)

    Yongsoo Kim

    Full Text Available We previously characterized members of the Myb protein family, MYT1 and MYT2, in Fusarium graminearum. MYT1 and MYT2 are involved in female fertility and perithecium size, respectively. To expand knowledge of Myb proteins in F. graminearum, in this study, we characterized the functions of the MYT3 gene, which encodes a putative Myb-like transcription factor containing two Myb DNA-binding domains and is conserved in the subphylum Pezizomycotina of Ascomycota. MYT3 proteins were localized in nuclei during most developmental stages, suggesting the role of MYT3 as a transcriptional regulator. Deletion of MYT3 resulted in impairment of conidiation, germination, and vegetative growth compared to the wild type, whereas complementation of MYT3 restored the wild-type phenotype. Additionally, the Δmyt3 strain grew poorly on nitrogen-limited media; however, the mutant grew robustly on minimal media supplemented with ammonium. Moreover, expression level of nitrate reductase gene in the Δmyt3 strain was decreased in comparison to the wild type and complemented strain. On flowering wheat heads, the Δmyt3 strain exhibited reduced pathogenicity, which corresponded with significant reductions in trichothecene production and transcript levels of trichothecene biosynthetic genes. When the mutant was selfed, mated as a female, or mated as a male for sexual development, perithecia were not observed on the cultures, indicating that the Δmyt3 strain lost both male and female fertility. Taken together, these results demonstrate that MYT3 is required for pathogenesis and sexual development in F. graminearum, and will provide a robust foundation to establish the regulatory networks for all Myb-like proteins in F. graminearum.

  6. Dendritic Cells Endocytose Bacillus Anthracis Spores: Implications for Anthrax Pathogenesis

    National Research Council Canada - National Science Library

    Brittingham, Katherine C; Ruthel, Gordon; Panchal, Rekha G; Fuller, Claudette L; Ribot, Wilson J

    2005-01-01

    Phagocytosis of inhaled Bacillus anthracis spores and subsequent trafficking to lymph nodes are decisive events in the progression of inhaled anthrax because they initiate germination and dissemination of spores...

  7. The PEX7-mediated peroxisomal import system is required for fungal development and pathogenicity in Magnaporthe oryzae.

    Directory of Open Access Journals (Sweden)

    Jaeduk Goh

    Full Text Available In eukaryotes, microbodies called peroxisomes play important roles in cellular activities during the life cycle. Previous studies indicate that peroxisomal functions are important for plant infection in many phytopathogenic fungi, but detailed relationships between fungal pathogenicity and peroxisomal function still remain unclear. Here we report the importance of peroxisomal protein import through PTS2 (Peroxisomal Targeting Signal 2 in fungal development and pathogenicity of Magnaporthe oryzae. Using an Agrobacterium tumefaciens-mediated transformation library, a pathogenicity-defective mutant was isolated from M. oryzae and identified as a T-DNA insert in the PTS2 receptor gene, MoPEX7. Gene disruption of MoPEX7 abolished peroxisomal localization of a thiolase (MoTHL1 containing PTS2, supporting its role in the peroxisomal protein import machinery. ΔMopex7 showed significantly reduced mycelial growth on media containing short-chain fatty acids as a sole carbon source. ΔMopex7 produced fewer conidiophores and conidia, but conidial germination was normal. Conidia of ΔMopex7 were able to develop appressoria, but failed to cause disease in plant cells, except after wound inoculation. Appressoria formed by ΔMopex7 showed a defect in turgor generation due to a delay in lipid degradation and increased cell wall porosity during maturation. Taken together, our results suggest that the MoPEX7-mediated peroxisomal matrix protein import system is required for fungal development and pathogenicity M. oryzae.

  8. Fifth international fungus spore conference. [Abstracts]: Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    Timberlake, W.E.

    1993-04-01

    This folio contains the proceedings of the Fifth International Fungal Spore Conference held August 17-21, 1991 at the Unicoi State Park at Helen, Georgia. The volume contains abstracts of each oral presentation as well as a collection of abstracts describing the poster sessions. Presentations were organized around the themes (1) Induction of Sporulation, (2) Nuclear Division, (3) Spore Formation, (4) Spore Release and Dispersal, and (4) Spore Germination.

  9. Measurement of Metabolic Activity in Dormant Spores of Bacillus Species

    Science.gov (United States)

    2015-01-14

    SECURITY CLASSIFICATION OF: Spores of Bacillus megaterium and Bacillus subtilis were harvested shortly after release from sporangia, incubated under...Dec-2014 Approved for Public Release; Distribution Unlimited Final Report: Measurement of Metabolic Activity in Dormant Spores of Bacillus Species...Research Office P.O. Box 12211 Research Triangle Park, NC 27709-2211 spores, Bacillus , spore dormancy, 3-phosphoglycerate REPORT DOCUMENTATION PAGE 11

  10. Comparison of four commercial DNA extraction kits for the recovery of Bacillus spp. spore DNA from spiked powder samples.

    Science.gov (United States)

    Mölsä, Markos; Kalin-Mänttäri, Laura; Tonteri, Elina; Hemmilä, Heidi; Nikkari, Simo

    2016-09-01

    Bacillus spp. include human pathogens such as Bacillus anthracis, the causative agent of anthrax and a biothreat agent. Bacillus spp. form spores that are physically highly resistant and may remain active over sample handling. We tested four commercial DNA extraction kits (QIAamp DNA Mini Kit, RTP Pathogen Kit, ZR Fungal/Bacterial DNA MiniPrep, and genesig Easy DNA/RNA Extraction kit) for sample inactivation and DNA recovery from two powders (icing sugar and potato flour) spiked with Bacillus thuringiensis spores. The DNA was analysed using a B. thuringiensis-specific real-time PCR assay. The detection limit was 3×10(1)CFU of spiked B. thuringiensis spores with the QIAamp DNA Mini, RTP Pathogen, and genesig Easy DNA/RNA Extraction kits, and 3×10(3)CFU with the ZR Fungal/Bacterial DNA MiniPrep kit. The results showed that manual extraction kits are effective and safe for fast and easy DNA extraction from powder samples even in field conditions. Adding a DNA filtration step to the extraction protocol ensures the removal of Bacillus spp. spores from DNA samples without affecting sensitivity. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Geraniol biotransformation-pathway in spores of Penicillium digitatum

    NARCIS (Netherlands)

    Wolken, W.A.M.; Werf, M.J. van der

    2001-01-01

    Spores of Penicillium digitatum ATCC 201167 transform geraniol, nerol, citral, and geranic acid into methylheptenone. Spore extracts of P. digitatum convert geraniol and nerol NAD+-dependently into citral. Spore extract also converts citral NAD+-dependently into geranic acid. Furthermore, a novel

  12. Expression and characterization of a novel spore wall protein from ...

    African Journals Online (AJOL)

    Microsporidia are obligate intracellular, eukaryotic, spore-forming parasites. The environmentally resistant spores, which harbor a rigid cell wall, are critical for their survival outside their host cells and host-to-host transmission. The spore wall comprises two major layers: the exospore and the endospore. In Nosema ...

  13. Imaging bacterial spores by soft-x-ray microscopy

    International Nuclear Information System (INIS)

    Stead, A.D.; Ford, T.W.; Judge, J.

    1997-01-01

    Bacterial spores are able to survive dehydration, but neither the physiological nor structural basis of this have been fully elucidated. Furthermore, once hydrated, spores often require activation before they will germinate. Several treatments can be used to activate spores, but in the case of Bacillus subtlis the most effective is heat treatment. The physiological mechanism associated with activation is also not understood, but some workers suggest that the loss of calcium from the spores may be critical. However, just prior to germination, the spores change from being phase bright to phase dark when viewed by light microscopy. Imaging spores by soft x-ray microscopy is possible without fixation. Thus, in contrast to electron microscopy, it is possible to compare the structure of dehydrated and hydrated spores in a manner not possible previously. A further advantage is that it is possible to monitor individual spores by phase contrast light microscopy immediately prior to imaging with soft x-rays; whereas, with both electron microscopy and biochemical studies, it is a population of spores being studied without knowledge of the phase characteristics of individual spores. This study has therefore tried to compare dehydrated and hydrated spores and to determine if there is a mass loss from individual spores as they pass the transition from being phase bright to phase dark

  14. Imaging bacterial spores by soft-x-ray microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Stead, A.D.; Ford, T.W. [Univ. of London, Surrey (United Kingdom); Judge, J. [Unilever plc, Sharnbrook (United Kingdom)] [and others

    1997-04-01

    Bacterial spores are able to survive dehydration, but neither the physiological nor structural basis of this have been fully elucidated. Furthermore, once hydrated, spores often require activation before they will germinate. Several treatments can be used to activate spores, but in the case of Bacillus subtlis the most effective is heat treatment. The physiological mechanism associated with activation is also not understood, but some workers suggest that the loss of calcium from the spores may be critical. However, just prior to germination, the spores change from being phase bright to phase dark when viewed by light microscopy. Imaging spores by soft x-ray microscopy is possible without fixation. Thus, in contrast to electron microscopy, it is possible to compare the structure of dehydrated and hydrated spores in a manner not possible previously. A further advantage is that it is possible to monitor individual spores by phase contrast light microscopy immediately prior to imaging with soft x-rays; whereas, with both electron microscopy and biochemical studies, it is a population of spores being studied without knowledge of the phase characteristics of individual spores. This study has therefore tried to compare dehydrated and hydrated spores and to determine if there is a mass loss from individual spores as they pass the transition from being phase bright to phase dark.

  15. Phospholipase Cδ regulates germination of Dictyostelium spores

    NARCIS (Netherlands)

    Dijken, Peter van; Haastert, Peter J.M. van

    2001-01-01

    Background: Many eukaryotes, including plants and fungi make spores that resist severe environmental stress. The micro-organism Dictyostelium contains a single phospholipase C gene (PLC); deletion of the gene has no effect on growth, cell movement and differentiation. In this report we show that PLC

  16. Detecting bacterial spores in soup manufacturing

    NARCIS (Netherlands)

    van Zuijlen, A.C.M.; Oomes, S.J.C.M.; Vos, P.; Brul, S.

    2009-01-01

    Spores from mesophilic aerobic sporeforming bacteria (Bacillus) are sometimes able to survive the thermal process of commercial sterile products and sporadically cause spoilage or food poisoning. Because of an increasing demand for more fresh products, ideally the processing temperatures should be

  17. Modeling to control spores in raw milk

    NARCIS (Netherlands)

    Vissers, M.

    2007-01-01

    A modeling approach was used to identify measures at the farm that reduce transmission of microorganisms to raw milk. Butyric acid bacteria (BAB) and Bacillus cereus were used as case-studies. Minimizing the concentration of BAB spores in raw milk is important to prevent late-blowing of Gouda-type

  18. On some white-spored Geoglossaceae

    NARCIS (Netherlands)

    Maas Geesteranus, R.A.

    1964-01-01

    Some genera of Geoglossaceae, characterized by colourless spores and positive iodine reaction of the ascus pore, are compared with respect to the structure of the stipe. Ochroglossum is reduced to the synonymy of Microglossum. Mitrula is regarded as a monotypic genus. The generic name Heyderia is

  19. Paleozoic in situ spores and pollen. Lycopsida

    Czech Academy of Sciences Publication Activity Database

    Bek, Jiří

    2017-01-01

    Roč. 296, 1/6 (2017), s. 1-111 ISSN 0375-0299 R&D Projects: GA ČR GAP210/12/2053 Institutional support: RVO:67985831 Keywords : in situ spores * reproductive organs * Lycopsida * Paleozoic Subject RIV: DB - Geology ; Mineralogy OBOR OECD: Paleontology Impact factor: 1.333, year: 2016

  20. Pathogenic factors associated with development of disseminated intravascular coagulopathy (DIC) in a tertiary academic hospital in South Africa.

    Science.gov (United States)

    Mayne, Elizabeth S; Mayne, Anthony L H; Louw, Susan J

    2018-01-01

    Disseminated intravascular coagulopathy (DIC) is a thrombotic microangiopathy arising from consumption of both coagulation factors and platelets. DIC is triggered by a number of clinical conditions including severe infection, trauma and obstetric complications. Early diagnosis and treatment of the underlying condition is paramount. A high clinical index of suspicion is needed to ensure that patients at risk of developing DIC are appropriately investigated. In order to establish the clinical conditions most frequently associated with DIC, we reviewed all DIC screens received at a tertiary hospital in Johannesburg, South Africa over a 1 year period. The commonest clinical condition associated with DIC in our population was infection with 84% of patients infected with an identified pathogen. The most frequently diagnosed pathogen was HIV followed by Mycobacterium tuberculosis and other bacterial infections. In the majority of cases, bacteria were isolated from blood cultures. In 47 patients, HIV was the only pathogen which could be isolated. A relative risk ratio of 2.73 and an odds ratio of 29.97 was attributed to HIV for development of a DIC. A malignancy was present in 51 of the patients of which approximately 60% had co-existing infection. No cause could be attributed in 30 patients. Infection was identified in the majority of the patients diagnosed with DIC in this study. HIV showed the highest relative risk ratio of all pathogens although previous studies have not suggested that HIV was strongly associated with DIC. In almost half of the HIV infected patients, there was no other pathogen isolated despite extensive investigation. This suggests that HIV has a strong association with the development of DIC, warranting further research into the relationship between HIV and disseminated microvascular thrombosis.

  1. Inhibiting Inosine Hydrolase and Alanine Racemase to Enhance the Germination of Bacillus anthracis Sterne Spores: Potential Spore Decontamination Strategies

    Science.gov (United States)

    2015-06-19

    2015): << Inhibiting inosine hydrolase and alanine racemase to enhance the germination of Bacillus anthracis Sterne spores: potential spore...display a currently valid OMB control number. 1. REPORT DATE 02 OCT 2015 2. REPORT TYPE N/A 3. DATES COVERED 4. TITLE AND SUBTITLE Inhibiting...inosine hydrolase and alanine racemase to enhance the germination of Bacillus anthracis Sterne spores potential spore decontamination strategies 5a

  2. Effectiveness of various cleaning and disinfectant products on Clostridium difficile spores of PCR ribotypes 010, 014 and 027

    NARCIS (Netherlands)

    Kenters, N.; E. Huijskens (Elisabeth); de Wit, S.C.J.; Sanders, I.G.J.M.; J.M. van Rosmalen (Joost); E. Kuijper; Voss, A.

    2017-01-01

    textabstractBackground: In healthcare facilities, Clostridium difficile infections spread by transmission of bacterial spores. Appropriate sporicidal disinfectants are needed to prevent development of clusters and outbreaks. In this study different cleaning/disinfecting wipes and sprays were tested

  3. Effectiveness of various cleaning and disinfectant products on Clostridium difficile spores of PCR ribotypes 010, 014 and 027

    NARCIS (Netherlands)

    Kenters, N.; Huijskens, E.G.; Wit, S.C.J. de; Sanders, I.; Rosmalen, J. van; Kuijper, E.J.; Voss, A.

    2017-01-01

    BACKGROUND: In healthcare facilities, Clostridium difficile infections spread by transmission of bacterial spores. Appropriate sporicidal disinfectants are needed to prevent development of clusters and outbreaks. In this study different cleaning/disinfecting wipes and sprays were tested for their

  4. Development and validation of a mathematical model for growth of pathogens in cut melons.

    Science.gov (United States)

    Li, Di; Friedrich, Loretta M; Danyluk, Michelle D; Harris, Linda J; Schaffner, Donald W

    2013-06-01

    Many outbreaks of foodborne illness associated with the consumption of fresh-cut melons have been reported. The objective of our research was to develop a mathematical model that predicts the growth rate of Salmonella on fresh-cut cantaloupe over a range of storage temperatures and to validate that model by using Salmonella and Escherichia coli O157:H7 on cantaloupe, honeydew, and watermelon, using both new data and data from the published studies. The growth of Salmonella on honeydew and watermelon and E. coli O157:H7 on cantaloupe, honeydew, and watermelon was monitored at temperatures of 4 to 25°C. The Ratkowsky (or square-root model) was used to describe Salmonella growth on cantaloupe as a function of storage temperature. Our results show that the levels of Salmonella on fresh-cut cantaloupe with an initial load of 3 log CFU/g can reach over 7 log CFU/g at 25°C within 24 h. No growth was observed at 4°C. A linear correlation was observed between the square root of Salmonella growth rate and temperature, such that √growth rate = 0.026 × (T - 5.613), R(2) = 0.9779. The model was generally suitable for predicting the growth of both Salmonella and E. coli O157:H7 on cantaloupe, honeydew, and watermelon, for both new data and data from the published literature. When compared with existing models for growth of Salmonella, the new model predicts a theoretic minimum growth temperature similar to the ComBase Predictive Models and Pathogen Modeling Program models but lower than other food-specific models. The ComBase Prediction Models results are very similar to the model developed in this study. Our research confirms that Salmonella can grow quickly and reach high concentrations when cut cantaloupe is stored at ambient temperatures, without visual signs of spoilage. Our model provides a fast and cost-effective method to estimate the effects of storage temperature on fresh-cut melon safety and could also be used in subsequent quantitative microbial risk

  5. Pathogenic specifics of development of vegetative dysfunction in adolescents in relation to their morphological status

    Directory of Open Access Journals (Sweden)

    O. Skyba

    2017-02-01

    Full Text Available Exploring the mechanisms of vegetative regulation in children and adolescents of different somatotypes has a prognostic value in regard to the character of adaptive reactions of the organism, as it facilitates the identification of the risk factors of pathological processes and states of vegetative systems, which may cause chronic illness in adulthood. The author defines the pathogenic specifics of development of vegetative dysfunction in adolescents in relation to their morphological status. Cardiointervalography and anthropometric, mathematical and statistical methods of research were used. Based on the results of cardiointervalography, the structure of initial vegetative tonus was established, which was characterized by prevalence of eutonia (38.4 ± 4.9%. The specific weight with background eutonia of adolescent boys and girls tended to be higher among the representatives of the thoracic and muscular somatotypes, compared to adolescents of the alimentive and osseous somatotypes (Р < 0.001–0.05. The established specifics indicate that thoracic and muscular somatotypes ensure optimal adaptation of organisms to the environment. Sympathicotonia was measured among the majority of boys of extreme constitutional variants (alimentive and osseous somatotypes (36.3% and 30.0% respectively, which demonstrates the activation of adaptive mechanisms in the abovementioned category of examined adolescents, while among girls this phenomenon was evident among the representatives of the osseous and thoracic somatotypes (38.5% and 30.8% respectively. We found that the majority of examined adolescents (53.4% had a normal vegetative reactivity. Gender differences in the structure of vegetative reactivity of adolescents could well be explained by the higher number of girls of asympaticotonic type (19.2% compared to boys (7.3%, Р < 0.05. Furthermore, we found that hypersympathicotonic and asympathicotonic types of vegetative reactivity were characteristic of

  6. Development of a PCR-Based Line Probe Assay for Identification of Fungal Pathogens

    OpenAIRE

    Martin, Cara; Roberts, David; van der Weide, Marjo; Rossau, Rudi; Jannes, Geert; Smith, Terry; Maher, Majella

    2000-01-01

    We report on a reverse-hybridization line probe assay (LiPA) which when combined with PCR amplification detects and identifies clinically significant fungal pathogens including Candida, Aspergillus, and Cryptococcus species. DNA probes have been designed from the internal transcribed-spacer (ITS) regions of Candida albicans, Candida parapsilosis, Candida glabrata, Candida tropicalis, Candida krusei, Candida dubliniensis, Cryptococcus neoformans, Aspergillus fumigatus, Aspergillus versicolor, ...

  7. The effect of nitrogen on disease development and gene expression in bacterial and fungal plant pathogens

    NARCIS (Netherlands)

    Snoeijers, S.S.; Pérez-García, A.; Joosten, M.H.A.J.; Wit, de P.J.G.M.

    2000-01-01

    Successful colonisation of plants by pathogens requires efficient utilisation of nutrient resources available in host tissues. Several bacterial and fungal genes are specifically induced during pathogenesis and under nitrogen-limiting conditions in vitro. This suggests that a nitrogen-limiting

  8. Development of a Nordic system for measuring the inactivation of pathogens during composting

    DEFF Research Database (Denmark)

    Christensen, Kasper Kjellberg; Møller, Kaare; Hockenhull, John

    The report presents the results of a study initiated to prepare a full-scale investigation for evaluating the inactivation of pathogens during composting of biodegradable waste by means of a direct evaluation. On the basis of the presented study it is recommended to include the direct procees eva...

  9. Development of recombinant antibody technology for application in plant pathogen diagnosis

    NARCIS (Netherlands)

    Griep, R.

    1999-01-01

    This thesis describes the applicability of the novel phage display technique to select plant-pathogen-specific monoclonal antibodies (MAbs) from combinatorial antibody libraries. The retrieved MAbs are so specific that they can be used as diagnostic tools in sensitive immunoassays for the

  10. Computational Fluid Dynamics Modeling of Bacillus anthracis Spore Deposition in Rabbit and Human Respiratory Airways

    Energy Technology Data Exchange (ETDEWEB)

    Kabilan, Senthil; Suffield, Sarah R.; Recknagle, Kurtis P.; Jacob, Rick E.; Einstein, Daniel R.; Kuprat, Andrew P.; Carson, James P.; Colby, Sean M.; Saunders, James H.; Hines, Stephanie; Teeguarden, Justin G.; Straub, Tim M.; Moe, M.; Taft, Sarah; Corley, Richard A.

    2016-09-30

    Three-dimensional computational fluid dynamics and Lagrangian particle deposition models were developed to compare the deposition of aerosolized Bacillus anthracis spores in the respiratory airways of a human with that of the rabbit, a species commonly used in the study of anthrax disease. The respiratory airway geometries for each species were derived from computed tomography (CT) or µCT images. Both models encompassed airways that extended from the external nose to the lung with a total of 272 outlets in the human model and 2878 outlets in the rabbit model. All simulations of spore deposition were conducted under transient, inhalation-exhalation breathing conditions using average species-specific minute volumes. The highest exposure concentration was modeled in the rabbit based upon prior acute inhalation studies. For comparison, human simulation was also conducted at the same concentration. Results demonstrated that regional spore deposition patterns were sensitive to airway geometry and ventilation profiles. Due to the complex airway geometries in the rabbit nose, higher spore deposition efficiency was predicted in the upper conducting airways compared to the human at the same air concentration of anthrax spores. As a result, higher particle deposition was predicted in the conducting airways and deep lung of the human compared to the rabbit lung due to differences in airway branching pattern. This information can be used to refine published and ongoing biokinetic models of inhalation anthrax spore exposures, which currently estimate deposited spore concentrations based solely upon exposure concentrations and inhaled doses that do not factor in species-specific anatomy and physiology.

  11. Inhibition of Bacillus licheniformis spore growth in milk by nisin, monolaurin, and pH combinations.

    Science.gov (United States)

    Mansour, M; Amri, D; Bouttefroy, A; Linder, M; Milliere, J B

    1999-02-01

    The effects of nisin and monolaurin, alone and in combination, were investigated on Bacillus licheniformis spores in milk at 37 degrees C. In the absence of inhibitors, germinated spores developed into growing vegetative cells and started sporulation at the end of the exponential phase. In the presence of nisin (25 IU ml-1), spore outgrowth was inhibited (4 log10 reduction at 10 h). Regrowth appeared between 10 and 24 h and reached a high population level (1.25 x 10(8) cfu ml-1) after 7 d. Monolaurin (250 micrograms ml-1) had a bacteriostatic effect during the first 10 h but thereafter, regrowth occurred slowly with a population level after 7 d (4 x 10(5) cfu ml-1) lower than that of nisin. Different combined effects of nisin (between 0 and 42 IU ml-1), monolaurin (ranging from 0 to 300 micrograms ml-1), pH values (between 5.0 and 7.0) and spore loads (10(3), 10(4), 10(5) spores ml-1) were investigated using a Doehlert matrix in order to study the main effects of these factors and the different interactions. Results were analysed using the Response Surface Methodology (RSM) and indicated that nisin and monolaurin had no action on spores before germination; only pH values had a significant effect (P monolaurin (100 micrograms ml-1) in combination acted synergistically on outgrown spores and vegetative cells, showing total inhibition at pH 6.0, without regrowth, within 7 d at 37 degrees C.

  12. COXIELLA BURNETII PATHOGENICITY MOLECULAR BASIS

    Directory of Open Access Journals (Sweden)

    Yu. A. Panferova

    2016-01-01

    Full Text Available Coxiella burnetii is an obligate intracellular gram-negative bacterial pathogen, an ethiological agent of Q-fever, a zoonotic disease, elapsing as an acute (mostly atypical pneumonia or a chronic (mostly endocarditis form. The host range is represented by wide range of mammal, avian and arthropod species, but the main source of human infection are farm animals. The main route of infection is aerosolic. In case of contact with organism pathogen binds with phagocytal monocytic-macrophagal cell line. C. burnetii promotes maturation of specific phagolysosome-like compartment in host cell, called coxiella-containing vacuole, within this vacuole pathogen becames metabolically activated and actively replicates. Coxiella persists as metabolically inactive spore-like form in environment. Internalisation of C. burnetii occurs using actin-mediated phagocytosis and zipper mechanism. After internalization of bacteria maturation of phagolysosome-like compartment and large coxiella-containing vacuole formation occure, and vacuole can occupy nearly the whole cytoplasm of the host cell. Survivance of infected cells is important for chronic infection with C. burnetii. C. burnetii elongate the viability of host cell by two ways: it actively inhibits apoptotic signal cascades and induce pro-survival factors. Exceptthat C. burnetii involves autophagic pathway during coxiella-containing vacuole formation, and induction of autophagy promotes pathogen replication. During infection C. burnetii translocates effector substrates from bacterial cytosole to euca ryotic host cell cytosole using type IV secretion system, where effectors modulate host cell proteins. Overall approximately 130 secreted effectors of type IV transport system, but function of most of them remains unknown to date. Specific sec reted proteins for variety of strains and isolates were identified, confirmed that certain pathotypes of C. burnetii can exist. Identification and

  13. Soya bean tempe extracts show antibacterial activity against Bacillus cereus cells and spores.

    Science.gov (United States)

    Roubos-van den Hil, P J; Dalmas, E; Nout, M J R; Abee, T

    2010-07-01

    Tempe, a Rhizopus ssp.-fermented soya bean food product, was investigated for bacteriostatic and/or bactericidal effects against cells and spores of the food-borne pathogen Bacillus cereus. Tempe extract showed a high antibacterial activity against B. cereus ATCC 14579 based on optical density and viable count measurements. This growth inhibition was manifested by a 4 log CFU ml(-1) reduction, within the first 15 min of exposure. Tempe extracts also rapidly inactivated B. cereus spores upon germination. Viability and membrane permeability assessments using fluorescence probes showed rapid inactivation and permeabilization of the cytoplasmic membrane confirming the bactericidal mode of action. Cooked beans and Rhizopus grown on different media did not show antibacterial activity, indicating the unique association of the antibacterial activity with tempe. Subsequent characterization of the antibacterial activity revealed that heat treatment and protease addition nullified the bactericidal effect, indicating the proteinaceous nature of the bioactive compound. During fermentation of soya beans with Rhizopus, compounds are released with extensive antibacterial activity against B. cereus cells and spores. The results show the potential of producing natural antibacterial compounds that could be used as ingredients in food preservation and pathogen control. © 2009 The Authors. Journal compilation © 2009 The Society for Applied Microbiology.

  14. Development of a one-run real-time PCR detection system for pathogens associated with bovine respiratory disease complex.

    Science.gov (United States)

    Kishimoto, Mai; Tsuchiaka, Shinobu; Rahpaya, Sayed Samim; Hasebe, Ayako; Otsu, Keiko; Sugimura, Satoshi; Kobayashi, Suguru; Komatsu, Natsumi; Nagai, Makoto; Omatsu, Tsutomu; Naoi, Yuki; Sano, Kaori; Okazaki-Terashima, Sachiko; Oba, Mami; Katayama, Yukie; Sato, Reiichiro; Asai, Tetsuo; Mizutani, Tetsuya

    2017-03-18

    Bovine respiratory disease complex (BRDC) is frequently found in cattle worldwide. The etiology of BRDC is complicated by infections with multiple pathogens, making identification of the causal pathogen difficult. Here, we developed a detection system by applying TaqMan real-time PCR (Dembo respiratory-PCR) to screen a broad range of microbes associated with BRDC in a single run. We selected 16 bovine respiratory pathogens (bovine viral diarrhea virus, bovine coronavirus, bovine parainfluenza virus 3, bovine respiratory syncytial virus, influenza D virus, bovine rhinitis A virus, bovine rhinitis B virus, bovine herpesvirus 1, bovine adenovirus 3, bovine adenovirus 7, Mannheimia haemolytica, Pasteurella multocida, Histophilus somni, Trueperella pyogenes, Mycoplasma bovis and Ureaplasma diversum) as detection targets and designed novel specific primer-probe sets for nine of them. The assay performance was assessed using standard curves from synthesized DNA. In addition, the sensitivity of the assay was evaluated by spiking solutions extracted from nasal swabs that were negative by Dembo respiratory-PCR for nucleic acids of pathogens or synthesized DNA. All primer-probe sets showed high sensitivity. In this study, a total of 40 nasal swab samples from cattle on six farms were tested by Dembo respiratory-PCR. Dembo respiratory-PCR can be applied as a screening system with wide detection targets.

  15. Development of a panel of recombinase polymerase amplification assays for detection of common bacterial urinary tract infection pathogens.

    Science.gov (United States)

    Raja, B; Goux, H J; Marapadaga, A; Rajagopalan, S; Kourentzi, K; Willson, R C

    2017-08-01

    To develop and evaluate the performance of a panel of isothermal real-time recombinase polymerase amplification (RPA) assays for detection of common bacterial urinary tract infection (UTI) pathogens. The panel included RPAs for Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Pseudomonas aeruginosa and Enterococcus faecalis. All five RPAs required reaction times of under 12 min to reach their lower limit of detection of 100 genomes per reaction or less, and did not cross-react with high concentrations of nontarget bacterial genomic DNA. In a 50-sample retrospective clinical study, the five-RPA assay panel was found to have a specificity of 100% (95% CI, 78-100%) and a sensitivity of 89% (95% CI, 75-96%) for UTI detection. The analytical and clinical validity of RPA for the rapid and sensitive detection of common UTI pathogens was established. Rapid identification of the causative pathogens of UTIs can be valuable in preventing serious complications by helping avoid the empirical treatment necessitated by traditional urine culture's 48-72-h turnaround time. The routine and widespread use of RPA to supplement or replace culture-based methods could profoundly impact UTI management and the emergence of multidrug-resistant pathogens. © 2017 The Society for Applied Microbiology.

  16. Effective Thermal Inactivation of the Spores of Bacillus cereus Biofilms Using Microwave.

    Science.gov (United States)

    Park, Hyong Seok; Yang, Jungwoo; Choi, Hee Jung; Kim, Kyoung Heon

    2017-07-28

    Microwave sterilization was performed to inactivate the spores of biofilms of Bacillus cereus involved in foodborne illness. The sterilization conditions, such as the amount of water and the operating temperature and treatment time, were optimized using statistical analysis based on 15 runs of experimental results designed by the Box-Behnken method. Statistical analysis showed that the optimal conditions for the inactivation of B. cereus biofilms were 14 ml of water, 108°C of temperature, and 15 min of treatment time. Interestingly, response surface plots showed that the amount of water is the most important factor for microwave sterilization under the present conditions. Complete inactivation by microwaves was achieved in 5 min, and the inactivation efficiency by microwave was obviously higher than that by conventional steam autoclave. Finally, confocal laser scanning microscopy images showed that the principal effect of microwave treatment was cell membrane disruption. Thus, this study can contribute to the development of a process to control food-associated pathogens.

  17. Absence of Fungal Spore Internalization by Bronchial Epithelium in Mouse Models Evidenced by a New Bioimaging Approach and Transmission Electronic Microscopy.

    Science.gov (United States)

    Rammaert, Blandine; Jouvion, Grégory; de Chaumont, Fabrice; Garcia-Hermoso, Dea; Szczepaniak, Claire; Renaudat, Charlotte; Olivo-Marin, Jean-Christophe; Chrétien, Fabrice; Dromer, Françoise; Bretagne, Stéphane

    2015-09-01

    Clinical data and experimental studies suggest that bronchial epithelium could serve as a portal of entry for invasive fungal infections. We therefore analyzed the interactions between molds and the bronchial/bronchiolar epithelium at the early steps after inhalation. We developed invasive aspergillosis (Aspergillus fumigatus) and mucormycosis (Lichtheimia corymbifera) murine models that mimic the main clinical risk factors for these infections. Histopathology studies were completed with a specific computer-assisted morphometric method to quantify bronchial and alveolar spores and with transmission electron microscopy. Morphometric analysis revealed a higher number of bronchial/bronchiolar spores for A. fumigatus than L. corymbifera. The bronchial/bronchiolar spores decreased between 1 and 18 hours after inoculation for both fungi, except in corticosteroid-treated mice infected with A. fumigatus, suggesting an effect of cortisone on bronchial spore clearance. No increase in the number of spores of any species was observed over time at the basal pole of the epithelium, suggesting the lack of transepithelial crossing. Transmission electron microscopy did not show spore internalization by bronchial epithelial cells. Instead, spores were phagocytized by mononuclear cells on the apical pole of epithelial cells. Early epithelial internalization of fungal spores in vivo cannot explain the bronchial/bronchiolar epithelium invasion observed in some invasive mold infections. The bioimaging approach provides a useful means to accurately enumerate and localize the fungal spores in the pulmonary tissues. Copyright © 2015 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  18. Identification of a Novel Lipoprotein Regulator of Clostridium difficile Spore Germination.

    Directory of Open Access Journals (Sweden)

    Kelly A Fimlaid

    2015-10-01

    Full Text Available Clostridium difficile is a Gram-positive spore-forming pathogen and a leading cause of nosocomial diarrhea. C. difficile infections are transmitted when ingested spores germinate in the gastrointestinal tract and transform into vegetative cells. Germination begins when the germinant receptor CspC detects bile salts in the gut. CspC is a subtilisin-like serine pseudoprotease that activates the related CspB serine protease through an unknown mechanism. Activated CspB cleaves the pro-SleC zymogen, which allows the activated SleC cortex hydrolase to degrade the protective cortex layer. While these regulators are essential for C. difficile spores to outgrow and form toxin-secreting vegetative cells, the mechanisms controlling their function have only been partially characterized. In this study, we identify the lipoprotein GerS as a novel regulator of C. difficile spore germination using targeted mutagenesis. A gerS mutant has a severe germination defect and fails to degrade cortex even though it processes SleC at wildtype levels. Using complementation analyses, we demonstrate that GerS secretion, but not lipidation, is necessary for GerS to activate SleC. Importantly, loss of GerS attenuates the virulence of C. difficile in a hamster model of infection. Since GerS appears to be conserved exclusively in related Peptostreptococcaeace family members, our results contribute to a growing body of work indicating that C. difficile has evolved distinct mechanisms for controlling the exit from dormancy relative to B. subtilis and other spore-forming organisms.

  19. Fungistatic activity of some perfumes against otomycotic pathogens.

    Science.gov (United States)

    Jain, S K; Agrawal, S C

    2002-04-01

    The sporostatic effect of five otomycotic pathogens, i.e. Aspergillus niger, A. flavus, Absidia corymbifera, Penicillium nigricans and Candida albicans to nine different perfumes was determined on the basis of their spore germination. These organisms were isolated from patients suffering from fungal infection of the external auditory canal. Volatile vapours emanating from musk, phulwari, jasmine, nagchampa and bela caused approximately 100% inhibition in spore germination of all the test fungi. Volatiles emanating from chandan, khas and hina showed no inhibition for the test pathogens, displaying their resistant character to these perfumes.

  20. Roles of Forkhead-box Transcription Factors in Controlling Development, Pathogenicity, and Stress Response in Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Jaejin Park

    2014-06-01

    Full Text Available Although multiple transcription factors (TFs have been characterized via mutagenesis to understand their roles in controlling pathogenicity and infection-related development in Magnaporthe oryzae, the causal agent of rice blast, if and how forkhead-box (FOX TFs contribute to these processes remain to be characterized. Four putative FOX TF genes were identified in the genome of M. oryzae, and phylogenetic analysis suggested that two of them (MoFKH1 and MoHCM1 correspond to Ascomycota-specific members of the FOX TF family while the others (MoFOX1 and MoFOX2 are Pezizomycotina-specific members. Deletion of MoFKH1 (ΔMofkh1 resulted in reduced mycelial growth and conidial germination, abnormal septation and stress response, and reduced virulence. Similarly, ΔMohcm1 exhibited reduced mycelial growth and conidial germination. Conidia of ΔMofkh1 and ΔMohcm1 were more sensitive to one or both of the cell cycle inhibitors hydroxyurea and benomyl, suggesting their role in cell cycle control. On the other hand, loss of MoFOX1 (ΔMofox1 did not show any noticeable changes in development, pathogenicity, and stress response. Deletion of MoFOX2 was not successful even after repeated attempts. Taken together, these results suggested that MoFKH1 and Mo-HCM1 are important in fungal development and that MoFKH1 is further implicated in pathogenicity and stress response in M. oryzae.

