WorldWideScience

Sample records for split trna genes

  1. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  2. Tri-split tRNA is a transfer RNA made from 3 transcripts that provides insight into the evolution of fragmented tRNAs in archaea.

    Science.gov (United States)

    Fujishima, Kosuke; Sugahara, Junichi; Kikuta, Kaoru; Hirano, Reiko; Sato, Asako; Tomita, Masaru; Kanai, Akio

    2009-02-24

    Transfer RNA (tRNA) is essential for decoding the genome sequence into proteins. In Archaea, previous studies have revealed unique multiple intron-containing tRNAs and tRNAs that are encoded on 2 separate genes, so-called split tRNAs. Here, we discovered 10 fragmented tRNA genes in the complete genome of the hyperthermoacidophilic Archaeon Caldivirga maquilingensis that are individually transcribed and further trans-spliced to generate all of the missing tRNAs encoding glycine, alanine, and glutamate. Notably, the 3 mature tRNA(Gly)'s with synonymous codons are created from 1 constitutive 3' half transcript and 4 alternatively switching transcripts, representing tRNA made from a total of 3 transcripts named a "tri-split tRNA." Expression and nucleotide sequences of 10 split tRNA genes and their joined tRNA products were experimentally verified. The intervening sequences of split tRNA have high identity to tRNA intron sequences located at the same positions in intron-containing tRNAs in related Thermoproteales species. This suggests that an evolutionary relationship between intron-containing and split tRNAs exists. Our findings demonstrate the first example of split tRNA genes in a free-living organism and a unique tri-split tRNA gene that provides further insight into the evolution of fragmented tRNAs.

  3. Mitochondrial tRNA gene translocations in highly eusocial bees

    Directory of Open Access Journals (Sweden)

    Daniela Silvestre

    2006-01-01

    Full Text Available Mitochondrial gene rearrangement events, especially involving tRNA genes, have been described more frequently as more complete mitochondrial genome sequences are becoming available. In the present work, we analyzed mitochondrial tRNA gene rearrangements between two bee species belonging to the tribes Apini and Meliponini within the "corbiculate Apidae". Eleven tRNA genes are in different genome positions or strands. The molecular events responsible for each translocation are explained. Considering the high number of rearrangements observed, the data presented here contradict the general rule of high gene order conservation among closely related organisms, and also represent a powerful molecular tool to help solve questions about phylogeny and evolution in bees.

  4. Diversity of human tRNA genes from the 1000-genomes project.

    Science.gov (United States)

    Parisien, Marc; Wang, Xiaoyun; Pan, Tao

    2013-12-01

    The sequence diversity of individual human genomes has been extensively analyzed for variations and phenotypic implications for mRNA, miRNA, and long non-coding RNA genes. TRNA (tRNA) also exhibits large sequence diversity in the human genome, but tRNA gene sequence variation and potential functional implications in individual human genomes have not been investigated. Here we capitalize on the sequencing data from the 1000-genomes project to examine the diversity of tRNA genes in the human population. Previous analysis of the reference human genome indicated an unexpected large number of diverse tRNA genes beyond the necessity of translation, suggesting that some tRNA transcripts may perform non-canonical functions. We found 24 new tRNA sequences in>1% and 76 new tRNA sequences in>0.2% of all individuals, indicating that tRNA genes are also subject to evolutionary changes in the human population. Unexpectedly, two abundant new tRNA genes contain base-pair mismatches in the anticodon stem. We experimentally determined that these two new tRNAs have altered structures in vitro; however, one new tRNA is not aminoacylated but extremely stable in HeLa cells, suggesting that this new tRNA can be used for non-canonical function. Our results show that at the scale of human population, tRNA genes are more diverse than conventionally understood, and some new tRNAs may perform non-canonical, extra-translational functions that may be linked to human health and disease.

  5. Analysis of the complement and molecular evolution of tRNA genes in cow

    Directory of Open Access Journals (Sweden)

    Barris Wesley C

    2009-04-01

    Full Text Available Abstract Background Detailed information regarding the number and organization of transfer RNA (tRNA genes at the genome level is becoming readily available with the increase of DNA sequencing of whole genomes. However the identification of functional tRNA genes is challenging for species that have large numbers of repetitive elements containing tRNA derived sequences, such as Bos taurus. Reliable identification and annotation of entire sets of tRNA genes allows the evolution of tRNA genes to be understood on a genomic scale. Results In this study, we explored the B. taurus genome using bioinformatics and comparative genomics approaches to catalogue and analyze cow tRNA genes. The initial analysis of the cow genome using tRNAscan-SE identified 31,868 putative tRNA genes and 189,183 pseudogenes, where 28,830 of the 31,868 predicted tRNA genes were classified as repetitive elements by the RepeatMasker program. We then used comparative genomics to further discriminate between functional tRNA genes and tRNA-derived sequences for the remaining set of 3,038 putative tRNA genes. For our analysis, we used the human, chimpanzee, mouse, rat, horse, dog, chicken and fugu genomes to predict that the number of active tRNA genes in cow lies in the vicinity of 439. Of this set, 150 tRNA genes were 100% identical in their sequences across all nine vertebrate genomes studied. Using clustering analyses, we identified a new tRNA-GlyCCC subfamily present in all analyzed mammalian genomes. We suggest that this subfamily originated from an ancestral tRNA-GlyGCC gene via a point mutation prior to the radiation of the mammalian lineages. Lastly, in a separate analysis we created phylogenetic profiles for each putative cow tRNA gene using a representative set of genomes to gain an overview of common evolutionary histories of tRNA genes. Conclusion The use of a combination of bioinformatics and comparative genomics approaches has allowed the confident identification of a

  6. The structure and function of tRNA genes of higher eukaryotes.

    Science.gov (United States)

    Kubli, E

    1981-01-15

    The most recent findings concerning the structure and function of tRNA genes of higher eukaryotes are discussed in an exemplary way. The tRNA genes of higher organisms are either dispersed or clustered at different sites of the genome. Clusters contain tRNA genes oriented in both directions and on both strands of the DNA with spacers of various length inbetween. Some genes contain intervening sequences close to the 3' side of the anticodon. The primary transcription product possesses a 5' leader and a 3' trailer sequence which are removed by several maturation steps in a strict temporal and spacial order. Internal transcription control regions (promotors) are located at the 5' and 3' ends of the mature tRNA coding section of the tRNA gene. External sequences modulating the efficiency of the expression are present at the immediate 5' ends of the genes. Transfer RNA genes are located nonrandomly in the nucleosomes.

  7. Caveolin 3 gene and mitochondrial tRNA methionin gene in ...

    African Journals Online (AJOL)

    ... severe exercise intolerance, lactic acidosis and growth retardation. Since DMD is X-linked maternally inherited disease, mitochondrial mutation in tRNA (Met) gene can be suspected to be the cause for the inefficient splicing of dystrophin gene during its expression and can be implicated as the cause of dystrophin inactive ...

  8. Permuted tRNA genes of Cyanidioschyzon merolae, the origin of the tRNA molecule and the root of the Eukarya domain.

    Science.gov (United States)

    Di Giulio, Massimo

    2008-08-07

    An evolutionary analysis is conducted on the permuted tRNA genes of Cyanidioschyzon merolae, in which the 5' half of the tRNA molecule is codified at the 3' end of the gene and its 3' half is codified at the 5' end. This analysis has shown that permuted genes cannot be considered as derived traits but seem to possess characteristics that suggest they are ancestral traits, i.e. they originated when tRNA molecule genes originated for the first time. In particular, if the hypothesis that permuted genes are a derived trait were true, then we should not have been able to observe that the most frequent class of permuted genes is that of the anticodon loop type, for the simple reason that this class would derive by random permutation from a class of non-permuted tRNA genes, which instead is the rarest. This would not explain the high frequency with which permuted tRNA genes with perfectly separate 5' and 3' halves were observed. Clearly the mechanism that produced this class of permuted genes would envisage the existence, in an advanced stage of evolution, of minigenes codifying for the 5' and 3' halves of tRNAs which were assembled in a permuted way at the origin of the tRNA molecule, thus producing a high frequency of permuted genes of the class here referred. Therefore, this evidence supports the hypothesis that the genes of the tRNA molecule were assembled by minigenes codifying for hairpin-like RNA molecules, as suggested by one model for the origin of tRNA [Di Giulio, M., 1992. On the origin of the transfer RNA molecule. J. Theor. Biol. 159, 199-214; Di Giulio, M., 1999. The non-monophyletic origin of tRNA molecule. J. Theor. Biol. 197, 403-414]. Moreover, the late assembly of the permuted genes of C. merolae, as well as their ancestrality, strengthens the hypothesis of the polyphyletic origins of these genes. Finally, on the basis of the uniqueness and the ancestrality of these permuted genes, I suggest that the root of the Eukarya domain is in the super

  9. Evidence that the mitochondrial leucyl tRNA synthetase (LARS2) gene represents a novel type 2 diabetes susceptibility gene

    DEFF Research Database (Denmark)

    hart, Leen M; Hansen, Torben; Rietveld, Ingrid

    2005-01-01

    Previously, we have shown that a mutation in the mitochondrial DNA-encoded tRNA(Leu(UUR)) gene is associated with type 2 diabetes. One of the consequences of this mutation is a reduced aminoacylation of tRNA(Leu(UUR)). In this study, we have examined whether variants in the leucyl tRNA synthetase...... gene (LARS2), involved in aminoacylation of tRNA(Leu(UUR)), associate with type 2 diabetes. Direct sequencing of LARS2 cDNA from 25 type 2 diabetic subjects revealed eight single nucleotide polymorphisms. Two of the variants were examined in 7,836 subjects from four independent populations...... no significant differences in clinical variables between carriers and noncarriers. In this study, we provide evidence that the LARS2 gene may represent a novel type 2 diabetes susceptibility gene. The mechanism by which the H324Q variant enhances type 2 diabetes risk needs to be further established...

  10. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

    International Nuclear Information System (INIS)

    Morgan, E.A.; Nomura, M.

    1979-01-01

    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA 1 /sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA 1 /sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA 1 /sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

  11. Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli.

    Science.gov (United States)

    Mualif, Siti Aisyah; Teow, Sin-Yeang; Omar, Tasyriq Che; Chew, Yik Wei; Yusoff, Narazah Mohd; Ali, Syed A

    2015-01-01

    Relative ease in handling and manipulation of Escherichia coli strains make them primary candidate to express proteins heterologously. Overexpression of heterologous genes that contain codons infrequently used by E. coli is related with difficulties such as mRNA instability, early termination of transcription and/or translation, deletions and/or misincorporation, and cell growth inhibition. These codon bias -associated problems are addressed by co-expressing ColE1-compatible, rare tRNA expressing helper plasmids. However, this approach has inadequacies, which we have addressed by engineering an expression vector that concomitantly expresses the heterologous protein of interest, and rare tRNA genes in E. coli. The expression vector contains three (argU, ileY, leuW) rare tRNA genes and a useful multiple cloning site for easy in-frame cloning. To maintain the overall size of the parental plasmid vector, the rare tRNA genes replaced the non-essential DNA segments in the vector. The cloned gene is expressed under the control of T7 promoter and resulting recombinant protein has a C-terminal 6His tag for IMAC-mediated purification. We have evaluated the usefulness of this expression vector by expressing three HIV-1 genes namely HIV-1 p27 (nef), HIV-1 p24 (ca), and HIV-1 vif in NiCo21(DE3) E.coli and demonstrated the advantages of using expression vector that concomitantly expresses rare tRNA and heterologous genes.

  12. Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA and HIV-1 nef Genes in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Siti Aisyah Mualif

    Full Text Available Relative ease in handling and manipulation of Escherichia coli strains make them primary candidate to express proteins heterologously. Overexpression of heterologous genes that contain codons infrequently used by E. coli is related with difficulties such as mRNA instability, early termination of transcription and/or translation, deletions and/or misincorporation, and cell growth inhibition. These codon bias -associated problems are addressed by co-expressing ColE1-compatible, rare tRNA expressing helper plasmids. However, this approach has inadequacies, which we have addressed by engineering an expression vector that concomitantly expresses the heterologous protein of interest, and rare tRNA genes in E. coli. The expression vector contains three (argU, ileY, leuW rare tRNA genes and a useful multiple cloning site for easy in-frame cloning. To maintain the overall size of the parental plasmid vector, the rare tRNA genes replaced the non-essential DNA segments in the vector. The cloned gene is expressed under the control of T7 promoter and resulting recombinant protein has a C-terminal 6His tag for IMAC-mediated purification. We have evaluated the usefulness of this expression vector by expressing three HIV-1 genes namely HIV-1 p27 (nef, HIV-1 p24 (ca, and HIV-1 vif in NiCo21(DE3 E.coli and demonstrated the advantages of using expression vector that concomitantly expresses rare tRNA and heterologous genes.

  13. Split-Doa10: a naturally split polytopic eukaryotic membrane protein generated by fission of a nuclear gene.

    Directory of Open Access Journals (Sweden)

    Elisabeth Stuerner

    Full Text Available Large polytopic membrane proteins often derive from duplication and fusion of genes for smaller proteins. The reverse process, splitting of a membrane protein by gene fission, is rare and has been studied mainly with artificially split proteins. Fragments of a split membrane protein may associate and reconstitute the function of the larger protein. Most examples of naturally split membrane proteins are from bacteria or eukaryotic organelles, and their exact history is usually poorly understood. Here, we describe a nuclear-encoded split membrane protein, split-Doa10, in the yeast Kluyveromyces lactis. In most species, Doa10 is encoded as a single polypeptide with 12-16 transmembrane helices (TMs, but split-KlDoa10 is encoded as two fragments, with the split occurring between TM2 and TM3. The two fragments assemble into an active ubiquitin-protein ligase. The K. lactis DOA10 locus has two ORFs separated by a 508-bp intervening sequence (IVS. A promoter within the IVS drives expression of the C-terminal KlDoa10 fragment. At least four additional Kluyveromyces species contain an IVS in the DOA10 locus, in contrast to even closely related genera, allowing dating of the fission event to the base of the genus. The upstream Kluyveromyces Doa10 fragment with its N-terminal RING-CH and two TMs resembles many metazoan MARCH (Membrane-Associated RING-CH and related viral RING-CH proteins, suggesting that gene splitting may have contributed to MARCH enzyme diversification. Split-Doa10 is the first unequivocal case of a split membrane protein where fission occurred in a nuclear-encoded gene. Such a split may allow divergent functions for the individual protein segments.

  14. Secondary structure and feature of mitochondrial tRNA genes of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae).

    Science.gov (United States)

    Yoon, Kwang Bae; Park, Yung Chul

    2015-09-01

    The complete mitogenome (NC_021119) of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae) was annotated and characterized in our recent publication (http://www.ncbi.nlm.nih.gov/nuccore/NC_021119). Here we provide additional information on methods in detail for obtaining the complete sequence of M. ussuriensis mitogenome. In addition, we describe characteristics of 22 tRNA genes and secondary structure and feature of 22 tRNAs of M. ussuriensis mitogenome.

  15. Secondary structure and feature of mitochondrial tRNA genes of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae

    Directory of Open Access Journals (Sweden)

    Kwang Bae Yoon

    2015-09-01

    Full Text Available The complete mitogenome (NC_021119 of the Ussurian tube-nosed bat Murina ussuriensis (Chiroptera: Vespertilionidae was annotated and characterized in our recent publication (http://www.ncbi.nlm.nih.gov/nuccore/NC_021119. Here we provide additional information on methods in detail for obtaining the complete sequence of M. ussuriensis mitogenome. In addition, we describe characteristics of 22 tRNA genes and secondary structure and feature of 22 tRNAs of M. ussuriensis mitogenome.

  16. Cardiac abnormalities in diabetic patients with mutation in the mitochondrial tRNA Leu(UUR)Gene

    International Nuclear Information System (INIS)

    Ueno, Hiroshi; Shiotani, Hideyuki

    1999-01-01

    An A-to-G transition at position 3243 of the mitochondrial DNA is known to be a pathogenic factor for mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS), diabetes and cardiomyopathy. This mutation causes dysfunction of the central nervous system in MELAS. Because the heart, as well as the brain and nervous system, is highly dependent on the energy produced by mitochondrial oxidation, these tissues are more vulnerable to mitochondrial defects. Cardiac abnormalities were assessed in 10 diabetic patients associated with this mutation using echocardiography and 123 I-metaiodobenzylguanidine (MIBG) scintigraphy, and compared with 19 diabetic patients without the mutation. Duration of diabetes, therapy, control of blood glucose and diabetic complications, such as diabetic retinopathy and nephropathy, were not different between the 2 groups. Diabetic patients with the mutation had a significantly thicker interventricular septum (16.8±3.7 vs 11.0±1.6 mm, p 0.05). In conclusion, left ventricular hypertrophy with or without abnormal wall motion and severely reduced MIBG uptake may be characteristic in diabetic patients with a mutation in the mitochondrial tRNA Leu(UUR) gene. (author)

  17. An artificial intelligence approach fit for tRNA gene studies in the era of big sequence data.

    Science.gov (United States)

    Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi

    2017-09-12

    Unsupervised data mining capable of extracting a wide range of knowledge from big data without prior knowledge or particular models is a timely application in the era of big sequence data accumulation in genome research. By handling oligonucleotide compositions as high-dimensional data, we have previously modified the conventional self-organizing map (SOM) for genome informatics and established BLSOM, which can analyze more than ten million sequences simultaneously. Here, we develop BLSOM specialized for tRNA genes (tDNAs) that can cluster (self-organize) more than one million microbial tDNAs according to their cognate amino acid solely depending on tetra- and pentanucleotide compositions. This unsupervised clustering can reveal combinatorial oligonucleotide motifs that are responsible for the amino acid-dependent clustering, as well as other functionally and structurally important consensus motifs, which have been evolutionarily conserved. BLSOM is also useful for identifying tDNAs as phylogenetic markers for special phylotypes. When we constructed BLSOM with 'species-unknown' tDNAs from metagenomic sequences plus 'species-known' microbial tDNAs, a large portion of metagenomic tDNAs self-organized with species-known tDNAs, yielding information on microbial communities in environmental samples. BLSOM can also enhance accuracy in the tDNA database obtained from big sequence data. This unsupervised data mining should become important for studying numerous functionally unclear RNAs obtained from a wide range of organisms.

  18. Species Tree Inference from Gene Splits by Unrooted STAR Methods.

    Science.gov (United States)

    Allman, Elizabeth S; Degnan, James H; Rhodes, John A

    2018-01-01

    The method was proposed by Liu and Yu to infer a species tree topology from unrooted topological gene trees. While its statistical consistency under the multispecies coalescent model was established only for a four-taxon tree, simulations demonstrated its good performance on gene trees inferred from sequences for many taxa. Here, we prove the statistical consistency of the method for an arbitrarily large species tree. Our approach connects to a generalization of the STAR method of Liu, Pearl, and Edwards, and a previous theoretical analysis of it. We further show utilizes only the distribution of splits in the gene trees, and not their individual topologies. Finally, we discuss how multiple samples per taxon per gene should be handled for statistical consistency.

  19. Cardiac abnormalities in diabetic patients with mutation in the mitochondrial tRNA {sup Leu(UUR)}Gene

    Energy Technology Data Exchange (ETDEWEB)

    Ueno, Hiroshi [Hyogo Medical Center for Adults, Akashi (Japan); Shiotani, Hideyuki

    1999-11-01

    An A-to-G transition at position 3243 of the mitochondrial DNA is known to be a pathogenic factor for mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS), diabetes and cardiomyopathy. This mutation causes dysfunction of the central nervous system in MELAS. Because the heart, as well as the brain and nervous system, is highly dependent on the energy produced by mitochondrial oxidation, these tissues are more vulnerable to mitochondrial defects. Cardiac abnormalities were assessed in 10 diabetic patients associated with this mutation using echocardiography and {sup 123}I-metaiodobenzylguanidine (MIBG) scintigraphy, and compared with 19 diabetic patients without the mutation. Duration of diabetes, therapy, control of blood glucose and diabetic complications, such as diabetic retinopathy and nephropathy, were not different between the 2 groups. Diabetic patients with the mutation had a significantly thicker interventricular septum (16.8{+-}3.7 vs 11.0{+-}1.6 mm, p<0.001) than those without the mutation. Fractional shortening was lower in diabetic patients with the mutation than those without it (30.7{+-}7.0 vs 42.5{+-}6.6, p<0.001). MIBG uptake on the delayed MIBG image was significantly lower in diabetic patients with the mutation than in those without the mutation (mean value of the heart to mediastinum ratio: 1.6{+-}0.2 vs 2.0{+-}0.4, p>0.05). In conclusion, left ventricular hypertrophy with or without abnormal wall motion and severely reduced MIBG uptake may be characteristic in diabetic patients with a mutation in the mitochondrial tRNA {sup Leu(UUR)} gene. (author)

  20. A Comprehensive tRNA Deletion Library Unravels the Genetic Architecture of the tRNA Pool

    Science.gov (United States)

    Bloom-Ackermann, Zohar; Navon, Sivan; Gingold, Hila; Towers, Ruth; Pilpel, Yitzhak; Dahan, Orna

    2014-01-01

    Deciphering the architecture of the tRNA pool is a prime challenge in translation research, as tRNAs govern the efficiency and accuracy of the process. Towards this challenge, we created a systematic tRNA deletion library in Saccharomyces cerevisiae, aimed at dissecting the specific contribution of each tRNA gene to the tRNA pool and to the cell's fitness. By harnessing this resource, we observed that the majority of tRNA deletions show no appreciable phenotype in rich medium, yet under more challenging conditions, additional phenotypes were observed. Robustness to tRNA gene deletion was often facilitated through extensive backup compensation within and between tRNA families. Interestingly, we found that within tRNA families, genes carrying identical anti-codons can contribute differently to the cellular fitness, suggesting the importance of the genomic surrounding to tRNA expression. Characterization of the transcriptome response to deletions of tRNA genes exposed two disparate patterns: in single-copy families, deletions elicited a stress response; in deletions of genes from multi-copy families, expression of the translation machinery increased. Our results uncover the complex architecture of the tRNA pool and pave the way towards complete understanding of their role in cell physiology. PMID:24453985

  1. Split-hand/split-foot malformation with paternal mutation in the p63 gene.

    NARCIS (Netherlands)

    Witters, I.; Bokhoven, J.H.L.M. van; Goossens, A.; Assche, F.A. van; Fryns, J.P.

    2001-01-01

    We report the prenatal diagnosis at 16 weeks' gestation of bilateral split-hand/split-foot malformation (SHSFM) with severe lobster claw deformity of hands and feet in a male fetus without associated malformations. A minor manifestation of SHSFM was present in the father with only mild bilateral

  2. tRNA - RMG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us RMG tRNA... Data detail Data name tRNA DOI 10.18908/lsdba.nbdc00193-006 Description of data con...tents Data contents are as follows: Amino acid sequences of 23 tRNA from 17 species identified in the rice m...n Amino acids Amino acid binding to tRNA tRNA tRNA gene indicated by the cognate amino acid in one-letter code rice Rice +: tRNA... present -: tRNA absent y: pseudogene a: mitochondrial tRNA b: plastid-like tRNA Miyata

  3. Experimental Confirmation of a Whole Set of tRNA Molecules in Two Archaeal Species

    Directory of Open Access Journals (Sweden)

    Yoh-ichi Watanabe

    2015-01-01

    Full Text Available Based on the genomic sequences for most archaeal species, only one tRNA gene (isodecoder is predicted for each triplet codon. This observation promotes analysis of a whole set of tRNA molecules and actual splicing patterns of interrupted tRNA in one organism. The entire genomic sequences of two Creanarchaeota, Aeropyrum pernix and Sulfolobus tokodaii, were determined approximately 15 years ago. In these genome datasets, 47 and 46 tRNA genes were detected, respectively. Among them, 14 and 24 genes, respectively, were predicted to be interrupted tRNA genes. To confirm the actual transcription of these predicted tRNA genes and identify the actual splicing patterns of the predicted interrupted tRNA molecules, RNA samples were prepared from each archaeal species and used to synthesize cDNA molecules with tRNA sequence-specific primers. Comparison of the nucleotide sequences of cDNA clones representing unspliced and spliced forms of interrupted tRNA molecules indicated that some introns were located at positions other than one base 3' from anticodon region and that bulge-helix-bulge structures were detected around the actual splicing sites in each interrupted tRNA molecule. Whole-set analyses of tRNA molecules revealed that the archaeal tRNA splicing mechanism may be essential for efficient splicing of all tRNAs produced from interrupted tRNA genes in these archaea.

  4. Active Center Control of Termination by RNA Polymerase III and tRNA Gene Transcription Levels In Vivo.

    Directory of Open Access Journals (Sweden)

    Keshab Rijal

    2016-08-01

    Full Text Available The ability of RNA polymerase (RNAP III to efficiently recycle from termination to reinitiation is critical for abundant tRNA production during cellular proliferation, development and cancer. Yet understanding of the unique termination mechanisms used by RNAP III is incomplete, as is its link to high transcription output. We used two tRNA-mediated suppression systems to screen for Rpc1 mutants with gain- and loss- of termination phenotypes in S. pombe. 122 point mutation mutants were mapped to a recently solved 3.9 Å structure of yeast RNAP III elongation complex (EC; they cluster in the active center bridge helix and trigger loop, as well as the pore and funnel, the latter of which indicate involvement of the RNA cleavage domain of the C11 subunit in termination. Purified RNAP III from a readthrough (RT mutant exhibits increased elongation rate. The data strongly support a kinetic coupling model in which elongation rate is inversely related to termination efficiency. The mutants exhibit good correlations of terminator RT in vitro and in vivo, and surprisingly, amounts of transcription in vivo. Because assessing in vivo transcription can be confounded by various parameters, we used a tRNA reporter with a processing defect and a strong terminator. By ruling out differences in RNA decay rates, the data indicate that mutants with the RT phenotype synthesize more RNA than wild type cells, and than can be accounted for by their increased elongation rate. Finally, increased activity by the mutants appears unrelated to the RNAP III repressor, Maf1. The results show that the mobile elements of the RNAP III active center, including C11, are key determinants of termination, and that some of the mutations activate RNAP III for overall transcription. Similar mutations in spontaneous cancer suggest this as an unforeseen mechanism of RNAP III activation in disease.

  5. A split hand-split foot (SHFM3) gene is located at 10q24{yields}25

    Energy Technology Data Exchange (ETDEWEB)

    Gurrieri, F.; Genuardi, M.; Nanni, L.; Sangiorgi, E.; Garofalo, G. [Catholic Univ. of Rome (Italy)] [and others

    1996-04-24

    The split hand-split foot (SHSF) malformation affects the central rays of the upper and lower limbs. It presents either as an isolated defect or in association with other skeletal or non-skeletal abnormalities. An autosomal SHSF locus (SHFM1) was previously mapped to 7q22.1. We report the mapping of a second autosomal SHSF locus to 10q24{yields}25 region. Maximum lod scores of 3.73, 4.33 and 4.33 at a recombination fraction of zero were obtained for the loci D10S198, PAX2 and D10S1239, respectively. An 19 cM critical region could be defined by haplotype analysis and several genes with a potential role in limb morphogenesis are located in this region. Heterogeneity testing indicates the existence of at least one additional autosomal SHSF locus. 36 refs., 3 figs., 3 tabs.

  6. tRNA Biology in Mitochondria

    Directory of Open Access Journals (Sweden)

    Thalia Salinas-Giegé

    2015-02-01

    Full Text Available Mitochondria are the powerhouses of eukaryotic cells. They are considered as semi-autonomous because they have retained genomes inherited from their prokaryotic ancestor and host fully functional gene expression machineries. These organelles have attracted considerable attention because they combine bacterial-like traits with novel features that evolved in the host cell. Among them, mitochondria use many specific pathways to obtain complete and functional sets of tRNAs as required for translation. In some instances, tRNA genes have been partially or entirely transferred to the nucleus and mitochondria require precise import systems to attain their pool of tRNAs. Still, tRNA genes have also often been maintained in mitochondria. Their genetic arrangement is more diverse than previously envisaged. The expression and maturation of mitochondrial tRNAs often use specific enzymes that evolved during eukaryote history. For instance many mitochondria use a eukaryote-specific RNase P enzyme devoid of RNA. The structure itself of mitochondrial encoded tRNAs is also very diverse, as e.g., in Metazoan, where tRNAs often show non canonical or truncated structures. As a result, the translational machinery in mitochondria evolved adapted strategies to accommodate the peculiarities of these tRNAs, in particular simplified identity rules for their aminoacylation. Here, we review the specific features of tRNA biology in mitochondria from model species representing the major eukaryotic groups, with an emphasis on recent research on tRNA import, maturation and aminoacylation.

  7. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  8. Homozygous sequence variants in the WNT10B gene underlie split hand/foot malformation

    Directory of Open Access Journals (Sweden)

    Asmat Ullah

    2018-01-01

    Full Text Available Abstract Split-hand/split-foot malformation (SHFM, also known as ectrodactyly is a rare genetic disorder. It is a clinically and genetically heterogeneous group of limb malformations characterized by absence/hypoplasia and/or median cleft of hands and/or feet. To date, seven genes underlying SHFM have been identified. This study described four consanguineous families (A-D segregating SHFM in an autosomal recessive manner. Linkage in the families was established to chromosome 12p11.1–q13.13 harboring WNT10B gene. Sequence analysis identified a novel homozygous nonsense variant (p.Gln154* in exon 4 of the WNT10B gene in two families (A and B. In the other two families (C and D, a previously reported variant (c.300_306dupAGGGCGG; p.Leu103Argfs*53 was detected. This study further expands the spectrum of the sequence variants reported in the WNT10B gene, which result in the split hand/foot malformation.

  9. Escherichia coli cells expressing a mutant glyV (glycine tRNA) gene have a UVM-constitutive phenotype: implications for mechanisms underlying the mutA or mutC mutator effect.

    Science.gov (United States)

    Murphy, H S; Humayun, M Z

    1997-12-01

    Transfection of M13 single-stranded viral DNA bearing a 3,N4-ethenocytosine lesion into Escherichia coli cells pretreated with UV results in a significant elevation of mutagenesis at the lesion site compared to that observed in untreated cells. This response, termed UVM, for UV modulation of mutagenesis, is induced by a variety of DNA-damaging agents and is distinct from known cellular responses to DNA damage, including the SOS response. This report describes our observation, as a part of our investigation of the UVM phenomenon, that E. coli cells bearing a mutA or mutC allele display a UVM-constitutive phenotype. These mutator alleles were recently mapped (M. M. Slupska, C. Baikalov, R. Lloyd, and J. H. Miller, Proc. Natl. Acad. Sci. USA 93:4380-4385, 1996) to the glyV (mutA) and glyW (mutC) tRNA genes. Each mutant allele was shown to arise by an identical mutation in the anticodon sequence such that the mutant tRNAs could, in principle, mistranslate aspartate codons in mRNA as glycine at a low level. Because a UVM-constitutive phenotype resulting from a mutation in a tRNA gene was unexpected, we undertook a series of experiments designed to test whether the phenotype was indeed mediated by the expression of mutant glycine tRNAs. We placed either a wild-type or a mutant glyV gene under the control of a heterologous inducible promoter on a plasmid vector. E. coli cells expressing the mutant glyV gene displayed all three of the following phenotypes: (i) missense suppression of a test allele, (ii) a mutator phenotype measured by mutation to rifampin resistance, and (iii) a UVM-constitutive phenotype. These phenotypes were not associated with cells expressing the wild-type glyV gene or with cells in which the mutant allele was present but was not transcriptionally induced. These observations provide strong support for the idea that expression of mutant tRNA can confer a mutator phenotype, including the UVM-constitutive phenotype observed in mutA and mutC cells

  10. Digital gene expression analysis of corky split vein caused by boron deficiency in 'Newhall' Navel Orange (Citrus sinensis Osbeck for selecting differentially expressed genes related to vascular hypertrophy.

    Directory of Open Access Journals (Sweden)

    Cheng-Quan Yang

    Full Text Available Corky split vein caused by boron (B deficiency in 'Newhall' Navel Orange was studied in the present research. The boron-deficient citrus exhibited a symptom of corky split vein in mature leaves. Morphologic and anatomical surveys at four representative phases of corky split veins showed that the symptom was the result of vascular hypertrophy. Digital gene expression (DGE analysis was performed based on the Illumina HiSeq™ 2000 platform, which was applied to analyze the gene expression profilings of corky split veins at four morphologic phases. Over 5.3 million clean reads per library were successfully mapped to the reference database and more than 22897 mapped genes per library were simultaneously obtained. Analysis of the differentially expressed genes (DEGs revealed that the expressions of genes associated with cytokinin signal transduction, cell division, vascular development, lignin biosynthesis and photosynthesis in corky split veins were all affected. The expressions of WOL and ARR12 involved in the cytokinin signal transduction pathway were up-regulated at 1(st phase of corky split vein development. Furthermore, the expressions of some cell cycle genes, CYCs and CDKB, and vascular development genes, WOX4 and VND7, were up-regulated at the following 2(nd and 3(rd phases. These findings indicated that the cytokinin signal transduction pathway may play a role in initiating symptom observed in our study.

  11. Selective sweep on human amylase genes postdates the split with Neanderthals

    Science.gov (United States)

    Inchley, Charlotte E.; Larbey, Cynthia D. A.; Shwan, Nzar A. A.; Pagani, Luca; Saag, Lauri; Antão, Tiago; Jacobs, Guy; Hudjashov, Georgi; Metspalu, Ene; Mitt, Mario; Eichstaedt, Christina A.; Malyarchuk, Boris; Derenko, Miroslava; Wee, Joseph; Abdullah, Syafiq; Ricaut, François-Xavier; Mormina, Maru; Mägi, Reedik; Villems, Richard; Metspalu, Mait; Jones, Martin K.; Armour, John A. L.; Kivisild, Toomas

    2016-01-01

    Humans have more copies of amylase genes than other primates. It is still poorly understood, however, when the copy number expansion occurred and whether its spread was enhanced by selection. Here we assess amylase copy numbers in a global sample of 480 high coverage genomes and find that regions flanking the amylase locus show notable depression of genetic diversity both in African and non-African populations. Analysis of genetic variation in these regions supports the model of an early selective sweep in the human lineage after the split of humans from Neanderthals which led to the fixation of multiple copies of AMY1 in place of a single copy. We find evidence of multiple secondary losses of copy number with the highest frequency (52%) of a deletion of AMY2A and associated low copy number of AMY1 in Northeast Siberian populations whose diet has been low in starch content. PMID:27853181

  12. tRNA splicing

    OpenAIRE

    Abelson, John; Trotta, Christopher R.; Li, Hong

    1998-01-01

    Introns interrupt the continuity of many eukaryal genes, and therefore their removal by splicing is a crucial step in gene expression. Interestingly, even within Eukarya there are at least four splicing mechanisms. mRNA splicing in the nucleus takes place in two phosphotransfer reactions on a complex and dynamic machine, the spliceosome. This reaction is related in mechanism to the two self-splicing mechanisms for Group 1 and Group 2 introns. In fact the Group 2 introns are spliced by an iden...

  13. DNA adenine methyltransferase (Dam) controls the expression of the cytotoxic enterotoxin (act) gene of Aeromonas hydrophila via tRNA modifying enzyme-glucose-inhibited division protein (GidA).

    Science.gov (United States)

    Erova, Tatiana E; Kosykh, Valeri G; Sha, Jian; Chopra, Ashok K

    2012-05-01

    Aeromonas hydrophila is both a human and animal pathogen, and the cytotoxic enterotoxin (Act) is a crucial virulence factor of this bacterium because of its associated hemolytic, cytotoxic, and enterotoxic activities. Previously, to define the role of some regulatory genes in modulating Act production, we showed that deletion of a glucose-inhibited division gene (gidA) encoding tRNA methylase reduced Act levels, while overproduction of DNA adenine methyltransferase (Dam) led to a concomitant increase in Act-associated biological activities of a diarrheal isolate SSU of A. hydrophila. Importantly, there are multiple GATC binding sites for Dam within an upstream sequence of the gidA gene and one such target site in the act gene upstream region. We showed the dam gene to be essential for the viability of A. hydrophila SSU, and, therefore, to better understand the interaction of the encoding genes, Dam and GidA, in act gene regulation, we constructed a gidA in-frame deletion mutant of Escherichia coli GM28 (dam(+)) and GM33 (∆dam) strains. We then tested the expressional activity of the act and gidA genes by using a promoterless pGlow-TOPO vector containing a reporter green fluorescent protein (GFP). Our data indicated that in GidA(+) strains of E. coli, constitutive methylation of the GATC site(s) by Dam negatively regulated act and gidA gene expression as measured by GFP production. However, in the ∆gidA strains, irrespective of the presence or absence of constitutively active Dam, we did not observe any alteration in the expression of the act gene signifying the role of GidA in positively regulating Act production. To determine the exact mechanism of how Dam and GidA influence Act, a real-time quantitative PCR (RT-qPCR) assay was performed. The analysis indicated an increase in gidA and act gene expression in the A. hydrophila Dam-overproducing strain, and these data matched with Act production in the E. coli GM28 strain. Thus, the extent of DNA methylation

  14. tRNA sequence data, annotation data and curation data - tRNADB-CE | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us tRNA...DB-CE tRNA sequence data, annotation data and curation data Data detail Data name tRNA s...equence data, annotation data and curation data DOI 10.18908/lsdba.nbdc00720-001 Description of data contents Data of tRNA... search results and curation data. Three prediction programs (tRNAScan-SE, Aragorn and tRNA fi...nder) were used together to search tRNA genes. If the prediction results did not

  15. Analyses of Genomic tRNA Reveal Presence of Novel tRNAs in Oryza sativa

    Science.gov (United States)

    Mohanta, Tapan K.; Bae, Hanhong

    2017-01-01

    Transfer rRNAs are important molecules responsible for the translation event during protein synthesis. tRNAs are widespread found in unicellular to multi-cellular organisms. Analysis of tRNA gene family members in Oryza sativa revealed the presence of 750 tRNA genes distributed unevenly in different chromosomes. The length of O. sativa tRNAs genes were ranged from 66 to 91 nucleotides encoding 52 isoacceptor in total. tRNASer found in chromosome 8 of O. sativa encoded only 66 nucleotides which is the smallest tRNA of O. sativa and to our knowledge, this is the smallest gene of eukaryotic lineage reported so far. Analyses revealed the presence of several novel/pseudo tRNA genes in O. sativa which are reported for the first time. Multiple sequence alignment of tRNAs revealed the presence of family specific conserved consensus sequences. Functional study of these novel tRNA and family specific conserved consensus sequences will be crucial to decipher their importance in biological events. The rate of transition of O. sativa tRNA was found to be higher than the rate of transversion. Evolutionary study revealed, O. sativa tRNAs were evolved from the lineages of multiple common ancestors. Duplication and loss study of tRNAs genes revealed, majority of the O. sativa tRNA were duplicated and 17 of them were found to be undergone loss during the evolution. Orthology and paralogy study showed, the majority of O. sativa tRNA were paralogous and only a few of tRNASer were found to contain orthologous tRNAs. PMID:28713421

  16. The crystal structure of tRNA

    Indian Academy of Sciences (India)

    Madhu

    of yeast alanine tRNA by Robert Holley's group at Cornell. University (lthaca, NY, USA) in 1965, earned Holley a ... 1964, to a staff position at the MRC LMB's Division of. Molecular Genetics, then co-headed by Francis ... purification methods for tRNAs, especially for the initiator. tRNA. We were becoming less interested in ...

  17. Regulation of the Drosophila Enhancer of split and invected-engrailed gene complexes by sister chromatid cohesion proteins.

    Directory of Open Access Journals (Sweden)

    Cheri A Schaaf

    2009-07-01

    Full Text Available The cohesin protein complex was first recognized for holding sister chromatids together and ensuring proper chromosome segregation. Cohesin also regulates gene expression, but the mechanisms are unknown. Cohesin associates preferentially with active genes, and is generally absent from regions in which histone H3 is methylated by the Enhancer of zeste [E(z] Polycomb group silencing protein. Here we show that transcription is hypersensitive to cohesin levels in two exceptional cases where cohesin and the E(z-mediated histone methylation simultaneously coat the entire Enhancer of split and invected-engrailed gene complexes in cells derived from Drosophila central nervous system. These gene complexes are modestly transcribed, and produce seven of the twelve transcripts that increase the most with cohesin knockdown genome-wide. Cohesin mutations alter eye development in the same manner as increased Enhancer of split activity, suggesting that similar regulation occurs in vivo. We propose that cohesin helps restrain transcription of these gene complexes, and that deregulation of similarly cohesin-hypersensitive genes may underlie developmental deficits in Cornelia de Lange syndrome.

  18. Quadruplex DNA formation in a region of the tRNA gene supE associated with hydrogen peroxide mediated mutations

    Energy Technology Data Exchange (ETDEWEB)

    Akman, S.A.; Lingeman, R.G.; Doroshow, J.H.; Smith, S.S. (City of Hope National Medical Center and Beckman Research Inst., Duarte, CA (United States))

    1991-09-03

    A hot spot for H{sub 2}O{sub 2}/Fe-mediated mutation has been observed between bases 154 and 170 of the supF gene in the mutation reporter plasmid pZ189. To further characterize this hot spot, the authors synthesized the 33mer d(pAAAGTGATGGTGGTGGGGGAAGGATTCGAACCT) (pZ33), which is complementary to bases 159-191 of the supF gene. pZ33 annealed spontaneously in 10 mM Tris-HCl (pH 8.0)-1 mM EDTA-100 mM NaCl at 50C into major forms, one of which migrates more slowly than does d(pT){sub 33} on nondenaturing 12% polyacrylamide gels. They propose that this form is a four-stranded structure stabilized by Hoogsteen-type deoxyguanosine quarters involving all deoxyguanosines of the sequence d-(pGGTGGTGGGGG) because of the following: (1) pZ33 migrates as a single form that comigrates with d(pT){sub 33} on denaturing 20% acrylamide-8 M urea gels; (2) annealing an equimolar mixture of 5{prime}-{sup 32}P-labeled pZ33 and the oligodeoxynucleotide d(pTTTTTTTTpZ33TTTTTTTT) (pZ49), as well as 5{prime}-{sup 32}P-labeled pZ49 and pZ33, caused the formation of four, discreet slowly migrating bands on nondenaturing 12% polyacrylamide gels; (3) an oligodeoxynucleotide identical with pZ33 except that every deoxyguanosine has been replaced with deoxyinosine did not anneal into a slowly migrating for; (4) dimethyl sulfate protection studies demonstrated that all deoxyguanosines of the sequence d(pGGTGGTGGGGG) were protected at N-7 in the slowly migrating form but not in single-stranded pZ33. These data suggest that a hot spot for H{sub 2}O{sub 2}/Fe-mediated base substitutions is located adjacent to a sequence that can spontaneously adopt a quadruplex structure in which deoxyguanosine quartets are Hoogsten bonded.

  19. Biosynthesis and functions of sulfur modifications in tRNA

    Directory of Open Access Journals (Sweden)

    Naoki eShigi

    2014-04-01

    Full Text Available Sulfur is an essential element for a variety of cellular constituents in all living organisms. In tRNA molecules, there are many sulfur-containing nucleosides, such as the derivatives of 2‑thiouridine (s2U, 4-thiouridine (s4U, 2-thiocytidine (s2C, and 2-methylthioadenosine (ms2A. Earlier studies established the functions of these modifications for accurate and efficient translation, including proper recognition of the codons in mRNA or stabilization of tRNA structure. In many cases, the biosynthesis of these sulfur modifications starts with cysteine desulfurases, which catalyze the generation of persulfide (an activated form of sulfur from cysteine. Many sulfur-carrier proteins are responsible for delivering this activated sulfur to each biosynthesis pathway. Finally, specific modification enzymes activate target tRNAs and then incorporate sulfur atoms. Intriguingly, the biosynthesis of 2-thiouridine in all domains of life is functionally and evolutionarily related to the ubiquitin-like post-translational modification system of cellular proteins in eukaryotes. This review summarizes the recent characterization of the biosynthesis of sulfur modifications in tRNA and the novel roles of this modification in cellular functions in various model organisms, with a special emphasis on 2-thiouridine derivatives. Each biosynthesis pathway of sulfur-containing molecules is mutually modulated via sulfur trafficking, and 2-thiouridine and codon usage bias have been proposed to control the translation of specific genes.

  20. Osteo-chondroprogenitor-specific deletion of the selenocysteine tRNA gene, Trsp, leads to chondronecrosis and abnormal skeletal development: a putative model for Kashin-Beck disease.

    Directory of Open Access Journals (Sweden)

    Charlene M Downey

    2009-08-01

    Full Text Available Kashin-Beck disease, a syndrome characterized by short stature, skeletal deformities, and arthropathy of multiple joints, is highly prevalent in specific regions of Asia. The disease has been postulated to result from a combination of different environmental factors, including contamination of barley by mold mycotoxins, iodine deficiency, presence of humic substances in drinking water, and, importantly, deficiency of selenium. This multifunctional trace element, in the form of selenocysteine, is essential for normal selenoprotein function, including attenuation of excessive oxidative stress, and for the control of redox-sensitive molecules involved in cell growth and differentiation. To investigate the effects of skeletal selenoprotein deficiency, a Cre recombinase transgenic mouse line was used to trigger Trsp gene deletions in osteo-chondroprogenitors. Trsp encodes selenocysteine tRNA([Ser]Sec, required for the incorporation of selenocysteine residues into selenoproteins. The mutant mice exhibited growth retardation, epiphyseal growth plate abnormalities, and delayed skeletal ossification, as well as marked chondronecrosis of articular, auricular, and tracheal cartilages. Phenotypically, the mice thus replicated a number of the pathological features of Kashin-Beck disease, supporting the notion that selenium deficiency is important to the development of this syndrome.

  1. Gene Synthesis with H G Khorana

    Indian Academy of Sciences (India)

    IAS Admin

    Why synthesize genes? Because of the naiveté of biologists and molecular biologists in 1965 when Gobind Khorana initiated synthesis of the yeast alanine tRNA gene, this was a valid question. At that time, we could deduce the sequence of only one gene – the yeast alanine tRNA gene as the corresponding tRNA.

  2. Embryo splitting

    OpenAIRE

    Karl Illmensee; Mike Levanduski

    2010-01-01

    Mammalian embryo splitting has successfully been established in farm animals. Embryo splitting is safely and efficiently used for assisted reproduction in several livestock species. In the mouse, efficient embryo splitting as well as single blastomere cloning have been developed in this animal system. In nonhuman primates embryo splitting has resulted in several pregnancies. Human embryo splitting has been reported recently. Microsurgical embryo splitting under Institutional Review Board appr...

  3. Embryo splitting

    Directory of Open Access Journals (Sweden)

    Karl Illmensee

    2010-04-01

    Full Text Available Mammalian embryo splitting has successfully been established in farm animals. Embryo splitting is safely and efficiently used for assisted reproduction in several livestock species. In the mouse, efficient embryo splitting as well as single blastomere cloning have been developed in this animal system. In nonhuman primates embryo splitting has resulted in several pregnancies. Human embryo splitting has been reported recently. Microsurgical embryo splitting under Institutional Review Board approval has been carried out to determine its efficiency for blastocyst development. Embryo splitting at the 6–8 cell stage provided a much higher developmental efficiency compared to splitting at the 2–5 cell stage. Embryo splitting may be advantageous for providing additional embryos to be cryopreserved and for patients with low response to hormonal stimulation in assisted reproduction programs. Social and ethical issues concerning embryo splitting are included regarding ethics committee guidelines. Prognostic perspectives are presented for human embryo splitting in reproductive medicine.

  4. Genetic transformation of the tomato pathogen Pyrenochaeta lycopersici allowed gene knockout using a split-marker approach.

    Science.gov (United States)

    Aragona, Maria; Valente, Maria Teresa

    2015-05-01

    Pyrenochaeta lycopersici, as other soil-transmitted fungal pathogens, generally received little attention compared to the pathogens affecting the aerial parts of the plants, although causing stunt and important fruit yield reduction of agronomic relevant crops. The scope of this study was to develop a system allowing to investigate the functional role of P. lycopersici genes putatively involved in the corky root rot of tomato. A genetic transformation system based on a split-marker approach was developed and tested to knock out a P. lycopersici gene encoding for a lytic polysaccharide monooxygenase (Plegl1) induced during the disease development. The regions flanking Plegl1 gene were fused with the overlapping parts of hygromycin marker gene, to favour homologous recombination. We were able to obtain four mutants not expressing the Plegl1 gene though, when tested on a susceptible tomato cultivar, Plegl1 mutants showed unaltered virulence, compared with the wild-type strain. The strategy illustrated in the present work demonstrated for the first time that homologous recombination occurs in P. lycopersici. Moreover, a transformation system mediated by Agrobacterium tumefaciens was established and stable genetic transformants have been obtained. The transformation systems developed represent important tools for investigating both the role of genes putatively involved in P. lycopersici interaction with host plant and the function of other physiological traits which emerged to be genetically expanded from the recent genome sequencing of this fungus.