  1. Effect of berberine and (+/-)-bicuculline isolated from Corydalis chaerophylla on spore germination of some fungi.

    Science.gov (United States)

    Basha, S Ameer; Mishra, R K; Jha, R N; Pandey, V B; Singh, U P

    2002-01-01

    Berberine and (+/-)-bicuculline were isolated from roots and leaves, respectively, of Corydalis chaerophylla. Both were effective in vitro against spore germination of some plant pathogenic fungi (Alternaria brassicicola, A. brassicae, A. cheiranthi, A. melongenae, A. solani, Colletotrichum musae, C. falcatum, Curvularia penniseti, C. lunata, C. maculans, C. pallescens, Curvularia sp., Erysiphe pisi, E. cichoracearum, Erysiphe sp., Fusarium udum, Helminthosporium spiciferum, H. penniseti, H. frumentacei, Heterosporium sp., Oidium erysiphoides and Ustilago cynodontis). Berberine and (+/-)-bicuculline significantly inhibited spore germination of all the fungi at concentrations of 100-1000 ppm. Berberine was effective against all the fungi at all concentrations; most of the fungi did not germinate at 1000 ppm. H. penniseti conidia did not germinate at any concentration of (+/-)-bicuculline. U. cynodontis was the least sensitive fungus at lower concentrations but 800 ppm dose was highly effective.

  2. The impact of inducing germination of Bacillus anthracis and Bacillus thuringiensis spores on potential secondary decontamination strategies.

    Science.gov (United States)

    Omotade, T O; Bernhards, R C; Klimko, C P; Matthews, M E; Hill, A J; Hunter, M S; Webster, W M; Bozue, J A; Welkos, S L; Cote, C K

    2014-12-01

    Decontamination and remediation of a site contaminated by the accidental or intentional release of fully virulent Bacillus anthracis spores are difficult, costly and potentially damaging to the environment. Development of novel decontamination strategies that have minimal environmental impacts remains a high priority. Although ungerminated spores are amongst the most resilient organisms known, once exposed to germinants, the germinating spores, in some cases, become susceptible to antimicrobial environments. We evaluated the concept that once germinated, B. anthracis spores would be less hazardous and significantly easier to remediate than ungerminated dormant spores. Through in vitro germination and sensitivity assays, we demonstrated that upon germination, B. anthracis Ames spores and Bacillus thuringiensis Al Hakam spores (serving as a surrogate for B. anthracis) become susceptible to environmental stressors. The majority of these germinated B. anthracis and B. thuringiensis spores were nonviable after exposure to a defined minimal germination-inducing solution for prolonged periods of time. Additionally, we examined the impact of potential secondary disinfectant strategies including bleach, hydrogen peroxide, formaldehyde and artificial UV-A, UV-B and UV-C radiation, employed after a 60-min germination-induction step. Each secondary disinfectant employs a unique mechanism of killing; as a result, germination-induction strategies are better suited for some secondary disinfectants than others. These results provide evidence that the deployment of an optimal combination strategy of germination-induction/secondary disinfection may be a promising aspect of wide-area decontamination following a B. anthracis contamination event. By inducing spores to germinate, our data confirm that the resulting cells exhibit sensitivities that can be leveraged when paired with certain decontamination measures. This increased susceptibility could be exploited to devise more

  3. Detection and differentiation of bacterial spores in a mineral matrix by Fourier transform infrared spectroscopy (FTIR and chemometrical data treatment

    Directory of Open Access Journals (Sweden)

    Brandes Ammann Andrea

    2011-07-01

    Full Text Available Abstract Background Fourier transform infrared spectroscopy (FTIR has been used as analytical tool in chemistry for many years. In addition, FTIR can also be applied as a rapid and non-invasive method to detect and identify microorganisms. The specific and fingerprint-like spectra allow - under optimal conditions - discrimination down to the species level. The aim of this study was to develop a fast and reproducible non-molecular method to differentiate pure samples of Bacillus spores originating from different species as well as to identify spores in a simple matrix, such as the clay mineral, bentonite. Results We investigated spores from pure cultures of seven different Bacillus species by FTIR in reflection or transmission mode followed by chemometrical data treatment. All species investigated (B. atrophaeus, B. brevis, B. circulans, B. lentus, B. megaterium, B. subtilis, B. thuringiensis are typical aerobic soil-borne spore formers. Additionally, a solid matrix (bentonite and mixtures of benonite with spores of B. megaterium at various wt/wt ratios were included in the study. Both hierarchical cluster analysis and principal component analysis of the spectra along with multidimensional scaling allowed the discrimination of different species and spore-matrix-mixtures. Conclusions Our results show that FTIR spectroscopy is a fast method for species-level discrimination of Bacillus spores. Spores were still detectable in the presence of the clay mineral bentonite. Even a tenfold excess of bentonite (corresponding to 2.1 × 1010 colony forming units per gram of mineral matrix still resulted in an unambiguous identification of B. megaterium spores.

  4. Recovery of heat treated Bacillus cereus spores is affected by matrix composition and factors with putative functions in damage repair

    Directory of Open Access Journals (Sweden)

    Alicja Katarzyna Warda

    2016-07-01

    Full Text Available The ability of spores to recover and grow out after food processing is affected by cellular factors and by the outgrowth conditions. In the current communication we studied the recovery and outgrowth of individually sorted spores in BHI and rice broth media and on agar plates using flow cytometry (FCM. We show that recovery of wet heat treated Bacillus cereus ATCC 14579 spores is affected by matrix composition with highest recovery in BHI broth or on rice agar plates, compared to BHI agar plates and rice broth. Data show that not only media composition but also its liquid or solid state affect the recovery of heat treated spores. To determine the impact of factors with putative roles in recovery of heat treated spores, specific genes previously shown to be highly expressed in outgrowing heat-treated spores were selected for mutant construction. Spores of nine B. cereus ATCC 14579 deletion mutants were obtained and their recovery from wet heat treatment was evaluated using BHI and rice broth and agar plates. Deletion mutant spores showed different capacity to recover from heat treatment compared to wild type with the most pronounced effect for a mutant lacking BC5242, a gene encoding a membrane protein with C2C2 zinc finger which resulted in over 95% reduction in recovery compared to the wild type in BHI broth. Notably, similar relative performance of wild type and mutants was observed using the other recovery conditions.We obtained insights on the impact of matrix composition and state on recovery of individually sorted heat treated spores and identified cellular factors with putative roles in this process. These results may provide leads for future developments in design of more efficient combined preservation treatments.

  5. Recovery of Heat Treated Bacillus cereus Spores Is Affected by Matrix Composition and Factors with Putative Functions in Damage Repair.

    Science.gov (United States)

    Warda, Alicja K; Tempelaars, Marcel H; Abee, Tjakko; Nierop Groot, Masja N

    2016-01-01

    The ability of spores to recover and grow out after food processing is affected by cellular factors and by the outgrowth conditions. In the current communication we studied the recovery and outgrowth of individually sorted spores in BHI and rice broth media and on agar plates using flow cytometry. We show that recovery of wet heat treated Bacillus cereus ATCC 14579 spores is affected by matrix composition with highest recovery in BHI broth or on rice agar plates, compared to BHI agar plates and rice broth. Data show that not only media composition but also its liquid or solid state affect the recovery of heat treated spores. To determine the impact of factors with putative roles in recovery of heat treated spores, specific genes previously shown to be highly expressed in outgrowing heat-treated spores were selected for mutant construction. Spores of nine B. cereus ATCC 14579 deletion mutants were obtained and their recovery from wet heat treatment was evaluated using BHI and rice broth and agar plates. Deletion mutant spores showed different capacity to recover from heat treatment compared to wild type with the most pronounced effect for a mutant lacking BC5242, a gene encoding a membrane protein with C2C2 zinc finger which resulted in over 95% reduction in recovery compared to the wild type in BHI broth. Notably, similar relative performance of wild type and mutants was observed using the other recovery conditions. We obtained insights on the impact of matrix composition and state on recovery of individually sorted heat treated spores and identified cellular factors with putative roles in this process. These results may provide leads for future developments in design of more efficient combined preservation treatments.

  6. Adaptation of the spore discharge mechanism in the basidiomycota.

    Directory of Open Access Journals (Sweden)

    Jessica L Stolze-Rybczynski

    Full Text Available Spore discharge in the majority of the 30,000 described species of Basidiomycota is powered by the rapid motion of a fluid droplet, called Buller's drop, over the spore surface. In basidiomycete yeasts, and phytopathogenic rusts and smuts, spores are discharged directly into the airflow around the fungal colony. Maximum discharge distances of 1-2 mm have been reported for these fungi. In mushroom-forming species, however, spores are propelled over much shorter ranges. In gilled mushrooms, for example, discharge distances of <0.1 mm ensure that spores do not collide with opposing gill surfaces. The way in which the range of the mechanism is controlled has not been studied previously.In this study, we report high-speed video analysis of spore discharge in selected basidiomycetes ranging from yeasts to wood-decay fungi with poroid fruiting bodies. Analysis of these video data and mathematical modeling show that discharge distance is determined by both spore size and the size of the Buller's drop. Furthermore, because the size of Buller's drop is controlled by spore shape, these experiments suggest that seemingly minor changes in spore morphology exert major effects upon discharge distance.This biomechanical analysis of spore discharge mechanisms in mushroom-forming fungi and their relatives is the first of its kind and provides a novel view of the incredible variety of spore morphology that has been catalogued by traditional taxonomists for more than 200 years. Rather than representing non-selected variations in micromorphology, the new experiments show that changes in spore architecture have adaptive significance because they control the distance that the spores are shot through air. For this reason, evolutionary modifications to fruiting body architecture, including changes in gill separation and tube diameter in mushrooms, must be tightly linked to alterations in spore morphology.

  7. Monitoring of fungal spores in the indoor air of preschool institution facilities in Novi Sad

    Directory of Open Access Journals (Sweden)

    Novaković Milana S.

    2013-01-01

    Full Text Available Fungal spores can cause a range of health problems in humans such as respiratory diseases and mycotoxicoses. Since children are the most vulnerable, the presence of fungal spores in the facilities of preschool and school institutions should be investigated readily. In order to estimate air contamination by fungal spores, air sampling was conducted in eight facilities of the preschool institution in Novi Sad during February and March, 2007. Sedimentation plate method was used for the detection of viable fungal spores, mostly being members of subdv. Deuteromycota (Fungi imperfecti. In 32 samples a total of 148 colonies were developed, among which five genera were identified: Penicillium, Cladosporium, Aspergillus, Alternaria and Acremonium while non-sporulating fungal colonies were labeled as sterile mycelia. Most frequently recorded genera were Penicillium with 46 colonies and Cladosporium with 44 colonies. The genera Aspergillus and Alternaria were represented with 3 colonies each and Acremonium with only 1 colony. The greatest number of colonies emerged in the samples from the day care facilities “Vendi” (58 colonies and “Panda” (49 colonies. Most diverse samples were obtained from the day care center “Zvončica”, with presence of all identified genera. These results showed notable presence of fungal spores in the indoor air of Preschool institution facilities and indicated the need for further, more complete seasonal research. Obtained information is considered useful for the evaluation of potential mycofactors that endanger health of children. [Projekat Ministarstva nauke Republike Srbije, br. III43002

  8. A Waking Review: Old and Novel Insights into the Spore Germination in Streptomyces

    Directory of Open Access Journals (Sweden)

    Jan Bobek

    2017-11-01

    Full Text Available The complex development undergone by Streptomyces encompasses transitions from vegetative mycelial forms to reproductive aerial hyphae that differentiate into chains of single-celled spores. Whereas their mycelial life – connected with spore formation and antibiotic production – is deeply investigated, spore germination as the counterpoint in their life cycle has received much less attention. Still, germination represents a system of transformation from metabolic zero point to a new living lap. There are several aspects of germination that may attract our attention: (1 Dormant spores are strikingly well-prepared for the future metabolic restart; they possess stable transcriptome, hydrolytic enzymes, chaperones, and other required macromolecules stabilized in a trehalose milieu; (2 Germination itself is a specific sequence of events leading to a complete morphological remodeling that include spore swelling, cell wall reconstruction, and eventually germ tube emergences; (3 Still not fully unveiled are the strategies that enable the process, including a single cell’s signal transduction and gene expression control, as well as intercellular communication and the probability of germination across the whole population. This review summarizes our current knowledge about the germination process in Streptomyces, while focusing on the aforementioned points.

  9. Development of a droplet digital polymerase chain reaction for rapid and simultaneous identification of common foodborne pathogens in soft cheese

    Directory of Open Access Journals (Sweden)

    Paola Cremonesi

    2016-10-01

    Full Text Available Dairy products can harbor various microorganisms (e.g., Campylobacter spp., Salmonella spp., Listeria monocytogenes, verocytotoxin-producing Escherichia coli arising from animal reservoirs, and which can become important sources of foodborne illness. Therefore, early detection of food pathogens is crucial to prevent diseases. We wished to develop an accurate quantitative protocol based on a droplet digital polymerase chain reaction (ddPCR involving eight individual TaqMan™ reactions to detect simultaneously, without selective enrichment, Listeria spp., L. monocytogenes, Salmonella spp., verocytotoxin-producing E. coli and Campylobacter spp. in cheese. ddPCR (a third-generation PCR provides absolute quantification of target DNAs without requirement of a standard curve, which simplifies experimentation and data comparability. The accuracy, specificity and sensitivity of the developed ddPCR system were assessed using purified DNA from 50 reference pathogenic and non-pathogenic strains from international or Italian collections and analyzing soft cheese samples artificially contaminated with serial dilutions (from 4×106 to 4×101 CFU/g of pure cultures from the American Type Culture Collection.Finally, the performance of our ddPCR system was compared by parallel testing with quantitative PCR: it gave higher sensitivity (102 CFU/g for the Listeria spp. assay without the necessity of a standard curve.In conclusion, this is the first ddPCR system developed for simultaneous detection of common foodborne pathogens in cheese using a single set of amplification conditions. As such, it could become a useful strategy for high-throughput screening of microorganisms to evaluate the quality and safety of food products.

  10. Development of a Droplet Digital Polymerase Chain Reaction for Rapid and Simultaneous Identification of Common Foodborne Pathogens in Soft Cheese.

    Science.gov (United States)

    Cremonesi, Paola; Cortimiglia, Claudia; Picozzi, Claudia; Minozzi, Giulietta; Malvisi, Michela; Luini, Mario; Castiglioni, Bianca

    2016-01-01

    Dairy products can harbor various microorganisms (e.g., Campylobacter spp., Salmonella spp., Listeria monocytogenes , verocytotoxin-producing Escherichia coli ) arising from animal reservoirs, and which can become important sources of foodborne illness. Therefore, early detection of food pathogens is crucial to prevent diseases. We wished to develop an accurate quantitative protocol based on a droplet digital polymerase chain reaction (ddPCR) involving eight individual TaqMan™ reactions to detect simultaneously, without selective enrichment, Listeria spp., L. monocytogenes, Salmonella spp., verocytotoxin-producing E. coli and Campylobacter spp. in cheese. ddPCR (a "third-generation PCR") provides absolute quantification of target DNAs without requirement of a standard curve, which simplifies experimentation and data comparability. The accuracy, specificity and sensitivity of the developed ddPCR system were assessed using purified DNA from 50 reference pathogenic and non-pathogenic strains from international or Italian collections and analyzing soft cheese samples artificially contaminated with serial dilutions (from 4 × 10 6 to 4 × 10 1 CFU/g) of pure cultures from the American Type Culture Collection. Finally, the performance of our ddPCR system was compared by parallel testing with quantitative PCR: it gave higher sensitivity (10 2 CFU/g for the Listeria spp. assay) without the necessity of a standard curve. In conclusion, this is the first ddPCR system developed for simultaneous detection of common foodborne pathogens in cheese using a single set of amplification conditions. As such, it could become a useful strategy for high-throughput screening of microorganisms to evaluate the quality and safety of food products.

  11. Development of non-pathogenic bacterial biofilms on the surface of stainless steel which are inhibitory to Salmonella enterica.

    Science.gov (United States)

    Kim, Yoonbin; Kim, Hoikyung; Beuchat, Larry R; Ryu, Jee-Hoon

    2018-02-01

    Non-pathogenic bacterial biofilms were developed on the surface of stainless steel possessing desiccation tolerance and antimicrobial activity against Salmonella enterica. Three bacteria exhibiting strong antimicrobial activities against S. enterica were isolated from various soils, foods, and food-contact surfaces. Isolates were identified as Pseudomonas extremorientalis (strain Lettuce-28), Paenibacillus peoriae (strain Lettuce-7), and Streptomyces cirratus (strain Geumsan-207). These bacteria grew rapidly and formed biofilms within 24 h on the surface of stainless steel coupons (SSCs) immersed in laboratory media (tryptic soy broth or Bennet's broth) at 25 °C. Cells in biofilms had enhanced tolerance to desiccation (exposure to 43% atmospheric relative humidity [RH]) and retained antimicrobial activity against S. enterica. Populations of S. enterica deposited on SSCs containing biofilm formed by Ps. extremorientalis strain Lettuce-28, for example, decreased by > 2.5 log CFU/coupon within 24 h at 25 °C and 43% RH, while the number of cells inoculated on SSCs lacking biofilm decreased by 1.5 log CFU/coupon. Antimicrobial activities of the three antagonistic bacteria against S. enterica persisted in desiccated biofilms. This study provides insights to developing strategies to inactivate Salmonella and perhaps other foodborne pathogens on abiotic surfaces using non-pathogenic antagonistic bacteria. Copyright © 2017. Published by Elsevier Ltd.

  12. Development of a gold nanoparticle-based universal oligonucleotide microarray for multiplex and low-cost detection of foodborne pathogens.

    Science.gov (United States)

    Wang, Xiaoqiang; Ying, Sisi; Wei, Xiaoguang; Yuan, Jun

    2017-07-17

    Bacterial foodborne diseases remain major threats to food safety and public health, especially in developing countries. In this study a novel assay, combining gold nanoparticle (GNP)-based multiplex oligonucleotide ligation-PCR and universal oligonucleotide microarray technology, was developed for inexpensive, specific, sensitive, and multiplex detection of eight common foodborne pathogens, including Shigella spp., Campylobacter jejuni, Bacillus cereus, Escherichia coli O157:H7, Listeria monocytogenes, Salmonella enterica, Staphylococcus aureus, and Vibrio parahaemolyticus. The target fragments of the eight pathogens were enriched by multiplex PCR and subjected to multiplex ligase detection reaction. Ligation products were enriched and labeled with GNPs by universal asymmetric PCR, using excess GNP-conjugated primers. The labeled single-stranded amplicons containing complementary tag sequences were captured by the corresponding tag sequences immobilized on microarrays, followed by silver staining for signal enhancement. Black images of microarray spots were visualized by naked eyes or scanned on a simple flatbed scanner, and quantified. The results indicated that this assay could unambiguously discriminate all eight pathogens in single and multiple infections, with detection sensitivity of 3.3-85CFU/mL for pure cultures. Microarray results of ninety-five artificially contaminated and retail food samples were consistent with traditional culture, biochemical and real-time PCR findings. Therefore, the novel assay has the potential to be used for routine detection due to rapidity, low cost, and high specificity and sensitivity. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Bacillus cereus spore formation, structure and germination

    NARCIS (Netherlands)

    Vries, de Y.P.

    2006-01-01

    Bacterial spores arespecializeddifferentiated celltypes for

  14. Spore membrane(s) as the site of damage within heated Clostridium perfringens spores.

    Science.gov (United States)

    Flowers, R S; Adams, D M

    1976-02-01

    Clostridium perfringens spores were injured by ultrahigh-temperature treatment at 105 C for 5 min. Injury was manifested as an increased sensitivity to polymyxin and neomycin. Since many of the survivors could not germinate normally the ultrahigh-temperature-treated spores were sensitized to and germinated by lysozyme. Polymyxin reportedly acts upon the cell membrane. Neomycin may inhibit protein synthesis and has surface-active properties. Injured spores were increasingly sensitive to known surface-active agents, sodium lauryl sulfate, sodium deoxycholate, and Roccal, a quaternary ammonium compound. Injured spores sensitive to polymyxin and neomycin also were osmotically fragile and died during outgrowth in a liquid medium unless the medium was supplemented with 20% sucrose, 10% dextran, or 10% polyvinylpyrrolidone. The results suggested that a spore structure destined to become cell membrane or cell wall was the site of injury. Repair of injury during outgrowth in the presence of protein, deoxyribonucleic acid, ribonucleic acid and cell wall synthesis inhibitors was consistent with this hypothesis.

  15. Functional characterisation of germinant receptors in Clostridium botulinum and Clostridium sporogenes presents novel insights into spore germination systems.

    Science.gov (United States)

    Brunt, Jason; Plowman, June; Gaskin, Duncan J H; Itchner, Manoa; Carter, Andrew T; Peck, Michael W

    2014-09-01

    Clostridium botulinum is a dangerous pathogen that forms the highly potent botulinum toxin, which when ingested causes a deadly neuroparalytic disease. The closely related Clostridium sporogenes is occasionally pathogenic, frequently associated with food spoilage and regarded as the non-toxigenic equivalent of Group I C. botulinum. Both species form highly resistant spores that are ubiquitous in the environment and which, under favourable growth conditions germinate to produce vegetative cells. To improve the control of botulinum neurotoxin-forming clostridia, it is imperative to comprehend the mechanisms by which spores germinate. Germination is initiated following the recognition of small molecules (germinants) by a specific germinant receptor (GR) located in the spore inner membrane. The present study precisely defines clostridial GRs, germinants and co-germinants. Group I C. botulinum ATCC3502 contains two tricistronic and one pentacistronic GR operons, while C. sporogenes ATCC15579 has three tricistronic and one tetracistronic GR operons. Insertional knockout mutants, allied with characterisation of recombinant GRs shows for the first time that amino acid stimulated germination in C. botulinum requires two tri-cistronic encoded GRs which act in synergy and cannot function individually. Spore germination in C. sporogenes requires one tri-cistronic GR. Two other GRs form part of a complex involved in controlling the rate of amino-acid stimulated germination. The suitability of using C. sporogenes as a substitute for C. botulinum in germination studies and food challenge tests is discussed.

  16. A simple identification method for spore-forming bacteria showing high resistance against γ-rays

    International Nuclear Information System (INIS)

    Koshikawa, Tomihiko; Sone, Koji; Kobayashi, Toshikazu

    1993-01-01

    A simple identification method was developed for spore-forming bacteria which are highly resistant against γ-rays. Among 23 species of Bacillus studied, the spores of Bacillus megaterium, B. cereus, B. thuringiensis, B. pumilus and B. aneurinolyticus showed high resistance against γ-rays as compared with other spores of Bacillus species. Combination of the seven kinds of biochemical tests, namely, the citrate utilization test, nitrate reduction test, starch hydrolysis test, Voges-Proskauer reaction test, gelatine hydrolysis test, mannitol utilization test and xylose utilization test showed a characteristic pattern for each species of Bacillus. The combination pattern of each the above tests with a few supplementary test, if necessary, was useful to identify Bacillus species showing high radiation resistance against γ-rays. The method is specific for B. megaterium, B. thuringiensis and B. pumilus, and highly selective for B. aneurinolyticus and B. cereus. (author)

  17. Species Specific Bacterial Spore Detection Using Lateral-Flow Immunoassay with DPA-Triggered Tb Luminescence

    Science.gov (United States)

    Ponce, Adrian

    2003-01-01

    A method of detecting bacterial spores incorporates (1) A method of lateral-flow immunoassay in combination with (2) A method based on the luminescence of Tb3+ ions to which molecules of dipicolinic acid (DPA) released from the spores have become bound. The present combination of lateral-flow immunoassay and DPA-triggered Tb luminescence was developed as a superior alternative to a prior lateral-flow immunoassay method in which detection involves the visual observation and/or measurement of red light scattered from colloidal gold nanoparticles. The advantage of the present combination method is that it affords both (1) High selectivity for spores of the species of bacteria that one seeks to detect (a characteristic of lateral-flow immunoassay in general) and (2) Detection sensitivity much greater (by virtue of the use of DPA-triggered Tb luminescence instead of gold nanoparticles) than that of the prior lateral-flow immunoassay method

  18. Bryophyte spore germinability is inhibited by peatland substrates

    Science.gov (United States)

    Bu, Zhao-Jun; Li, Zhi; Liu, Li-Jie; Sundberg, Sebastian; Feng, Ya-Min; Yang, Yun-He; Liu, Shuang; Song, Xue; Zhang, Xing-Lin

    2017-01-01

    Bryophyte substrates and species may affect spore germination through allelopathy. Polytrichum strictum is currently expanding in peatlands in north-eastern China - is this an effect of its superior spore germinability or do its gametophytes have a stronger allelopathic effect than do Sphagnum? We conducted a spore burial experiment to test the effect of species identity, substrate and water table depth (WTD) on spore germinability and bryophyte allelopathic effect with P. strictum and two Sphagnum species (S. palustre and S. magellanicum). After 5 months of burial during a growing season, the spores were tested for germinability. Allelopathic effect of bryophyte substrates was assessed by the difference between spore germinability after being stored inside or outside the substrates. After burial, more than 90% of the spores lost their germinability across all three species due to ageing and allelopathy. Spore germinability differed among species, where the spores in S. palustre had a higher germination frequency than those in P. strictum. The three bryophytes maintained a higher germinability in Sphagnum than in Polytrichum hummocks, probably due to a stronger allelopathic effect of P. strictum. Water table drawdown by 10 cm increased germinability by more than 60% across the three species. The study indicates that P. strictum does not possess an advantage regarding spore germination but rather its gametophytes have a stronger allelopathic effect. Due to the weaker inhibitive effect of Sphagnum gametophytes, P. strictum may have a potential establishment superiority over Sphagnum in peatlands, in addition to a better drought tolerance, which may explain its current expansion.

  19. Development of bioassay for pathogenecity testing of Ureaplasma urealyticum as part of host-pathogen communication

    Directory of Open Access Journals (Sweden)

    Purnomo Soeharso

    2005-12-01

    Full Text Available Bioassay of Ureaplasma urealyticum is necessary for detection as well as determination of pathogenic factors in order to understand the pathogenesis of diseases associate with ureaplasma infection. Cultivation and verification of ureaplasma is the first step of this study in the purpose of discovering sensitive method for ureaplasma detection. Cultivation of ureaplasma either in liquid or in solid media are able to detect the existence of ureaplasma in samples analyzed. However, application of PCR using specific primers to be compatible with urease gene (ure would confirm the presence of ureaplasma. The pathogenicity of ureaplasma is potentially monitored using reporter gene as a marker for gene expression. IceC was chosen as reporter gene for ureaplasma pathogenic determination as the gene has great sensitivity, easily detectable and quantitated in simple method of ice nucleation assay. Transposon 916 (Tn916 was selected as a vector for iceC gene to transform ureaplasma. The application of recombinant Tn916-iceC which is considered as pUI, allow detection of ureaplasma activities when transform ureaplasma is tested by ice nucleation assay. It was expected that ureaplasma transformation is the manifestation of mutagenesis which interfere genes responsible for bacterial pathogenicity, in order pathogenesis of bacterial infection to be analyzed accurately. IgA1 protease is considered to be an important factor for ureaplasma pathogenicity as the enzyme is required for successful colonization. Identification of iga gene and  determination of IgA1 protease activity are important for understanding the pathogenesis of ureaplasma infection. Putative iga gene of Mycoplasma genitalium was used as a reference to identify the presence of iga nucleotide sequence in U. urealyticum. Convincing evidence were obtained after PCR amplification of ureaplasma DNA using primers designed to be compatible with putative iga gene of M. genitalium followed by the

  20. Development of an Avirulent Salmonella Surrogate for Modeling Pathogen Behavior in Pre- and Postharvest Environments.

    Science.gov (United States)

    de Moraes, Marcos H; Chapin, Travis K; Ginn, Amber; Wright, Anita C; Parker, Kenneth; Hoffman, Carol; Pascual, David W; Danyluk, Michelle D; Teplitski, Max

    2016-07-15

    Recurrent outbreaks of bacterial gastroenteritis linked to the consumption of fresh fruits and vegetables highlight the paucity of understanding of the ecology of Salmonella enterica under crop production and postharvest conditions. These gaps in knowledge are due, at least in part, to the lack of suitable surrogate organisms for studies for which biosafety level 2 is problematic. Therefore, we constructed and validated an avirulent strain of Salmonella enterica serovar Typhimurium. The strain lacks major Salmonella pathogenicity islands SPI-1, SPI-2, SPI-3, SPI-4, and SPI-5 as well as the virulence plasmid pSLT. Deletions and the absence of genomic rearrangements were confirmed by genomic sequencing, and the surrogate behaved like the parental wild-type strain on selective media. A loss-of-function (phoN) selective marker allowed the differentiation of this strain from wild-type strains on a medium containing a chromogenic substrate for alkaline phosphatase. Lack of virulence was confirmed by oral infection of female BALB/c mice. The strain persisted in tomatoes, cantaloupes, leafy greens, and soil with the same kinetics as the parental wild-type and selected outbreak strains, and it reached similar final population levels. The responses of this strain to heat treatment and disinfectants were similar to those of the wild type, supporting its potential as a surrogate for future studies on the ecology and survival of Salmonella in production and processing environments. There is significant interest in understanding the ecology of human pathogens in environments outside of their animal hosts, including the crop production environment. However, manipulative field experiments with virulent human pathogens are unlikely to receive regulatory approval due to the obvious risks. Therefore, we constructed an avirulent strain of S. enterica serovar Typhimurium and characterized it extensively. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  1. Hygiene Aspects of the Biogas Process with Emphasis on Spore-Forming Bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Bagge, Elisabeth

    2009-07-01

    Biogas is a renewable source of energy which can be obtained from processing of biowaste. The digested residues can be used as fertiliser. Biowaste intended for biogas production contains pathogenic micro-organisms. A pre-pasteurisation step at 70 deg C for 60 min before anaerobic digestion reduces non spore-forming bacteria such as Salmonella spp. To maintain the standard of the digested residues it must be handled in a strictly hygienic manner to avoid recontamination and re-growth of bacteria. The risk of contamination is particularly high when digested residues are transported in the same vehicles as the raw material. However, heat treatment at 70 deg C for 60 min will not reduce spore-forming bacteria such as Bacillus spp. and Clostridium spp. Spore-forming bacteria, including those that cause serious diseases, can be present in substrate intended for biogas production. The number of species and the quantity of Bacillus spp. and Clostridium spp. in manure, slaughterhouse waste and in samples from different stages during the biogas process were investigated. The number of species of clostridia seemed to decrease following digestion, likewise the quantity. However, Bacillus spp. seemed to pass unaffected through the biogas process. In laboratory-scale experiments the effects on clostridia during pasteurisation and digestion were investigated. Pathogenic clostridia were inoculated in substrates from homogenisation tanks and digester tanks. The inoculated clostridia remained after pasteurisation, but the impacts of digestion differ between different species. Culture followed by identification of C. chauvoei by PCR in samples from cattle died from blackleg, is faster and safer than culture followed by biochemical identification of C. chauvoei. However, for environmental samples the PCR method is not practically applicable for detection of C. chauvoei. To avoid spreading of diseases via biogas plants when digested residues are spread on arable land, a pasteurisation

  2. Targeted Disruption of Melanin Biosynthesis Genes in the Human Pathogenic Fungus Lomentospora prolificans and Its Consequences for Pathogen Survival

    Directory of Open Access Journals (Sweden)

    Ayat Al-Laaeiby

    2016-03-01

    Full Text Available The dematiaceous (melanised fungus Lomentospora (Scedosporium prolificans is a life-threatening opportunistic pathogen of immunocompromised humans, resistant to anti-fungal drugs. Melanin has been shown to protect human pathogenic fungi against antifungal drugs, oxidative killing and environmental stresses. To determine the protective role of melanin in L. prolificans to oxidative killing (H2O2, UV radiation and the polyene anti-fungal drug amphotericin B, targeted gene disruption was used to generate mutants of the pathogen lacking the dihydroxynaphthalene (DHN-melanin biosynthetic enzymes polyketide synthase (PKS1, tetrahydroxynapthalene reductase (4HNR and scytalone dehydratase (SCD1. Infectious propagules (spores of the wild-type strain 3.1 were black/brown, whereas spores of the PKS-deficient mutant ΔLppks1::hph were white. Complementation of the albino mutant ΔLppks1::hph restored the black-brown spore pigmentation, while the 4HNR-deficient mutant ΔLp4hnr::hph and SCD-deficient mutant ΔLpscd1::hph both produced orange-yellow spores. The mutants ΔLppks1::hph and ΔLp4hnr::hph showed significant reductions in spore survival following H2O2 treatment, while spores of ΔLpscd1::hph and the ΔLppks1::hph complemented strain ΔLppks1::hph:PKS showed spore survivals similar to strain 3.1. Spores of the mutants ΔLp4hnr::hph and ΔLpscd1::hph and complemented strain ΔLppks1::hph:PKS showed spore survivals similar to 3.1 following exposure to UV radiation, but survival of ΔLppks1::hph spores was significantly reduced compared to the wild-type strain. Strain 3.1 and mutants ΔLp4hnr::hph and ΔLppks1::hph:PKS were resistant to amphotericin B while, paradoxically, the PKS1- and SCD1-deficient mutants showed significant increases in growth in the presence of the antifungal drug. Taken together, these results show that while melanin plays a protective role in the survival of the pathogen to oxidative killing and UV radiation, melanin does not

  3. Targeted Disruption of Melanin Biosynthesis Genes in the Human Pathogenic Fungus Lomentospora prolificans and Its Consequences for Pathogen Survival.