  5. The first mitochondrial genomes of antlion (Neuroptera: Myrmeleontidae) and split-footed lacewing (Neuroptera: Nymphidae), with phylogenetic implications of Myrmeleontiformia.

    Science.gov (United States)

    Yan, Yan; Wang, Yuyu; Liu, Xingyue; Winterton, Shaun L; Yang, Ding

    2014-01-01

    In the holometabolous insect order Neuroptera (lacewings), the cosmopolitan Myrmeleontidae (antlions) are the most species-rich family, while the closely related Nymphidae (split-footed lacewings) are a small endemic family from the Australian-Malesian region. Both families belong to the suborder Myrmeleontiformia, within which controversial hypotheses on the interfamilial phylogenetic relationships exist. Herein, we describe the complete mitochondrial (mt) genomes of an antlion (Myrmeleon immanis Walker, 1853) and a split-footed lacewing (Nymphes myrmeleonoides Leach, 1814), representing the first mt genomes for both families. These mt genomes are relatively small (respectively composed of 15,799 and 15,713 bp) compared to other lacewing mt genomes, and comprise 37 genes (13 protein coding genes, 22 tRNA genes and two rRNA genes). The arrangement of these two mt genomes is the same as in most derived Neuroptera mt genomes previously sequenced, specifically with a translocation of trnC. The start codons of all PCGs are started by ATN, with an exception of cox1, which is ACG in the M. immanis mt genome and TCG in N. myrmeleonoides. All tRNA genes have a typical clover-leaf structure of mitochondrial tRNA, with the exception of trnS1(AGN). The secondary structures of rrnL and rrnS are similar with those proposed insects and the domain I contains nine helices rather than eight helices, which is common within Neuroptera. A phylogenetic analysis based on the mt genomic data for all Neuropterida sequenced thus far, supports the monophyly of Myrmeleontiformia and the sister relationship between Ascalaphidae and Myrmeleontidae.

  6. Mitochondrial tRNA cleavage by tRNA-targeting ribonuclease causes mitochondrial dysfunction observed in mitochondrial disease

    Energy Technology Data Exchange (ETDEWEB)

    Ogawa, Tetsuhiro, E-mail: atetsu@mail.ecc.u-tokyo.ac.jp; Shimizu, Ayano; Takahashi, Kazutoshi; Hidaka, Makoto; Masaki, Haruhiko, E-mail: amasaki@mail.ecc.u-tokyo.ac.jp

    2014-08-15

    Highlights: • MTS-tagged ribonuclease was translocated successfully to the mitochondrial matrix. • MTS-tagged ribonuclease cleaved mt tRNA and reduced COX activity. • Easy and reproducible method of inducing mt tRNA dysfunction. - Abstract: Mitochondrial DNA (mtDNA) is a genome possessed by mitochondria. Since reactive oxygen species (ROS) are generated during aerobic respiration in mitochondria, mtDNA is commonly exposed to the risk of DNA damage. Mitochondrial disease is caused by mitochondrial dysfunction, and mutations or deletions on mitochondrial tRNA (mt tRNA) genes are often observed in mtDNA of patients with the disease. Hence, the correlation between mt tRNA activity and mitochondrial dysfunction has been assessed. Then, cybrid cells, which are constructed by the fusion of an enucleated cell harboring altered mtDNA with a ρ{sup 0} cell, have long been used for the analysis due to difficulty in mtDNA manipulation. Here, we propose a new method that involves mt tRNA cleavage by a bacterial tRNA-specific ribonuclease. The ribonuclease tagged with a mitochondrial-targeting sequence (MTS) was successfully translocated to the mitochondrial matrix. Additionally, mt tRNA cleavage, which resulted in the decrease of cytochrome c oxidase (COX) activity, was observed.

  7. Plant-Specific Preprotein and Amino Acid Transporter Proteins Are Required for tRNA Import into Mitochondria1[OPEN

    Science.gov (United States)

    Kubiszewski-Jakubiak, Szymon; Teixeira, Pedro F.; Narsai, Reena; Ivanova, Aneta; Megel, Cyrille; Schock, Annette; Kraus, Sabrina; Glaser, Elzbieta; Philippar, Katrin; Maréchal-Drouard, Laurence; Soll, Jürgen

    2016-01-01

    A variety of eukaryotes, in particular plants, do not contain the required number of tRNAs to support the translation of mitochondria-encoded genes and thus need to import tRNAs from the cytosol. This study identified two Arabidopsis (Arabidopsis thaliana) proteins, Tric1 and Tric2 (for tRNA import component), which on simultaneous inactivation by T-DNA insertion lines displayed a severely delayed and chlorotic growth phenotype and significantly reduced tRNA import capacity into isolated mitochondria. The predicted tRNA-binding domain of Tric1 and Tric2, a sterile-α-motif at the C-terminal end of the protein, was required to restore tRNA uptake ability in mitochondria of complemented plants. The purified predicted tRNA-binding domain binds the T-arm of the tRNA for alanine with conserved lysine residues required for binding. T-DNA inactivation of both Tric proteins further resulted in an increase in the in vitro rate of in organello protein synthesis, which was mediated by a reorganization of the nuclear transcriptome, in particular of genes encoding a variety of proteins required for mitochondrial gene expression at both the transcriptional and translational levels. The characterization of Tric1/2 provides mechanistic insight into the process of tRNA import into mitochondria and supports the theory that the tRNA import pathway resulted from the repurposing of a preexisting protein import apparatus. PMID:27789739

  8. Structural rearrangements of the RNA polymerase III machinery during tRNA transcription initiation.

    Science.gov (United States)

    Ramsay, Ewan Phillip; Vannini, Alessandro

    2018-04-01

    RNA polymerase III catalyses the synthesis of tRNAs in eukaryotic organisms. Through combined biochemical and structural characterisation, multiple auxiliary factors have been identified alongside RNA Polymerase III as critical in both facilitating and regulating transcription. Together, this machinery forms dynamic multi-protein complexes at tRNA genes which are required for polymerase recruitment, DNA opening and initiation and elongation of the tRNA transcripts. Central to the function of these complexes is their ability to undergo multiple conformational changes and rearrangements that regulate each step. Here, we discuss the available biochemical and structural data on the structural plasticity of multi-protein complexes involved in RNA Polymerase III transcriptional initiation and facilitated re-initiation during tRNA synthesis. Increasingly, structural information is becoming available for RNA polymerase III and its functional complexes, allowing for a deeper understanding of tRNA transcriptional initiation. This article is part of a Special Issue entitled: SI: Regulation of tRNA synthesis and modification in physiological conditions and disease edited by Dr. Boguta Magdalena. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  9. Saturation of recognition elements blocks evolution of new tRNA identities

    Science.gov (United States)

    Saint-Léger, Adélaïde; Bello, Carla; Dans, Pablo D.; Torres, Adrian Gabriel; Novoa, Eva Maria; Camacho, Noelia; Orozco, Modesto; Kondrashov, Fyodor A.; Ribas de Pouplana, Lluís

    2016-01-01

    Understanding the principles that led to the current complexity of the genetic code is a central question in evolution. Expansion of the genetic code required the selection of new transfer RNAs (tRNAs) with specific recognition signals that allowed them to be matured, modified, aminoacylated, and processed by the ribosome without compromising the fidelity or efficiency of protein synthesis. We show that saturation of recognition signals blocks the emergence of new tRNA identities and that the rate of nucleotide substitutions in tRNAs is higher in species with fewer tRNA genes. We propose that the growth of the genetic code stalled because a limit was reached in the number of identity elements that can be effectively used in the tRNA structure. PMID:27386510

  10. The early history of tRNA recognition by aminoacyl-tRNA synthetases

    Indian Academy of Sciences (India)

    Madhu

    2006-10-04

    Oct 4, 2006 ... of molecular biology were thinking on gene expression and genetic code. In a famous letter send in 1955 to the “RNA Tie. Club” Francis Crick predicted the existence of small adaptor. RNA molecules that would carry their own amino acids and. The early history of tRNA recognition by aminoacyl-tRNA.

  11. The crystal structure of tRNA

    Indian Academy of Sciences (India)

    Madhu

    determination of the 3D structure of the tRNA (in 1974) has not been recognized with such distinction. ... structure: these being led by Aaron Klug at the MRC. Laboratory of Molecular Biology (LMB), Cambridge, UK, ..... by-product of the tRNAPhe structure was the first detailed chemical picture of a G–U base pair in a double ...

  12. Hsp27 gene in Drosophila ananassae subgroup was split by a ...

    Indian Academy of Sciences (India)

    heat shock protein 27 (Hsp27) is a critical single-copy intron-free nuclear gene involved in the defense responseagainst fungi and bacteria, and is a regulator of adult lifespan. In the present study, 33 homologousHsp27nucleotide sequencesfrom differentDrosophilaspecies were amplified by PCR and reverse transcription ...

  13. Hsp27 gene in Drosophila ananassae subgroup was split by a ...

    Indian Academy of Sciences (India)

    Abstract. In Drosophila, heat shock protein 27 (Hsp27) is a critical single-copy intron-free nuclear gene involved in the defense response against fungi and bacteria, and is a regulator of adult lifespan. In the present study, 33 homologous Hsp27 nucleotide sequences from different Drosophila species were amplified by PCR ...

  14. A split and rearranged nuclear gene encoding the iron-sulfur subunit of mitochondrial succinate dehydrogenase in Euglenozoa

    Directory of Open Access Journals (Sweden)

    Gray Michael W

    2009-02-01

    Full Text Available Abstract Background Analyses based on phylogenetic and ultrastructural data have suggested that euglenids (such as Euglena gracilis, trypanosomatids and diplonemids are members of a monophyletic lineage termed Euglenozoa. However, many uncertainties are associated with phylogenetic reconstructions for ancient and rapidly evolving groups; thus, rare genomic characters become increasingly important in reinforcing inferred phylogenetic relationships. Findings We discovered that the iron-sulfur subunit (SdhB of mitochondrial succinate dehydrogenase is encoded by a split and rearranged nuclear gene in Euglena gracilis and trypanosomatids, an example of a rare genomic character. The two subgenic modules are transcribed independently and the resulting mRNAs appear to be independently translated, with the two protein products imported into mitochondria, based on the presence of predicted mitochondrial targeting peptides. Although the inferred protein sequences are in general very divergent from those of other organisms, all of the required iron-sulfur cluster-coordinating residues are present. Moreover, the discontinuity in the euglenozoan SdhB sequence occurs between the two domains of a typical, covalently continuous SdhB, consistent with the inference that the euglenozoan 'half' proteins are functional. Conclusion The discovery of this unique molecular marker provides evidence for the monophyly of Euglenozoa that is independent of evolutionary models. Our results pose questions about the origin and timing of this novel gene arrangement and the structure and function of euglenozoan SdhB.

  15. Translational infidelity-induced protein stress results from a deficiency in Trm9-catalyzed tRNA modifications.

    Science.gov (United States)

    Patil, Ashish; Chan, Clement T Y; Dyavaiah, Madhu; Rooney, John P; Dedon, Peter C; Begley, Thomas J

    2012-07-01

    Correct codon-anticodon pairing promotes translational fidelity, with these interactions greatly facilitated by modified nucleosides found in tRNA. We hypothesized that wobble uridine modifications catalyzed by tRNA methyltransferase 9 (Trm9) are essential for translational fidelity. In support, we have used phenotypic, reporter and protein-based assays to demonstrate increased translational infidelity in trm9Δ Saccharomyces cerevisiae cells. Codon reengineering studies suggest that Trm9-catalyzed tRNA modifications promote fidelity during the translation of specific genes, those rich in arginine and glutamic acid codons from mixed boxes. Using quantitative tRNA modification analysis, we determined that trm9Δ cells are only deficient in 2 of 23 tRNA modifications, with those 2, 5-methoxycarbonylmethyluridine (mcm ( 5) U) and 5-methoxycarbonylmethyl-2-thiouridine (mcm ( 5) s ( 2) U), classified as key determinants of translational fidelity. We also show that in the absence of mcm ( 5) U and mcm ( 5) s ( 2) U, the resulting translational infidelity promotes protein errors and activation of unfolded protein and heat shock responses. These data support a model in which Trm9-catalyzed tRNA modifications promote fidelity during the translation of specific transcripts, with decreased wobble base modification leading to translational infidelity, protein errors and activation of protein stress response pathways.

  16. An efficient gene disruption method using a positive-negative split-selection marker and Agrobacterium tumefaciens-mediated transformation for Nomuraea rileyi.

    Science.gov (United States)

    Su, Yu; Wang, Zhongkang; Shao, Changwen; Luo, Yuanli; Wang, Li; Yin, Youping

    2018-01-16

    Targeted gene disruption via Agrobacterium tumefaciens-mediated transformation (ATMT) and homologous recombination is the most common method used to identify and investigate the functions of genes in fungi. However, the gene disruption efficiency of this method is low due to ectopic integration. In this study, a high-efficiency gene disruption strategy based on ATMT and the split-marker method was developed for use in Nomuraea rileyi. The β-glucuronidase (gus) gene was used as a negative selection marker to facilitate the screening of putative transformants. We assessed the efficacy of this gene disruption method using the NrCat1, NrCat4, and NrPex16 genes and found that the targeting efficiency was between 36.2 and 60.7%, whereas the targeting efficiency using linear cassettes was only 1.0-4.2%. The efficiency of negative selection assays was between 64.1 and 82.3%. Randomly selected deletion mutants exhibited a single copy of the hph cassette. Therefore, high-throughput gene disruption could be possible using the split-marker method and the majority of ectopic integration transformants can be eliminated using negative selection markers. This study provides a platform to study the function of genes in N. rileyi.

  17. Compilation of tRNA sequences.

    Science.gov (United States)

    Sprinzl, M; Grueter, F; Spelzhaus, A; Gauss, D H

    1980-01-11

    This compilation presents in a small space the tRNA sequences so far published. The numbering of tRNAPhe from yeast is used following the rules proposed by the participants of the Cold Spring Harbor Meeting on tRNA 1978 (1,2;Fig. 1). This numbering allows comparisons with the three dimensional structure of tRNAPhe. The secondary structure of tRNAs is indicated by specific underlining. In the primary structure a nucleoside followed by a nucleoside in brackets or a modification in brackets denotes that both types of nucleosides can occupy this position. Part of a sequence in brackets designates a piece of sequence not unambiguosly analyzed. Rare nucleosides are named according to the IUPACIUB rules (for complicated rare nucleosides and their identification see Table 1); those with lengthy names are given with the prefix x and specified in the footnotes. Footnotes are numbered according to the coordinates of the corresponding nucleoside and are indicated in the sequence by an asterisk. The references are restricted to the citation of the latest publication in those cases where several papers deal with one sequence. For additional information the reader is referred either to the original literature or to other tRNA sequence compilations (3-7). Mutant tRNAs are dealt with in a compilation by J. Celis (8). The compilers would welcome any information by the readers regarding missing material or erroneous presentation. On the basis of this numbering system computer printed compilations of tRNA sequences in a linear form and in cloverleaf form are in preparation.

  18. Recombinant human immunodeficiency virus type 1 nucleocapsid (NCp7) protein unwinds tRNA.

    Science.gov (United States)

    Khan, R; Giedroc, D P

    1992-04-05

    The nucleocapsid protein (NC) of all animal retroviruses, encoded by the gag gene, is the major structural protein of the core ribonucleoprotein complex, bound to genomic RNA in mature virions. NC is also thought to play one or more accessory roles in reverse transcription. Mature NC (p7NC) from human immunodeficiency virus type 1 (HIV-1) is a 71-amino acid, basic protein which contains two Cys3His Zn(II) retroviral-type zinc finger domains. Herein, we describe the subcloning and expression of HIV-1 NC, denoted NC71, from an inducible phage T7 RNA polymerase promoter in Escherichia coli. Purified NC71 can be reversibly reconstituted with 2 g.at Zn(II) determined by atomic absorption. Ultraviolet circulation dichroism spectroscopy has been used to characterize the complexes between highly purified NC71 and the RNA homopolynucleotide poly(A) and E. coli tRNA(mixed). On poly(A), Zn2 NC71 is characterized by an apparent site size n = 15 +/- 3 nucleotides and high affinity (Kapp = 3 x 10(7) M-1) and moderately cooperative (omega approximately 170 +/- 25) binding. A mixture of E. coli tRNA species (tRNA(mixed) was used to probe the conformational changes induced in tRNA upon binding of HIV-1 NC71. Two structural forms of tRNA(mixed), which differ in their degree of tertiary structure, were assayed for their susceptibility to denaturation by NC71. Five molar monomer equivalents of NC71 are required to denature the "inactive" tRNA in the absence of Mg2+. A Zn(II)-free, oxidized form of NC71 was also shown to unwind inactive tRNA with the same efficiency and stoichiometry. The detailed spectral changes which occur on NC-induced denaturation closely mimic temperature-induced denaturation of inactive tRNA(mixed). The prototype helix-destabilizing protein, T4 gene 32 protein, is unable to unwind this form of tRNA under the same conditions. The stoichiometry of unwinding of inactive tRNA by NC71 is consistent with the site size determined with poly(A). An "active" form of t

  19. Regulation of tRNA biogenesis in plants and its link to plant growth and response to pathogens.

    Science.gov (United States)

    Soprano, Adriana Santos; Smetana, Juliana Helena Costa; Benedetti, Celso Eduardo

    2017-12-06

    The field of tRNA biology, encompassing the functional and structural complexity of tRNAs, has fascinated scientists over the years and is continuously growing. Besides their fundamental role in protein translation, new evidence indicates that tRNA-derived molecules also regulate gene expression and protein synthesis in all domains of life. This review highlights some of the recent findings linking tRNA transcription and modification with plant cell growth and response to pathogens. In fact, mutations in proteins directly involved in tRNA synthesis and modification most often lead to pleiotropic effects on plant growth and immunity. As plants need to optimize and balance their energy and nutrient resources towards growth and defense, regulatory pathways that play a central role in integrating tRNA transcription and protein translation with cell growth control and organ development, such as the auxin-TOR signaling pathway, also influence the plant immune response against pathogens. As a consequence, distinct pathogens employ an array of effector molecules including tRNA fragments to target such regulatory pathways to exploit the plant's translational capacity, gain access to nutrients and evade defenses. An example includes the RNA polymerase III repressor MAF1, a conserved component of the TOR signaling pathway that controls ribosome biogenesis and tRNA synthesis required for plant growth and which is targeted by a pathogen effector molecule to promote disease. This article is part of a Special Issue entitled: SI: Regulation of tRNA synthesis and modification in physiological conditions and disease edited by Dr. Boguta Magdalena. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli

    OpenAIRE

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M. Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan; Ishihama, Akira

    2016-01-01

    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters rec...

  1. Effects of Heterologous tRNA Modifications on the Production of Proteins Containing Noncanonical Amino Acids.

    Science.gov (United States)

    Crnković, Ana; Vargas-Rodriguez, Oscar; Merkuryev, Anna; Söll, Dieter

    2018-02-02

    Synthesis of proteins with noncanonical amino acids (ncAAs) enables the creation of protein-based biomaterials with diverse new chemical properties that may be attractive for material science. Current methods for large-scale production of ncAA-containing proteins, frequently carried out in Escherichia coli , involve the use of orthogonal aminoacyl-tRNA synthetases (o-aaRSs) and tRNAs (o-tRNAs). Although o-tRNAs are designed to be orthogonal to endogenous aaRSs, their orthogonality to the components of the E. coli metabolism remains largely unexplored. We systematically investigated how the E. coli tRNA modification machinery affects the efficiency and orthogonality of o-tRNA Sep used for production of proteins with the ncAA O- phosphoserine (Sep). The incorporation of Sep into a green fluorescent protein (GFP) in 42 E. coli strains carrying deletions of single tRNA modification genes identified several genes that affect the o-tRNA activity. Deletion of cysteine desulfurase ( iscS ) increased the yield of Sep-containing GFP more than eightfold, while overexpression of dimethylallyltransferase MiaA and pseudouridine synthase TruB improved the specificity of Sep incorporation. These results highlight the importance of tRNA modifications for the biosynthesis of proteins containing ncAAs, and provide a novel framework for optimization of o-tRNAs.

  2. Effects of Heterologous tRNA Modifications on the Production of Proteins Containing Noncanonical Amino Acids

    Directory of Open Access Journals (Sweden)

    Ana Crnković

    2018-02-01

    Full Text Available Synthesis of proteins with noncanonical amino acids (ncAAs enables the creation of protein-based biomaterials with diverse new chemical properties that may be attractive for material science. Current methods for large-scale production of ncAA-containing proteins, frequently carried out in Escherichia coli, involve the use of orthogonal aminoacyl-tRNA synthetases (o-aaRSs and tRNAs (o-tRNAs. Although o-tRNAs are designed to be orthogonal to endogenous aaRSs, their orthogonality to the components of the E. coli metabolism remains largely unexplored. We systematically investigated how the E. coli tRNA modification machinery affects the efficiency and orthogonality of o-tRNASep used for production of proteins with the ncAA O-phosphoserine (Sep. The incorporation of Sep into a green fluorescent protein (GFP in 42 E. coli strains carrying deletions of single tRNA modification genes identified several genes that affect the o-tRNA activity. Deletion of cysteine desulfurase (iscS increased the yield of Sep-containing GFP more than eightfold, while overexpression of dimethylallyltransferase MiaA and pseudouridine synthase TruB improved the specificity of Sep incorporation. These results highlight the importance of tRNA modifications for the biosynthesis of proteins containing ncAAs, and provide a novel framework for optimization of o-tRNAs.

  3. RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification.

    Directory of Open Access Journals (Sweden)

    Aneeshkumar G Arimbasseri

    2015-12-01

    Full Text Available Control of the differential abundance or activity of tRNAs can be important determinants of gene regulation. RNA polymerase (RNAP III synthesizes all tRNAs in eukaryotes and it derepression is associated with cancer. Maf1 is a conserved general repressor of RNAP III under the control of the target of rapamycin (TOR that acts to integrate transcriptional output and protein synthetic demand toward metabolic economy. Studies in budding yeast have indicated that the global tRNA gene activation that occurs with derepression of RNAP III via maf1-deletion is accompanied by a paradoxical loss of tRNA-mediated nonsense suppressor activity, manifested as an antisuppression phenotype, by an unknown mechanism. We show that maf1-antisuppression also occurs in the fission yeast S. pombe amidst general activation of RNAP III. We used tRNA-HydroSeq to document that little changes occurred in the relative levels of different tRNAs in maf1Δ cells. By contrast, the efficiency of N2,N2-dimethyl G26 (m(22G26 modification on certain tRNAs was decreased in response to maf1-deletion and associated with antisuppression, and was validated by other methods. Over-expression of Trm1, which produces m(22G26, reversed maf1-antisuppression. A model that emerges is that competition by increased tRNA levels in maf1Δ cells leads to m(22G26 hypomodification due to limiting Trm1, reducing the activity of suppressor-tRNASerUCA and accounting for antisuppression. Consistent with this, we show that RNAP III mutations associated with hypomyelinating leukodystrophy decrease tRNA transcription, increase m(22G26 efficiency and reverse antisuppression. Extending this more broadly, we show that a decrease in tRNA synthesis by treatment with rapamycin leads to increased m(22G26 modification and that this response is conserved among highly divergent yeasts and human cells.

  4. Splitting Descartes

    DEFF Research Database (Denmark)

    Schilhab, Theresa

    2007-01-01

    Kognition og Pædagogik vol. 48:10-18. 2003 Short description : The cognitivistic paradigm and Descartes' view of embodied knowledge. Abstract: That the philosopher Descartes separated the mind from the body is hardly news: He did it so effectively that his name is forever tied to that division....... But what exactly is Descartes' point? How does the Kartesian split hold up to recent biologically based learning theories?...

  5. Gain-Of-Function Mutational Activation of Human TRNA Synthetase Procytokine

    Energy Technology Data Exchange (ETDEWEB)

    Yang, X.L.; Kapoor, M.; Otero, F.J.; Slike, B.M.; Tsuruta, H.; Frausto, R.; Bates, A.; Ewalt, K.L.; Cheresh, D.A.; Schimmel, P.; /Scripps Res. Inst. /SLAC, SSRL

    2009-04-30

    Disease-causing mutations occur in genes for aminoacyl tRNA synthetases. That some mutations are dominant suggests a gain of function. Native tRNA synthetases, such as tyrosyl-tRNA synthetase (TyrRS) and tryptophanyl-tRNA synthetase, catalyze aminoacylation and are also procytokines that are activated by natural fragmentation. In principle, however, gain-of-function phenotypes could arise from mutational activation of synthetase procytokines. From crystal structure analysis, we hypothesized that a steric block of a critical Glu-Leu-Arg (ELR) motif in full-length TyrRS suppresses the cytokine activity of a natural fragment. To test this hypothesis, we attempted to uncover ELR in the procytokine by mutating a conserved tyrosine (Y341) that tethers ELR. Site-specific proteolytic cleavage and small-angle X-ray scattering established subtle opening of the structure by the mutation. Strikingly, four different assays demonstrated mutational activation of cytokine functions. The results prove the possibilities for constitutive gain-of-function mutations in tRNA synthetases.

  6. RNase MRP cleaves pre-tRNASer-Met in the tRNA maturation pathway.

    Science.gov (United States)

    Saito, Yuichiro; Takeda, Jun; Adachi, Kousuke; Nobe, Yuko; Kobayashi, Junya; Hirota, Kouji; Oliveira, Douglas V; Taoka, Masato; Isobe, Toshiaki

    2014-01-01

    Ribonuclease mitochondrial RNA processing (RNase MRP) is a multifunctional ribonucleoprotein (RNP) complex that is involved in the maturation of various types of RNA including ribosomal RNA. RNase MRP consists of a potential catalytic RNA and several protein components, all of which are required for cell viability. We show here that the temperature-sensitive mutant of rmp1, the gene for a unique protein component of RNase MRP, accumulates the dimeric tRNA precursor, pre-tRNA(Ser-Met). To examine whether RNase MRP mediates tRNA maturation, we purified the RNase MRP holoenzyme from the fission yeast Schizosaccharomyces pombe and found that the enzyme directly and selectively cleaves pre-tRNA(Ser-Met), suggesting that RNase MRP participates in the maturation of specific tRNA in vivo. In addition, mass spectrometry-based ribonucleoproteomic analysis demonstrated that this RNase MRP consists of one RNA molecule and 11 protein components, including a previously unknown component Rpl701. Notably, limited nucleolysis of RNase MRP generated an active catalytic core consisting of partial mrp1 RNA fragments, which constitute "Domain 1" in the secondary structure of RNase MRP, and 8 proteins. Thus, the present study provides new insight into the structure and function of RNase MRP.

  7. Gene Synthesis with HG Khorana

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 17; Issue 12. Gene Synthesis with H G Khorana. Marvin H Caruthers. General Article Volume 17 Issue 12 December 2012 pp ... Keywords. Chemical synthesis of genes for yeast alanine tRNA and E. coli supressor tRNA; Khorana's philosophy on science.

  8. Origins and Early Evolution of the tRNA Molecule

    Directory of Open Access Journals (Sweden)

    Koji Tamura

    2015-12-01

    Full Text Available Modern transfer RNAs (tRNAs are composed of ~76 nucleotides and play an important role as “adaptor” molecules that mediate the translation of information from messenger RNAs (mRNAs. Many studies suggest that the contemporary full-length tRNA was formed by the ligation of half-sized hairpin-like RNAs. A minihelix (a coaxial stack of the acceptor stem on the T-stem of tRNA can function both in aminoacylation by aminoacyl tRNA synthetases and in peptide bond formation on the ribosome, indicating that it may be a vestige of the ancestral tRNA. The universal CCA-3′ terminus of tRNA is also a typical characteristic of the molecule. “Why CCA?” is the fundamental unanswered question, but several findings give a comprehensive picture of its origin. Here, the origins and early evolution of tRNA are discussed in terms of various perspectives, including nucleotide ligation, chiral selectivity of amino acids, genetic code evolution, and the organization of the ribosomal peptidyl transferase center (PTC. The proto-tRNA molecules may have evolved not only as adaptors but also as contributors to the composition of the ribosome.

  9. Origins and Early Evolution of the tRNA Molecule.

    Science.gov (United States)

    Tamura, Koji

    2015-12-03

    Modern transfer RNAs (tRNAs) are composed of ~76 nucleotides and play an important role as "adaptor" molecules that mediate the translation of information from messenger RNAs (mRNAs). Many studies suggest that the contemporary full-length tRNA was formed by the ligation of half-sized hairpin-like RNAs. A minihelix (a coaxial stack of the acceptor stem on the T-stem of tRNA) can function both in aminoacylation by aminoacyl tRNA synthetases and in peptide bond formation on the ribosome, indicating that it may be a vestige of the ancestral tRNA. The universal CCA-3' terminus of tRNA is also a typical characteristic of the molecule. "Why CCA?" is the fundamental unanswered question, but several findings give a comprehensive picture of its origin. Here, the origins and early evolution of tRNA are discussed in terms of various perspectives, including nucleotide ligation, chiral selectivity of amino acids, genetic code evolution, and the organization of the ribosomal peptidyl transferase center (PTC). The proto-tRNA molecules may have evolved not only as adaptors but also as contributors to the composition of the ribosome.

  10. Reverse translocation of tRNA in the ribosome.

    Science.gov (United States)

    Shoji, Shinichiro; Walker, Sarah E; Fredrick, Kurt

    2006-12-28

    A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes containing P-site tRNA. In the latter assay, the rate of tRNA movement is increased by streptomycin and neomycin, decreased by tetracycline, and not affected by the acylation state of the tRNA. In one case, we provide evidence that complex conversion occurs by reverse translocation (i.e., direct movement of the tRNAs from the E and P sites to the P and A sites, respectively). These findings have important implications for the energetics of translocation.

  11. The initiator methionine tRNA drives cell migration and invasion leading to increased metastatic potential in melanoma

    Directory of Open Access Journals (Sweden)

    Joanna Birch

    2016-10-01

    Full Text Available The cell's repertoire of transfer RNAs (tRNAs has been linked to cancer. Recently, the level of the initiator methionine tRNA (tRNAiMet in stromal fibroblasts has been shown to influence extracellular matrix (ECM secretion to drive tumour growth and angiogenesis. Here we show that increased tRNAiMet within cancer cells does not influence tumour growth, but drives cell migration and invasion via a mechanism that is independent from ECM synthesis and dependent on α5β1 integrin and levels of the translation initiation ternary complex. In vivo and ex vivo migration (but not proliferation of melanoblasts is significantly enhanced in transgenic mice which express additional copies of the tRNAiMet gene. We show that increased tRNAiMet in melanoma drives migratory, invasive behaviour and metastatic potential without affecting cell proliferation and primary tumour growth, and that expression of RNA polymerase III-associated genes (which drive tRNA expression are elevated in metastases by comparison with primary tumours. Thus, specific alterations to the cancer cell tRNA repertoire drive a migration/invasion programme that may lead to metastasis.

  12. Biogenesis and function of tRNA fragments during sperm maturation and fertilization in mammals.

    Science.gov (United States)

    Sharma, Upasna; Conine, Colin C; Shea, Jeremy M; Boskovic, Ana; Derr, Alan G; Bing, Xin Y; Belleannee, Clemence; Kucukural, Alper; Serra, Ryan W; Sun, Fengyun; Song, Lina; Carone, Benjamin R; Ricci, Emiliano P; Li, Xin Z; Fauquier, Lucas; Moore, Melissa J; Sullivan, Robert; Mello, Craig C; Garber, Manuel; Rando, Oliver J

    2016-01-22

    Several recent studies link parental environments to phenotypes in subsequent generations. In this work, we investigate the mechanism by which paternal diet affects offspring metabolism. Protein restriction in mice affects small RNA (sRNA) levels in mature sperm, with decreased let-7 levels and increased amounts of 5' fragments of glycine transfer RNAs (tRNAs). In testicular sperm, tRNA fragments are scarce but increase in abundance as sperm mature in the epididymis. Epididymosomes (vesicles that fuse with sperm during epididymal transit) carry RNA payloads matching those of mature sperm and can deliver RNAs to immature sperm in vitro. Functionally, tRNA-glycine-GCC fragments repress genes associated with the endogenous retroelement MERVL, in both embryonic stem cells and embryos. Our results shed light on sRNA biogenesis and its dietary regulation during posttesticular sperm maturation, and they also link tRNA fragments to regulation of endogenous retroelements active in the preimplantation embryo. Copyright © 2016, American Association for the Advancement of Science.

  13. Engineering CRISPR/Cpf1 with tRNA promotes genome editing capability in mammalian systems.

    Science.gov (United States)

    Wu, Han; Liu, Qishuai; Shi, Hui; Xie, Jingke; Zhang, Quanjun; Ouyang, Zhen; Li, Nan; Yang, Yi; Liu, Zhaoming; Zhao, Yu; Lai, Chengdan; Ruan, Degong; Peng, Jiangyun; Ge, Weikai; Chen, Fangbing; Fan, Nana; Jin, Qin; Liang, Yanhui; Lan, Ting; Yang, Xiaoyu; Wang, Xiaoshan; Lei, Zhiyong; Doevendans, Pieter A; Sluijter, Joost P G; Wang, Kepin; Li, Xiaoping; Lai, Liangxue

    2018-04-10

    CRISPR/Cpf1 features a number of properties that are distinct from CRISPR/Cas9 and provides an excellent alternative to Cas9 for genome editing. To date, genome engineering by CRISPR/Cpf1 has been reported only in human cells and mouse embryos of mammalian systems and its efficiency is ultimately lower than that of Cas9 proteins from Streptococcus pyogenes. The application of CRISPR/Cpf1 for targeted mutagenesis in other animal models has not been successfully verified. In this study, we designed and optimized a guide RNA (gRNA) transcription system by inserting a transfer RNA precursor (pre-tRNA) sequence downstream of the gRNA for Cpf1, protecting gRNA from immediate digestion by 3'-to-5' exonucleases. Using this new gRNA tRNA system, genome editing, including indels, large fragment deletion and precise point mutation, was induced in mammalian systems, showing significantly higher efficiency than the original Cpf1-gRNA system. With this system, gene-modified rabbits and pigs were generated by embryo injection or somatic cell nuclear transfer (SCNT) with an efficiency comparable to that of the Cas9 gRNA system. These results demonstrated that this refined gRNA tRNA system can boost the targeting capability of CRISPR/Cpf1 toolkits.

  14. Use of a Yeast tRNase Killer Toxin to Diagnose Kti12 Motifs Required for tRNA Modification by Elongator.

    Science.gov (United States)

    Mehlgarten, Constance; Prochaska, Heike; Hammermeister, Alexander; Abdel-Fattah, Wael; Wagner, Melanie; Krutyhołowa, Rościsław; Jun, Sang Eun; Kim, Gyung-Tae; Glatt, Sebastian; Breunig, Karin D; Stark, Michael J R; Schaffrath, Raffael

    2017-09-05

    Saccharomyces cerevisiae cells are killed by zymocin, a tRNase ribotoxin complex from Kluyveromyces lactis , which cleaves anticodons and inhibits protein synthesis. Zymocin's action requires specific chemical modification of uridine bases in the anticodon wobble position (U34) by the Elongator complex (Elp1-Elp6). Hence, loss of anticodon modification in mutants lacking Elongator or related KTI ( K. lactis Toxin Insensitive) genes protects against tRNA cleavage and confers resistance to the toxin. Here, we show that zymocin can be used as a tool to genetically analyse KTI12 , a gene previously shown to code for an Elongator partner protein. From a kti12 mutant pool of zymocin survivors, we identify motifs in Kti12 that are functionally directly coupled to Elongator activity. In addition, shared requirement of U34 modifications for nonsense and missense tRNA suppression ( SUP4 ; SOE1 ) strongly suggests that Kti12 and Elongator cooperate to assure proper tRNA functioning. We show that the Kti12 motifs are conserved in plant ortholog DRL1/ELO4 from Arabidopsis thaliana and seem to be involved in binding of cofactors (e.g., nucleotides, calmodulin). Elongator interaction defects triggered by mutations in these motifs correlate with phenotypes typical for loss of U34 modification. Thus, tRNA modification by Elongator appears to require physical contact with Kti12, and our preliminary data suggest that metabolic signals may affect proper communication between them.

  15. Loss of wobble uridine modification in tRNA anticodons interferes with TOR pathway signaling.

    Science.gov (United States)

    Scheidt, Viktor; Jüdes, André; Bär, Christian; Klassen, Roland; Schaffrath, Raffael

    2014-11-29

    Previous work in yeast has suggested that modification of tRNAs, in particular uridine bases in the anticodon wobble position (U34), is linked to TOR (target of rapamycin) signaling. Hence, U34 modification mutants were found to be hypersensitive to TOR inhibition by rapamycin. To study whether this involves inappropriate TOR signaling, we examined interaction between mutations in TOR pathway genes ( tip41 ∆, sap190 ∆, ppm1 ∆, rrd1 ∆) and U34 modification defects ( elp3 ∆, kti 12∆, urm1 ∆, ncs2 ∆) and found the rapamycin hypersensitivity in the latter is epistatic to drug resistance of the former. Epistasis, however, is abolished in tandem with a gln3 ∆ deletion, which inactivates transcription factor Gln3 required for TOR-sensitive activation of NCR (nitrogen catabolite repression) genes. In line with nuclear import of Gln3 being under control of TOR and dephosphorylation by the Sit4 phosphatase, we identify novel TOR-sensitive sit4 mutations that confer rapamycin resistance and importantly, mislocalise Gln3 when TOR is inhibited. This is similar to gln3 ∆ cells, which abolish the rapamycin hypersensitivity of U34 modification mutants, and suggests TOR deregulation due to tRNA undermodification operates through Gln3. In line with this, loss of U34 modifications ( elp3 ∆, urm1 ∆) enhances nuclear import of and NCR gene activation ( MEP2 , GAP1 ) by Gln3 when TOR activity is low. Strikingly, this stimulatory effect onto Gln3 is suppressed by overexpression of tRNAs that usually carry the U34 modifications. Collectively, our data suggest that proper TOR signaling requires intact tRNA modifications and that loss of U34 modifications impinges on the TOR-sensitive NCR branch via Gln3 misregulation.

  16. Thiolation Controls Cytoplasmic tRNA Stability and Acts as a Negative Determinant for tRNA Editing in Mitochondria

    Czech Academy of Sciences Publication Activity Database

    Wohlgamuth-Benedum, J. M.; RUBIO, M. A. T.; Paris, Zdeněk; Long, Shaojun; Poliak, Pavel; Lukeš, Julius; Alfonzo, J. D.

    2009-01-01

    Roč. 284, č. 36 (2009), s. 23947-23953 ISSN 0021-9258 R&D Projects: GA ČR GA204/06/1558; GA MŠk LC07032; GA MŠk 2B06129 Institutional research plan: CEZ:AV0Z60220518 Keywords : T. brucei * tRNA * 2-thiolation * Fe-S cluster * editing Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.328, year: 2009

  17. Identity Elements of tRNA as Derived from Information Analysis

    Science.gov (United States)

    Zamudio, Gabriel S.; José, Marco V.

    2018-03-01

    The decipherment of the tRNA's operational code, known as the identity problem, requires the location of the sites in the tRNA structure that are involved in their correct recognition by the corresponding aminoacyl-tRNA synthetase. In this work, we determine the identity elements of each tRNA isoacceptor by means of the variation of information measure from information theory. We show that all isoacceptors exhibit sites associated with some bases of the anticodon. These sites form clusters that are scattered along the tRNA structure. The clusters determine the identity elements of each tRNA. We derive a catalogue of clustered sites for each tRNA that expands previously reported elements.

  18. Capture, unfolding, and detection of individual tRNA molecules using a nanopore device

    Directory of Open Access Journals (Sweden)

    Andrew M Smith

    2015-06-01

    Full Text Available Transfer RNAs (tRNA are the most common RNA molecules in cells and have critical roles as both translators of the genetic code and regulators of protein synthesis. As such, numerous methods have focused on studying tRNA abundance and regulation, with the most widely used methods being RNA-seq and microarrays. Though revolutionary to transcriptomics, these assays are limited by an inability to encode tRNA modifications in the requisite cDNA. These modifications are abundant in tRNA and critical to their function. Here we describe proof-of-concept experiments where individual tRNA molecules are examined as linear strands using a biological nanopore. This method utilizes an enzymatically ligated synthetic DNA adapter to concentrate tRNA at the lipid bilayer of the nanopore device and efficiently denature individual tRNA molecules as they are pulled through the α-hemolysin (α-HL nanopore. Additionally, the DNA adapter provides a loading site for ϕ29 DNA polymerase (ϕ29 DNAP, which acts as a brake on the translocating tRNA. This increases the dwell time of adapted tRNA in the nanopore, allowing us to identify the region of the nanopore signal that is produced by the translocating tRNA itself. Using adapter-modified E. coli tRNAfMet and tRNALys, we show that the nanopore signal during controlled translocation is dependent on the identity of the tRNA. This confirms that adapter-modified tRNA can translocate end-to-end through nanopores and provides the foundation for future work in direct sequencing of individual transfer RNA with a nanopore-based device.

  19. Capture, Unfolding, and Detection of Individual tRNA Molecules Using a Nanopore Device

    Science.gov (United States)

    Smith, Andrew M.; Abu-Shumays, Robin; Akeson, Mark; Bernick, David L.

    2015-01-01

    Transfer RNAs (tRNA) are the most common RNA molecules in cells and have critical roles as both translators of the genetic code and regulators of protein synthesis. As such, numerous methods have focused on studying tRNA abundance and regulation, with the most widely used methods being RNA-seq and microarrays. Though revolutionary to transcriptomics, these assays are limited by an inability to encode tRNA modifications in the requisite cDNA. These modifications are abundant in tRNA and critical to their function. Here, we describe proof-of-concept experiments where individual tRNA molecules are examined as linear strands using a biological nanopore. This method utilizes an enzymatically ligated synthetic DNA adapter to concentrate tRNA at the lipid bilayer of the nanopore device and efficiently denature individual tRNA molecules, as they are pulled through the α-hemolysin (α-HL) nanopore. Additionally, the DNA adapter provides a loading site for ϕ29 DNA polymerase (ϕ29 DNAP), which acts as a brake on the translocating tRNA. This increases the dwell time of adapted tRNA in the nanopore, allowing us to identify the region of the nanopore signal that is produced by the translocating tRNA itself. Using adapter-modified Escherichia coli tRNAfMet and tRNALys, we show that the nanopore signal during controlled translocation is dependent on the identity of the tRNA. This confirms that adapter-modified tRNA can translocate end-to-end through nanopores and provide the foundation for future work in direct sequencing of individual transfer RNA with a nanopore-based device. PMID:26157798

  20. Effect of Correlated tRNA Abundances on Translation Errors and Evolution of Codon Usage Bias

    OpenAIRE

    Shah, Premal; Gilchrist, Michael A.

    2010-01-01

    Despite the fact that tRNA abundances are thought to play a major role in determining translation error rates, their distribution across the genetic code and the resulting implications have received little attention. In general, studies of codon usage bias (CUB) assume that codons with higher tRNA abundance have lower missense error rates. Using a model of protein translation based on tRNA competition and intra-ribosomal kinetics, we show that this assumption can be violated when tRNA abundan...

  1. Sequence organization and control of transcription in the bacteriophage T4 tRNA region.

    Science.gov (United States)

    Broida, J; Abelson, J

    1985-10-05

    Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.

  2. Non-Conserved Residues in Clostridium acetobutylicum tRNA(Ala) Contribute to tRNA Tuning for Efficient Antitermination of the alaS T Box Riboswitch.

    Science.gov (United States)

    Liu, Liang-Chun; Grundy, Frank J; Henkin, Tina M

    2015-09-28

    The T box riboswitch regulates expression of amino acid-related genes in Gram-positive bacteria by monitoring the aminoacylation status of a specific tRNA, the binding of which affects the folding of the riboswitch into mutually exclusive terminator or antiterminator structures. Two main pairing interactions between the tRNA and the leader RNA have been demonstrated to be necessary, but not sufficient, for efficient antitermination. In this study, we used the Clostridium acetobutylicum alaS gene, which encodes alanyl-tRNA synthetase, to investigate the specificity of the tRNA response. We show that the homologous C. acetobutylicum tRNA(Ala) directs antitermination of the C. acetobutylicum alaS gene in vitro, but the heterologous Bacillus subtilis tRNA(Ala) (with the same anticodon and acceptor end) does not. Base substitutions at positions that vary between these two tRNAs revealed synergistic and antagonistic effects. Variation occurs primarily at positions that are not conserved in tRNA(Ala) species, which indicates that these non-conserved residues contribute to optimal antitermination of the homologous alaS gene. This study suggests that elements in tRNA(Ala) may have coevolved with the homologous alaS T box leader RNA for efficient antitermination.

  3. Non-Conserved Residues in Clostridium acetobutylicum tRNAAla Contribute to tRNA Tuning for Efficient Antitermination of the alaS T Box Riboswitch

    Science.gov (United States)

    Liu, Liang-Chun; Grundy, Frank J.; Henkin, Tina M.

    2015-01-01

    The T box riboswitch regulates expression of amino acid-related genes in Gram-positive bacteria by monitoring the aminoacylation status of a specific tRNA, the binding of which affects the folding of the riboswitch into mutually exclusive terminator or antiterminator structures. Two main pairing interactions between the tRNA and the leader RNA have been demonstrated to be necessary, but not sufficient, for efficient antitermination. In this study, we used the Clostridium acetobutylicum alaS gene, which encodes alanyl-tRNA synthetase, to investigate the specificity of the tRNA response. We show that the homologous C. acetobutylicum tRNAAla directs antitermination of the C. acetobutylicum alaS gene in vitro, but the heterologous Bacillus subtilis tRNAAla (with the same anticodon and acceptor end) does not. Base substitutions at positions that vary between these two tRNAs revealed synergistic and antagonistic effects. Variation occurs primarily at positions that are not conserved in tRNAAla species, which indicates that these non-conserved residues contribute to optimal antitermination of the homologous alaS gene. This study suggests that elements in tRNAAla may have coevolved with the homologous alaS T box leader RNA for efficient antitermination. PMID:26426057

  4. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Hiraku Takada

    Full Text Available Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon, within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons

  5. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli

    Science.gov (United States)

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M. Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan

    2016-01-01

    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3’ proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP) holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon), within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons are expressed

  6. Differential Regulation of rRNA and tRNA Transcription from the rRNA-tRNA Composite Operon in Escherichia coli.

    Science.gov (United States)

    Takada, Hiraku; Shimada, Tomohiro; Dey, Debashish; Quyyum, M Zuhaib; Nakano, Masahiro; Ishiguro, Akira; Yoshida, Hideji; Yamamoto, Kaneyoshi; Sen, Ranjan; Ishihama, Akira

    2016-01-01

    Escherichia coli contains seven rRNA operons, each consisting of the genes for three rRNAs (16S, 23S and 5S rRNA in this order) and one or two tRNA genes in the spacer between 16S and 23S rRNA genes and one or two tRNA genes in the 3' proximal region. All of these rRNA and tRNA genes are transcribed from two promoters, P1 and P2, into single large precursors that are afterward processed to individual rRNAs and tRNAs by a set of RNases. In the course of Genomic SELEX screening of promoters recognized by RNA polymerase (RNAP) holoenzyme containing RpoD sigma, a strong binding site was identified within 16S rRNA gene in each of all seven rRNA operons. The binding in vitro of RNAP RpoD holoenzyme to an internal promoter, referred to the promoter of riRNA (an internal RNA of the rRNA operon), within each 16S rRNA gene was confirmed by gel shift assay and AFM observation. Using this riRNA promoter within the rrnD operon as a representative, transcription in vitro was detected with use of the purified RpoD holoenzyme, confirming the presence of a constitutive promoter in this region. LacZ reporter assay indicated that this riRNA promoter is functional in vivo. The location of riRNA promoter in vivo as identified using a set of reporter plasmids agrees well with that identified in vitro. Based on transcription profile in vitro and Northern blot analysis in vivo, the majority of transcript initiated from this riRNA promoter was estimated to terminate near the beginning of 23S rRNA gene, indicating that riRNA leads to produce the spacer-coded tRNA. Under starved conditions, transcription of the rRNA operon is markedly repressed to reduce the intracellular level of ribosomes, but the levels of both riRNA and its processed tRNAGlu stayed unaffected, implying that riRNA plays a role in the continued steady-state synthesis of tRNAs from the spacers of rRNA operons. We then propose that the tRNA genes organized within the spacers of rRNA-tRNA composite operons are expressed

  7. Viral tRNA Mimicry from a Biocommunicative Perspective

    Directory of Open Access Journals (Sweden)

    Ascensión Ariza-Mateos

    2017-12-01

    Full Text Available RNA viruses have very small genomes which limits the functions they can encode. One of the strategies employed by these viruses is to mimic key factors of the host cell so they can take advantage of the interactions and activities these factors typically participate in. The viral RNA genome itself was first observed to mimic cellular tRNA over 40 years ago. Since then researchers have confirmed that distinct families of RNA viruses are accessible to a battery of cellular factors involved in tRNA-related activities. Recently, potential tRNA-like structures have been detected within the sequences of a 100 mRNAs taken from human cells, one of these being the host defense interferon-alpha mRNA; these are then additional to the examples found in bacterial and yeast mRNAs. The mimetic relationship between tRNA, cellular mRNA, and viral RNA is the central focus of two considerations described below. These are subsequently used as a preface for a final hypothesis drawing on concepts relating to mimicry from the social sciences and humanities, such as power relations and creativity. Firstly, the presence of tRNA-like structures in mRNAs indicates that the viral tRNA-like signal could be mimicking tRNA-like elements that are contextualized by the specific carrier mRNAs, rather than, or in addition to, the tRNA itself, which would significantly increase the number of potential semiotic relations mediated by the viral signals. Secondly, and in particular, mimicking a host defense mRNA could be considered a potential new viral strategy for survival. Finally, we propose that mRNA’s mimicry of tRNA could be indicative of an ancestral intracellular conflict in which species of mRNAs invaded the cell, but from within. As the meaning of the mimetic signal depends on the context, in this case, the conflict that arises when the viral signal enters the cell can change the meaning of the mRNAs’ internal tRNA-like signals, from their current significance to that

  8. Metatranscriptomic analysis of microbes in an Oceanfront deep-subsurface hot spring reveals novel small RNAs and type-specific tRNA degradation.