    Science.gov (United States)

    Al-Laaeiby, Ayat; Kershaw, Michael J; Penn, Tina J; Thornton, Christopher R

    2016-03-24

    The dematiaceous (melanised) fungus Lomentospora (Scedosporium) prolificans is a life-threatening opportunistic pathogen of immunocompromised humans, resistant to anti-fungal drugs. Melanin has been shown to protect human pathogenic fungi against antifungal drugs, oxidative killing and environmental stresses. To determine the protective role of melanin in L. prolificans to oxidative killing (H₂O₂), UV radiation and the polyene anti-fungal drug amphotericin B, targeted gene disruption was used to generate mutants of the pathogen lacking the dihydroxynaphthalene (DHN)-melanin biosynthetic enzymes polyketide synthase (PKS1), tetrahydroxynapthalene reductase (4HNR) and scytalone dehydratase (SCD1). Infectious propagules (spores) of the wild-type strain 3.1 were black/brown, whereas spores of the PKS-deficient mutant ΔLppks1::hph were white. Complementation of the albino mutant ΔLppks1::hph restored the black-brown spore pigmentation, while the 4HNR-deficient mutant ΔLp4hnr::hph and SCD-deficient mutant ΔLpscd1::hph both produced orange-yellow spores. The mutants ΔLppks1::hph and ΔLp4hnr::hph showed significant reductions in spore survival following H₂O₂ treatment, while spores of ΔLpscd1::hph and the ΔLppks1::hph complemented strain ΔLppks1::hph:PKS showed spore survivals similar to strain 3.1. Spores of the mutants ΔLp4hnr::hph and ΔLpscd1::hph and complemented strain ΔLppks1::hph:PKS showed spore survivals similar to 3.1 following exposure to UV radiation, but survival of ΔLppks1::hph spores was significantly reduced compared to the wild-type strain. Strain 3.1 and mutants ΔLp4hnr::hph and ΔLppks1::hph:PKS were resistant to amphotericin B while, paradoxically, the PKS1- and SCD1-deficient mutants showed significant increases in growth in the presence of the antifungal drug. Taken together, these results show that while melanin plays a protective role in the survival of the pathogen to oxidative killing and UV radiation, melanin does not

  4. Identification and Validation of Specific Markers of Bacillus anthracis Spores by Proteomics and Genomics Approaches*

    Science.gov (United States)

    Chenau, Jérôme; Fenaille, François; Caro, Valérie; Haustant, Michel; Diancourt, Laure; Klee, Silke R.; Junot, Christophe; Ezan, Eric; Goossens, Pierre L.; Becher, François

    2014-01-01

    Bacillus anthracis is the causative bacteria of anthrax, an acute and often fatal disease in humans. The infectious agent, the spore, represents a real bioterrorism threat and its specific identification is crucial. However, because of the high genomic relatedness within the Bacillus cereus group, it is still a real challenge to identify B. anthracis spores confidently. Mass spectrometry-based tools represent a powerful approach to the efficient discovery and identification of such protein markers. Here we undertook comparative proteomics analyses of Bacillus anthracis, cereus and thuringiensis spores to identify proteoforms unique to B. anthracis. The marker discovery pipeline developed combined peptide- and protein-centric approaches using liquid chromatography coupled to tandem mass spectrometry experiments using a high resolution/high mass accuracy LTQ-Orbitrap instrument. By combining these data with those from complementary bioinformatics approaches, we were able to highlight a dozen novel proteins consistently observed across all the investigated B. anthracis spores while being absent in B. cereus/thuringiensis spores. To further demonstrate the relevance of these markers and their strict specificity to B. anthracis, the number of strains studied was extended to 55, by including closely related strains such as B. thuringiensis 9727, and above all the B. cereus biovar anthracis CI, CA strains that possess pXO1- and pXO2-like plasmids. Under these conditions, the combination of proteomics and genomics approaches confirms the pertinence of 11 markers. Genes encoding these 11 markers are located on the chromosome, which provides additional targets complementary to the commonly used plasmid-encoded markers. Last but not least, we also report the development of a targeted liquid chromatography coupled to tandem mass spectrometry method involving the selection reaction monitoring mode for the monitoring of the 4 most suitable protein markers. Within a proof

  5. Pathogenic diversity of Phytophthora sojae and breeding strategies to develop Phytophthora-resistant soybeans

    Science.gov (United States)

    Sugimoto, Takuma; Kato, Masayasu; Yoshida, Shinya; Matsumoto, Isao; Kobayashi, Tamotsu; Kaga, Akito; Hajika, Makita; Yamamoto, Ryo; Watanabe, Kazuhiko; Aino, Masataka; Matoh, Toru; Walker, David R.; Biggs, Alan R.; Ishimoto, Masao

    2012-01-01

    Phytophthora stem and root rot, caused by Phytophthora sojae, is one of the most destructive diseases of soybean [Glycine max (L.) Merr.], and the incidence of this disease has been increasing in several soybean-producing areas around the world. This presents serious limitations for soybean production, with yield losses from 4 to 100%. The most effective method to reduce damage would be to grow Phytophthora-resistant soybean cultivars, and two types of host resistance have been described. Race-specific resistance conditioned by single dominant Rps (“resistance to Phytophthora sojae”) genes and quantitatively inherited partial resistance conferred by multiple genes could both provide protection from the pathogen. Molecular markers linked to Rps genes or quantitative trait loci (QTLs) underlying partial resistance have been identified on several molecular linkage groups corresponding to chromosomes. These markers can be used to screen for Phytophthora-resistant plants rapidly and efficiently, and to combine multiple resistance genes in the same background. This paper reviews what is currently known about pathogenic races of P. sojae in the USA and Japan, selection of sources of Rps genes or minor genes providing partial resistance, and the current state and future scope of breeding Phytophthora-resistant soybean cultivars. PMID:23136490

  6. The infrared spectral transmittance of Aspergillus niger spore aggregated particle swarm

    Science.gov (United States)

    Zhao, Xinying; Hu, Yihua; Gu, Youlin; Li, Le

    2015-10-01

    Microorganism aggregated particle swarm, which is quite an important composition of complex media environment, can be developed as a new kind of infrared functional materials. Current researches mainly focus on the optical properties of single microorganism particle. As for the swarm, especially the microorganism aggregated particle swarm, a more accurate simulation model should be proposed to calculate its extinction effect. At the same time, certain parameters deserve to be discussed, which helps to better develop the microorganism aggregated particle swarm as a new kind of infrared functional materials. In this paper, take Aspergillus Niger spore as an example. On the one hand, a new calculation model is established. Firstly, the cluster-cluster aggregation (CCA) model is used to simulate the structure of Aspergillus Niger spore aggregated particle. Secondly, the single scattering extinction parameters for Aspergillus Niger spore aggregated particle are calculated by using the discrete dipole approximation (DDA) method. Thirdly, the transmittance of Aspergillus Niger spore aggregated particle swarm is simulated by using Monte Carlo method. On the other hand, based on the model proposed above, what influences can wavelength causes has been studied, including the spectral distribution of scattering intensity of Aspergillus Niger spore aggregated particle and the infrared spectral transmittance of the aggregated particle swarm within the range of 8-14μm incident infrared wavelengths. Numerical results indicate that the scattering intensity of Aspergillus Niger spore aggregated particle reduces with the increase of incident wavelengths at each scattering angle. Scattering energy mainly concentrates on the scattering angle between 0-40°, forward scattering has an obvious effect. In addition, the infrared transmittance of Aspergillus Niger spore aggregated particle swarm goes up with the increase of incident wavelengths. However, some turning points of the trend are

  7. No evidence for a Ganoderma spore dispersal mutualism in an obligate spore-feeding beetle Zearagytodes maculifer.

    Science.gov (United States)

    Kadowaki, Kohmei; Leschen, Richard A B; Beggs, Jacqueline R

    2011-08-01

    The role of spore dispersal mutualism remains equivocal in many fungus-insect assemblages. We tested experimentally whether an obligate spore-feeding beetle Zearagytodes maculifer has a mutualistic relationship with its host bracket fungus Ganoderma cf. applanatum via spore dispersal. We asked three specific questions: (1) whether or not Ganoderma spore germination rate is increased via beetle digestive activity and (2) is dependent on temperature and sporocarp identity. Spore germination rates were examined in 2×3×2 factorial experiments (spores consumed by beetles or not×temperature 20, 25, and 30°C×two independent pairs of sporocarp-beetle populations) replicated five times in an array of 60 experimental cultures. Analysis showed that consumption by beetles significantly reduced germination rate of Ganoderma spores. The effect of temperature was modulated by the effect of individual sporocarp, and was overridden by beetle feeding. Microscopic analysis revealed that spores from beetle faecal pellets exhibited extensive damage to their thin outer walls (pellicles) and thick inner walls, as well as significant loss of cytoplasm, while control spores were intact. The overall evidence argued against our spore dispersal mutualism hypothesis, suggesting that Z. maculifer can potentially exert a negative, if vanishingly small, fitness effect on its host fungus G. cf. applanatum. Copyright © 2011 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  8. A study of Ganoderma lucidum spores by FTIR microspectroscopy

    Science.gov (United States)

    Wang, Xin; Chen, Xianliang; Qi, Zeming; Liu, Xingcun; Li, Weizu; Wang, Shengyi

    2012-06-01

    In order to obtain unique information of Ganoderma lucidum spores, FTIR microspectroscopy was used to study G. lucidum spores from Anhui Province (A), Liaoning Province (B) and Shangdong Province (C) of China. IR micro-spectra were acquired with high-resolution and well-reproducibility. The IR spectra of G. lucidum spores from different areas were similar and mainly made up of the absorption bands of polysaccharide, sterols, proteins, fatty acids, etc. The results of curve fitting indicated the protein secondary structures were dissimilar among the above G. lucidum spores. To identify G. lucidum spores from different areas, the H1078/H1640 value might be a potentially useful factor, furthermore FTIR microspectroscopy could realize this identification efficiently with the help of hierarchical cluster analysis. The result indicates FTIR microspectroscopy is an efficient tool for identification of G. lucidum spores from different areas. The result also suggests FTIR microspectroscopy is a potentially useful tool for the study of TCM.

  9. Spore communities of arbuscular mycorrhizal fungi and mycorrhizal associations in different ecosystems, south Australia

    Directory of Open Access Journals (Sweden)

    Z. I. Antoniolli

    2002-09-01

    Full Text Available Communities of arbuscular mycorrhizal fungi (AMF were surveyed in different South Australian ecosystems. The soil was wet-sieved for spore extraction, followed by the determination of presence and abundance of AMF species as well as the percentage of root colonization. Mycorrhizal associations were common and there was substantial fungal diversity in different ecosystems. Spores were most abundant in the permanent pasture system and less abundant under continuous wheat. The incidence of mycorrhizal associations in different plant species and the occurrence of Arum and Paris type colonization generally conformed with previous information. Spores of seventeen AMF were verified throughout seasonal changes in 1996 and 1997 in the permanent pasture and on four host species (Lolium perenne, Plantago lanceolata, Sorghum sp. and Trifolium subterraneum , set up with the same soils under greenhouse conditions. Glomus mosseae was the dominant spore type at all sampling times and in all trap cultures. Mycorrhizal diversity was significantly affected by different sampling times in trap cultures but not in field-collected soil. P. lanceolata, Sorghum sp. and T. subterraneum as hosts for trap cultures showed no differences in richness and diversity of AMF spores that developed in association with their roots. Abundance and diversity were lowest, however, in association with L. perenne , particularly in December 1996. Results show that the combination of spore identification from field-collected soil and trap cultures is essential to study population and diversity of AMF. The study provides baseline data for ongoing monitoring of mycorrhizal populations using conventional methods and material for the determination of the symbiotic effectiveness of AMF key members.

  10. Modeling Radiation Effectiveness for Inactivation of Bacillus Spores

    Science.gov (United States)

    2015-09-17

    MODELING RADIATION EFFECTIVENESS FOR INACTIVATION OF BACILLUS SPORES DISSERTATION Emily A. Knight, Major, USAF AFIT-ENC-DS-15-S-001 DEPARTMENT OF THE...not subject to copyright protection in the United States. AFIT-ENC-DS-15-S-001 MODELING RADIATION EFFECTIVENESS FOR INACTIVATION OF BACILLUS SPORES...EFFECTIVENESS FOR INACTIVATION OF BACILLUS SPORES Emily A. Knight, B.A., M.S. Major, USAF Committee Membership: Dr. William P. Baker Chair Dr. Larry W

  11. Chitinolytic activity in viable spores of encephalitozoon species

    OpenAIRE

    Schottelius,J; Hünger,F; Schüler,Th; Gonçalves da Costa,SC

    2000-01-01

    By employing 4-methylumbelliferyl-beta-D-NN',N"-triacetylchitotriose substrate in a semi quantitative assay, chitinolytic activity in viable spores of Encephalitozoon cuniculi and E. intestinalis was detected and dependence on reaction time, spore concentration, concentration of substrate and temperature were demonstrated. It was possible to block the chitinolytic activity by chitin hydrolysate. By incubation at 80°C for 10 min or at 55°C for 20 min the spores were loosing the chitinolytic ac...

  12. Predictive modeling of Bacillus cereus spores in farm tank milk during grazing and housing periods

    NARCIS (Netherlands)

    Vissers, M.M.M.; Giffel, M.C.T.; Driehuis, F.; Jong, de P.; Lankveld, J.M.G.

    2007-01-01

    The shelf life of pasteurized dairy products depends partly on the concentration of Bacillus cereus spores in raw milk. Based on a translation of contamination pathways into chains of unit-operations, 2 simulation models were developed to quantitatively identify factors that have the greatest effect

  13. Spore production in Paecilomyces lilacinus (Thom.) samson strains on agro-industrial residues

    OpenAIRE

    Robl, Diogo; Sung, Letizia B.; Novakovich, Jo?o Henrique; Marangoni, Paulo R.D.; Zawadneak, Maria Aparecida C.; Dalzoto, Patricia R.; Gabardo, Juarez; Pimentel, Ida Chapaval

    2009-01-01

    Paecilomyces lilacinus has potential for pests control. We aimed to analyze mycelial growth and spore production in P. lilacinus strains in several agro-industrial residues and commercial media. This study suggests alternative nutrient sources for fungi production and that the biotechnological potential of agro-industrial refuses could be employed in byproducts development.

  14. Optimization of Verticillium lecanii spore production in solid-state fermentation on sugarcane bagasse

    NARCIS (Netherlands)

    Shi, Y.; Xu, X.; Zhu, Y.

    2009-01-01

    Verticillium lecanii is an entomopathogen with high potential in biological control of pests. We developed a solid-state fermentation with sugarcane bagasse as carrier absorbing liquid medium to propagate V. lecanii spores. Using statistical experimental design, we optimized the medium composition

  15. A rapid colorimetric assay for mold spore germination using XTT tetrazolium salt

    Science.gov (United States)

    Carol A. Clausen; Vina W. Yang

    2011-01-01

    Current laboratory test methods to measure efficacy of new mold inhibitors are time consuming, some require specialized test equipment and ratings are subjective. Rapid, simple quantitative assays to measure the efficacy of mold inhibitors are needed. A quantitative, colorimetric microassay was developed using XTT tetrazolium salt to metabolically assess mold spore...

  16. Chitinolytic activity in viable spores of encephalitozoon species

    Directory of Open Access Journals (Sweden)

    J Schottelius

    2000-10-01

    Full Text Available By employing 4-methylumbelliferyl-beta-D-NN',N"-triacetylchitotriose substrate in a semi quantitative assay, chitinolytic activity in viable spores of Encephalitozoon cuniculi and E. intestinalis was detected and dependence on reaction time, spore concentration, concentration of substrate and temperature were demonstrated. It was possible to block the chitinolytic activity by chitin hydrolysate. By incubation at 80°C for 10 min or at 55°C for 20 min the spores were loosing the chitinolytic activity. Incubation of the spores in trypsin reduced the chitinolytic activity. Cellulase activity could not be detected.

  17. Chitinolytic activity in viable spores of Encephalitozoon species.

    Science.gov (United States)

    Schottelius, J; Hünger, F; Schüler, T; Gonçalves da Costa, S C

    2000-01-01

    By employing 4-methylumbelliferyl-beta-D-NN',N"-triacetylchitotriose substrate in a semi quantitative assay, chitinolytic activity in viable spores of Encephalitozoon cuniculi and E. intestinalis was detected and dependence on reaction time, spore concentration, concentration of substrate and temperature were demonstrated. It was possible to block the chitinolytic activity by chitin hydrolysate. By incubation at 80 degrees C for 10 min or at 55 degrees C for 20 min the spores were loosing the chitinolytic activity. Incubation of the spores in trypsin reduced the chitinolytic activity. Cellulase activity could not be detected.

  18. Effects of Chlorine Dioxide on Spore Structural and Functional Properties

    National Research Council Canada - National Science Library

    Leighton, Terrance

    2003-01-01

    .... The experimental results described in this report were designed to test this hypothesis. Dormant bacterial endospores are highly birefringent due to the anhydrous nature of the spore cytoplasm...

  19. Cross inoculation of anthracnose pathogens infecting various tropical fruits

    Science.gov (United States)

    Suparman; Rahmiyah, M.; Pujiastuti, Y.; Gunawan, B.; Arsi

    2018-01-01

    Anthracnose disease is very important disease of tropical fruits causing significant yield losses. The disease is caused by Colletotrichum spp. and infects almost all tropical fruit species, especially the succulent ones. Various species of Colletotrichum infect various tropical fruits and there are possibilities for cross inoculation to occur among tropical fruits which might cause severe infection. An experimental research was conducted to examine the effect of cross inoculation of anthracnose pathogen among papaya, eggplant, chili and common bean on the infection development and severity of the disease on each inoculated fruit species. Colletotrichum spp. were isolated from naturally infected papaya, eggplant, chili and common bean. Each fungal isolate was purified and identified to determine the species name. The spores of each isolate were then used to separately inoculate healthy and sterilized papaya, eggplant, chili and common bean. The results showed that cross infection developed on chili, eggplant and papaya but not on bean. Chili showed the highest susceptibility to all Colletotrichum isolates and significantly different from eggplant and papaya. The anthracnose pathogen isolated from common bean showed no pathogenicity to other hosts and might be used as cross protection inoculant to the disease in the other hosts.

  20. Sample preparation and assay refinements for pathogen detection platforms

    Science.gov (United States)

    Lim, Daniel V.; Kearns, Elizabeth A.; Leskinen, Stephaney D.; Magaña, Sonia; Stroot, Joyce M.; Hunter, Dawn M.; Schlemmer, Sarah M.

    2009-02-01

    Food-borne and waterborne microbial pathogens are a potential problem in biowarfare and public health. Such pathogens can affect the health, combat readiness, and effectiveness of the warfighter in a battlefield environment and present potential threats to the civilian population through intentional or natural contamination of food and water. Conventional procedures to detect and identify microbial pathogens in food, water, and other materials can take days to perform and may provide inconclusive information. Research at the University of South Florida's Advanced Biosensors Laboratory (ABL) focuses on development of sample processing procedures and biosensor-based assays for rapid detection of biothreat agents. Rapid processing methods, including use of an automated concentrator of microorganisms in water, have been developed for complex matrix samples including ground beef, apple juice, produce, potable water and recreational water, enabling such samples to be directly tested by biosensor assays for target analytes. Bacillus atrophaeus spores and other bacteria can be concentrated from potable and recreational water at low levels with a dead-end hollow-fiber ultrafiltration concentration system. Target bacteria recovered by these processing procedures can be identified by evanescent wave, fiber optic biosensors or other detection platforms. Fiber optic biosensor assays have been improved to include subsequent PCR analysis and viability determination of captured target bacteria using broth enrichment and/or ATP luminescence.

  1. Inhibitive Effect of Fuyuziphine isolated from Plant (Pittapapra) (Fumaria indica) on Spore Germination of Some Fungi.

    Science.gov (United States)

    Pandey, M B; Singh, Ashok K; Singh, Anil K; Singh, U P

    2007-09-01

    The alkaloid fuyuziphine was isolated from the whole plant of Fumaria indica. It had inhibitive effect against spore germination of some plant pathogenic fungi (Collectotrichum sp., C. gloeosporioides, C. falcatum, Curvularia maculans, C. lunata, Erysiphe cichoracearum, Helminthosporium pennisetti, Oidium erysiphoides, Ustilago cynodontis, Alternaria chieranthi, A. melongenae, A. brassicicola and A. solani). Curvularia lunata, Oidium erysiphoides, Alternaria brassicicola and A. solani did not germinate at 750 and 1000 ppm and Colletotrichum gloeosporioides, C. falcatum, Curvularia maculans were inhibited at 1000 ppm for 24 hr incubation. Germination of most fungi was significantly inhibited at 100~750 ppm.

  2. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Science.gov (United States)

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  3. Potential sources of airborne Alternaria spp. spores in South-west Spain.

    Science.gov (United States)

    Fernández-Rodríguez, Santiago; Sadyś, Magdalena; Smith, Matt; Tormo-Molina, Rafael; Skjøth, Carsten Ambelas; Maya-Manzano, José María; Silva-Palacios, Inmaculada; Gonzalo-Garijo, Ángela

    2015-11-15

    Fungi belonging to the genus of Alternaria are recognised as being significant plant pathogens, and Alternaria allergens are one of the most important causes of respiratory allergic diseases in Europe. This study aims to provide a detailed and original analysis of Alternaria transport dynamics in Badajoz, SW Spain. This was achieved by examining daily mean and hourly observations of airborne Alternaria spores recorded during days with high airborne concentrations of Alternaria spores (>100 s m(-3)) from 2009 to 2011, as well as four inventory maps of major Alternaria habitats, the overall synoptic weather situation and analysis of air mass transport using Hybrid Single Particle Lagrangian Integrated Trajectory model and geographic information systems. Land use calculated within a radius of 100 km from Badajoz shows that crops and grasslands are potentially the most important local sources of airborne Alternaria spores recorded at the site. The results of back trajectory analysis show that, during the examined four episodes, the two main directions where Alternaria source areas were located were: (1) SW-W; and (2) NW-NE. Regional scale and long distance transport could therefore supplement the airborne catch recorded at Badajoz with Alternaria conidia originating from sources such as crops and orchards situated in other parts of the Iberian Peninsula. Published by Elsevier B.V.

  4. Development and application of an eDNA method to detect and quantify a pathogenic parasite in aquatic ecosystems.

    Science.gov (United States)

    Huver, J R; Koprivnikar, J; Johnson, P T J; Whyard, S

    2015-06-01

    Approaches based on organismal DNA found in the environment (eDNA) have become increasingly utilized for ecological studies and biodiversity inventories as an alternative to traditional field survey methods. Such DNA-based techniques have largely been used to establish the presence of free-living organisms, but have much potential for detecting and quantifying infectious agents in the environment, which is necessary to evaluate disease risk. We developed an eDNA method to examine the distribution and abundance of the trematode Ribeiroia ondatrae, a pathogenic parasite known to cause malformations in North American amphibians. In addition to comparing this eDNA approach to classical host necropsy, we examined the detectability of R. ondatrae in water samples subject to different degradation conditions (time and temperature). Our test exhibited high specificity and sensitivity to R. ondatrae, capable of detecting as little as 14 fg (femtograms) of this parasite's DNA (1/2500th of a single infectious stage) from field water samples. Compared to our results from amphibian host necropsy, quantitative PCR was -90% concordant with respect to R. ondatrae detection from 15 field sites and was also a significant predictor of host infection abundance. DNA was still detectable in lab samples after 21 days at 25°C, indicating that our method is robust to field conditions. By comparing the advantages and disadvantages of eDNA vs. traditional survey methods for determining pathogen presence and abundance in the field, we found that the lower cost and effort associated with eDNA approaches provide many advantages. The development of alternative tools is critical for disease ecology, as wildlife management and conservation efforts require reliable establishment and monitoring of pathogens.

  5. Developing an easy-to-apply model for identifying relevant pathogen pathways into surface waters used for recreational purposes.

    Science.gov (United States)

    Tondera, Katharina; Klaer, Kassandra; Roder, Silke; Brueckner, Ira; Strathmann, Martin; Kistemann, Thomas; Schreiber, Christiane; Pinnekamp, Johannes

    2016-10-01

    Swimming in inner-city surface waters is popular in the warm season, but can have negative consequences such as gastro-intestinal, ear and skin infections. The pathogens causing these infections commonly enter surface waters via several point source discharges such as the effluents from wastewater treatment plants and sewer overflows, as well as through diffuse non-point sources such as surface runoff. Nonetheless, the recreational use of surface waters is attractive for residents. In order to save financial and organizational resources, local authorities need to estimate the most relevant pathways of pathogens into surface waters. In particular, when detailed data on a local scale are missing, this is quite difficult to achieve. For this reason, we have developed an easy-to-apply model using the example of Escherichia coli and intestinal enterococci as a first approach to the local situation, where missing data can be replaced by data from literature. The model was developed based on a case study of a river arm monitored in western Germany and will be generalized for future applications. Although the limits of the EU Bathing Water Directive are already fulfilled during dry weather days, we showed that the effluent of wastewater treatment plants and overland flow had the most relevant impact on the microbial surface water quality. On rainy weather days, combined sewer overflows are responsible for the highest microbial pollution loads. The results obtained in this study can help decision makers to focus on reducing the relevant pathogen sources within a catchment area. Copyright © 2015 Elsevier GmbH. All rights reserved.

  6. Development of real-time PCR array for simultaneous detection of eight human blood-borne viral pathogens.

    Directory of Open Access Journals (Sweden)

    Natalia Pripuzova

    Full Text Available BACKGROUND: Real-time PCR array for rapid detection of multiple viral pathogens should be highly useful in cases where the sample volume and the time of testing are limited, i.e. in the eligibility testing of tissue and organ donors. FINDINGS: We developed a real-time PCR array capable of simultaneously detecting eight human viral pathogens: human immunodeficiency virus types 1 and 2 (HIV-1 and -2, hepatitis B virus (HBV, hepatitis C virus (HCV, human T-cell leukemia virus-1 and -2 (HTLV-1 and -2, vaccinia virus (VACV and West Nile virus (WNV. One hundred twenty (120 primers were designed using a combination of bioinformatics approaches, and, after experimental testing, 24 primer sets targeting eight viral pathogens were selected to set up the array with SYBR Green chemistry. The specificity and sensitivity of the virus-specific primer sets selected for the array were evaluated using analytical panels with known amounts of viruses spiked into human plasma. The array detected: 10 genome equivalents (geq/ml of HIV-2 and HCV, 50 geq of HIV-1 (subtype B, HBV (genotype A and WNV. It detected 100-1,000 geq/ml of plasma of HIV-1 subtypes (A - G, group N and CRF (AE and AG isolates. Further evaluation with a panel consisting of 28 HIV-1 and HIV-2 clinical isolates revealed no cross-reactivity of HIV-1 or HIV-2 specific primers with another type of HIV. All 28 viral isolates were identified with specific primer sets targeting the most conserved genome areas. The PCR array correctly identified viral infections in a panel of 17 previously quantified clinical plasma samples positive for HIV-1, HCV or HBV at as low as several geq per PCR reaction. CONCLUSIONS: The viral array described here demonstrated adequate performance in the testing of donors' clinical samples. Further improvement in its sensitivity for the broad spectrum of HIV-1 subtypes is under development.

  7. Spore-Forming Bacteria that Resist Sterilization

    Science.gov (United States)

    LaDuc, Myron; Venkateswaran, Kasthuri

    2003-01-01

    A report presents a phenotypic and genotypic characterization of a bacterial species that has been found to be of the genus Bacillus and has been tentatively named B. odysseensis because it was isolated from surfaces of the Mars Odyssey spacecraft as part of continuing research on techniques for sterilizing spacecraft to prevent contamination of remote planets by terrestrial species. B. odysseensis is a Gram-positive, facultatively anaerobic, rod-shaped bacterium that forms round spores. The exosporium has been conjectured to play a role in the elevated resistance to sterilization. Research on the exosporium is proposed as a path toward improved means of sterilization, medical treatment, and prevention of biofouling.

  8. Management of foliar and soilborne pathogens of cowpea ( Vigna ...

    African Journals Online (AJOL)

    White and pink garlic extracts were tested for their antifungal potentials on mycelial radial growth, spores and sclerotial production of Macrophomina phaseolina (Tassi) Goid, Colletotrichum destructivum O gara and Colletotrichum capsici (Syd) Butler and Bisby pathogens of cowpea in vitro. Water or ethanol extracts of ...

  9. Spore Dispersal Patterns of Fusarium circinatum on an Infested Monterey Pine Forest in North-Western Spain

    Directory of Open Access Journals (Sweden)

    Miloň Dvořák

    2017-11-01

    Full Text Available The airborne inoculum of Fusarium circinatum Nirenberg & O’Donnell, the fungal pathogen causing Pine Pitch Canker (PPC, is one of the main means of spread of the disease in forest stands and forest nurseries. Since this world-wide known pathogen was introduced in Europe, its biology in this newly infested area still remains scarcely known. To shed more light on this topic, we set up an experiment on a naturally PPC infested forest of Monterey pine in Galicia (NW Spain with the following two goals: (i to describe the seasonal spore dispersal pattern during one year of regular sampling and (ii to assess the spatial spore dispersal pattern around the infested plot. Portable rotating arm spore traps were used and complemented with meteorological measurements. The abundance of F. circinatum spores in the samples was assessed by quantitative PCR (qPCR with a hydrolysis probe. The results showed almost permanent occurrence of the air inoculum throughout the whole year, being detected in 27 of the 30 samplings. No clear temporal trends were observed, but a higher air inoculum was favoured by previous lower air temperatures and lower leaf wetness. Conversely, neither rainfall nor air humidity seemed to have any significant importance. The spatial spread of the inoculum was noted to be successful up to a distance of 1000 m in the wind direction, even with winds of just 5 m·s−1. Our study shows that rotating arm spore traps combined with qPCR may be an efficient tool for F. circinatum detection.

  10. Development of carboxymethyl cellulose-based hydrogel and nanosilver composite as antimicrobial agents for UTI pathogens.

    Science.gov (United States)

    Alshehri, Saad M; Aldalbahi, Ali; Al-Hajji, Abdullah Baker; Chaudhary, Anis Ahmad; Panhuis, Marc In Het; Alhokbany, Norah; Ahamad, Tansir

    2016-03-15

    Silver nanoparticles (AgNPs) containing hydrogel composite were first synthesized by preparing a new hydrogel from carboxymethyl cellulose (CMC), polyvinyl alcohol (PVA), and the cross-linker ethylene glycol diglycidyl ether (EGDE), followed by the incorporation of AgNPs by microwave radiation. The resulting neat hydrogels and AgNPs-hydrogel composites were characterized using spectral, thermal, microscopic analysis and X-ray diffraction (XRD) analyses. The SEM and TEM results demonstrated that the synthesized AgNPs were spherical with diameters ranging from 8 to 14nm. In addition, the XRD analysis confirmed the nanocrystalline phase of silver with face-centered cubic (FCC) crystal structure. Energy dispersive spectroscopy (EDS) analysis of the AgNPs confirmed the presence of an elemental silver signal, and no peaks of any other impurities were detected. Additionally, the antibacterial activities of the neat hydrogel and AgNPs-hydrogel composites were measured by Kirby-Bauer method against urinary tract infection (UTI) pathogens. The rheology measurement revealed that the values of storage modulus (G') were higher than that of loss modulus (G″). The AgNPs-hydrogel composites exhibited higher antibacterial activity against Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Proteus vulgaris, Staphylococcus aureus and Proteus mirabilis compared to the corresponding neat hydrogel. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Airborne fungal spores of Alternaria, meteorological parameters and predicting variables

    Science.gov (United States)

    Filali Ben Sidel, Farah; Bouziane, Hassan; del Mar Trigo, Maria; El Haskouri, Fatima; Bardei, Fadoua; Redouane, Abdelbari; Kadiri, Mohamed; Riadi, Hassane; Kazzaz, Mohamed

    2015-03-01

    Alternaria is frequently found as airborne fungal spores and is recognized as an important cause of respiratory allergies. The aerobiological monitoring of fungal spores was performed using a Burkard volumetric spore traps. To establish predicting variables for daily and weakly spore counts, a stepwise multiple regression between spore concentrations and independent variables (meteorological parameters and lagged values from the series of spore concentrations: previous day or week concentration (Alt t - 1) and mean concentration of the same day or week in other years ( C mean)) was made with data obtained during 2009-2011. Alternaria conidia are present throughout the year in the atmosphere of Tetouan, although they show important seasonal fluctuations. The highest levels of Alternaria spores were recorded during the spring and summer or autumn. Alternaria showed maximum daily values in April, May or October depending on year. When the spore variables of Alternaria, namely C mean and Alt t - 1, and meteorological parameters were included in the equation, the resulting R 2 satisfactorily predict future concentrations for 55.5 to 81.6 % during the main spore season and the pre-peak 2. In the predictive model using weekly values, the adjusted R 2 varied from 0.655 to 0.676. The Wilcoxon test was used to compare the results from the expected values and the pre-peak spore data or weekly values for 2012, indicating that there were no significant differences between series compared. This test showed the C mean, Alt t - 1, frequency of the wind third quadrant, maximum wind speed and minimum relative humidity as the most efficient independent variables to forecast the overall trend of this spore in the air.

  12. Airborne fungal spores of Alternaria, meteorological parameters and predicting variables.

    Science.gov (United States)

    Filali Ben Sidel, Farah; Bouziane, Hassan; Del Mar Trigo, Maria; El Haskouri, Fatima; Bardei, Fadoua; Redouane, Abdelbari; Kadiri, Mohamed; Riadi, Hassane; Kazzaz, Mohamed

    2015-03-01

    Alternaria is frequently found as airborne fungal spores and is recognized as an important cause of respiratory allergies. The aerobiological monitoring of fungal spores was performed using a Burkard volumetric spore traps. To establish predicting variables for daily and weakly spore counts, a stepwise multiple regression between spore concentrations and independent variables (meteorological parameters and lagged values from the series of spore concentrations: previous day or week concentration (Alt t - 1) and mean concentration of the same day or week in other years (C mean)) was made with data obtained during 2009-2011. Alternaria conidia are present throughout the year in the atmosphere of Tetouan, although they show important seasonal fluctuations. The highest levels of Alternaria spores were recorded during the spring and summer or autumn. Alternaria showed maximum daily values in April, May or October depending on year. When the spore variables of Alternaria, namely C mean and Alt t - 1, and meteorological parameters were included in the equation, the resulting R (2) satisfactorily predict future concentrations for 55.5 to 81.6 % during the main spore season and the pre-peak 2. In the predictive model using weekly values, the adjusted R (2) varied from 0.655 to 0.676. The Wilcoxon test was used to compare the results from the expected values and the pre-peak spore data or weekly values for 2012, indicating that there were no significant differences between series compared. This test showed the C mean, Alt t - 1, frequency of the wind third quadrant, maximum wind speed and minimum relative humidity as the most efficient independent variables to forecast the overall trend of this spore in the air.

  13. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  14. Microfungal spores (Ustilago maydis and U. digitariae) immobilised chitosan microcapsules for heavy metal removal.

    Science.gov (United States)

    Sargın, İdris; Arslan, Gulsin; Kaya, Murat

    2016-03-15

    Designing effective chitosan-based biosorbents from unexploited biomass for heavy metal removal has received much attention over the past decade. Ustilago, loose smut, is a ubiquitous fungal plant pathogen infecting over 4000 species including maize and weed. This study aimed to establish whether the spores of the phytopathogenic microfungi Ustilago spores can be immobilised in cross-linked chitosan matrix, and it reports findings on heavy metal sorption performance of chitosan/Ustilago composite microcapsules. Immobilisation of Ustilago maydis and U. digitariae spores (from maize and weed) in chitosan microcapsules was achieved via glutaraldehyde cross-linking. The cross-linked microcapsules were characterised using scanning electron microscopy, FT-IR spectroscopy and thermogravimetric analysis. Sorption capacities of chitosan-U. maydis and chitosan-U. digitariae microcapsules were investigated and compared to cross-linked chitosan beads: Cu(II): 66.72, 69.26, 42.57; Cd(II): 49.46, 53.96, 7.87; Cr(III): 35.88, 49.40, 43.68; Ni(II): 41.67, 33.46, 16.43 and Zn(II): 30.73, 60.81, 15.04mg/g, respectively. Sorption experiments were conducted as a function of initial metal ion concentration (2-10mg/L), contact time (60-480min), temperature (25, 35 and 45°C), amount of the sorbent (0.05-0.25g) and pH of the metal solution. The microcapsules with spores exhibited better performance over the plain chitosan beads, demonstrating their potential use in water treatment. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Characterization of small-spored Alternaria from Argentinean crops through a polyphasic approach.

    Science.gov (United States)

    da Cruz Cabral, Lucía; Rodriguero, Marcela; Stenglein, Sebastián; Fog Nielsen, Kristian; Patriarca, Andrea

    2017-09-18

    Small-spored Alternaria have been isolated from a wide variety of food crops, causing both economic losses and human health risk due to the metabolites produced. Their taxonomy has been discussed widely, but no scientific consensus has been established in this field to date. Argentina is a major exporter of agricultural products, so it is essential to thoroughly understand the physiological behaviour of this pathogen in a food safety context. Thus, the objective of this work was to characterize small-spored Alternaria spp. obtained from tomato fruits, pepper fruits, wheat grains and blueberries from Argentina by a polyphasic approach involving metabolomic and phylogenetic analyses based on molecular and morphological characters. Morphological analysis divided the population studied into three groups; A. arborescens sp.-grp., A. tenuissima sp.-grp., and A. alternata sp.-grp. However, when these characters were simultaneously analysed with molecular data, no clearly separated groups were obtained. Haplotype network and phylogenetic analysis (both Bayesian and maximum parsimony) of a conserved region yielded the same result, suggesting that all isolates belong to the same species. Furthermore, no correlation could be established between morphological species-groups and a metabolite or group of metabolites synthesized. Thus, the whole set of analyses carried out in the present work supports the hypothesis that these small-spored Alternaria isolates from food belong to the same species. Identification at species level through classical morphology or modern molecular techniques does not seem to be a useful tool to predict toxicological risk in food matrices. The detection of any small-spored Alternaria from Section Alternaria (D.P. Lawr., Gannibal, Peever & B.M. Pryor 2013) in food implies a potential toxicological risk. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. In vitro propagation of Cyathea atrovirens (Cyatheaceae): spore storage and sterilization conditions.

    Science.gov (United States)

    Vargas, Isabel Beatriz de; Droste, Annette

    2014-03-01

    Cyathea atrovirens occurs in a wide range of habitats in Brazil, Paraguay, Uruguay and Argentina. In the Brazilian State of Rio Grande do Sul, this commonly found species is a target of intense exploitation, because of its ornamental characteristics. The in vitro culture is an important tool for propagation which may contribute toward the reduction of extractivism. However, exogenous contamination of spores is an obstacle for the success of aseptic long-term cultures. This study evaluated the influence of different sterilization methods combined with storage conditions on the contamination of the in vitro cultures and the gametophytic development of C. atrovirens, in order to establish an efficient propagation protocol. Spores were obtained from plants collected in Novo Hamburgo, State of Rio Grande do Sul, Brazil. In the first experiment, spores stored at 7 degrees C were surface sterilized with 0.5, 0.8 and 2% of sodium hypochlorite (NaClO) for 15 minutes and sown in Meyer's culture medium. The cultures were maintained in a growth room at 26 +/- 1 degrees C for a 12-h photoperiod and photon flux density of 100 micromol/m2/s provided by cool white fluorescent light. Contamination was assessed at 60 days, and gametophytic development was scored at 30, 60, 120 and 130 days of in vitro culture, analyzing 300 individuals for each treatment. There was no significant difference in culture contamination among the different sodium hypochlorite concentrations tested, and all treatments allowed for the development of cordiform gametophytes at 130 days of culture. In the second experiment, spores stored at 7 and -20 degrees C were divided into two groups. Half of the spores were surface sterilized with 2% of NaClO for 15 minutes and the other half was not sterilized. All spores were sown in Meyer's medium supplemented with one of the following antibiotics: nystatin, Micostatin and actidione. The culture conditions and the procedures used for evaluating contamination and

  17. A Gompertz regression model for fern spores germination

    Directory of Open Access Journals (Sweden)

    Gabriel y Galán, Jose María

    2015-06-01

    Full Text Available Germination is one of the most important biological processes for both seed and spore plants, also for fungi. At present, mathematical models of germination have been developed in fungi, bryophytes and several plant species. However, ferns are the only group whose germination has never been modelled. In this work we develop a regression model of the germination of fern spores. We have found that for Blechnum serrulatum, Blechnum yungense, Cheilanthes pilosa, Niphidium macbridei and Polypodium feuillei species the Gompertz growth model describe satisfactorily cumulative germination. An important result is that regression parameters are independent of fern species and the model is not affected by intraspecific variation. Our results show that the Gompertz curve represents a general germination model for all the non-green spore leptosporangiate ferns, including in the paper a discussion about the physiological and ecological meaning of the model.La germinación es uno de los procesos biológicos más relevantes tanto para las plantas con esporas, como para las plantas con semillas y los hongos. Hasta el momento, se han desarrollado modelos de germinación para hongos, briofitos y diversas especies de espermatófitos. Los helechos son el único grupo de plantas cuya germinación nunca ha sido modelizada. En este trabajo se desarrolla un modelo de regresión para explicar la germinación de las esporas de helechos. Observamos que para las especies Blechnum serrulatum, Blechnum yungense, Cheilanthes pilosa, Niphidium macbridei y Polypodium feuillei el modelo de crecimiento de Gompertz describe satisfactoriamente la germinación acumulativa. Un importante resultado es que los parámetros de la regresión son independientes de la especie y que el modelo no está afectado por variación intraespecífica. Por lo tanto, los resultados del trabajo muestran que la curva de Gompertz puede representar un modelo general para todos los helechos leptosporangiados

  18. Filtration of Pathogenic Parasites Using Surfactant-Modified Zeolites

    Science.gov (United States)

    Lehner, T.; Schulze-Makuch, D.; Bowman, R.