    Science.gov (United States)

    Murakami, Shinnosuke; Fujishima, Kosuke; Tomita, Masaru; Kanai, Akio

    2012-02-01

    Studies of small noncoding RNAs (sRNAs) have been conducted predominantly using culturable organisms, and the acquisition of further information about sRNAs from global environments containing uncultured organisms now is very important. In this study, hot spring water (57°C, pH 8.1) was collected directly from the underground environment at depths of 250 to 1,000 m in Yunohama, Japan, and small RNA sequences obtained from the environment were analyzed. A phylogenetic analysis of both archaeal and bacterial 16S rRNA gene sequences was conducted, and the results suggested the presence of unique species in the environment, corresponding to the Archaeal Richmond Mine Acidophilic Nanoorganisms (ARMAN) group and three new Betaproteobacteria. A metatranscriptomic analysis identified 64,194 (20,057 nonredundant) cDNA sequences. Of these cDNAs, 90% were either tRNAs, tRNA fragments, rRNAs, or rRNA fragments, whereas 2,181 reads (10%) were classified as previously uncharacterized putative candidate sRNAs. Among these, 15 were particularly abundant, 14 of which showed no sequence similarity to any known noncoding RNA, and at least six of which form very stable RNA secondary structures. The analysis of a large number of tRNA fragments suggested that unique relationships exist between the anticodons of the tRNAs and the sites of tRNA degradation. Previous bacterial tRNA degradation studies have been limited to specific organisms, such as Escherichia coli and Streptomyces coelicolor, and the current results suggest that specific tRNA decay occurs more frequently than previously expected.

  9. Infidelity of translation of encephalomyocarditis viral RNA with tRNA from human malignant trophoblastic cells

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, O.K.; Kuchino, Y.

    1977-09-23

    We have investigated tRNA from the human malignant trophoblastic cells (BeWo cell) and human chorionic tissue for the translation of specific mRNAs, in a tRNA-dependent protein synthesizing system from Ehrlich ascites cells. BeWo cell tRNA and chorionic tRNA supported oviduct mRNA or encephalomyocarditis (EMC) viral RNA directed amino acid incorporation into polypeptides equally effectively. Polypeptides synthesized with oviduct mRNA and tRNA from both sources were identical upon sodium dodecylsulfate polyacrylamide gel electrophoresis. But the EMC RNA directed polypeptides synthesized with BeWo cell tRNA were different from those synthesized with chorionic tRNA. A polypeptide (molecular weight 58,000) was apparently not synthesized and the synthesis of a faster moving component (molecular weight, 14,000) was enhanced when BeWo cell tRNA was used. These results imply a functional difference in tRNA from human malignant cells compared to their normal counterpart.

  10. Coded Splitting Tree Protocols

    DEFF Research Database (Denmark)

    Sørensen, Jesper Hemming; Stefanovic, Cedomir; Popovski, Petar

    2013-01-01

    This paper presents a novel approach to multiple access control called coded splitting tree protocol. The approach builds on the known tree splitting protocols, code structure and successive interference cancellation (SIC). Several instances of the tree splitting protocol are initiated, each...... instance is terminated prematurely and subsequently iterated. The combined set of leaves from all the tree instances can then be viewed as a graph code, which is decodable using belief propagation. The main design problem is determining the order of splitting, which enables successful decoding as early...... as possible. Evaluations show that the proposed protocol provides considerable gains over the standard tree splitting protocol applying SIC. The improvement comes at the expense of an increased feedback and receiver complexity....

  11. Split Cord Malformations

    Directory of Open Access Journals (Sweden)

    Yurdal Gezercan

    2015-06-01

    Full Text Available Split cord malformations are rare form of occult spinal dysraphism in children. Split cord malformations are characterized by septum that cleaves the spinal canal in sagittal plane within the single or duplicated thecal sac. Although their precise incidence is unknown, split cord malformations are exceedingly rare and represent %3.8-5 of all congenital spinal anomalies. Characteristic neurological, urological, orthopedic clinical manifestations are variable and asymptomatic course is possible. Earlier diagnosis and surgical intervention for split cord malformations is associated with better long-term fuctional outcome. For this reason, diagnostic imaging is indicated for children with associated cutaneous and orthopedic signs. Additional congenital anomalies usually to accompany the split cord malformations. Earlier diagnosis, meticuolus surgical therapy and interdisciplinary careful evaluation and follow-up should be made for good prognosis. [Cukurova Med J 2015; 40(2.000: 199-207

  12. Side effects of extra tRNA supplied in a typical bacterial protein production scenario

    DEFF Research Database (Denmark)

    Søgaard, Karina Marie; Nørholm, Morten H. H.

    2016-01-01

    Recombinant protein production is at the core of biotechnology and numerous molecular tools and bacterial strains have been developed to make the process more efficient. One commonly used generic solution is to supply extra copies of low-abundance tRNAs to compensate for the presence of complemen......Recombinant protein production is at the core of biotechnology and numerous molecular tools and bacterial strains have been developed to make the process more efficient. One commonly used generic solution is to supply extra copies of low-abundance tRNAs to compensate for the presence...... of complementary rare codons in genes-of-interest. Here we show that such extra tRNA, supplied by the commonly used pLysSRARE2 plasmid, can cause two side effects: (1) growth and gene expression can be impaired, and (2) apparent positive effects can be caused by differential expression of the lysozyme gene encoded...... on the same plasmid and not the tRNAs per se. These phenomena seem to have been largely overlooked despite the huge popularity of the T7/pET-based systems for bacterial protein production....

  13. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer

    2015-03-01

    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  14. Splitting Strategy for Simulating Genetic Regulatory Networks

    Directory of Open Access Journals (Sweden)

    Xiong You

    2014-01-01

    Full Text Available The splitting approach is developed for the numerical simulation of genetic regulatory networks with a stable steady-state structure. The numerical results of the simulation of a one-gene network, a two-gene network, and a p53-mdm2 network show that the new splitting methods constructed in this paper are remarkably more effective and more suitable for long-term computation with large steps than the traditional general-purpose Runge-Kutta methods. The new methods have no restriction on the choice of stepsize due to their infinitely large stability regions.

  15. Effect of correlated tRNA abundances on translation errors and evolution of codon usage bias.

    Directory of Open Access Journals (Sweden)

    Premal Shah

    2010-09-01

    Full Text Available Despite the fact that tRNA abundances are thought to play a major role in determining translation error rates, their distribution across the genetic code and the resulting implications have received little attention. In general, studies of codon usage bias (CUB assume that codons with higher tRNA abundance have lower missense error rates. Using a model of protein translation based on tRNA competition and intra-ribosomal kinetics, we show that this assumption can be violated when tRNA abundances are positively correlated across the genetic code. Examining the distribution of tRNA abundances across 73 bacterial genomes from 20 different genera, we find a consistent positive correlation between tRNA abundances across the genetic code. This work challenges one of the fundamental assumptions made in over 30 years of research on CUB that codons with higher tRNA abundances have lower missense error rates and that missense errors are the primary selective force responsible for CUB.

  16. tRNA conjugation with chitosan nanoparticles: An AFM imaging study.

    Science.gov (United States)

    Agudelo, D; Kreplak, L; Tajmir-Riahi, H A

    2016-04-01

    The conjugation of tRNA with chitosan nanoparticles of different sizes 15,100 and 200 kDa was investigated in aqueous solution using multiple spectroscopic methods and atomic force microscopy (AFM). Structural analysis showed that chitosan binds tRNA via G-C and A-U base pairs as well as backbone PO2 group, through electrostatic, hydrophilic and H-bonding contacts with overall binding constants of KCh-15-tRNA=4.1 (±0.60)×10(3)M(-1), KCh-100-tRNA=5.7 (±0.8)×10(3)M(-1) and KCh-200-tRNA=1.2 (±0.3)×10(4)M(-1). As chitosan size increases more stable polymer-tRNA conjugate is formed. AFM images showed major tRNA aggregation and particle formation occurred as chitosan concentration increased. Even though chitosan induced major biopolymer structural changes, tRNA remains in A-family structure. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Intrinsic Properties of tRNA Molecules as Deciphered via Bayesian Network and Distribution Divergence Analysis

    Directory of Open Access Journals (Sweden)

    Sergio Branciamore

    2018-02-01

    Full Text Available The identity/recognition of tRNAs, in the context of aminoacyl tRNA synthetases (and other molecules, is a complex phenomenon that has major implications ranging from the origins and evolution of translation machinery and genetic code to the evolution and speciation of tRNAs themselves to human mitochondrial diseases to artificial genetic code engineering. Deciphering it via laboratory experiments, however, is difficult and necessarily time- and resource-consuming. In this study, we propose a mathematically rigorous two-pronged in silico approach to identifying and classifying tRNA positions important for tRNA identity/recognition, rooted in machine learning and information-theoretic methodology. We apply Bayesian Network modeling to elucidate the structure of intra-tRNA-molecule relationships, and distribution divergence analysis to identify meaningful inter-molecule differences between various tRNA subclasses. We illustrate the complementary application of these two approaches using tRNA examples across the three domains of life, and identify and discuss important (informative positions therein. In summary, we deliver to the tRNA research community a novel, comprehensive methodology for identifying the specific elements of interest in various tRNA molecules, which can be followed up by the corresponding experimental work and/or high-resolution position-specific statistical analyses.

  18. Defective i6A37 modification of mitochondrial and cytosolic tRNAs results from pathogenic mutations in TRIT1 and its substrate tRNA.

    Directory of Open Access Journals (Sweden)

    John W Yarham

    2014-06-01

    Full Text Available Identifying the genetic basis for mitochondrial diseases is technically challenging given the size of the mitochondrial proteome and the heterogeneity of disease presentations. Using next-generation exome sequencing, we identified in a patient with severe combined mitochondrial respiratory chain defects and corresponding perturbation in mitochondrial protein synthesis, a homozygous p.Arg323Gln mutation in TRIT1. This gene encodes human tRNA isopentenyltransferase, which is responsible for i6A37 modification of the anticodon loops of a small subset of cytosolic and mitochondrial tRNAs. Deficiency of i6A37 was previously shown in yeast to decrease translational efficiency and fidelity in a codon-specific manner. Modelling of the p.Arg323Gln mutation on the co-crystal structure of the homologous yeast isopentenyltransferase bound to a substrate tRNA, indicates that it is one of a series of adjacent basic side chains that interact with the tRNA backbone of the anticodon stem, somewhat removed from the catalytic center. We show that patient cells bearing the p.Arg323Gln TRIT1 mutation are severely deficient in i6A37 in both cytosolic and mitochondrial tRNAs. Complete complementation of the i6A37 deficiency of both cytosolic and mitochondrial tRNAs was achieved by transduction of patient fibroblasts with wild-type TRIT1. Moreover, we show that a previously-reported pathogenic m.7480A>G mt-tRNASer(UCN mutation in the anticodon loop sequence A36A37A38 recognised by TRIT1 causes a loss of i6A37 modification. These data demonstrate that deficiencies of i6A37 tRNA modification should be considered a potential mechanism of human disease caused by both nuclear gene and mitochondrial DNA mutations while providing insight into the structure and function of TRIT1 in the modification of cytosolic and mitochondrial tRNAs.

  19. Loss of a conserved tRNA anticodon modification perturbs cellular signaling.

    Directory of Open Access Journals (Sweden)

    Boris Zinshteyn

    Full Text Available Transfer RNA (tRNA modifications enhance the efficiency, specificity and fidelity of translation in all organisms. The anticodon modification mcm(5s(2U(34 is required for normal growth and stress resistance in yeast; mutants lacking this modification have numerous phenotypes. Mutations in the homologous human genes are linked to neurological disease. The yeast phenotypes can be ameliorated by overexpression of specific tRNAs, suggesting that the modifications are necessary for efficient translation of specific codons. We determined the in vivo ribosome distributions at single codon resolution in yeast strains lacking mcm(5s(2U. We found accumulations at AAA, CAA, and GAA codons, suggesting that translation is slow when these codons are in the ribosomal A site, but these changes appeared too small to affect protein output. Instead, we observed activation of the GCN4-mediated stress response by a non-canonical pathway. Thus, loss of mcm(5s(2U causes global effects on gene expression due to perturbation of cellular signaling.

  20. Split Malcev algebras

    Indian Academy of Sciences (India)

    project of the Spanish Ministerio de Educación y Ciencia MTM2007-60333. References. [1] Calderón A J, On split Lie algebras with symmetric root systems, Proc. Indian. Acad. Sci (Math. Sci.) 118(2008) 351–356. [2] Calderón A J, On split Lie triple systems, Proc. Indian. Acad. Sci (Math. Sci.) 119(2009). 165–177.

  1. Mutations in Cytosine-5 tRNA Methyltransferases Impact Mobile Element Expression and Genome Stability at Specific DNA Repeats

    Directory of Open Access Journals (Sweden)

    Bianca Genenncher

    2018-02-01

    Full Text Available The maintenance of eukaryotic genome stability is ensured by the interplay of transcriptional as well as post-transcriptional mechanisms that control recombination of repeat regions and the expression and mobility of transposable elements. We report here that mutations in two (cytosine-5 RNA methyltransferases, Dnmt2 and NSun2, impact the accumulation of mobile element-derived sequences and DNA repeat integrity in Drosophila. Loss of Dnmt2 function caused moderate effects under standard conditions, while heat shock exacerbated these effects. In contrast, NSun2 function affected mobile element expression and genome integrity in a heat shock-independent fashion. Reduced tRNA stability in both RCMT mutants indicated that tRNA-dependent processes affected mobile element expression and DNA repeat stability. Importantly, further experiments indicated that complex formation with RNA could also contribute to the impact of RCMT function on gene expression control. These results thus uncover a link between tRNA modification enzymes, the expression of repeat DNA, and genomic integrity.

  2. Defects in tRNA modification associated with neurological and developmental dysfunctions in Caenorhabditis elegans elongator mutants.

    Directory of Open Access Journals (Sweden)

    Changchun Chen

    2009-07-01

    Full Text Available Elongator is a six subunit protein complex, conserved from yeast to humans. Mutations in the human Elongator homologue, hELP1, are associated with the neurological disease familial dysautonomia. However, how Elongator functions in metazoans, and how the human mutations affect neural functions is incompletely understood. Here we show that in Caenorhabditis elegans, ELPC-1 and ELPC-3, components of the Elongator complex, are required for the formation of the 5-carbamoylmethyl and 5-methylcarboxymethyl side chains of wobble uridines in tRNA. The lack of these modifications leads to defects in translation in C. elegans. ELPC-1::GFP and ELPC-3::GFP reporters are strongly expressed in a subset of chemosensory neurons required for salt chemotaxis learning. elpc-1 or elpc-3 gene inactivation causes a defect in this process, associated with a posttranscriptional reduction of neuropeptide and a decreased accumulation of acetylcholine in the synaptic cleft. elpc-1 and elpc-3 mutations are synthetic lethal together with those in tuc-1, which is required for thiolation of tRNAs having the 5'methylcarboxymethyl side chain. elpc-1; tuc-1 and elpc-3; tuc-1 double mutants display developmental defects. Our results suggest that, by its effect on tRNA modification, Elongator promotes both neural function and development.

  3. Base-pairing versatility determines wobble sites in tRNA anticodons of vertebrate mitogenomes.

    Directory of Open Access Journals (Sweden)

    Miguel M Fonseca

    Full Text Available BACKGROUND: Vertebrate mitochondrial genomes typically have one transfer RNA (tRNA for each synonymous codon family. This limited anticodon repertoire implies that each tRNA anticodon needs to wobble (establish a non-Watson-Crick base pairing between two nucleotides in RNA molecules to recognize one or more synonymous codons. Different hypotheses have been proposed to explain the factors that determine the nucleotide composition of wobble sites in vertebrate mitochondrial tRNA anticodons. Until now, the two major postulates--the "codon-anticodon adaptation hypothesis" and the "wobble versatility hypothesis"--have not been formally tested in vertebrate mitochondria because both make the same predictions regarding the composition of anticodon wobble sites. The same is true for the more recent "wobble cost hypothesis". PRINCIPAL FINDINGS: In this study we have analyzed the occurrence of synonymous codons and tRNA anticodon wobble sites in 1553 complete vertebrate mitochondrial genomes, focusing on three fish species with mtDNA codon usage bias reversal (L-strand is GT-rich. These mitogenomes constitute an excellent opportunity to study the evolution of the wobble nucleotide composition of tRNA anticodons because due to the reversal the predictions for the anticodon wobble sites differ between the existing hypotheses. We observed that none of the wobble sites of tRNA anticodons in these unusual mitochondrial genomes coevolved to match the new overall codon usage bias, suggesting that nucleotides at the wobble sites of tRNA anticodons in vertebrate mitochondrial genomes are determined by wobble versatility. CONCLUSIONS/SIGNIFICANCE: Our results suggest that, at wobble sites of tRNA anticodons in vertebrate mitogenomes, selection favors the most versatile nucleotide in terms of wobble base-pairing stability and that wobble site composition is not influenced by codon usage. These results are in agreement with the "wobble versatility hypothesis".

  4. A Drosophila model for mito-nuclear diseases generated by an incompatible interaction between tRNA and tRNA synthetase

    Directory of Open Access Journals (Sweden)

    Marissa A. Holmbeck

    2015-08-01

    Full Text Available Communication between the mitochondrial and nuclear genomes is vital for cellular function. The assembly of mitochondrial enzyme complexes, which produce the majority of cellular energy, requires the coordinated expression and translation of both mitochondrially and nuclear-encoded proteins. The joint genetic architecture of this system complicates the basis of mitochondrial diseases, and mutations both in mitochondrial DNA (mtDNA- and nuclear-encoded genes have been implicated in mitochondrial dysfunction. Previously, in a set of mitochondrial-nuclear introgression strains, we characterized a dual genome epistasis in which a naturally occurring mutation in the Drosophila simulans simw501 mtDNA-encoded transfer RNA (tRNA for tyrosine (tRNATyr interacts with a mutation in the nuclear-encoded mitochondrially localized tyrosyl-tRNA synthetase from Drosophila melanogaster. Here, we show that the incompatible mitochondrial-nuclear combination results in locomotor defects, reduced mitochondrial respiratory capacity, decreased oxidative phosphorylation (OXPHOS enzyme activity and severe alterations in mitochondrial morphology. Transgenic rescue strains containing nuclear variants of the tyrosyl-tRNA synthetase are sufficient to rescue many of the deleterious phenotypes identified when paired with the simw501 mtDNA. However, the severity of this defective mito-nuclear interaction varies across traits and genetic backgrounds, suggesting that the impact of mitochondrial dysfunction might be tissue specific. Because mutations in mitochondrial tRNATyr are associated with exercise intolerance in humans, this mitochondrial-nuclear introgression model in Drosophila provides a means to dissect the molecular basis of these, and other, mitochondrial diseases that are a consequence of the joint genetic architecture of mitochondrial function.

  5. Aspects of Split Supersymmetry

    CERN Document Server

    Arkani-Hamed, N; Giudice, Gian Francesco; Romanino, A

    2005-01-01

    We explore some fundamental differences in the phenomenology, cosmology and model building of Split Supersymmetry compared with traditional low-scale supersymmetry. We show how the mass spectrum of Split Supersymmetry naturally emerges from theories where the dominant source of supersymmetry breaking preserves an $R$ symmetry, characterize the class of theories where the unavoidable $R$-breaking by gravity can be neglected, and point out a new possibility, where supersymmetry breaking is directly communicated at tree level to the visible sector via renormalizable interactions. Next, we discuss possible low-energy signals for Split Supersymmetry. The absence of new light scalars removes all the phenomenological difficulties of low-energy supersymmetry, associated with one-loop flavor and CP violating effects. However, the electric dipole moments of leptons and quarks do arise at two loops, and are automatically at the level of present limits with no need for small phases, making them accessible to several ongo...

  6. Essential nontranslational functions of tRNA synthetases.

    Science.gov (United States)

    Guo, Min; Schimmel, Paul

    2013-03-01

    Nontranslational functions of vertebrate aminoacyl tRNA synthetases (aaRSs), which catalyze the production of aminoacyl-tRNAs for protein synthesis, have recently been discovered. Although these new functions were thought to be 'moonlighting activities', many are as critical for cellular homeostasis as their activity in translation. New roles have been associated with their cytoplasmic forms as well as with nuclear and secreted extracellular forms that affect pathways for cardiovascular development and the immune response and mTOR, IFN-γ and p53 signaling. The associations of aaRSs with autoimmune disorders, cancers and neurological disorders further highlight nontranslational functions of these proteins. New architecture elaborations of the aaRSs accompany their functional expansion in higher organisms and have been associated with the nontranslational functions for several aaRSs. Although a general understanding of how these functions developed is limited, the expropriation of aaRSs for essential nontranslational functions may have been initiated by co-opting the amino acid-binding site for another purpose.

  7. Essential Non-Translational Functions of tRNA Synthetases

    Science.gov (United States)

    Guo, Min; Schimmel, Paul

    2013-01-01

    Nontranslational functions of vertebrate aminoacyl tRNA synthetases (aaRSs), which catalyze the production of aminoacyl-tRNAs for protein synthesis, have recently been discovered. While these new functions were thought to be ‘moonlighting activities’, many are as critical for cellular homeostasis as the activity in translation. New roles have been associated with cytoplasmic forms as well as with nuclear and secreted extracellular forms that impact pathways for cardiovascular development, the immune response, and mTOR, IFN-γ and p53 signaling. The associations of aaRSs with autoimmune disorders, cancers and neurological disorders further highlight nontranslational functions of these proteins. Novel architecture elaborations of the aaRSs accompany their functional expansion in higher organisms and have been associated with the nontranslational functions for several aaRSs. While a general understanding of how these functions developed is limited, the expropriation of aaRSs for essential nontranslational functions may have been initiated by co-opting the amino acid binding site for another purpose. PMID:23416400

  8. Split Malcev algebras

    Indian Academy of Sciences (India)

    We study the structure of split Malcev algebras of arbitrary dimension over an algebraically closed field of characteristic zero. We show that any such algebras is of the form M = U + ∑ j I j with U a subspace of the abelian Malcev subalgebra and any I j a well described ideal of satisfying [ I j , I k ] = 0 if ≠ .

  9. Splitting of Comets

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 7; Issue 1. Splitting of Comets. Utpal Mukhopadhyay. General Article Volume 7 Issue 1 January 2002 pp 11-22. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/007/01/0011-0022. Keywords. Cometary ...

  10. Alternative tRNA priming of human immunodeficiency virus type 1 reverse transcription explains sequence variation in the primer-binding site that has been attributed to APOBEC3G activity

    NARCIS (Netherlands)

    Das, Atze T.; Vink, Monique; Berkhout, Ben

    2005-01-01

    It is generally assumed that human immunodeficiency virus type 1 (HIV-1) uses exclusively the cellular tRNA(3)(Lys) molecule as a primer for reverse transcription. We demonstrate that HIV-1 uses not only tRNA(3)(Lys) but also an alternative tRNA primer. This tRNA was termed tRNA(5)(Lys), and the

  11. The MiaA tRNA modification enzyme is necessary for robust RpoS expression in Escherichia coli.

    Science.gov (United States)

    Thompson, Karl M; Gottesman, Susan

    2014-02-01

    The stationary phase/general stress response sigma factor RpoS (σ(S)) is necessary for adaptation and restoration of homeostasis in stationary phase. As a physiological consequence, its levels are tightly regulated at least at two levels. Multiple small regulatory RNA molecules modulate its translation, in a manner that is dependent on the RNA chaperone Hfq and the rpoS 5' untranslated region. ClpXP and the RssB adaptor protein degrade RpoS, unless it is protected by an anti-adaptor. We here find that, in addition to these posttranscriptional levels of regulation, tRNA modification also affects the steady-state levels of RpoS. We screened mutants of several RNA modification enzymes for an effect on RpoS expression and identified the miaA gene, encoding a tRNA isopentenyltransferase, as necessary for full expression of both an rpoS750-lacZ translational fusion and the RpoS protein. This effect is independent of rpoS, the regulatory RNAs, and RpoS degradation. RpoD steady-state levels were not significantly different in the absence of MiaA, suggesting that this is an RpoS-specific effect. The rpoS coding sequence is significantly enriched for leu codons that use MiaA-modified tRNAs, compared to rpoD and many other genes. Dependence on MiaA may therefore provide yet another way for RpoS levels to respond to growth conditions.

  12. Prevalence of the A1555G (12S rRNA and tRNA Ser(UCN mitochondrial mutations in hearing-impaired Brazilian patients

    Directory of Open Access Journals (Sweden)

    Abreu-Silva R.S.

    2006-01-01

    Full Text Available Mitochondrial mutations are responsible for at least 1% of the cases of hereditary deafness, but the contribution of each mutation has not yet been defined in African-derived or native American genetic backgrounds. A total of 203 unselected hearing-impaired patients were screened for the presence of the mitochondrial mutation A1555G in the 12S rRNA gene and mutations in the tRNA Ser(UCN gene in order to assess their frequency in the ethnically admixed Brazilian population. We found four individuals with A1555G mutation (2%, which is a frequency similar to those reported for European-derived populations in unselected samples. On the other hand, complete sequencing of the tRNA Ser(UCN did not reveal reported pathogenic substitutions, namely A7445G, 7472insC, T7510C, or T7511C. Instead, other rare substitutions were found such as T1291C, A7569G, and G7444A. To evaluate the significance of these findings, 110 "European-Brazilians" and 190 "African-Brazilians" unrelated hearing controls were screened. The T1291C, A7569G and G7444A substitutions were each found in about 1% (2/190 of individuals of African ancestry, suggesting that they are probably polymorphic. Our results indicate that screening for the A1555G mutation is recommended among all Brazilian deaf patients, while testing for mutations in the tRNA Ser(UCN gene should be considered only when other frequent deafness-causing mutations have been excluded or in the presence of a maternal transmission pattern.

  13. Split warhead simultaneous impact

    Directory of Open Access Journals (Sweden)

    Rahul Singh Dhari

    2017-12-01

    Full Text Available A projectile system is proposed to improve efficiency and effectiveness of damage done by anti-tank weapon system on its target by designing a ballistic projectile that can split into multiple warheads and engage a target at the same time. This idea has been developed in interest of saving time consumed from the process of reloading and additional number of rounds wasted on target during an attack. The proposed system is achieved in three steps: Firstly, a mathematical model is prepared using the basic equations of motion. Second, An Ejection Mechanism of proposed warhead is explained with the help of schematics. Third, a part of numerical simulation which is done using the MATLAB software. The final result shows various ranges and times when split can be effectively achieved. With the new system, impact points are increased and hence it has a better probability of hitting a target.

  14. Interactions between RNAP III transcription machinery and tRNA processing factors.

    Science.gov (United States)

    Arimbasseri, G Aneeshkumar

    2018-04-01

    Eukaryotes have at least three nuclear RNA polymerases to carry out transcription. While RNA polymerases I and II are responsible for ribosomal RNA transcription and messenger RNA transcription, respectively, RNA Polymerase III transcribes approximately up to 300 nt long noncoding RNAs, including tRNA. For all three RNAPs, the nascent transcripts generated undergo extensive post-transcriptional processing. Transcription of mRNAs by RNAP II and their processing are coupled with the aid of the C-terminal domain of the RNAP II. RNAP I transcription and the processing of its transcripts are co-localized to the nucleolus and to some extent, rRNA processing occurs co-transcriptionally. Here, I review the current evidence for the interaction between tRNA processing factors and RNA polymerase III. These interactions include the moonlighting functions of tRNA processing factors in RNAP III transcription and the indirect effect of tRNA transcription levels on tRNA modification machinery. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. tRNA modification profiles of the fast-proliferating cancer cells

    International Nuclear Information System (INIS)

    Dong, Chao; Niu, Leilei; Song, Wei; Xiong, Xin; Zhang, Xianhua; Zhang, Zhenxi; Yang, Yi; Yi, Fan; Zhan, Jun; Zhang, Hongquan; Yang, Zhenjun; Zhang, Li-He; Zhai, Suodi; Li, Hua; Ye, Min; Du, Quan

    2016-01-01

    Despite the recent progress in RNA modification study, a comprehensive modification profile is still lacking for mammalian cells. Using a quantitative HPLC/MS/MS assay, we present here a study where RNA modifications are examined in term of the major RNA species. With paired slow- and fast-proliferating cell lines, distinct RNA modification profiles are first revealed for diverse RNA species. Compared to mRNAs, increased ribose and nucleobase modifications are shown for the highly-structured tRNAs and rRNAs, lending support to their contribution to the formation of high-order structures. This study also reveals a dynamic tRNA modification profile in the fast-proliferating cells. In addition to cultured cells, this unique tRNA profile has been further confirmed with endometrial cancers and their adjacent normal tissues. Taken together, the results indicate that tRNA is a actively regulated RNA species in the fast-proliferating cancer cells, and suggest that they may play a more active role in biological process than expected. -- Highlights: •RNA modifications were first examined in term of the major RNA species. •A dynamic tRNA modifications was characterized for the fast-proliferating cells. •The unique tRNA profile was confirmed with endometrial cancers and their adjacent normal tissues. •tRNA was predicted as an actively regulated RNA species in the fast-proliferating cancer cells.

  16. tRNA modification profiles of the fast-proliferating cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Chao; Niu, Leilei; Song, Wei [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China); Xiong, Xin; Zhang, Xianhua [Departmentof Pharmacy, Peking University Third Hospital, Peking University, Beijing 100191 (China); Zhang, Zhenxi; Yang, Yi; Yi, Fan [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China); Zhan, Jun; Zhang, Hongquan [Department of Anatomy, Histology and Embryology, Laboratory of Molecular Cell Biology and Tumor Biology, Peking University, Beijing 100191 (China); Yang, Zhenjun; Zhang, Li-He [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China); Zhai, Suodi [Departmentof Pharmacy, Peking University Third Hospital, Peking University, Beijing 100191 (China); Li, Hua, E-mail: huali88@sina.com [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China); Ye, Min, E-mail: yemin@bjmu.edu.cn [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China); Du, Quan, E-mail: quan.du@pku.edu.cn [State Key Laboratory of Natural and Biomimetic Drugs, School of Pharmaceutical Sciences, Department of Obstetrics and Gynecology, Peking University Third Hospital, Peking University, Beijing 100191 (China)

    2016-08-05

    Despite the recent progress in RNA modification study, a comprehensive modification profile is still lacking for mammalian cells. Using a quantitative HPLC/MS/MS assay, we present here a study where RNA modifications are examined in term of the major RNA species. With paired slow- and fast-proliferating cell lines, distinct RNA modification profiles are first revealed for diverse RNA species. Compared to mRNAs, increased ribose and nucleobase modifications are shown for the highly-structured tRNAs and rRNAs, lending support to their contribution to the formation of high-order structures. This study also reveals a dynamic tRNA modification profile in the fast-proliferating cells. In addition to cultured cells, this unique tRNA profile has been further confirmed with endometrial cancers and their adjacent normal tissues. Taken together, the results indicate that tRNA is a actively regulated RNA species in the fast-proliferating cancer cells, and suggest that they may play a more active role in biological process than expected. -- Highlights: •RNA modifications were first examined in term of the major RNA species. •A dynamic tRNA modifications was characterized for the fast-proliferating cells. •The unique tRNA profile was confirmed with endometrial cancers and their adjacent normal tissues. •tRNA was predicted as an actively regulated RNA species in the fast-proliferating cancer cells.

  17. On split Lie triple systems

    Indian Academy of Sciences (India)

    We also introduced in [1] techniques of connection of roots in the framework of split Lie algebras. In the present paper we extend these techniques to the framework of split Lie triple systems so as to obtain a generalization of the results in [1]. We consider the wide class of split Lie triple systems (which contains the class of.

  18. Global translational impacts of the loss of the tRNA modification t6A in yeast

    Directory of Open Access Journals (Sweden)

    Patrick C. Thiaville

    2015-12-01

    Full Text Available The universal tRNA modification t6A is found at position 37 of nearly all tRNAs decoding ANN codons. The absence of t6A37 leads to severe growth defects in baker’s yeast, phenotypes similar to those caused by defects in mcm5s2U34 synthesis. Mutants in mcm5s2U34 can be suppressed by overexpression of tRNALysUUU, but we show t6A phenotypes could not be suppressed by expressing any individual ANN decoding tRNA, and t6A and mcm5s2U are not determinants for each other’s formation. Our results suggest that t6A deficiency, like mcm5s2U deficiency, leads to protein folding defects, and show that the absence of t6A led to stress sensitivities (heat, ethanol, salt and sensitivity to TOR pathway inhibitors. Additionally, L-homoserine suppressed the slow growth phenotype seen in t6A-deficient strains, and proteins aggregates and Advanced Glycation End-products (AGEs were increased in the mutants. The global consequences on translation caused by t6A absence were examined by ribosome profiling. Interestingly, the absence of t6A did not lead to global translation defects, but did increase translation initiation at upstream non-AUG codons and increased frame-shifting in specific genes. Analysis of codon occupancy rates suggests that one of the major roles of t6A is to homogenize the process of elongation by slowing the elongation rate at codons decoded by high abundance tRNAs and I34:C3 pairs while increasing the elongation rate of rare tRNAs and G34:U3 pairs. This work reveals that the consequences of t6A absence are complex and multilayered and has set the stage to elucidate the molecular basis of the observed phenotypes.

  19. tRNA's wobble decoding of the genome: 40 years of modification.

    Science.gov (United States)

    Agris, Paul F; Vendeix, Franck A P; Graham, William D

    2007-02-09

    The genetic code is degenerate, in that 20 amino acids are encoded by 61 triplet codes. In 1966, Francis Crick hypothesized that the cell's limited number of tRNAs decoded the genome by recognizing more than one codon. The ambiguity of that recognition resided in the third base-pair, giving rise to the Wobble Hypothesis. Post-transcriptional modifications at tRNA's wobble position 34, especially modifications of uridine 34, enable wobble to occur. The Modified Wobble Hypothesis proposed in 1991 that specific modifications of a tRNA wobble nucleoside shape the anticodon architecture in such a manner that interactions were restricted to the complementary base plus a single wobble pairing for amino acids with twofold degenerate codons. However, chemically different modifications at position 34 would expand the ability of a tRNA to read three or even four of the fourfold degenerate codons. One foundation of Crick's Wobble Hypothesis was that a near-constant geometry of canonical base-pairing be maintained in forming all three base-pairs between the tRNA anticodon and mRNA codon on the ribosome. In accepting an aminoacyl-tRNA, the ribosome requires maintenance of a specific geometry for the anticodon-codon base-pairing. However, it is the post-transcriptional modifications at tRNA wobble position 34 and purine 37, 3'-adjacent to the anticodon, that pre-structure the anticodon domain to ensure the correct codon binding. The modifications create both the architecture and the stability needed for decoding through restraints on anticodon stereochemistry and conformational space, and through selective hydrogen bonding. A physicochemical understanding of modified nucleoside contributions to the tRNA anticodon domain architecture and its decoding of the genome has advanced RNA world evolutionary theory, the principles of RNA chemistry, and the application of this knowledge to the introduction of new amino acids to proteins.

  20. Catalytic mechanism and inhibition of tRNA (Uracil-5-)methyltransferase: evidence for covalent catalysis

    International Nuclear Information System (INIS)

    Santi, D.V.; Hardy, L.W.

    1987-01-01

    tRNA (Ura-5-) methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine (AdoMet) to the 5-carbon of a specific Urd residue in tRNA. This results in stoichiometric release of tritium from [5- 3 H] Urd-labeled substrate tRNA isolated from methyltransferase-deficient Escherichia coli. The enzyme also catalyzes an AdoMet-independent exchange reaction between [5- 3 H]-Urd-labeled substrate tRNA and protons of water at a rate that is about 1% that of the normal methylation reaction, but with identical stoichiometry. S-Adenosylhomocysteine inhibits the rate of the exchange reaction by 2-3-fold, whereas an analog having the sulfur of AdoMet replaced by nitrogen accelerates the exchange reaction 9-fold. In the presence (but not absence) of AdoMet, 5-fluorouracil-substituted tRNA (FUra-tRNA) leads to the first-order inactivation of the enzyme. This is accompanied by the formation of a stable covalent complex containing the enzyme, FUra-tRNA, and the methyl group AdoMet. A mechanism for catalysis is proposed that explains both the 5-H exchange reaction and the inhibition by FUra-tRNA: the enzyme forms a covalent Michael adduct with substrate or inhibitor tRNA by attack of a nucleophilic group of the enzyme at carbon 6 of the pyrimidine residue to be modified. As a result, an anion equivalent is generated at carbon 5 that is sufficiently reactive to be methylated by AdoMet. Preliminary experiments and precedents suggest that the nucleophilic catalyst of the enzyme is a thiol group of cysteine. The potent irreversible inhibition by FUra-tRNA suggest that a mechanism for the RNA effects of FUra may also involve irreversible inhibition of RNA-modifying enzymes

  1. Crosslinking of tRNA containing a long extra arm to elongation factor Tu by trans-diamminedichloroplatinum(II)

    DEFF Research Database (Denmark)

    Rasmussen, Nils-Jørgen; Wikman, Friedrik; Clark, Brian F. C.

    1990-01-01

    A tRNA containing a long extra arm, namely E. coli tRNA1Leu has been crosslinked to elongation factor Tu, with the crosslinking reagent trans-diamminedichloroplatinum(II). The nucleotide involved in the crosslinking was identified to be a guanosine in the variable region at position 47F or 47G....

  2. Movement of the 3'-end of tRNA through the peptidyl transferase centre and its inhibition by antibiotics

    DEFF Research Database (Denmark)

    Kirillov, Stanislav; Porse, Bo Torben; Vester, Birthe

    1997-01-01

    experimental data and, especially, those relevant to substrate movements through the peptidyl transferase centre. With the exception of deacylated tRNA, which binds at the E-site, ribosomal interactions of the 3'-ends of the tRNA substrates generate only a small part of the total free energy of t...

  3. Structural requirements for the binding of tRNA Lys3 to reverse transcriptase of the human immunodeficiency virus type 1

    NARCIS (Netherlands)

    Oude Essink, B. B.; Das, A. T.; Berkhout, B.

    1995-01-01

    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA Lys3 molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA

  4. Formation of tRNA granules in the nucleus of heat-induced human cells

    International Nuclear Information System (INIS)

    Miyagawa, Ryu; Mizuno, Rie; Watanabe, Kazunori; Ijiri, Kenichi

    2012-01-01

    Highlights: ► tRNAs are tranlocated into the nucleus in heat-induced HeLa cells. ► tRNAs form the unique granules in the nucleus. ► tRNA ganules overlap with nuclear stress granules. -- Abstract: The stress response, which can trigger various physiological phenomena, is important for living organisms. For instance, a number of stress-induced granules such as P-body and stress granule have been identified. These granules are formed in the cytoplasm under stress conditions and are associated with translational inhibition and mRNA decay. In the nucleus, there is a focus named nuclear stress body (nSB) that distinguishes these structures from cytoplasmic stress granules. Many splicing factors and long non-coding RNA species localize in nSBs as a result of stress. Indeed, tRNAs respond to several kinds of stress such as heat, oxidation or starvation. Although nuclear accumulation of tRNAs occurs in starved Saccharomyces cerevisiae, this phenomenon is not found in mammalian cells. We observed that initiator tRNA Met (Meti) is actively translocated into the nucleus of human cells under heat stress. During this study, we identified unique granules of Meti that overlapped with nSBs. Similarly, elongator tRNA Met was translocated into the nucleus and formed granules during heat stress. Formation of tRNA granules is closely related to the translocation ratio. Then, all tRNAs may form the specific granules.

  5. Protozoan ALKBH8 Oxygenases Display both DNA Repair and tRNA Modification Activities

    DEFF Research Database (Denmark)

    Zdżalik, Daria; Vågbø, Cathrine B; Kirpekar, Finn

    2014-01-01

    , interestingly, two protozoan ALKBH8s also catalyzed wobble uridine modification of tRNA, thus displaying a dual in vitro activity. Also, we found the modification status of tRNAGly(UCC) to be unaltered in an ALKBH8 deficient mutant of Agrobacterium tumefaciens, indicating that bacterial ALKBH8s have a function...

  6. The early history of tRNA recognition by aminoacyl-tRNA synthetases

    Indian Academy of Sciences (India)

    Madhu

    2006-10-04

    Oct 4, 2006 ... of these enzymes for correct genetic code expression as well as early structural data and related enzymology will be reviewed. Despite structural diversity, all synthetases follow a two-step mechanism for tRNA aminoacylation. Specificity, however, is not absolute since synthetases were shown to catalyze ...

  7. Real-time tRNA transit on single translating ribosomes at codon resolution

    Science.gov (United States)

    Uemura, Sotaro; Aitken, Colin Echeverría; Korlach, Jonas; Flusberg, Benjamin A.; Turner, Stephen W.; Puglisi, Joseph D.

    2015-01-01

    Translation by the ribosome occurs by a complex mechanism involving the coordinated interaction of multiple nucleic acid and protein ligands. Here we have used zero-mode waveguides (ZMWs) and sophisticated detection instrumentation to allow real-time observation of translation at physiologically-relevant (μM) ligand concentrations. Translation at each codon is monitored by stable binding of tRNAs – labeled with distinct fluorophores – to translating ribosomes, allowing direct detection of the identity of tRNA molecules bound to the ribosome, and therefore, the underlying mRNA sequence. We observe the transit of tRNAs on single translating ribosomes and have determined the number of tRNA molecules simultaneously bound to the ribosome, at each codon of an mRNA. Our results show that ribosomes are only briefly occupied by two tRNAs and that release of deacylated tRNA from the E site is uncoupled from binding of A-site tRNA and occurs rapidly after translocation. The methods outlined here have broad application to the study of mRNA sequences, and the mechanism and regulation of translation. PMID:20393556

  8. Selection of tRNA charging quality control mechanisms that increase mistranslation of the genetic code

    DEFF Research Database (Denmark)

    Yadavalli, Srujana S; Ibba, Michael

    2013-01-01

    Mistranslation can follow two events during protein synthesis: production of non-cognate amino acid:transfer RNA (tRNA) pairs by aminoacyl-tRNA synthetases (aaRSs) and inaccurate selection of aminoacyl-tRNAs by the ribosome. Many aaRSs actively edit non-cognate amino acids, but editing mechanisms...

  9. Machine News and Volatility: The Dow Jones Industrial Average and the TRNA Sentiment Series

    NARCIS (Netherlands)

    D.E. Allen (David); A.K. Singh (Abhay)

    2014-01-01

    markdownabstract__Abstract__ This paper features an analysis of the relationship between the volatility of the Dow Jones Industrial Average (DJIA) Index and a sentiment news series using daily data obtained from the Thomson Reuters News Analytics (TRNA) provided by SIRCA (The Securities Industry

  10. tRNA acceptor-stem and anticodon bases embed separate features of amino acid chemistry

    Science.gov (United States)

    Carter, Charles W.; Wolfenden, Richard

    2016-01-01

    abstract The universal genetic code is a translation table by which nucleic acid sequences can be interpreted as polypeptides with a wide range of biological functions. That information is used by aminoacyl-tRNA synthetases to translate the code. Moreover, amino acid properties dictate protein folding. We recently reported that digital correlation techniques could identify patterns in tRNA identity elements that govern recognition by synthetases. Our analysis, and the functionality of truncated synthetases that cannot recognize the tRNA anticodon, support the conclusion that the tRNA acceptor stem houses an independent code for the same 20 amino acids that likely functioned earlier in the emergence of genetics. The acceptor-stem code, related to amino acid size, is distinct from a code in the anticodon that is related to amino acid polarity. Details of the acceptor-stem code suggest that it was useful in preserving key properties of stereochemically-encoded peptides that had developed the capacity to interact catalytically with RNA. The quantitative embedding of the chemical properties of amino acids into tRNA bases has implications for the origins of molecular biology. PMID:26595350

  11. Unusual evolutionary history of the tRNA splicing endonuclease EndA: relationship to the LAGLIDADG and PD-(D/E)XK deoxyribonucleases.

    Science.gov (United States)

    Bujnicki, J M; Rychlewski, L

    2001-03-01

    The tRNA splicing endoribonuclease EndA from Methanococcus jannaschii is a homotetramer formed via heterologous interaction between the two pairs of homodimers. Each monomer consists of two alpha/beta domains, the N-terminal domain (NTD) and the C-terminal domain (CTD) containing the RNase A-like active site. Comparison of the EndA coordinates with the publicly available protein structure database revealed the similarity of both domains to site-specific deoxyribonucleases: the NTD to the LAGLIDADG family and the CTD to the PD-(D/E)XK family. Superposition of the NTD on the catalytic domain of LAGLIDADG homing endonucleases allowed a suggestion to be made about which amino acid residues of the tRNA splicing nuclease might participate in formation of a presumptive cryptic deoxyribonuclease active site. On the other hand, the CTD and PD-(D/E)XK endonucleases, represented by restriction enzymes and a phage lambda exonuclease, were shown to share extensive similarities of the structural framework, to which entirely different active sites might be attached in two alternative locations. These findings suggest that EndA evolved from a fusion protein with at least two distinct endonuclease activities: the ribonuclease, which made it an essential "antitoxin" for the cells whose RNA genes were interrupted by introns, and the deoxyribonuclease, which provided the means for homing-like mobility. The residues of the noncatalytic CTDs from the positions corresponding to the catalytic side chains in PD-(D/E)XK deoxyribonucleases map to the surface at the opposite side to the tRNA binding site, for which no function has been implicated. Many restriction enzymes from the PD-(D/E)XK superfamily might have the potential to maintain an additional active or binding site at the face opposite the deoxyribonuclease active site, a property that can be utilized in protein engineering.