    2003-12-01

    Migration of pathogenic microorganisms, specifically Cryptosporidium parvum and Giardia lamblia, in groundwater due to sewage effluent and mismanaged wastewater has become an increased concern for human health in many regions. Cryptosporididosis and Giardiasis produces moderate to severe intestinal illness for many weeks and is a serious threat for immunodeficient persons. Previous studies by Schulze-Makuch et al. (2002) indicated that surfactant-modified zeolites (SMZ) removed all of the bacteria and most viruses in laboratory experiments. This study focuses on the efficiency of the SMZ to prevent migration of the protozoan spores in groundwater. Adsorption of the spores involves interactions between the surface properties of the spores and the SMZ. The efficiency of removal is tested simulating natural conditions. Laboratory experiments are conducted in a plexiglass model aquifer and pathogen removal is measured by taking water samples from strategically placed piezometers in the model. Since C. parvum and G. lamblia are hazardous to humans and move primarily in spore state through groundwater, polystyrene microspheres of similar sizes and Bacillus subtilis, a sporulating bacterium, are used as analogues for the protozoa. Preliminary results show a significant decrease in concentration of the B. subtilis spores down-gradient of the barrier.

  19. Determination of fungal spore release from wet building materials

    DEFF Research Database (Denmark)

    Kildesø, J.; Wurtz, H.; Nielsen, Kristian Fog

    2003-01-01

    The release and transport of fungal spores from water-damaged building materials is a key factor for understanding the exposure to particles of fungal origin as a possible cause of adverse health effects associated to growth of fungi indoors. In this study, the release of spores from nine species...

  20. Bacterial Spores in Food : Survival, Emergence, and Outgrowth

    NARCIS (Netherlands)

    Wells-Bennik, Marjon H J; Eijlander, Robyn T; den Besten, Heidy M W; Berendsen, Erwin M; Warda, Alicja K; Krawczyk, Antonina O; Nierop Groot, Masja N; Xiao, Yinghua; Zwietering, Marcel H; Kuipers, Oscar P; Abee, Tjakko

    2016-01-01

    Spore-forming bacteria are ubiquitous in nature. The resistance properties of bacterial spores lie at the heart of their widespread occurrence in food ingredients and foods. The efficacy of inactivation by food-processing conditions is largely determined by the characteristics of the different types

  1. The Role of the Electrostatic Force in Spore Adhesion

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Eunhyea [Georgia Institute of Technology; Yiacoumi, Sotira [Georgia Institute of Technology; Lee, Ida [University of Tennessee, Knoxville (UTK); Tsouris, Costas [ORNL

    2010-01-01

    Electrostatic force is investigated as one of the components of the adhesion force between Bacillus thuringiensis (Bt) spores and planar surfaces. The surface potentials of a Bt spore and a mica surface are experimentally obtained using a combined atomic force microscopy (AFM)-scanning surface potential microscopy technique. On the basis of experimental information, the surface charge density of the spores is estimated at 0.03 {micro}C/cm{sup 2} at 20% relative humidity and decreases with increasing humidity. The Coulombic force is introduced for the spore-mica system (both charged, nonconductive surfaces), and an electrostatic image force is introduced to the spore-gold system because gold is electrically conductive. The Coulombic force for spore-mica is repulsive because the components are similarly charged, while the image force for the spore-gold system is attractive. The magnitude of both forces decreases with increasing humidity. The electrostatic forces are added to other force components, e.g., van der Waals and capillary forces, to obtain the adhesion force for each system. The adhesion forces measured by AFM are compared to the estimated values. It is shown that the electrostatic (Coulombic and image) forces play a significant role in the adhesion force between spores and planar surfaces.

  2. Survival of Clostridium difficile spores at low water activity.

    Science.gov (United States)

    Deng, Kai; Talukdar, Prabhat K; Sarker, Mahfuzur R; Paredes-Sabja, Daniel; Torres, J Antonio

    2017-08-01

    Clostridium difficile is frequently found in meat and meat products. Germination efficiency, defined as colony formation, was previously investigated at temperatures found in meat handling and processing for spores of strain M120 (animal isolate), R20291 (human isolate), and DK1 (beef isolate). In this study, germination efficiency of these spore strains was assessed in phosphate buffered saline (PBS, a w ∼1.00), commercial beef jerky (a w ∼0.82/0.72), and a w -adjusted PBS (a w ∼0.82/0.72). Surface hydrophobicity was followed for spores stored in PBS. After three months and for all PBS a w levels tested, M120 and DK1 spores showed a ∼1 decimal reduction in colony formation but this was not the case when kept in beef jerky suggesting a protective food matrix effect. During storage, and with no significant a w effect, an increase in colony formation was observed for R20291 spores kept in PBS (∼2 decimal log increase) and beef jerky (∼1 decimal log increase) suggesting a loss of spore superdormancy. For all strains, no significant changes in spore surface hydrophobicity were observed after storage. Collectively, these results indicate that depending on the germination properties of C. difficile spores and the media properties, their germination efficiency may increase or decrease during long term food storage. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Germination of Bacillus cereus spores adhered to stainless steel

    NARCIS (Netherlands)

    Hornstra, L.M.; Leeuw, de P.P.L.A.; Moezelaar, R.; Wolbert, E.J.H.; Vries, de Y.P.; Vos, de W.M.; Abee, T.

    2007-01-01

    Adhered spores of Bacillus cereus represent a significant part of the surface-derived contamination in processing equipment used in the dairy industry. As germinated spores lose their resistance capacities instantaneously, efficient germination prior to a cleaning in place treatment could aid to the

  4. Inhibition of spore germination of Alternaria tenuis by sulfur dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Couey, H.M.

    1962-08-01

    As a part of a continuing study of SO/sub 2/ fumigation of table grapes, the effect of SO/sub 2/ on spores of an isolate of A. tenuis Auct. causing decay of table grapes was determined. The amount of SO/sub 2/ required to inhibit completely spore germination depended on availability of moisture and the temperature. At 20/sup 0/C, wet spores required 20-min exposure to 100 ppm SO/sub 2/ to prevent germination, but spores equilibrated at 90% relative humidity (RH) required 10-min exposure to 1000 ppm SO/sub 2/. Dry spores at 60% RH were unaffected by a 20-min exposure to 4000 ppm SO/sub 2/. Increasing the temperature in the range 5-20/sup 0/C increased effectiveness of the SO/sub 2/ treatment. A comparison of Alternaria with Botrytis cinerea Fr. (studied earlier) showed that wet spores of these organisms were about equally sensitive to SO/sub 2/, but that dry Alternaria spores were more resistant to SO/sub 2/ than dry Botrytis spores under comparable conditions.

  5. Live-imaging of Bacillus subtilis spore germination and outgrowth

    NARCIS (Netherlands)

    Pandey, R.

    2014-01-01

    Spores of Gram-positive bacteria such as Bacillus and Clostridium cause huge economic losses to the food industry. In food products, spores survive under food preservation conditions and subsequent germination and outgrowth eventually causes food spoilage. Therefore efforts are being made to

  6. Inactivation of Bacillus Anthracis Spores Using Carbon Nanotubes

    Science.gov (United States)

    2014-10-30

    effect of SWNTs in combination with antimicrobial chemicals on inactivation of B. anthracis spores; 4) the effect of CNTs coated surfaces on the...2010 31-May-2014 Approved for Public Release; Distribution Unlimited Final Report: (Life Science Division/ Biochemistry ) Inactivation of Bacillus... Biochemistry ) Inactivation of Bacillus Anthracis Spores Using Carbon Nanotubes Report Title The Specific Aims of the project were to investigate: 1) the

  7. Breaking the spores of Ganoderma lucidum by fermentation with ...

    African Journals Online (AJOL)

    In this paper, fermentation of G. lucidum with Lactobacillus plantarum was applied to break down the sporoderm. Scanning electron microscope (SEM) was used to characterize the spores. The broken spores were found on the 3rd day and complete breaking on the 5th day of fermentation. Lactic acid, acetic acid and ...

  8. Effect of Gamma Irradiation and Its Convergent Treatments on Lily Leaf Blight Pathogen, Botrytis elliptica, and the Disease Development

    Directory of Open Access Journals (Sweden)

    Ji-Hoon Kim

    2014-06-01

    Full Text Available Gamma irradiation and its convergence with nano-silver particles and sodium dichloroisocyanurate (NaDCC were investigated to inhibit germination and mycelial growth of Botrytis elliptica, the pathogen of lily leaf blight. In addition, the same treatments were studied on the process of disease development with detached leaf of lily cv. Siberia. Spray inoculation, which is closer to natural infection than wound inoculation, can be a way to investigate infection ability of the treated pathogen. The irradiating dose required to reduce the population by 90%, D10, was 526 Gy irradiating with 0-2000 Gy gamma ray on the conidial suspension as well as the growing mycelia. Even at 2000 Gy, the mycelium was not killed but just delayed its growth at 1–2 days behind. Convergent treatment with 40 mg/l of NaDCC just before 200 Gy gamma irradiation was the best way to decrease the conidial germination about 1/1000 times. The control values of gamma irradiation were 23% and 19.5% at wound inoculation and spray inoculation, respectively. On wound-inoculation, the control value of NaDCC only was 89%, and that of NaDCC convergent with 200 Gy gamma irradiation was 32%. On sprayinoculation, the highest control value was NaDCC at 50%, and that of NaDCC convergent with gamma irradiation was 24%.

  9. Presence survival spores of Bacillus thuringiensis varieties in grain warehouse

    Directory of Open Access Journals (Sweden)

    Sánchez-Yáñez Juan Manuel

    2016-08-01

    Full Text Available Genus Bacillus thuringiensis (Bt synthesized spores and crystals toxic to pest-insects in agriculture. Bt is comospolitan then possible to isolate some subspecies or varieties from warehouse. The aims of study were: i to isolate Bt varieties from grain at werehouse ii to evaluate Bt toxicity on Spodoptera frugiperda and Shit-ophilus zeamaisese iii to analyze Bt spores persistence in Zea mays grains at werehouse compared to same Bt on grains exposed to sun radiation. Results showed that at werehouse were recovered more than one variety of Bt spores. According to each isolate Bt1 o Bt2 were toxic to S. frugiperda or S. zeamaisese. One those Bt belong to var morrisoni. At werehouse these spores on Z. mays grains surviving more time, while the same spores exposed to boicide sun radiation they died.

  10. Custom database development and biomarker discovery methods for MALDI-TOF mass spectrometry-based identification of high-consequence bacterial pathogens.

    Science.gov (United States)

    Tracz, Dobryan M; Tyler, Andrea D; Cunningham, Ian; Antonation, Kym S; Corbett, Cindi R

    2017-03-01

    A high-quality custom database of MALDI-TOF mass spectral profiles was developed with the goal of improving clinical diagnostic identification of high-consequence bacterial pathogens. A biomarker discovery method is presented for identifying and evaluating MALDI-TOF MS spectra to potentially differentiate biothreat bacteria from less-pathogenic near-neighbour species. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  11. Reduced spore germination explains sensitivity of reef-building algae to climate change stressors.

    Directory of Open Access Journals (Sweden)

    Alexandra Ordoñez

    Full Text Available Reduced seawater pH and changes in carbonate chemistry associated with ocean acidification (OA decrease the recruitment of crustose coralline algae (CCAcf., an important coral-reef builder. However, it is unclear whether the observed decline in recruitment is driven by impairment of spore germination, or post-settlement processes (e.g. space competition. To address this, we conducted an experiment using a dominant CCA, Porolithon cf. onkodes to test the independent and combined effects of OA, warming, and irradiance on its germination success and early development. Elevated CO2 negatively affected several processes of spore germination, including formation of the germination disc, initial growth, and germling survival. The magnitude of these effects varied depending on the levels of temperature and irradiance. For example, the combination of high CO2 and high temperature reduced formation of the germination disc, but this effect was independent of irradiance levels, while spore abnormalities increased under high CO2 and high temperature particularly in combination with low irradiance intensity. This study demonstrates that spore germination of CCA is impacted by the independent and interactive effects of OA, increasing seawater temperature and irradiance intensity. For the first time, this provides a mechanism for how the sensitivity of critical early life history processes to global change may drive declines of adult populations of key marine calcifiers.

  12. Mucosal vaccine delivery by non-recombinant spores of Bacillus subtilis.

    Science.gov (United States)

    Ricca, Ezio; Baccigalupi, Loredana; Cangiano, Giuseppina; De Felice, Maurilio; Isticato, Rachele

    2014-08-12

    Development of mucosal vaccines strongly relies on an efficient delivery system and, over the years, a variety of approaches based on phages, bacteria or synthetic nanoparticles have been proposed to display and deliver antigens. The spore of Bacillus subtilis displaying heterologous antigens has also been considered as a mucosal vaccine vehicle, and shown able to conjugate some advantages of live microrganisms with some of synthetic nanoparticles. Here we review the use of non-recombinant spores of B. subtilis as a delivery system for mucosal immunizations. The non-recombinant display is based on the adsorption of heterologous molecules on the spore surface without the need of genetic manipulations, thus avoiding all concerns about the use and environmental release of genetically modified microorganisms. In addition, adsorbed molecules are stabilized and protected by the interaction with the spore, suggesting that this system could reduce the rapid degradation of the antigen, often observed with other delivery systems and identified as a major drawback of mucosal vaccines.

  13. In Vitro Inactivation of Kudoa septempunctata Spores Infecting the Muscle of Olive Flounder Paralichthys olivaceus.

    Science.gov (United States)

    Yokoyama, Hiroshi; Funaguma, Naoko; Kobayashi, Shoko

    2016-01-01

    Kudoa septempunctata, a myxosporean parasite infecting the trunk muscles of olive flounder (Paralichthys olivaceus), has been recently reported to be the causative agent of a type of food poisoning in humans. Patients exhibited acute diarrhea and vomiting after ingestion of the raw flesh of infected flounder. A recent increase in the number of food-poisoning cases has prompted us to develop a control strategy of this parasite. In this study, we evaluated the efficacy of several temperature and chemical treatments for inactivating K. septempunctata spores in vitro using the vital staining assay with the fluorescent dyes Hoechst 33342 and propidium iodide (PI). Screening tests of treatment methods against K. septempunctata suggested that 25% ethanol for 5 min, 80°C for 10 s, limonene at 10 μL/mL for 5 min, and salinities at 0‰ and 160‰ for 5 min were effective for killing spores. To verify toxicity loss in K. septempunctata spores after the treatments, tight junction barrier integrity assays with Caco-2 cells were conducted. The results of the Caco-2 assays corresponded well with those of the Hoechst 33342-PI staining assay. Further studies are required to determine a practical treatment procedure for inactivating spores considering the treatment application in the production process of cultured olive flounder.

  14. Weather Conditions Associated with the Release and Dispersal of Zymoseptoria tritici Spores in the Argentine Pampas Region

    Directory of Open Access Journals (Sweden)

    C. A. Cordo

    2017-01-01

    Full Text Available The abundance of Zymoseptoria tritici ascospores and conidia in a field was examined throughout two one-year periods (1998-1999 and 1999-2000 establishing the relationship between spore release and weather variables. Radiation, temperature, intensity of rainfall, and relative humidity significantly affected the dispersal of ascospores and pycnidiospores of this pathogen. Spore traps collected both types of spores, at weekly intervals, at two different stages of the wheat crop (vegetative and wheat stubble stages and different distances from the sources. Ascospores were the predominant sources of inoculum in the field. The numbers of ascospores and pycnidiospores declined with the increase of distance from the sources. The release of pycnidiospores was associated with the increase in rainfall intensity 7 days before the released event and the increase in radiation 60 days before the same event. Relative humidity 3 and 15 days before the release event was positively correlated with ascospores release and negatively correlated with radiation and temperature in all the sampling interval. Also for the first time, a positive correlation between radiation and pycnidiospores dispersal is reported. Understanding the relationship between environment conditions and spores dispersal event could improve the control strategies of the disease.

  15. Biosynthesis of silver nanoparticles by Bacillus stratosphericus spores and the role of dipicolinic acid in this process.

    Science.gov (United States)

    Hosseini-Abari, Afrouzossadat; Emtiazi, Giti; Lee, Sang-Hyuk; Kim, Byung-Gee; Kim, June-Hyung

    2014-09-01

    Seeking for simple, rapid, and environmental-friendly routes to produce metal nanoparticles is quite attractive for various biotechnological applications. Biological synthesis method of silver nanoparticles has been found very promising due to their non-toxicity and simplicity. Here, the spores of Bacillus stratosphericus isolated from soil enriched with 30 % H2O2 were used for the production of silver nanoparticles. Furthermore, the possible mechanism of silver nanoparticle synthesis by the spores was elucidated for the first time. In this regard, dipicolinic acid (DPA) was shown to play a critical role as a nanoparticle-producing agent. UV-Vis absorption spectroscopy, X-ray diffraction technique, energy-dispersive spectroscopy, and transmission electron microscopy were used to characterize the nanoparticles. Unlike vegetative cells of B. stratosphericus, the spores and the purified DPA were capable of producing nanoparticles from silver nitrate (AgNO3). These biogenic nanoparticles, which were highly toxic against different pathogenic bacteria, showed mixed structures including spherical, triangular, cubic, and hexagonal with the approximate size between 2 and 20 nm in diameter. Our results illustrated the role of dipicolinic acid as a main factor for the synthesis of nanoparticles by the bacterial spores.

  16. Seasonal Trends in Airborne Fungal Spores in Coastal California Ecosystems

    Science.gov (United States)

    Morfin, J.; Crandall, S. G.; Gilbert, G. S.

    2014-12-01

    Airborne fungal spores cause disease in plants and animals and may trigger respiratory illnesses in humans. In terrestrial systems, fungal sporulation, germination, and persistence are strongly regulated by local meteorological conditions. However, few studies investigate how microclimate affects the spatio-temporal dynamics of airborne spores. We measured fungal aerospora abundance and microclimate at varying spatial and time scales in coastal California in three habitat-types: coast redwood forest, mixed-evergreen forest, and maritime chaparral. We asked: 1) is there a difference in total airborne spore concentration between habitats, 2) when do we see peak spore counts, and 3) do spore densities correlate with microclimate conditions? Fungal spores were caught from the air with a volumetric vacuum air spore trap during the wet season (January - March) in 2013 and 2014, as well as monthly in 2014. Initial results suggest that mixed-evergreen forests exhibit the highest amounts of spore abundance in both years compared to the other habitats. This may be due to either a higher diversity of host plants in mixed-evergreen forests or a rich leaf litter layer that may harbor a greater abundance of saprotrophic fungi. Based on pilot data, we predict that temperature and to a lesser degree, relative humidity, will be important microclimate predictors for high spore densities. These data are important for understanding when and under what weather conditions we can expect to see high levels of fungal spores in the air; this can be useful information for managers who are interested in treating diseased plants with fungicides.

  17. Decontamination Options for Drinking Water Contaminated with Bacillus anthracis Spores

    Energy Technology Data Exchange (ETDEWEB)

    Raber, E; Burklund, A

    2010-02-16

    Five parameters were evaluated with surrogates of Bacillus anthracis spores to determine effective decontamination options for use in a contaminated drinking water supply. The parameters were: (1) type of Bacillus spore surrogate (B. thuringiensis or B. atrophaeus); (2) spore concentration in suspension (10{sup 2} to 10{sup 6} spores/ml); (3) chemical characteristics of decontaminant [sodium dicholor-s-triazinetrione dihydrate (Dichlor), hydrogen peroxide, potassium peroxymonosulfate (Oxone), sodium hypochlorite, and VirkonS{reg_sign}]; (4) decontaminant concentration (0.01% to 5%); and (5) decontaminant exposure time (10 min to 24 hr). Results from 162 suspension tests with appropriate controls are reported. Hydrogen peroxide at a concentration of 5%, and Dichlor and sodium hypochlorite at a concentration of 2%, were effective at spore inactivation regardless of spore type tested, spore exposure time, or spore concentration evaluated. This is the first reported study of Dichlor as an effective decontaminant for B. anthracis spore surrogates. Dichlor's desirable characteristics of high oxidation potential, high level of free chlorine, and more neutral pH than that of other oxidizers evaluated appear to make it an excellent alternative. All three oxidizers were effective against B. atrophaeus spores in meeting EPA's biocide standard of greater than a 6 log kill after a 10-minute exposure time and at lower concentrations than typically reported for biocide use. Solutions of 5% VirkonS{reg_sign} and Oxone were less effective decontaminants than other options evaluated in this study and did not meet the EPA's efficacy standard for biocides. Differences in methods and procedures reported by other investigators make quantitative comparisons among studies difficult.

  18. Disinfection and regrowth potential of bacillus subtilis spores by ozone, ultraviolet rays and gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hae Yeon; Lee, O Mi; Kim, Tae Hun; Lee, Myun Joo; Yu, Seung Ho [Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2009-06-15

    Chlorination has been the most commonly adopted disinfection process for the treatment of drinking water. However, Cryptosporidium parvum oocysts and Giardia lamblia cysts were not treated effectively by the common chlorine-based disinfectants. Additionally the regrowth of pathogenic microorganisms is associated with hygienic and aesthetic problems for the consumers of drinking water. Study on alternative disinfection processes such as ozone, UV-C, VUV and gamma irradiation were conducted. Bacillus subtilis spores have been used as a surrogate microorganism for Cryptosporidium parvum oocysts and Giardia lamblia cyst. Inactivation efficiency by ozone was from 30% to 96% within the range of 5 min to 120 min exposures. Inactivation efficiencies by UV-C and VUV were 95.18%, 95.07% at 30 sec, respectively. Inactivation efficiency at gamma irradiation dose of 2 kGy was 99.4%. Microbial regrowths after ozone, UV-C, VUV and gamma irradiation disinfections were also evaluated for 4 days. Bacillus subtilis spores after ozone treatment for 120 min exposure at the rate of 1.68 mg {center_dot} min{sup -1} showed 96.02% disinfection efficiency and significant microbial regrowth. Bacillus subtilis spores after UV-C (99.25% disinfection efficiency) and VUV (99.67% disinfection efficiency) treatments for 5 min showed gradual regrowth. However, inactivation efficiency of gamma irradiation at dose of 1 kGy was 98.8% and the disinfected sample showed no microbial regrowth for 4 days. Therefore, gamma irradiation is the most effective process for the disinfection of pathogenic microorganisms such as oocysts of protozoan parasites among four disinfection process.

  19. Development of a greenhouse-based inoculation protocol for the fungus Colletotrichum cereale pathogenic to annual bluegrass (Poa annua

    Directory of Open Access Journals (Sweden)

    Lisa A. Beirn

    2015-08-01

    Full Text Available The fungus Colletotrichum cereale incites anthracnose disease on Poa annua (annual bluegrass turfgrass. Anthracnose disease is geographically widespread throughout the world and highly destructive to cool-season turfgrasses, with infections by C. cereale resulting in extensive turf loss. Comprehensive research aimed at controlling turfgrass anthracnose has been performed in the field, but knowledge of the causal organism and its basic biology is still needed. In particular, the lack of a reliable greenhouse-based inoculation protocol performed under controlled environmental conditions is an obstacle to the study of C. cereale and anthracnose disease. Our objective was to develop a consistent and reproducible inoculation protocol for the two major genetic lineages of C. cereale. By adapting previously successful field-based protocols and combining with components of existing inoculation procedures, the method we developed consistently produced C. cereale infection on two susceptible P. annua biotypes. Approximately 7 to 10 days post-inoculation, plants exhibited chlorosis and thinning consistent with anthracnose disease symptomology. Morphological inspection of inoculated plants revealed visual signs of the fungus (appressoria and acervuli, although acervuli were not always present. After stringent surface sterilization of inoculated host tissue, C. cereale was consistently re-isolated from symptomatic tissue. Real-time PCR detection analysis based on the Apn2 marker confirmed the presence of the pathogen in host tissue, with both lineages of C. cereale detected from all inoculated plants. When a humidifier was not used, no infection developed for any biotypes or fungal isolates tested. The inoculation protocol described here marks significant progress for in planta studies of C. cereale, and will enable scientifically reproducible investigations of the biology, infectivity and lifestyle of this important grass pathogen.

  20. A nonnative and a native fungal plant pathogen similarly stimulate ectomycorrhizal development but are perceived differently by a fungal symbiont.

    Science.gov (United States)

    Zampieri, Elisa; Giordano, Luana; Lione, Guglielmo; Vizzini, Alfredo; Sillo, Fabiano; Balestrini, Raffaella; Gonthier, Paolo

    2017-03-01

    The effects of plant symbionts on host defence responses against pathogens have been extensively documented, but little is known about the impact of pathogens on the symbiosis and if such an impact may differ for nonnative and native pathogens. Here, this issue was addressed in a study of the model system comprising Pinus pinea, its ectomycorrhizal symbiont Tuber borchii, and the nonnative and native pathogens Heterobasidion irregulare and Heterobasidion annosum, respectively. In a 6-month inoculation experiment and using both in planta and gene expression analyses, we tested the hypothesis that H. irregulare has greater effects on the symbiosis than H. annosum. Although the two pathogens induced the same morphological reaction in the plant-symbiont complex, with mycorrhizal density increasing exponentially with pathogen colonization of the host, the number of target genes regulated in T. borchii in plants inoculated with the native pathogen (i.e. 67% of tested genes) was more than twice that in plants inoculated with the nonnative pathogen (i.e. 27% of genes). Although the two fungal pathogens did not differentially affect the amount of ectomycorrhizas, the fungal symbiont perceived their presence differently. The results may suggest that the symbiont has the ability to recognize a self/native and a nonself/nonnative pathogen, probably through host plant-mediated signal transduction. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  1. The Rho-activating CNF1 toxin from pathogenic E. coli: A risk factor for human cancer development?

    Directory of Open Access Journals (Sweden)

    Fiorentini Carla

    2008-03-01

    Full Text Available Abstract Nowadays, there is increasing evidence that some pathogenic bacteria can contribute to specific stages of cancer development. The concept that bacterial infection could be involved in carcinogenesis acquired a widespread interest with the discovery that H. pylori is able to establish chronic infections in the stomach and that this infection is associated with an increased risk of gastric adenocarcinoma and mucosa associated lymphoid tissue lymphoma. Chronic infections triggered by bacteria can facilitate tumor initiation or progression since, during the course of infection, normal cell functions can come under the control of pathogen factors that directly manipulate the host regulatory pathways and the inflammatory reactions. Renowned publications have recently corroborated the molecular mechanisms that link bacterial infections, inflammation and cancer, indicating certain strains of Escherichia coli as a risk factor for patients with colon cancer. E. coli is a normal inhabitant of the human intestine that becomes highly pathogenic following the acquisition of virulence factors, including a protein toxin named cytotoxic necrotizing factor 1 (CNF1. This toxin permanently activates the small GTP-binding proteins belonging to the Rho family, thus promoting a prominent polymerization of the actin cytoskeleton as well as a number of cellular responses, including changes in protein expression and functional modification of the cell physiology. CNF1 is receiving an increasing attention as a putative factor involved in transformation because of its ability to: (i induce COX2 expression, an immediate-early gene over-expressed in some type of cancers; (ii induce a long-lasting activation of the transcription factor NF-kB, a largely accepted marker of tumor cells; (iii protect epithelial cells from apoptosis; (iv ensue the release of pro-inflammatory cytokines in epithelial and endothelial cells; and (v promote cellular motility. As cancer may

  2. Development of a Commercial Prototype of the Autonomous Pathogen Detection System Final Report CRADA No. TC-02077-04

    Energy Technology Data Exchange (ETDEWEB)

    Dzenitis, J. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Haigh, P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2017-09-27

    This was a collaborative effort between The Regents of the University of California, Lawrence Livermore National Laboratory (LLNL), and GE Ion Track, Inc. (GEIT) to develop a commercial prototype of the Autonomous Pathogen Detection System (APDS), an instrument that monitors the air for all three biological threat agents (bacteria, viruses and toxins). This was originally a one year CRADA project, with the cost of the work at LLNL being funded by the Department of Homeland Security's Office of National Laboratories. The original project consisted of five major tasks and deliverables. The CRADA was then amended, converting the CRADA from a programmatically funded CRADA to a funds-in CRADA, extending the project for an additional 14 months, and adding four new tasks and deliverable to the project.

  3. Germination Requirements of Bacillus macerans Spores

    Science.gov (United States)

    Sacks, L. E.; Thompson, P. A.

    1971-01-01

    2-Phenylacetamide is an effective germinant for spores of five strains of Bacillus macerans, particularly in the presence of fructose. Benzyl penicillin, the phenyl acetamide derivative of penicillin, and phenylacetic acid are also good germinants. l-Asparagine is an excellent germinant for four strains. α-Amino-butyric acid is moderately effective. Pyridoxine, pyridoxal, adenine, and 2,6-diaminopurine are potent germinants for NCA strain 7X1 only. d-Glucose is a powerful germinant for strain B-70 only. d-Fructose and d-ribose strongly potentiate germination induced by other germinants (except l-asparagine) but have only weak activity by themselves. Niacinamide and nicotinamide-adenine dinucleotide, inactive by themselves, are active in the presence of fructose or ribose. Effects of pH, ion concentration, and temperature are described. PMID:4251279

  4. Development of electrochemical biosensor for detection of pathogenic microorganism in Asian dust events.

    Science.gov (United States)

    Yoo, Min-Sang; Shin, Minguk; Kim, Younghun; Jang, Min; Choi, Yoon-E; Park, Si Jae; Choi, Jonghoon; Lee, Jinyoung; Park, Chulhwan

    2017-05-01

    We developed a single-walled carbon nanotubes (SWCNTs)-based electrochemical biosensor for the detection of Bacillus subtilis, one of the microorganisms observed in Asian dust events, which causes respiratory diseases such as asthma and pneumonia. SWCNTs plays the role of a transducer in biological antigen/antibody reaction for the electrical signal while 1-pyrenebutanoic acid succinimidyl ester (1-PBSE) and ant-B. subtilis were performed as a chemical linker and an acceptor, respectively, for the adhesion of target microorganism in the developed biosensor. The detection range (10 2 -10 10  CFU/mL) and the detection limit (10 2  CFU/mL) of the developed biosensor were identified while the response time was 10 min. The amount of target B. subtilis was the highest in the specificity test of the developed biosensor, compared with the other tested microorganisms (Staphylococcus aureus, Flavobacterium psychrolimnae, and Aquabacterium commune). In addition, target B. subtilis detected by the developed biosensor was observed by scanning electron microscope (SEM) analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Using Spores for Fusarium spp. Classification by MALDI-Based Intact Cell/Spore Mass Spectrometry

    Directory of Open Access Journals (Sweden)

    Wolfgang Winkler

    2012-01-01

    Full Text Available Fusarium is a widespread genus of filamentous fungi and a member of the soil microbial community. Certain subspecies are health threatening because of their mycotoxin production that affects the human and animal food chain. Thus, for early and effective pest control, species identification is of particular interest; however, differentiation on the subspecies level is challenging and time-consuming for this fungus. In the present study, we show the possibilities of intact cell mass spectrometry for spore analysis of 22 different Fusarium strains belonging to six Fusarium subspecies. We found that species differentiation is possible if mass spectrometric analyses are performed under well-defined conditions with fixed parameters. A critical point for analysis is a proper sample preparation of spores, which increases the quality of mass spectra with respect to signal intensity and m/z value variations. It was concluded that data acquistion has to be performed automatically; otherwise, user-specific variations are introduced generating data which cannot fit the existing datasets. Data that show clearly that matrix-assisted laser desorption ionization-based intact cell/intact spore mass spectrometry (IC/ISMS can be applied to differentiate closely related Fusarium spp. are presented. Results show a potential to build a database on Fusarium species for accurate species identification, for fast response in the case of infections in the cornfield. We furthermore demonstrate the high precision of our approach in classification of intact Fusarium species according to the location of their collection.

  6. Inactivation of certain insect pathogens by ultraviolet radiation

    International Nuclear Information System (INIS)

    Krieg, A.; Groener, A.; Huber, J.; Zimmermann, G.

    1981-01-01

    The UV-sensitivity of two baculoviruses (granulosis virus, nuclear polyhedrosis virus) and two entomopathogenic microorganisms (Bacillus thuringiensis, Beauveria bassiana) was determined by radiation tests. In the far UV (254 nm) the stability, measured at an inactivation rate of 99%, was in declining order: nuclear polyhedra >= conidia of B. bassiana > granula > spores of B. thuringiensis >= vegetative cells of B. thuringiensis. In the near UV (285-380 nm) the following order could be found: conidia of B. bassiana >= nuclear polyhedra > spores of B. thuringiensis >= granula > vegetative cells of B. thuringiensis. Far UV had a much higher germicidal effect for all pathogens tested than near UV. (orig.) [de

  7. Development and Deployment of Systems-Based Approaches for the Management of Soilborne Plant Pathogens.

    Science.gov (United States)

    Chellemi, D O; Gamliel, A; Katan, J; Subbarao, K V

    2016-03-01

    Biological suppression of soilborne diseases with minimal use of outside interventive actions has been difficult to achieve in high input conventional crop production systems due to the inherent risk of pest resurgence. This review examines previous approaches to the management of soilborne disease as precursors to the evolution of a systems-based approach, in which plant disease suppression through natural biological feedback mechanisms in soil is incorporated into the design and operation of cropping systems. Two case studies are provided as examples in which a systems-based approach is being developed and deployed in the production of high value crops: lettuce/strawberry production in the coastal valleys of central California (United States) and sweet basil and other herb crop production in Israel. Considerations for developing and deploying system-based approaches are discussed and operational frameworks and metrics to guide their development are presented with the goal of offering a credible alternative to conventional approaches to soilborne disease management.

  8. Evaluating Composite Sampling Methods of Bacillus spores at Low Concentrations

    Energy Technology Data Exchange (ETDEWEB)

    Hess, Becky M.; Amidan, Brett G.; Anderson, Kevin K.; Hutchison, Janine R.

    2016-10-13

    Restoring facility operations after the 2001 Amerithrax attacks took over three months to complete, highlighting the need to reduce remediation time. The most time intensive tasks were environmental sampling and sample analyses. Composite sampling allows disparate samples to be combined, with only a single analysis needed, making it a promising method to reduce response times. We developed a statistical experimental design to test three different composite sampling methods: 1) single medium single pass composite: a single cellulose sponge samples multiple coupons; 2) single medium multi-pass composite: a single cellulose sponge is used to sample multiple coupons; and 3) multi-medium post-sample composite: a single cellulose sponge samples a single surface, and then multiple sponges are combined during sample extraction. Five spore concentrations of Bacillus atrophaeus Nakamura spores were tested; concentrations ranged from 5 to 100 CFU/coupon (0.00775 to 0.155CFU/cm2, respectively). Study variables included four clean surface materials (stainless steel, vinyl tile, ceramic tile, and painted wallboard) and three grime coated/dirty materials (stainless steel, vinyl tile, and ceramic tile). Analysis of variance for the clean study showed two significant factors: composite method (p-value < 0.0001) and coupon material (p-value = 0.0008). Recovery efficiency (RE) was higher overall using the post-sample composite (PSC) method compared to single medium composite from both clean and grime coated materials. RE with the PSC method for concentrations tested (10 to 100 CFU/coupon) was similar for ceramic tile, painted wall board, and stainless steel for clean materials. RE was lowest for vinyl tile with both composite methods. Statistical tests for the dirty study showed RE was significantly higher for vinyl and stainless steel materials, but significantly lower for ceramic tile. These results suggest post-sample compositing can be used to reduce sample analysis time when

  9. Prevalence, intensity and complications of Microsporidium spores amongst HIV-positive hospital patients in Ilorin, Nigeria

    Directory of Open Access Journals (Sweden)

    Amase Nyamngee

    2013-11-01

    Full Text Available Background: Microsporidiasis, which is of great concern for immunocompromised patients, is poorly studied in developing countries. Objectives: A study was carried out amongst HIV-positive hospital patients and HIV-negative hospital controls in Ilorin, Nigeria, between January 2009 and July 2010 to determine the prevalence and intensity of Microsporidium spores and the complications associated with their presence. Method: Stool samples from 750 HIV-positive patients and 375 HIV-negative patients were studied using the Chromotrope-2R staining technique. Determination of CD4+ count was performed on the Partec Cyflow SL-3 CD4/8 instrument. Intensity of spores was determined by counting the total number of the spores in a 10 μl stained smear of stool. Images were captured with Phenix Microimage Analysis Software and data obtained were analysed using the Statistical Package for the Social Sciences. Results: The prevalence of Microsporidium isolates amongst the HIV-positive hospital patients was significantly higher (42.4% than amongst the HIV-negative controls (19.2%(p < 0.05. The intensity of microsporidial spores amongst HIV-positive hospital patients was also significantly higher than amongst the controls (p < 0.05. However, the difference in the intensity of spores amongst HIV-positive patients who were on antiretroviral therapy(n = 411 and those who were not (n = 339 was not significant (p = 0.236. Microsporidiasis in HIV infection infection was common amongst patients with with low CD4+ counts, diarrhoea, body rashes and cough. Conclusion: Both the prevalence and intensity of Microsporidiasis are high amongst HIV-positive hospital patients; campaigns to promote awareness, prevention and control are required. Laboratory testing for microsporidia in HIV patients should be performed routinely so as to identify the organism for prompt medical attention.

  10. Water Behavior in Bacterial Spores by Deuterium NMR Spectroscopy

    Science.gov (United States)

    2015-01-01

    Dormant bacterial spores are able to survive long periods of time without nutrients, withstand harsh environmental conditions, and germinate into metabolically active bacteria when conditions are favorable. Numerous factors influence this hardiness, including the spore structure and the presence of compounds to protect DNA from damage. It is known that the water content of the spore core plays a role in resistance to degradation, but the exact state of water inside the core is a subject of discussion. Two main theories present themselves: either the water in the spore core is mostly immobile and the core and its components are in a glassy state, or the core is a gel with mobile water around components which themselves have limited mobility. Using deuterium solid-state NMR experiments, we examine the nature of the water in the spore core. Our data show the presence of unbound water, bound water, and deuterated biomolecules that also contain labile deuterons. Deuterium–hydrogen exchange experiments show that most of these deuterons are inaccessible by external water. We believe that these unreachable deuterons are in a chemical bonding state that prevents exchange. Variable-temperature NMR results suggest that the spore core is more rigid than would be expected for a gel-like state. However, our rigid core interpretation may only apply to dried spores whereas a gel core may exist in aqueous suspension. Nonetheless, the gel core, if present, is inaccessible to external water. PMID:24950158

  11. Water behavior in bacterial spores by deuterium NMR spectroscopy.

    Science.gov (United States)

    Friedline, Anthony W; Zachariah, Malcolm M; Johnson, Karen; Thomas, Kieth J; Middaugh, Amy N; Garimella, Ravindranath; Powell, Douglas R; Vaishampayan, Parag A; Rice, Charles V

    2014-07-31

    Dormant bacterial spores are able to survive long periods of time without nutrients, withstand harsh environmental conditions, and germinate into metabolically active bacteria when conditions are favorable. Numerous factors influence this hardiness, including the spore structure and the presence of compounds to protect DNA from damage. It is known that the water content of the spore core plays a role in resistance to degradation, but the exact state of water inside the core is a subject of discussion. Two main theories present themselves: either the water in the spore core is mostly immobile and the core and its components are in a glassy state, or the core is a gel with mobile water around components which themselves have limited mobility. Using deuterium solid-state NMR experiments, we examine the nature of the water in the spore core. Our data show the presence of unbound water, bound water, and deuterated biomolecules that also contain labile deuterons. Deuterium-hydrogen exchange experiments show that most of these deuterons are inaccessible by external water. We believe that these unreachable deuterons are in a chemical bonding state that prevents exchange. Variable-temperature NMR results suggest that the spore core is more rigid than would be expected for a gel-like state. However, our rigid core interpretation may only apply to dried spores whereas a gel core may exist in aqueous suspension. Nonetheless, the gel core, if present, is inaccessible to external water.

  12. Infrared signatures to discriminate viability of autoclaved Bacillus spores

    Science.gov (United States)

    Schneider, Matthew D. W.; Valentine, Nancy B.; Johnson, Timothy J.

    2011-11-01

    Optical methods can offer good sensitivity for detecting small amounts of chemicals and biologicals, and as these methods mature, are some of the few techniques that can offer true standoff detection. For detection of biological species, determining the viability is clearly important: Certain species of gram-positive bacteria are capable of forming endospores, specialized structures that arise when living conditions become unfavorable or little growth medium is available. Spores are also resistant to many chemicals as well as changes in heat or pH; such spores can remain dormant from months to years until more favorable conditions arise, resulting in germination back to the vegetative state. This persistence characteristic of bacterial spores allows for contamination of a surface (e.g. food or medical equipment) even after the surface has been nominally cleaned. Bacterial spores have also been used as biological weapons, as in the case of B. anthracis. Thus, having rapid analytical methods to determine a spore's viability after attempts to clean a given environment is crucial. The increasing availability of portable spectrometers may provide a key to such rapid onsite analysis. The present study was designed to determine whether infrared spectroscopy may be used to differentiate between viable vs. dead B. subtilis and B. atrophaeus spores. Preliminary results show that the reproducible differences in the IR signatures can be used to identify the viable vs. the autoclaved (dead) spores.

  13. Two Rab5 Homologs Are Essential for the Development and Pathogenicity of the Rice Blast Fungus Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Cheng D. Yang

    2017-05-01

    Full Text Available The rice blast fungus, Magnaporthe oryzae, infects many economically important cereal crops, particularly rice. It has emerged as an important model organism for studying the growth, development, and pathogenesis of filamentous fungi. RabGTPases are important molecular switches in regulation of intracellular membrane trafficking in all eukaryotes. MoRab5A and MoRab5B are Rab5 homologs in M. oryzae, but their functions in the fungal development and pathogenicity are unknown. In this study, we have employed a genetic approach and demonstrated that both MoRab5A and MoRab5B are crucial for vegetative growth and development, conidiogenesis, melanin synthesis, vacuole fusion, endocytosis, sexual reproduction, and plant pathogenesis in M. oryzae. Moreover, both MoRab5A and MoRab5B show similar localization in hyphae and conidia. To further investigate possible functional redundancy between MoRab5A and MoRab5B, we overexpressed MoRAB5A and MoRAB5B, respectively, in MoRab5B:RNAi and MoRab5A:RNAi strains, but neither could rescue each other’s defects caused by the RNAi. Taken together, we conclude that both MoRab5A and MoRab5B are necessary for the development and pathogenesis of the rice blast fungus, while they may function independently.

  14. The Steroid Catabolic Pathway of the Intracellular Pathogen Rhodococcus equi Is Important for Pathogenesis and a Target for Vaccine Development

    Science.gov (United States)

    van der Geize, R.; Grommen, A. W. F.; Hessels, G. I.; Jacobs, A. A. C.; Dijkhuizen, L.

    2011-01-01

    Rhodococcus equi causes fatal pyogranulomatous pneumonia in foals and immunocompromised animals and humans. Despite its importance, there is currently no effective vaccine against the disease. The actinobacteria R. equi and the human pathogen Mycobacterium tuberculosis are related, and both cause pulmonary diseases. Recently, we have shown that essential steps in the cholesterol catabolic pathway are involved in the pathogenicity of M. tuberculosis. Bioinformatic analysis revealed the presence of a similar cholesterol catabolic gene cluster in R. equi. Orthologs of predicted M. tuberculosis virulence genes located within this cluster, i.e. ipdA (rv3551), ipdB (rv3552), fadA6 and fadE30, were identified in R. equi RE1 and inactivated. The ipdA and ipdB genes of R. equi RE1 appear to constitute the α-subunit and β-subunit, respectively, of a heterodimeric coenzyme A transferase. Mutant strains RE1ΔipdAB and RE1ΔfadE30, but not RE1ΔfadA6, were impaired in growth on the steroid catabolic pathway intermediates 4-androstene-3,17-dione (AD) and 3aα-H-4α(3′-propionic acid)-5α-hydroxy-7aβ-methylhexahydro-1-indanone (5α-hydroxy-methylhexahydro-1-indanone propionate; 5OH-HIP). Interestingly, RE1ΔipdAB and RE1ΔfadE30, but not RE1ΔfadA6, also displayed an attenuated phenotype in a macrophage infection assay. Gene products important for growth on 5OH-HIP, as part of the steroid catabolic pathway, thus appear to act as factors involved in the pathogenicity of R. equi. Challenge experiments showed that RE1ΔipdAB could be safely administered intratracheally to 2 to 5 week-old foals and oral immunization of foals even elicited a substantial protective immunity against a virulent R. equi strain. Our data show that genes involved in steroid catabolism are promising targets for the development of a live-attenuated vaccine against R. equi infections. PMID:21901092

  15. The steroid catabolic pathway of the intracellular pathogen Rhodococcus equi is important for pathogenesis and a target for vaccine development.

    Directory of Open Access Journals (Sweden)

    R van der Geize

    2011-08-01

    Full Text Available Rhodococcus equi causes fatal pyogranulomatous pneumonia in foals and immunocompromised animals and humans. Despite its importance, there is currently no effective vaccine against the disease. The actinobacteria R. equi and the human pathogen Mycobacterium tuberculosis are related, and both cause pulmonary diseases. Recently, we have shown that essential steps in the cholesterol catabolic pathway are involved in the pathogenicity of M. tuberculosis. Bioinformatic analysis revealed the presence of a similar cholesterol catabolic gene cluster in R. equi. Orthologs of predicted M. tuberculosis virulence genes located within this cluster, i.e. ipdA (rv3551, ipdB (rv3552, fadA6 and fadE30, were identified in R. equi RE1 and inactivated. The ipdA and ipdB genes of R. equi RE1 appear to constitute the α-subunit and β-subunit, respectively, of a heterodimeric coenzyme A transferase. Mutant strains RE1ΔipdAB and RE1ΔfadE30, but not RE1ΔfadA6, were impaired in growth on the steroid catabolic pathway intermediates 4-androstene-3,17-dione (AD and 3aα-H-4α(3'-propionic acid-5α-hydroxy-7aβ-methylhexahydro-1-indanone (5α-hydroxy-methylhexahydro-1-indanone propionate; 5OH-HIP. Interestingly, RE1ΔipdAB and RE1ΔfadE30, but not RE1ΔfadA6, also displayed an attenuated phenotype in a macrophage infection assay. Gene products important for growth on 5OH-HIP, as part of the steroid catabolic pathway, thus appear to act as factors involved in the pathogenicity of R. equi. Challenge experiments showed that RE1ΔipdAB could be safely administered intratracheally to 2 to 5 week-old foals and oral immunization of foals even elicited a substantial protective immunity against a virulent R. equi strain. Our data show that genes involved in steroid catabolism are promising targets for the development of a live-attenuated vaccine against R. equi infections.

  16. Nosocomial pathogens

    African Journals Online (AJOL)

    remains an important problem in intensive care units. Hospital wards had been shown to act as reservoirs of pathogenic microorganisms associated with infection. To assess the prevalence of pathogenic organisms in the environment of the neonatal unit, 92 swabs were randomly collected from cots, incubators and various ...

  17. Antitumor effects and mechanisms of Ganoderma extracts and spores oil

    Science.gov (United States)

    Chen, Chun; Li, Peng; Li, Ye; Yao, Guan; Xu, Jian-Hua

    2016-01-01

    Ganoderma lucidum is a popular herbal medicine used in China to promote health. Modern studies have disclosed that the active ingredients of Ganoderma can exhibit several effects, including antitumor effects and immunomodulation. The present study evaluated the antitumor effects of self-prepared Ganoderma extracts and spores oil, and investigated the possible underlying mechanisms by observing the effects of the extracts and oil on topoisomerases and the cell cycle. The results showed that Ganoderma extracts and spores oil presented dose-dependent inhibitory effects on tumor cells. The half maximal inhibitory concentration (IC50) values of Ganoderma extracts on HL60, K562 and SGC-7901 cells for 24 h were 0.44, 0.39 and 0.90 mg/ml, respectively; for Ganoderma spores oil, the IC50 values were 1.13, 2.27 and 6.29 mg/ml, respectively. In the in vivo study, the inhibitory rates of Ganoderma extracts (4 g/kg/d, intragastrically) on S180 and H22 cells were 39.1 and 44.6%, respectively, and for Ganoderma spores oil (1.2 g/kg/d, intragastrically) the inhibitory rates were 30.9 and 44.9%, respectively. Ganoderma extracts and spores oil inhibited the activities of topoisomerase I and II. Ganoderma spores oil was shown block the cell cycle at the transition between the G1 and S phases and induce a marked decrease in cyclin D1 levels in K562 cells, with no significant change in cyclin E level. These results suggest that the Ganoderma extracts and spores oil possessed antitumor effects in the in vitro and in vivo studies. The antitumor mechanisms of the extracts and spores oil were associated with inhibitory effects on topoisomerase I and II activities, and for Ganoderma spores oil, the antitumor effects may also be associated with decreased cyclin D1 levels, thus inducing G1 arrest in the cell cycle. PMID:27900038

  18. Bacteriocins: Novel Solutions to Age Old Spore-Related Problems?

    Directory of Open Access Journals (Sweden)

    Kevin eEgan

    2016-04-01

    Full Text Available Bacteriocins are ribosomally synthesized antimicrobial peptides produced by bacteria, which have the ability to kill or inhibit other bacteria. Many bacteriocins are produced by food grade lactic acid bacteria (LAB. Indeed, the prototypic bacteriocin, nisin, is produced by Lactococcus lactis, and is licensed in over 50 countries. With consumers becoming more concerned about the levels of chemical preservatives present in food, bacteriocins offer an alternative, more natural, approach, while ensuring both food safety and product shelf life. Bacteriocins also show additive/synergistic effects when used in combination with other treatments, such as heating, high pressure, organic compounds, and as part of food packaging. These features are particularly attractive from the perspective of controlling sporeforming bacteria. Bacterial spores are common contaminants of food products, and their outgrowth may cause food spoilage or food-borne illness. They are of particular concern to the food industry due to their thermal and chemical resistance in their dormant state. However, when spores germinate they lose the majority of their resistance traits, making them susceptible to a variety of food processing treatments. Bacteriocins represent one potential treatment as they may inhibit spores in the post-germination/outgrowth phase of the spore cycle. Spore eradication and control in food is critical, as they are able to spoil and in certain cases compromise the safety of food by producing dangerous toxins. Thus, understanding the mechanisms by which bacteriocins exert their sporostatic/sporicidal activity against bacterial spores will ultimately facilitate their optimal use in food. This review will focus on the use of bacteriocins alone, or in combination with other innovative processing methods to control spores in food, the current knowledge and gaps therein with regard to bacteriocin-spore interactions and discuss future research approaches to enable

  19. Sterilization Resistance of Bacterial Spores Explained with Water Chemistry.

    Science.gov (United States)

    Friedline, Anthony W; Zachariah, Malcolm M; Middaugh, Amy N; Garimella, Ravindranath; Vaishampayan, Parag A; Rice, Charles V

    2015-11-05

    Bacterial spores can survive for long periods without nutrients and in harsh environmental conditions. This survival is influenced by the structure of the spore, the presence of protective compounds, and water retention. These compounds, and the physical state of water in particular, allow some species of bacterial spores to survive sterilization schemes with hydrogen peroxide and UV light. The chemical nature of the spore core and its water has been a subject of some contention and the chemical environment of the water impacts resistance paradigms. Either the spore has a glassy core, where water is immobilized along with other core components, or the core is gel-like with mobile water diffusion. These properties affect the movement of peroxide and radical species, and hence resistance. Deuterium solid-state NMR experiments are useful for examining the nature of the water inside the spore. Previous work in our lab with spores of Bacillus subtilis indicate that, for spores, the core water is in a more immobilized state than expected for the gel-like core theory, suggesting a glassy core environment. Here, we report deuterium solid-state NMR observations of the water within UV- and peroxide-resistant spores from Bacillus pumilus SAFR-032. Variable-temperature NMR experiments indicate no change in the line shape after heating to 50 °C, but an overall decrease in signal after heating to 100 °C. These results show glass-like core dynamics within B. pumilus SAFR-032 that may be the potential source of its known UV-resistance properties. The observed NMR traits can be attributed to the presence of an exosporium containing additional labile deuterons that can aid in the deactivation of sterilizing agents.

  20. Bacteriocins: Novel Solutions to Age Old Spore-Related Problems?

    Science.gov (United States)

    Egan, Kevin; Field, Des; Rea, Mary C; Ross, R Paul; Hill, Colin; Cotter, Paul D

    2016-01-01

    Bacteriocins are ribosomally synthesized antimicrobial peptides produced by bacteria, which have the ability to kill or inhibit other bacteria. Many bacteriocins are produced by food grade lactic acid bacteria (LAB). Indeed, the prototypic bacteriocin, nisin, is produced by Lactococcus lactis, and is licensed in over 50 countries. With consumers becoming more concerned about the levels of chemical preservatives present in food, bacteriocins offer an alternative, more natural approach, while ensuring both food safety and product shelf life. Bacteriocins also show additive/synergistic effects when used in combination with other treatments, such as heating, high pressure, organic compounds, and as part of food packaging. These features are particularly attractive from the perspective of controlling sporeforming bacteria. Bacterial spores are common contaminants of food products, and their outgrowth may cause food spoilage or food-borne illness. They are of particular concern to the food industry due to their thermal and chemical resistance in their dormant state. However, when spores germinate they lose the majority of their resistance traits, making them susceptible to a variety of food processing treatments. Bacteriocins represent one potential treatment as they may inhibit spores in the post-germination/outgrowth phase of the spore cycle. Spore eradication and control in food is critical, as they are able to spoil and in certain cases compromise the safety of food by producing dangerous toxins. Thus, understanding the mechanisms by which bacteriocins exert their sporostatic/sporicidal activity against bacterial spores will ultimately facilitate their optimal use in food. This review will focus on the use of bacteriocins alone, or in combination with other innovative processing methods to control spores in food, the current knowledge and gaps therein with regard to bacteriocin-spore interactions and discuss future research approaches to enable spores to be more

  1. Bacteriocins: Novel Solutions to Age Old Spore-Related Problems?

    Science.gov (United States)

    Egan, Kevin; Field, Des; Rea, Mary C.; Ross, R. Paul; Hill, Colin; Cotter, Paul D.

    2016-01-01

    Bacteriocins are ribosomally synthesized antimicrobial peptides produced by bacteria, which have the ability to kill or inhibit other bacteria. Many bacteriocins are produced by food grade lactic acid bacteria (LAB). Indeed, the prototypic bacteriocin, nisin, is produced by Lactococcus lactis, and is licensed in over 50 countries. With consumers becoming more concerned about the levels of chemical preservatives present in food, bacteriocins offer an alternative, more natural approach, while ensuring both food safety and product shelf life. Bacteriocins also show additive/synergistic effects when used in combination with other treatments, such as heating, high pressure, organic compounds, and as part of food packaging. These features are particularly attractive from the perspective of controlling sporeforming bacteria. Bacterial spores are common contaminants of food products, and their outgrowth may cause food spoilage or food-borne illness. They are of particular concern to the food industry due to their thermal and chemical resistance in their dormant state. However, when spores germinate they lose the majority of their resistance traits, making them susceptible to a variety of food processing treatments. Bacteriocins represent one potential treatment as they may inhibit spores in the post-germination/outgrowth phase of the spore cycle. Spore eradication and control in food is critical, as they are able to spoil and in certain cases compromise the safety of food by producing dangerous toxins. Thus, understanding the mechanisms by which bacteriocins exert their sporostatic/sporicidal activity against bacterial spores will ultimately facilitate their optimal use in food. This review will focus on the use of bacteriocins alone, or in combination with other innovative processing methods to control spores in food, the current knowledge and gaps therein with regard to bacteriocin-spore interactions and discuss future research approaches to enable spores to be more

  2. Antitumor effects and mechanisms of Ganoderma extracts and spores oil.

    Science.gov (United States)

    Chen, Chun; Li, Peng; Li, Ye; Yao, Guan; Xu, Jian-Hua

    2016-11-01

    Ganoderma lucidum is a popular herbal medicine used in China to promote health. Modern studies have disclosed that the active ingredients of Ganoderma can exhibit several effects, including antitumor effects and immunomodulation. The present study evaluated the antitumor effects of self-prepared Ganoderma extracts and spores oil, and investigated the possible underlying mechanisms by observing the effects of the extracts and oil on topoisomerases and the cell cycle. The results showed that Ganoderma extracts and spores oil presented dose-dependent inhibitory effects on tumor cells. The half maximal inhibitory concentration (IC 50 ) values of Ganoderma extracts on HL60, K562 and SGC-7901 cells for 24 h were 0.44, 0.39 and 0.90 mg/ml, respectively; for Ganoderma spores oil, the IC 50 values were 1.13, 2.27 and 6.29 mg/ml, respectively. In the in vivo study, the inhibitory rates of Ganoderma extracts (4 g/kg/d, intragastrically) on S180 and H22 cells were 39.1 and 44.6%, respectively, and for Ganoderma spores oil (1.2 g/kg/d, intragastrically) the inhibitory rates were 30.9 and 44.9%, respectively. Ganoderma extracts and spores oil inhibited the activities of topoisomerase I and II. Ganoderma spores oil was shown block the cell cycle at the transition between the G1 and S phases and induce a marked decrease in cyclin D1 levels in K562 cells, with no significant change in cyclin E level. These results suggest that the Ganoderma extracts and spores oil possessed antitumor effects in the in vitro and in vivo studies. The antitumor mechanisms of the extracts and spores oil were associated with inhibitory effects on topoisomerase I and II activities, and for Ganoderma spores oil, the antitumor effects may also be associated with decreased cyclin D1 levels, thus inducing G1 arrest in the cell cycle.

  3. Development and evaluation of rapid novel isothermal amplification assays for important veterinary pathogens: Chlamydia psittaci and Chlamydia pecorum

    Directory of Open Access Journals (Sweden)

    Martina Jelocnik

    2017-09-01

    Full Text Available Background Chlamydia psittaci and Chlamydia pecorum are important veterinary pathogens, with the former also being responsible for zoonoses, and the latter adversely affecting koala populations in Australia and livestock globally. The rapid detection of these organisms is still challenging, particularly at the point-of-care (POC. In the present study, we developed and evaluated rapid, sensitive and robust C. psittaci-specific and C. pecorum-specific Loop Mediated Isothermal Amplification (LAMP assays for detection of these pathogens. Methods and Materials The LAMP assays, performed in a Genie III real-time fluorometer, targeted a 263 bp region of the C. psittaci-specific Cps_0607 gene or a 209 bp region of a C. pecorum-specific conserved gene CpecG_0573, and were evaluated using a range of samples previously screened using species-specific quantitative PCRs (qPCRs. Species-specificity for C. psittaci and C. pecorum LAMP targets was tested against DNA samples from related chlamydial species and a range of other bacteria. In order to evaluate pathogen detection in clinical samples, C. psittaci LAMP was evaluated using a total of 26 DNA extracts from clinical samples from equine and avian hosts, while for C. pecorum LAMP, we tested a total of 63 DNA extracts from clinical samples from koala, sheep and cattle hosts. A subset of 36 C. pecorum samples was also tested in a thermal cycler (instead of a real-time fluorometer using newly developed LAMP and results were determined as an end point detection. We also evaluated rapid swab processing (without DNA extraction to assess the robustness of these assays. Results Both LAMP assays were demonstrated to species-specific, highly reproducible and to be able to detect as little as 10 genome copy number/reaction, with a mean amplification time of 14 and 24 min for C. psittaci and C. pecorum, respectively. When testing clinical samples, the overall congruence between the newly developed LAMP assays and q

  4. New pressure and temperature effects on bacterial spores

    International Nuclear Information System (INIS)

    Mathys, A; Knorr, D; Heinz, V

    2008-01-01

    The mechanism of inactivation of bacterial spores by heat and pressure is still a matter of discussion. Obviously, the change of the dissociation equilibrium under pressure and temperature plays a dominant role in inactivation of microorganisms. Heat and pressure inactivation of Geobacillus. stearothermophilus spores at different initial pH-values in ACES and phosphate buffer confirmed this view. Thermal inactivation in ACES buffer at 122 deg. C resulted in higher logarithmic reductions. Contrary, after pressure treatment at 900 MPa with 80 deg. C phosphate buffer showed higher inactivation. These results indicated the different dissociation equilibrium shifts in buffer systems by heat and pressure. Due to preparation, storage and handling of highly concentrated spore suspensions the clumping and the formation of aggregates can hardly be avoided. Consequently, the impact of the agglomeration size distribution on the quantitative assessment of G. stearothermophilus spore inactivation was determined by using a three-fold dynamic optical backreflexion measurement. Two limiting cases have been discriminated in mathematical modelling: three dimensional, spherical packing for maximum spore count and two dimensional, circular packing for minimum spore count of a particular agglomerate. Thermal inactivation studies have been carried out in thin glass capillaries, where by using numerical simulations the non isothermal conditions were modelled and taken into account. It is shown that the shoulder formation often found in thermal spore inactivation can sufficiently be described by first-order inactivation kinetics when the agglomeration size is considered. In case of high pressure inactivation agglomerations could be strongly changed by high forces at compression and especially decompression phase. The physiological response of Bacillus licheniformis spores to high pressure was investigated using multiparameter flow cytometry. Spores were treated by high pressure at 150 MPa

  5. New pressure and temperature effects on bacterial spores

    Science.gov (United States)

    Mathys, A.; Heinz, V.; Knorr, D.

    2008-07-01

    The mechanism of inactivation of bacterial spores by heat and pressure is still a matter of discussion. Obviously, the change of the dissociation equilibrium under pressure and temperature plays a dominant role in inactivation of microorganisms. Heat and pressure inactivation of Geobacillus. stearothermophilus spores at different initial pH-values in ACES and phosphate buffer confirmed this view. Thermal inactivation in ACES buffer at 122°C resulted in higher logarithmic reductions. Contrary, after pressure treatment at 900 MPa with 80°C phosphate buffer showed higher inactivation. These results indicated the different dissociation equilibrium shifts in buffer systems by heat and pressure. Due to preparation, storage and handling of highly concentrated spore suspensions the clumping and the formation of aggregates can hardly be avoided. Consequently, the impact of the agglomeration size distribution on the quantitative assessment of G. stearothermophilus spore inactivation was determined by using a three-fold dynamic optical backreflexion measurement. Two limiting cases have been discriminated in mathematical modelling: three dimensional, spherical packing for maximum spore count and two dimensional, circular packing for minimum spore count of a particular agglomerate. Thermal inactivation studies have been carried out in thin glass capillaries, where by using numerical simulations the non isothermal conditions were modelled and taken into account. It is shown that the shoulder formation often found in thermal spore inactivation can sufficiently be described by first-order inactivation kinetics when the agglomeration size is considered. In case of high pressure inactivation agglomerations could be strongly changed by high forces at compression and especially decompression phase. The physiological response of Bacillus licheniformis spores to high pressure was investigated using multiparameter flow cytometry. Spores were treated by high pressure at 150 MPa with 37

  6. New pressure and temperature effects on bacterial spores

    Energy Technology Data Exchange (ETDEWEB)

    Mathys, A; Knorr, D [Berlin University of Technology, Department of Food Biotechnology and Food Process Engineering, Koenigin-Luise-Str. 22, D-14195 Berlin (Germany); Heinz, V [German Institute of Food Technology, p. o. box 1165, D-49601, Quackenbrueck (Germany)], E-mail: alexander.mathys@tu-berlin.de

    2008-07-15

    The mechanism of inactivation of bacterial spores by heat and pressure is still a matter of discussion. Obviously, the change of the dissociation equilibrium under pressure and temperature plays a dominant role in inactivation of microorganisms. Heat and pressure inactivation of Geobacillus. stearothermophilus spores at different initial pH-values in ACES and phosphate buffer confirmed this view. Thermal inactivation in ACES buffer at 122 deg. C resulted in higher logarithmic reductions. Contrary, after pressure treatment at 900 MPa with 80 deg. C phosphate buffer showed higher inactivation. These results indicated the different dissociation equilibrium shifts in buffer systems by heat and pressure. Due to preparation, storage and handling of highly concentrated spore suspensions the clumping and the formation of aggregates can hardly be avoided. Consequently, the impact of the agglomeration size distribution on the quantitative assessment of G. stearothermophilus spore inactivation was determined by using a three-fold dynamic optical backreflexion measurement. Two limiting cases have been discriminated in mathematical modelling: three dimensional, spherical packing for maximum spore count and two dimensional, circular packing for minimum spore count of a particular agglomerate. Thermal inactivation studies have been carried out in thin glass capillaries, where by using numerical simulations the non isothermal conditions were modelled and taken into account. It is shown that the shoulder formation often found in thermal spore inactivation can sufficiently be described by first-order inactivation kinetics when the agglomeration size is considered. In case of high pressure inactivation agglomerations could be strongly changed by high forces at compression and especially decompression phase. The physiological response of Bacillus licheniformis spores to high pressure was investigated using multiparameter flow cytometry. Spores were treated by high pressure at 150 MPa

  7. Autophagy in plant pathogenic fungi.

    Science.gov (United States)

    Liu, Xiao-Hong; Xu, Fei; Snyder, John Hugh; Shi, Huan-Bin; Lu, Jian-Ping; Lin, Fu-Cheng

    2016-09-01

    Autophagy is a conserved cellular process that degrades cytoplasmic constituents in vacuoles. Plant pathogenic fungi develop special infection structures and/or secrete a range of enzymes to invade their plant hosts. It has been demonstrated that monitoring autophagy processes can be extremely useful in visualizing the sequence of events leading to pathogenicity of plant pathogenic fungi. In this review, we introduce the molecular mechanisms involved in autophagy. In addition, we explore the relationship between autophagy and pathogenicity in plant pathogenic fungi. Finally, we discuss the various experimental strategies available for use in the study of autophagy in plant pathogenic fungi. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Plant-pathogen interactions: toward development of next-generation disease-resistant plants.

    Science.gov (United States)

    Nejat, Naghmeh; Rookes, James; Mantri, Nitin L; Cahill, David M

    2017-03-01

    Briskly evolving phytopathogens are dire threats to our food supplies and threaten global food security. From the recent advances made toward high-throughput sequencing technologies, understanding of pathogenesis and effector biology, and plant innate immunity, translation of these means into new control tools is being introduced to develop durable disease resistance. Effectoromics as a powerful genetic tool for uncovering effector-target genes, both susceptibility genes and executor resistance genes in effector-assisted breeding, open up new avenues to improve resistance. TALENs (Transcription Activator-Like Effector Nucleases), engineered nucleases and CRISPR (Clustered Regulatory Interspaced Short Palindromic Repeats)/Cas9 systems are breakthrough and powerful techniques for genome editing, providing efficient mechanisms for targeted crop protection strategies in disease resistance programs. In this review, major advances in plant disease management to confer durable disease resistance and novel strategies for boosting plant innate immunity are highlighted.

  9. Development and host compatibility of plasmids for two important ruminant pathogens, Mycoplasma bovis and Mycoplasma agalactiae.

    Directory of Open Access Journals (Sweden)

    Shukriti Sharma

    Full Text Available Mycoplasma bovis is a cause of pneumonia, mastitis, arthritis and otitis media in cattle throughout the world. However, despite its clinical significance, there is a paucity of tools to genetically manipulate it, impeding our capacity to further explore the molecular basis of its virulence. To address this limitation, we developed a series of homologous and heterologous replicable plasmids from M. bovis and M. agalactiae. The shortest replicable oriC plasmid based on the region downstream of dnaA in M. bovis was 247 bp and contained two DnaA boxes, while oriC plasmids based on the region downstream of dnaA in M. agalactiae strains 5632 and PG2 were 219 bp and 217 bp in length, respectively, and contained only a single DnaA box. The efficiency of transformation in M. bovis and M. agalactiae was inversely correlated with the size of the oriC region in the construct, and, in general, homologous oriC plasmids had a higher transformation efficiency than heterologous oriC plasmids. The larger pWholeoriC45 and pMM21-7 plasmids integrated into the genomic oriC region of M. bovis, while the smaller oriC plasmids remained extrachromosomal for up to 20 serial passages in selective media. Although specific gene disruptions were not be achieved in M. bovis in this study, the oriC plasmids developed here could still be useful as tools in complementation studies and for expression of exogenous genes in both M. bovis and M. agalactiae.

  10. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca

    2008-07-15

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.

  11. Development and application of an oligonucleotide microarray and real-time quantitative PCR for detection of wastewater bacterial pathogens

    International Nuclear Information System (INIS)

    Lee, Dae-Young; Lauder, Heather; Cruwys, Heather; Falletta, Patricia; Beaudette, Lee A.

    2008-01-01

    Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10 3 A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater

  12. Arthropods vector grapevine trunk disease pathogens.

    Science.gov (United States)

    Moyo, P; Allsopp, E; Roets, F; Mostert, L; Halleen, F

    2014-10-01

    Arthropod-mediated dispersal of pathogens is known in many cropping systems but has never been demonstrated for grapevine trunk disease pathogens. Arthropods from vineyards were screened for the presence of pathogens associated with Petri disease and esca using cultural and molecular techniques. The ability of the most abundant pathogen-carrying species to inoculate healthy grapevine vascular tissues was also determined. Millipedes and ants were allowed to associate with a DsRed- Express-transformed Phaeomoniella chlamydospora, after which they were exposed to freshly pruned healthy grapevines under controlled conditions and wounds were monitored for subsequent infection. In addition, the possibility of millipede excreta, commonly found on pruning wounds in the field, to act as inoculum source was determined. A diverse arthropod fauna was associated with declining grapevines and many of these carried trunk disease pathogens. However, spiders, the ant Crematogaster peringueyi, and the millipede Ommattoiulus moreleti were the most abundant pathogen carriers. The ant and millipede species fed on pruning wound sap and effectively transmitted trunk disease pathogens. Millipede excreta contained viable spores of Phaeomoniella chlamydospora and may serve as an inoculum source. Numerous arthropods, including beneficial predators, are potential vectors of grapevine trunk disease pathogens. Our results highlight the need for an integrated approach, including targeted management of ants and millipedes at the time of pruning, to limit the spread of grapevine trunk diseases.

  13. Fungal spores in four catholic churches in the metropolitan area of Monterrey, Nuevo León State, Mexico – First study

    Directory of Open Access Journals (Sweden)

    Alejandra Rocha Estrada

    2015-05-01

    Full Text Available Introduction. About 500,000 species of fungi have been described to-date, although an estimated between 1 – 1.5 million species may occur. They have a wide distribution in nature, contributing to the decomposition of organic matter and playing a part in the biogeochemical cycles of major nutrients. A small number are considered pathogens of animals and plants. There is ample historical evidence that certain types of allergies are associated with fungi; exposure to fungal allergens occurs in both outdoor and indoor spaces. Many indoor allergens are the same as those found outside buildings, entering through windows and doors, ventilation systems, or through cracks or other fissures in the walls. Objective. To determine the diversity and abundance of fungal spores inside four churches in the metropolitan area of Monterrey city in Mexico. Materials and methods. The study was carried out from July 2009 – January 2010 using a Hirst type volumetric collector (Burkard Manufacturing Co Ltd. Results. A total of 31,629 spores from 54 taxa were registered in the four churches. The building that showed the highest amount of spores was the Santa Catarina Mártir Church with 12,766 spores, followed by Cristo Rey with 7,155 and Nuestra Señora del Roble with 6,887. Regularly high concentrations of spores were recorded from 14:00 – 20:00 hours. The highest concentration value was observed at the church of Santa Catarina Mártir at 16:00 hours with 1153 spores/m 3 air. Conclusions. The most abundant spores in the four churches studied corresponded to Cladosporium, the [i]Aspergillus/Penicillium complex[/i], [i]Coprinus[/i], [i]Ganoderma[/i], [i]Curvularia and Ustilago[/i].

  14. Feed-forward neural network assisted by discriminant analysis for the spectroscopic discriminantion of cracked spores Ganoderma lucidum: A prospective biotechnology production tool.

    Science.gov (United States)

    Lim, Chee Wei; Chan, Sheot Harn; Visconti, Angelo

    2011-11-15

    A major problem for manufacturers of cracked spores Ganoderma lucidum, a traditional functional food/Chinese medicine (TCM), is to ensure that raw materials are consistent as received from the producer. To address this, a feed-forward artificial neural network (ANN) method assisted by linear discriminant analysis (LDA) and principal component analysis (PCA) was developed for the spectroscopic discrimination of cracked spores of Ganoderma lucidum from uncracked spores. 120 samples comprising cracked spores, uncracked spores and concentrate of Ganoderma lucidum were analyzed. Differences in the absorption spectra located at ν1 (1143 - 1037 cm-1), ν2 (1660 - 1560 cm-1), ν3 (1745 - 1716 cm-1) and ν4 (2845 - 2798 cm-1) were identified by applying fourier transform infra-red (FTIR) spectroscopy and used as variables for discriminant analysis. The utilization of spectra frequencies offered maximum chemical information provided by the absorption spectra. Uncracked spores gave rise to characteristic spectrum that permitted discrimination from its cracked physical state. Parallel application of variables derived from unsupervised LDA/PCA provided useful (feed-forward) information to achieve 100% classification integrity objective in ANN. 100% model validation was obtained by utilizing 30 independent samples. ν1 was used to construct the matrix-matched calibration curve (n = 10) based on 4 levels of concentration (20%, 40%, 60% and 80% uncracked spores in cracked spores). A coefficient of correlation (r) of 0.97 was obtained. Relative standard deviation (RSD) of 11% was achieved using 100% uncracked spores (n = 30). These results demonstrate the feasibility of utilizing a combination of spectroscopy and prospective statistical tools to perform non destructive food quality assessment in a high throughput environment.

  15. Development of qPCR systems to quantify shoot infections by canker-causing pathogens in stone fruits and nut crops.

    Science.gov (United States)

    Luo, Y; Gu, S; Felts, D; Puckett, R D; Morgan, D P; Michailides, T J

    2017-02-01

    To develop real-time PCR assays for quantification of shoot infection levels of canker disease of stone fruits and nut crops caused by six fungal pathogen groups. This study focused on six major canker-causing fungal pathogen groups: Phomopsis sp., Botryosphaeria dothidea, Lasiodiplodia sp., Cytospora sp., Neofusicoccum sp. and Diplodia sp., occurring in stone fruits and nut crops in California. DNA primers were designed to specifically target each of the six pathogen groups after the specificity tests using canker-causing and non-canker-causing pathogens and by using DNA sequences of other species from GenBank using blast. The quantitative real-time PCR (qPCR) systems were developed and used to quantify the infection levels of inoculated dried plum shoots. For Neofusicoccum sp. and Phomopsis sp., which were used in inoculation of walnut shoots, the values of the molecular severity ranged from 5·60 to 6·94 during the 16 days of latent infection period. The qPCR assays were more efficient, accurate and precise to quantify latent infections caused by canker-causing pathogens as compared to the traditional plating methods. This study demonstrated the potential of using the developed qPCR systems for epidemiological studies on canker diseases of woody plants. © 2016 The Society for Applied Microbiology.

  16. Host–Pathogen Interactions

    NARCIS (Netherlands)

    Smits, M.A.; Schokker, D.J.