  12. Identification and sequence analysis of metazoan tRNA 3'-end processing enzymes tRNase Zs.

    Directory of Open Access Journals (Sweden)

    Zhikang Wang

    Full Text Available tRNase Z is the endonuclease responsible for removing the 3'-trailer sequences from precursor tRNAs, a prerequisite for the addition of the CCA sequence. It occurs in the short (tRNase Z(S and long (tRNase Z(L forms. Here we report the identification and sequence analysis of candidate tRNase Zs from 81 metazoan species. We found that the vast majority of deuterostomes, lophotrochozoans and lower metazoans have one tRNase Z(S and one tRNase Z(L genes, whereas ecdysozoans possess only a single tRNase Z(L gene. Sequence analysis revealed that in metazoans, a single nuclear tRNase Z(L gene is likely to encode both the nuclear and mitochondrial forms of tRNA 3'-end processing enzyme through mechanisms that include alternative translation initiation from two in-frame start codons and alternative splicing. Sequence conservation analysis revealed a variant PxKxRN motif, PxPxRG, which is located in the N-terminal region of tRNase Z(Ss. We also identified a previously unappreciated motif, AxDx, present in the C-terminal region of both tRNase Z(Ss and tRNase Z(Ls. The AxDx motif consisting mainly of a very short loop is potentially close enough to form hydrogen bonds with the loop containing the PxKxRN or PxPxRG motif. Through complementation analysis, we demonstrated the likely functional importance of the AxDx motif. In conclusion, our analysis supports the notion that in metazoans a single tRNase Z(L has evolved to participate in both nuclear and mitochondrial tRNA 3'-end processing, whereas tRNase Z(S may have evolved new functions. Our analysis also unveils new evolutionarily conserved motifs in tRNase Zs, including the C-terminal AxDx motif, which may have functional significance.

  13. The Pai-associated leuX specific tRNA5(Leu) affects type 1fimbriation in pathogenic Escherichia coli by control of FimB recombinase expression

    DEFF Research Database (Denmark)

    Ritter, A.; Gally, D.; Olsen, Peter Bjarke

    1997-01-01

    ) and other virulence factors. Transcription of fimA, encoding the major type 1 fimbrialsubunit is controlled by an invertable DNA switch. The inversion is catalysed by two recombinases,FimB and FimE. FimB is able to turn the switch on, FimE only off. The fimB gene of strain 536contains five TTG codons...... recognized by tRNA5Leu, fimE contains only two. It was proposed thatturning on the fim switch requires efficient translation of FimB, in turn requiring tRNA5Leu. Strainsin which the TTG codons in fimB were replaced with CTG codons at the wild-type locus were ableto produce type 1 fimbriae in the absence...

  14. Steric complementarity in the decoding center is important for tRNA selection by the ribosome.

    Science.gov (United States)

    Khade, Prashant K; Shi, Xinying; Joseph, Simpson

    2013-10-23

    Accurate tRNA selection by the ribosome is essential for the synthesis of functional proteins. Previous structural studies indicated that the ribosome distinguishes between cognate and near-cognate tRNAs by monitoring the geometry of the codon-anticodon helix in the decoding center using the universally conserved 16S ribosomal RNA bases G530, A1492 and A1493. These bases form hydrogen bonds with the 2'-hydroxyl groups of the codon-anticodon helix, which are expected to be disrupted with a near-cognate codon-anticodon helix. However, a recent structural study showed that G530, A1492 and A1493 form hydrogen bonds in a manner identical with that of both cognate and near-cognate codon-anticodon helices. To understand how the ribosome discriminates between cognate and near-cognate tRNAs, we made 2'-deoxynucleotide and 2'-fluoro substituted mRNAs, which disrupt the hydrogen bonds between the A site codon and G530, A1492 and A1493. Our results show that multiple 2'-deoxynucleotide substitutions in the mRNA substantially inhibit tRNA selection, whereas multiple 2'-fluoro substitutions in the mRNA have only modest effects on tRNA selection. Furthermore, the miscoding antibiotics paromomycin and streptomycin rescue the defects in tRNA selection with the multiple 2'-deoxynucleotide substituted mRNA. These results suggest that steric complementarity in the decoding center is more important than the hydrogen bonds between the A site codon and G530, A1492 and A1493 for tRNA selection. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Structural similarities and functional differences clarify evolutionary relationships between tRNA healing enzymes and the myelin enzyme CNPase.

    Science.gov (United States)

    Muruganandam, Gopinath; Raasakka, Arne; Myllykoski, Matti; Kursula, Inari; Kursula, Petri

    2017-05-16

    Eukaryotic tRNA splicing is an essential process in the transformation of a primary tRNA transcript into a mature functional tRNA molecule. 5'-phosphate ligation involves two steps: a healing reaction catalyzed by polynucleotide kinase (PNK) in association with cyclic phosphodiesterase (CPDase), and a sealing reaction catalyzed by an RNA ligase. The enzymes that catalyze tRNA healing in yeast and higher eukaryotes are homologous to the members of the 2H phosphoesterase superfamily, in particular to the vertebrate myelin enzyme 2',3'-cyclic nucleotide 3'-phosphodiesterase (CNPase). We employed different biophysical and biochemical methods to elucidate the overall structural and functional features of the tRNA healing enzymes yeast Trl1 PNK/CPDase and lancelet PNK/CPDase and compared them with vertebrate CNPase. The yeast and the lancelet enzymes have cyclic phosphodiesterase and polynucleotide kinase activity, while vertebrate CNPase lacks PNK activity. In addition, we also show that the healing enzymes are structurally similar to the vertebrate CNPase by applying synchrotron radiation circular dichroism spectroscopy and small-angle X-ray scattering. We provide a structural analysis of the tRNA healing enzyme PNK and CPDase domains together. Our results support evolution of vertebrate CNPase from tRNA healing enzymes with a loss of function at its N-terminal PNK-like domain.

  16. The archaeal COG1901/DUF358 SPOUT-methyltransferase members, together with pseudouridine synthase Pus10, catalyze the formation of 1-methylpseudouridine at position 54 of tRNA

    Science.gov (United States)

    Chatterjee, Kunal; Blaby, Ian K.; Thiaville, Patrick C.; Majumder, Mrinmoyee; Grosjean, Henri; Yuan, Y. Adam; Gupta, Ramesh; de Crécy-Lagard, Valérie

    2012-01-01

    The methylation of pseudouridine (Ψ) at position 54 of tRNA, producing m1Ψ, is a hallmark of many archaeal species, but the specific methylase involved in the formation of this modification had yet to be characterized. A comparative genomics analysis had previously identified COG1901 (DUF358), part of the SPOUT superfamily, as a candidate for this missing methylase family. To test this prediction, the COG1901 encoding gene, HVO_1989, was deleted from the Haloferax volcanii genome. Analyses of modified base contents indicated that while m1Ψ was present in tRNA extracted from the wild-type strain, it was absent from tRNA extracted from the mutant strain. Expression of the gene encoding COG1901 from Halobacterium sp. NRC-1, VNG1980C, complemented the m1Ψ minus phenotype of the ΔHVO_1989 strain. This in vivo validation was extended with in vitro tests. Using the COG1901 recombinant enzyme from Methanocaldococcus jannaschii (Mj1640), purified enzyme Pus10 from M. jannaschii and full-size tRNA transcripts or TΨ-arm (17-mer) fragments as substrates, the sequential pathway of m1Ψ54 formation in Archaea was reconstituted. The methylation reaction is AdoMet dependent. The efficiency of the methylase reaction depended on the identity of the residue at position 55 of the TΨ-loop. The presence of Ψ55 allowed the efficient conversion of Ψ54 to m1Ψ54, whereas in the presence of C55, the reaction was rather inefficient and no methylation reaction occurred if a purine was present at this position. These results led to renaming the Archaeal COG1901 members as TrmY proteins. PMID:22274953

  17. Polycistronic tRNA and CRISPR guide-RNA enables highly efficient multiplexed genome engineering in human cells.

    Science.gov (United States)

    Dong, Fengping; Xie, Kabin; Chen, Yueying; Yang, Yinong; Mao, Yingwei

    2017-01-22

    CRISPR/Cas9 has been widely used for genomic editing in many organisms. Many human diseases are caused by multiple mutations. The CRISPR/Cas9 system provides a potential tool to introduce multiple mutations in a genome. To mimic complicated genomic variants in human diseases, such as multiple gene deletions or mutations, two or more small guide RNAs (sgRNAs) need to be introduced all together. This can be achieved by separate Pol III promoters in a construct. However, limited enzyme sites and increased insertion size lower the efficiency to make a construct. Here, we report a strategy to quickly assembly multiple sgRNAs in one construct using a polycistronic-tRNA-gRNA (PTG) strategy. Taking advantage of the endogenous tRNA processing system in mammalian cells, we efficiently express multiple sgRNAs driven using only one Pol III promoter. Using an all-in-one construct carrying PTG, we disrupt the deacetylase domain in multiple histone deacetylases (HDACs) in human cells simultaneously. We demonstrate that multiple HDAC deletions significantly affect the activation of the Wnt-signaling pathway. Thus, this method enables to efficiently target multiple genes and provide a useful tool to establish mutated cells mimicking human diseases. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Split SUSY Radiates Flavor

    CERN Document Server

    Baumgart, Matthew; Zorawski, Thomas

    2014-01-01

    Radiative flavor models where the hierarchies of Standard Model (SM) fermion masses and mixings are explained via loop corrections are elegant ways to solve the SM flavor puzzle. Here we build such a model in the context of Mini-Split Supersymmetry (SUSY) where both flavor and SUSY breaking occur at a scale of 1000 TeV. This model is consistent with the observed Higgs mass, unification, and WIMP dark matter. The high scale allows large flavor mixing among the sfermions, which provides part of the mechanism for radiative flavor generation. In the deep UV, all flavors are treated democratically, but at the SUSY breaking scale, the third, second, and first generation Yukawa couplings are generated at tree level, one loop, and two loops, respectively. Save for one, all the dimensionless parameters in the theory are O(1), with the exception being a modest and technically natural tuning that explains both the smallness of the bottom Yukawa coupling and the largeness of the Cabibbo angle.

  19. How rivers split

    Science.gov (United States)

    Seybold, H. F.; Yi, R.; Devauchelle, O.; Petroff, A.; Rothman, D.

    2012-12-01

    River networks have fascinated mankind for centuries. They exhibit a striking geometry with similar shapes repeating on all scales. Yet, how these networks form and create these geometries remains elusive. Recently we have shown that channels fed by subsurface flow split at a characteristic angle of 2π/5 unambiguously consistent with our field measurements in a seepage network on the Florida Panhandle (Fig.1). Our theory is based only on the simple hypothesis that the channels grow in the direction at which the ground water enters the spring and classical solutions of subsurface hydrology. Here we apply our analysis to the ramification of large drainage basins and extend our theory to include slope effects. Using high resolution stream networks from the National Hydrography Dataset (NHD), we scrutinize our hypothesis in arbitrary channel networks and investigate the branching angle dependence on Horton-Strahler order and the maturity of the streams.; High-resolution topographic map of valley networks incised by groundwater flow, located on the Florida Panhandle near Bristol, FL.

  20. Split supersymmetry radiates flavor

    Science.gov (United States)

    Baumgart, Matthew; Stolarski, Daniel; Zorawski, Thomas

    2014-09-01

    Radiative flavor models where the hierarchies of Standard Model (SM) fermion masses and mixings are explained via loop corrections are elegant ways to solve the SM flavor puzzle. Here we build such a model in the context of mini-split supersymmetry (SUSY) where both flavor and SUSY breaking occur at a scale of 1000 TeV. This model is consistent with the observed Higgs mass, unification, and dark matter as a weakly interacting massive particle. The high scale allows large flavor mixing among the sfermions, which provides part of the mechanism for radiative flavor generation. In the deep UV, all flavors are treated democratically, but at the SUSY-breaking scale, the third, second, and first generation Yukawa couplings are generated at tree level, one loop, and two loops, respectively. Save for one, all the dimensionless parameters in the theory are O(1), with the exception being a modest and technically natural tuning that explains both the smallness of the bottom Yukawa coupling and the largeness of the Cabibbo angle.

  1. Identification and analysis of candidate fungal tRNA 3'-end processing endonucleases tRNase Zs, homologs of the putative prostate cancer susceptibility protein ELAC2

    Directory of Open Access Journals (Sweden)

    Zhao Wei

    2010-09-01

    Full Text Available Abstract Background tRNase Z is the endonuclease that is responsible for the 3'-end processing of tRNA precursors, a process essential for tRNA 3'-CCA addition and subsequent tRNA aminoacylation. Based on their sizes, tRNase Zs can be divided into the long (tRNase ZL and short (tRNase ZS forms. tRNase ZL is thought to have arisen from a tandem gene duplication of tRNase ZS with further sequence divergence. The species distribution of tRNase Z is complex. Fungi represent an evolutionarily diverse group of eukaryotes. The recent proliferation of fungal genome sequences provides an opportunity to explore the structural and functional diversity of eukaryotic tRNase Zs. Results We report a survey and analysis of candidate tRNase Zs in 84 completed fungal genomes, spanning a broad diversity of fungi. We find that tRNase ZL is present in all fungi we have examined, whereas tRNase ZS exists only in the fungal phyla Basidiomycota, Chytridiomycota and Zygomycota. Furthermore, we find that unlike the Pezizomycotina and Saccharomycotina, which contain a single tRNase ZL, Schizosaccharomyces fission yeasts (Taphrinomycotina contain two tRNase ZLs encoded by two different tRNase ZL genes. These two tRNase ZLs are most likely localized to the nucleus and mitochondria, respectively, suggesting partitioning of tRNase Z function between two different tRNase ZLs in fission yeasts. The fungal tRNase Z phylogeny suggests that tRNase ZSs are ancestral to tRNase ZLs. Additionally, the evolutionary relationship of fungal tRNase ZLs is generally consistent with known phylogenetic relationships among the fungal species and supports tRNase ZL gene duplication in certain fungal taxa, including Schizosaccharomyces fission yeasts. Analysis of tRNase Z protein sequences reveals putative atypical substrate binding domains in most fungal tRNase ZSs and in a subset of fungal tRNase ZLs. Finally, we demonstrate the presence of pseudo-substrate recognition and catalytic motifs at

  2. Global Locator, Local Locator, and Identifier Split (GLI-Split

    Directory of Open Access Journals (Sweden)

    Michael Menth

    2013-03-01

    Full Text Available The locator/identifier split is an approach for a new addressing and routing architecture to make routing in the core of the Internet more scalable. Based on this principle, we developed the GLI-Split framework, which separates the functionality of current IP addresses into a stable identifier and two independent locators, one for routing in the Internet core and one for edge networks. This makes routing in the Internet more stable and provides more flexibility for edge networks. GLI-Split can be incrementally deployed and it is backward-compatible with the IPv6 Internet. We describe its architecture, compare it to other approaches, present its benefits, and finally present a proof-of-concept implementation of GLI-Split.

  3. Enhanced Dynamics of Hydrated tRNA on Nanodiamond Surfaces: A Combined Neutron Scattering and MD Simulation Study.

    Science.gov (United States)

    Dhindsa, Gurpreet K; Bhowmik, Debsindhu; Goswami, Monojoy; O'Neill, Hugh; Mamontov, Eugene; Sumpter, Bobby G; Hong, Liang; Ganesh, Panchapakesan; Chu, Xiang-Qiang

    2016-09-14

    Nontoxic, biocompatible nanodiamonds (ND) have recently been implemented in rational, systematic design of optimal therapeutic use in nanomedicines. However, hydrophilicity of the ND surface strongly influences structure and dynamics of biomolecules that restrict in situ applications of ND. Therefore, fundamental understanding of the impact of hydrophilic ND surface on biomolecules at the molecular level is essential. For tRNA, we observe an enhancement of dynamical behavior in the presence of ND contrary to generally observed slow motion at strongly interacting interfaces. We took advantage of neutron scattering experiments and computer simulations to demonstrate this atypical faster dynamics of tRNA on ND surface. The strong attractive interactions between ND, tRNA, and water give rise to unlike dynamical behavior and structural changes of tRNA in front of ND compared to without ND. Our new findings may provide new design principles for safer, improved drug delivery platforms.

  4. Split-illumination electron holography

    International Nuclear Information System (INIS)

    Tanigaki, Toshiaki; Aizawa, Shinji; Suzuki, Takahiro; Park, Hyun Soon; Inada, Yoshikatsu; Matsuda, Tsuyoshi; Taniyama, Akira; Shindo, Daisuke; Tonomura, Akira

    2012-01-01

    We developed a split-illumination electron holography that uses an electron biprism in the illuminating system and two biprisms (applicable to one biprism) in the imaging system, enabling holographic interference micrographs of regions far from the sample edge to be obtained. Using a condenser biprism, we split an electron wave into two coherent electron waves: one wave is to illuminate an observation area far from the sample edge in the sample plane and the other wave to pass through a vacuum space outside the sample. The split-illumination holography has the potential to greatly expand the breadth of applications of electron holography.

  5. Scyl1 Facilitates Nuclear tRNA Export in Mammalian Cells by Acting at the Nuclear Pore Complex

    Science.gov (United States)

    Chafe, Shawn C.

    2010-01-01

    Scyl1 is an evolutionarily conserved N-terminal protein kinase-like domain protein that plays a role in COP1-mediated retrograde protein trafficking in mammalian cells. Furthermore, loss of Scyl1 function has been shown to result in neurodegenerative disorders in mice. Here, we report that Scyl1 is also a cytoplasmic component of the mammalian nuclear tRNA export machinery. Like exportin-t, overexpression of Scyl1 restored export of a nuclear export-defective serine amber suppressor tRNA mutant in COS-7 cells. Scyl1 binds tRNA saturably, and associates with the nuclear pore complex by interacting, in part, with Nup98. Scyl1 copurifies with the nuclear tRNA export receptors exportin-t and exportin-5, the RanGTPase, and the eukaryotic elongation factor eEF-1A, which transports aminoacyl-tRNAs to the ribosomes. Scyl1 interacts directly with exportin-t and RanGTP but not with eEF-1A or RanGDP in vitro. Moreover, exportin-t containing tRNA, Scyl1, and RanGTP form a quaternary complex in vitro. Biochemical characterization also suggests that the nuclear aminoacylation-dependent pathway is primarily responsible for tRNA export in mammalian cells. These findings together suggest that Scyl1 participates in the nuclear aminoacylation-dependent tRNA export pathway and may unload aminoacyl-tRNAs from the nuclear tRNA export receptor at the cytoplasmic side of the nuclear pore complex and channels them to eEF-1A. PMID:20505071

  6. Sharing the load: Mex67-Mtr2 cofunctions with Los1 in primary tRNA nuclear export.

    Science.gov (United States)

    Chatterjee, Kunal; Majumder, Shubhra; Wan, Yao; Shah, Vijay; Wu, Jingyan; Huang, Hsiao-Yun; Hopper, Anita K

    2017-11-01

    Eukaryotic transfer RNAs (tRNAs) are exported from the nucleus, their site of synthesis, to the cytoplasm, their site of function for protein synthesis. The evolutionarily conserved β-importin family member Los1 (Exportin-t) has been the only exporter known to execute nuclear export of newly transcribed intron-containing pre-tRNAs. Interestingly, LOS1 is unessential in all tested organisms. As tRNA nuclear export is essential, we previously interrogated the budding yeast proteome to identify candidates that function in tRNA nuclear export. Here, we provide molecular, genetic, cytological, and biochemical evidence that the Mex67-Mtr2 (TAP-p15) heterodimer, best characterized for its essential role in mRNA nuclear export, cofunctions with Los1 in tRNA nuclear export. Inactivation of Mex67 or Mtr2 leads to rapid accumulation of end-matured unspliced tRNAs in the nucleus. Remarkably, merely fivefold overexpression of Mex67-Mtr2 can substitute for Los1 in los1 Δ cells. Moreover, in vivo coimmunoprecipitation assays with tagged Mex67 document that the Mex67 binds tRNAs. Our data also show that tRNA exporters surprisingly exhibit differential tRNA substrate preferences. The existence of multiple tRNA exporters, each with different tRNA preferences, may indicate that the proteome can be regulated by tRNA nuclear export. Thus, our data show that Mex67-Mtr2 functions in primary nuclear export for a subset of yeast tRNAs. © 2017 Chatterjee et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Binding of DNA-binding alkaloids berberine and palmatine to tRNA and comparison to ethidium: Spectroscopic and molecular modeling studies

    Science.gov (United States)

    Islam, Md. Maidul; Pandya, Prateek; Chowdhury, Sebanti Roy; Kumar, Surat; Kumar, Gopinatha Suresh

    2008-11-01

    The interaction of two natural protoberberine plant alkaloids berberine and palmatine with tRNA phe was studied using various biophysical techniques and molecular modeling and the data were compared with the binding of the classical DNA intercalator, ethidium. Circular dichroic studies revealed that the tRNA conformation was moderately perturbed on binding of the alkaloids. The cooperative binding of both the alkaloids and ethidium to tRNA was revealed from absorbance and fluorescence studies. Fluorescence quenching studies advanced a conclusion that while berberine and palmatine are partially intercalated, ethidium is fully intercalated on the tRNA molecule. The binding of the alkaloids as well as ethidium stabilized the tRNA melting, and the binding constant evaluated from the averaged optical melting temperature data was in agreement with fluorescence spectral-binding data. Differential scanning calorimetry revealed that the tRNA melting showed three close transitions that were affected on binding of these small molecules. Molecular docking calculations performed showed the preferred regions of binding of these small molecules on the tRNA. Taken together, the results suggest that the binding of the alkaloids berberine and palmatine on the tRNA structure appears to be mostly by partial intercalation while ethidium intercalates fully on the tRNA. These results further advance our knowledge on the molecular aspects on the interaction of these alkaloids to tRNA.

  8. Mitochondrial tRNA import in Trypanosoma brucei is independent of thiolation and the Rieske protein

    Czech Academy of Sciences Publication Activity Database

    Paris, Zdeněk; RUBIO, M. A. T.; Lukeš, Julius; Alfonzo, J. D.

    2009-01-01

    Roč. 15, č. 7 (2009), s. 1398-1406 ISSN 1355-8382 R&D Projects: GA ČR GA204/06/1558; GA MŠk LC07032; GA MŠk 2B06129 Institutional research plan: CEZ:AV0Z60220518 Keywords : T. brucei * tRNA import * 2-thiolation * RIC * Rieske * Fe-S cluster Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.198, year: 2009

  9. The enigmatic mitochondrial genome of Rhabdopleura compacta (Pterobranchia reveals insights into selection of an efficient tRNA system and supports monophyly of Ambulacraria

    Directory of Open Access Journals (Sweden)

    Stadler Peter F

    2011-05-01

    Full Text Available Abstract Background The Hemichordata comprises solitary-living Enteropneusta and colonial-living Pterobranchia, sharing morphological features with both Chordata and Echinodermata. Despite their key role for understanding deuterostome evolution, hemichordate phylogeny is controversial and only few molecular data are available for phylogenetic analysis. Furthermore, mitochondrial sequences are completely lacking for pterobranchs. Therefore, we determined and analyzed the complete mitochondrial genome of the pterobranch Rhabdopleura compacta to elucidate deuterostome evolution. Thereby, we also gained important insights in mitochondrial tRNA evolution. Results The mitochondrial DNA of Rhabdopleura compacta corresponds in size and gene content to typical mitochondrial genomes of metazoans, but shows the strongest known strand-specific mutational bias in the nucleotide composition among deuterostomes with a very GT-rich main-coding strand. The order of the protein-coding genes in R. compacta is similar to that of the deuterostome ground pattern. However, the protein-coding genes have been highly affected by a strand-specific mutational pressure showing unusual codon frequency and amino acid composition. This composition caused extremely long branches in phylogenetic analyses. The unusual codon frequency points to a selection pressure on the tRNA translation system to codon-anticodon sequences of highest versatility instead of showing adaptations in anticodon sequences to the most frequent codons. Furthermore, an assignment of the codon AGG to Lysine has been detected in the mitochondrial genome of R. compacta, which is otherwise observed only in the mitogenomes of some arthropods. The genomes of these arthropods do not have such a strong strand-specific bias as found in R. compacta but possess an identical mutation in the anticodon sequence of the tRNALys. Conclusion A strong reversed asymmetrical mutational constraint in the mitochondrial genome of

  10. tRNA modifying enzymes, NSUN2 and METTL1, determine sensitivity to 5-fluorouracil in HeLa cells.

    Directory of Open Access Journals (Sweden)

    Mayumi Okamoto

    2014-09-01

    Full Text Available Nonessential tRNA modifications by methyltransferases are evolutionarily conserved and have been reported to stabilize mature tRNA molecules and prevent rapid tRNA decay (RTD. The tRNA modifying enzymes, NSUN2 and METTL1, are mammalian orthologs of yeast Trm4 and Trm8, which are required for protecting tRNA against RTD. A simultaneous overexpression of NSUN2 and METTL1 is widely observed among human cancers suggesting that targeting of both proteins provides a novel powerful strategy for cancer chemotherapy. Here, we show that combined knockdown of NSUN2 and METTL1 in HeLa cells drastically potentiate sensitivity of cells to 5-fluorouracil (5-FU whereas heat stress of cells revealed no effects. Since NSUN2 and METTL1 are phosphorylated by Aurora-B and Akt, respectively, and their tRNA modifying activities are suppressed by phosphorylation, overexpression of constitutively dephosphorylated forms of both methyltransferases is able to suppress 5-FU sensitivity. Thus, NSUN2 and METTL1 are implicated in 5-FU sensitivity in HeLa cells. Interfering with methylation of tRNAs might provide a promising rationale to improve 5-FU chemotherapy of cancer.

  11. ISR split-field magnet

    CERN Multimedia

    CERN PhotoLab

    1975-01-01

    The experimental apparatus used at intersection 4 around the Split-Field Magnet by the CERN-Bologna Collaboration (experiment R406). The plastic scintillator telescopes are used for precise pulse-height and time-of-flight measurements.

  12. Sequence-dependent base-stacking stabilities guide tRNA folding energy landscapes.

    Science.gov (United States)

    Li, Rongzhong; Ge, Heming W; Cho, Samuel S

    2013-10-24

    The folding of bacterial tRNAs with disparate sequences has been observed to proceed in distinct folding mechanisms despite their structural similarity. To explore the folding landscapes of tRNA, we performed ion concentration-dependent coarse-grained TIS model MD simulations of several E. coli tRNAs to compare their thermodynamic melting profiles to the classical absorbance spectra of Crothers and co-workers. To independently validate our findings, we also performed atomistic empirical force field MD simulations of tRNAs, and we compared the base-to-base distances from coarse-grained and atomistic MD simulations to empirical base-stacking free energies. We then projected the free energies to the secondary structural elements of tRNA, and we observe distinct, parallel folding mechanisms whose differences can be inferred on the basis of their sequence-dependent base-stacking stabilities. In some cases, a premature, nonproductive folding intermediate corresponding to the Ψ hairpin loop must backtrack to the unfolded state before proceeding to the folded state. This observation suggests a possible explanation for the fast and slow phases observed in tRNA folding kinetics.

  13. MMB-GUI: a fast morphing method demonstrates a possible ribosomal tRNA translocation trajectory.

    Science.gov (United States)

    Tek, Alex; Korostelev, Andrei A; Flores, Samuel Coulbourn

    2016-01-08

    Easy-to-use macromolecular viewers, such as UCSF Chimera, are a standard tool in structural biology. They allow rendering and performing geometric operations on large complexes, such as viruses and ribosomes. Dynamical simulation codes enable modeling of conformational changes, but may require considerable time and many CPUs. There is an unmet demand from structural and molecular biologists for software in the middle ground, which would allow visualization combined with quick and interactive modeling of conformational changes, even of large complexes. This motivates MMB-GUI. MMB uses an internal-coordinate, multiscale approach, yielding as much as a 2000-fold speedup over conventional simulation methods. We use Chimera as an interactive graphical interface to control MMB. We show how this can be used for morphing of macromolecules that can be heterogeneous in biopolymer type, sequence, and chain count, accurately recapitulating structural intermediates. We use MMB-GUI to create a possible trajectory of EF-G mediated gate-passing translocation in the ribosome, with all-atom structures. This shows that the GUI makes modeling of large macromolecules accessible to a wide audience. The morph highlights similarities in tRNA conformational changes as tRNA translocates from A to P and from P to E sites and suggests that tRNA flexibility is critical for translocation completion. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Growth-Rate Dependent Regulation of tRNA Level and Charging in Bacillus licheniformis.

    Science.gov (United States)

    Ferro, Iolanda; Liebeton, Klaus; Ignatova, Zoya

    2017-10-13

    Cellular growth crucially depends on protein synthesis and the abundance of translational components. Among them, aminoacyl-tRNAs play a central role in biosynthesis and shape the kinetics of mRNA translation, thus influencing protein production. Here, we used microarray-based approaches to determine the charging levels and tRNA abundance of Bacillus licheniformis. We observed an interesting cross-talk among tRNA expression, charging pattern, and growth rate. For a large subset of tRNAs, we found a co-regulated and augmented expression at high growth rate. Their tRNA aminoacylation level is kept relatively constant through riboswitch-regulated expression of the cognate aminoacyl-tRNA-synthetase (AARS). We show that AARSs with putative riboswitch-controlled expression are those charging tRNAs with amino acids which disfavor cell growth when individually added to the nutrient medium. Our results suggest that the riboswitch-regulated AARS expression in B. licheniformis is a powerful mechanism not only to maintain a constant ratio of aminoacyl-tRNA independent of the growth rate but concomitantly to control the intracellular level of free amino acids. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Snapshots of Dynamics in Synthesizing N6-isopentenyladenosine at tRNA Anticodon†,‡

    Science.gov (United States)

    Chimnaronk, Sarin; Forouhar, Farhad; Sakai, Junichi; Yao, Min; Tron, Cecile M.; Atta, Mohamed; Fontecave, Marc; Hunt, John F.; Tanaka, Isao

    2009-01-01

    Bacterial and eukaryotic transfer RNAs that decode codons starting with uridine have a hydrophobically-hypermodified adenosine at the position 37 (A37) adjacent to the 3′-end of the anticodon, which is essential for efficient and highly accurate protein translation by the ribosome. However, it remains unclear how the corresponding tRNAs are selected to be modified by alkylation at the correct position of the adenosine base. We have determined a series of the crystal structures of bacterial tRNA isopentenyltransferase (MiaA) in apo- and tRNA-bound forms, which completely render snapshots of substrate selections during modification of RNA. A compact evolutionary inserted domain (herein ‘swinging domain’) in MiaA that exhibits as a highly mobile entity moves around the catalytic domain as likely to reach and trap the tRNA substrate. Thereby, MiaA clamps the anticodon stem loop of tRNA substrate between the catalytic and swinging domains, where the two conserved elongated residues from the swinging domain pinch the two flanking A36 and A38 together to squeeze out A37 into the reaction tunnel. The site-specific isopentenylation of RNA is thus ensured by a characteristic pinch-and-flip mechanism and by a reaction tunnel to confine the substrate selection. Furthermore, combining information from soaking experiments with structural comparisons, we propose a mechanism for the ordered substrate-binding of MiaA. PMID:19435325

  16. Alteration of protein function by a silent polymorphism linked to tRNA abundance.

    Directory of Open Access Journals (Sweden)

    Sebastian Kirchner

    2017-05-01

    Full Text Available Synonymous single nucleotide polymorphisms (sSNPs are considered neutral for protein function, as by definition they exchange only codons, not amino acids. We identified an sSNP that modifies the local translation speed of the cystic fibrosis transmembrane conductance regulator (CFTR, leading to detrimental changes to protein stability and function. This sSNP introduces a codon pairing to a low-abundance tRNA that is particularly rare in human bronchial epithelia, but not in other human tissues, suggesting tissue-specific effects of this sSNP. Up-regulation of the tRNA cognate to the mutated codon counteracts the effects of the sSNP and rescues protein conformation and function. Our results highlight the wide-ranging impact of sSNPs, which invert the programmed local speed of mRNA translation and provide direct evidence for the central role of cellular tRNA levels in mediating the actions of sSNPs in a tissue-specific manner.

  17. Alteration of protein function by a silent polymorphism linked to tRNA abundance.

    Science.gov (United States)

    Kirchner, Sebastian; Cai, Zhiwei; Rauscher, Robert; Kastelic, Nicolai; Anding, Melanie; Czech, Andreas; Kleizen, Bertrand; Ostedgaard, Lynda S; Braakman, Ineke; Sheppard, David N; Ignatova, Zoya

    2017-05-01

    Synonymous single nucleotide polymorphisms (sSNPs) are considered neutral for protein function, as by definition they exchange only codons, not amino acids. We identified an sSNP that modifies the local translation speed of the cystic fibrosis transmembrane conductance regulator (CFTR), leading to detrimental changes to protein stability and function. This sSNP introduces a codon pairing to a low-abundance tRNA that is particularly rare in human bronchial epithelia, but not in other human tissues, suggesting tissue-specific effects of this sSNP. Up-regulation of the tRNA cognate to the mutated codon counteracts the effects of the sSNP and rescues protein conformation and function. Our results highlight the wide-ranging impact of sSNPs, which invert the programmed local speed of mRNA translation and provide direct evidence for the central role of cellular tRNA levels in mediating the actions of sSNPs in a tissue-specific manner.

  18. Structure–function relations in the NTPase domain of the antiviral tRNA ribotoxin Escherichia coli PrrC

    International Nuclear Information System (INIS)

    Meineke, Birthe; Shuman, Stewart

    2012-01-01

    Breakage of tRNA by Escherichia coli anticodon nuclease PrrC (EcoPrrC) underlies a host antiviral response to phage T4 infection. Expression of EcoPrrC is cytocidal in yeast, signifying that PrrC ribotoxicity crosses phylogenetic domain boundaries. EcoPrrC consists of an N-terminal NTPase module that resembles ABC transporters and a C-terminal nuclease module that is sui generis. PrrC homologs are prevalent in many other bacteria. Here we report that Haemophilus influenzae PrrC is toxic in E. coli and yeast. To illuminate structure–activity relations, we conducted a new round of mutational analysis of EcoPrrC guided by primary structure conservation among toxic PrrC homologs. We indentify 17 candidate active site residues in the NTPase module that are essential for toxicity in yeast when EcoPrrC is expressed at high gene dosage. Their functions could be educed by integrating mutational data with the atomic structure of the transition-state complex of a homologous ABC protein.

  19. Towards an Integrative Understanding of tRNA Aminoacylation-Diet-Host-Gut Microbiome Interactions in Neurodegeneration.

    Science.gov (United States)

    Paley, Elena L; Perry, George

    2018-03-26

    Transgenic mice used for Alzheimer's disease (AD) preclinical experiments do not recapitulate the human disease. In our models, the dietary tryptophan metabolite tryptamine produced by human gut microbiome induces tryptophanyl-tRNA synthetase (TrpRS) deficiency with consequent neurodegeneration in cells and mice. Dietary supplements, antibiotics and certain drugs increase tryptamine content in vivo. TrpRS catalyzes tryptophan attachment to tRNA trp at initial step of protein biosynthesis. Tryptamine that easily crosses the blood-brain barrier induces vasculopathies, neurodegeneration and cell death via TrpRS competitive inhibition. TrpRS inhibitor tryptophanol produced by gut microbiome also induces neurodegeneration. TrpRS inhibition by tryptamine and its metabolites preventing tryptophan incorporation into proteins lead to protein biosynthesis impairment. Tryptophan, a least amino acid in food and proteins that cannot be synthesized by humans competes with frequent amino acids for the transport from blood to brain. Tryptophan is a vulnerable amino acid, which can be easily lost to protein biosynthesis. Some proteins marking neurodegenerative pathology, such as tau lack tryptophan. TrpRS exists in cytoplasmic (WARS) and mitochondrial (WARS2) forms. Pathogenic gene variants of both forms cause TrpRS deficiency with consequent intellectual and motor disabilities in humans. The diminished tryptophan-dependent protein biosynthesis in AD patients is a proof of our model-based disease concept.

  20. Structure-function relations in the NTPase domain of the antiviral tRNA ribotoxin Escherichia coli PrrC

    Energy Technology Data Exchange (ETDEWEB)

    Meineke, Birthe; Shuman, Stewart, E-mail: s-shuman@ski.mskcc.org

    2012-06-05

    Breakage of tRNA by Escherichia coli anticodon nuclease PrrC (EcoPrrC) underlies a host antiviral response to phage T4 infection. Expression of EcoPrrC is cytocidal in yeast, signifying that PrrC ribotoxicity crosses phylogenetic domain boundaries. EcoPrrC consists of an N-terminal NTPase module that resembles ABC transporters and a C-terminal nuclease module that is sui generis. PrrC homologs are prevalent in many other bacteria. Here we report that Haemophilus influenzae PrrC is toxic in E. coli and yeast. To illuminate structure-activity relations, we conducted a new round of mutational analysis of EcoPrrC guided by primary structure conservation among toxic PrrC homologs. We indentify 17 candidate active site residues in the NTPase module that are essential for toxicity in yeast when EcoPrrC is expressed at high gene dosage. Their functions could be educed by integrating mutational data with the atomic structure of the transition-state complex of a homologous ABC protein.

  1. Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

    Directory of Open Access Journals (Sweden)

    Ovchinnikov Sergey

    2012-03-01

    Full Text Available Abstract Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic

  2. Conformation and functioning of tRNAs: cross-linked tRNAs as substrate for tRNA nucleotidyl-transferase and aminoacyl synthetases

    International Nuclear Information System (INIS)

    Carre, D.S.; Thomas, G.; Favre, A.

    1974-01-01

    The behavior of mixed E. coli tRNAs ''cross-linked'' by irradiation with near ultraviolet light (310-400 nm) has been compared to that of the intact molecules in two enzymatic processes. No change in the rate and extent of the repair of the pCpCpA 3' terminus of tRNA by purified E. coli tRNA nucleotidyltransferase can be detected. In contrast, complex data were obtained in the acylation reaction. They can be understood using other tRNA specific modifications as well as our present knowledge of E. coli tRNA sequences and rare base content [fr

  3. Exploring the interaction of Azure dyes with t-RNA by hybrid spectroscopic and computational approaches and its applications toward human lung cancer cell line.

    Science.gov (United States)

    Rajan, Dhanya; Ilanchelian, Malaichamy

    2018-03-01

    In the present study, in depth characterization of binding aspects of Azure A (AZA) and Azure B (AZB) with transfer Ribonucleic acid (t-RNA) from Escherichia coli (E.coli) is investigated using spectroscopic techniques. The absorbance and fluorescence properties of these dyes have been remarkably changed upon binding with t-RNA. Significant changes in the absorption maxima of the dyes evidence the t-RNA induced metachromasy and the binding clearly revealed the high affinity of AZA and AZB to t-RNA. Strong emission polarization of the bound dyes and strong energy transfer from the guanine base pairs of t-RNA suggested intercalative binding interaction. The stoichiometry of AZA and AZB with t-RNA complexes are determined by the Benesi-Hildebrand plot from emission data. The negative values of free energy change indicated the involvement of hydrophobic forces and noncovalent interactions in the complexation of both the dyes with t-RNA. The 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) colorimetric assay in A-549 human lung cancer cell lines reveals that binding of t-RNA reduces the toxicity of AZA and AZB. The utility of the present work explores the potential binding applicability of these dyes to t-RNA for their development as effective therapeutic agents and its target at molecular level for the treatment of diseases like cancer. Copyright © 2018. Published by Elsevier B.V.

  4. Splitting strings on integrable backgrounds

    International Nuclear Information System (INIS)

    Vicedo, Benoit

    2011-05-01

    We use integrability to construct the general classical splitting string solution on R x S 3 . Namely, given any incoming string solution satisfying a necessary self-intersection property at some given instant in time, we use the integrability of the worldsheet σ-model to construct the pair of outgoing strings resulting from a split. The solution for each outgoing string is expressed recursively through a sequence of dressing transformations, the parameters of which are determined by the solutions to Birkhoff factorization problems in an appropriate real form of the loop group of SL 2 (C). (orig.)

  5. A Split Staphylococcus aureus Cas9 as a Compact Genome-Editing Tool in Plants

    OpenAIRE

    Kaya, Hidetaka; Ishibashi, Kazuhiro; Toki, Seiichi

    2017-01-01

    Split-protein methods?where a protein is split into two inactive fragments that must re-assemble to form an active protein?can be used to regulate the activity of a given protein and reduce the size of gene transcription units. Here, we show that a Staphylococcus aureus Cas9 (SaCas9) can be split, and that split-SaCas9 expressed from Agrobacterium can induce targeted mutagenesis in Nicotiana benthamiana. Since SaCas9 is smaller than the more commonly used Cas9 derived from Streptococcus pyoge...

  6. Limited diagnostic value of enzyme analysis in patients with mitochondrial tRNA mutations

    DEFF Research Database (Denmark)

    Wibrand, Flemming; Jeppesen, Tina Dysgaard; Frederiksen, Anja L

    2010-01-01

    We evaluated the diagnostic value of respiratory chain (RC) enzyme analysis of muscle in adult patients with mitochondrial myopathy (MM). RC enzyme activity was measured in muscle biopsies from 39 patients who carry either the 3243A>G mutation, other tRNA point mutations, or single, large......, respectively, in these three groups. The results indicate that RC enzyme analysis in muscle is not a sensitive test for MM in adults. In these patients, abnormal muscle histochemistry appears to be a better predictor ofMM....

  7. Alteration of protein function by a silent polymorphism linked to tRNA abundance

    OpenAIRE

    Kirchner, Sebastian; Cai, Zhiwei; Rauscher, Robert; Kastelic, Nicolai; Anding, Melanie; Czech, Andreas; Kleizen, Bertrand; Ostedgaard, Lynda S.; Braakman, Ineke; Sheppard, David N.; Ignatova, Zoya

    2017-01-01

    Synonymous single nucleotide polymorphisms (sSNPs) are considered neutral for protein function, as by definition they exchange only codons, not amino acids. We identified an sSNP that modifies the local translation speed of the cystic fibrosis transmembrane conduc-tance regulator (CFTR), leading to detrimental changes to protein stability and function. This sSNP introduces a codon pairing to a low-abundance tRNA that is particularly rare in human bronchial epithelia, but not in other human ti...

  8. Split supersymmetry in brane models

    Indian Academy of Sciences (India)

    Type-I string theory in the presence of internal magnetic fields provides a concrete realization of split supersymmetry. To lowest order, gauginos are massless while squarks and sleptons are superheavy. For weak magnetic fields, the correct Standard Model spectrum guarantees gauge coupling unification with sin2 W ...

  9. VBSCan Split 2017 Workshop Summary

    Energy Technology Data Exchange (ETDEWEB)

    Anders, Christoph Falk; et al.

    2018-01-12

    This document summarises the talks and discussions happened during the VBSCan Split17 workshop, the first general meeting of the VBSCan COST Action network. This collaboration is aiming at a consistent and coordinated study of vector-boson scattering from the phenomenological and experimental point of view, for the best exploitation of the data that will be delivered by existing and future particle colliders.

  10. Split supersymmetry in brane models

    Indian Academy of Sciences (India)

    journal of. November 2006 physics pp. 793–802. Split supersymmetry in brane models. IGNATIOS ANTONIADIS∗. Department of Physics, CERN-Theory Division, 1211 Geneva 23, Switzerland. E-mail: Ignatios. ... that LEP data favor the unification of the three SM gauge couplings are smoking guns for the presence of new ...

  11. Water splitting by cooperative catalysis

    NARCIS (Netherlands)

    Hetterscheid, D.G.H.; van der Vlugt, J.I.; de Bruin, B.; Reek, J.N.H.

    2009-01-01

    A mononuclear Ru complex is shown to efficiently split water into H2 and O2 in consecutive steps through a heat- and light-driven process (see picture). Thermally driven H2 formation involves the aid of a non-innocent ligand scaffold, while dioxygen is generated by initial photochemically induced

  12. On split Lie triple systems

    Indian Academy of Sciences (India)

    Lie triple system; system of roots; root space; split Lie algebra; structure theory. 1. Introduction and previous definitions. Throughout this paper, Lie triple systems T are considered of arbitrary dimension and over an arbitrary field K. It is worth to mention that, unless otherwise stated, there is not any restriction on dim Tα or {k ...

  13. On split Lie triple systems

    Indian Academy of Sciences (India)

    The key tool in this job is the notion of connection of roots in the framework of split Lie triple systems. Author Affiliations. Antonio J Calderón Martín1. Departamento de Matemáticas, Universidad de Cádiz, 11510 Puerto Real, Cádiz, Spain. Dates. Manuscript received: 25 January 2008. Proceedings – Mathematical Sciences.

  14. New pleiotropic effects of eliminating a rare tRNA from Streptomyces coelicolor, revealed by combined proteomic and transcriptomic analysis of liquid cultures

    Directory of Open Access Journals (Sweden)

    Hotchkiss Graham

    2007-08-01

    Full Text Available Abstract Background In Streptomyces coelicolor, bldA encodes the only tRNA for a rare leucine codon, UUA. This tRNA is unnecessary for growth, but is required for some aspects of secondary metabolism and morphological development. We describe a transcriptomic and proteomic analysis of the effects of deleting bldA on cellular processes during submerged culture: conditions relevant to the industrial production of antibiotics. Results At the end of rapid growth, a co-ordinated transient up-regulation of about 100 genes, including many for ribosomal proteins, was seen in the parent strain but not the ΔbldA mutant. Increased basal levels of the signal molecule ppGpp in the mutant strain may be responsible for this difference. Transcripts or proteins from a further 147 genes classified as bldA-influenced were mostly expressed late in culture in the wild-type, though others were significantly transcribed during exponential growth. Some were involved in the biosynthesis of seven secondary metabolites; and some have probable roles in reorganising metabolism after rapid growth. Many of the 147 genes were "function unknown", and may represent unknown aspects of Streptomyces biology. Only two of the 147 genes contain a TTA codon, but some effects of bldA could be traced to TTA codons in regulatory genes or polycistronic operons. Several proteins were affected post-translationally by the bldA deletion. There was a statistically significant but weak positive global correlation between transcript and corresponding protein levels. Different technical limitations of the two approaches were a major cause of discrepancies in the results obtained with them. Conclusion Although deletion of bldA has very conspicuous effects on the gross phenotype, the bldA molecular phenotype revealed by the "dualomic" approach has shown that only about 2% of the genome is affected; but this includes many previously unknown effects at a variety of different levels, including post

  15. The frequency of translational misreading errors in E. coli is largely determined by tRNA competition

    Science.gov (United States)

    Kramer, Emily B.; Farabaugh, Philip J.

    2007-01-01

    Estimates of missense error rates (misreading) during protein synthesis vary from 10−3 to 10−4 per codon. The experiments reporting these rates have measured several distinct errors using several methods and reporter systems. Variation in reported rates may reflect real differences in rates among the errors tested or in sensitivity of the reporter systems. To develop a more accurate understanding of the range of error rates, we developed a system to quantify the frequency of every possible misreading error at a defined codon in Escherichia coli. This system uses an essential lysine in the active site of firefly luciferase. Mutations in Lys529 result in up to a 1600-fold reduction in activity, but the phenotype varies with amino acid. We hypothesized that residual activity of some of the mutant genes might result from misreading of the mutant codons by tRNALys UUUU, the cognate tRNA for the lysine codons, AAA and AAG. Our data validate this hypothesis and reveal details about relative missense error rates of near-cognate codons. The error rates in E. coli do, in fact, vary widely. One source of variation is the effect of competition by cognate tRNAs for the mutant codons; higher error frequencies result from lower competition from low-abundance tRNAs. We also used the system to study the effect of ribosomal protein mutations known to affect error rates and the effect of error-inducing antibiotics, finding that they affect misreading on only a subset of near-cognate codons and that their effect may be less general than previously thought. PMID:17095544

  16. Structure and Activity of an Aminoacyl-tRNA Synthetase that Charges tRNA with Nitro-Tryptophan

    Energy Technology Data Exchange (ETDEWEB)

    Buddha,M.; Crane, B.

    2005-01-01

    The most divergent of two tryptophanyl tRNA synthetases (TrpRS II) found in Deinococcus radiodurans interacts with a nitric oxide synthase protein that produces 4-nitro-tryptophan (4-NRP). TrpRS II efficiently charges transfer RNATrp with 4-NRP and 5-hydroxy-tryptophan (5-HRP). The crystal structures of TrpRS II bound to tryptophan and 5-HRP reveal residue substitutions that accommodate modified indoles. A class of auxiliary bacterial TrpRSs conserve this capacity to charge tRNA with nonstandard amino acids.

  17. tRNA Derived smallRNAs: smallRNAs Repertoire Has Yet to Be Decoded in Plants

    Directory of Open Access Journals (Sweden)

    Gaurav Sablok

    2017-07-01

    Full Text Available Among several smallRNAs classes, microRNAs play an important role in controlling the post-transcriptional events. Next generation sequencing has played a major role in extending the landscape of miRNAs and revealing their spatio-temporal roles in development and abiotic stress. Lateral evolution of these smallRNAs classes have widely been seen with the recently emerging knowledge on tRNA derived smallRNAs. In the present perspective, we discussed classification, identification and roles of tRNA derived smallRNAs across plants and their potential involvement in abiotic and biotic stresses.