    2011-01-01

    The outcome of an infection is determined by numerous interactions between hosts and pathogens occurring at many different biological levels, ranging from molecule to population. To develop new control strategies for infectious diseases in livestock species, appropriate methodologies are needed

  17. Development of disease preventive method using radiated pathogenic microorganisms, cell lines and animals

    Energy Technology Data Exchange (ETDEWEB)

    Murakami, Yosuke; Sakamoto, Kenichi; Yamakawa, Mutsumi [National Inst. of Animal Health, Kodaira, Tokyo (Japan)] [and others

    1999-02-01

    A radiated bone marrow chimera mouse has been constructed by grafting. This chimera mouse was thought useful for analyzing gene specific functions in vivo. This study aimed to construct a vector available for a study on the functions of various genes that were cloned from animals through their constitutive expressions. Construction of a retroviral vector was attempted using spleen focus forming virus (SFFV), a mouse leukemia virus. The virus thus obtained was demonstrated to be able to express the gene when infected to NIH3T3, a mouse fibroblast cell line. Furthermore, packaging cells were constructed by transfecting the retroviral vector into the fibroblast cell. Bone marrow cells were incubated with the packaging cells for several days to make gene transfection into the bone marrow cells. After radiation exposure at a lethal dose, the mouse was grafted with the bone marrow cells. Thus, it became possible to investigate in vivo functions of a cloned gene through its expression in the cells. Then, development of a retroviral vector was attempted to use for transfection into bone marrow cells. Aujeszky`s disease virus, a large size DNA virus was exposed to Co radiation at -78degC, but the infectivity of the irradiated virus was not detectable. Since viral RNA was demonstrated to be already broken 24 hours after the exposure to {beta}-ray, the effects of {beta}-radiation were examined with swine vesicular disease virus, a small RNA virus. This virus was exposed to {alpha}-{sup 32}dATP (37MBq) as a {beta}-ray source for 1 hour to 96 hours. However, there were no significant differences in the infectivity titer between the virus exposed for any of the durations and the control, non-radiated virus. This suggested that the virus was not inactivated under the present conditions. Further investigation to determine exposure conditions is under way. (M.N.)

  18. The effect of chitosan on limitation of growth and development of some pathogenic fungi for ornamental plants

    Directory of Open Access Journals (Sweden)

    Alicja Saniewska

    2013-12-01

    Full Text Available The inhibitory effect of crab-shell chitosan, medium (200-800 cps and high molecular weight ( 800-2000 cps (purchased from Sigma-Aldrich Chemicals toward Alternaria alternata, Botrytis tulipae, Fiisarium oxysporum f. sp. callistephi, Fusarium oxysporum f. sp. tulipae, Phoma narcissi and Phoma poolensis was evaluated in vitro and in vivo. The chitosan evidently inhibited in vitro growth of all tested pathogens, with a marked effect at higher concentrations above 200 μg/cm3. Chitosan at a concentration of 1,25; 2,5 and 5,0 mg/cm3 didn't have inhibitory action in appearance of fungi growth on naturally contaminated Callistephus chinensis seeds. At the same concentrations, chitosan applied as bulb scales dressing of Hymenocallis narcissiflora bulbs, before inoculation or after inoculation with Phoma narcissi, inhibited the development of necrotic spots on scales. Chitosan used preventively or curatively at a concentrations of 1,25; 2,5 and 5,0 mg/cm3 indicated inhibitory effect on development of Fusarium oxysporum f. sp. tulipae on tulip bulbs. Chitosan at a concentration of 10 mg/cm3 applied preventively (first spray 12th June was very effective in the control of Puccinia antirrhini on snapdragon in the field. The strongest inhibitory effect was observed on snapdragon treated 8 times at week intervals.

  19. LEVELS AND TYPES OF AEROBIC SPORE FORMING BACTERIA ...

    African Journals Online (AJOL)

    Limnothrissa miodon) had the product sourced from them analysed morphologically by a microscope and biochemically for levels of aerobic spore forming bacteria that could adversely affect safety of the product. The four companies whose packaged ...

  20. Analysis of Bacillus Globigii Spores Using the BioDetector

    National Research Council Canada - National Science Library

    Lee, William

    1999-01-01

    .... An automated immunoassay instrument capable of providing rapid identification of biological agents was used to analyses laboratory and field trial samples containing the field trial simulants Bacillus globigii (BG) spores...

  1. Late Silurian trilete spores from northern Jiangsu, China.

    Science.gov (United States)

    Wang; Li

    2000-08-01

    The Late Silurian is generally considered to a particular significant key period in the study of early land vascular plants. A trilete spore assemblage of the Upper Silurian is described from northern Jiangsu, China. This assemblage comprises 11 genera and 20 species of trilete spores (including laevigate, apiculate, perinotrilite, patinate, rarely distally murornate and equatorially crassitate, and three indeterminate trilete miospores forms). It has similarities to those described from coeval assemblages from around the world (e.g., England and South Wales; Tripolitania, Libya; Cornwallis Island, Canadian Arctic; Northwest Spain). The rare cryptospore, only one specimen (Tetrahedraletes sp.) had been found to be associated with the Chinese trilete spore assemblage. The discovery of the trilete spores from Late Silurian rocks indicates the existence of early land plants, some possibly vascular, at that time in northern Jiangsu, China.

  2. Small Probes for Orbital Return of Experiments (SPORE), Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — Analogous to the CubeSat standardization of micro-satellites, the SPORE flight system architecture will utilize a modular design approach to provide low-cost...

  3. Development of a real-time PCR for the detection of pathogenic Leptospira spp. in California sea lions.

    Science.gov (United States)

    Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori

    2014-08-11

    Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.

  4. Comparative analysis of Bacillus subtilis spores and monophosphoryl lipid A as adjuvants of protein-based mycobacterium tuberculosis-based vaccines: partial requirement for interleukin-17a for induction of protective immunity.

    Science.gov (United States)

    Esparza-Gonzalez, Sandra C; Troy, Amber R; Izzo, Angelo A

    2014-04-01

    The development of adjuvants for vaccines has become an important area of research as the number of protein-based vaccines against infectious pathogens increases. Currently, there are a number of adjuvant-based Mycobacterium tuberculosis vaccines in clinical trials that have shown efficacy in animal models. Despite these novel adjuvants, there is still a need to design new and more versatile adjuvants that have minimal adverse side effects but produce robust long-lasting adaptive immune responses. To this end, we hypothesized that Bacillus subtilis spores may provide the appropriate innate signals that are required to generate such vaccine-mediated responses, which would be sufficient to reduce the mycobacterial burden after infection with M. tuberculosis. In addition, we compared the response generated by B. subtilis spores to that generated by monophosphoryl lipid A (MPL), which has been used extensively to test tuberculosis vaccines. The well-characterized, 6-kDa early secretory antigenic target of M. tuberculosis (ESAT-6; Rv3875) was used as a test antigen to determine the T cell activation potential of each adjuvant. Inoculated into mice, B. subtilis spores induced a strong proinflammatory response and Th1 immunity, similar to MPL; however, unlike MPL formulated with dimethyldioctadecylammonium (DDA) bromide, it failed to induce significant levels of interleukin-17A (IL-17A) and was unable to significantly reduce the mycobacterial burden after pulmonary infection with M. tuberculosis. Further analysis of the activity of MPL-DDA suggested that IL-17A was required for protective immunity. Taken together, the data emphasize the requirement for a network of cytokines that are essential for protective immunity.

  5. Thermal inactivation kinetics of Bacillus coagulans spores in tomato juice.

    Science.gov (United States)

    Peng, Jing; Mah, Jae-Hyung; Somavat, Romel; Mohamed, Hussein; Sastry, Sudhir; Tang, Juming

    2012-07-01

    The thermal characteristics of the spores and vegetative cells of three strains of Bacillus coagulans (ATCC 8038, ATCC 7050, and 185A) in tomato juice were evaluated. B. coagulans ATCC 8038 was chosen as the target microorganism for thermal processing of tomato products due to its spores having the highest thermal resistance among the three strains. The thermal inactivation kinetics of B. coagulans ATCC 8038 spores in tomato juice between 95 and 115°C were determined independently in two different laboratories using two different heating setups. The results obtained from both laboratories were in general agreement, with z-values (z-value is defined as the change in temperature required for a 10-fold reduction of the D-value, which is defined as the time required at a certain temperature for a 1-log reduction of the target microorganisms) of 8.3 and 8.7°C, respectively. The z-value of B. coagulans 185A spores in tomato juice (pH 4.3) was found to be 10.2°C. The influence of environmental factors, including cold storage time, pH, and preconditioning, upon the thermal resistance of these bacterial spores is discussed. The results obtained showed that a storage temperature of 4°C was appropriate for maintaining the viability and thermal resistance of B. coagulans ATCC 8038 spores. Acidifying the pH of tomato juice decreased the thermal resistance of these spores. A 1-h exposure at room temperature was considered optimal for preconditioning B. coagulans ATCC 8038 spores in tomato juice.

  6. Purification and Properties of Clostridium perfringens Spore Lytic Enzymes.

    Science.gov (United States)

    1983-01-01

    reaction mixture at 550C gave the opti- mum response although the activity of initiation protein remained high at 65"C and 75"C. Denaturation of the...CASSIER M. and Sebald M. 1969. Germination Iysozyme-ddpendente des spores de aCnerilim perfringeno ATCC 3624 sprks tralitment thermique . Ann. Inst. Pasteur...activity upon prolonged extraction -of spores in GME was not surprising, since this compound is an active protein denaturant . Urea acts in the same

  7. Fate of ingested Clostridium difficile spores in mice.

    Directory of Open Access Journals (Sweden)

    Amber Howerton

    Full Text Available Clostridium difficile infection (CDI is a leading cause of antibiotic-associated diarrhea, a major nosocomial complication. The infective form of C. difficile is the spore, a dormant and resistant structure that forms under stress. Although spore germination is the first committed step in CDI onset, the temporal and spatial distribution of ingested C. difficile spores is not clearly understood. We recently reported that CamSA, a synthetic bile salt analog, inhibits C. difficile spore germination in vitro and in vivo. In this study, we took advantage of the anti-germination activity of bile salts to determine the fate of ingested C. difficile spores. We tested four different bile salts for efficacy in preventing CDI. Since CamSA was the only anti-germinant tested able to prevent signs of CDI, we characterized CamSa's in vitro stability, distribution, and cytotoxicity. We report that CamSA is stable to simulated gastrointestinal (GI environments, but will be degraded by members of the natural microbiota found in a healthy gut. Our data suggest that CamSA will not be systemically available, but instead will be localized to the GI tract. Since in vitro pharmacological parameters were acceptable, CamSA was used to probe the mouse model of CDI. By varying the timing of CamSA dosage, we estimated that C. difficile spores germinated and established infection less than 10 hours after ingestion. We also showed that ingested C. difficile spores rapidly transited through the GI tract and accumulated in the colon and cecum of CamSA-treated mice. From there, C. difficile spores were slowly shed over a 96-hour period. To our knowledge, this is the first report of using molecular probes to obtain disease progression information for C. difficile infection.

  8. Tip-enhanced Raman scattering of bacillus subtilis spores

    Science.gov (United States)

    Rusciano, G.; Zito, G.; Pesce, G.; Sasso, A.; Isticato, R.; Ricca, E.

    2015-07-01

    Understanding of the complex interactions of molecules at biological interfaces is a fundamental issue in biochemistry, biotechnology as well as biomedicine. A plethora of biological processes are ruled by the molecular texture of cellular membrane: cellular communications, drug transportations and cellular recognition are just a few examples of such chemically-mediated processes. Tip-Enhanced Raman Scattering (TERS) is a novel, Raman-based technique which is ideally suited for this purpose. TERS relies on the combination of scanning probe microscopy and Raman spectroscopy. The basic idea is the use of a metalled tip as a sort of optical nano-antenna, which gives place to SERS effect close to the tip end. Herein, we present the application of TERS to analyze the surface of Bacillus subtilis spores. The choice of this biological systems is related to the fact that a number of reasons support the use of spores as a mucosal delivery system. The remarkable and well-documented resistance of spores to various environmental and toxic effects make them clear potentials as a novel, surface-display system. Our experimental outcomes demonstrate that TERS is able to provide a nano-scale chemical imaging of spore surface. Moreover, we demonstrate that TERS allows differentiation between wilde-type spore and genetically modified strains. These results hold promise for the characterization and optimization of spore surface for drug-delivery applications.

  9. Infrared Signatures to Discriminate Viability of Autoclaved Bacillus Spores

    Energy Technology Data Exchange (ETDEWEB)

    Schneider, Matthew D.; Valentine, Nancy B.; Johnson, Timothy J.

    2011-10-06

    Optical methods can offer good sensitivity for detecting small amounts of chemicals and biologicals, and as these methods mature, are some of the few techniques that can offer true standoff detection. For detection of biological species, determining the viability is clearly important: Certain species of gram-positive bacteria are capable of forming endospores, specialized structures that arise when living conditions become unfavorable or little growth medium is available, being resistant to many chemicals as well as changes in heat or pH. Such spores can remain dormant from months to years until more favorable conditions arise, resulting in germination back to the vegetative state. This persistence characteristic of bacterial spores allows for contamination of a surface (e.g. food or medical equipment) even after the surface has been nominally cleaned. Bacterial spores have also been used as biological weapons, as in the case with B. anthracis. Thus, rapid analysis to determine a spore's viability in a given environment or after attempts to sterilize a given environment is crucial. The increasing availability of portable spectrometers may provide a key to such rapid onsite analysis. The present study was designed to determine whether infrared spectroscopy may be used to differentiate between viable vs. dead B. subtilis and B. atrophaeus spores. Preliminary results show that the reproducible differences in the IR signatures can be used to identify viable vs. autoclaved (dead) B. subtilis and B. atrophaeus bacterial spores.

  10. Maternal parentage influences spore production but not spore pigmentation in the anisogamous and hermaphroditic fungus Neurospora crassa

    DEFF Research Database (Denmark)

    Zimmerman, Kolea; Levitis, Daniel; Pringle, Anne

    2014-01-01

    , and various ascospore characteristics. Mixed effects models of these data show that the female parent accounts for the majority of variation in perithecial production, number of spores produced, and spore germination. Surprisingly, both sexes equally influence the percentage of spores that are pigmented......In this study, we tested the hypothesis that maternal effects on offspring production and quality are greater than paternal effects in both offspring number (fertility) and offspring viability (mortality). We used the model filamentous fungus Neurospora crassa. This fungus is anisogamous......, Hall, & Kowbel 2011). Precise genetic distances between mating pairs were calculated to control for the effects of crossing distance on offspring production. We performed reciprocal crosses of all 121 strain pairings and collected data on perithecial production, ascospore (sexual spore) production...

  11. Particularities of pathogenic microorganism development at anthropogenic influence and estimate of their adaptation potential by means of radiobiological method

    International Nuclear Information System (INIS)

    Shilina, Yu.V.; Gushcha, N.I.; Dyachenko, A.I.; Dmitriev, A.P.; Molozhava, O.S.; Romashko, V.M.

    2008-01-01

    Influence of anthropogenic factors on ecosystems causes their structure disturbance and reduction of species variety. Some resistance nonspecific forms of pathogenic microorganisms, which have high adaptation potential, become dominant. Thus their aggressiveness can increase. (authors)

  12. INFLUENCE OF CULTIVARS AND SEED THERMAL TREATMENT ON THE DEVELOPMENT OF FUNGAL PATHOGENS IN CARROT AND ONION PLANTS

    Czech Academy of Sciences Publication Activity Database

    Koudela, M.; Novotný, Čeněk

    2016-01-01

    Roč. 64, č. 4 (2016), s. 1181-1189 ISSN 1211-8516 R&D Projects: GA MZe QJ1210165 Institutional support: RVO:61388971 Keywords : carrot * onion * fungal pathogens * plants infection Subject RIV: EE - Microbiology, Virology

  13. Development of Macrocystis pyrifera from spores and gametes on artificial substrate: Algal production in a surface culture Desarrollo de Macrocystis pyrifera en sustrato artificial a partir de esporas y gametos: Producción algal en cultivo de superficie

    Directory of Open Access Journals (Sweden)

    Paula Celis Plá

    2012-07-01

    Full Text Available This study proposes establishing a methodology for generating algal biomass from spores and gametes of Macrocystis pyrifera (Phaeophyta, Laminariales on nylon ropes that are 100 m long and 3 mm in diameter, installed on the sea surface. The algae are initially farmed in tanks with seawater of 11°-13°C, pH 8.2, salinity 28-33, radiation 75-100 μm-2 s-1, aeration every 20 min, the addition of nutrients (NaNO3 and Na3PO4, and a 12:12 photoperiod. Twenty days after beginning the cultivation, male gametophytes were 17 μm long by 2.5 μm in diameter, and female gametophytes were 10.5 μm by 7.5 μm. After 60 days of cultivation, the elongated laminar sporophytes were 412 μm by 103 μm. After 195 days, ropes with 2500 μm long sporophytes were installed in the sea at 1 m depth (intermediate cultivation phase, obtaining specimens 36 cm in length after 30 days. Of these specimens, 46 individuals between 30 and 40 cm in size were selected and tied to a 15 m long guide rope that was installed on the surface by means of buoys and anchored to the bottom. After three months, these specimens reached sizes of more than 3 m in length, with abundant laminate biomass surface, reaching an average of 7 kg per specimen, lacking stipes, and with holdfasts of a few centimeters. The surface technique used avoids the herbivory by crustaceans and sea urchins that occurs when the initial developmental stages are done on the seafloor.Este estudio postula establecer una metodología para generar biomasa algal a partir de esporas y gametos de Macrocystis pyrifera (Phaeophyta, Laminariales, en cuerdas de nailon de 100 m de largo y 3 mm de diámetro, instaladas en la superficie del mar y cultivadas inicialmente en estanques con agua de mar a 11°-13°C, pH 8,2; 28-33 de salinidad, 75-100 μmol m-2 s-1 de radiación y aireación cada 20 min, con adición de nutrientes (NaNO3 y Na3PO4 y fotoperiodo 12:12. A los 20 días de iniciado el cultivo se obtuvo gametofitos masculinos

  14. The Master Transcription Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity in the Fungus Aspergillus flavus.

    Science.gov (United States)

    Zhuang, Zhenhong; Lohmar, Jessica M; Satterlee, Timothy; Cary, Jeffrey W; Calvo, Ana M

    2016-01-20

    Aspergillus flavus produces a variety of toxic secondary metabolites; among them, the aflatoxins (AFs) are the most well known. These compounds are highly mutagenic and carcinogenic, particularly AFB₁. A. flavus is capable of colonizing a number of economically-important crops, such as corn, cotton, peanut and tree nuts, and contaminating them with AFs. Molecular genetic studies in A. flavus could identify novel gene targets for use in strategies to reduce AF contamination and its adverse impact on food and feed supplies worldwide. In the current study, we investigated the role of the master transcription factor gene mtfA in A. flavus. Our results revealed that forced overexpression of mtfA results in a drastic decrease or elimination of several secondary metabolites, among them AFB₁. The reduction in AFB₁ was accompanied by a decrease in aflR expression. Furthermore, mtfA also regulates development; conidiation was influenced differently by this gene depending on the type of colonized substrate. In addition to its effect on conidiation, mtfA is necessary for the normal maturation of sclerotia. Importantly, mtfA positively affects the pathogenicity of A. flavus when colonizing peanut seeds. AF production in colonized seeds was decreased in the deletion mtfA strain and particularly in the overexpression strain, where only trace amounts were detected. Interestingly, a more rapid colonization of the seed tissue occurred when mtfA was overexpressed, coinciding with an increase in lipase activity and faster maceration of the oily part of the seed.

  15. Development of a fluorogenic 5' nuclease PCR assay for detection of the ail gene of pathogenic Yersinia enterocolitica.

    Science.gov (United States)

    Jourdan, A D; Johnson, S C; Wesley, I V

    2000-09-01

    In this report we describe the development and evaluation of a fluorogenic PCR assay for the detection of pathogenic Yersinia enterocolitica. The assay targets the chromosomally encoded attachment and invasion gene, ail. Three primer-probe sets (TM1, TM2, and TM3) amplifying different, yet overlapping, regions of ail were examined for their specificity and sensitivity. All three primer-probe sets were able to detect between 0.25 and 0.5 pg of purified Y. enterocolitica DNA. TM1 identified all 26 Y. enterocolitica strains examined. TM3 was able to detect all strains except one, whereas TM2 was unable to detect 10 of the Y. enterocolitica strains tested. None of the primer-probe sets cross-reacted with any of the 21 non-Y. enterocolitica strains examined. When the TM1 set was utilized, the fluorogenic PCR assay was able to detect

  16. Inactivation of Spores of Bacillus Species by Wet Heat: Studies on Single Spores Using Laser Tweezers Taman Spectroscopy

    Science.gov (United States)

    2013-02-01

    13/2011 22.00 Keren K. Griffiths, Jingqiao Zhang, Ann E. Cowan, Ji Yu, Peter Setlow. Germination proteins in the inner membrane of dormant Bacillus...that this technique can be used to rapidly identify single airborne particles or bacteria collected on a slide and to monitor germination dynamics of...the environment of dipicolinic acid in the core of superdormant spores is different from that in dormant spores [J. Bacteriol., 191, 5584 (2009

  17. Development and evaluation of a panel of filovirus sequence capture probes for pathogen detection by next-generation sequencing.

    Directory of Open Access Journals (Sweden)

    Jeffrey W Koehler

    Full Text Available A detailed understanding of the circulating pathogens in a particular geographic location aids in effectively utilizing targeted, rapid diagnostic assays, thus allowing for appropriate therapeutic and containment procedures. This is especially important in regions prevalent for highly pathogenic viruses co-circulating with other endemic pathogens such as the malaria parasite. The importance of biosurveillance is highlighted by the ongoing Ebola virus disease outbreak in West Africa. For example, a more comprehensive assessment of the regional pathogens could have identified the risk of a filovirus disease outbreak earlier and led to an improved diagnostic and response capacity in the region. In this context, being able to rapidly screen a single sample for multiple pathogens in a single tube reaction could improve both diagnostics as well as pathogen surveillance. Here, probes were designed to capture identifying filovirus sequence for the ebolaviruses Sudan, Ebola, Reston, Taï Forest, and Bundibugyo and the Marburg virus variants Musoke, Ci67, and Angola. These probes were combined into a single probe panel, and the captured filovirus sequence was successfully identified using the MiSeq next-generation sequencing platform. This panel was then used to identify the specific filovirus from nonhuman primates experimentally infected with Ebola virus as well as Bundibugyo virus in human sera samples from the Democratic Republic of the Congo, thus demonstrating the utility for pathogen detection using clinical samples. While not as sensitive and rapid as real-time PCR, this panel, along with incorporating additional sequence capture probe panels, could be used for broad pathogen screening and biosurveillance.

  18. Development of a novel approach for the production of dried genomic DNA for use as standards for qualitative PCR testing of food-borne pathogens

    DEFF Research Database (Denmark)

    Trapmann, S.; Catalani, P.; Hoorfar, Jeffrey

    2004-01-01

    , Campylobacter jejuni and Yersinia enterocolitica were used to produce genomic DNA (gDNA). These preparations gave support to method development for qualitative polymerase chain reaction (PCR) detection methods for food-borne pathogens. Purified gDNA was transformed into stable and dry gDNA by using...

  19. Pathogen transfer and high variability in pathogen removal by detergent wipes.

    Science.gov (United States)

    Ramm, Lauren; Siani, Harsha; Wesgate, Rebecca; Maillard, Jean-Yves

    2015-07-01

    The rise in health care-associated infections has placed a greater emphasis on cleaning and disinfection practices. The majority of policies advocate using detergent-based products for routine cleaning, with detergent wipes increasingly being used; however, there is no information about their ability to remove and subsequently transfer pathogens in practice. Seven detergent wipes were tested for their ability to remove and transfer Staphylococcus aureus, Acinetobacter baumannii, and Clostridium difficile spores using the 3-stage wipe protocol. The ability of the detergent wipes to remove S aureus, A baumannii, and C difficile spores from a stainless steel surface ranged from 1.50 log10 (range, 0.24-3.25), 3.51 log10 (range, 3.01-3.81), and 0.96 log10 (range, 0.26-1.44), respectively, following a 10-second wiping time. All wipes repeatedly transferred significant amounts of bacteria/spores over 3 consecutive surfaces, although the percentage of total microorganisms transferred from the wipes after wiping was low for a number of products. Detergent-based wipe products have 2 major drawbacks: their variability in removing microbial bioburden from inanimate surfaces and a propensity to transfer pathogens between surfaces. The use of additional complementary measures such as combined detergent/disinfectant-based products and/or antimicrobial surfaces need to be considered for appropriate infection control and prevention. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  20. Development of SCAR primers for the detection of the postharvest pathogens of kiwifruit and pome fruit Cadophora luteo-olivacea and C. malorum

    Directory of Open Access Journals (Sweden)

    DAVIDE SPADARO

    2012-01-01

    Full Text Available 800x600 Normal 0 14 false false false IT X-NONE X-NONE MicrosoftInternetExplorer4 In recent years a postharvest disease of kiwifruit, characterized by skin pitting appearing after 3 or more months of storage, and caused by C. luteo-olivacea, has been reported in most Italian packinghouses. Forty-four strains isolated from kiwifruit harvested in Italy during the period 2001-2009 were tested for their pathogenicity on kiwifruit, apple and pear. The pathogenicity tests showed that different isolates of C. luteo-olivacea were pathogenic on the three fruit species stored at 1°C for 120 days with various degree of virulence. A PCR-based method to identify the pathogen species in kiwifruit was developed. Sequencing of the internal transcribed spacer (ITS1, 5.8S gene and ITS2 region of the rDNA (ITS showed high similarity with the species C. malorum, agent of side rot of apples and pears. Variation within the ITS was used to design one reverse primer common to both species and two species specific forward primers to specifically identify isolates of C. luteo-olivacea and C. malorum. Both SCAR (sequence characterized amplified region primer pairs showed to be specific for either Cadophora species when cross-tested and assessed on other species of Cadophora or on species of typical postharvest pathogens of kiwifruit, apple and pear.

  1. Development of a new resequencing pathogen microarray based assay for detection of broad-spectrum respiratory tract viruses in patients with community-acquired pneumonia.

    Directory of Open Access Journals (Sweden)

    Hongwei Shen

    Full Text Available A Resequencing Pathogen Microarray (RPM is a single, highly multiplexed assay for detecting and differentiating similarly related pathogens by using closely overlapping probe sets to determine a target organism's nucleotide sequence. In this study, a new RPM (RPM-IVDC1 that consisted of 224-bp detector tiles corresponding to 9 influenza A subtypes, 11 rhinoviruses, 28 enteroviruses and 38 other respiratory viruses was developed and optimized to provide individual and simultaneous detection sensitivities ranging from 15 to 750 genomic copies for 16 common respiratory pathogens. A total of 110 consecutive patients with community-acquired pneumonia (CAP admitted to 5 district general hospitals in Beijing during a 1-year period were assessed using the new assay. Among the children (under age 5 and adult patients (above age 18, respiratory syncytial virus (RSV and rhinovirus (RV were the most common etiological agents, respectively, which is consistent with reference assays. Atypical pathogens that may cause CAP-like illness, including rubella virus, measles virus, influenza type C virus, human herpesvirus (HHV were also detected. The results show the capability of RPM-IVDC1 for the accurate detection and identification of multiple virus types, which may be of significant use in epidemic surveillance and outbreak investigations of atypical pathogens.

  2. Challenges and advances in systems biology analysis of Bacillus spore physiology; molecular differences between an extreme heat resistant spore forming Bacillus subtilis food isolate and a laboratory strain

    NARCIS (Netherlands)

    Brul, Stanley; van Beilen, Johan; Caspers, Martien P M; O'Brien, Andrea; de Koster, Chris; Oomes, Suus; Smelt, Jan; Kort, Remco; Ter Beek, Alex

    Bacterial spore formers are prime organisms of concern in the food industry. Spores from the genus Bacillus are extremely stress resistant, most notably exemplified by high thermotolerance. This sometimes allows surviving spores to germinate and grow out to vegetative cells causing food spoilage and

  3. Challenges and advances in systems biology analysis of Bacillus spore physiology; molecular differences between an extreme heat resistant spore forming Bacillus subtilis food isolate and a laboratory strain

    NARCIS (Netherlands)

    Brul, S.; van Beilen, J.; Caspers, M.; O'Brien, A.; de Koster, C.; Oomes, S.; Smelt, J.; Kort, R.; ter Beek, A.

    2011-01-01

    Bacterial spore formers are prime organisms of concern in the food industry. Spores from the genus Bacillus are extremely stress resistant, most notably exemplified by high thermotolerance. This sometimes allows surviving spores to germinate and grow out to vegetative cells causing food spoilage and

  4. Live cell imaging of germination and outgrowth of individual Bacillus subtilis spores; the effect of heat stress quantitatively analyzed with SporeTracker

    NARCIS (Netherlands)

    Pandey, R.; ter Beek, A.; Vischer, N.O.E.; Smelt, J.P.P.M.; Brul, S.; Manders, E.M.M.

    2013-01-01

    Spore-forming bacteria are a special problem for the food industry as some of them are able to survive preservation processes. Bacillus spp. spores can remain in a dormant, stress resistant state for a long period of time. Vegetative cells are formed by germination of spores followed by a more

  5. Nanoceria and bulk cerium oxide effects on the germination of asplenium adiantum-nigrum spores

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Garay, A.; Pintos, B.; Manzanera, J.A.; Prada, C.; Martin, L.; Gabriel y Galan, J.M.

    2016-07-01

    Aim of the study: The effect of cerium oxide engineered nanoparticles on the spore germination of the fern. Asplenium adiantum-nigrum. Area of study: France, Britanny Region, Finistére Department, Plougonvelin, in rocks near the sea. Material and methods: Asplenium spores were cultured in vitro on agar medium with Nano-CeO2 (less than 25 nm particle size) and bulk-CeO2. The addition of each nano- and bulk particles ranged from 0 to 3000 mg L-1. Observations on rhizoidal and prothallial cells during first stages of gametophyte development were made. The No-Observed-Adverse-Effect concentration (NOAEC) and Lowest-Observed-Adverse-Effect-Concentration (LOEC) values for spore germination rate data were analyzed. Main results: Germination was speeded up by 100 to 2000 mg L-1 nanoceria, while bulk cerium oxide had the same effect for 500 to 200 mg L-1 concentrations. Present results showed cellular damage in the protonema while rhizoid cells seemed not to be affected, as growth and membrane integrity remained. Research highlights: Both nanosized and bulk cerium oxide are toxic for the fern Asplenium adiantum-nigrum, although diverse toxicity patterns were shown for both materials. Diverse toxic effects have been observed: chloroplast membrane damage and lysis, cell wall and membrane disruption which leads to cell lysis; and alterations in morphology and development. (Author)

  6. Rugged single domain antibody detection elements for Bacillus anthracis spores and vegetative cells.

    Directory of Open Access Journals (Sweden)

    Scott A Walper

    Full Text Available Significant efforts to develop both laboratory and field-based detection assays for an array of potential biological threats started well before the anthrax attacks of 2001 and have continued with renewed urgency following. While numerous assays and methods have been explored that are suitable for laboratory utilization, detection in the field is often complicated by requirements for functionality in austere environments, where limited cold-chain facilities exist. In an effort to overcome these assay limitations for Bacillus anthracis, one of the most recognizable threats, a series of single domain antibodies (sdAbs were isolated from a phage display library prepared from immunized llamas. Characterization of target specificity, affinity, and thermal stability was conducted for six sdAb families isolated from rounds of selection against the bacterial spore. The protein target for all six sdAb families was determined to be the S-layer protein EA1, which is present in both vegetative cells and bacterial spores. All of the sdAbs examined exhibited a high degree of specificity for the target bacterium and its spore, with affinities in the nanomolar range, and the ability to refold into functional antigen-binding molecules following several rounds of thermal denaturation and refolding. This research demonstrates the capabilities of these sdAbs and their potential for integration into current and developing assays and biosensors.

  7. Engineering Rugged Field Assays to Detect Hazardous Chemicals Using Spore-Based Bacterial Biosensors.

    Science.gov (United States)

    Wynn, Daniel; Deo, Sapna; Daunert, Sylvia

    2017-01-01

    Bacterial whole cell-based biosensors have been genetically engineered to achieve selective and reliable detection of a wide range of hazardous chemicals. Although whole-cell biosensors demonstrate many advantages for field-based detection of target analytes, there are still some challenges that need to be addressed. Most notably, their often modest shelf life and need for special handling and storage make them challenging to use in situations where access to reagents, instrumentation, and expertise are limited. These problems can be circumvented by developing biosensors in Bacillus spores, which can be engineered to address all of these concerns. In its sporulated state, a whole cell-based biosensor has a remarkably long life span and is exceptionally resistant to environmental insult. When these spores are germinated for use in analytical techniques, they show no loss in performance, even after long periods of storage under harsh conditions. In this chapter, we will discuss the development and use of whole cell-based sensors, their adaptation to spore-based biosensors, their current applications, and future directions in the field. © 2017 Elsevier Inc. All rights reserved.

  8. Nanoceria and bulk cerium oxide effects on the germination of asplenium adiantum-nigrum spores

    Directory of Open Access Journals (Sweden)

    Aranzazu Gomez-Garay

    2016-12-01

    Full Text Available Aim of study: The effect of cerium oxide engineered nanoparticles on the spore germination of the fern. Asplenium adiantum-nigrum. Area of study: France, Britanny Region, Finistére Department, Plougonvelin, in rocks near the sea. Material and methods: Asplenium spores were cultured in vitro on agar medium with Nano-CeO2 (less than 25 nm particle size and bulk-CeO2. The addition of each nano- and bulk particles ranged from 0 to 3000 mg L-1. Observations on rhizoidal and prothallial cells during first stages of gametophyte development were made. The No-Observed-Adverse-Effect concentration (NOAEC and Lowest-Observed-Adverse-Effect-Concentration (LOEC values for spore germination rate data were analyzed.  Main results: Germination was speeded up by 100 to 2000 mg L-1 nanoceria, while bulk cerium oxide had the same effect for 500 to 200 mg L-1 concentrations. Present results showed cellular damage in the protonema while rhizoid cells seemed not to be affected, as growth and membrane integrity remained. Research highlights: Both nanosized and bulk cerium oxide are toxic for the fern Asplenium adiantum-nigrum, although diverse toxicity patterns were shown for both materials. Diverse toxic effects have been observed: chloroplast membrane damage and lysis, cell wall and membrane disruption which leads to cell lysis; and alterations in morphology and development. Keywords: Nanoparticles; rhizoid; prothallus; chloroplast; fern.

  9. Pathogen pollution and the emergence of a deadly amphibian pathogen.

    Science.gov (United States)

    McKenzie, Valerie J; Peterson, Anna C

    2012-11-01

    ). In a new study published in this issue of Molecular Ecology, Schloegel et al. (2012) identify an additional unique Bd lineage that is endemic to the Atlantic Brazilian rainforests (Bd-Brazil) and provide striking evidence that the Bd-Brazil lineage has sexually recombined with the BdGPL lineage in an area where the two lineages likely came into contact as a result of classic anthropogenically mediated 'pathogen pollution'(see below). Fungal pathogens, including Bd, have the propensity to form recombinant lineages when allopatric populations that have not yet formed genetic reproductive barriers are provided with opportunities to intermingle, and virulent strains may be selected for because they tend to be highly transmissible (Fisher et al. 2012). As Schloegel et al. (2012) point out, the demonstrated ability for Bd to undergo meiosis may also mean that it has the capacity to form a resistant spore stage (as yet undiscovered), based on extrapolation from other sexually reproducing chytrids that all have spore stages. © 2012 Blackwell Publishing Ltd.

  10. Systematic analysis of Zn2Cys6 transcription factors required for development and pathogenicity by high-throughput gene knockout in the rice blast fungus.

    Directory of Open Access Journals (Sweden)

    Jianping Lu

    2014-10-01

    Full Text Available Because of great challenges and workload in deleting genes on a large scale, the functions of most genes in pathogenic fungi are still unclear. In this study, we developed a high-throughput gene knockout system using a novel yeast-Escherichia-Agrobacterium shuttle vector, pKO1B, in the rice blast fungus Magnaporthe oryzae. Using this method, we deleted 104 fungal-specific Zn(2Cys(6 transcription factor (TF genes in M. oryzae. We then analyzed the phenotypes of these mutants with regard to growth, asexual and infection-related development, pathogenesis, and 9 abiotic stresses. The resulting data provide new insights into how this rice pathogen of global significance regulates important traits in the infection cycle through Zn(2Cys(6TF genes. A large variation in biological functions of Zn(2Cys(6TF genes was observed under the conditions tested. Sixty-one of 104 Zn(2Cys(6 TF genes were found to be required for fungal development. In-depth analysis of TF genes revealed that TF genes involved in pathogenicity frequently tend to function in multiple development stages, and disclosed many highly conserved but unidentified functional TF genes of importance in the fungal kingdom. We further found that the virulence-required TF genes GPF1 and CNF2 have similar regulation mechanisms in the gene expression involved in pathogenicity. These experimental validations clearly demonstrated the value of a high-throughput gene knockout system in understanding the biological functions of genes on a genome scale in fungi, and provided a solid foundation for elucidating the gene expression network that regulates the development and pathogenicity of M. oryzae.

  11. Effect of sporulation medium and its divalent cation content on the heat and high pressure resistance of Clostridium botulinum type E spores.