  18. Orthogonal use of a human tRNA synthetase active site to achieve multi-functionality

    Science.gov (United States)

    Zhou, Quansheng; Kapoor, Mili; Guo, Min; Belani, Rajesh; Xu, Xiaoling; Kiosses, William B.; Hanan, Melanie; Park, Chulho; Armour, Eva; Do, Minh-Ha; Nangle, Leslie A.; Schimmel, Paul; Yang, Xiang-Lei

    2011-01-01

    Protein multi-functionality is an emerging explanation for the complexity of higher organisms. In this regard, while aminoacyl tRNA synthetases catalyze amino acid activation for protein synthesis, some also act in pathways for inflammation, angiogenesis, and apoptosis. How multiple functions evolved and their relationship to the active site is not clear. Here structural modeling analysis, mutagenesis, and cell-based functional studies show that the potent angiostatic, natural fragment of human TrpRS associates via Trp side chains that protrude from the cognate cellular receptor VE-cadherin. Modeling indicates that (I prefer the way it was because the conclusion was reached not only by modeling, but more so by experimental studies.)VE-cadherin Trp side chains fit into the Trp-specific active site of the synthetase. Thus, specific side chains of the receptor mimic (?) amino acid substrates and expand the functionality of the active site of the synthetase. We propose that orthogonal use of the same active site may be a general way to develop multi-functionality of human tRNA synthetases and other proteins. PMID:20010843

  19. Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein

    International Nuclear Information System (INIS)

    Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.

    1988-01-01

    In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes

  20. 2'-O-methylation in mRNA disrupts tRNA decoding during translation elongation.

    Science.gov (United States)

    Choi, Junhong; Indrisiunaite, Gabriele; DeMirci, Hasan; Ieong, Ka-Weng; Wang, Jinfan; Petrov, Alexey; Prabhakar, Arjun; Rechavi, Gideon; Dominissini, Dan; He, Chuan; Ehrenberg, Måns; Puglisi, Joseph D

    2018-03-01

    Chemical modifications of mRNA may regulate many aspects of mRNA processing and protein synthesis. Recently, 2'-O-methylation of nucleotides was identified as a frequent modification in translated regions of human mRNA, showing enrichment in codons for certain amino acids. Here, using single-molecule, bulk kinetics and structural methods, we show that 2'-O-methylation within coding regions of mRNA disrupts key steps in codon reading during cognate tRNA selection. Our results suggest that 2'-O-methylation sterically perturbs interactions of ribosomal-monitoring bases (G530, A1492 and A1493) with cognate codon-anticodon helices, thereby inhibiting downstream GTP hydrolysis by elongation factor Tu (EF-Tu) and A-site tRNA accommodation, leading to excessive rejection of cognate aminoacylated tRNAs in initial selection and proofreading. Our current and prior findings highlight how chemical modifications of mRNA tune the dynamics of protein synthesis at different steps of translation elongation.

  1. Cross-Talk between Dnmt2-Dependent tRNA Methylation and Queuosine Modification

    Directory of Open Access Journals (Sweden)

    Ann E. Ehrenhofer-Murray

    2017-02-01

    Full Text Available Enzymes of the Dnmt2 family of methyltransferases have yielded a number of unexpected discoveries. The first surprise came more than ten years ago when it was realized that, rather than being DNA methyltransferases, Dnmt2 enzymes actually are transfer RNA (tRNA methyltransferases for cytosine-5 methylation, foremost C38 (m5C38 of tRNAAsp. The second unanticipated finding was our recent discovery of a nutritional regulation of Dnmt2 in the fission yeast Schizosaccharomyces pombe. Significantly, the presence of the nucleotide queuosine in tRNAAsp strongly stimulates Dnmt2 activity both in vivo and in vitro in S. pombe. Queuine, the respective base, is a hypermodified guanine analog that is synthesized from guanosine-5’-triphosphate (GTP by bacteria. Interestingly, most eukaryotes have queuosine in their tRNA. However, they cannot synthesize it themselves, but rather salvage it from food or from gut microbes. The queuine obtained from these sources comes from the breakdown of tRNAs, where the queuine ultimately was synthesized by bacteria. Queuine thus has been termed a micronutrient. This review summarizes the current knowledge of Dnmt2 methylation and queuosine modification with respect to translation as well as the organismal consequences of the absence of these modifications. Models for the functional cooperation between these modifications and its wider implications are discussed.

  2. The complete mitochondrial genome sequence of the hydrothermal vent galatheid crab Shinkaia crosnieri (Crustacea: Decapoda: Anomura: A novel arrangement and incomplete tRNA suite

    Directory of Open Access Journals (Sweden)

    Yang Jin-Shu

    2008-05-01

    Full Text Available Abstract Background Metazoan mitochondrial genomes usually consist of the same 37 genes. Such genes contain useful information for phylogenetic analyses and evolution modelling. Although complete mitochondrial genomes have been determined for over 1,000 animals to date, hydrothermal vent species have, thus far, remained excluded due to the scarcity of collected specimens. Results The mitochondrial genome of the hydrothermal vent galatheid crab Shinkaia crosnieri is 15,182 bp in length, and is composed of 13 protein-coding genes, two ribosomal RNA genes and only 18 transfer RNA genes. The total AT content of the genome, as is typical for decapods, is 72.9%. We identified a non-coding control region of 327 bp according to its location and AT-richness. This is the smallest control region discovered in crustaceans so far. A mechanism of cytoplasmic tRNA import was addressed to compensate for the four missing tRNAs. The S. crosnieri mitogenome exhibits a novel arrangement of mitochondrial genes. We investigated the mitochondrial gene orders and found that at least six rearrangements from the ancestral pancrustacean (crustacean + hexapod pattern have happened successively. The codon usage, nucleotide composition and bias show no substantial difference with other decapods. Phylogenetic analyses using the concatenated nucleotide and amino acid sequences of the 13 protein-coding genes prove consistent with the previous classification based upon their morphology. Conclusion The present study will supply considerable data of use for both genomic and evolutionary research on hydrothermal vent ecosystems. The mitochondrial genetic characteristics of decapods are sustained in this case of S. crosnieri despite the absence of several tRNAs and a number of dramatic rearrangements. Our results may provide evidence for the immigrating hypothesis about how vent species originate.

  3. The complete mitochondrial genome sequence of the hydrothermal vent galatheid crab Shinkaia crosnieri (Crustacea: Decapoda: Anomura): a novel arrangement and incomplete tRNA suite.

    Science.gov (United States)

    Yang, Jin-Shu; Nagasawa, Hiromichi; Fujiwara, Yoshihiro; Tsuchida, Shinji; Yang, Wei-Jun

    2008-05-30

    Metazoan mitochondrial genomes usually consist of the same 37 genes. Such genes contain useful information for phylogenetic analyses and evolution modelling. Although complete mitochondrial genomes have been determined for over 1,000 animals to date, hydrothermal vent species have, thus far, remained excluded due to the scarcity of collected specimens. The mitochondrial genome of the hydrothermal vent galatheid crab Shinkaia crosnieri is 15,182 bp in length, and is composed of 13 protein-coding genes, two ribosomal RNA genes and only 18 transfer RNA genes. The total AT content of the genome, as is typical for decapods, is 72.9%. We identified a non-coding control region of 327 bp according to its location and AT-richness. This is the smallest control region discovered in crustaceans so far. A mechanism of cytoplasmic tRNA import was addressed to compensate for the four missing tRNAs. The S. crosnieri mitogenome exhibits a novel arrangement of mitochondrial genes. We investigated the mitochondrial gene orders and found that at least six rearrangements from the ancestral pancrustacean (crustacean + hexapod) pattern have happened successively. The codon usage, nucleotide composition and bias show no substantial difference with other decapods. Phylogenetic analyses using the concatenated nucleotide and amino acid sequences of the 13 protein-coding genes prove consistent with the previous classification based upon their morphology. The present study will supply considerable data of use for both genomic and evolutionary research on hydrothermal vent ecosystems. The mitochondrial genetic characteristics of decapods are sustained in this case of S. crosnieri despite the absence of several tRNAs and a number of dramatic rearrangements. Our results may provide evidence for the immigrating hypothesis about how vent species originate.

  4. Stability of split Stirling refrigerators

    International Nuclear Information System (INIS)

    Waele, A T A M de; Liang, W

    2009-01-01

    In many thermal systems spontaneous mechanical oscillations are generated under the influence of large temperature gradients. Well-known examples are Taconis oscillations in liquid-helium cryostats and oscillations in thermoacoustic systems. In split Stirling refrigerators the compressor and the cold finger are connected by a flexible tube. The displacer in the cold head is suspended by a spring. Its motion is pneumatically driven by the pressure oscillations generated by the compressor. In this paper we give the basic dynamic equations of split Stirling refrigerators and investigate the possibility of spontaneous mechanical oscillations if a large temperature gradient develops in the cold finger, e.g. during or after cool down. These oscillations would be superimposed on the pressure oscillations of the compressor and could ruin the cooler performance.

  5. Examining tRNA 3'-ends inEscherichia coli: teamwork between CCA-adding enzyme, RNase T, and RNase R.

    Science.gov (United States)

    Wellner, Karolin; Czech, Andreas; Ignatova, Zoya; Betat, Heike; Mörl, Mario

    2018-03-01

    tRNA maturation and quality control are crucial for proper functioning of these transcripts in translation. In several organisms, defective tRNAs were shown to be tagged by poly(A) or CCACCA tails and subsequently degraded by 3'-exonucleases. In a deep-sequencing analysis of tRNA 3'-ends, we detected the CCACCA tag also in Escherichia coli However, this tag closely resembles several 3'-trailers of tRNA precursors targeted for maturation and not for degradation. Here, we investigate the ability of two important exonucleases, RNase R and RNase T, to distinguish tRNA precursors with a native 3'-trailer from tRNAs with a CCACCA tag. Our results show that the degrading enzyme RNase R breaks down both tRNAs primed for degradation as well as precursor transcripts, indicating that it is a rather nonspecific RNase. RNase T, a main processing exonuclease involved in trimming of 3'-trailers, is very inefficient in converting the CCACCA-tagged tRNA into a mature transcript. Hence, while both RNases compete for trailer-containing tRNA precursors, the inability of RNase T to process CCACCA tails ensures that defective tRNAs cannot reenter the functional tRNA pool, representing a safeguard to avoid detrimental effects of tRNAs with erroneous integrity on protein synthesis. Furthermore, these data indicate that the RNase T-mediated end turnover of the CCA sequence represents a means to deliver a tRNA to a repeated quality control performed by the CCA-adding enzyme. Hence, originally described as a futile side reaction, the tRNA end turnover seems to fulfill an important function in the maintenance of the tRNA pool in the cell. © 2018 Wellner et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  6. Geometrical Applications of Split Octonions

    Directory of Open Access Journals (Sweden)

    Merab Gogberashvili

    2015-01-01

    Full Text Available It is shown that physical signals and space-time intervals modeled on split-octonion geometry naturally exhibit properties from conventional (3 + 1-theory (e.g., number of dimensions, existence of maximal velocities, Heisenberg uncertainty, and particle generations. This paper demonstrates these properties using an explicit representation of the automorphisms on split-octonions, the noncompact form of the exceptional Lie group G2. This group generates specific rotations of (3 + 4-vector parts of split octonions with three extra time-like coordinates and in infinitesimal limit imitates standard Poincare transformations. In this picture translations are represented by noncompact Lorentz-type rotations towards the extra time-like coordinates. It is shown how the G2 algebra’s chirality yields an intrinsic left-right asymmetry of a certain 3-vector (spin, as well as a parity violating effect on light emitted by a moving quantum system. Elementary particles are connected with the special elements of the algebra which nullify octonionic intervals. Then the zero-norm conditions lead to free particle Lagrangians, which allow virtual trajectories also and exhibit the appearance of spatial horizons governing by mass parameters.

  7. 7 CFR 51.2002 - Split shell.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Split shell. 51.2002 Section 51.2002 Agriculture... Standards for Grades of Filberts in the Shell 1 Definitions § 51.2002 Split shell. Split shell means a shell... of the shell, measured in the direction of the crack. ...

  8. Several RNase T2 enzymes function in induced tRNA and rRNA turnover in the ciliate Tetrahymena

    DEFF Research Database (Denmark)

    Andersen, Kasper Langebjerg; Collins, Kathleen

    2012-01-01

    RNA fragments continued to accumulate, with only a minor change in fragment profile in one strain. We therefore generated strains lacking pairwise combinations of the top three candidates for Rnt2 tRNases. Each of these strains showed a distinct starvation-specific profile of tRNA and rRNA fragment accumulation...

  9. N(6)-methyladenosine in mRNA disrupts tRNA selection and translation-elongation dynamics.

    Science.gov (United States)

    Choi, Junhong; Ieong, Ka-Weng; Demirci, Hasan; Chen, Jin; Petrov, Alexey; Prabhakar, Arjun; O'Leary, Seán E; Dominissini, Dan; Rechavi, Gideon; Soltis, S Michael; Ehrenberg, Måns; Puglisi, Joseph D

    2016-02-01

    N(6)-methylation of adenosine (forming m(6)A) is the most abundant post-transcriptional modification within the coding region of mRNA, but its role during translation remains unknown. Here, we used bulk kinetic and single-molecule methods to probe the effect of m(6)A in mRNA decoding. Although m(6)A base-pairs with uridine during decoding, as shown by X-ray crystallographic analyses of Thermus thermophilus ribosomal complexes, our measurements in an Escherichia coli translation system revealed that m(6)A modification of mRNA acts as a barrier to tRNA accommodation and translation elongation. The interaction between an m(6)A-modified codon and cognate tRNA echoes the interaction between a near-cognate codon and tRNA, because delay in tRNA accommodation depends on the position and context of m(6)A within codons and on the accuracy level of translation. Overall, our results demonstrate that chemical modification of mRNA can change translational dynamics.

  10. In vitro studies on tRNA annealing and reverse transcription with mutant HIV-1 RNA templates

    NARCIS (Netherlands)

    Beerens, N.; Berkhout, B.

    2000-01-01

    The human immunodeficiency virus type 1 (HIV-1) RNA genome encodes a semistable stem-loop structure, the U5-PBS hairpin, which occludes part of the tRNA primer binding site (PBS). In previous studies, we demonstrated that mutations that alter the stability of the U5-PBS hairpin inhibit virus

  11. An entropy based analysis of the relationship between the DOW JONES Index and the TRNA Sentiment series

    NARCIS (Netherlands)

    D.E. Allen (David); M.J. McAleer (Michael); A.K. Singh (Abhay)

    2016-01-01

    textabstractThis paper features an analysis of the relationship between the DOW JONES Industrial Average Index (DJIA) and a sentiment news series using daily data obtained from the Thomson Reuters News Analytics (TRNA)1 provided by SIRCA (The Securities Industry Research Centre of the Asia Pacic).

  12. Innovative wedge axe in making split firewood

    International Nuclear Information System (INIS)

    Mutikainen, A.

    1998-01-01

    Interteam Oy, a company located in Espoo, has developed a new method for making split firewood. The tools on which the patented System Logmatic are based are wedge axe and cylindrical splitting-carrying frame. The equipment costs about 495 FIM. The block of wood to be split is placed inside the upright carrying frame and split in a series of splitting actions using the innovative wedge axe. The finished split firewood remains in the carrying frame, which (as its name indicates) also serves as the means for carrying the firewood. This innovative wedge-axe method was compared with the conventional splitting of wood using an axe (Fiskars -handy 1400 splitting axe costing about 200 FIM) in a study conducted at TTS-Institute. There were eight test subjects involved in the study. In the case of the wedge-axe method, handling of the blocks to be split and of the finished firewood was a little quicker, but in actual splitting it was a little slower than the conventional axe method. The average productivity of splitting the wood and of the work stages related to it was about 0.4 m 3 per effective hour in both methods. The methods were also equivalent of one another in terms of the load imposed by the work when measured in terms of the heart rate. As regards work safety, the wedge-axe method was superior to the conventional method, but the continuous striking action and jolting transmitted to the arms were unpleasant (orig.)

  13. Split-Cre complementation restores combination activity on transgene excision in hair roots of transgenic tobacco.

    Directory of Open Access Journals (Sweden)

    Mengling Wen

    Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.

  14. The nucleotide sequence of histidine tRNA gamma of Drosophila melanogaster.

    OpenAIRE

    Altwegg, M; Kubli, E

    1980-01-01

    The nucleotide sequence of D. melanogaster histidine tRNA gamma was determined to be: pG-G-C-C-G-U-G-A-U-C-G-U-C-psi-A-G-D-G-G-D-D-A-G-G-A-C-C-C-C-A-C-G-psi-U-G-U-G- m1G-C-C-G-U-G-G-U-A-A-C-C-m5C-A-G-G-U-psi-C-G-m1A-A-U-C-C-U-G-G-U-C-A-C-G-G-m5C -A-C-C-AOH. An additional unpaired G is found at the 5' end, and the T in the TpsiC loop is replaced by a U.

  15. Simulating movement of tRNA through the ribosome during hybrid-state formation.

    Science.gov (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y

    2013-09-28

    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  16. Formation of tRNA granules in the nucleus of heat-induced human cells

    Energy Technology Data Exchange (ETDEWEB)

    Miyagawa, Ryu [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Department of Biological Science, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8654 (Japan); Mizuno, Rie [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Watanabe, Kazunori, E-mail: watanabe@ric.u-tokyo.ac.jp [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Ijiri, Kenichi [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Department of Biological Science, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8654 (Japan)

    2012-02-03

    Highlights: Black-Right-Pointing-Pointer tRNAs are tranlocated into the nucleus in heat-induced HeLa cells. Black-Right-Pointing-Pointer tRNAs form the unique granules in the nucleus. Black-Right-Pointing-Pointer tRNA ganules overlap with nuclear stress granules. -- Abstract: The stress response, which can trigger various physiological phenomena, is important for living organisms. For instance, a number of stress-induced granules such as P-body and stress granule have been identified. These granules are formed in the cytoplasm under stress conditions and are associated with translational inhibition and mRNA decay. In the nucleus, there is a focus named nuclear stress body (nSB) that distinguishes these structures from cytoplasmic stress granules. Many splicing factors and long non-coding RNA species localize in nSBs as a result of stress. Indeed, tRNAs respond to several kinds of stress such as heat, oxidation or starvation. Although nuclear accumulation of tRNAs occurs in starved Saccharomyces cerevisiae, this phenomenon is not found in mammalian cells. We observed that initiator tRNA{sup Met} (Meti) is actively translocated into the nucleus of human cells under heat stress. During this study, we identified unique granules of Meti that overlapped with nSBs. Similarly, elongator tRNA{sup Met} was translocated into the nucleus and formed granules during heat stress. Formation of tRNA granules is closely related to the translocation ratio. Then, all tRNAs may form the specific granules.

  17. Parallel BLAST on split databases.

    Science.gov (United States)

    Mathog, David R

    2003-09-22

    BLAST programs often run on large SMP machines where multiple threads can work simultaneously and there is enough memory to cache the databases between program runs. A group of programs is described which allows comparable performance to be achieved with a Beowulf configuration in which no node has enough memory to cache a database but the cluster as an aggregate does. To achieve this result, databases are split into equal sized pieces and stored locally on each node. Each query is run on all nodes in parallel and the resultant BLAST output files from all nodes merged to yield the final output. Source code is available from ftp://saf.bio.caltech.edu/

  18. Familial dysautonomia (FD) patients have reduced levels of the modified wobble nucleoside mcm(5)s(2)U in tRNA.

    Science.gov (United States)

    Karlsborn, Tony; Tükenmez, Hasan; Chen, Changchun; Byström, Anders S

    2014-11-21

    Familial dysautonomia (FD) is a recessive neurodegenerative genetic disease. FD is caused by a mutation in the IKBKAP gene resulting in a splicing defect and reduced levels of full length IKAP protein. IKAP homologues can be found in all eukaryotes and are part of a conserved six subunit protein complex, Elongator complex. Inactivation of any Elongator subunit gene in multicellular organisms cause a wide range of phenotypes, suggesting that Elongator has a pivotal role in several cellular processes. In yeast, there is convincing evidence that the main role of Elongator complex is in formation of modified wobble uridine nucleosides in tRNA and that their absence will influence translational efficiency. To date, no study has explored the possibility that FD patients display defects in formation of modified wobble uridine nucleosides as a consequence of reduced IKAP levels. In this study, we show that brain tissue and fibroblast cell lines from FD patients have reduced levels of the wobble uridine nucleoside 5-methoxycarbonylmethyl-2-thiouridine (mcm(5)s(2)U). Our findings indicate that FD could be caused by inefficient translation due to lower levels of wobble uridine nucleosides. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  19. A survey of green plant tRNA 3'-end processing enzyme tRNase Zs, homologs of the candidate prostate cancer susceptibility protein ELAC2

    Directory of Open Access Journals (Sweden)

    Wang Zhikang

    2011-07-01

    Full Text Available Abstract Background tRNase Z removes the 3'-trailer sequences from precursor tRNAs, which is an essential step preceding the addition of the CCA sequence. tRNase Z exists in the short (tRNase ZS and long (tRNase ZL forms. Based on the sequence characteristics, they can be divided into two major types: bacterial-type tRNase ZS and eukaryotic-type tRNase ZL, and one minor type, Thermotoga maritima (TM-type tRNase ZS. The number of tRNase Zs is highly variable, with the largest number being identified experimentally in the flowering plant Arabidopsis thaliana. It is unknown whether multiple tRNase Zs found in A. thaliana is common to the plant kingdom. Also unknown is the extent of sequence and structural conservation among tRNase Zs from the plant kingdom. Results We report the identification and analysis of candidate tRNase Zs in 27 fully sequenced genomes of green plants, the great majority of which are flowering plants. It appears that green plants contain multiple distinct tRNase Zs predicted to reside in different subcellular compartments. Furthermore, while the bacterial-type tRNase ZSs are present only in basal land plants and green algae, the TM-type tRNase ZSs are widespread in green plants. The protein sequences of the TM-type tRNase ZSs identified in green plants are similar to those of the bacterial-type tRNase ZSs but have distinct features, including the TM-type flexible arm, the variant catalytic HEAT and HST motifs, and a lack of the PxKxRN motif involved in CCA anti-determination (inhibition of tRNase Z activity by CCA, which prevents tRNase Z cleavage of mature tRNAs. Examination of flowering plant chloroplast tRNA genes reveals that many of these genes encode partial CCA sequences. Based on our results and previous studies, we predict that the plant TM-type tRNase ZSs may not recognize the CCA sequence as an anti-determinant. Conclusions Our findings substantially expand the current repertoire of the TM-type tRNase ZSs and hint

  20. Algebraic techniques for diagonalization of a split quaternion matrix in split quaternionic mechanics

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Tongsong, E-mail: jiangtongsong@sina.com [Department of Mathematics, Linyi University, Linyi, Shandong 276005 (China); Department of Mathematics, Heze University, Heze, Shandong 274015 (China); Jiang, Ziwu; Zhang, Zhaozhong [Department of Mathematics, Linyi University, Linyi, Shandong 276005 (China)

    2015-08-15

    In the study of the relation between complexified classical and non-Hermitian quantum mechanics, physicists found that there are links to quaternionic and split quaternionic mechanics, and this leads to the possibility of employing algebraic techniques of split quaternions to tackle some problems in complexified classical and quantum mechanics. This paper, by means of real representation of a split quaternion matrix, studies the problem of diagonalization of a split quaternion matrix and gives algebraic techniques for diagonalization of split quaternion matrices in split quaternionic mechanics.

  1. Testing PVLAS axions with resonant photon splitting

    CERN Document Server

    Gabrielli, E; Gabrielli, Emidio; Giovannini, Massimo

    2007-01-01

    The photon splitting gamma -> gamma gamma in a time-independent and inhomogeneous magnetized background is considered when neutral and ultralight spin-0 particles are coupled to two-photons. Depending on the inhomogeneity scale of the external field, resonant photon splitting can occur. If an optical laser crosses a magnetic field of few Tesla with typical inhomogeneity scale of the order of the meter, a potentially observable rate of photon splittings is expected for the PVLAS range of couplings and masses.

  2. Additive operator-difference schemes splitting schemes

    CERN Document Server

    Vabishchevich, Petr N

    2013-01-01

    Applied mathematical modeling isconcerned with solving unsteady problems. This bookshows how toconstruct additive difference schemes to solve approximately unsteady multi-dimensional problems for PDEs. Two classes of schemes are highlighted: methods of splitting with respect to spatial variables (alternating direction methods) and schemes of splitting into physical processes. Also regionally additive schemes (domain decomposition methods)and unconditionally stable additive schemes of multi-component splitting are considered for evolutionary equations of first and second order as well as for sy

  3. Iterative Splitting Methods for Differential Equations

    CERN Document Server

    Geiser, Juergen

    2011-01-01

    Iterative Splitting Methods for Differential Equations explains how to solve evolution equations via novel iterative-based splitting methods that efficiently use computational and memory resources. It focuses on systems of parabolic and hyperbolic equations, including convection-diffusion-reaction equations, heat equations, and wave equations. In the theoretical part of the book, the author discusses the main theorems and results of the stability and consistency analysis for ordinary differential equations. He then presents extensions of the iterative splitting methods to partial differential

  4. Spin Splitting in Different Semiconductor Quantum Wells

    International Nuclear Information System (INIS)

    Hao Yafei

    2012-01-01

    We theoretically investigate the spin splitting in four undoped asymmetric quantum wells in the absence of external electric field and magnetic field. The quantum well geometry dependence of spin splitting is studied with the Rashba and the Dresselhaus spin-orbit coupling included. The results show that the structure of quantum well plays an important role in spin splitting. The Rashba and the Dresselhaus spin splitting in four asymmetric quantum wells are quite different. The origin of the distinction is discussed in this work. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  5. Dark matter from split seesaw

    International Nuclear Information System (INIS)

    Kusenko, Alexander; Takahashi, Fuminobu; Yanagida, Tsutomu T.

    2010-01-01

    The seesaw mechanism in models with extra dimensions is shown to be generically consistent with a broad range of Majorana masses. The resulting democracy of scales implies that the seesaw mechanism can naturally explain the smallness of neutrino masses for an arbitrarily small right-handed neutrino mass. If the scales of the seesaw parameters are split, with two right-handed neutrinos at a high scale and one at a keV scale, one can explain the matter-antimatter asymmetry of the universe, as well as dark matter. The dark matter candidate, a sterile right-handed neutrino with mass of several keV, can account for the observed pulsar velocities and for the recent data from Chandra X-ray Observatory, which suggest the existence of a 5 keV sterile right-handed neutrino.

  6. Emittance compensation in split photoinjectors

    Directory of Open Access Journals (Sweden)

    Klaus Floettmann

    2017-01-01

    Full Text Available The compensation of correlated emittance contributions is of primary importance to optimize the performance of high brightness photoinjectors. While only extended numerical simulations can capture the complex beam dynamics of space-charge-dominated beams in sufficient detail to optimize a specific injector layout, simplified models are required to gain a deeper understanding of the involved dynamics, to guide the optimization procedure, and to interpret experimental results. In this paper, a slice envelope model for the emittance compensation process in a split photoinjector is presented. The emittance term is included in the analytical solution of the beam envelope in a drift, which is essential to take the emittance contribution due to a beam size mismatch into account. The appearance of two emittance minima in the drift is explained, and the matching into the booster cavity is discussed. A comparison with simulation results points out effects which are not treated in the envelope model, such as overfocusing and field nonlinearities.

  7. Gauge mediated mini-split

    Science.gov (United States)

    Cohen, Timothy; Craig, Nathaniel; Knapen, Simon

    2016-03-01

    We propose a simple model of split supersymmetry from gauge mediation. This model features gauginos that are parametrically a loop factor lighter than scalars, accommodates a Higgs boson mass of 125 GeV, and incorporates a simple solution to the μ- b μ problem. The gaugino mass suppression can be understood as resulting from collective symmetry breaking. Imposing collider bounds on μ and requiring viable electroweak symmetry breaking implies small a-terms and small tan β — the stop mass ranges from 105 to 108 GeV. In contrast with models with anomaly + gravity mediation (which also predict a one-loop loop suppression for gaugino masses), our gauge mediated scenario predicts aligned squark masses and a gravitino LSP. Gluinos, electroweakinos and Higgsinos can be accessible at the LHC and/or future colliders for a wide region of the allowed parameter space.

  8. Minimal Doubling and Point Splitting

    Energy Technology Data Exchange (ETDEWEB)

    Creutz, M.

    2010-06-14

    Minimally-doubled chiral fermions have the unusual property of a single local field creating two fermionic species. Spreading the field over hypercubes allows construction of combinations that isolate specific modes. Combining these fields into bilinears produces meson fields of specific quantum numbers. Minimally-doubled fermion actions present the possibility of fast simulations while maintaining one exact chiral symmetry. They do, however, introduce some peculiar aspects. An explicit breaking of hyper-cubic symmetry allows additional counter-terms to appear in the renormalization. While a single field creates two different species, spreading this field over nearby sites allows isolation of specific states and the construction of physical meson operators. Finally, lattice artifacts break isospin and give two of the three pseudoscalar mesons an additional contribution to their mass. Depending on the sign of this mass splitting, one can either have a traditional Goldstone pseudoscalar meson or a parity breaking Aoki-like phase.

  9. Gauge mediated mini-split

    Energy Technology Data Exchange (ETDEWEB)

    Cohen, Timothy [Institute of Theoretical Science, University of Oregon,Eugene, OR 97403 (United States); Craig, Nathaniel [Department of Physics, University of California,Santa Barbara, CA 93106 (United States); Knapen, Simon [Berkeley Center for Theoretical Physics,University of California, Berkeley, CA 94720 (United States); Theoretical Physics Group,Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States)

    2016-03-15

    We propose a simple model of split supersymmetry from gauge mediation. This model features gauginos that are parametrically a loop factor lighter than scalars, accommodates a Higgs boson mass of 125 GeV, and incorporates a simple solution to the μ−b{sub μ} problem. The gaugino mass suppression can be understood as resulting from collective symmetry breaking. Imposing collider bounds on μ and requiring viable electroweak symmetry breaking implies small a-terms and small tan β — the stop mass ranges from 10{sup 5} to 10{sup 8} GeV. In contrast with models with anomaly + gravity mediation (which also predict a one-loop loop suppression for gaugino masses), our gauge mediated scenario predicts aligned squark masses and a gravitino LSP. Gluinos, electroweakinos and Higgsinos can be accessible at the LHC and/or future colliders for a wide region of the allowed parameter space.

  10. Euglena gracilis chloroplast transfer RNA transcription units. I. Physical map of the transfer RNA gene loci.

    Science.gov (United States)

    Orozco, E M; Hallick, R B

    1982-03-25

    The locations of transfer RNA genes with respect to the restriction endonuclease cleavage map of Euglena gracilis Klebs, strain Z Pringsheim chloroplast DNA have been determined. Purified chloroplast tRNAs were treated with snake venom phosphodiesterase to remove the 3'-CCA terminus, and radioactively labeled by the action of Escherichia coli tRNA nucleotidyltransferase in the presence of [alpha-32P]CTP. Chloroplast DNA was treated individually and with combinations of the enzymes Bal I, Bam HI, Eco RI, Pst I, Pvu II, Sal I, and Xho I. The location of tRNA genes with respect to the cleavage sites for these enzymes was determined by hybridization of the 32P-labeled tRNAs to membrane filter blots of the chloroplast DNA restriction nuclease fragments following gel electrophoresis. The 145-kilobase pair genome was resolved into nine areas of strong tRNA hybridization, separated by areas of weak or no tRNA hybridization. The loci of tRNA genes are within the Eco RI fragments Eco A, B, G, H, I, J', P, Q, and V.

  11. SplitDist—Calculating Split-Distances for Sets of Trees

    DEFF Research Database (Denmark)

    Mailund, T

    2004-01-01

    We present a tool for comparing a set of input trees, calculating for each pair of trees the split-distances, i.e., the number of splits in one tree not present in the other.......We present a tool for comparing a set of input trees, calculating for each pair of trees the split-distances, i.e., the number of splits in one tree not present in the other....

  12. Effect of anoxia and Polyscias filicifolia Bailey biomass tincture on the activity of tRNA and aminoacyl-tRNA synthetases in isolated pig heart.

    Science.gov (United States)

    Kasauskas, Artūras; Rodovicius, Hiliaras; Viezeliene, Dale; Lazauskas, Robertas

    2009-01-01

    The aim of this study was to investigate effect of anoxia and Polyscias filicifolia Bailey biomass tincture on the activities of different tRNA and aminoacyl-tRNA synthetases in isolated pig heart. The isolated pig heart was perfused according to the modified method of Langendorf, using an artificial blood circulation apparatus. Anoxia 20 min in duration was performed by perfusion of isolated heart with Krebs-Henseleit bicarbonate buffer saturated with gas mixture (95% N(2) and 5% CO(2)). Control heart was perfused with the same buffer saturated with gas mixture (95% O(2) and 5% CO(2)). Effect of Polyscias filicifolia Bailey biomass tincture was evaluated by perfusion of isolated heart with a buffer containing tincture. Total tRNA and aminoacyl-tRNA synthetases were isolated from pig heart. Activities of tRNA and aminoacyl-tRNA synthetases were measured by the aminoacylation reaction using C(14)-amino acids. Anoxia 20 min in duration has caused a decrease in the acceptor activity of tRNA and increase in the activities of aminacyl-tRNA synthetases. Polyscias filicifolia Bailey tincture did not affect the acceptor activity of tRNA and activities aminacyl-tRNA synthetases. After 20-min anoxic perfusion with the buffer containing Polyscias filicifolia Bailey biomass tincture, the acceptor activities of tRNA increased to the control value and activities of aminacyl-tRNA synthetases reached the control value. The acceptor activity of tRNA from isolated pig heart decreased and activities of aminacyl-tRNA synthetases increased under anoxia. Perfusion with buffer containing tincture of Polyscias filicifolia Bailey biomass restored acceptor activities of tRNA and activities of aminacyl-tRNA synthetases.

  13. The structure of the hypothetical protein smu.1377c from Streptococcus mutans suggests a role in tRNA modification

    International Nuclear Information System (INIS)

    Fu, Tian-Min; Liu, Xiang; Li, Lanfen; Su, Xiao-Dong

    2010-01-01

    The crystal structure of smu.1377c, a hypothetical protein from S. mutans, shows a similar fold to Sua5-YciO-YrdC-family proteins and indicates its functional role in tRNA modification. Members of the Sua5-YciO-YrdC protein family are found in both eukaryotes and prokaryotes and possess a conserved α/β twisted open-sheet fold. The Escherichia coli protein YrdC has been shown to be involved in modification of tRNA. The crystal structure of smu.1377c, a hypothetical protein from Streptococcus mutans, has been determined to 2.25 Å resolution. From structure analysis and comparison, it is shown that smu.1377c is a member of the Sua5-YciO-YrdC family and that it may play the same role as E. coli YrdC

  14. Initiation factor 2, tRNA, and 50S subunits cooperatively stabilize mRNAs on the ribosome during initiation

    Science.gov (United States)

    Masuda, Tomoaki; Petrov, Alexey N.; Iizuka, Ryo; Funatsu, Takashi; Puglisi, Joseph D.; Uemura, Sotaro

    2012-01-01

    Initiation factor 2 (IF2) is a key factor in initiation of bacterial protein synthesis. It recruits initiator tRNA to the small ribosomal subunit and facilitates joining of the large ribosomal subunit. Using reconstituted translation system of Escherichia coli and optical tweezers, we directly measure the rupture force between single ribosomal complexes and mRNAs for initiation complexes in the presence and the absence of IF2. We demonstrate that IF2 together with codon recognition by initiator tRNA increases the force required to dislocate mRNA from the ribosome complexes; mRNA stabilization by IF2 required the presence of a joined 50S subunit, and was independent of bound guanine nucleotide. IF2 thus helps lock the 70S ribosome over the start codon during initiation, thus maintaining reading frame. Our results show how mRNA is progressively stabilized on the ribosome through distinct steps of initiation. PMID:22411833

  15. Conservation of tRNA and rRNA 5-methylcytosine in the kingdom Plantae.

    Science.gov (United States)

    Burgess, Alice Louise; David, Rakesh; Searle, Iain Robert

    2015-08-14

    Post-transcriptional methylation of RNA cytosine residues to 5-methylcytosine (m(5)C) is an important modification that regulates RNA metabolism and occurs in both eukaryotes and prokaryotes. Yet, to date, no transcriptome-wide identification of m(5)C sites has been undertaken in plants. Plants provide a unique comparative system for investigating the origin and evolution of m(5)C as they contain three different genomes, the nucleus, mitochondria and chloroplast. Here we use bisulfite conversion of RNA combined with high-throughput IIlumina sequencing (RBS-seq) to identify single-nucleotide resolution of m(5)C sites in non-coding ribosomal RNAs and transfer RNAs of all three sub-cellular transcriptomes across six diverse species that included, the single-celled algae Nannochloropsis oculata, the macro algae Caulerpa taxifolia and multi-cellular higher plants Arabidopsis thaliana, Brassica rapa, Triticum durum and Ginkgo biloba. Using the plant model Arabidopsis thaliana, we identified a total of 39 highly methylated m(5)C sites in predicted structural positions of nuclear tRNAs and 7 m(5)C sites in rRNAs from nuclear, chloroplast and mitochondrial transcriptomes. Both the nucleotide position and percent methylation of tRNAs and rRNAs m(5)C sites were conserved across all species analysed, from single celled algae N. oculata to multicellular plants. Interestingly the mitochondrial and chloroplast encoded tRNAs were devoid of m(5)C in A. thaliana and this is generally conserved across Plantae. This suggests independent evolution of organelle methylation in animals and plants, as animal mitochondrial tRNAs have m(5)C sites. Here we characterize 5 members of the RNA 5-methylcytosine family in Arabidopsis and extend the functional characterization of TRDMT1 and NOP2A/OLI2. We demonstrate that nuclear tRNA methylation requires two evolutionarily conserved methyltransferases, TRDMT1 and TRM4B. trdmt1 trm4b double mutants are hypersensitive to the antibiotic hygromycin B

  16. Degradation of nucleic acids with ozone. II. Degradation of yeast RNA, yeast phenylalanine tRNA and tobacco mosaic virus RNA.

    Science.gov (United States)

    Shinriki, N; Ishizaki, K; Ikehata, A; Yoshizaki, T; Nomura, A; Miura, K; Mizuno, Y

    1981-10-27

    The degradation of a mixture of four 5'-ribonucleotides (AMP, GMP, CMP and UMP), yeast RNA, yeast phenylalanine tRNA, and tobacco mosaic virus RNA (TMV-RNA) with ozone (concentration in inlet gas, 0.1-0.5 mg/l) was examined in a phosphate buffer (pH 6.9). In the case of the mixture, GMP alone was degraded in the initial stage. In the ozonization of yeast RNA, the guanine moiety was less vulnerable to attack by ozone than in the case of free GMP, but it again degraded most rapidly among the four nucleotides. In the treatment of tRNA with ozone, the guanine moiety degraded first. When the numbers of degraded nucleotides reached 4.8 (remaining amino acid acceptor activity was 3.6%), the polyacrylamide gel electrophoresis of the ozonized tRNA gave a single band with the same mobility as that of the intact tRNA. It is evident that ozonolysis of tRNA proceeded without cleavage of the polynucleotide chain. In the case of TMV-RNA, the loss of the infectivity by ozone proceeded rapidly within 30 min and was followed by preferential degradation of the guanine moiety. The outstanding lability of the guanine moiety observed in each case is discussed in connection with the inactivation of tRNA and TMV-RNA.

  17. Split-specific bootstrap measures for quantifying phylogenetic stability and the influence of taxon selection.

    Science.gov (United States)

    Wang, Huai-Chun; Susko, Edward; Roger, Andrew J

    2016-12-01

    Assessing the robustness of an inferred phylogeny is an important element of phylogenetics. This is typically done with measures of stabilities at the internal branches and the variation of the positions of the leaf nodes. The bootstrap support for branches in maximum parsimony, distance and maximum likelihood estimation, or posterior probabilities in Bayesian inference, measure the uncertainty about a branch due to the sampling of the sites from genes or sampling genes from genomes. However, these measures do not reveal how taxon sampling affects branch support and the effects of taxon sampling on the estimated phylogeny. An internal branch in a phylogenetic tree can be viewed as a split that separates the taxa into two nonempty complementary subsets. We develop several split-specific measures of stability determined from bootstrap support for quartets. These include BPtaxon_split (average bootstrap percentage [BP] for all quartets involving a taxon within a split), BPsplit (BPtaxon_split averaged over taxa), BPtaxon (BPtaxon_split averaged over splits) and RBIC-taxon (average BP over all splits after removing a taxon). We also develop a pruned-tree distance metric. Application of our measures to empirical and simulated data illustrate that existing measures of overall stability can fail to detect taxa that are the primary source of a split-specific instability. Moreover, we show that the use of many reduced sets of quartets is important in being able to detect the influence of joint sets of taxa rather than individual taxa. These new measures are valuable diagnostic tools to guide taxon sampling in phylogenetic experimental design. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Split Questionnaire Design for Massive Surveys

    NARCIS (Netherlands)

    Adiguzel, F.; Wedel, M.

    2008-01-01

    Companies are conducting more and longer surveys than ever before. Massive questionnaires are pervasive in marketing practice. As an alternative to the heuristic methods that are currently used to split questionnaires, this study develops a methodology to design the split questionnaire in a way that

  19. Cheating More when the Spoils Are Split

    Science.gov (United States)

    Wiltermuth, Scott S.

    2011-01-01

    Four experiments demonstrated that people are more likely to cheat when the benefits of doing so are split with another person, even an anonymous stranger, than when the actor alone captures all of the benefits. In three of the studies, splitting the benefits of over-reporting one's performance on a task made such over-reporting seem less…

  20. Standard Model Particles from Split Octonions

    Directory of Open Access Journals (Sweden)

    Gogberashvili M.

    2016-01-01

    Full Text Available We model physical signals using elements of the algebra of split octonions over the field of real numbers. Elementary particles are corresponded to the special elements of the algebra that nullify octonionic norms (zero divisors. It is shown that the standard model particle spectrum naturally follows from the classification of the independent primitive zero divisors of split octonions.

  1. Split Scheduling with Uniform Setup Times

    NARCIS (Netherlands)

    Schalekamp, F.; Sitters, R.A.; van der Ster, S.L.; Stougie, L.; Verdugo, V.; van Zuylen, A.

    2015-01-01

    We study a scheduling problem in which jobs may be split into parts, where the parts of a split job may be processed simultaneously on more than one machine. Each part of a job requires a setup time, however, on the machine where the job part is processed. During setup, a machine cannot process or

  2. Split scheduling with uniform setup times.

    NARCIS (Netherlands)

    F. Schalekamp; R.A. Sitters (René); S.L. van der Ster; L. Stougie (Leen); V. Verdugo; A. van Zuylen

    2015-01-01

    htmlabstractWe study a scheduling problem in which jobs may be split into parts, where the parts of a split job may be processed simultaneously on more than one machine. Each part of a job requires a setup time, however, on the machine where the job part is processed. During setup, a

  3. On split Lie triple systems II

    Indian Academy of Sciences (India)

    Lie triple system with a coherent 0-root space is the direct sum of the family of its minimal ideals, each one being a simple split Lie triple system, and the simplicity of T is characterized. In the present paper we extend these results to arbitrary split Lie triple systems with no restrictions on their 0-root spaces. Keywords.

  4. A subcomplex of human mitochondrial RNase P is a bifunctional methyltransferase--extensive moonlighting in mitochondrial tRNA biogenesis.

    Science.gov (United States)

    Vilardo, Elisa; Nachbagauer, Christa; Buzet, Aurélie; Taschner, Andreas; Holzmann, Johann; Rossmanith, Walter

    2012-12-01

    Transfer RNAs (tRNAs) reach their mature functional form through several steps of processing and modification. Some nucleotide modifications affect the proper folding of tRNAs, and they are crucial in case of the non-canonically structured animal mitochondrial tRNAs, as exemplified by the apparently ubiquitous methylation of purines at position 9. Here, we show that a subcomplex of human mitochondrial RNase P, the endonuclease removing tRNA 5' extensions, is the methyltransferase responsible for m(1)G9 and m(1)A9 formation. The ability of the mitochondrial tRNA:m(1)R9 methyltransferase to modify both purines is uncommon among nucleic acid modification enzymes. In contrast to all the related methyltransferases, the human mitochondrial enzyme, moreover, requires a short-chain dehydrogenase as a partner protein. Human mitochondrial RNase P, thus, constitutes a multifunctional complex, whose subunits moonlight in cascade: a fatty and amino acid degradation enzyme in tRNA methylation and the methyltransferase, in turn, in tRNA 5' end processing.

  5. Trying on tRNA for Size: RNase P and the T-box Riboswitch as Molecular Rulers

    Directory of Open Access Journals (Sweden)

    Jinwei Zhang

    2016-04-01

    Full Text Available Length determination is a fundamental problem in biology and chemistry. Numerous proteins measure distances on linear biopolymers to exert effects with remarkable spatial precision. Recently, ruler-like devices made of noncoding RNAs have been structurally and biochemically characterized. Two prominent examples are the RNase P ribozyme and the T-box riboswitch. Both act as molecular calipers. The two RNAs clamp onto the elbow of tRNA (or pre-tRNA and make distance measurements orthogonal to each other. Here, we compare and contrast the molecular ruler characteristics of these RNAs. RNase P appears pre-configured to measure a fixed distance on pre-tRNA to ensure the fidelity of its maturation. RNase P is a multiple-turnover ribozyme, and its rigid structure efficiently selects pre-tRNAs, cleaves, and releases them. In contrast, the T-box is flexible and segmented, an architecture that adapts to the intrinsically flexible tRNA. The tripartite T-box inspects the overall shape, anticodon sequence, and aminoacylation status of an incoming tRNA while it folds co-transcriptionally, leading to a singular, conditional genetic switching event. The elucidation of the structures and mechanisms of action of these two RNA molecular rulers may augur the discovery of new RNA measuring devices in noncoding and viral transcriptomes, and inform the design of artificial RNA rulers.

  6. Particulate photocatalysts for overall water splitting

    Science.gov (United States)

    Chen, Shanshan; Takata, Tsuyoshi; Domen, Kazunari

    2017-10-01

    The conversion of solar energy to chemical energy is a promising way of generating renewable energy. Hydrogen production by means of water splitting over semiconductor photocatalysts is a simple, cost-effective approach to large-scale solar hydrogen synthesis. Since the discovery of the Honda-Fujishima effect, considerable progress has been made in this field, and numerous photocatalytic materials and water-splitting systems have been developed. In this Review, we summarize existing water-splitting systems based on particulate photocatalysts, focusing on the main components: light-harvesting semiconductors and co-catalysts. The essential design principles of the materials employed for overall water-splitting systems based on one-step and two-step photoexcitation are also discussed, concentrating on three elementary processes: photoabsorption, charge transfer and surface catalytic reactions. Finally, we outline challenges and potential advances associated with solar water splitting by particulate photocatalysts for future commercial applications.

  7. tRNA Modification and Genetic Code Variations in Animal Mitochondria

    Directory of Open Access Journals (Sweden)

    Kimitsuna Watanabe

    2011-01-01

    Full Text Available In animal mitochondria, six codons have been known as nonuniversal genetic codes, which vary in the course of animal evolution. They are UGA (termination codon in the universal genetic code changes to Trp codon in all animal mitochondria, AUA (Ile to Met in most metazoan mitochondria, AAA (Lys to Asn in echinoderm and some platyhelminth mitochondria, AGA/AGG (Arg to Ser in most invertebrate, Arg to Gly in tunicate, and Arg to termination in vertebrate mitochondria, and UAA (termination to Tyr in a planaria and a nematode mitochondria, but conclusive evidence is lacking in this case. We have elucidated that the anticodons of tRNAs deciphering these nonuniversal codons (tRNATrp for UGA, tRNAMet for AUA, tRNAAsn for AAA, and tRNASer and tRNAGly for AGA/AGG are all modified; tRNATrp has 5-carboxymethylaminomethyluridine or 5-taurinomethyluridine, tRNAMet has 5-formylcytidine or 5-taurinomethyluridine, tRNASer has 7-methylguanosine and tRNAGly has 5-taurinomethyluridine in their anticodon wobble position, and tRNAAsn has pseudouridine in the anticodon second position. This review aims to clarify the structural relationship between these nonuniversal codons and the corresponding tRNA anticodons including modified nucleosides and to speculate on the possible mechanisms for explaining the evolutional changes of these nonuniversal codons in the course of animal evolution.