    Science.gov (United States)

    Lenz, Christian A; Vogel, Rudi F

    2014-12-01

    Clostridium (C.) botulinum type E belongs to the non-proteolytic physiological C. botulinum group II and produces the highly potent Botulinum neurotoxin E (BoNT/E) even at refrigerated temperatures. As C. botulinum type E spores are highly prevalent in aquatic environments, seafood and fishery products are commonly associated with this organism. Hydrostatic high pressure (HHP) treatments, or treatments combining HHP with elevated temperatures (HHPT), can be used to improve traditional preservation methods and increase food safety, quality and durability. In this study, we assessed the effect of different sporulation media and cation concentration on the heat resistance, HHP resistance, and HHPT resistance of spores from three C. botulinum type E strains. SFE (sediment fish extract) sporulation media yielded the most resistant spores, whereas, in M140 media, the least resistant spores were produced. Furthermore our results indicate that the divalent cation content (Ca(2+), Mg(2+) and Mn(2+)) plays a role in the differential development of C. botulinum type E spore resistance to heat, HHP and HHPT in different media. Calcium cations confer heat and HPPT resistance to spores, while high amounts of magnesium cations appear to have a negative effect. Manganese cations in low concentrations are important for the development resistance to HPP and HPPT treatments, but not heat alone. This study provides valuable information on the nature of non-proteolytic C. botulinum type E spores grown in different media. The data provided here can be useful to the food industry and to researchers when considering spore properties in food safety risk assessment and the experimental design of future inactivation studies. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. The Effect of Resin and Monoterpenes on Spore Germination and Growth in Fusarium circinatum.

    Science.gov (United States)

    Slinski, S L; Zakharov, F; Gordon, T R

    2015-01-01

    Resin obtained from Pinus radiata and five monoterpene components of resin (limonene, α-pinene, β-pinene, camphene, and myrcene) were tested to determine their effects on mycelial growth and germination and survival of spores of Fusarium circinatum, the cause of pitch canker in pine, and F. temperatum, which is interfertile with F. circinatum but not pathogenic to pine. Averaged across all treatments, F. temperatum sustained the greatest reduction in radial growth (16.9±0.02% of control). The greatest reduction in dry weight also occurred in F. temperatum (11.7±0.01% of control), and all isolates of F. circinatum were significantly less affected (Pgermination rates in a saturated atmosphere of monoterpenes were relatively high for all tested isolates but, when placed in direct contact with resin, spore survival was significantly greater for F. circinatum than for F. temperatum. Our results are consistent with the hypothesis that greater tolerance of resin is one factor distinguishing F. circinatum from the nonpathogenic F. temperatum. However, differential tolerance of monoterpene components of resin is not sufficient to explain the observed variation in virulence to pine in F. circinatum.

  13. Inactivation of Aspergillus flavus spores in a sealed package by cold plasma streamers

    Science.gov (United States)

    Sohbatzadeh, F.; Mirzanejhad, S.; Shokri, H.; Nikpour, M.

    2016-06-01

    The main objective of this study is to investigate the inactivation efficacy of cold streamers in a sealed package on pathogenic fungi Aspergillus flavus ( A. flavus) spores that artificially contaminated pistachio surface. To produce penetrating cold streamers, electric power supply was adapted to deposit adequate power into the package. The plasma streamers were generated by an alternating high voltage with carrier frequency of 12.5 kHz which was suppressed by a modulated pulsed signal at frequency of 110 Hz. The plasma exposition time was varied from 8 to 18 min to show the effect of the plasma treatment on fungal clearance while the electrode and sample remained at room temperature. This proved a positive effect of the cold streamers treatment on fungal clearance. Benefits of deactivation of fungal spores by streamers inside the package include no heating, short treatment time and adaptability to existing processes. Given its ability to ensure the safety and longevity of food products, this technology has great potential for utilization in food packaging and processing industry. In this study, moisture and pH changes of pistachio samples after plasma streamers treatment were also investigated.

  14. Comparative analysis of detection limits and specificity of molecular diagnostic markers for three pathogens (Microsporidia, Nosema spp.) in the key pollinators Apis mellifera and Bombus terrestris.

    Science.gov (United States)

    Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G

    2012-04-01

    Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.

  15. Development and Characterization of Novel Genic-SSR Markers in Apple-Juniper Rust Pathogen Gymnosporangium yamadae (Pucciniales: Pucciniaceae Using Next-Generation Sequencing

    Directory of Open Access Journals (Sweden)

    Si-Qi Tao

    2018-04-01

    Full Text Available The Apple-Juniper rust, Gymnosporangium yamadae, is an economically important pathogen of apples and junipers in Asia. The absence of markers has hampered the study of the genetic diversity of this widespread pathogen. In our study, we developed twenty-two novel microsatellite markers for G. yamadae from randomly sequenced regions of the transcriptome, using next-generation sequencing methods. These polymorphic markers were also tested on 96 G. yamadae individuals from two geographical populations. The allele numbers ranged from 2 to 9 with an average value of 6 per locus. The polymorphism information content (PIC values ranged from 0.099 to 0.782 with an average value of 0.48. Furthermore, the observed (HO and expected (HE heterozygosity ranged from 0.000 to 0.683 and 0.04 to 0.820, respectively. These novel developed microsatellites provide abundant molecular markers for investigating the genetic structure and genetic diversity of G. yamadae, which will help us to better understand disease epidemics and the origin and migration routes of the Apple-Juniper rust pathogen. Further studies will also be completed to dissect how human activities influence the formation of current population structures. Furthermore, these SSR (simple sequence repeat markers can also be used as tools to identify virulence by mapping the whole genomes of different virulent populations. These markers will, thus, assist the development of effective risk-assessment models and management systems for the Apple-Juniper rust pathogen.

  16. Airway inflammation among compost workers exposed to actinomycetes spores.

    Science.gov (United States)

    Heldal, Kari Kulvik; Madsø, Lene; Eduard, Wijnand

    2015-01-01

    To study the associations between exposure to bioaerosols and work-related symptoms, lung function and biomarkers of airway inflammation in compost workers. Personal full-shift exposure measurements were performed on 47 workers employed at five windrow plants (n=20) and five reactor plants (n=27). Samples were analyzed for endotoxins, bacteria, fungal and actinomycetes spores. Health examinations were performed on workers and 37 controls before and after work on the day exposure was measured. The examinations included symptoms recorded by questionnaire, lung function by spirometry and nasal dimensions by acoustic rhinometry (AR). The pneumoproteins CC16, SP-D and SP-A were measured in a blood sample drawn at the end of the day. The levels of endotoxins (median 3 EU/m(3), range 0-730 EU/m(3)) and actinomycetes spores (median 0.2 × 10(6) spores/m(3), range 0-590 × 10(6) spores/m(3)) were significantly higher in reactor plants compared to windrow plants. However, windrow composting workers reported more symptoms than reactor composting workers, probably due to use of respiratory protection. Exposure-response relationships between actinomycetes spores exposure and respiratory effects, found as cough and nose irritation during a shift, was significantly increased (OR 4.3, 95% CI 1.1-16, OR 6.1, 95% CI 1.5-25, respectively, pactinomycetes spores/m3, and FEV1/FVC% decreased cross shift (b=-3.2, SE=1.5%, pactinomycetes spores which was associated with work related cough symptoms and work-shift lung function decrease.

  17. Detection of Bacillus anthracis spores by super-paramagnetic lateral-flow immunoassays based on "Road Closure".

    Science.gov (United States)

    Wang, Dian-Bing; Tian, Bo; Zhang, Zhi-Ping; Wang, Xu-Ying; Fleming, Joy; Bi, Li-Jun; Yang, Rui-Fu; Zhang, Xian-En

    2015-05-15

    Detection of Bacillus anthracis in the field, whether as a natural infection or as a biothreat remains challenging. Here we have developed a new lateral-flow immunochromatographic assay (LFIA) for B. anthracis spore detection based on the fact that conjugates of B. anthracis spores and super-paramagnetic particles labeled with antibodies will block the pores of chromatographic strips and form retention lines on the strips, instead of the conventionally reported test lines and control lines in classic LFIA. As a result, this new LFIA can simultaneously realize optical, magnetic and naked-eye detection by analyzing signals from the retention lines. As few as 500-700 pure B. anthracis spores can be recognized with CV values less than 8.31% within 5 min of chromatography and a total time of 20 min. For powdery sample tests, this LFIA can endure interference from 25% (w/v) milk, 10% (w/v) baking soda and 10% (w/v) starch without any sample pre-treatment, and has a corresponding detection limit of 6×10(4) spores/g milk powder, 2×10(5) spores/g starch and 5×10(5) spores/g baking soda. Compared with existing methods, this new approach is very competitive in terms of sensitivity, specificity, cost and ease of operation. This proof-of-concept study can also be extended for detection of many other large-sized analytes. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Inactivation of bacterial spores by combination processes: ultraviolet plus gamma radiation. [Streptococcus faecium, micrococcus radiodurans, clostridium botulinum

    Energy Technology Data Exchange (ETDEWEB)

    Grecz, N.; Durban, E.

    1973-01-01

    Bacterial spores, viruses and some vegetative bacteria such as Streptococcus faecium and Micrococcus radiodurans are distinguished by high radiation resistance. In order to lay a theoretical basis for biomedical sterilization applications, we have investigated the combined action of uv and gamma rays. Spores of two strains of C. botulinum were selected, a highly radiation resistant strain, 33A having a D/sub 10/-value of 0.32 Mrad, and a relatively radiation sensitive strain, 51B having a D/sub 10/-value of 0.12 Mrad. Strain 33A exhibits an extensive initial ''shoulder'' in its uv as well as gamma ray survival curves; strain 51B shows only a slight shoulder. The shoulder in the gamma ray survival curve of spores of strain 33A could be reduced or completely eliminated by preirradiation with uv. Simultaneously the D/sub 10/-value for gamma inactivation of spores of 33A was reduced substantially. For example, the gamma resistance was reduced almost to half of its original D/sub 10/-value by uv-preirradiation for only one minute under an 8 watt GE germicidal lamp. The effect of uv-preirradiation on the radiation sensitive strain 51B was less pronounced. In fact, there was about seven fold higher positive interaction (synergism) between uv and gamma radiation in 33A spores than in 51B spores. The experiments suggest that interference with DNA repair enzymes in the radiation resistant strain are responsible for lethal synergism between uv and gamma radiation. A hypothesis is developed attempting to explain the combined effect of these two radiations in terms of a special summation of known DNA lesions in the cell. These observations emphasize the potential practical advantages of combining uv and gamma rays for effective sterilization of certain biomedical devices, drugs and biologicals.

  19. Optimal spore germination in Clostridium botulinum ATCC 3502 requires the presence of functional copies of SleB and YpeB, but not CwlJ.

    Science.gov (United States)

    Meaney, Carolyn A; Cartman, Stephen T; McClure, Peter J; Minton, Nigel P

    2015-08-01

    Germination, the process by which dormant endospores return to vegetative growth, is a critical process in the life cycle of the notorious pathogen Clostridium botulinum. Crucial is the degradation by hydrolytic enzymes of an inner peptidoglycan spore layer termed the cortex. Two mechanistically different systems of cortex lysis exist in spores of Clostridium species. C. botulinum ATCC 3502 harbours the Bacillus-like system of SleB, CwlJ and YpeB cortex lytic enzymes (CLEs). Through the construction of insertional gene knockout mutants in the sleB, cwlJ and ypeB genes of C. botulinum ATCC 3502 and the production of spores of each mutant strain, the effect on germination was assessed. This study demonstrates a reduced germination efficiency in spores carrying mutations in either sleB or ypeB with an approximate 2-fold reduction in heat resistant colony forming units (CFU/OD600) when plated on rich media. This reduction could be restored to wild-type levels by removing the spore coat and plating on media supplemented with lysozyme. It was observed that cwlJ spores displayed a similar germination efficiency as wild-type spores (P > 0.05). An optimal germinant commixture was identified to include a combination of l-alanine with sodium bicarbonate as it resulted in a 32% drop in OD600, while the additional incorporation of l-lactate resulted in a 57% decrease. Studies of the germination efficiency of spores prepared from all three CLE mutants was performed by monitoring the associated decrease in optical density but a germination defect was not observed in any of the CLE mutant strains. This was likely due to the lack of specificity of this particular assay. Taken together, these data indicate that functional copies of SleB and YpeB, but not CwlJ are required for the optimal germination of the spores of C. botulinum ATCC 3502. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Reduction of Growth and Reproduction of the Biotrophic Fungus Blumeria graminis in the Presence of a Necrotrophic Pathogen.

    Science.gov (United States)

    Orton, Elizabeth S; Brown, James K M

    2016-01-01

    Crops are attacked by many potential pathogens with differing life-history traits, which raises the question of whether or not the outcome of infection by one pathogen may be modulated by a change in the host environment brought on by infection by another pathogen. We investigated the host-mediated interaction between the biotroph Blumeria graminis f.sp. tritici (Bgt), the powdery mildew pathogen of wheat, and the necrotroph Zymoseptoria tritici, which has a long latent, endophytic phase following which it switches to a necrotrophic phase, resulting in the disease symptoms of Septoria tritici blotch. Both diseases are potentially severe in humid temperate climates and are controlled by fungicides and by growing wheat varieties with partial resistance. The compatible interaction between Z. tritici and the host reduced the number, size, and reproductive capacity of mildew colonies that a normally virulent Bgt isolate would produce but did not significantly alter the early development of Bgt on the leaf. The effect on virulent Bgt was elicited only by viable spores of Z. tritici. Notably, this effect was seen before the necrotic foliar symptoms induced by Z. tritici were visible, which implies there is a physiological interaction during the latent, endophytic period of Z. tritici, which either takes place directly between this fungus and Bgt or is mediated by the wheat leaf. Information on how different pathogens interact in host plants may allow plant breeders and others to improve the design of screening trials and selection of germplasm.

  1. Reduction of growth and reproduction of the biotrophic fungus Blumeria graminis in the presence of a necrotrophic pathogen

    Directory of Open Access Journals (Sweden)

    Elizabeth S. Orton

    2016-05-01

    Full Text Available Crops are attacked by many potential pathogens with differing life-history traits, which raises the question of whether or not the outcome of infection by one pathogen may be modulated by a change in the host environment brought on by infection by another pathogen. We investigated the host-mediated interaction between the biotroph Blumeria graminis f.sp. tritici (Bgt, the powdery mildew pathogen of wheat, and the necrotroph Zymoseptoria tritici, which has a long latent, endophytic phase following which it switches to a necrotrophic phase, resulting in the disease symptoms of Septoria tritici blotch. Both diseases are potentially severe in humid temperate climates and are controlled by fungicides and by growing wheat varieties with partial resistance. The compatible interaction between Z. tritici and the host reduced the number, size and reproductive capacity of mildew colonies that a normally virulent Bgt isolate would produce but did not significantly alter the early development of Bgt on the leaf. The effect on virulent Bgt was elicited only by viable spores of Z. tritici. Notably, this effect was seen before the necrotic foliar symptoms induced by Z. tritici were visible, which implies there is a physiological interaction during the latent, endophytic period of Z. tritici, which either takes place directly between this fungus and Bgt or is mediated by the wheat leaf. Information on how different pathogens interact in host plants may allow plant breeders and others to improve the design of screening trials and selection of germplasm.

  2. The Master Transcription Factor mtfA Governs Aflatoxin Production, Morphological Development and Pathogenicity in the Fungus Aspergillus flavus

    Directory of Open Access Journals (Sweden)

    Zhenhong Zhuang

    2016-01-01

    Full Text Available Aspergillus flavus produces a variety of toxic secondary metabolites; among them, the aflatoxins (AFs are the most well known. These compounds are highly mutagenic and carcinogenic, particularly AFB1. A. flavus is capable of colonizing a number of economically-important crops, such as corn, cotton, peanut and tree nuts, and contaminating them with AFs. Molecular genetic studies in A. flavus could identify novel gene targets for use in strategies to reduce AF contamination and its adverse impact on food and feed supplies worldwide. In the current study, we investigated the role of the master transcription factor gene mtfA in A. flavus. Our results revealed that forced overexpression of mtfA results in a drastic decrease or elimination of several secondary metabolites, among them AFB1. The reduction in AFB1 was accompanied by a decrease in aflR expression. Furthermore, mtfA also regulates development; conidiation was influenced differently by this gene depending on the type of colonized substrate. In addition to its effect on conidiation, mtfA is necessary for the normal maturation of sclerotia. Importantly, mtfA positively affects the pathogenicity of A. flavus when colonizing peanut seeds. AF production in colonized seeds was decreased in the deletion mtfA strain and particularly in the overexpression strain, where only trace amounts were detected. Interestingly, a more rapid colonization of the seed tissue occurred when mtfA was overexpressed, coinciding with an increase in lipase activity and faster maceration of the oily part of the seed.

  3. Decontamination of Bacillus subtilis var. niger spores on selected surfaces by chlorine dioxide gas*

    Science.gov (United States)

    Li, Yan-ju; Zhu, Neng; Jia, Hai-quan; Wu, Jin-hui; Yi, Ying; Qi, Jian-cheng

    2012-01-01

    Objective: Chlorine dioxide (CD) gas has been used as a fumigant in the disinfection of biosafety laboratories. In this study, some experiments were conducted to assess the inactivation of spores inoculated on six materials [stainless steel (SS), painted steel (PS), polyvinyl chlorid (PVC), polyurethane (PU), glass (GS), and cotton cloth (CC)] by CD gas. The main aims of the study were to determine the sporicidal efficacy of CD gas and the effect of prehumidification before decontamination on sporicidal efficacy. Methods: Material coupons (1.2 cm diameter of SS, PS, and PU; 1.0 cm×1.0 cm for PVC, GS, and CC) were contaminated with 10 μl of Bacillus subtilis var. niger (ATCC 9372) spore suspension in mixed organic burden and then dried in a biosafety cabinet for 12 h. The spores were recovered by soaking the coupons in 5 ml of extraction liquid for 1 h and then vortexing the liquid for 1 min. Results: The log reductions in spore numbers on inoculated test materials exposed to CD gas [0.080% (volume ratio, v/v) for 3 h] were in the range of from 1.80 to 6.64. Statistically significant differences were found in decontamination efficacies on test material coupons of SS, PS, PU, and CC between with and without a 1-h prehumidification treatment. With the extraction method, there were no statistically significant differences in the recovery ratios between the porous and non-porous materials. Conclusions: The results reported from this study could provide information for developing decontamination technology based on CD gas for targeting surface microbial contamination. PMID:22467366

  4. Response surface modeling for the inactivation of Bacillus subtilis subsp. niger spores by chlorine dioxide gas in an enclosed space.

    Science.gov (United States)

    Wang, Tao; Qi, Jiancheng; Wu, Jinhui; Hao, Limei; Yi, Ying; Lin, Song; Zhang, Zongxing

    2016-05-01

    Bacillus subtilis subsp. niger spores are a commonly used biological indicator to evaluate the disinfection of an enclosed space. In the present study, chlorine dioxide (ClO2) gas was applied to inactivate B. subtilis subsp. niger spores in an enclosed space. The effects of the ClO2 gas concentration (1-3 mg/l), relative humidity (RH, 30-70%) and exposure time (30-90 min) were investigated using a response surface methodology (RSM). A three-factor Box-Behnken experimental design was used. The obtained data were adequately fitted to a second-order polynomial model with an R2adj of 0.992. The ClO2 gas concentration, RH and exposure time all significantly (Pgas concentration and RH as well as that between the exposure time and RH indicated significant and synergistic effects (Pgas. The inactivation of indoor biological contaminants plays an important role in preventing the transmission of pathogens and ensuring human safety. The predictive model using response surface methodology indicates the influence and interaction of the main factors on the inactivation of Bacillus subtilis subsp. niger spores by ClO2 gas, and can predict a ClO2 gas treatment condition to achieve an effective sterilization of enclosed spaces. The results in this paper will provide a reference for the application of ClO2 gas treatments for indoor disinfection.

  5. Scanning Surface Potential Microscopy of Spore Adhesion on Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ida [University of Tennessee, Knoxville (UTK); Chung, Eunhyea [Georgia Institute of Technology; Kweon, Hyojin [Georgia Institute of Technology; Yiacoumi, Sotira [Georgia Institute of Technology; Tsouris, Costas [ORNL

    2012-01-01

    The adhesion of spores of Bacillus anthracis - the cause of anthrax and a likely biological threat - to solid surfaces is an important consideration in cleanup after an accidental or deliberate release. However, because of safety concerns, directly studying B. anthracis spores with advanced instrumentation is problematic. As a first step, we are examining the electrostatic potential of Bacillus thuringiensis (Bt), which is a closely related species that is often used as a simulant to study B. anthracis. Scanning surface potential microscopy (SSPM), also known as Kelvin probe force microscopy (KPFM), was used to investigate the influence of relative humidity (RH) on the surface electrostatic potential of Bt that had adhered to silica, mica, or gold substrates. AFM/SSPM side-by-side images were obtained separately in air, at various values of RH, after an aqueous droplet with spores was applied on each surface and allowed to dry before measurements. In the SSPM images, a negative potential on the surface of the spores was observed compared with that of the substrates. The surface potential decreased as the humidity increased. Spores were unable to adhere to a surface with an extremely negative potential, such as mica.

  6. Scanning surface potential microscopy of spore adhesion on surfaces.

    Science.gov (United States)

    Lee, I; Chung, E; Kweon, H; Yiacoumi, S; Tsouris, C

    2012-04-01

    The adhesion of spores of Bacillus anthracis - the cause of anthrax and a likely biological threat - to solid surfaces is an important consideration in cleanup after an accidental or deliberate release. However, because of safety concerns, directly studying B. anthracis spores with advanced instrumentation is problematic. As a first step, we are examining the electrostatic potential of Bacillus thuringiensis (Bt), which is a closely related species that is often used as a simulant to study B. anthracis. Scanning surface potential microscopy (SSPM), also known as Kelvin probe force microscopy (KPFM), was used to investigate the influence of relative humidity (RH) on the surface electrostatic potential of Bt that had adhered to silica, mica, or gold substrates. AFM/SSPM side-by-side images were obtained separately in air, at various values of RH, after an aqueous droplet with spores was applied on each surface and allowed to dry before measurements. In the SSPM images, a negative potential on the surface of the spores was observed compared with that of the substrates. The surface potential decreased as the humidity increased. Spores were unable to adhere to a surface with an extremely negative potential, such as mica. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Germination of Bacillus cereus spores adhered to stainless steel.

    Science.gov (United States)

    Hornstra, L M; de Leeuw, P L A; Moezelaar, R; Wolbert, E J; de Vries, Y P; de Vos, W M; Abee, T

    2007-05-30

    Adhered spores of Bacillus cereus represent a significant part of the surface-derived contamination in processing equipment used in the dairy industry. As germinated spores lose their resistance capacities instantaneously, efficient germination prior to a cleaning in place treatment could aid to the disinfecting effect of such a treatment. Therefore, spores of B. cereus ATCC 14579 and that of the environmental isolate B. cereus CMCC 3328 were assessed for their germination behaviour when adhered to a stainless steel surface. A mixture of l-alanine and inosine initiated germination of adhered spores efficiently, resulting in 3.2 decimal logarithms of germination. Notably, implementation of a germination-inducing step prior to a representative cleaning in place procedure reduced the number of survivors with over 3 decimal log units, while an alkali treatment alone, as part of the cleaning in place procedure, did not show any effect on B. cereus spore viability. These results show that implementation of a germination step enhances the disinfection effect of currently used cleaning in place procedures.

  8. Daily variations of Alternaria spores in the city of Murcia (semi-arid southeastern Spain)

    Science.gov (United States)

    Munuera Giner, M.; Carrión García, J. S.

    1995-12-01

    Annual variations in the abundance of Alternaria spores were related to the length of the spore period for data from Murcia (southeastern Spain). To understand the relationship between the number of spores and climatic factors, Alternaria spore counts for March 1993 to February 1994 were examined by means of correlation and regression analyses with fourteen different weather parameters. The results indicated that there was a tendency for Alternaria spore concentrations to increase with increases in temperature, wind speed and hours of sunshine. Negative correlations were observed with air pressure, wind direction and humidity. Theoretical curves for Alternaria spore counts are given in relation to temperatures during the period studied.

  9. Spore analysis and tetrad dissection of Schizosaccharomyces pombe

    DEFF Research Database (Denmark)

    Ekwall, Karl; Thon, Genevieve

    2017-01-01

    Here we describe the processing of Schizosaccharomyces pombe spores in batches (random spore analysis) or through tetrad dissections. Spores are usually prepared from matings between haploid strains (producing zygotic asci) or from sporulating diploids (producing azygotic asci). In random spore...... analysis, a snail enzyme preparation is used to digest the walls of asci to release free spores that are diluted and plated to form colonies. In tetrad dissection, a needle attached to a micromanipulator is used to pick asci and separate spores. Tetrad dissection has traditionally been the method of choice...

  10. Comparative evaluation of eleven commercial DNA extraction kits for real-time PCR detection of Bacillus anthracis spores in spiked dairy samples.

    Science.gov (United States)

    Mertens, Katja; Freund, Lisa; Schmoock, Gernot; Hänsel, Christoph; Melzer, Falk; Elschner, Mandy C

    2014-01-17

    Spores of Bacillus anthracis are highly resistant and can survive conditions used for food preservation. Sample size and complexity represent the major hurdles for pathogen detection in food-related settings. Eleven commercial DNA extraction kits were evaluated for detection of B. anthracis spores by quantitative real-time PCR (qPCR) in dairy products. DNA was extracted from serial dilutions of B. anthracis spores in milk powder, cream cheese, whole milk and buttermilk. Three kits (QIAamp DNA mini kit, Invisorb Food kit I and II) were determined to produce the lowest limit of detections (LODs) with equally good performance. These kits employed lysozyme and proteinase K treatments or proteinase K in combination with cethyltrimethylamonium bromide-mediated (CTAB) precipitation of cell debris for cell disruption and DNA release. The LODs for these three kits were determined as 10(2) spores/ml of distilled water, 10(3)s pores/20 mg of powdered milk and 10(4) spores/100 mg of cream cheese, respectively. Performance testing of the QIAamp DNA mini kit demonstrated a good reproducibility and appropriate detection limits from 10(3)/ml for butter milk, 10(4)/ml for whole milk and 10(4)/100 mg for low fat cream cheese. However, DNA extraction efficiency was strongly inhibited by cream cheese with higher fat contents with an increased LOD of 10(6)/100 mg spores. This study demonstrated that qPCR detection depends directly on the appropriate DNA extraction method for an individual food matrix and bacterial agent. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Integration of Membrane Distillation with solar photo-Fenton for purification of water contaminated with Bacillus sp. and Clostridium sp. spores.

    Science.gov (United States)

    Ruiz-Aguirre, A; Polo-López, M I; Fernández-Ibáñez, P; Zaragoza, G

    2017-10-01

    Although Membrane Distillation (MD) has been extensively studied for desalination, it has other applications like removing all kinds of solutes from water and concentrating non-volatile substances. MD offers the possibility of producing a clean stream while concentrating valuable compounds from waste streams towards their recovery, or emerging contaminants and pathogens present in wastewater in order to facilitate their chemical elimination. This paper analyses the elimination of bacterial spores from contaminated water with MD and the role of MD in the subsequent treatment of the concentrate with photo-Fenton process. The experiments were performed at Plataforma Solar de Almería (PSA) using a plate and frame bench module with a Permeate Gap Membrane Distillation (PGMD) configuration. Tests were done for two different kinds of spores in two different water matrixes: distilled water with 3.5wt% of sea salts contaminated with spores of Bacillus subtilis (B. subtilis) and wastewater after a secondary treatment and still contaminated with Clostridium sp. spores. An analysis of the permeate was performed in all cases to determine its purity, as well as the concentrated stream and its further treatment in order to assess the benefits of using MD. Results showed a permeate free of spores in all the cases, demonstrating the viability of MD to treat biological contaminated wastewater for further use in agriculture. Moreover, the results obtained after treating the concentrate with photo-Fenton showed a shorter treatment time for the reduction of the spore concentration in the water than that when only photo-Fenton was used. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    International Nuclear Information System (INIS)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-01

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10 −1 genomic equivalent ml −1 . An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP internal

  13. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira

    Energy Technology Data Exchange (ETDEWEB)

    Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Mohamed, Maizan [Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, City Campus, Pengkalan Chepa, Locked Bag 36, 16100 Kota Bharu, Kelantan (Malaysia); Yean, Chan Yean, E-mail: yeancyn@yahoo.com [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Institute for Research in Molecular Medicine (INFORMM), Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia)

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10{sup −1} genomic equivalent ml{sup −1}. An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP

  14. Children developing asthma by school-age display aberrant immune responses to pathogenic airway bacteria as infants

    DEFF Research Database (Denmark)

    Larsen, Jeppe Madura; Pedersen, Susanne Brix; Thysen, Anna Hammerich

    2014-01-01

    Asthma is a highly prevalent chronic lung disease that commonly originates in early childhood. Colonisation of neonatal airways with the pathogenic bacterial strains H. influenzae, M. catarrhalis and S. pneumoniae is associated with increased risk of later childhood asthma. We hypothesized...

  15. Bacillus thuringiensis Is an Environmental Pathogen and Host-Specificity Has Developed as an Adaptation to Human-Generated Ecological Niches

    Science.gov (United States)

    Argôlo-Filho, Ronaldo Costa; Loguercio, Leandro Lopes

    2013-01-01

    Bacillus thuringiensis (Bt) has been used successfully as a biopesticide for more than 60 years. More recently, genes encoding their toxins have been used to transform plants and other organisms. Despite the large amount of research on this bacterium, its true ecology is still a matter of debate, with two major viewpoints dominating: while some understand Bt as an insect pathogen, others see it as a saprophytic bacteria from soil. In this context, Bt’s pathogenicity to other taxa and the possibility that insects may not be the primary targets of Bt are also ideas that further complicate this scenario. The existence of conflicting research results, the difficulty in developing broader ecological and genetics studies, and the great genetic plasticity of this species has cluttered a definitive concept. In this review, we gathered information on the aspects of Bt ecology that are often ignored, in the attempt to clarify the lifestyle, mechanisms of transmission and target host range of this bacterial species. As a result, we propose an integrated view to account for Bt ecology. Although Bt is indeed a pathogenic bacterium that possesses a broad arsenal for virulence and defense mechanisms, as well as a wide range of target hosts, this seems to be an adaptation to specific ecological changes acting on a versatile and cosmopolitan environmental bacterium. Bt pathogenicity and host-specificity was favored evolutionarily by increased populations of certain insect species (or other host animals), whose availability for colonization were mostly caused by anthropogenic activities. These have generated the conditions for ecological imbalances that favored dominance of specific populations of insects, arachnids, nematodes, etc., in certain areas, with narrower genetic backgrounds. These conditions provided the selective pressure for development of new hosts for pathogenic interactions, and so, host specificity of certain strains. PMID:26462580

  16. Pollen and spores as a passive monitor of ultraviolet radiation

    Directory of Open Access Journals (Sweden)

    Wesley Toby Fraser

    2014-04-01

    Full Text Available Sporopollenin is the primary component of the outer walls of pollen and spores. The chemical composition of sporopollenin is responsive to levels of ultraviolet (UV radiation exposure, via a concomitant change in the concentration of phenolic compounds. This relationship offers the possibility of using fossil pollen and spore chemistry as a novel proxy for past UV flux. Phenolic compounds in sporopollenin can be quantified using Fourier Transform infrared spectroscopy. The high potential for preservation of pollen and spores in the geologic record, and the conservative nature of sporopollenin chemistry across the land plant phylogeny, means that this new proxy has the potential to reconstruct UV flux over much longer timescales than has previously been possible. This new tool has important implications for understanding the relationship between UV flux, solar insolation and climate in the past, as well as providing a possible means of assessing paleoaltitude, and ozone thickness.

  17. Mutagenic effect of tritated water on spores of Bacillus subtilis

    International Nuclear Information System (INIS)

    Tanooka, H.; Munakata, N.

    1978-01-01

    The mutagenic effect of tritiated water was observed with spores of Bacillus subtilis polA strain suspended in 50 mCi/ml of tritiated water for various intervals. Dose rate given by tritium beta particles to spore core was estimated to be 400 rad/hr from some assumptions and E. coli data computed by Bockrath et al. and Sands et al. The initial mutation rate was 4.2 x 10 -9 mutants/rad, as compared with 2.4 x 10 -9 mutants/rad for 60 Co γ rays and 3.3 x 10 -9 mutants/rad for 30-kVp x rays. The mutagenic effect of tritiated water on spores is most likely due to beta particle ionizing radiation damage

  18. Evolutionary stasis of sporopollenin biochemistry revealed by unaltered Pennsylvanian spores.

    Science.gov (United States)

    Fraser, W T; Scott, A C; Forbes, A E S; Glasspool, I J; Plotnick, R E; Kenig, F; Lomax, B H

    2012-10-01

    The biopolymer sporopollenin present in the spore/pollen walls of all land plants is regarded as one of the most recalcitrant biomacromolecules (biopolymers), providing protection against a range of abiotic stresses. This long-term stability is demonstrated by the near-ubiquitous presence of pollen and spores in the fossil record with spores providing the first evidence for the colonization of the land. Here, we report for the first time chemical analyses of geologically unaltered sporopollenin from Pennsylvanian (c. 310 million yr before present (MyBP)) cave deposits. Our data show that Pennsylvanian Lycophyta megaspore sporopollenin has a strong chemical resemblance to extant relatives and indicates that a co-polymer model of sporopollenin formation is the most likely configuration. Broader comparison indicates that extant sporopollenin structure is similar across widely spaced phylogenetic groups and suggests land plant sporopollenin structure has remained stable since embryophytes invaded land. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  19. Effect of irradiation of bacteria on the formation of spores

    International Nuclear Information System (INIS)

    Szulc, M.; Tropilo, J.; Olszewski, G.

    1980-01-01

    Studies were carried out on bacteria: Bac. subtilis, Bac. cereus, Cl. perfringens, Cl. botulinum which were irradiated in two media (PBS and broth containing 1% of protein) with 100, 1000, 5000 and 10 000 X-radiation doses. The results obtained show that: all bacteria species studied (vegetative forms) are characterized by a high sensitivity to X-radiation, though distinctly lower than the species of Enterobacteriaceae family; the bacteria species studied are characterized by various sporing rate. The highest sporing rate was shown by Bac. cereus, the following: Bac. subtilis, Cl. perfringens and Cl. botulinum; increased X-radiation doses weaken sporing of Bac. subtilis and Bac. cereus. This effect could not be observed in Cl. perfringens and Cl. botulinum. (author)

  20. MPLEx: a method for simultaneous pathogen inactivation and extraction of samples for multi-omics profiling

    Energy Technology Data Exchange (ETDEWEB)

    Burnum-Johnson, Kristin E.; Kyle, Jennifer E.; Eisfeld, Amie J.; Casey, Cameron P.; Stratton, Kelly G.; Gonzalez, Juan F.; Habyarimana, Fabien; Negretti, Nicholas M.; Sims, Amy C.; Chauhan, Sadhana; Thackray, Larissa B.; Halfmann, Peter J.; Walters, Kevin B.; Kim, Young-Mo; Zink, Erika M.; Nicora, Carrie D.; Weitz, Karl K.; Webb-Robertson, Bobbie-Jo M.; Nakayasu, Ernesto S.; Ahmer, Brian; Konkel, Michael E.; Motin, Vladimir; Baric, Ralph S.; Diamond, Michael S.; Kawaoka, Yoshihiro; Waters, Katrina M.; Smith, Richard D.; Metz, Thomas O.

    2017-01-01

    The continued emergence and spread of infectious agents is of increasing concern due to increased population growth and the associated increased livestock production to meet food demands, increased urbanization and land-use changes, and greater travel. A systems biology approach to infectious disease research can significantly advance our understanding of host-pathogen relationships and facilitate the development of new therapies and vaccines. Molecular characterization of infectious samples outside of appropriate biosafety containment can only take place subsequent to pathogen inactivation. Herein, we describe a modified Folch extraction using chloroform/methanol that facilitates the molecular characterization of infectious samples by enabling simultaneous pathogen inactivation and extraction of proteins, metabolites, and lipids for subsequent mass spectrometry-based multi-omics measurements. This metabolite, protein and lipid extraction (MPLEx) method resulted in complete inactivation of bacterial and viral pathogens with exposed lipid membranes, including Yersinia pestis, Salmonella Typhimurium, and Campylobacter jejuni in pure culture, and Yersinia pestis, Campylobacter jejuni, West Nile, MERS-CoV, Ebola, and influenza H7N9 viruses in infection studies. Partial inactivation was observed for pathogens without exposed lipid membranes including 99.99% inactivation of community-associated methicillin-resistant Staphylococcus aureus, 99.6% and >99% inactivation of Clostridium difficile spores and vegetative cells, respectively, and 50% inactivation of adenovirus type 5. To demonstrate that MPLEx yields biomaterial of sufficient quality for subsequent multi-omics analyses, we highlight select proteomics, metabolomics and lipidomics data from human epithelial lung cells infected with wild-type and mutant forms of influenza H7N9. We believe that MPLEx will facilitate systems biology studies of infectious samples by enabling simultaneous pathogen inactivation and multi

  1. In vitro propagation of Cyathea atrovirens (Cyatheaceae: spore storage and sterilization conditions

    Directory of Open Access Journals (Sweden)

    Isabel Beatriz de Vargas

    2014-03-01

    Full Text Available Cyathea atrovirens occurs in a wide range of habitats in Brazil, Paraguay, Uruguay and Argentina. In the Brazilian State of Rio Grande do Sul, this commonly found species is a target of intense exploitation, because of its ornamental characteristics. The in vitro cultura is an important tool for propagation which may contribute toward the reduction of extractivism. However, exogenous contamination of spores is an obstacle for the success of aseptic long-term cultures. This study evaluated the influence of different sterilization methods combined with storage conditions on the contamination of the in vitro cultures and the gametophytic development of C. atrovirens, in order to establish an efficient propagation protocol. Spores were obtained from plants collected in Novo Hamburgo, State of Rio Grande do Sul, Brazil. In the first experiment, spores stored at 7oC were surface sterilized with 0.5, 0.8 and 2% of sodium hypochlorite (NaClO for 15 minutes and sown in Meyer’s culture medium. The cultures were maintained in a growth room at 26±1ºC for a 12-h photoperiod and photon flux density of 100μmol/m²/s provided by cool white fluorescent light. Contamination was assessed at 60 days, and gametophytic development was scored at 30, 60, 120 and 130 days of in vitro culture, analyzing 300 individuals for each treatment. There was no significant difference in culture contamination among the different sodium hypochlorite concentrations tested, and all treatments allowed for the development of cordiform gametophytes at 130 days of culture. In the second experiment, spores stored at 7 and -20°C were divided into two groups. Half of the spores were surface sterilized with 2% of NaClO for 15 minutes and the other half was not sterilized. All spores were sown in Meyer’s medium supplemented with one of the following antibiotics: nystatin, Micostatin® and actidione. The culture conditions and the procedures used for evaluating contamination and

  2. Human pathogen avoidance adaptations

    NARCIS (Netherlands)

    Tybur, J.M.; Lieberman, D.

    2016-01-01

    Over the past few decades, researchers have become increasingly interested in the adaptations guiding the avoidance of disease-causing organisms. Here we discuss the latest developments in this area, including a recently developed information-processing model of the adaptations underlying pathogen

  3. Development of multiplex loop mediated isothermal amplification (m-LAMP) label-based gold nanoparticles lateral flow dipstick biosensor for detection of pathogenic Leptospira.

    Science.gov (United States)

    Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean

    2016-01-15

    In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Discrimination of Spore-Forming Bacilli Using spoIVA

    Science.gov (United States)

    Venkateswaran, Kasthuri; LaDuc, Myron; Stuecker, Tara

    2009-01-01

    A method of discriminating between spore-forming and non-spore-forming bacteria is based on a combination of simultaneous sporulation-specific and non-sporulation-specific quantitative polymerase chain reactions (Q-PCRs). The method was invented partly in response to the observation that for the purposes of preventing or reducing biological contamination affecting many human endeavors, ultimately, only the spore-forming portions of bacterial populations are the ones that are problematic (or, at least, more problematic than are the non-spore-forming portions). In some environments, spore-forming bacteria constitute small fractions of the total bacterial populations. The use of sporulation-specific primers in Q-PCR affords the ability to assess the spore-forming fraction of a bacterial population present in an environment of interest. This assessment can provide a more thorough and accurate understanding of the bacterial contamination in the environment, thereby making it possible to focus contamination- testing, contamination-prevention, sterilization, and decontamination resources more economically and efficiently. The method includes the use of sporulation-specific primers in the form of designed, optimized deoxyribonucleic acid (DNA) oligonucleotides specific for the bacterial spoIVA gene (see table). [In "spoIVA," "IV" signifies Roman numeral four and the entire quoted name refers to gene A for the fourth stage of sporulation.] These primers are mixed into a PCR cocktail with a given sample of bacterial cells. A control PCR cocktail into which are mixed universal 16S rRNA primers is also prepared. ["16S rRNA" denotes a ribosomal ribonucleic acid (rRNA) sequence that is common to all organisms.] Following several cycles of heating and cooling according to the PCR protocol to amplify amounts of DNA molecules, the amplification products can be analyzed to determine the types of bacterial cells present within the samples. If the amplification product is strong

  5. Architecture and Assembly of the Bacillus subtilis Spore Coat

    Science.gov (United States)

    2014-09-26

    483 489. 15. Abhyankar W, Ter Beek A, Dekker H, Kort R, Brul S, et al. (2011) Gel-free proteomic identification of the Bacillus subtilis insoluble coat... identification of additional sporulation genes in Bacillus subtilis. J Mol Biol 327: 945 972. AFM of Spore Coat Architecture PLOS ONE | www.plosone.org 16 September 2014 | Volume 9 | Issue 9 | e108560 ...1ITLE AND SUBTITLE 5a CONTRACTNUMBER Architecture and assembly of the Bacillus subtilis spore coat W911NF-09-l-0286 5b. GRANT NUMBER 5c. PROGRAM

  6. Physical determinants of radiation sensitivity in bacterial spores

    International Nuclear Information System (INIS)

    Powers, E.L.

    1982-01-01

    Several factors modifying radiation sensitivity in dry bacterial spores are described and discussed. Vacuum inducing the loss of critical structural water, very low dose rates of radiation from which the cell may recover, radiations of high linear energy transfer, and the action of temperature over long periods of time on previously irradiated cells are recognized from extensive laboratory work as important in determining survival of spores exposed to low radiation doses at low temperatures for long periods of time. Some extensions of laboratory work are proposed

  7. Influence of heat and radiation on the germinability and viability of B. cereus BIS-59 spores

    International Nuclear Information System (INIS)

    Kamat, A.S.; Lewis, N.F.

    1983-01-01

    Spores of Bicillus cereus BIS-59, isolated in this laboratory from shrimps, exhibited an exponential gamma radiation survival curve with a d 10 value of 400 krad as compared with a D 10 value of 30 krad for the vegetative cells. The D 10 value of DPA-depleted spores was also 400 krad indicating that DPA does not influence the radiation response of these spores. Maximum germination monitored with irradiated spores was 60 percent as compared with 80 percent in case of unirradiated spores. Radiation-induced inhibition of the germination processes was not dose dependent. Heat treatment (15 min at 80 C) to spores resulted in activation of the germination process; however, increase in heating time (30 min and 60 min) increased the germination lag period. DPA-depleted spores were less heat resistant than normal spores and exhibited biphasic exponential inactivation. (author)

  8. FORMALDEHYDE GAS INACTIVATION OF BACILLUS ANTHRACIS, BACILLUS SUBTILIS AND GEOBACILLUS STEAROTHERMOPHILUS SPORES ON INDOOR SURFACE MATERIALS.

    Science.gov (United States)

    Research evaluated the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface material using formaldehyde gas. Spores were dried on seven types of indoor surfaces and exposed to 1100 ppm formaldehyde gas for 10 hr. Fo...

  9. Development of antimicrobial peptide defenses of southern leopard frogs, Rana sphenocephala, against the pathogenic chytrid fungus, Batrachochytrium dendrobatidis.

    Science.gov (United States)

    Holden, Whitney M; Reinert, Laura K; Hanlon, Shane M; Parris, Matthew J; Rollins-Smith, Louise A

    2015-01-01

    Amphibian species face the growing threat of extinction due to the emerging fungal pathogen Batrachochytrium dendrobatidis, which causes the disease chytridiomycosis. Antimicrobial peptides (AMPs) produced in granular glands of the skin are an important defense against this pathogen. Little is known about the ontogeny of AMP production or the impact of AMPs on potentially beneficial symbiotic skin bacteria. We show here that Rana (Lithobates) sphenocephala produces a mixture of four AMPs with activity against B. dendrobatidis, and we report the minimum inhibitory concentration (MIC) of synthesized replicates of these four AMPs tested against B. dendrobatidis. Using mass spectrometry and protein quantification assays, we observed that R. sphenocephala does not secrete a mature suite of AMPs until approximately 12 weeks post-metamorphosis, and geographically disparate populations produce a different suite of peptides. Use of norepinephrine to induce maximal secretion significantly reduced levels of culturable skin bacteria. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Levels of glycine betaine in growing cells and spores of Bacillus species and lack of effect of glycine betaine on dormant spore resistance.

    Science.gov (United States)

    Loshon, Charles A; Wahome, Paul G; Maciejewski, Mark W; Setlow, Peter

    2006-04-01

    Bacteria of various Bacillus species are able to grow in media with very high osmotic strength in part due to the accumulation of low-molecular-weight osmolytes such as glycine betaine (GB). Cells of Bacillus species grown in rich and minimal media contained low levels of GB, but GB levels were 4- to 60-fold higher in cells grown in media with high salt. GB levels in Bacillus subtilis cells grown in minimal medium were increased approximately 7-fold by GB in the medium and 60-fold by GB plus high salt. GB was present in spores of Bacillus species prepared in media with or without high salt but at lower levels than in comparable growing cells. With spores prepared in media with high salt, GB levels were highest in B. subtilis spores and > or =20-fold lower in B. cereus and B. megaterium spores. Although GB levels in B. subtilis spores were elevated 15- to 30-fold by GB plus high salt in sporulation media, GB levels did not affect spore resistance. GB levels were similar in wild-type B. subtilis spores and spores that lacked major small, acid-soluble spore proteins but were much lower in spores that lacked dipicolinic acid.

  11. Immunolocalization of an alternative respiratory chain in Antonospora (Paranosema) locustae spores: mitosomes retain their role in microsporidial energy metabolism.

    Science.gov (United States)

    Dolgikh, Viacheslav V; Senderskiy, Igor V; Pavlova, Olga A; Naumov, Anton M; Beznoussenko, Galina V

    2011-04-01

    Microsporidia are a group of fungus-related intracellular parasites with severely reduced metabolic machinery. They lack canonical mitochondria, a Krebs cycle, and a respiratory chain but possess genes encoding glycolysis enzymes, a glycerol phosphate shuttle, and ATP/ADP carriers to import host ATP. The recent finding of alternative oxidase genes in two clades suggests that microsporidial mitosomes may retain an alternative respiratory pathway. We expressed the fragments of mitochondrial chaperone Hsp70 (mitHsp70), mitochondrial glycerol-3-phosphate dehydrogenase (mitG3PDH), and alternative oxidase (AOX) from the microsporidium Antonospora (Paranosema) locustae in Escherichia coli. Immunoblotting with antibodies against recombinant polypeptides demonstrated specific accumulation of both metabolic enzymes in A. locustae spores. At the same time comparable amounts of mitochondrial Hsp70 were found in spores and in stages of intracellular development as well. Immunoelectron microscopy of ultrathin cryosections of spores confirmed mitosomal localization of the studied proteins. Small amounts of enzymes of an alternative respiratory chain in merogonial and early sporogonial stages, alongside their accumulation in mature spores, suggest conspicuous changes in components and functions of mitosomes during the life cycle of microsporidia and the important role of these organelles in parasite energy metabolism, at least at the final stages of sporogenesis.

  12. Development of New Therapeutics Targeting Biofilm Formation by the Opportunistic Pulmonary Pathogens Pseudomonas aeruginosa and Aspergillus Fumigatus

    Science.gov (United States)

    2017-10-01

    preliminary data for the preclinical evaluation of pulmonary GH therapy against two of the most important opportunistic pulmonary pathogens. In the long...Marked variation in the half- lives of individual GH proteins were observed, ranging from 3 to 30 hours (see Table 3) Hydrolase Sph3h PelAh Ega3h...matrix can lead to artificially high metabolic readings suggests an important limitation to this assay that was previously unknown. What was the

  13. Evaluating the Sporicidal Activity of Disinfectants againstClostridium difficileandBacillus amyloliquefaciensSpores by Using the Improved Methods Based on ASTM E2197-11.

    Science.gov (United States)

    Uwamahoro, Marie Christine; Massicotte, Richard; Hurtubise, Yves; Gagné-Bourque, François; Mafu, Akier Assanta; Yahia, L'Hocine

    2018-01-01

    Spore-forming pathogenic bacteria, such as Clostridium difficile , are associated with nosocomial infection, leading to the increased use of sporicidal disinfectants, which impacts socioeconomic costs. However, C. difficile can be prevented using microorganisms such as Bacillus amyloliquefaciens , a prophylactic agent that has been proven to be effective against it in recent tests or it can be controlled by sporicidal disinfectants. These disinfectants against spores should be evaluated according to a known and recommended standard. Unfortunately, some newly manufactured disinfectants like Bioxy products have not yet been tested. ASTM E2197-11 is a standard test that uses stainless steel disks (1 cm in diameter) as carriers, and the performance of the test formulation is calculated by comparing the number of viable test organisms to that on the control carriers. Surface tests are preferable for evaluating disinfectants with sporicidal effects on hard surfaces. This study applies improved methods, based on the ASTM E2197-11 standard, for evaluating and comparing the sporicidal efficacies of several disinfectants against spores of C. difficile and B. amyloliquefaciens , which are used as the test organisms. With the improved method, all spores were recovered through vortexing and membrane filtration. The results show that chlorine-based products are effective in 5 min and Bioxy products at 5% w/v are effective in 10 min. Although Bioxy products may take longer to prove their effectiveness, their non-harmful effects to hospital surfaces and people have been well established in the literature.

  14. Monitoring Rates and Heterogeneity of High-Pressure Germination of Bacillus Spores by Phase-Contrast Microscopy of Individual Spores

    Science.gov (United States)

    2014-01-01

    processes also have significant applied interest, since (i) spores are major agents of food spoilage and food poisoning and (ii) spores’ extreme...by U N IV O F C O N N E C T IC U T http://aem .asm .org/ D ow nloaded from needed in conjunction with HP to inactivate bacterial spores and...achieve the commercial sterility of low-acid foods (22). While HP is probably most often used as a single treatment, a number of studies have demonstrated

  15. Observations on the migration of bacillus spores outside a contaminated facility during a decontamination efficacy study

    Science.gov (United States)

    Silvestri, Erin E.; Perkins, Sarah; Lordo, Robert; Kovacik, William; Nichols, Tonya L.; Bowling, Charlena Yoder; Griffin, Dale W.; Schaefer, Frank W.

    2015-01-01

    The potential for an intentional wide-area or indoor release of Bacillus anthracis spores remains a concern, but the fate and transport of B. anthracis spores in indoor and outdoor environments are not well understood. Some studies have examined the possibility of spore transport within ventilation systems and in buildings and transport into a building following an outdoor release. Little research exists regarding the potential for spores to migrate to the outside of a building following an indoor release.

  16. Following Pathogen Development and Gene Expression in a Food Ecosystem: the Case of a Staphylococcus aureus Isolate in Cheese

    Science.gov (United States)

    Aigle, Marina; Fleurot, Renaud; Darrigo, Claire; Hennekinne, Jacques-Antoine; Gruss, Alexandra; Borezée-Durant, Elise; Delacroix-Buchet, Agnès

    2014-01-01

    Human intoxication or infection due to bacterial food contamination constitutes an economic challenge and a public health problem. Information on the in situ distribution and expression of pathogens responsible for this risk is to date lacking, largely because of technical bottlenecks in detecting signals from minority bacterial populations within a complex microbial and physicochemical ecosystem. We simulated the contamination of a real high-risk cheese with a natural food isolate of Staphylococcus aureus, an enterotoxin-producing pathogen responsible for food poisoning. To overcome the problem of a detection limit in a solid matrix, we chose to work with a fluorescent reporter (superfolder green fluorescent protein) that would allow spatiotemporal monitoring of S. aureus populations and targeted gene expression. The combination of complementary techniques revealed that S. aureus localizes preferentially on the cheese surface during ripening. Immunochemistry and confocal laser scanning microscopy enabled us to visualize, in a single image, dairy bacteria and pathogen populations, virulence gene expression, and the toxin produced. This procedure is readily applicable to other genes of interest, other bacteria, and different types of food matrices. PMID:24928871

  17. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Directory of Open Access Journals (Sweden)

    Wynhoven Brian

    2011-03-01

    Full Text Available Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt, we have generated Expressed Sequence Tags (ESTs by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores and asexual (germinated urediniospores stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum, 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs. Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt and stripe rust, P. striiformis f. sp

  18. Gene activity during germination of spores of the fern, Onoclea sensibilis. Cell-free translation analysis of mRNA of spores and the effect of alpha-amanitin on spore germination

    Science.gov (United States)

    Raghavan, V.

    1992-01-01

    Poly(A)-RNA fractions of dormant, dark-imbibed (non-germinating) and photoinduced (germinating) spores of Onoclea sensibilis were poor templates in the rabbit reticulocyte lysate protein synthesizing system, but the translational efficiency of poly(A)+RNA was considerably higher than that of unfractionated RNA. Poly(A)+RNA isolated from photoinduced spores had a consistently higher translational efficiency than poly(A)+RNA from dark-imbibed spores. Analysis of the translation products by one-dimensional polyacrylamide gel electrophoresis showed no qualitative differences in the mRNA populations of dormant, dark-imbibed, and photoinduced spores. However, poly(A)+RNA from dark-imbibed spores appeared to encode in vitro fewer detectable polypeptides at a reduced intensity than photoinduced spores. A DNA clone encoding the large subunit of maize ribulose bisphosphate carboxylase hybridized at strong to moderate intensity to RNA isolated from dark-imbibed spores, indicating the absence of mRNA degradation. Although alpha-amanitin did not inhibit the germination of spores, the drug prevented the elongation of the rhizoid and protonemal initial with a concomitant effect on the synthesis of poly(A)+RNA. These results are consistent with the view that some form of translational control involving stored mRNA operates during dark-imbibition and photoinduced germination of spores.

  19. A new mouse model of lung allergy induced by the spores of Alternaria alternata and Cladosporium herbarum molds

    Science.gov (United States)

    Havaux, X; Zeine, A; Dits, A; Denis, O

    2005-01-01

    Asthma is a serious health problem and during the last decade various experimental models of asthma have been developed to study the pathogenesis of this disease. In this study we describe a new mouse model of asthma that uses the spores of Alternaria alternata and Cladosporium herbarum, two allergenic molds recognized as common inducers of rhinitis and asthma in humans. Here we demonstrate that A. alternata and C. herbarum spores are immunogenic when injected into BALB/c mice, and induce the production of specific IgM and IgG1 antibodies and strongly increase IgE serum levels. To induce the allergic response, mice were sensitized by two intraperitoneal (i.p.) injections and then intranasaly (i.n.) challenged with A. alternata and C. herbarum spores. Bronchoalveolar lavages (BALs) from these mice contained numerous macrophages, neutrophils, eosinophils and lymphocytes whereas neutrophils were the predominant BAL inflammatory cells in nonsensitized mice. Histological studies demonstrated an influx of eosinophils in peri-vascular and peri-bronchial areas and the presence of numerous epithelial goblet cells only in sensitized mice. Increased expression of mRNA specific for various chemokines (eotaxin, MIP-1α, MIP-2) and chemokine receptors (CCR-1, CCR-2 and CCR-5) was observed in the lungs of nonsensitized mice challenged with the spores. Expression of CCR-3 mRNA in the lungs and Th2 cytokine (IL-4, IL-5 and IL-13) secretion in the BAL was additionally observed in sensitized and challenged mice. Finally we demonstrate through whole-body plethysmography that mold spore sensitization and challenge induce the development of an airway hyperreactivity in response to nebulized methacholine. PMID:15654816

  20. Rapid identification of Bacillus anthracis spores in suspicious powder samples by using matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS).

    Science.gov (United States)

    Dybwad, Marius; van der Laaken, Anton L; Blatny, Janet Martha; Paauw, Armand

    2013-09-01

    Rapid and reliable identification of Bacillus anthracis spores in suspicious powders is important to mitigate the safety risks and economic burdens associated with such incidents. The aim of this study was to develop and validate a rapid and reliable laboratory-based matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) analysis method for identifying B. anthracis spores in suspicious powder samples. A reference library containing 22 different Bacillus sp. strains or hoax materials was constructed and coupled with a novel classification algorithm and standardized processing protocol for various powder samples. The method's limit of B. anthracis detection was determined to be 2.5 × 10(6) spores, equivalent to a 55-μg sample size of the crudest B. anthracis-containing powder discovered during the 2001 Amerithrax incidents. The end-to-end analysis method was able to successfully discriminate among samples containing B. anthracis spores, closely related Bacillus sp. spores, and commonly encountered hoax materials. No false-positive or -negative classifications of B. anthracis spores were observed, even when the analysis method was challenged with a wide range of other bacterial agents. The robustness of the method was demonstrated by analyzing samples (i) at an external facility using a different MALDI-TOF MS instrument, (ii) using an untrained operator, and (iii) using mixtures of Bacillus sp. spores and hoax materials. Taken together, the observed performance of the analysis method developed demonstrates its potential applicability as a rapid, specific, sensitive, robust, and cost-effective laboratory-based analysis tool for resolving incidents involving suspicious powders in less than 30 min.

  1. Induction of prophages in spores of Bacillus subtilis by ultraviolet irradiation from synchrotron orbital radiation

    Energy Technology Data Exchange (ETDEWEB)

    Sadaie, Y.; Kada, T.; Ohta, Y. (National Inst. of Genetics, Mishima, Shizuoka (Japan)); Kobayashi, K.; Hieda, K.; Ito, T.

    1984-06-01

    Prophages were induced from Bacillus subtilis spores lysogenic with SP02 by ultraviolet (160 nm to 240 nm) irradiation from synchrotron orbital radiation (SR UV). SR UV at around 220 nm was most effective in the inactivation of spores and prophage induction from lysogenic spores, suggesting that the lesions are produced on the DNA molecule which eventually induces signals to inactivate the phage repressor.

  2. Anthrax surrogate spores are destroyed by PDT mediated by phenothiazinium dyes

    Science.gov (United States)

    Demidova, Tatiana N.; Hamblin, Michael R.

    2005-04-01

    Some Gram-positive bacteria (including the causative agent of anthrax - Bacillus anthracis) survive conditions of stress and starvation by producing dormant stage spores. The spore"s multilayered capsule consists of inner and outer membranes, cortex, proteinaceous spore coat, and in some species an exosporium. These outer layers enclose dehydrated and condensed DNA, saturated with small, acid-soluble proteins. These protective structures make spores highly resistant to damage by heat, radiation, and commonly employed anti-bacterial agents. Previously Bacillus spores have been shown to be resistant to photodynamic inactivation (PDI) using dyes and light that easily destroy the corresponding vegetative bacteria, but recently we have discovered that they are susceptible to PDI. Photoinactivation, however, is only possible if phenothiazinium dyes are used. Dimethylmethylene blue, methylene blue, new methylene blue and toluidine blue O are all effective photosensitizers. Alternative photosensitizers such as Rose Bengal, polylysine chlorin(e6) conjugate, a tricationic porphyrin and benzoporphyrin derivative are ineffective against spores even though they can easily kill vegetative cells. Spores of B. cereus and B. thuringiensis are most susceptible, B. subtilis and B. atrophaeus are also killed, while B. megaterium is resistant. Photoinactivation is most effective when excess dye is washed from the spores showing that the dye binds to the spores and that excess dye in solution can quench light delivery. The relatively mild conditions needed for spore killing could have applications for treating wounds contaminated by anthrax spores and for which conventional sporicides would have unacceptable tissue toxicity.

  3. Spore-killing meiotic drive factors in a natural population of the fungus Podospora anserina

    NARCIS (Netherlands)

    Gaag, van der M.; Debets, A.J.M.; Oosterhof, J.; Slakhorst, S.M.; Thijssen, J.A.G.M.; Hoekstra, R.F.

    2000-01-01

    In fungi, meiotic drive is observed as spore killing. In the secondarily homothallic ascomycete Podospora anserina it is characterized by the abortion of two of the four spores in the ascus. We have identified seven different types of meiotic drive elements (Spore killers). Among 99 isolates from

  4. SporeWeb : an interactive journey through the complete sporulation cycle of Bacillus subtilis

    NARCIS (Netherlands)

    Eijlander, Robyn T.; Jong, Anne de; Krawczyk, Antonina O.; Holsappel, Siger; Kuipers, Oscar P.

    2014-01-01

    Bacterial spores are a continuous problem for both food-based and health-related industries. Decades of scientific research dedicated towards understanding molecular and gene regulatory aspects of sporulation, spore germination and spore properties have resulted in a wealth of data and information.

  5. Adhesion of Spores of Bacillus thuringiensis on a Planar Surface

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Eunhyea [Georgia Institute of Technology; Kweon, Hyojin [Georgia Institute of Technology; Yiacoumi, Sotira [Georgia Institute of Technology; Lee, Ida [University of Tennessee, Knoxville (UTK); Joy, David Charles [ORNL; Palumbo, Anthony Vito [ORNL; Tsouris, Costas [ORNL

    2010-01-01

    Adhesion of spores of Bacillus thuringiensis (Bt) and spherical silica particles on surfaces was experimentally and theoretically investigated in this study. Topography analysis via atomic force microscopy (AFM) and electron microscopy indicates that Bt spores are rod shaped, {approx}1.3 {mu}m in length and {approx}0.8 {mu}m in diameter. The adhesion force of Bt spores and silica particles on gold-coated glass was measured at various relative humidity (RH) levels by AFM. It was expected that the adhesion force would vary with RH because the individual force components contributing to the adhesion force depend on RH. The adhesion force between a particle and a planar surface in atmospheric environments was modeled as the contribution of three major force components: capillary, van der Waals, and electrostatic interaction forces. Adhesion force measurements for Bt spore (silica particle) and the gold surface system were comparable with calculations. Modeling results show that there is a critical RH value, which depends on the hydrophobicity of the materials involved, below which the water meniscus does not form and the contribution of the capillary force is zero. As RH increases, the van der Waals force decreases while the capillary force increases to a maximum value.

  6. Stem rust spores elicit rapid RPG1 phosphorylation

    Science.gov (United States)

    Stem rust threatens cereal production worldwide. Understanding the mechanism by which durable resistance genes, such as Rpg1, function is critical. We show that the RPG1 protein is phosphorylated within 5 min by exposure to spores from avirulent but not virulent races of stem rust. Transgenic mutant...

  7. Increased resistance of environmental anaerobic spores to inactivation by UV

    NARCIS (Netherlands)

    Hijnen, W.A.M.; Veer, A.J. van der; Beerendonk, E.F.; Medema, Gerriet Jan

    2004-01-01

    Water Company Europoort started a pilot plant (MP)UV study to determine the UV-fluence to meet the Dutch drinking water standards. The results of large volume sampling of this pilot plant demonstrated that environmental spores of sulphite-reducing clostridia (SSRC) were highly resistant against UV.

  8. Changes in spore chemistry and appearance with increasing maturity

    NARCIS (Netherlands)

    Fraser, W.T.; Watson, J.S.; Sephton, M.A.; Lomax, B.H.; Harrington, G.; Gosling, W.D.; Self, S.

    2014-01-01

    Sporopollenin is the primary biopolymer found in the walls of pollen and spores; during maturation sporopollenin undergoes a number of discrete chemical changes, despite maintaining identifiable morphological features which can be exploited for palynological study. Here we report the results of

  9. Decontamination of Bacillus spores adhered to iron and ...

    Science.gov (United States)

    Journal Article This study examines the effectiveness of decontaminating Bacillus globigii spores attached to corroded iron and cement-mortar coupons with free chlorine at two pH levels, monochloramine, chlorine dioxide, ozone, peracetic acid (PAA) and acidified nitrite, followed by flushing.

  10. DNA fingerprinting of spore-forming bacterial isolates, using Bacillus ...

    African Journals Online (AJOL)

    User

    Bc-repetitive extragenic palindromic polymerase chain reaction (Bc-Rep PCR) analysis was conducted on seven Bacillus thuringiensis isolates accessed from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) culture collection and on five local isolates of entomopathogenic spore- forming bacteria.

  11. Biomarkers of Aspergillus spores: Strain typing and protein identification

    Czech Academy of Sciences Publication Activity Database

    Šulc, Miroslav; Pešlová, Kateřina; Žabka, Martin; Hajdúch, M.; Havlíček, Vladimír

    2009-01-01

    Roč. 280, 1-3 (2009), s. 162-168 ISSN 1387-3806 R&D Projects: GA MŠk LC07017; GA ČR GP203/05/P575 Institutional research plan: CEZ:AV0Z50200510 Keywords : aspergillus * spore * protein Subject RIV: EE - Microbiology, Virology Impact factor: 2.117, year: 2009

  12. The proteome of spore surface layers in food spoiling bacteria

    NARCIS (Netherlands)

    Abhyankar, W.R.

    2014-01-01

    Endospores are dormant, multilayered, highly resistant cellular structures formed in response to stress by certain bacteria belonging to the genera Bacillus, Clostridium and other related organisms. In presence of nutrients and favorable conditions spores germinate and grow out as normal vegetative

  13. Spore Proteomics: The Past, Present and the Future

    NARCIS (Netherlands)

    Abhyankar, W.; de Koning, L.J.; Brul, S.; de Koster, C.G.

    2014-01-01

    Endospores are metabolically dormant, multi-layered cellular structures formed by Gram positive bacteria belonging to the genera Bacillus, Clostridium and related organisms. Their external layers are composed of proteins which in part play a role in resistance behaviour of spores to varied chemical

  14. Effects of Ingesting Bacillus Thuringiensis (Berliner) Spores on ...

    African Journals Online (AJOL)

    Bacillus thuringiensis Berliner was isolated from dead Sesamia calamistis Hampson (Lepidoptera: Noctuidae) larvae collected from maize farms in Cape Coast, Ghana. Spores produced from the vegetative cells were incorporated into an artificial diet and fed to 2nd instar S. calamistis larvae. The duration of larval and pupal ...

  15. Effects of Ingesting Bacillus Thuringiensis (Berliner) Spores on ...

    African Journals Online (AJOL)

    Effects of Ingesting Bacillus Thuringiensis (Berliner) Spores on Developmental Stages and Fecundity of Surviving Sesamia Calamistis (Hampson) (Lepidoptera: ... The PDF file you selected should load here if your Web browser has a PDF reader plug-in installed (for example, a recent version of Adobe Acrobat Reader).

  16. Spore survival during batch dry rendering of abattoir waste.

    Science.gov (United States)

    Lowry, P D; Fernando, T; Gill, C O

    1979-01-01

    Normal batch dry rendering practice does not ensure sterile products, because bacterial spores are protected against thermal denaturation by the high fat-low water content environment which results from drying the materials at temperatures below those required for sterilization. PMID:117753

  17. DNA fingerprinting of spore-forming bacterial isolates, using Bacillus ...

    African Journals Online (AJOL)

    Bc-repetitive extragenic palindromic polymerase chain reaction (Bc-Rep PCR) analysis was conducted on seven Bacillus thuringiensis isolates accessed from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) culture collection and on five local isolates of entomopathogenic spore-forming bacteria.

  18. Deficiency of the melanin biosynthesis genes SCD1 and THR1 affects sclerotial development and vegetative growth, but not pathogenicity, in Sclerotinia sclerotiorum.

    Science.gov (United States)

    Liang, Yue; Xiong, Wei; Steinkellner, Siegrid; Feng, Jie

    2017-10-11

    The fungus Sclerotinia sclerotiorum is a necrotrophic plant pathogen causing significant damage on a broad range of crops. This fungus produces sclerotia that serve as the long-term survival structures in the life cycle and the primary inoculum in the disease cycle. Melanin plays an important role in protecting mycelia and sclerotia from ultraviolet radiation and other adverse environmental conditions. In this study, two genes, SCD1 encoding a scytalone dehydratase and THR1 encoding a trihydroxynaphthalene reductase, were disrupted by target gene replacement, and their roles in mycelial growth, sclerotial development and fungal pathogenicity were investigated. Phylogenetic analyses indicated that the deduced amino acid sequences of SCD1 and THR1 were similar to the orthologues of Botrytis cinerea. Expression of SCD1 was at higher levels in sclerotia relative to mycelia. THR1 was expressed at similar levels in mycelia and sclerotia at early stages, but was up-regulated in sclerotia at the maturation stage. Disruption of SCD1 or THR1 did not change the pathogenicity of the fungus, but resulted in slower radial growth, less biomass, wider angled hyphal branches, impaired sclerotial development and decreased resistance to ultraviolet light. © 2017 BSPP AND JOHN WILEY & SONS LTD.

  19. Airway inflammation among compost workers exposed to actinomycetes spores

    Directory of Open Access Journals (Sweden)

    Kari Kulvik Heldal

    2015-05-01

    Full Text Available Objectives. To study the associations between exposure to bioaerosols and work-related symptoms, lung function and biomarkers of airway inflammation in compost workers. Materials and method. Personal full-shift exposure measurements were performed on 47 workers employed at five windrow plants (n=20 and five reactor plants (n=27. Samples were analyzed for endotoxins, bacteria, fungal and actinomycetes spores. Health examinations were performed on workers and 37 controls before and after work on the day exposure was measured. The examinations included symptoms recorded by questionnaire, lung function by spirometry and nasal dimensions by acoustic rhinometry (AR. The pneumoproteins CC16, SP-D and SP-A were measured in a blood sample drawn at the end of the day. Results. The levels of endotoxins (median 3 EU/m[sup]3[/sup] , range 0–730 EU/m[sup]3[/sup] and actinomycetes spores (median 0.2 × 10[sup]6[/sup] spores/m[sup]3[/sup] , range 0–590 × 10[sup]6[/sup] spores/m[sup]3[/sup] were significantly higher in reactor plants compared to windrow plants. However, windrow composting workers reported more symptoms than reactor composting workers, probably due to use of respiratory protection. Exposure-response relationships between actinomycetes spores exposure and respiratory effects, found as cough and nose irritation during a shift, was significantly increased (OR 4.3, 95% CI 1.1–16, OR 6.1, 95% CI 1.5–25, respectively, p<0.05 among workers exposed to 0.02–0.3 × 10[sup]6[/sup] actinomycetes spores/m 3 , and FEV1/FVC% decreased cross shift (b=–3.2, SE=1.5%, p<0.01. Effects were weaker in the highest exposed group, but these workers used respiratory protection, frequently limiting their actual exposure. No relationships were found between exposure and pneumoprotein concentrations. Conclusions. The major agent in the aerosol generated at compost plants was actinomycetes spores which was associated with work related cough symptoms and work

  20. Development and field application of a molecular probe for the primary pathogen of the coral disease white plague type II

    Directory of Open Access Journals (Sweden)

    Laurie L Richardson

    2005-05-01

    Full Text Available One of the current problems in the field of coral disease research is that of tracking coral pathogens in the natural environment.A promising method to do this is by use of pathogen-specific molecular probes. However,this approach has been little used to date.We constructed,and validated in the laboratory,a fluoro-chrome-labeled molecular probe specific to Aurantimonas coralicida ,the bacterial pathogen of the Caribbean coral disease white plague type II (WPII.We then used the probe to test field samples of diseased coral tissue for the presence of this pathogen.Probe design was based on a unique subset (25 nucleotidesof the complete16S rRNA gene sequence derived from a pure culture of the pathogen.The pathogen-specific probe was labeled with the fluorochrome GreenStar*™FITC (fluorescein isothiocyanate,GeneDetect Ltd,New Zealand.As a control, we used the universal eubacterial probe EUB 338,labeled with a different fluorochrome (TRITC,tetra-methyl-rhodamine isothiocyanate.Both probes were applied to laboratory samples of pure cultures of bacteria, and field samples collected from the surface of the disease line of corals exhibiting signs of white plague (types I and II,healthy controls,and corals with an uncharacterized disease ("patchy necrosis ".All samples were analyzed using fluorescence in situ hybridization (FISH.We have determined that the probe is specific to our laboratory culture of the coral pathogen,and does not react with other bacterial species (the eubacterial probe does.The WPII pathogen was detected in association with diseased coral samples collected from coral colonies on reefs of the Bahamas (n=9 samplesexhibiting signs of both WPI and WPII.Diseased (and healthytissue samples (n=4from corals exhibiting signs of "patchy necrosis "were also assayed.In this case the results were negative, indicating that the same pathogen is not involved in the two diseases.Incorporation and use of pathogen-specific probes can significantly

  1. EXPERIMENTAL INDUCTION OF LUNG DAMAGE IN THE F344 RAT UPON EXPOSURE TO CITRAL, RETINOIC ACID (ATRA), OVALBUMIN AND MOLD SPORES

    Science.gov (United States)

    Holt-Gray, Carlene; Cameron, Joseph A.; Tucci, Michelle; Cason, Zelma; Benghuzzi, Hamed

    2014-01-01

    The experimental impact of retinoic acid (All Trans Retinoic Acid; ATRA), citrals, ovalbumin and mold spores in the development of lung pathology and tissue remodeling are not well established in the literature. As well, the role of these agents in lung pathology was not ascertained under an in vivo setting. Therefore, it is hypothesized that citrals, ATRA, ovalbumin and mold-spore exposure will sensitize lung tissues and will lead to the development of lung tissue pathology in these animals. The study used an IACUC approved between-subject in vivo randomized split plot factorial design (F344 rat model; N=30). Mold spores were applied to animals by intra-tracheal route whereas vehicle, ovalbumin, C1, C2 and ATRA were administered by intra-peritoneal route. Rat weight data and blood were collected on Days 1 and 21. All animals were sacrificed on day 21 and lung tissues were processed for histopathology. Evidence from weights and blood (ANOVA and Duncan) as well as histopatholgical analysis supported the findings that exposure of these animals to C1, C2, ATRA, ovalbumin and mold spores showed different levels of lung tissue damage representing environmental exposure to these agents. This promising study showed variable lung tissue responses to the administration of ATRA, ovalbumin, citrals, and mold spores in the development of various levels of lung tissue pathologies. PMID:25405452

  2. Foodborne pathogens

    Directory of Open Access Journals (Sweden)

    Thomas Bintsis

    2017-06-01

    Full Text Available Foodborne pathogens are causing a great number of diseases with significant effects on human health and economy. The characteristics of the most common pathogenic bacteria (Bacillus cereus, Campylobacter jejuni, Clostridium botulinum, Clostridium perfringens, Cronobacter sakazakii, Esherichia coli, Listeria monocytogenes, Salmonella spp., Shigella spp., Staphylococccus aureus, Vibrio spp. and Yersinia enterocolitica, viruses (Hepatitis A and Noroviruses and parasites (Cyclospora cayetanensis, Toxoplasma gondii and Trichinella spiralis,