  8. Metabolic and chemical regulation of tRNA modification associated with taurine deficiency and human disease

    Science.gov (United States)

    Asano, Kana; Suzuki, Takeo; Saito, Ayaka; Wei, Fan-Yan; Ikeuchi, Yoshiho; Numata, Tomoyuki; Tanaka, Ryou; Yamane, Yoshihisa; Yamamoto, Takeshi; Goto, Takanobu; Kishita, Yoshihito; Murayama, Kei; Ohtake, Akira; Okazaki, Yasushi; Tomizawa, Kazuhito; Sakaguchi, Yuriko

    2018-01-01

    Abstract Modified uridine containing taurine, 5-taurinomethyluridine (τm5U), is found at the anticodon first position of mitochondrial (mt-)transfer RNAs (tRNAs). Previously, we reported that τm5U is absent in mt-tRNAs with pathogenic mutations associated with mitochondrial diseases. However, biogenesis and physiological role of τm5U remained elusive. Here, we elucidated τm5U biogenesis by confirming that 5,10-methylene-tetrahydrofolate and taurine are metabolic substrates for τm5U formation catalyzed by MTO1 and GTPBP3. GTPBP3-knockout cells exhibited respiratory defects and reduced mitochondrial translation. Very little τm5U34 was detected in patient’s cells with the GTPBP3 mutation, demonstrating that lack of τm5U results in pathological consequences. Taurine starvation resulted in downregulation of τm5U frequency in cultured cells and animal tissues (cat liver and flatfish). Strikingly, 5-carboxymethylaminomethyluridine (cmnm5U), in which the taurine moiety of τm5U is replaced with glycine, was detected in mt-tRNAs from taurine-depleted cells. These results indicate that tRNA modifications are dynamically regulated via sensing of intracellular metabolites under physiological condition. PMID:29390138

  9. Differentiating analogous tRNA methyltransferases by fragments of the methyl donor

    Science.gov (United States)

    Lahoud, Georges; Goto-Ito, Sakurako; Yoshida, Ken-ichi; Ito, Takuhiro; Yokoyama, Shigeyuki; Hou, Ya-Ming

    2011-01-01

    Bacterial TrmD and eukaryotic-archaeal Trm5 form a pair of analogous tRNA methyltransferase that catalyze methyl transfer from S-adenosyl methionine (AdoMet) to N1 of G37, using catalytic motifs that share no sequence or structural homology. Here we show that natural and synthetic analogs of AdoMet are unable to distinguish TrmD from Trm5. Instead, fragments of AdoMet, adenosine and methionine, are selectively inhibitory of TrmD rather than Trm5. Detailed structural information of the two enzymes in complex with adenosine reveals how Trm5 escapes targeting by adopting an altered structure, whereas TrmD is trapped by targeting due to its rigid structure that stably accommodates the fragment. Free energy analysis exposes energetic disparities between the two enzymes in how they approach the binding of AdoMet versus fragments and provides insights into the design of inhibitors selective for TrmD. PMID:21602303

  10. Differentiating analogous tRNA methyltransferases by fragments of the methyl donor.

    Science.gov (United States)

    Lahoud, Georges; Goto-Ito, Sakurako; Yoshida, Ken-Ichi; Ito, Takuhiro; Yokoyama, Shigeyuki; Hou, Ya-Ming

    2011-07-01

    Bacterial TrmD and eukaryotic-archaeal Trm5 form a pair of analogous tRNA methyltransferase that catalyze methyl transfer from S-adenosyl methionine (AdoMet) to N(1) of G37, using catalytic motifs that share no sequence or structural homology. Here we show that natural and synthetic analogs of AdoMet are unable to distinguish TrmD from Trm5. Instead, fragments of AdoMet, adenosine and methionine, are selectively inhibitory of TrmD rather than Trm5. Detailed structural information of the two enzymes in complex with adenosine reveals how Trm5 escapes targeting by adopting an altered structure, whereas TrmD is trapped by targeting due to its rigid structure that stably accommodates the fragment. Free energy analysis exposes energetic disparities between the two enzymes in how they approach the binding of AdoMet versus fragments and provides insights into the design of inhibitors selective for TrmD.

  11. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  12. Split-coil-system SULTAN

    International Nuclear Information System (INIS)

    Vecsey, G.

    1992-08-01

    The high field superconductor test facility SULTAN started operation successfully in May 1992. Originally designed for testing full scale conductors for the large magnets of the next generation fusion reactors, the SULTAN facility installed at PSI (Switzerland) was designed as a common venture of three European Laboratories: ENEA (Italy), ECN (Netherlands) and PSI, and built by ENEA and PSI in the framework of the Euratom Fusion Technology Program. Presently the largest facility in the world, with its superconducting split coil system generating 11 Tesla in a 0.6 m bore, it is ready now for testing superconductor samples with currents up to 50 kA at variable cooling conditions. Similar tests can be arranged also for other applications. SULTAN is offered by the European Community as a contribution to the worldwide cooperation for the next step of fusion reactor development ITER. First measurements on conductor developed by CEA (Cadarache) are now in progress. Others like those of ENEA and CERN will follow. For 1993, a test of an Italian 12 TZ model coil for fusion application is planned. SULTAN is a worldwide unique facility marking the competitive presence of Swiss technology in the field of applied superconductivity research. Based on development and design of PSI, the high field Nb 3 Sn superconductors and coils were fabricated at the works of Kabelwerke Brugg and ABB, numerous Swiss companies contributed to the success of this international effort. Financing of the Swiss contribution of SULTAN was made available by NEFF, BEW, BBW, PSI and EURATOM. (author) figs., tabs., 20 refs

  13. 2-Photon tandem device for water splitting

    DEFF Research Database (Denmark)

    Seger, Brian; Castelli, Ivano Eligio; Vesborg, Peter Christian Kjærgaard

    2014-01-01

    Within the field Of photocatalytic water splitting there are several strategies to achieve the goal of efficient and cheap photocatalytic water splitting. This work examines one particular strategy by focusing on monolithically stacked, two-photon photoelectrochemical cells. The overall aim...... absorption, this is the more difficult side to optimize. Nevertheless, by using TiO2 as a transparent cathode protection layer in conjunction with known H-2 evolution catalysts, protection is clearly feasible for a large bandgap photocathode. This suggests that there may be promising strategies...... for photocatalytic water splitting by using a large bandgap photocathode and a low bandgap photoanode with attached protection layers....

  14. Communication: Tunnelling splitting in the phosphine molecule

    Energy Technology Data Exchange (ETDEWEB)

    Sousa-Silva, Clara; Tennyson, Jonathan; Yurchenko, Sergey N. [Department of Physics and Astronomy, University College London, London WC1E 6BT (United Kingdom)

    2016-09-07

    Splitting due to tunnelling via the potential energy barrier has played a significant role in the study of molecular spectra since the early days of spectroscopy. The observation of the ammonia doublet led to attempts to find a phosphine analogous, but these have so far failed due to its considerably higher barrier. Full dimensional, variational nuclear motion calculations are used to predict splittings as a function of excitation energy. Simulated spectra suggest that such splittings should be observable in the near infrared via overtones of the ν{sub 2} bending mode starting with 4ν{sub 2}.

  15. Splitting Functions at High Transverse Momentum

    CERN Document Server

    Moutafis, Rhea Penelope; CERN. Geneva. TH Department

    2017-01-01

    Among the production channels of the Higgs boson one contribution could become significant at high transverse momentum which is the radiation of a Higgs boson from another particle. This note focuses on the calculation of splitting functions and cross sections of such processes. The calculation is first carried out on the example $e\\rightarrow e\\gamma$ to illustrate the way splitting functions are calculated. Then the splitting function of $e\\rightarrow eh$ is calculated in similar fashion. This procedure can easily be generalized to processes such as $q\\rightarrow qh$ or $g\\rightarrow gh$.

  16. Virus-induced gene silencing of RPC5-like subunit of RNA polymerase III caused pleiotropic effects in Nicotiana benthamiana

    Science.gov (United States)

    In eukaryotic cells, RNA polymerase III is highly conserved, contains 17 subunits and transcribes housekeeping genes such as ribosomal 50S rRNA, tRNA and other small RNAs. Functional roles of the RPC5 are poorly characterized in the literature. In this work, we report that virus-induced gene silenci...

  17. Splitting Strip Detector Clusters in Dense Environments

    CERN Document Server

    Nachman, Benjamin Philip; The ATLAS collaboration

    2018-01-01

    Tracking in high density environments, particularly in high energy jets, plays an important role in many physics analyses at the LHC. In such environments, there is significant degradation of track reconstruction performance. Between runs 1 and 2, ATLAS implemented an algorithm that splits pixel clusters originating from multiple charged particles, using charge information, resulting in the recovery of much of the lost efficiency. However, no attempt was made in prior work to split merged clusters in the Semi Conductor Tracker (SCT), which does not measure charge information. In spite of the lack of charge information in SCT, a cluster-splitting algorithm has been developed in this work. It is based primarily on the difference between the observed cluster width and the expected cluster width, which is derived from track incidence angle. The performance of this algorithm is found to be competitive with the existing pixel cluster splitting based on track information.

  18. Structural basis of photosynthetic water-splitting

    International Nuclear Information System (INIS)

    Photosynthetic water-splitting takes place in photosystem II (PSII), a membrane protein complex consisting of 20 subunits with an overall molecular mass of 350 kDa. The light-induced water-splitting reaction catalyzed by PSII not only converts light energy into biologically useful chemical energy, but also provides us with oxygen indispensible for sustaining oxygenic life on the earth. We have solved the structure of PSII at a 1.9 Å resolution, from which, the detailed structure of the Mn 4 CaO 5 -cluster, the catalytic center for water-splitting, became clear. Based on the structure of PSII at the atomic resolution, possible mechanism of light-induced water-splitting was discussed

  19. Irrational beliefs, attitudes about competition, and splitting.

    Science.gov (United States)

    Watson, P J; Morris, R J; Miller, L

    2001-03-01

    Rational-Emotive Behavior Therapy (REBT) theoretically promotes actualization of both individualistic and social-oriented potentials. In a test of this assumption, the Belief Scale and subscales from the Survey of Personal Beliefs served as measures of what REBT presumes to be pathogenic irrationalities. These measures were correlated with the Hypercompetitive Attitude Scale (HCAS), the Personal Development Competitive Attitude Scale (PDCAS), factors from the Splitting Index, and self-esteem. Results for the HCAS and Self-Splitting supported the REBT claim about individualistic self-actualization. Mostly nonsignificant and a few counterintuitive linkages were observed for irrational beliefs with the PDCAS, Family-Splitting, and Other-Splitting, and these data suggested that REBT may be less successful in capturing the "rationality" of a social-oriented self-actualization. Copyright 2001 John Wiley & Sons, Inc.

  20. Mort Rainey's Split Personality in Secret Window

    OpenAIRE

    Sandjaya, Cynthya; Limanta, Liem Satya

    2013-01-01

    Psychological issue is the main issue discussed in David Koepp's Secret Window through its main character, Mort Rainey. Rainey's psychological struggle will be the main theme in this research. This thesis examines Rainey's split personality. Furthermore, in this study, we want to analyze the process of how Mort Rainey's personality splits into two different personalities. To meet the answer of this study, we will use the theory of Dissociative Identity Disorder with a support from Sigmund Fre...

  1. A split SUSY model from SUSY GUT

    OpenAIRE

    Wang, FeiDepartment of Physics and Engineering, Zhengzhou University, Zhengzhou, 450000, P.R. China; Wang, Wenyu(Institute of Theoretical Physics, College of Applied Science, Beijing University of Technology, Beijing, 100124, P.R. China); Yang, Jin(State Key Laboratory of Theoretical Physics, Institute of Theoretical Physics, Chinese Academy of Sciences, Beijing, 100190, P.R. China)

    2015-01-01

    We propose to split the sparticle spectrum from the hierarchy between the GUT scale and the Planck scale. A split supersymmetric model, which gives non-universal gaugino masses, is built with proper high dimensional operators in the framework of SO(10) GUT. Based on a calculation of two-loop beta functions for gauge couplings (taking into account all weak scale threshold corrections), we check the gauge coupling unification and dark matter constraints (relic density and direct detections). We...

  2. Split School of High Energy Physics 2015

    CERN Document Server

    2015-01-01

    Split School of High Energy Physics 2015 (SSHEP 2015) was held at the Faculty of Electrical Engineering, Mechanical Engineering and Naval Architecture (FESB), University of Split, from September 14 to September 18, 2015. SSHEP 2015 aimed at master and PhD students who were interested in topics pertaining to High Energy Physics. SSHEP 2015 is the sixth edition of the High Energy Physics School. Previous five editions were held at the Department of Physics, University of Sarajevo, Bosnia and Herzegovina.

  3. Are Ducted Mini-Splits Worth It?

    Energy Technology Data Exchange (ETDEWEB)

    Winkler, Jonathan M [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Maguire, Jeffrey B [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Metzger, Cheryn E. [Pacific Northwest National Laboratory; Zhang, Jason [Pacific Northwest National Laboratory

    2018-02-01

    Ducted mini-split heat pumps are gaining popularity in some regions of the country due to their energy-efficient specifications and their ability to be hidden from sight. Although product and install costs are typically higher than the ductless mini-split heat pumps, this technology is well worth the premium for some homeowners who do not like to see an indoor unit in their living area. Due to the interest in this technology by local utilities and homeowners, the Bonneville Power Administration (BPA) has funded the Pacific Northwest National Laboratory (PNNL) and the National Renewable Energy Laboratory (NREL) to develop capabilities within the Building Energy Optimization (BEopt) tool to model ducted mini-split heat pumps. After the fundamental capabilities were added, energy-use results could be compared to other technologies that were already in BEopt, such as zonal electric resistance heat, central air source heat pumps, and ductless mini-split heat pumps. Each of these technologies was then compared using five prototype configurations in three different BPA heating zones to determine how the ducted mini-split technology would perform under different scenarios. The result of this project was a set of EnergyPlus models representing the various prototype configurations in each climate zone. Overall, the ducted mini-split heat pumps saved about 33-60% compared to zonal electric resistance heat (with window AC systems modeled in the summer). The results also showed that the ducted mini-split systems used about 4% more energy than the ductless mini-split systems, which saved about 37-64% compared to electric zonal heat (depending on the prototype and climate).

  4. Antenna Splitting Functions for Massive Particles

    Energy Technology Data Exchange (ETDEWEB)

    Larkoski, Andrew J.; Peskin, Michael E.; /SLAC

    2011-06-22

    An antenna shower is a parton shower in which the basic move is a color-coherent 2 {yields} 3 parton splitting process. In this paper, we give compact forms for the spin-dependent antenna splitting functions involving massive partons of spin 0 and spin 1/2. We hope that this formalism we have presented will be useful in describing the QCD dynamics of the top quark and other heavy particles at LHC.

  5. Deep Sequencing of Serum Small RNAs Identifies Patterns of 5′ tRNA Half and YRNA Fragment Expression Associated with Breast Cancer

    Directory of Open Access Journals (Sweden)

    Joseph M. Dhahbi

    2014-01-01

    Full Text Available Small noncoding RNAs circulating in the blood may serve as signaling molecules because of their ability to carry out a variety of cellular functions. We have previously described tRNA- and YRNA-derived small RNAs circulating as components of larger complexes in the blood of humans and mice; the characteristics of these small RNAs imply specific processing, secretion, and physiological regulation. In this study, we have asked if changes in the serum abundance of these tRNA and YRNA fragments are associated with a diagnosis of cancer. We used deep sequencing and informatics analysis to catalog small RNAs in the sera of breast cancer cases and normal controls. 5′ tRNA halves and YRNA fragments are abundant in both groups, but we found that a breast cancer diagnosis is associated with changes in levels of specific subtypes. This prompted us to look at existing sequence datasets of serum small RNAs from 42 breast cancer cases, taken at the time of diagnosis. We find significant changes in the levels of specific 5′ tRNA halves and YRNA fragments associated with clinicopathologic characteristics of the cancer. Although these findings do not establish causality, they suggest that circulating 5′ tRNA halves and YRNA fragments with known cellular functions may participate in breast cancer syndromes and have potential as circulating biomarkers. Larger studies with multiple types of cancer are needed to adequately evaluate their potential use for the development of noninvasive cancer screening.

  6. Affinity labeling of Escherichia coli phenylalanyl-tRNA synthetase at the binding site for tRNA

    International Nuclear Information System (INIS)

    Hountondji, C.; Schmitter, J.M.; Beauvallet, C.; Blanquet, S.

    1987-01-01

    Periodate-oxidized tRNA/sup Phe/ (tRNA/sub ox//sup Phe/) behaves as a specific affinity label of tetrameric Escherichia coli phenylalanyl-tRNA synthetase (PheRS). Reaction of the α 2 β 2 enzyme with tRNA/sub ox//sup Phe/ results in the loss of tRNA/sup Phe/ aminoacylation activity with covalent attachment of 2 mol of tRNA dialdehyde/mol of enzyme, in agreement with the stoichiometry of tRNA binding. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the PheRS-[ 14 C]tRNA/sub ox//sup Phe/ covalent complex indicates that the large (α, M/sub r/ 87K) subunit of the enzyme interacts with the 3'-adenosine of tRNA/sub ox//sup Phe/. The [ 14 C]tRNA-labeled chymotryptic peptides of PheRS were purified by both gel filtration and reverse-phase high-performance liquid chromatography. The radioactivity was almost equally distributed among three peptides: Met-Lys[Ado]-Phe, Ala-Asp-Lys[Ado]-Leu, and Lys-Ile-Lys[Ado]-Ala. These sequences correspond to residues 1-3, 59-62, and 104-107, respectively, in the N-terminal region of the 795 amino acid sequence of the α subunit. It is noticeable that the labeled peptide Ala-Asp-Lys-Leu is adjacent to residues 63-66 (Arg-Val-Thr-Lys). The latter sequence was just predicted to resemble the proposed consensus tRNA CCA binding region Lys-Met-Ser-Lys-Ser, as deduced from previous affinity labeling studies on E. coli methionyl- and tyrosyl-tRNA synthetases

  7. 12 CFR 7.2023 - Reverse stock splits.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Reverse stock splits. 7.2023 Section 7.2023... Corporate Practices § 7.2023 Reverse stock splits. (a) Authority to engage in reverse stock splits. A national bank may engage in a reverse stock split if the transaction serves a legitimate corporate purpose...

  8. Why should cancer biologists care about tRNAs? tRNA synthesis, mRNA translation and the control of growth.

    Science.gov (United States)

    Grewal, Savraj S

    2015-07-01

    Transfer RNAs (tRNAs) are essential for mRNA translation. They are transcribed in the nucleus by RNA polymerase III and undergo many modifications before contributing to cytoplasmic protein synthesis. In this review I highlight our understanding of how tRNA biology may be linked to the regulation of mRNA translation, growth and tumorigenesis. First, I review how oncogenes and tumour suppressor signalling pathways, such as the PI3 kinase/TORC1, Ras/ERK, Myc, p53 and Rb pathways, regulate Pol III and tRNA synthesis. In several cases, this regulation contributes to cell, tissue and body growth, and has implications for our understanding of tumorigenesis. Second, I highlight some recent work, particularly in model organisms such as yeast and Drosophila, that shows how alterations in tRNA synthesis may be not only necessary, but also sufficient to drive changes in mRNA translation and growth. These effects may arise due to both absolute increases in total tRNA levels, but also changes in the relative levels of tRNAs in the overall pool. Finally, I review some recent studies that have revealed how tRNA modifications (amino acid acylation, base modifications, subcellular shuttling, and cleavage) can be regulated by growth and stress cues to selectively influence mRNA translation. Together these studies emphasize the importance of the regulation of tRNA synthesis and modification as critical control points in protein synthesis and growth. This article is part of a Special Issue entitled: Translation and Cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Genome-wide analysis of tRNA charging and activation of the eIF2 kinase Gcn2p.

    Science.gov (United States)

    Zaborske, John M; Narasimhan, Jana; Jiang, Li; Wek, Sheree A; Dittmar, Kimberly A; Freimoser, Florien; Pan, Tao; Wek, Ronald C

    2009-09-11

    When cells are subjected to nutritional stress, uncharged tRNAs accumulate and activate Gcn2p phosphorylation of eukaryotic initiation factor-2 (eIF2) and the general amino acid control pathway. The Gcn2p regulatory domain homologous to histidyl-tRNA synthetases is proposed to bind to uncharged tRNA, directly contributing to activation of Gcn2p. Here we apply a microarray technology to analyze genome-wide changes in tRNA charging in yeast upon activation of Gcn2p in response to amino acid starvation and high salinity, a stress not directly linked to nutritional deficiency. This microarray technology is applicable for all eukaryotic cells. Strains were starved for histidine, leucine, or tryptophan and shown to rapidly induce Gcn2p phosphorylation of eIF2. The relative charging level of all tRNAs was measured before and after starvation, and Gcn2p activation and the intracellular levels of the starved amino acid correlate with the observed decrease in tRNA charging. Interestingly, in some cases, tRNAs not charged with the starved amino acid became deacylated more rapidly than tRNAs charged with the starved amino acid. This increase in uncharged tRNA levels occurred although the intracellular levels for these non-starved amino acids remained unchanged. Additionally, treatment of a wild-type strain with high salinity stress showed transient changes in the charging of several different tRNAs. These results suggest that Gcn2p can be activated by many different tRNA species in the cell. These results also depict a complex cellular relationship between tRNA charging, amino acid availability, and non-nutrient stress. These relationships are best revealed by simultaneous monitoring of the charging level of all tRNAs.

  10. Targeting ribonucleic acids by toxic small molecules: structural perturbation and energetics of interaction of phenothiazinium dyes thionine and toluidine blue O to tRNA phe.

    Science.gov (United States)

    Paul, Puja; Kumar, Gopinatha Suresh

    2013-12-15

    This study was designed to examine the toxic interaction of two phenothiazinium dyes thionine (TO) and toluidine blue O (TBO) with tRNA(phe) by spectroscopic and calorimetric techniques. While phenothiazinium dye complexation with DNA is known, their bindings to RNA are not fully investigated. The non cooperative binding of both the dyes to tRNA was revealed from absorbance and fluorescence studies. From absorption, steady-state emission, the effect of ferrocyanide ion-induced steady-state fluorescence quenching, circular dichroism, the mode of binding of these dyes into the tRNA helix has been substantiated to be principally by intercalative in nature. Both dyes enhanced the thermal stability of tRNA. Circular dichroism studies provided evidence for the structural perturbations associated with the tRNA structure with induction of optical activity in the CD inactive dye molecules. Results from isothermal titration calorimetry experiments suggested that the binding of both dyes was predominantly entropy driven with a smaller but favorable enthalpy term that increased with temperature. The binding was dependent on the Na(+) concentration, but had a larger non-electrostatic contribution to the Gibbs energy. A small heat capacity value and the enthalpy-entropy compensation in the energetics of the interaction characterized the binding of the dyes to tRNA. This study confirms that the tRNA(phe) binding affinity is greater for TO compared to TBO. The utility of the present work lies in understanding the potential binding and consequent damage to tRNA by these toxic dyes in their development as therapeutic agents. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Fano resonance Rabi splitting of surface plasmons.

    Science.gov (United States)

    Liu, Zhiguang; Li, Jiafang; Liu, Zhe; Li, Wuxia; Li, Junjie; Gu, Changzhi; Li, Zhi-Yuan

    2017-08-14

    Rabi splitting and Fano resonance are well-known physical phenomena in conventional quantum systems as atoms and quantum dots, arising from strong interaction between two quantum states. In recent years similar features have been observed in various nanophotonic and nanoplasmonic systems. Yet, realization of strong interaction between two or more Fano resonance states has not been accomplished either in quantum or in optical systems. Here we report the observation of Rabi splitting of two strongly coupled surface plasmon Fano resonance states in a three-dimensional plasmonic nanostructure consisting of vertical asymmetric split-ring resonators. The plasmonic system stably supports triple Fano resonance states and double Rabi splittings can occur between lower and upper pairs of the Fano resonance states. The experimental discovery agrees excellently with rigorous numerical simulations, and is well explained by an analytical three-oscillator model. The discovery of Fano resonance Rabi splitting could provide a stimulating insight to explore new fundamental physics in analogous atomic systems and could be used to significantly enhance light-matter interaction for optical sensing and detecting applications.

  12. Photochemical Water-Splitting with Organomanganese Complexes.

    Science.gov (United States)

    Kadassery, Karthika J; Dey, Suman Kr; Cannella, Anthony F; Surendhran, Roshaan; Lacy, David C

    2017-08-21

    Certain organometallic chromophores with water-derived ligands, such as the known [Mn(CO) 3 (μ 3 -OH)] 4 (1) tetramer, drew our attention as possible platforms to study water-splitting reactions. Herein, we investigate the UV irradiation of various tricarbonyl organomanganese complexes, including 1, and demonstrate that dihydrogen, CO, and hydrogen peroxide form as products in a photochemical water-splitting decomposition reaction. The organic and manganese-containing side products are also characterized. Labeling studies with 18 O-1 suggest that the source of oxygen atoms in H 2 O 2 originates from free water that interacts with 1 after photochemical dissociation of CO (1-CO) constituting the oxidative half-reaction of water splitting mediated by 1. Hydrogen production from 1 is the result of several different processes, one of which involves the protons derived from the hydroxido ligands in 1 constituting the reductive half-reaction of water splitting mediated by 1. Other processes that generate H 2 are also operative and are described. Collectively the results from the photochemical decomposition of 1 provide an opportunity to propose a mechanism, and it is discussed within the context of developing new strategies for water-splitting reactions with organomanganese complexes.

  13. Urban pattern: Layout design by hierarchical domain splitting

    KAUST Repository

    Yang, Yongliang

    2013-11-06

    We present a framework for generating street networks and parcel layouts. Our goal is the generation of high-quality layouts that can be used for urban planning and virtual environments. We propose a solution based on hierarchical domain splitting using two splitting types: streamline-based splitting, which splits a region along one or multiple streamlines of a cross field, and template-based splitting, which warps pre-designed templates to a region and uses the interior geometry of the template as the splitting lines. We combine these two splitting approaches into a hierarchical framework, providing automatic and interactive tools to explore the design space.

  14. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  15. Mutational analysis of the mitochondrial 12S rRNA and tRNASer(UCN) genes in Tunisian patients with nonsyndromic hearing loss

    International Nuclear Information System (INIS)

    Mkaouar-Rebai, Emna; Tlili, Abdelaziz; Masmoudi, Saber; Louhichi, Nacim; Charfeddine, Ilhem; Amor, Mohamed Ben; Lahmar, Imed; Driss, Nabil; Drira, Mohamed; Ayadi, Hammadi; Fakhfakh, Faiza

    2006-01-01

    We explored the mitochondrial 12S rRNA and the tRNA Ser(UCN) genes in 100 Tunisian families affected with NSHL and in 100 control individuals. We identified the mitochondrial A1555G mutation in one out of these 100 families and not in the 100 control individuals. Members of this family harbouring the A1555G mutation showed phenotypic heterogeneity which could be explained by an eventual nuclear-mitochondrial interaction. So, we have screened three nuclear genes: GJB2, GJB3, and GJB6 but we have not found correlation between the phenotypic heterogeneity and variants detected in these genes. We explored also the entire mitochondrial 12S rRNA and the tRNA Ser(UCN) genes. We detected five novel polymorphisms: T742C, T794A, A813G, C868T, and C954T, and 12 known polymorphisms in the mitochondrial 12S rRNA gene. None of the 100 families or the 100 controls were found to carry mutations in the tRNA Ser(UCN) gene. We report here First mutational screening of the mitochondrial 12S rRNA and the tRNA Ser(UCN) genes in the Tunisian population which describes the second family harbouring the A1555G mutation in Africa and reveals novel polymorphisms in the mitochondrial 12S rRNA gene

  16. Structure, Mechanism, and Specificity of a Eukaryal tRNA Restriction Enzyme Involved in Self-Nonself Discrimination

    Directory of Open Access Journals (Sweden)

    Anupam K. Chakravarty

    2014-04-01

    Full Text Available tRNA restriction by anticodon nucleases underlies cellular stress responses and self-nonself discrimination in a wide range of taxa. Anticodon breakage inhibits protein synthesis, which, in turn, results in growth arrest or cell death. The eukaryal ribotoxin PaT secreted by Pichia acaciae inhibits growth of Saccharomyces cerevisiae via cleavage of tRNAGln(UUG. We find that recombinant PaT incises a synthetic tRNAGln(UUG stem-loop RNA by transesterification at a single site 3′ of the wobble uridine, yielding 2′,3′-cyclic phosphate and 5′-OH ends. Incision is suppressed by replacement of the wobble nucleobase with adenine or guanine. The crystal structure of PaT reveals a distinctive fold and active site, essential components of which are demonstrated by mutagenesis. Pichia acaciae evades self-toxicity via a distinctive intracellular immunity protein, ImmPaT, which binds PaT and blocks nuclease activity. Our results highlight the evolutionary diversity of tRNA restriction and immunity systems.

  17. Three-Dimensional Algebraic Models of the tRNA Code and 12 Graphs for Representing the Amino Acids.

    Science.gov (United States)

    José, Marco V; Morgado, Eberto R; Guimarães, Romeu Cardoso; Zamudio, Gabriel S; de Farías, Sávio Torres; Bobadilla, Juan R; Sosa, Daniela

    2014-08-11

    Three-dimensional algebraic models, also called Genetic Hotels, are developed to represent the Standard Genetic Code, the Standard tRNA Code (S-tRNA-C), and the Human tRNA code (H-tRNA-C). New algebraic concepts are introduced to be able to describe these models, to wit, the generalization of the 2n-Klein Group and the concept of a subgroup coset with a tail. We found that the H-tRNA-C displayed broken symmetries in regard to the S-tRNA-C, which is highly symmetric. We also show that there are only 12 ways to represent each of the corresponding phenotypic graphs of amino acids. The averages of statistical centrality measures of the 12 graphs for each of the three codes are carried out and they are statistically compared. The phenotypic graphs of the S-tRNA-C display a common triangular prism of amino acids in 10 out of the 12 graphs, whilst the corresponding graphs for the H-tRNA-C display only two triangular prisms. The graphs exhibit disjoint clusters of amino acids when their polar requirement values are used. We contend that the S-tRNA-C is in a frozen-like state, whereas the H-tRNA-C may be in an evolving state.

  18. Large Bandgap Semiconductors for Solar Water Splitting

    DEFF Research Database (Denmark)

    Malizia, Mauro

    Photoelectrochemical water splitting represents an eco-friendly technology that could enable the production of hydrogen using water as reactant and solar energy as primary energy source. The exploitation of solar energy for the production of hydrogen would help modern society to reduce the reliance...... (bismuth vanadate) was investigated in view of combining this 2.4 eV large bandgap semiconductor with a Si back-illuminated photocathode. A device obtained by mechanical stacking of BiVO4 photoanode and standard Si photocathode performs non-assisted water splitting under illumination with Solar......-to-Hydrogen efficiency lower than 0.5%. In addition, BiVO4 was synthesized on the back-side of a Si back-illuminated photocathode to produce a preliminary monolithic solar water splitting device.The Faradaic efficiency of different types of catalysts for the electrochemical production of hydrogen or oxygen was evaluated...

  19. Multiple spectral splits of supernova neutrinos.

    Science.gov (United States)

    Dasgupta, Basudeb; Dighe, Amol; Raffelt, Georg G; Smirnov, Alexei Yu

    2009-07-31

    Collective oscillations of supernova neutrinos swap the spectra f(nu(e))(E) and f(nu[over ](e))(E) with those of another flavor in certain energy intervals bounded by sharp spectral splits. This phenomenon is far more general than previously appreciated: typically one finds one or more swaps and accompanying splits in the nu and nu[over ] channels for both inverted and normal neutrino mass hierarchies. Depending on an instability condition, swaps develop around spectral crossings (energies where f(nu(e))=f(nu(x)), f(nu[over ](e))=f(nu[over ](x)) as well as E-->infinity where all fluxes vanish), and the widths of swaps are determined by the spectra and fluxes. Washout by multiangle decoherence varies across the spectrum and splits can survive as sharp spectral features.

  20. Split Notochord Syndrome: A Rare Variant

    Science.gov (United States)

    Dhawan, Vidhu; Kapoor, Kanchan; Singh, Balbir; Kochhar, Suman; Sehgal, Alka; Dada, Rima

    2017-01-01

    Split notochord syndrome represents an extremely rare and pleomorphic form of spinal dysraphism characterized by a persistent communication between the endoderm and the ectoderm, resulting in splitting or deviation of the notochord. It manifests as a cleft in the dorsal midline of the body through which intestinal loops are exteriorized and even myelomeningoceles or teratomas may occur at the site. A rare variant was diagnosed on autopsy of a 23+4-week-old fetus showing a similar dorsal enteric fistula and midline protruding intestinal loops in thoracolumbar region. The anteroposterior radiograph showed a complete midline cleft in the vertebral bodies from T11 to L5 region, and a split in the spinal cord was further confirmed by ultrasonography. Myelomeningocele was erroneously reported on antenatal ultrasound. Thus, awareness of this rare anomaly is necessary to thoroughly evaluate the cases of such spinal defects or suspected myelomeningoceles. PMID:28904581

  1. Fuzzy split and merge for shadow detection

    Directory of Open Access Journals (Sweden)

    Remya K. Sasi

    2015-03-01

    Full Text Available Presence of shadow in an image often causes problems in computer vision applications such as object recognition and image segmentation. This paper proposes a method to detect the shadow from a single image using fuzzy split and merge approach. Split and merge is a classical algorithm used in image segmentation. Predicate function in the classical approach is replaced by a Fuzzy predicate in the proposed approach. The method follows a top down approach of recursively splitting an image into homogeneous quadtree blocks, followed by a bottom up approach by merging adjacent unique regions. The method has been compared with previous approaches and found to be better in performance in terms of accuracy.

  2. Faster multiple emulsification with drop splitting.

    Science.gov (United States)

    Abate, Adam R; Weitz, David A

    2011-06-07

    Microfluidic devices can form emulsions in which the drops have an intricate, controlled structure; however, a challenge is that the droplets are produced slowly, typically only a few millilitres per hour. Here, we present a simple technique to increase the production rate. Using a large drop maker, we produce large drops at a fast volumetric rate; by splitting these drops several times in a splitting array, we create drops of the desired small size. The advantage of this over forming the small drops directly using a small drop maker is that the drops can be formed at much faster rates. This can be applied to the production of single and multiple emulsions.

  3. Hyperfine splitting in lithium-like bismuth

    Energy Technology Data Exchange (ETDEWEB)

    Lochmann, Matthias; Froemmgen, Nadja; Hammen, Michael; Will, Elisa [Universitaet Mainz (Germany); Andelkovic, Zoran; Kuehl, Thomas; Litvinov, Yuri; Winters, Danyal; Sanchez, Rodolfo [GSI Helmholtzzentrum, Darmstadt (Germany); Botermann, Benjamin; Noertershaeuser, Wilfried [Technische Universitaet Darmstadt (Germany); Bussmann, Michael [Helmholtzzentrum Dresden-Rossendorf (Germany); Dax, Andreas [CERN, Genf (Switzerland); Hannen, Volker; Joehren, Raphael; Vollbrecht, Jonas; Weinheimer, Christian [Universitaet Muenster (Germany); Geppert, Christopher [Universitaet Mainz (Germany); GSI Helmholtzzentrum, Darmstadt (Germany); Stoehlker, Thomas [GSI Helmholtzzentrum, Darmstadt (Germany); Universitaet Heidelberg (Germany); Thompson, Richard [Imperial College, London (United Kingdom); Volotka, Andrey [Technische Universitaet Dresden (Germany); Wen, Weiqiang [IMP Lanzhou (China)

    2013-07-01

    High-precision measurements of the hyperfine splitting values on Li- and H-like bismuth ions, combined with precise atomic structure calculations allow us to test QED-effects in the regime of the strongest magnetic fields that are available in the laboratory. Performing laser spectroscopy at the experimental storage ring (ESR) at GSI Darmstadt, we have now succeeded in measuring the hyperfine splitting in Li-like bismuth. Probing this transition has not been easy because of its extremely low fluorescence rate. Details about this challenging experiment will be given and the achieved experimental accuracy are presented.

  4. Split-gene system for hybrid wheat seed production

    OpenAIRE

    Kempe, Katja; Rubtsova, Myroslava; Gils, Mario

    2014-01-01

    Global food security demands the development of new technologies to increase and secure cereal production on finite arable land without increasing water and fertilizer use. Although the use of heterosis through hybrid breeding has produced tremendous economic benefits in worldwide crop production, less than 1% of the global wheat area is planted with hybrids. One of the greatest bottlenecks in breeding hybrid wheat is the lack of an efficient sterility system to block self-pollination. This r...

  5. Split-gene system for hybrid wheat seed production.

    Science.gov (United States)

    Kempe, Katja; Rubtsova, Myroslava; Gils, Mario

    2014-06-24

    Hybrid wheat plants are superior in yield and growth characteristics compared with their homozygous parents. The commercial production of wheat hybrids is difficult because of the inbreeding nature of wheat and the lack of a practical fertility control that enforces outcrossing. We describe a hybrid wheat system that relies on the expression of a phytotoxic barnase and provides for male sterility. The barnase coding information is divided and distributed at two loci that are located on allelic positions of the host chromosome and are therefore "linked in repulsion." Functional complementation of the loci is achieved through coexpression of the barnase fragments and intein-mediated ligation of the barnase protein fragments. This system allows for growth and maintenance of male-sterile female crossing partners, whereas the hybrids are fertile. The technology does not require fertility restorers and is based solely on the genetic modification of the female crossing partner.

  6. Discrete objects, splitting closure and connectedness | Castellini ...

    African Journals Online (AJOL)

    Notions of discrete and indiscrete classes with respect to a closure operator are introduced and studied. These notions are strongly related to splitting and cosplitting closure operators. By linking the above concepts, two Galois connections arise whose composition provides a third Galois connection that can be used as a ...

  7. Miniaturized Planar Split-Ring Resonator Antenna

    DEFF Research Database (Denmark)

    Kim, Oleksiy S.; Breinbjerg, Olav

    2009-01-01

    A miniaturized planar antenna based on a broadside-coupled split ring resonator excited by an arc-shaped dipole is presented. The excitation dipole acts as a small tuning capacitor in series with a parallel RLC circuit represented by the SRR. The antenna resonance frequency and dimensions...

  8. Split Coil Forms for Rotary Transformers

    Science.gov (United States)

    Mclyman, C. W. T.

    1982-01-01

    Split cores for rotor and stator windings of rotary transformer mounted around their respective coils (which are in bobbins) and cemented together. This arrangement simplifies winding of stator coil to go in a slot in inner diameter of stator coil. One practical application of rotary transformers fabricated according to this technique is for centrifuges, in which conventional sliprings are of uncertain reliability.

  9. Split Beta-Lactamase Complementation Assay

    Indian Academy of Sciences (India)

    IAS Admin

    Concept of split beta. -lactamase protein fragment complementation assay. (A) and (B) are vector systems involved in the assay. As an example, a vector system for bacterial host is described here. (C) Co-transformation of complementation vectors in appropriate bacterial host. (D) and (E) are types of inter- actions expected ...

  10. Molecular catalytic system for efficient water splitting

    NARCIS (Netherlands)

    Joya, Khurram Saleem

    2011-01-01

    The aim of this dissertation is to construct and explore artificial oxygen evolving complexes that are synthetically accessible, stable, functionally robust and efficient. To achieve this, a class of mono metal water splitting catalysts is introduced in this manuscript and exploitation of these

  11. Splitting up Beta’s change

    OpenAIRE

    Suarez, Ronny

    2014-01-01

    In this paper we estimated IBM beta from 2000 to 2013, then using differential equation mathematical formula we split up the annual beta’s change attributed to the volatility market effect, the stock volatility effect, the correlation effect and the jointly effect of these variables.

  12. Shear-wave splitting and moonquakes

    Science.gov (United States)

    Dimech, J. L.; Weber, R. C.; Savage, M. K.

    2017-12-01

    Shear-wave splitting is a powerful tool for measuring anisotropy in the Earth's crust and mantle, and is sensitive to geological features such as fluid filled cracks, thin alternating layers of rock with different elastic properties, and preferred mineral orientations caused by strain. Since a shear wave splitting measurement requires only a single 3-component seismic station, it has potential applications for future single-station planetary seismic missions, such as the InSight geophysical mission to Mars, as well as possible future missions to Europa and the Moon. Here we present a preliminary shear-wave splitting analysis of moonquakes detected by the Apollo Passive Seismic Experiment. Lunar seismic data suffers from several drawbacks compared to modern terrestrial data, including severe seismic scattering, low intrinsic attenuation, 10-bit data resolution, thermal spikes, and timing errors. Despite these drawbacks, we show that it is in principle possible to make a shear wave splitting measurement using the S-phase arrival of a relatively high-quality moonquake, as determined by several agreeing measurement criteria. Encouraged by this finding, we further extend our analysis to clusters of "deep moonquake" events by stacking multiple events from the same cluster together to further enhance the quality of the S-phase arrivals that the measurement is based on.

  13. Split brain: divided perception but undivided consciousness.

    Science.gov (United States)

    Pinto, Yair; Neville, David A; Otten, Marte; Corballis, Paul M; Lamme, Victor A F; de Haan, Edward H F; Foschi, Nicoletta; Fabri, Mara

    2017-05-01

    In extensive studies with two split-brain patients we replicate the standard finding that stimuli cannot be compared across visual half-fields, indicating that each hemisphere processes information independently of the other. Yet, crucially, we show that the canonical textbook findings that a split-brain patient can only respond to stimuli in the left visual half-field with the left hand, and to stimuli in the right visual half-field with the right hand and verbally, are not universally true. Across a wide variety of tasks, split-brain patients with a complete and radiologically confirmed transection of the corpus callosum showed full awareness of presence, and well above chance-level recognition of location, orientation and identity of stimuli throughout the entire visual field, irrespective of response type (left hand, right hand, or verbally). Crucially, we used confidence ratings to assess conscious awareness. This revealed that also on high confidence trials, indicative of conscious perception, response type did not affect performance. These findings suggest that severing the cortical connections between hemispheres splits visual perception, but does not create two independent conscious perceivers within one brain. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  14. Helioseismic Solar Cycle Changes and Splitting Coefficients

    Indian Academy of Sciences (India)

    tribpo

    Abstract. Using the GONG data for a period over four years, we have studied the variation of frequencies and splitting coefficients with solar cycle. Frequencies and even-order coefficients are found to change signi- ficantly with rising phase of the solar cycle. We also find temporal varia- tions in the rotation rate near the solar ...

  15. Czech, Slovak science ten years after split

    CERN Multimedia

    2003-01-01

    Ten years after the split of Czechoslovakia Czech and Slovak science are facing the same difficulties: shortage of money for research, poor salaries, obsolete equipment and brain drain, especially of the young, according to a feature in the Daily Lidove Noviny (1 page).

  16. Comparing Electrochemical and Biological Water Splitting

    DEFF Research Database (Denmark)

    Rossmeisl, Jan; Dimitrievski, Kristian; Siegbahn, P.

    2007-01-01

    On the basis of density functional theory calculations, we compare the free energies of key intermediates in the water splitting reaction over transition metal oxide surfaces to those of the Mn cluster in photo system II. In spite of the very different environments in the enzyme system...

  17. A structured RNA motif is involved in correct placement of the tRNA(3)(Lys) primer onto the human immunodeficiency virus genome

    NARCIS (Netherlands)

    Beerens, N.; Klaver, B.; Berkhout, B.

    2000-01-01

    Human immunodeficiency virus type 1 (HIV-1) reverse transcription is primed by the cellular tRNA(3)(Lys) molecule that binds with its 3'-terminal 18 nucleotides to the fully complementary primer-binding site (PBS) on the viral RNA genome. Besides this complementarity, annealing of the primer may be

  18. Reduced replication of human immunodeficiency virus type 1 mutants that use reverse transcription primers other than the natural tRNA(3Lys)

    NARCIS (Netherlands)

    Das, A. T.; Klaver, B.; Berkhout, B.

    1995-01-01

    Replication of the human immunodeficiency virus type 1 (HIV-1) and other retroviruses involves reverse transcription of the viral RNA genome into a double-stranded DNA. This reaction is primed by the cellular tRNA(3Lys) molecule, which binds to a complementary sequence in the viral genome, referred

  19. The tRNA primer activation signal in the human immunodeficiency virus type 1 genome is important for initiation and processive elongation of reverse transcription

    NARCIS (Netherlands)

    Beerens, Nancy; Berkhout, Ben

    2002-01-01

    Human immunodeficiency virus type 1 (HIV-1) reverse transcription is primed by the cellular tRNA(3)(Lys) molecule, which binds, with its 3'-terminal 18 nucleotides (nt), to a complementary sequence in the viral genome, the primer-binding site (PBS). Besides PBS-anti-PBS pairing, additional

  20. Non-Mendelian transmission in a human developmental disorder: split hand/split foot.

    OpenAIRE

    Jarvik, G. P.; Patton, M. A.; Homfray, T.; Evans, J. P.

    1994-01-01

    The study of Mendelian disorders that do not meet some Mendelian expectations has led to an increased understanding of such previously obscure genetic phenomena as anticipation. Split hand/split foot (SHSF), a human developmental malformation, demonstrates such distinctive genetic features as reduced penetrance and variable expressivity. In this study, new pedigrees with defined ascertainment confirm the existence of non-Mendelian transmission characterized by the overtransmission of SHSF fro...

  1. Splitting, splitting and splitting again: A brief history of the development of regional government in Indonesia since independence

    Directory of Open Access Journals (Sweden)

    Anne Booth

    2011-04-01

    Full Text Available The paper reviews the changes in the structure and role of provincial and sub-provincial governments in Indonesia since independence. Particular attention is paid to the process of splitting both provinces and districts (kabupaten and kota into smaller units. The paper points out that this process has been going on since the 1950s, but has accelerated in the post-Soeharto era. The paper examines why the splitting of government units has occurred in some parts of the Outer Islands to a much greater extent than in Java, and also examines the implications of developments since 1999 for the capacity of local government units to deliver basic services such as health and education.

  2. Overexpression and rapid purification of the orfE/rph gene product, RNase PH of Escherichia coli

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Andersen, J T; Poulsen, Peter

    1992-01-01

    acid residue protein which was recently identified as the phosphorolytic ribonuclease, RNase PH, that removes nucleotides from the 3' ends of tRNA precursors. In this paper we report the construction of a plasmid, which overexpresses the orfE and pyrE gene products substantially, as well...

  3. Split mandrel versus split sleeve coldworking: Dual methods for extending the fatigue life of metal structures

    Science.gov (United States)

    Rodman, Geoffrey A.; Creager, Matthew

    1994-01-01

    It is common practice to use split sleeve coldworking of fastener holes as a means of extending the fatigue life of metal structures. In search of lower manufacturing costs, the aerospace industry is examining the split mandrel (sleeveless) coldworking process as an alternative method of coldworking fastener holes in metal structures. The split mandrel process (SpM) significantly extends the fatigue life of metal structures through the introduction of a residual compressive stress in a manner that is very similar to the split sleeve system (SpSl). Since the split mandrel process is significantly less expensive than the split sleeve process and more adaptable to robotic automation, it will have a notable influence upon other new manufacture of metal structures which require coldworking a significant number of holes, provided the aerospace community recognizes that the resulting residual stress distributions and fatigue life improvement are the same for both processes. Considerable testing has validated the correctness of that conclusion. The findings presented in this paper represent the results of an extensive research and development program, comprising data collected from over 400 specimens fabricated from 2024-T3 and 7075-T651 aluminum alloys in varied configurations, which quantify the benefits (fatigue enhancement and cost savings) of automating a sleeveless coldworking system.

  4. Selective charging of tRNA isoacceptors induced by amino-acid starvation

    DEFF Research Database (Denmark)

    Dittmar, K. A.; Sørensen, Michael Askvad; Elf, J.

    2005-01-01

    Aminoacylated (charged) transfer RNA isoacceptors read different messenger RNA codons for the same amino acid. The concentration of an isoacceptor and its charged fraction are principal determinants of the translation rate of its codons. A recent theoretical model predicts that amino-acid...... by isoacceptors that retain high charging can be used for efficient translation of genes that are essential during amino-acid starvation. Selective charging can explain anomalous patterns of codon usage in the genes for different families of proteins....

  5. Photoelectrochemical water splitting: optimizing interfaces and light absorption

    NARCIS (Netherlands)

    Park, Sun-Young

    2015-01-01

    In this thesis several photoelectrochemical water splitting devices based on semiconductor materials were investigated. The aim was the design, characterization, and fabrication of solar-to-fuel devices which can absorb solar light and split water to produce hydrogen.

  6. A Regularized Algorithm for the Proximal Split Feasibility Problem

    Directory of Open Access Journals (Sweden)

    Zhangsong Yao

    2014-01-01

    Full Text Available The proximal split feasibility problem has been studied. A regularized method has been presented for solving the proximal split feasibility problem. Strong convergence theorem is given.

  7. Multiple Rabi Splittings under Ultrastrong Vibrational Coupling.

    Science.gov (United States)

    George, Jino; Chervy, Thibault; Shalabney, Atef; Devaux, Eloïse; Hiura, Hidefumi; Genet, Cyriaque; Ebbesen, Thomas W

    2016-10-07

    From the high vibrational dipolar strength offered by molecular liquids, we demonstrate that a molecular vibration can be ultrastrongly coupled to multiple IR cavity modes, with Rabi splittings reaching 24% of the vibration frequencies. As a proof of the ultrastrong coupling regime, our experimental data unambiguously reveal the contributions to the polaritonic dynamics coming from the antiresonant terms in the interaction energy and from the dipolar self-energy of the molecular vibrations themselves. In particular, we measure the opening of a genuine vibrational polaritonic band gap of ca. 60 meV. We also demonstrate that the multimode splitting effect defines a whole vibrational ladder of heavy polaritonic states perfectly resolved. These findings reveal the broad possibilities in the vibrational ultrastrong coupling regime which impact both the optical and the molecular properties of such coupled systems, in particular, in the context of mode-selective chemistry.

  8. Splitting of high power, cw proton beams

    Directory of Open Access Journals (Sweden)

    Alberto Facco

    2007-09-01

    Full Text Available A simple method for splitting a high power, continuous wave (cw proton beam in two or more branches with low losses has been developed in the framework of the EURISOL (European Isotope Separation On-Line Radioactive Ion Beam Facility design study. The aim of the system is to deliver up to 4 MW of H^{-} beam to the main radioactive ion beam production target, and up to 100 kW of proton beams to three more targets, simultaneously. A three-step method is used, which includes magnetic neutralization of a fraction of the main H^{-} beam, magnetic splitting of H^{-} and H^{0}, and stripping of H^{0} to H^{+}. The method allows slow raising and individual fine adjustment of the beam intensity in each branch.

  9. Meshed split skin graft for extensive vitiligo

    Directory of Open Access Journals (Sweden)

    Srinivas C

    2004-05-01

    Full Text Available A 30 year old female presented with generalized stable vitiligo involving large areas of the body. Since large areas were to be treated it was decided to do meshed split skin graft. A phototoxic blister over recipient site was induced by applying 8 MOP solution followed by exposure to UVA. The split skin graft was harvested from donor area by Padgett dermatome which was meshed by an ampligreffe to increase the size of the graft by 4 times. Significant pigmentation of the depigmented skin was seen after 5 months. This procedure helps to cover large recipient areas, when pigmented donor skin is limited with minimal risk of scarring. Phototoxic blister enables easy separation of epidermis thus saving time required for dermabrasion from recipient site.

  10. Timelike single-logarithm-resummed splitting functions

    International Nuclear Information System (INIS)

    Albino, S.; Bolzoni, P.; Kniehl, B.A.; Kotikov, A.V.; Joint Inst. of Nuclear Research, Moscow

    2011-08-01

    We calculate the single logarithmic contributions to the quark singlet and gluon matrix of timelike splitting functions at all orders in the modified minimal-subtraction (MS) scheme. We fix two of the degrees of freedom of this matrix from the analogous results in the massive-gluon regularization scheme by using the relation between that scheme and the MS scheme. We determine this scheme transformation from the double logarithmic contributions to the timelike splitting functions and the coefficient functions of inclusive particle production in e + e - annihilation now available in both schemes. The remaining two degrees of freedom are fixed by reasonable physical assumptions. The results agree with the fixed-order results at next-to-next-to-leading order in the literature. (orig.)

  11. Solar Water Splitting Using Semiconductor Photocatalyst Powders

    KAUST Repository

    Takanabe, Kazuhiro

    2015-07-01

    Solar energy conversion is essential to address the gap between energy production and increasing demand. Large scale energy generation from solar energy can only be achieved through equally large scale collection of the solar spectrum. Overall water splitting using heterogeneous photocatalysts with a single semiconductor enables the direct generation of H from photoreactors and is one of the most economical technologies for large-scale production of solar fuels. Efficient photocatalyst materials are essential to make this process feasible for future technologies. To achieve efficient photocatalysis for overall water splitting, all of the parameters involved at different time scales should be improved because the overall efficiency is obtained by the multiplication of all these fundamental efficiencies. Accumulation of knowledge ranging from solid-state physics to electrochemistry and a multidisciplinary approach to conduct various measurements are inevitable to be able to understand photocatalysis fully and to improve its efficiency.

  12. Atom beams split by gentle persuasion

    International Nuclear Information System (INIS)

    Pool, R.

    1994-01-01

    Two different research teams have taken a big step toward atom interferometry. They have succeeded in splitting atomic beams by using atoms in spin states that neither absorb nor reemit laser light. By proper adjustment of experimental conditions, atoms are changed from one spin state to another, without passing through the intermediary excited state. The atoms in essence absorb momentum from the laser photons, without absorption or emission of photons. The change in momentum deflects atoms in the proper spin state

  13. On split Lie triple systems II

    Indian Academy of Sciences (India)

    In the present paper we extend these results to arbitrary split Lie triple systems with no restrictions on their 0-root spaces. Author Affiliations. Antonio J Calderón Martín1 M Forero Piulestán1. Departamento de Matemáticas, Universidad de Cádiz, 11510 Puerto Real, Cádiz, Spain. Dates. Manuscript received: 24 June 2009 ...

  14. A new location to split Cre recombinase for protein fragment complementation.

    Science.gov (United States)

    Rajaee, Maryam; Ow, David W

    2017-11-01

    We have previously described a recombinase-mediated gene stacking system in which the Cre recombinase is used to remove lox-site flanked DNA no longer needed after each round of Bxb1 integrase-mediated site-specific integration. The Cre recombinase can be conveniently introduced by hybridization with a cre-expressing plant. However, maintaining an efficient cre-expressing line over many generations can be a problem, as high production of this DNA-binding protein might interfere with normal chromosome activities. To counter this selection against high Cre activity, we considered a split-cre approach, in which Cre activity is reconstituted after separate parts of Cre are brought into the same genome by hybridization. To insure that the recombinase-mediated gene stacking system retains its freedom to operate, we tested for new locations to split Cre into complementing fragments. In this study, we describe testing four new locations for splitting the Cre recombinase for protein fragment complementation and show that the two fragments of Cre split between Lys244 and Asn245 can reconstitute activity that is comparable to that of wild-type Cre. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  15. Transonymization as Revitalization: Old Toponyms of Split

    Directory of Open Access Journals (Sweden)

    Katarina Lozić Knezović

    2017-07-01

    Full Text Available The paper deals with ancient toponyms of Split, a city in the centre of the Croatian region of Dalmatia. Along with numerous monuments of spiritual and material culture, toponyms are part of the two-thousand-year-old city’s historical heritage. Split in particular abounds with sources that provide valuable information concerning ancient toponyms. In terms of the study and preservation of toponymy, three basic sources are crucial: the living oral tradition, written records, and old charts — mostly cadastral plans. In addition to researching, recording, documenting, and publishing Split’s ancient place names through toponomastic, geographical, and town planning studies, toponymic heritage preservation is also implemented through the direct use of the names in everyday life. One of the ways of such revitalization of Split’s ancient place names is their transonymization into the category of chrematonyms, i.e. their secondary use as names of institutions, shops, restaurants, schools, sports associations and facilities, bars and coffee shops, cemeteries, and so on. The present paper provides a classification and etymological analysis of detoponymic chrematonyms of Split. The authors propose measures to raise public awareness of the historical information conveyed by the names and raise some issues for consideration regarding further study of transonymization as a means of revitalizing local toponymic tradition.

  16. 26 CFR 1.7872-15 - Split-dollar loans.

    Science.gov (United States)

    2010-04-01

    ...) INCOME TAXES General Actuarial Valuations § 1.7872-15 Split-dollar loans. (a) General rules—(1... split-dollar loan depend upon the relationship between the parties and upon whether the loan is a demand...-dollar demand loan is any split-dollar loan that is payable in full at any time on the demand of the...

  17. 7 CFR 51.2731 - U.S. Spanish Splits.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Spanish Splits. 51.2731 Section 51.2731... STANDARDS) United States Standards for Grades of Shelled Spanish Type Peanuts Grades § 51.2731 U.S. Spanish Splits. “U.S. Spanish Splits” consists of shelled Spanish type peanut kernels which are split or broken...

  18. Semiconductor Nanowires for Photoelectrochemical Water Splitting

    Science.gov (United States)

    Hwang, Yun Jeong

    Photolysis of water with semiconductor materials has been investigated intensely as a clean and renewable energy resource by storing solar energy in chemical bonds such as hydrogen. One-dimensional (1D) nanostructures such as nanowires can provide several advantages for photoelectrochemical (PEC) water splitting due to their high surface areas and excellent charge transport and collection efficiency. This dissertation discusses various nanowire photoelectrodes for single or dual semiconductor systems, and their linked PEC cells for self-driven water splitting. After an introduction of solar water splitting in the first chapter, the second chapter demonstrates water oxidative activities of hydrothermally grown TiO2 nanowire arrays depending on their length and surface properties. The photocurrents with TiO2 nanowire arrays approach saturation due to their poor charge collection efficiency with longer nanowires despite increased photon absorption efficiency. Epitaxial grains of rutile atomic layer deposition (ALD) shell on TiO2 nanowire increase the photocurrent density by 1.5 times due to improved charge collection efficiency especially in the short wavelength region. Chapter three compares the photocurrent density of the planar Si and Si nanowire arrays coated by anatase ALD TiO 2 thin film as a model system of a dual bandgap system. The electroless etched Si nanowire coated by ALD TiO2 (Si EENW/TiO2) shows 2.5 times higher photocurrent density due to lower reflectance and higher surface area. Also, this chapter illustrates that n-Si/n-TiO2 heterojunction is a promising structure for the photoanode application of a dual semiconductor system, since it can enhance the photocurrent density compared to p-Si/n-TiO 2 junction with the assistance of bend banding at the interface. Chapter four demonstrates the charge separation and transport of photogenerated electrons and holes within a single asymmetric Si/TiO2 nanowire. Kelvin probe force microscopy measurements show

  19. Splitting methods for split feasibility problems with application to Dantzig selectors

    Science.gov (United States)

    He, Hongjin; Xu, Hong-Kun

    2017-05-01

    The split feasibility problem (SFP), which refers to the task of finding a point that belongs to a given nonempty, closed and convex set, and whose image under a bounded linear operator belongs to another given nonempty, closed and convex set, has promising applicability in modeling a wide range of inverse problems. Motivated by the increasingly data-driven regularization in the areas of signal/image processing and statistical learning, in this paper, we study the regularized split feasibility problem (RSFP), which provides a unified model for treating many real-world problems. By exploiting the split nature of the RSFP, we shall gainfully employ several efficient splitting methods to solve the model under consideration. A remarkable advantage of our methods lies in their easier subproblems in the sense that the resulting subproblems have closed-form representations or can be efficiently solved up to a high precision. As an interesting application, we apply the proposed algorithms for finding Dantzig selectors, in addition to demonstrating the effectiveness of the splitting methods through some computational results on synthetic and real medical data sets.

  20. Flow Cytometric Bead Sandwich Assay Based on a Split Aptamer.

    Science.gov (United States)

    Shen, Luyao; Bing, Tao; Liu, Xiangjun; Wang, Junyan; Wang, Linlin; Zhang, Nan; Shangguan, Dihua

    2018-01-24

    A few aptamers still bind their targets after being split into two moieties. Split aptamers have shown great potential in the development of aptameric sensors. However, only a few split aptamers have been generated because of lack of knowledge on the binding structure of their parent aptamers. Here, we report the design of a new split aptamer and a flow cytometric bead sandwich assay using a split aptamer instead of double antibodies. Through DMS footprinting and mutation assay, we figured out the target-binding moiety and the structure-stabilizing moiety of the l-selectin aptamer, Sgc-3b. By separating the duplex strand in the structure-stabilizing moiety, we obtained a split aptamer that bound l-selectin. After optimization of one part of the split sequence to eliminate the nonspecific binding of the split sequence pair, we developed a split-aptamer-based cytometric bead assay (SACBA) for the detection of soluble l-selectin. SACBA showed good sensitivity and selectivity to l-selectin and was successfully applied for the detection of spiked l-selectin in the human serum. The strategies for generating split aptamers and designing the split-aptamer-based sandwich assay are simple and efficient and show good practicability in aptamer engineering.

  1. SplitRFLab: A MATLAB GUI toolbox for receiver function analysis based on SplitLab

    Science.gov (United States)

    Xu, Mijian; Huang, Hui; Huang, Zhouchuan; Wang, Liangshu

    2016-02-01

    We add new modules for receiver function (RF) analysis in SplitLab toolbox, which includes the manual RF analysis module, automatic RF analysis and related quality control modules, and H- k stacking module. The updated toolbox (named SplitRFLab toolbox), especially its automatic RF analysis module, could calculate the RFs quickly and efficiently, which is very useful in RF analysis with huge amount of seismic data. China is now conducting the ChinArray project that plans to deploy thousands of portable stations across Chinese mainland. Our SplitRFLab toolbox may obtain reliable RF results quickly at the first time, which provide essentially new constraint to the crustal and mantle structures.

  2. Method of orthogonally splitting imaging pose measurement

    Science.gov (United States)

    Zhao, Na; Sun, Changku; Wang, Peng; Yang, Qian; Liu, Xintong

    2018-01-01

    In order to meet the aviation's and machinery manufacturing's pose measurement need of high precision, fast speed and wide measurement range, and to resolve the contradiction between measurement range and resolution of vision sensor, this paper proposes an orthogonally splitting imaging pose measurement method. This paper designs and realizes an orthogonally splitting imaging vision sensor and establishes a pose measurement system. The vision sensor consists of one imaging lens, a beam splitter prism, cylindrical lenses and dual linear CCD. Dual linear CCD respectively acquire one dimensional image coordinate data of the target point, and two data can restore the two dimensional image coordinates of the target point. According to the characteristics of imaging system, this paper establishes the nonlinear distortion model to correct distortion. Based on cross ratio invariability, polynomial equation is established and solved by the least square fitting method. After completing distortion correction, this paper establishes the measurement mathematical model of vision sensor, and determines intrinsic parameters to calibrate. An array of feature points for calibration is built by placing a planar target in any different positions for a few times. An terative optimization method is presented to solve the parameters of model. The experimental results show that the field angle is 52 °, the focus distance is 27.40 mm, image resolution is 5185×5117 pixels, displacement measurement error is less than 0.1mm, and rotation angle measurement error is less than 0.15°. The method of orthogonally splitting imaging pose measurement can satisfy the pose measurement requirement of high precision, fast speed and wide measurement range.

  3. Injuries caused by firewood splitting machines.

    Science.gov (United States)

    Hellstrand, P H

    1989-01-01

    The aim of this paper is to present the types of injury caused by firewood splitting machines and also to elucidate the accident mechanism. The study is based on 15 cases. The machine has a rotating spiral cone, and usually the victims' gloved fingertips were caught by the point of the cone. This led to either amputations, usually of radial fingers and/or penetrating wounds through the middle of the hand. In most cases the accidents could not be blamed on bad working techniques. The study of the mechanisms of injury points to insufficient protective devices in a machine construction which has a potentially dangerous working principle.

  4. Randomized clinical trial comparing fixed-time split dosing and split dosing of oral Picosulfate regimen for bowel preparation.

    Science.gov (United States)

    Jun, Jae Hyuck; Han, Koon Hee; Park, Jong Kyu; Seo, Hyun Il; Kim, Young Don; Lee, Sang Jin; Jun, Baek Gyu; Hwang, Min Sik; Park, Yoon Kyoo; Kim, Myeong Jong; Cheon, Gab Jin

    2017-08-28

    To compare the efficacy of fixed-time split dose and split dose of an oral sodium picosulfate for bowel preparation. This is study was prospective, randomized controlled study performed at a single Institution (2013-058). A total of 204 subjects were assigned to receive one of two sodium picosulfate regimens ( i.e ., fixed-time split or split) prior to colonoscopy. Main outcome measurements were bowel preparation quality and subject tolerability. There was no statistical difference between the fixed-time split dose regimen group and the split dose regimen group (Ottawa score mean 2.57 ± 1.91 vs 2.80 ± 2.51, P = 0.457). Cecal intubation time and physician's satisfaction of inspection were not significantly different between the two groups ( P = 0.428, P = 0.489). On subgroup analysis, for afternoon procedures, the fixed-time split dose regimen was equally effective as compared with the split dose regimen (Ottawa score mean 2.56 ± 1.78 vs 2.59 ± 2.27, P = 0.932). There was no difference in tolerability or compliance between the two groups. Nausea was 21.2% in the fixed-time split dose group and 14.3% in the split dose group ( P = 0.136). Vomiting was 7.1% and 2.9% ( P = 0.164), abdominal discomfort 7.1% and 4.8% ( P = 0.484), dizziness 1% and 4.8% ( P = 0.113), cold sweating 1% and 0% ( P = 0.302) and palpitation 0% and 1% ( P = 0.330), respectively. Sleep disturbance was two (2%) patients in the fixed-time split dose group and zero (0%) patient in the split dose preparation ( P = 0.143) group. A fixed-time split dose regimen with sodium picosulfate is not inferior to a split dose regimen for bowel preparation and equally effective for afternoon colonoscopy.

  5. The Regularity of Functions on Dual Split Quaternions in Clifford Analysis

    Directory of Open Access Journals (Sweden)

    Ji Eun Kim

    2014-01-01

    Full Text Available This paper shows some properties of dual split quaternion numbers and expressions of power series in dual split quaternions and provides differential operators in dual split quaternions and a dual split regular function on Ω⊂ℂ2×ℂ2 that has a dual split Cauchy-Riemann system in dual split quaternions.

  6. Crystallization and preliminary X-ray crystallographic analysis of dihydrouridine synthase from Thermus thermophilus and its complex with tRNA

    International Nuclear Information System (INIS)

    Yu, Futao; Tanaka, Yoshikazu; Yamamoto, Shiho; Nakamura, Akiyoshi; Kita, Shunsuke; Hirano, Nagisa; Tanaka, Isao; Yao, Min

    2011-01-01

    Crystals of dihydrouridine synthase from Thermus thermophilus and its complex with tRNA were obtained and X-ray diffraction data were collected to 1.70 and 3.51 Å resolution, respectively. Dihydrouridine synthase (Dus) is responsible for catalyzing dihydrouridine formation in RNA by the reduction of uridine. To elucidate its RNA-recognition mechanism, Dus from Thermus thermophilus (TthDus) and its complex with tRNA were crystallized. Diffraction data sets were collected from crystals of native and selenomethionine-substituted TthDus to resolutions of 1.70 and 2.30 Å, respectively. These crystals belonged to space group P1. Preliminary X-ray crystallographic analysis showed that two molecules of TthDus were contained in an asymmetric unit. In addition, diffraction data were collected to 3.51 Å resolution from a crystal of selenomethionine-substituted TthDus in complex with tRNA, which belonged to space group P4 1 2 1 2. Preliminary structural analysis showed that the asymmetric unit contained two TthDus–tRNA complexes

  7. Splitting of the weak hypercharge quantum

    International Nuclear Information System (INIS)

    Nielsen, H.B.; Brene, N.

    1990-12-01

    The ratio between the weak hypercharge quantum for particles having no coupling to the gauge bosons corresponding to the semisimple component of the gauge group and the smallest hypercharge quantum for particles that do have such couplings is exceptionally large for the standard model, considering its rank. To compare groups with respect to this property we propose a quantity χ which depends on the rank of the group and the splitting ratio of the hypercharge(s) to be found in the group. The quantity χ has maximal value for the gauge group of the standard model. This suggest that the hypercharge splitting may play an important role either in the origin of the gauge symmetry at a fundamental scale or in some kind of selection mechanism at a scale perhaps nearer to the experimental scale. Such selection mechanism might be what we have called confusion which removes groups with many (so called generalized) automorphisms. The quantity χ tends to be large for groups with few generalized automorphisms. (orig.)

  8. Strong CP, flavor, and twisted split fermions

    International Nuclear Information System (INIS)

    Harnik, Roni; Perez, Gilad; Schwartz, Matthew D.; Shirman, Yuri

    2005-01-01

    We present a natural solution to the strong CP problem in the context of split fermions. By assuming CP is spontaneously broken in the bulk, a weak CKM phase is created in the standard model due to a twisting in flavor space of the bulk fermion wavefunctions. But the strong CP phase remains zero, being essentially protected by parity in the bulk and CP on the branes. As always in models of spontaneous CP breaking, radiative corrections to theta bar from the standard model are tiny, but even higher dimension operators are not that dangerous. The twisting phenomenon was recently shown to be generic, and not to interfere with the way that split fermions naturally weaves small numbers into the standard model. It follows that out approach to strong CP is compatible with flavor, and we sketch a comprehensive model. We also look at deconstructed version of this setup which provides a viable 4D model of spontaneous CP breaking which is not in the Nelson-Barr class. (author)

  9. An Iterative Algorithm for the Split Equality and Multiple-Sets Split Equality Problem

    Directory of Open Access Journals (Sweden)

    Luoyi Shi

    2014-01-01

    Full Text Available The multiple-sets split equality problem (MSSEP requires finding a point x∈∩i=1NCi, y∈∩j=1MQj such that Ax=By, where N and M are positive integers, {C1,C2,…,CN} and {Q1,Q2,…,QM} are closed convex subsets of Hilbert spaces H1, H2, respectively, and A:H1→H3, B:H2→H3 are two bounded linear operators. When N=M=1, the MSSEP is called the split equality problem (SEP. If  B=I, then the MSSEP and SEP reduce to the well-known multiple-sets split feasibility problem (MSSFP and split feasibility problem (SFP, respectively. One of the purposes of this paper is to introduce an iterative algorithm to solve the SEP and MSSEP in the framework of infinite-dimensional Hilbert spaces under some more mild conditions for the iterative coefficient.

  10. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura.

    Science.gov (United States)

    Tang, Bo-Ping; Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin; Liu, Qiu-Ning

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata.

  11. Proteomic interrogation of androgen action in prostate cancer cells reveals roles of aminoacyl tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Adaikkalam Vellaichamy

    2009-09-01

    Full Text Available Prostate cancer remains the most common malignancy among men in United States, and there is no remedy currently available for the advanced stage hormone-refractory cancer. This is partly due to the incomplete understanding of androgen-regulated proteins and their encoded functions. Whole-cell proteomes of androgen-starved and androgen-treated LNCaP cells were analyzed by semi-quantitative MudPIT ESI- ion trap MS/MS and quantitative iTRAQ MALDI- TOF MS/MS platforms, with identification of more than 1300 high-confidence proteins. An enrichment-based pathway mapping of the androgen-regulated proteomic data sets revealed a significant dysregulation of aminoacyl tRNA synthetases, indicating an increase in protein biosynthesis- a hallmark during prostate cancer progression. This observation is supported by immunoblot and transcript data from LNCaP cells, and prostate cancer tissue. Thus, data derived from multiple proteomics platforms and transcript data coupled with informatics analysis provides a deeper insight into the functional consequences of androgen action in prostate cancer.

  12. Formylation of initiator tRNA methionine in procaryotic protein synthesis: in vivo polarity in lactose operon expression.

    Science.gov (United States)

    Petersen, H U; Joseph, E; Ullmann, A; Danchin, A

    1978-01-01

    Eucaryotic and procaryotic organisms differ in two aspects of their translation machinery: polycistronic messengers are expressed as a sequence of individual proteins only in procaryotes, and the initiation of protein synthesis proceeds with an initiator tRNA which is found to be modified (formylated) in procaryotes and not in eucaryotes. In the present study, we show that formylation is required in vivo for the coordinate expression of the Escherichia coli lactose operon. Our experiments are consistent with a translation mechanism using dissociated ribosomes at the 5' end of the mRNA in a reaction that is only weakly dependent on formylation at this initiation step; the ribosomes then travel along the messenger and can reinitiate after the intracistronic barrier without dissociation. This latter initiation step is strongly dependent on the level of formylation: a low level of the formyl group, obtained by the antifolic agent trimethoprim, induces a strong polarity in the expression of the lactose operon. There exist mutant strains in which this polarity is much less apparent than in the wild type. We show here that such is the case of rpsL mutants. Ribosomes mutated in the S12 protein (rpsL) are found to be much more easily dissociated than the wild type. This might explain why the expression of the lactose operon on rpsL strains remains coordinated when the intracellular level of formylation is decreased. PMID:98518

  13. Evolutionary Limitation and Opportunities for Developing tRNA Synthetase Inhibitors with 5-Binding-Mode Classification

    Directory of Open Access Journals (Sweden)

    Pengfei Fang

    2015-12-01

    Full Text Available Aminoacyl-tRNA synthetases (aaRSs are enzymes that catalyze the transfer of amino acids to their cognate tRNAs as building blocks for translation. Each of the aaRS families plays a pivotal role in protein biosynthesis and is indispensable for cell growth and survival. In addition, aaRSs in higher species have evolved important non-translational functions. These translational and non-translational functions of aaRS are attractive for developing antibacterial, antifungal, and antiparasitic agents and for treating other human diseases. The interplay between amino acids, tRNA, ATP, EF-Tu and non-canonical binding partners, had shaped each family with distinct pattern of key sites for regulation, with characters varying among species across the path of evolution. These sporadic variations in the aaRSs offer great opportunity to target these essential enzymes for therapy. Up to this day, growing numbers of aaRS inhibitors have been discovered and developed. Here, we summarize the latest developments and structural studies of aaRS inhibitors, and classify them with distinct binding modes into five categories.

  14. Binding interactions between yeast tRNA ligase and a precursor transfer ribonucleic acid containing two photoreactive uridine analogues

    International Nuclear Information System (INIS)

    Tanner, N.K.; Hanna, M.M.; Abelson, J.

    1988-01-01

    Yeast tRNA ligase, from Saccharomyces cerevisiae, is one of the protein components that is involved in the splicing reaction of intron-containing yeast precursor tRNAs. It is an unusual protein because it has three distinct catalytic activities. It functions as a polynucleotide kinase, as a cyclic phosphodiesterase, and as an RNA ligase. We have studied the binding interactions between ligase and precursor tRNAs containing two photoreactive uridine analogues, 4-thiouridine and 5-bromouridine. When irradiated with long ultraviolet light, RNA containing these analogues can form specific covalent bonds with associated proteins. In this paper, we show that 4-thiouridine triphosphate and 5-bromouridine triphosphate were readily incorporated into a precursor tRNA(Phe) that was synthesized, in vitro, with bacteriophage T7 RNA polymerase. The analogue-containing precursor tRNAs were authentic substrates for the two splicing enzymes that were tested (endonuclease and ligase), and they formed specific covalent bonds with ligase when they were irradiated with long-wavelength ultraviolet light. We have determined the position of three major cross-links and one minor cross-link on precursor tRNA(Phe) that were located within the intron and near the 3' splice site. On the basis of these data, we present a model for the in vivo splicing reaction of yeast precursor tRNAs

  15. CARACTERIZACIÓN DEL TALLO ACEPTOR DEL tRNA MEDIANTE DESCRIPTORES LOCALES BASADOS EN CARGAS PARCIALES

    Directory of Open Access Journals (Sweden)

    Ray Marín

    2009-04-01

    Full Text Available En este trabajo se caracteriza la distribución de carga del tallo aceptor del tRNA, considerando todas las posibles combinaciones de pares Watson-Crick. El estudio se realizó con 256 fragmentos moleculares de 10 nucleótidos que modelan los tres primeros pares del tallo aceptor, la base diferenciadora y el extremo CCA. Para caracterizar los nucleótidos se proponen dos descriptores locales basados en la distribución de carga de las base nitrogenada de cada nucleótido, los cuales se calculan a partir de las cargas parciales de Mulliken obtenidas de cálculos HF/6-31G. La caracterización y clasificación de los tallos según estos descriptores mostró como la base diferenciadora tiene un comportamiento particular respecto a los demás nucleótidos del tallo y una fuerte influencia sobre el extremo CCA. La clasificación de nueve variaciones del tallo aceptor del tRNAAla mostró una buena relación estructura-actividad que pone en evidencia la bondad de los descriptores propuestos para caracterizar de manera local la distribución de carga de estas biomoléculas. 

  16. Electrocatalytic water splitting to produce fuel hydrogen

    Science.gov (United States)

    Yuan, Hao

    Solar energy is regarded as a promising source for clean and sustainable energy. However, it is not a continuous energy source, thus certain strategies have to be developed to effectively convert and store it. Solar-driven electrocatalytic water splitting, which converts solar energy into chemical energy for storage as fuel hydrogen, can effectively mitigate the intermittence of solar radiation. Water splitting consists of two half reactions: water oxidation and hydrogen evolution. Both reactions rely on highly effective electrocatalysts. This dissertation is an account of four detailed studies on developing highly effective low-cost electrocatalysts for both reactions, and includes a preliminary attempt at system integration to build a functional photoanode for solar-driven water oxidation. For the water oxidation reaction, we have developed an electrochemical method to immobilize a cobalt-based (Co-OXO) water oxidation catalyst on a conductive surface to promote recyclability and reusability without affecting functionality. We have also developed a method to synthesize a manganese-based (MnOx) catalytic film in situ, generating a nanoscale fibrous morphology that provides steady and excellent water oxidation performance. The new method involves two series of cyclic voltammetry (CV) over different potential ranges, followed by calcination to increase crystallinity. The research has the potential to open avenues for synthesizing and optimizing other manganese-based water oxidation catalysts. For the hydrogen evolution reaction, we have developed a new electrodeposition method to synthesize Ni/Ni(OH)2 catalysts in situ on conductive surfaces. The new method involves only two cycles of CV over a single potential range. The resulting catalytic film has a morphology of packed walnut-shaped particles. It has superior catalytic activity and good stability over long periods. We have investigated the feasibility of incorporating manganese-based water oxidation catalysts

  17. The impact of payment splitting on liquidity requirements in RTGS

    OpenAIRE

    Denbee, Edward; Norman, Ben

    2010-01-01

    This paper examines the impact that payment splitting could have upon the liquidity requirements and efficiency of a large-value payment system, such as the United Kingdom’s CHAPS. Using the Bank of Finland Payment and Settlement Simulator and real UK payments data we find that payment splitting could reduce the liquidity required to settle payments. The reduction in required liquidity would increase as the payment splitting threshold decreased but the relationship is non-linear. Liquidity sa...

  18. Splitting methods in communication, imaging, science, and engineering

    CERN Document Server

    Osher, Stanley; Yin, Wotao

    2016-01-01

    This book is about computational methods based on operator splitting. It consists of twenty-three chapters written by recognized splitting method contributors and practitioners, and covers a vast spectrum of topics and application areas, including computational mechanics, computational physics, image processing, wireless communication, nonlinear optics, and finance. Therefore, the book presents very versatile aspects of splitting methods and their applications, motivating the cross-fertilization of ideas. .

  19. A Power System Network Splitting Strategy Based on Contingency Analysis

    Directory of Open Access Journals (Sweden)

    Nur Zawani Saharuddin

    2018-02-01

    Full Text Available This paper proposes a network splitting strategy following critical line outages based on N-1 contingency analysis. Network splitting is the best option for certain critical outages when the tendency of severe cascading failures is very high. Network splitting is executed by splitting the power system network into feasible set of islands. Thus, it is essential to identify the optimal splitting solution (in terms of minimal power flow disruption that satisfies certain constraints. This paper determines the optimal splitting solution for each of the critical line outage using discrete evolutionary programming (DEP optimization technique assisted by heuristic initialization approach. Heuristic initialization provides the best initial cutsets which will guide the optimization technique to find the optimal splitting solution. Generation–load balance and transmission line overloading analysis are carried out in each island to ensure the steady state stability is achieved. Load shedding scheme is initiated if the power balance criterion is violated in any island to sustain the generation–load balance. The proposed technique is validated on the IEEE 118 bus system. Results show that the proposed approach produces an optimal splitting solution with lower power flow disruption during network splitting execution.

  20. Split-plot designs for multistage experimentation

    DEFF Research Database (Denmark)

    Kulahci, Murat; Tyssedal, John

    2016-01-01

    Most of today’s complex systems and processes involve several stages through which input or the raw material has to go before the final product is obtained. Also in many cases factors at different stages interact. Therefore, a holistic approach for experimentation that considers all stages...... on the Kronecker product representation of orthogonal designs and can be used for any number of stages, for various numbers of subplots and for different number of subplots for each stage. The procedure is demonstrated on both regular and nonregular designs and provides the maximum number of factors that can...... be accommodated in each stage. Furthermore, split-plot designs for multistage experiments with good projective properties are also provided....

  1. A Frequency Splitting Method For CFM Imaging

    DEFF Research Database (Denmark)

    Udesen, Jesper; Gran, Fredrik; Jensen, Jørgen Arendt

    2006-01-01

    The performance of conventional CFM imaging will often be degraded due to the relatively low number of pulses (4-10) used for each velocity estimate. To circumvent this problem we propose a new method using frequency splitting (FS). The FS method uses broad band chirps as excitation pulses instead...... of narrow band pulses as in conventional CFM imaging. By appropriate filtration, the returned signals are divided into a number of narrow band signals which are approximately disjoint. After clutter filtering the velocities are found from each frequency band using a conventional autocorrelation estimator....... Finally the velocity estimates from each frequency band are averaged to obtain an improved velocity estimate. The FS method has been evaluated in simulations using the Field II program and in flow phantom experiments using the experimental ultrasound scanner RASMUS. In both simulations and experiments...

  2. Molecular concepts of water splitting. Nature's approach

    International Nuclear Information System (INIS)

    Cox, Nicholas; Lubitz, Wolfgang

    2013-01-01

    Based on studies of natural systems, much has also been learned concerning the design principles required for biomimetic catalysis of water splitting and hydrogen evolution. In summary, these include use of abundant and inexpensive metals, the effective protection of the active sites in functional environments, repair/replacement of active components in case of damage, and the optimization of reaction rates. Biomimetic chemistry aims to mimic all these features; many labs are working toward this goal by developing new approaches in the design and synthesis of such systems, encompassing not only the catalytic center, but also smart matrices and assembly via self-organization. More stable catalysts that do not require self-repair may be obtained from fully artificial (inorganic) catalytic systems that are totally different from the biological ones and only apply some basic principles learned from nature. Metals other than Mn/Ca, Fe, and Ni could be used (e.g. Co) in new ligand spheres and other matrices. For light harvesting, charge separation/stabilization, and the effective coupling of the oxidizing/reducing equivalents to the redox catalysts, different methods have been proposed - for example, covalently linked molecular donor-acceptor systems, photo-voltaic devices, semiconductor-based systems, and photoactive metal complexes. The aim of all these approaches is to develop catalytic systems that split water with sunlight into hydrogen and oxygen while displaying high efficiency and long-term stability. Such a system - either biological, biomimetic, or bioinspired - has the potential to be used on a large scale to produce 'solar fuels' (e.g. hydrogen or secondary products thereof). (orig.)

  3. Structural characterization of antibiotic self-immunity tRNA synthetase in plant tumour biocontrol agent.

    Science.gov (United States)

    Chopra, Shaileja; Palencia, Andrés; Virus, Cornelia; Schulwitz, Sarah; Temple, Brenda R; Cusack, Stephen; Reader, John

    2016-10-07

    Antibiotic-producing microbes evolved self-resistance mechanisms to avoid suicide. The biocontrol Agrobacterium radiobacter K84 secretes the Trojan Horse antibiotic agrocin 84 that is selectively transported into the plant pathogen A. tumefaciens and processed into the toxin TM84. We previously showed that TM84 employs a unique tRNA-dependent mechanism to inhibit leucyl-tRNA synthetase (LeuRS), while the TM84-producer prevents self-poisoning by expressing a resistant LeuRS AgnB2. We now identify a mechanism by which the antibiotic-producing microbe resists its own toxin. Using a combination of structural, biochemical and biophysical approaches, we show that AgnB2 evolved structural changes so as to resist the antibiotic by eliminating the tRNA-dependence of TM84 binding. Mutagenesis of key resistance determinants results in mutants adopting an antibiotic-sensitive phenotype. This study illuminates the evolution of resistance in self-immunity genes and provides mechanistic insights into a fascinating tRNA-dependent antibiotic with applications for the development of anti-infectives and the prevention of biocontrol emasculation.

  4. Interactions between co-expressed Arabidopsis sucrose transporters in the split-ubiquitin system

    Directory of Open Access Journals (Sweden)

    Lalonde Sylvie

    2003-03-01

    Full Text Available Abstract Background The Arabidopsis genome contains nine sucrose transporter paralogs falling into three clades: SUT1-like, SUT2 and SUT4. The carriers differ in their kinetic properties. Many transport proteins are known to exist as oligomers. The yeast-based split ubiquitin system can be used to analyze the ability of membrane proteins to interact. Results Promoter-GUS fusions were used to analyze the cellular expression of the three transporter genes in transgenic Arabidopsis plants. All three fusion genes are co-expressed in companion cells. Protein-protein interactions between Arabidopsis sucrose transporters were tested using the split ubiquitin system. Three paralogous sucrose transporters are capable of interacting as either homo- or heteromers. The interactions are specific, since a potassium channel and a glucose transporter did not show interaction with sucrose transporters. Also the biosynthetic and metabolizing enzymes, sucrose phosphate phosphatase and sucrose synthase, which were found to be at least in part bound to the plasma membrane, did not specifically interact with sucrose transporters. Conclusions The split-ubiquitin system provides a powerful tool to detect potential interactions between plant membrane proteins by heterologous expression in yeast, and can be used to screen for interactions with membrane proteins as baits. Like other membrane proteins, the Arabidopsis sucrose transporters are able to form oligomers. The biochemical approaches are required to confirm the in planta interaction.

  5. Towards Highly Efficient Bias-Free Solar Water Splitting

    NARCIS (Netherlands)

    Abdi, F.F.

    2013-01-01

    Solar water splitting has attracted significant attention due to its potential of converting solar to chemical energy. It uses semiconductor to convert sunlight into electron-hole pairs, which then split water into hydrogen and oxygen. The hydrogen can be used as a renewable fuel, or it can serve as

  6. 77 FR 8127 - Foreign Tax Credit Splitting Events

    Science.gov (United States)

    2012-02-14

    ... Tax Credit Splitting Events AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Final and... affect taxpayers claiming foreign tax credits. The text of the temporary regulations also serves as the... that if there is a foreign tax credit splitting event with respect to a foreign income tax paid or...

  7. 77 FR 8184 - Foreign Tax Credit Splitting Events

    Science.gov (United States)

    2012-02-14

    ... Foreign Tax Credit Splitting Events AGENCY: Internal Revenue Service (IRS), Treasury. ACTION: Notice of... these proposed regulations. The regulations affect taxpayers claiming foreign tax credits. Special... of the Federal Register.] Sec. 1.909-6 Pre-2011 foreign tax credit splitting events. [The text of...

  8. Clonal differences in log end splitting in Eucalyptus grandis in ...

    African Journals Online (AJOL)

    This paper discusses the juvenile–mature correlation of log end splitting among Eucalyptus grandis clones from two trials and how differences in splitting relate to differences in wood density, pith-to-bark gradient and growth rate. Two approximately 20-year-old Eucalyptus grandis clonal trials at Bergvliet plantation were ...

  9. April / May 2006. 108 Harvesting split thickness skin in

    African Journals Online (AJOL)

    user

    Background: In the third world countries like Ethiopia the majority of Hospitals have difficulties in harvesting split thickness skin ... The grafts were well taken by the recipient areas and technically there was no danger of deep bite. Conclusion: Split ... to meet the hospital needs. Thus we need to improvise and use appropriate.

  10. Pulse splitting in nonlinear media with anisotropic dispersion properties

    DEFF Research Database (Denmark)

    Bergé, L.; Juul Rasmussen, J.; Schmidt, M.R.

    1998-01-01

    to a singularity in the transverse plane. Instead, the pulse spreads out along the direction of negative dispersion and splits up into small-scale cells, which may undergo further splitting events. The analytical results are supported by direct numerical solutions of the three dimensional cubic Schrodinger...

  11. Split-liver transplantation : An underused resource in liver transplantation

    NARCIS (Netherlands)

    Rogiers, Xavier; Sieders, Egbert

    2008-01-01

    Split-liver transplantation is an efficient tool to increase the number of liver grafts available for transplantation. More than 15 years after its introduction only the classical splitting technique has reached broad application. Consequently children are benefiting most from this possibility.

  12. Plasmonic nanoparticle-semiconductor composites for efficient solar water splitting

    NARCIS (Netherlands)

    Valenti, M.; Jonsson, M.P.; Biskos, G.; Schmidt-Ott, A.; Smith, W.A.

    2016-01-01

    Photoelectrochemical (PEC) water splitting is a promising technology that uses light absorbing semiconductors to convert solar energy directly into a chemical fuel (i.e., hydrogen). PEC water splitting has the potential to become a key technology in achieving a sustainable society, if high solar

  13. Enhanced residual mean circulation during the evolution of split type ...

    Indian Academy of Sciences (India)

    8

    keywords: split events, stratospheric sudden warming, residual mean circulation. 1 Introduction ... sudden warming. It is characterized by a rapid cooling of the polar cap tempera- ture (Kuroda, 2008). The competition between planetary waves and gravity waves to the residual .... any automated scheme. The split events ...

  14. Recent developments in solar H 2 generation from water splitting

    Indian Academy of Sciences (India)

    Assistance of metal nanostructures and quantum dots to semiconductors attains vital importance as they are exuberant visible light harvesters and charge carrier amplifiers. Benevolent use of quantum dots in solar water splitting and photoelectrochemical water splitting provides scope to revolutionize the quantum efficiency ...

  15. 7 CFR 51.2753 - U.S. Virginia Splits.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false U.S. Virginia Splits. 51.2753 Section 51.2753... STANDARDS) United States Standards for Shelled Virginia Type Peanuts Grades § 51.2753 U.S. Virginia Splits. “U.S. Virginia Splits” consists of shelled Virginia type peanut kernels of similar varietal...

  16. Linear expansion of products out of thermal splitting graphite

    International Nuclear Information System (INIS)

    Tishina, E.A.; Kurnevich, G.I.

    1994-01-01

    Linear expansion of thermally split graphite in the form of foil and pressed items of different density was studied. It is ascertained that the extreme character of temperature dependence of linear expansion factor of pressed samples of thermally split graphite is determined by the formation of closed pores containing air in the course of their production. 3 refs., 2 figs

  17. Evaluation of Certain Pharmaceutical Quality Attributes of Lisinopril Split Tablets

    Directory of Open Access Journals (Sweden)

    Khairi M. S. Fahelelbom

    2016-10-01

    Full Text Available Tablet splitting is an accepted practice for the administration of drugs for a variety of reasons, including dose adjustment, ease of swallowing and cost savings. The purpose of this study was to evaluate the physical properties of lisinopril tablets as a result of splitting the tablets either by hand or with a splitting device. The impact of the splitting technique of lisinopril (Zestril® tablets, 20 mg on certain physical parameters such as weight variation, friability, disintegration, dissolution and drug content were studied. Splitting the tablets either by hand or with a splitter resulted in a minute but statistically significant average weight loss of <0.25% of the tablet to the surrounding environment. The variability in the weight of the hand-split tablet halves was more pronounced (37 out of 40 tablet halves varied by more than 10% from the mean weight than when using the tablet splitter (3 out of 40 tablet halves. The dissolution and drug content of the hand-split tablets were therefore affected because of weight differences. However, the pharmacopoeia requirements for friability and disintegration time were met. Hand splitting of tablets can result in an inaccurate dose and may present clinical safety issues, especially for drugs with a narrow therapeutic window in which large fluctuations in drug concentrations are undesirable. It is recommended to use tablets with the exact desired dose, but if this is not an option, then a tablet splitter could be used.

  18. Photocatalytic Water-Splitting Reaction from Catalytic and Kinetic Perspectives

    KAUST Repository

    Hisatomi, Takashi

    2014-10-16

    Abstract: Some particulate semiconductors loaded with nanoparticulate catalysts exhibit photocatalytic activity for the water-splitting reaction. The photocatalysis is distinct from the thermal catalysis because photocatalysis involves photophysical processes in particulate semiconductors. This review article presents a brief introduction to photocatalysis, followed by kinetic aspects of the photocatalytic water-splitting reaction.Graphical Abstract: [Figure not available: see fulltext.

  19. Physical mapping of the split hand/split foot (SHSF) locus on chromosome 7 reveals a relationship between SHSF and the syndromic ectrodactylies

    Energy Technology Data Exchange (ETDEWEB)

    Poorkaj, P.; Nunes, M.E.; Geshuri, D. [Univ. of Washington, Seattle, WA (United States)] [and others

    1994-09-01

    Split hand/split foot (also knows as ectrodactyly) is a human developmental malformation characterized by missing digits and claw-like extremities. An autosomal dominant form of this disorder has been mapped to 7q21.3-q22.1 on the basis of SHSF-associated chromosomal rearrangements: this locus has been designated SHFD1. We have constructed a physical map of the SHFD1 region that consists of contiguous yeast artificial chromosome clones and spans approximately 8 Mb. Somatic cell hybrid and fluorescent in situ hybridization analyses were used to define SHSF-associated chromosomal breakpoints in fourteen patients. A critical interval of about 1 Mb was established for SHFD1 by analysis of six patients with deletions. Translocation and inversion breakpoints in seven other patients were found to localize within a 500-700 kb interval within the critical region. Several candidate genes including DLX5 and DLX6 (members of the Drosophilia Distal-less homeobox-containing gene family) localize to this region. At least four of these genes are expressed in the developing mouse limb bud. Of particular interest is the observation that 8 of the 14 patients studied have syndromic ectrodactyly, which is characterized by the association of SHSF with a variety of other anomalies including cleft lip/palate, ectodermal dysplasia, and renal anomalies. Thus, these data implicate a single gene or cluster of genes at the SHFD1 locus in a wide range of developmental processes and serve to establish a molecular genetic relationship between simple SHSF and a broad group of human birth defects.

  20. Nonlinear Fracture Mechanics and Plasticity of the Split Cylinder Test

    DEFF Research Database (Denmark)

    Olesen, John Forbes; Østergaard, Lennart; Stang, Henrik

    2006-01-01

    The split cylinder testis subjected to an analysis combining nonlinear fracture mechanics and plasticity. The fictitious crack model is applied for the analysis of splitting tensile fracture, and the Mohr-Coulomb yield criterion is adopted for modelling the compressive crushing/sliding failure. Two...... demonstrates the influence of varying geometry or constitutive properties. For a split cylinder test in load control it is shown how the ultimate load is either plasticity dominated or fracture mechanics dominated. The transition between the two modes is related to changes in geometry or constitutive...... properties. This implies that the linear elastic interpretation of the ultimate splitting force in term of the uniaxial tensile strength of the material is only valid for special situations, e.g. for very large cylinders. Furthermore, the numerical analysis suggests that the split cylinder test is not well...

  1. Optimizing TCP Performance over UMTS with Split TCP Proxy

    DEFF Research Database (Denmark)

    Hu, Liang; Dittmann, Lars

    2009-01-01

    . To cope with large delay bandwidth product, we propose a novel concept of split TCP proxy which is placed at GGSN between UNITS network and Internet. The split proxy divides the bandwidth delay product into two parts, resulting in two TCP connections with smaller bandwidth delay products which can...... be pipelined and thus operating at higher speeds. Simulation results show, the split TCP proxy can significantly improve the TCP performance in terms of RLC throughput under high bit rate DCH channel scenario (e.g.256 kbps). On the other hand, it only brings small performance improvement under low bit rate DCH...... scenario (e.g.64 kbps). Besides, the split TCP proxy brings more performance gain for downloading large files than downloading small ones. To the end, for the configuration of the split proxy, an aggressive initial TCP congestion window size (e.g. 10 MSS) at proxy is particularly useful for radio links...

  2. Photoelectrochemical solar water splitting: From basic principles to advanced devices

    Directory of Open Access Journals (Sweden)

    Bandar Y.Alfaifi

    2018-02-01

    Full Text Available Photoelectrochemical water splitting (PEC offers a promising path for sustainable generation of hydrogen fuel. However, improving solar fuel water splitting efficiency facing tremendous challenges, due to the energy loss related to fast recombination of the photogenerated charge carriers, electrode degradation, as well as limited light harvesting. This review focuses on the brief introduction of basic fundamental of PEC water splitting and the concept of various types of water splitting approaches. Numerous engineering strategies for the investgating of the higher efficiency of the PEC, including charge separation, light harvesting, and co-catalysts doping, have been discussed. Moreover, recent remarkable progress and developments for PEC water splitting with some promising materials are discussed. Recent advanced applications of PEC are also reviewed. Finally, the review concludes with a summary and future outlook of this hot field.

  3. Localization of tRNAsup(asp)2 genes from Drosophila melanogaster by 'in situ' hybridization

    International Nuclear Information System (INIS)

    Schmidt, T.; Egg, A.H.; Kubli, E.

    1978-01-01

    Transfer RNAsup(asp) 2 delta was isolated from Drosophila melanogaster by affinity chromatography on concanavalin A-Sepharose. The tRNA was iodinated 'in vitro' with Na[ 125 I] and hybridized 'in situ' to salivary gland chromosomes from Drosophila. Subsequent autoradiography allowed the localization of the genes for tRNAsup(asp) 2 delta to the left arm of the second chromosome in the regions 29 D and E. (orig.) [de

  4. Field-Split Preconditioned Inexact Newton Algorithms

    KAUST Repository

    Liu, Lulu

    2015-06-02

    The multiplicative Schwarz preconditioned inexact Newton (MSPIN) algorithm is presented as a complement to additive Schwarz preconditioned inexact Newton (ASPIN). At an algebraic level, ASPIN and MSPIN are variants of the same strategy to improve the convergence of systems with unbalanced nonlinearities; however, they have natural complementarity in practice. MSPIN is naturally based on partitioning of degrees of freedom in a nonlinear PDE system by field type rather than by subdomain, where a modest factor of concurrency can be sacrificed for physically motivated convergence robustness. ASPIN, originally introduced for decompositions into subdomains, is natural for high concurrency and reduction of global synchronization. We consider both types of inexact Newton algorithms in the field-split context, and we augment the classical convergence theory of ASPIN for the multiplicative case. Numerical experiments show that MSPIN can be significantly more robust than Newton methods based on global linearizations, and that MSPIN can be more robust than ASPIN and maintain fast convergence even for challenging problems, such as high Reynolds number Navier--Stokes equations.

  5. Split-Field Magnet facility upgraded

    CERN Multimedia

    CERN PhotoLab

    1977-01-01

    The Split Field Magnet (SFM) was the largest spectrometer for particles from beam-beam collisions in the ISR. It could determine particle momenta in a large solid angle, but was designed mainly for the analysis of forward travelling particles.As the magnet was working on the ISR circulating beams, its magnetic field had to be such as to restore the correct proton orbit.The SFM, therefore, produced zero field at the crossing point and fields of opposite signs upstream and downstream of it and was completed by 2 large and 2 small compensator magnets. The gradient effects were corrected by magnetic channels equipped with movable flaps. The useful magnetic field volume was 28 m3, the induction in the median plane 1.14 T, the gap heigth 1.1 m, the length 10.5 m, the weight about 1000 ton. Concerning the detectors, the SFM was the first massive application of multiwire proportional chambers (about 70000 wires) which filled the main and the large compensator magnets. In 1976 an improved programme was started with tw...

  6. MD SIMULATION STUDIES TO INVESTIGATE ISO-ENERGETIC CONFORMATIONAL BEHAVIOUR OF MODIFIED NUCLEOSIDES M2G AND M22G PRESENT IN tRNA

    Directory of Open Access Journals (Sweden)

    Rohit S Bavi

    2013-02-01

    Full Text Available Modified nucleic acid bases are most commonly found in tRNA. These may contain modifications from simple methylation to addition of bulky groups. Methylation of the four canonical nucleotide bases at a wide variety of positions is particularly prominent among the known modification. Methylation of N2 group of guanine is a relatively common modification in tRNA and rRNA. N2-methylguanosine (m2G is the second most often encountered nucleoside in E. coli tRNAs. N2, N2-dimethylguanosine (m22G is found in the majority of eukaryotic tRNAs and involved in forming base pair interactions with adjacent bases. Hence, in order to understand the structural significance of these methylated nucleic acid bases we have carried out molecular dynamics simulation to see the salvation effect. The results obtained shows iso-energetic conformational behaviors for m2G and m22G. The simulation trajectory of m2G shows regular periodical fluctuations suggesting that m2G is equally stable as either s-cis or s-trans rotamers. The two rotamers of m2G may interact canonically or non-canonically with opposite base as s-trans m2G26:C/A/U44 and s-cis m2G26:A/U44. The free rotations around the C-N bond could be the possible reason for these iso-energetic conformations. Dimethylation of G has almost no influence on base pairing with either A or U. Thus, these results reveal that modified nucleosides m2G and m22G may play an important role to prevent tRNA from adopting the unusual mitochondrial like conformation.

  7. Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

    Science.gov (United States)

    Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

    2017-12-01

    In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  8. Photoswitchable Rabi Splitting in Hybrid Plasmon-Waveguide Modes.

    Science.gov (United States)

    Lin, Linhan; Wang, Mingsong; Wei, Xiaoling; Peng, Xiaolei; Xie, Chong; Zheng, Yuebing

    2016-12-14

    Rabi splitting that arises from strong plasmon-molecule coupling has attracted tremendous interests. However, it has remained elusive to integrate Rabi splitting into the hybrid plasmon-waveguide modes (HPWMs), which have advantages of both subwavelength light confinement of surface plasmons and long-range propagation of guided modes in dielectric waveguides. Herein, we explore a new type of HPWMs based on hybrid systems of Al nanodisk arrays covered by PMMA thin films that are doped with photochromic molecules and demonstrate the photoswitchable Rabi splitting with a maximum splitting energy of 572 meV in the HPWMs by controlling the photoisomerization of the molecules. Through our experimental measurements combined with finite-difference time-domain (FDTD) simulations, we reveal that the photoswitchable Rabi splitting arises from the switchable coupling between the HPWMs and molecular excitons. By harnessing the photoswitchable Rabi splitting, we develop all-optical light modulators and rewritable waveguides. The demonstration of Rabi splitting in the HPWMs will further advance scientific research and device applications of hybrid plasmon-molecule systems.

  9. Gene 5.5 protein of bacteriophage T7 in complex with Escherichia coli nucleoid protein H-NS and transfer RNA masks transfer RNA priming in T7 DNA replication.

    Science.gov (United States)

    Zhu, Bin; Lee, Seung-Joo; Tan, Min; Wang, En-Duo; Richardson, Charles C

    2012-05-22

    DNA primases provide oligoribonucleotides for DNA polymerase to initiate lagging strand synthesis. A deficiency in the primase of bacteriophage T7 to synthesize primers can be overcome by genetic alterations that decrease the expression of T7 gene 5.5, suggesting an alternative mechanism to prime DNA synthesis. The product of gene 5.5 (gp5.5) forms a stable complex with the Escherichia coli histone-like protein H-NS and transfer RNAs (tRNAs). The 3'-terminal sequence (5'-ACCA-3') of tRNAs is identical to that of a functional primer synthesized by T7 primase. Mutations in T7 that suppress the inability of primase reduce the amount of gp5.5 and thus increase the pool of tRNA to serve as primers. Alterations in T7 gene 3 facilitate tRNA priming by reducing its endonuclease activity that cleaves at the tRNA-DNA junction. The tRNA bound to gp5.5 recruits H-NS. H-NS alone inhibits reactions involved in DNA replication, but the binding to gp5.5-tRNA complex abolishes this inhibition.

  10. Wideband metasurface filter based on complementary split-ring resonators

    Science.gov (United States)

    Zhang, Tong; Zhang, Jiameng; Xu, Jianchun; Wang, Qingmin; Zhao, Ruochen; Liu, Hao; Dong, Guoyan; Hao, Yanan; Bi, Ke

    2017-08-01

    A wideband metasurface filter based on complementary split-ring resonators (CSRR) has been prepared. The frequency and transmission bandwidth of the metasurface filters with different split widths are discussed. After analyzing the mechanism of the metasurface, the proposed metasurface filters are fabricated. The electromagnetic properties of the metasurface are measured by a designed test system. The measured results are in good agreement with the simulated ones, which shows that the metasurface filter has a wideband property. As the split width of the CSRR increases, the frequency of the passband shifts to higher frequency regions and the transmission bandwidth decreases.

  11. A splitting algorithm for directional regularization and sparsification

    DEFF Research Database (Denmark)

    Rakêt, Lars Lau; Nielsen, Mads

    2012-01-01

    We present a new split-type algorithm for the minimization of a p-harmonic energy with added data fidelity term. The half-quadratic splitting reduces the original problem to two straightforward problems, that can be minimized efficiently. The minimizers to the two sub-problems can typically...... be computed pointwise and are easily implemented on massively parallel processors. Furthermore the splitting method allows for the computation of solutions to a large number of more advanced directional regularization problems. In particular we are able to handle robust, non-convex data terms, and to define...

  12. Ridge Splitting Technique for Horizontal Augmentation and Immediate Implant Placement

    Directory of Open Access Journals (Sweden)

    Papathanasiou Ioannis

    2014-03-01

    Full Text Available Insufficient width of the alveolar ridge often prevents ideal implant placement. Guided bone regeneration, bone grafting, alveolar ridge splitting and combinations of these techniques are used for the lateral augmentation of the alveolar ridge. Ridge splitting is a minimally invasive technique indicated for alveolar ridges with adequate height, which enables immediate implant placement and eliminates morbidity and overall treatment time. The classical approach of the technique involves splitting the alveolar ridge into 2 parts with use of ostetomes and chisels. Modifications of this technique include the use of rotating instrument, screw spreaders, horizontal spreaders and ultrasonic device.

  13. Market Split based Congestion Management for Networks with Loops

    Science.gov (United States)

    Marmiroli, Marta; Tanimoto, Masahiko; Tsukamoto, Yukitoki; Yokoyama, Ryuichi

    Market splitting is one of the methods to solve the transmission congestion problem associated with the introduction of competitive electricity market and transmission access. Based on the concept of price difference among congested areas, the market splitting approach produces a solution that strongly informs market participants of congestion path. In this paper, an algorithm to solve the market splitting problem for complex networks including loop structures is proposed. The method, based on an algebraic approach, ensures a feasible optimal solution verifiable and easily understandable by the market participants. Complex networks are transformed into simple radial ones using the delta-star approach. The method was tested on large problems to evaluate the performances.

  14. MIP Models and Hybrid Algorithms for Simultaneous Job Splitting and Scheduling on Unrelated Parallel Machines

    Science.gov (United States)

    Ozmutlu, H. Cenk

    2014-01-01

    We developed mixed integer programming (MIP) models and hybrid genetic-local search algorithms for the scheduling problem of unrelated parallel machines with job sequence and machine-dependent setup times and with job splitting property. The first contribution of this paper is to introduce novel algorithms which make splitting and scheduling simultaneously with variable number of subjobs. We proposed simple chromosome structure which is constituted by random key numbers in hybrid genetic-local search algorithm (GAspLA). Random key numbers are used frequently in genetic algorithms, but it creates additional difficulty when hybrid factors in local search are implemented. We developed algorithms that satisfy the adaptation of results of local search into the genetic algorithms with minimum relocation operation of genes' random key numbers. This is the second contribution of the paper. The third contribution of this paper is three developed new MIP models which are making splitting and scheduling simultaneously. The fourth contribution of this paper is implementation of the GAspLAMIP. This implementation let us verify the optimality of GAspLA for the studied combinations. The proposed methods are tested on a set of problems taken from the literature and the results validate the effectiveness of the proposed algorithms. PMID:24977204

  15. MIP models and hybrid algorithms for simultaneous job splitting and scheduling on unrelated parallel machines.

    Science.gov (United States)

    Eroglu, Duygu Yilmaz; Ozmutlu, H Cenk

    2014-01-01

    We developed mixed integer programming (MIP) models and hybrid genetic-local search algorithms for the scheduling problem of unrelated parallel machines with job sequence and machine-dependent setup times and with job splitting property. The first contribution of this paper is to introduce novel algorithms which make splitting and scheduling simultaneously with variable number of subjobs. We proposed simple chromosome structure which is constituted by random key numbers in hybrid genetic-local search algorithm (GAspLA). Random key numbers are used frequently in genetic algorithms, but it creates additional difficulty when hybrid factors in local search are implemented. We developed algorithms that satisfy the adaptation of results of local search into the genetic algorithms with minimum relocation operation of genes' random key numbers. This is the second contribution of the paper. The third contribution of this paper is three developed new MIP models which are making splitting and scheduling simultaneously. The fourth contribution of this paper is implementation of the GAspLAMIP. This implementation let us verify the optimality of GAspLA for the studied combinations. The proposed methods are tested on a set of problems taken from the literature and the results validate the effectiveness of the proposed algorithms.

  16. A Generalized Michaelis-Menten Equation in Protein Synthesis: Effects of Mis-Charged Cognate tRNA and Mis-Reading of Codon.

    Science.gov (United States)

    Dutta, Annwesha; Chowdhury, Debashish

    2017-05-01

    The sequence of amino acid monomers in the primary structure of a protein is decided by the corresponding sequence of codons (triplets of nucleic acid monomers) on the template messenger RNA (mRNA). The polymerization of a protein, by incorporation of the successive amino acid monomers, is carried out by a molecular machine called ribosome. We develop a stochastic kinetic model that captures the possibilities of mis-reading of mRNA codon and prior mis-charging of a tRNA. By a combination of analytical and numerical methods, we obtain the distribution of the times taken for incorporation of the successive amino acids in the growing protein in this mathematical model. The corresponding exact analytical expression for the average rate of elongation of a nascent protein is a 'biologically motivated' generalization of the Michaelis-Menten formula for the average rate of enzymatic reactions. This generalized Michaelis-Menten-like formula (and the exact analytical expressions for a few other quantities) that we report here display the interplay of four different branched pathways corresponding to selection of four different types of tRNA.

  17. A Platform for Discovery and Quantification of Modified Ribonucleosides in RNA: Application to Stress-Induced Reprogramming of tRNA Modifications.

    Science.gov (United States)

    Cai, Weiling Maggie; Chionh, Yok Hian; Hia, Fabian; Gu, Chen; Kellner, Stefanie; McBee, Megan E; Ng, Chee Sheng; Pang, Yan Ling Joy; Prestwich, Erin G; Lim, Kok Seong; Babu, I Ramesh; Begley, Thomas J; Dedon, Peter C

    2015-01-01

    Here we describe an analytical platform for systems-level quantitative analysis of modified ribonucleosides in any RNA species, with a focus on stress-induced reprogramming of tRNA as part of a system of translational control of cell stress response. This chapter emphasizes strategies and caveats for each of the seven steps of the platform workflow: (1) RNA isolation, (2) RNA purification, (3) RNA hydrolysis to individual ribonucleosides, (4) chromatographic resolution of ribonucleosides, (5) identification of the full set of modified ribonucleosides, (6) mass spectrometric quantification of ribonucleosides, (6) interrogation of ribonucleoside datasets, and (7) mapping the location of stress-sensitive modifications in individual tRNA molecules. We have focused on the critical determinants of analytical sensitivity, specificity, precision, and accuracy in an effort to ensure the most biologically meaningful data on mechanisms of translational control of cell stress response. The methods described here should find wide use in virtually any analysis involving RNA modifications. © 2015 Elsevier Inc. All rights reserved.

  18. MTO1 mediates tissue specificity of OXPHOS defects via tRNA modification and translation optimization, which can be bypassed by dietary intervention

    Science.gov (United States)

    Tischner, Christin; Hofer, Annette; Wulff, Veronika; Stepek, Joanna; Dumitru, Iulia; Becker, Lore; Haack, Tobias; Kremer, Laura; Datta, Alexandre N.; Sperl, Wolfgang; Floss, Thomas; Wurst, Wolfgang; Chrzanowska-Lightowlers, Zofia; De Angelis, Martin Hrabe; Klopstock, Thomas; Prokisch, Holger; Wenz, Tina

    2015-01-01

    Mitochondrial diseases often exhibit tissue-specific pathologies, but this phenomenon is poorly understood. Here we present regulation of mitochondrial translation by the Mitochondrial Translation Optimization Factor 1, MTO1, as a novel player in this scenario. We demonstrate that MTO1 mediates tRNA modification and controls mitochondrial translation rate in a highly tissue-specific manner associated with tissue-specific OXPHOS defects. Activation of mitochondrial proteases, aberrant translation products, as well as defects in OXPHOS complex assembly observed in MTO1 deficient mice further imply that MTO1 impacts translation fidelity. In our mouse model, MTO1-related OXPHOS deficiency can be bypassed by feeding a ketogenic diet. This therapeutic intervention is independent of the MTO1-mediated tRNA modification and involves balancing of mitochondrial and cellular secondary stress responses. Our results thereby establish mammalian MTO1 as a novel factor in the tissue-specific regulation of OXPHOS and fine tuning of mitochondrial translation accuracy. PMID:25552653

  19. Shear wave splitting in the Isparta Angle, southwestern Turkey ...

    Indian Academy of Sciences (India)

    broadband station in the Isparta Angle,southwestern Turkey.We selected 21 good quality seismic events out of nearly 357 earthquakes and calculated splitting parameters (polarization direction of fast wave, and delay time between fast and ...

  20. Field Monitoring Protocol. Mini-Split Heat Pumps

    Energy Technology Data Exchange (ETDEWEB)

    Christensen, Dane [National Renewable Energy Lab. (NREL), Golden, CO (United States); Fang, Xia [National Renewable Energy Lab. (NREL), Golden, CO (United States); Tomerlin, Jeff [National Renewable Energy Lab. (NREL), Golden, CO (United States); Winkler, Jon [National Renewable Energy Lab. (NREL), Golden, CO (United States); Hancock, E. [Mountain Energy Partnership, Longmont, CO (United States)

    2011-03-01

    This Building America program report provides a detailed method for accurately measuring and monitoring performance of a residential mini-split heat pump, which will be used in high-performance retrofit applications.

  1. Electrochemical Water-Splitting Based on Hypochlorite Oxidation

    Czech Academy of Sciences Publication Activity Database

    Minhová Macounová, Kateřina; Simic, N.; Ahlberg, E.; Krtil, Petr

    2015-01-01

    Roč. 137, č. 23 (2015), s. 7262-7265 ISSN 0002-7863 Institutional support: RVO:61388955 Keywords : electrochemistry * hypochlorite oxidation * water-splitting Subject RIV: CG - Electrochemistry Impact factor: 13.038, year: 2015

  2. Possibilities of Intermodal Passenger Transport between Split Airport and Islands

    Directory of Open Access Journals (Sweden)

    Slavko Roguljić

    2008-07-01

    Full Text Available A substantial number of passengers landing at Split Airportduring the tourist season continue their journey to the destinationson the central Dalmatian islands. Today the transfer isdone mainly through the ferry port in Split. The insufficient capacitiesof roads from the airport to the city centre which accommodatesthe ferry port and waiting for the embarkation onthe ferries and the transport itself to the islands and the finaldestinations take much longer than the air transport itself toSplit. The paper studies the possible improvements of the existingcondition as well as the construction completion and openingto traffic of the passenger sea port next to Split Airport whichwould provide a much better solution of passenger transfer tothe islands.

  3. Effect of Repeated Food Morsel Splitting on Jaw Muscle Control

    DEFF Research Database (Denmark)

    A, Kumar; Svensson, Krister G; Baad-Hansen, Lene

    2014-01-01

    Mastication is a complex motor task often initiated by splitting of the food morsel between the anterior teeth. Training of complex motor tasks has consistently been shown to trigger neuroplastic changes in corticomotor control and optimization of muscle function. It is not known if training...... and repeated food morsel splitting lead to changes in jaw muscle function. Objective: To investigate if repeated splitting of food morsels in participants with natural dentition changes the force and jaw muscle electromyographic (EMG) activity. Methods: Twenty healthy volunteers (mean age = 26.2 ± 3.9 years......) participated in a single one-hour session divided into six series. Each series consisted of ten trials of a standardized behavioral task (total of 60 trials). The behavioral task was to hold and split a food morsel (8 mm, 180 mg placebo tablet) placed on a bite force transducer with the anterior teeth...

  4. Acoustic Split-Beam Echosounder Data (EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Southeast Fisheries Science Center Mississippi Laboratories collects data using Simrad EK60 scientific split-beam acoustic echosounders during resource...

  5. The homogeneous property and flux splitting in gas dynamics

    Science.gov (United States)

    Lerat, A.

    The homogeneous property of fluxes in gas dynamics is investigated, and its consequences concerning the flux splitting introduced by Steger and Warming (1981) are examined. It is shown that, for any hyperbolic system w sub t + f(w) sub x = 0 which satisfies the homogeneous property, the flux f(w) can be expressed in terms of the eigenvalues and eigenvectors of the matrix A(w) = df(w)/dw. This same result is also found to hold for the split fluxes f(+)(w) and f(-)(w). The problem of the validity of flux splitting is studied using these results. Three applications of flux splitting are then considered. The first application concerns uncentered schemes and particularly a precise analysis of their stability, the second is connected with a method for correcting the dispersive error of second-order accurate schemes, and the third deals with a nonreflective boundary condition.

  6. Recent Progress in Energy-Driven Water Splitting.

    Science.gov (United States)

    Tee, Si Yin; Win, Khin Yin; Teo, Wee Siang; Koh, Leng-Duei; Liu, Shuhua; Teng, Choon Peng; Han, Ming-Yong

    2017-05-01

    Hydrogen is readily obtained from renewable and non-renewable resources via water splitting by using thermal, electrical, photonic and biochemical energy. The major hydrogen production is generated from thermal energy through steam reforming/gasification of fossil fuel. As the commonly used non-renewable resources will be depleted in the long run, there is great demand to utilize renewable energy resources for hydrogen production. Most of the renewable resources may be used to produce electricity for driving water splitting while challenges remain to improve cost-effectiveness. As the most abundant energy resource, the direct conversion of solar energy to hydrogen is considered the most sustainable energy production method without causing pollutions to the environment. In overall, this review briefly summarizes thermolytic, electrolytic, photolytic and biolytic water splitting. It highlights photonic and electrical driven water splitting together with photovoltaic-integrated solar-driven water electrolysis.

  7. Mini-Split Heat Pumps Multifamily Retrofit Feasibility Study

    Energy Technology Data Exchange (ETDEWEB)

    Dentz, J.; Podorson, D.; Varshney, K.

    2014-05-01

    Mini-split heat pumps can provide space heating and cooling in many climates and are relatively affordable. These and other features make them potentially suitable for retrofitting into multifamily buildings in cold climates to replace electric resistance heating or other outmoded heating systems. This report investigates the suitability of mini-split heat pumps for multifamily retrofits. Various technical and regulatory barriers are discussed and modeling was performed to compare long-term costs of substituting mini-splits for a variety of other heating and cooling options. A number of utility programs have retrofit mini-splits in both single family and multifamily residences. Two such multifamily programs are discussed in detail.

  8. Opportunistic splitting for scheduling using a score-based approach

    KAUST Repository

    Rashid, Faraan

    2012-06-01

    We consider the problem of scheduling a user in a multi-user wireless environment in a distributed manner. The opportunistic splitting algorithm is applied to find the best group of users without reporting the channel state information to the centralized scheduler. The users find the best among themselves while requiring just a ternary feedback from the common receiver at the end of each mini-slot. The original splitting algorithm is modified to handle users with asymmetric channel conditions. We use a score-based approach with the splitting algorithm to introduce time and throughput fairness while exploiting the multi-user diversity of the network. Analytical and simulation results are given to show that the modified score-based splitting algorithm works well as a fair scheduling scheme with good spectral efficiency and reduced feedback. © 2012 IEEE.

  9. Endoscopic classification of representations of quasi-split unitary groups

    CERN Document Server

    Mok, Chung Pang

    2015-01-01

    In this paper the author establishes the endoscopic classification of tempered representations of quasi-split unitary groups over local fields, and the endoscopic classification of the discrete automorphic spectrum of quasi-split unitary groups over global number fields. The method is analogous to the work of Arthur on orthogonal and symplectic groups, based on the theory of endoscopy and the comparison of trace formulas on unitary groups and general linear groups.

  10. Spectral splitting for thermal management in photovoltaic cells

    Science.gov (United States)

    Apostoleris, Harry; Chiou, Yu-Cheng; Chiesa, Matteo; Almansouri, Ibraheem

    2017-09-01

    Spectral splitting is widely employed as a way to divide light between different solar cells or processes to optimize energy conversion. Well-understood but less explored is the use of spectrum splitting or filtering to combat solar cell heating. This has impacts both on cell performance and on the surrounding environment. In this manuscript we explore the design of spectral filtering systems that can improve the thermal and power-conversion performance of commercial PV modules.

  11. Split Octonion electrodynamics and unified fields of dyons

    International Nuclear Information System (INIS)

    Bisht, P.S.

    2004-01-01

    Split octonion electrodynamics has been developed in terms of Zorn's vector matrix realization by reformulating electromagnetic potential, current, field tensor and other dynamical quantities. Corresponding field equation (Unified Maxwell's equations) and equation of motion have been reformulated by means of split octonion and its Zorn vector realization in unique, simpler and consistent manner. It has been shown that this theory reproduces the dyon field equations in the absence of gravito-dyons and vice versa

  12. Visualization of the sequence of a couple splitting outside shop

    DEFF Research Database (Denmark)

    2015-01-01

    Visualization of tracks of couple walking together before splitting and one goes into shop the other waits outside. The visualization represents the sequence described in figure 7 in the publication 'Taking the temperature of pedestrian movement in public spaces'......Visualization of tracks of couple walking together before splitting and one goes into shop the other waits outside. The visualization represents the sequence described in figure 7 in the publication 'Taking the temperature of pedestrian movement in public spaces'...

  13. A Modified Halpern's Iterative Scheme for Solving Split Feasibility Problems

    Directory of Open Access Journals (Sweden)

    Jitsupa Deepho

    2012-01-01

    Full Text Available The purpose of this paper is to introduce and study a modified Halpern’s iterative scheme for solving the split feasibility problem (SFP in the setting of infinite-dimensional Hilbert spaces. Under suitable conditions a strong convergence theorem is established. The main result presented in this paper improves and extends some recent results done by Xu (Iterative methods for the split feasibility problem in infinite-dimensional Hilbert space, Inverse Problem 26 (2010 105018 and some others.

  14. Hydrogen Production from Semiconductor-based Photocatalysis via Water Splitting

    Directory of Open Access Journals (Sweden)

    Jeffrey C. S. Wu

    2012-10-01

    Full Text Available Hydrogen is the ideal fuel for the future because it is clean, energy efficient, and abundant in nature. While various technologies can be used to generate hydrogen, only some of them can be considered environmentally friendly. Recently, solar hydrogen generated via photocatalytic water splitting has attracted tremendous attention and has been extensively studied because of its great potential for low-cost and clean hydrogen production. This paper gives a comprehensive review of the development of photocatalytic water splitting for generating hydrogen, particularly under visible-light irradiation. The topics covered include an introduction of hydrogen production technologies, a review of photocatalytic water splitting over titania and non-titania based photocatalysts, a discussion of the types of photocatalytic water-splitting approaches, and a conclusion for the current challenges and future prospects of photocatalytic water splitting. Based on the literatures reported here, the development of highly stable visible–light-active photocatalytic materials, and the design of efficient, low-cost photoreactor systems are the key for the advancement of solar-hydrogen production via photocatalytic water splitting in the future.

  15. Numerical investigation of a dual-loop EGR split strategy using a split index and multi-objective Pareto optimization

    International Nuclear Information System (INIS)

    Park, Jungsoo; Song, Soonho; Lee, Kyo Seung

    2015-01-01

    Highlights: • Model-based control of dual-loop EGR system is performed. • EGR split index is developed to provide non-dimensional index for optimization. • EGR rates are calibrated using EGR split index at specific operating conditions. • Multi-objective Pareto optimization is performed to minimize NO X and BSFC. • Optimum split strategies are suggested with LP-rich dual-loop EGR at high load. - Abstract: A proposed dual-loop exhaust-gas recirculation (EGR) system that combines the features of high-pressure (HP) and low-pressure (LP) systems is considered a key technology for improving the combustion behavior of diesel engines. The fraction of HP and LP flows, known as the EGR split, for a given dual-loop EGR rate play an important role in determining the engine performance and emission characteristics. Therefore, identifying the proper EGR split is important for the engine optimization and calibration processes, which affect the EGR response and deNO X efficiencies. The objective of this research was to develop a dual-loop EGR split strategy using numerical analysis and one-dimensional (1D) cycle simulation. A control system was modeled by coupling the 1D cycle simulation and the control logic. An EGR split index was developed to investigate the HP/LP split effects on the engine performance and emissions. Using the model-based control system, a multi-objective Pareto (MOP) analysis was used to minimize the NO X formation and fuel consumption through optimized engine operating parameters. The MOP analysis was performed using a response surface model extracted from Latin hypercube sampling as a fractional factorial design of experiment. By using an LP rich dual-loop EGR, a high EGR rate was attained at low, medium, and high engine speeds, increasing the applicable load ranges compared to base conditions

  16. Archease from Pyrococcus abyssi improves substrate specificity and solubility of a tRNA m5C methyltransferase

    DEFF Research Database (Denmark)

    Auxilien, Sylvie; El Khadali, Fatima; Rasmussen, Anette

    2007-01-01

    Members of the archease superfamily of proteins are represented in all three domains of life. Archease genes are generally located adjacent to genes encoding proteins involved in DNA or RNA processing. Archease have therefore been predicted to play a modulator or chaperone role in selected steps...

  17. Molecular modeling and molecular dynamics simulation study of archaeal leucyl-tRNA synthetase in complex with different mischarged tRNA in editing conformation.

    Science.gov (United States)

    Rayevsky, A V; Sharifi, M; Tukalo, M A

    2017-09-01

    Aminoacyl-tRNA synthetases (aaRSs) play important roles in maintaining the accuracy of protein synthesis. Some aaRSs accomplish this via editing mechanisms, among which leucyl-tRNA synthetase (LeuRS) edits non-cognate amino acid norvaline mainly by post-transfer editing. However, the molecular basis for this pathway for eukaryotic and archaeal LeuRS remain unclear. In this study, a complex of archaeal P. horikoshii LeuRS (PhLeuRS) with misacylated tRNA Leu was modeled wherever tRNA's acceptor stem was oriented directly into the editing site. To understand the distinctive features of organization we reconstructed a complex of PhLeuRS with tRNA and visualize post-transfer editing interactions mode by performing molecular dynamics (MD) simulation studies. To study molecular basis for substrate selectivity by PhLeuRS's editing site we utilized MD simulation of the entire LeuRS complexes using a diverse charged form of tRNAs, namely norvalyl-tRNA Leu and isoleucyl-tRNA Leu . In general, the editing site organization of LeuRS from P.horikoshii has much in common with bacterial LeuRS. The MD simulation results revealed that the post-transfer editing substrate norvalyl-A76, binds more strongly than isoleucyl-A76. Moreover, the branched side chain of isoleucine prevents water molecules from being closer and hence the hydrolysis reaction slows significantly. To investigate a possible mechanism of the post-transfer editing reaction, by PhLeuRS we have determined that two water molecules (the attacking and assisting water molecules) are localized near the carbonyl group of the amino acid to be cleaved off. These water molecules approach the substrate from the opposite side to that observed for Thermus thermophilus LeuRS (TtLeuRS). Based on the results obtained, it was suggested that the post-transfer editing mechanism of PhLeuRS differs from that of prokaryotic TtLeuRS. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of the Japanese pond frog Rana nigromaculata.

    Science.gov (United States)

    Sumida, M; Kanamori, Y; Kaneda, H; Kato, Y; Nishioka, M; Hasegawa, M; Yonekawa, H

    2001-10-01

    In this study, we determined the complete nucleotide sequence of the mitochondrial genome of the Japanese pond frog Rana nigromaculata. The length of the sequence of the frog was 17,804 bp, though this was not absolute due to length variation caused by differing numbers of repetitive units in the control regions of individual frogs. The gene content, base composition, and codon usage of the Japanese pond frog conformed to those of typical vertebrate patterns. However, the comparison of gene organization between three amphibian species (Rana, Xenopus and caecilian) provided evidence that the gene arrangement of Rana differs by four tRNA gene positions from that of Xenopus or caecilian, a common gene arrangement in vertebrates. These gene rearrangements are presumed to have occurred by the tandem duplication of a gene region followed by multiple deletions of redundant genes. It is probable that the rearrangements start and end at tRNA genes involved in the initial production of a tandemly duplicated gene region. Putative secondary structures for the 22 tRNAs and the origin of the L-strand replication (OL) are described. Evolutionary relationships were estimated from the concatenated sequences of the 12 proteins encoded in the H-strand of mtDNA among 37 vertebrate species. A quartet-puzzling tree showed that three amphibian species form a monophyletic clade and that the caecilian is a sister group of the monophyletic Anura.

  19. An Examination Of Fracture Splitting Parameters Of Crackable Connecting Rods

    Directory of Open Access Journals (Sweden)

    Zafer Özdemir

    2000-06-01

    Full Text Available Fracture splitting method is an innovative processing technique in the field of automobile engine connecting rod (con/rod manufacturing. Compared with traditional method, this technique has remarkable advantages. Manufacturing procedures, equipment and tools investment can be decreased and energy consumption reduced remarkably. Furthermore, product quality and bearing capability can also be improved. It provides a high quality, high accuracy and low cost route for producing connecting rods (con/rods. With the many advantages mentioned above, this method has attracted manufacturers attention and has been utilized in many types of con/rod manufacturing. In this article, the method and the advantages it provides, such as materials, notches for fracture splitting, fracture splitting conditions and fracture splitting equipment are discussed in detail. The paper describes an analysis of examination of fracture splitting parameters and optik-SEM fractography of C70S6 crackable connectıng rod. Force and velocity parameters are investigated. That uniform impact force distrubition starting from the starting notch causes brittle and cleavage failure mode is obtained as a result. This induces to decrease the toughness.

  20. New Splitting Criteria for Decision Trees in Stationary Data Streams.

    Science.gov (United States)

    Jaworski, Maciej; Duda, Piotr; Rutkowski, Leszek

    2017-05-10

    The most popular tools for stream data mining are based on decision trees. In previous 15 years, all designed methods, headed by the very fast decision tree algorithm, relayed on Hoeffding's inequality and hundreds of researchers followed this scheme. Recently, we have demonstrated that although the Hoeffding decision trees are an effective tool for dealing with stream data, they are a purely heuristic procedure; for example, classical decision trees such as ID3 or CART cannot be adopted to data stream mining using Hoeffding's inequality. Therefore, there is an urgent need to develop new algorithms, which are both mathematically justified and characterized by good performance. In this paper, we address this problem by developing a family of new splitting criteria for classification in stationary data streams and investigating their probabilistic properties. The new criteria, derived using appropriate statistical tools, are based on the misclassification error and the Gini index impurity measures. The general division of splitting criteria into two types is proposed. Attributes chosen based on type-$I$ splitting criteria guarantee, with high probability, the highest expected value of split measure. Type-$II$ criteria ensure that the chosen attribute is the same, with high probability, as it would be chosen based on the whole infinite data stream. Moreover, in this paper, two hybrid splitting criteria are proposed, which are the combinations of single criteria based on the misclassification error and Gini index.

  1. Experimental study on dynamic splitting of recycled concrete using SHPB

    Science.gov (United States)

    Lu, Yubin; Yu, Shuisheng; Cai, Yong

    2015-09-01

    To study the recycled concrete splitting tensile properties and fracture state with various recycled coarse aggregate replacement percentage (i.e. 0%, 25%, 50%, 75% and 100%), the dynamic splitting test of recycled concrete was carried out using large diameter (75 mm) split Hopkinson pressure bar (SHPB). The results show that the recycled concrete splitting tensile strength increases with the increase of loading rate, and the loading rate also affects the recycled concrete fracture state, which indicates that the recycled concrete has obvious rate sensitivity. The damage state of the recycled concrete is not only the destruction of the interface between coarse aggregate and cement mortar, but also associates with the fracture damage of aggregates. Under the same water cement ratio, when the replacement percentage of coarse aggregates is around 50%-75%, the gradation of natural and recycled coarse aggregate is optimal, and thus the splitting tensile strength is the largest. This study offers theoretical basis for the engineering applications of recycled concrete.

  2. Alveolar Ridge Split Technique Using Piezosurgery with Specially Designed Tips

    Directory of Open Access Journals (Sweden)

    Alessandro Moro

    2017-01-01

    Full Text Available The treatment of patients with atrophic ridge who need prosthetic rehabilitation is a common problem in oral and maxillofacial surgery. Among the various techniques introduced for the expansion of alveolar ridges with a horizontal bone deficit is the alveolar ridge split technique. The aim of this article is to give a description of some new tips that have been specifically designed for the treatment of atrophic ridges with transversal bone deficit. A two-step piezosurgical split technique is also described, based on specific osteotomies of the vestibular cortex and the use of a mandibular ramus graft as interpositional graft. A total of 15 patients were treated with the proposed new tips by our department. All the expanded areas were successful in providing an adequate width and height to insert implants according to the prosthetic plan and the proposed tips allowed obtaining the most from the alveolar ridge split technique and piezosurgery. These tips have made alveolar ridge split technique simple, safe, and effective for the treatment of horizontal and vertical bone defects. Furthermore the proposed piezosurgical split technique allows obtaining horizontal and vertical bone augmentation.

  3. SplitRacer - a semi-automatic tool for the analysis and interpretation of teleseismic shear-wave splitting

    Science.gov (United States)

    Reiss, Miriam Christina; Rümpker, Georg

    2017-04-01

    We present a semi-automatic, graphical user interface tool for the analysis and interpretation of teleseismic shear-wave splitting in MATLAB. Shear wave splitting analysis is a standard tool to infer seismic anisotropy, which is often interpreted as due to lattice-preferred orientation of e.g. mantle minerals or shape-preferred orientation caused by cracks or alternating layers in the lithosphere and hence provides a direct link to the earth's kinematic processes. The increasing number of permanent stations and temporary experiments result in comprehensive studies of seismic anisotropy world-wide. Their successive comparison with a growing number of global models of mantle flow further advances our understanding the earth's interior. However, increasingly large data sets pose the inevitable question as to how to process them. Well-established routines and programs are accurate but often slow and impractical for analyzing a large amount of data. Additionally, shear wave splitting results are seldom evaluated using the same quality criteria which complicates a straight-forward comparison. SplitRacer consists of several processing steps: i) download of data per FDSNWS, ii) direct reading of miniSEED-files and an initial screening and categorizing of XKS-waveforms using a pre-set SNR-threshold. iii) an analysis of the particle motion of selected phases and successive correction of the sensor miss-alignment based on the long-axis of the particle motion. iv) splitting analysis of selected events: seismograms are first rotated into radial and transverse components, then the energy-minimization method is applied, which provides the polarization and delay time of the phase. To estimate errors, the analysis is done for different randomly-chosen time windows. v) joint-splitting analysis for all events for one station, where the energy content of all phases is inverted simultaneously. This allows to decrease the influence of noise and to increase robustness of the measurement

  4. GenePRIMP: A GENE PRediction IMprovement Pipeline for Prokaryotic genomes

    Energy Technology Data Exchange (ETDEWEB)

    Pati, Amrita; Ivanova, Natalia N.; Mikhailova, Natalia; Ovchinnikova, Galina; Hooper, Sean D.; Lykidis, Athanasios; Kyrpides, Nikos C.

    2010-04-01

    We present 'gene prediction improvement pipeline' (GenePRIMP; http://geneprimp.jgi-psf.org/), a computational process that performs evidence-based evaluation of gene models in prokaryotic genomes and reports anomalies including inconsistent start sites, missed genes and split genes. We found that manual curation of gene models using the anomaly reports generated by GenePRIMP improved their quality, and demonstrate the applicability of GenePRIMP in improving finishing quality and comparing different genome-sequencing and annotation technologies.

  5. Improved tRNA prediction in the American house dust mite reveals widespread occurrence of extremely short minimal tRNAs in acariform mites.

    Science.gov (United States)

    Klimov, Pavel B; Oconnor, Barry M

    2009-12-11

    Atypical tRNAs are functional minimal tRNAs, lacking either the D- or T-arm. They are significantly shorter than typical cloverleaf tRNAs. Widespread occurrence of atypical tRNAs was first demonstrated for secernentean nematodes and later in various arachnids. Evidence started to accumulate that tRNAs of certain acariform mites are even shorter than the minimal tRNAs of nematodes, raising the possibility that tRNAs lacking both D- and T-arms might exist in these organisms. The presence of cloverleaf tRNAs in acariform mites, particularly in the house dust mite genus Dermatophagoides, is still disputed. Mitochondrial tRNAs of Dermatophagoides farinae are minimal, atypical tRNAs lacking either the T- or D-arm. The size (49-62, 54.4 +/- 2.86 nt) is significantly (p = 0.019) smaller than in Caenorhabditis elegans (53-63, 56.3 +/- 2.30 nt), a model minimal tRNA taxon. The shortest tRNA (49 nt) in Dermatophagoides is approaching the length of the shortest known tRNAs (45-49 nt) described in other acariform mites. The D-arm is absent in these tRNAs, and the inferred T-stem is small (2-3 bp) and thermodynamically unstable, suggesting that it may not exist in reality. The discriminator nucleotide is probably not encoded and is added postranscriptionally in many Dermatophagoides tRNAs. Mitochondrial tRNAs of acariform mites are largely atypical, non-cloverleaf tRNAs. Among them, the shortest known tRNAs with no D-arm and a short and unstable T-arm can be inferred. While our study confirmed seven tRNAs in Dermatophagoides by limited EST data, further experimental evidence is needed to demonstrate extremely small and unusual tRNAs in acariform mites.

  6. Free-Energy Landscape of Reverse tRNA Translocation through the Ribosome Analyzed by Electron Microscopy Density Maps and Molecular Dynamics Simulations

    Science.gov (United States)

    Ishida, Hisashi; Matsumoto, Atsushi

    2014-01-01

    To understand the mechanism of reverse tRNA translocation in the ribosome, all-atom molecular dynamics simulations of the ribosome-tRNAs-mRNA-EFG complex were performed. The complex at the post-translocational state was directed towards the translocational and pre-translocational states by fitting the complex into cryo-EM density maps. Between a series of the fitting simulations, umbrella sampling simulations were performed to obtain the free-energy landscape. Multistep structural changes, such as a ratchet-like motion and rotation of the head of the small subunit were observed. The free-energy landscape showed that there were two main free-energy barriers: one between the post-translocational and intermediate states, and the other between the pre-translocational and intermediate states. The former corresponded to a clockwise rotation, which was coupled to the movement of P-tRNA over the P/E-gate made of G1338, A1339 and A790 in the small subunit. The latter corresponded to an anticlockwise rotation of the head, which was coupled to the location of the two tRNAs in the hybrid state. This indicates that the coupled motion of the head rotation and tRNA translocation plays an important role in opening and closing of the P/E-gate during the ratchet-like movement in the ribosome. Conformational change of EF-G was interpreted to be the result of the combination of the external motion by L12 around an axis passing near the sarcin-ricin loop, and internal hinge-bending motion. These motions contributed to the movement of domain IV of EF-G to maintain its interaction with A/P-tRNA. PMID:24999999

  7. The Differences Between Stock Splits and Stock Dividends

    DEFF Research Database (Denmark)

    Bechmann, Ken L.; Raaballe, Johannes

    It is often asserted that stock splits and stock dividends are purely cosmetic events. However, many studies have documented several stock market effects associated with stock splits and stock dividends. This paper examines the effects of these two types of events for the Danish stock market...... different. Second, the positive stock market reaction is closely related to associated changes in a firm's payout policy, but the relationship varies for the two types of events. Finally, there is only very weak evidence for a change in the liquidity of the stock. On the whole, after controlling...... for the firm's payout policy, the results suggest that a stock split is a cosmetic event and that a stock dividend on its own is considered negative news....

  8. Electron refrigeration in hybrid structures with spin-split superconductors

    Science.gov (United States)

    Rouco, M.; Heikkilä, T. T.; Bergeret, F. S.

    2018-01-01

    Electron tunneling between superconductors and normal metals has been used for an efficient refrigeration of electrons in the latter. Such cooling is a nonlinear effect and usually requires a large voltage. Here we study the electron cooling in heterostructures based on superconductors with a spin-splitting field coupled to normal metals via spin-filtering barriers. The cooling power shows a linear term in the applied voltage. This improves the coefficient of performance of electron refrigeration in the normal metal by shifting its optimum cooling to lower voltage, and also allows for cooling the spin-split superconductor by reverting the sign of the voltage. We also show how tunnel coupling spin-split superconductors with regular ones allows for a highly efficient refrigeration of the latter.

  9. Giant Rashba spin splitting in Bi2Se3: Tl

    KAUST Repository

    Singh, Nirpendra

    2014-07-25

    First-principles calculations are employed to demonstrate a giant Rashba spin splitting in Bi2Se3:Tl. Biaxial tensile and compressive strain is used to tune the splitting by modifying the potential gradient. The band gap is found to increase under compression and decreases under tension, whereas the dependence of the Rashba spin splitting on the strain is the opposite. Large values of αR = 1.57 eV Å at the bottom of the conduction band (electrons) and αR = 3.34 eV Å at the top of the valence band (holes) are obtained without strain. These values can be further enhanced to αR = 1.83 eV Å and αR = 3.64 eV Å, respectively, by 2% tensile strain. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Stride length asymmetry in split-belt locomotion.

    Science.gov (United States)

    Hoogkamer, Wouter; Bruijn, Sjoerd M; Duysens, Jacques

    2014-01-01

    The number of studies utilizing a split-belt treadmill is rapidly increasing in recent years. This has led to some confusion regarding the definitions of reported gait parameters. The purpose of this paper is to clearly present the definitions of the gait parameters that are commonly used in split-belt treadmill studies. We argue that the modified version of stride length for split-belt gait, which is different from the standard definition of stride length and actually is a measure of limb excursion, should be referred to as 'limb excursion' in future studies. Furthermore, the symmetry of stride length and stride time is specifically addressed. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Geometric inductance effects in the spectrum of split transmon qubits

    Science.gov (United States)

    Brierley, R. T.; Blumoff, J.; Chou, K.; Schoelkopf, R. J.; Girvin, S. M.

    2014-03-01

    The low-energy spectra of transmon superconducting qubits in a cavity can be accurately calculated using the black-box quantization approach. This method involves finding the normal modes of the circuit with a linearized Josephson junction and using these as the basis in which to express the non-linear terms. A split transmon qubit consists of two Josephson junctions in a SQUID loop. This configuration allows the Josephson energy to be tuned by applying external flux. Ideally, the system otherwise behaves as a conventional transmon with a single effective Josephson junction. However, the finite geometric inductance of the SQUID loop causes deviations from the simplest ideal description of a split transmon. This alters both the linearized and non-linear behaviour of the Josephson junctions in the superconducting circuit. We study how these changes can be incorporated into the black-box quantization approach and their effects on the low-energy spectrum of the split transmon.

  12. Point splitting in a curved space-time background

    International Nuclear Information System (INIS)

    Liggatt, P.A.J.; Macfarlane, A.J.

    1979-01-01

    A prescription is given for point splitting in a curved space-time background which is a natural generalization of that familiar in quantum electrodynamics and Yang-Mills theory. It is applied (to establish its validity) to the verification of the gravitational anomaly in the divergence of a fermion axial current. Notable features of the prescription are that it defines a point-split current that can be differentiated straightforwardly, and that it involves a natural way of averaging (four-dimensionally) over the directions of point splitting. The method can extend directly from the spin-1/2 fermion case treated to other cases, e.g., to spin-3/2 Rarita-Schwinger fermions. (author)

  13. Splitting rules for spectra of two-dimensional Fibonacci quasilattices

    Science.gov (United States)

    Yang, Xiangbo; Liu, Youyan

    1997-10-01

    In the framework of the single-electron tight-binding on-site model, after establishing the method of constructing a class of two-dimensional Fibonacci quasilattices, we have studied the rules of energy spectra splitting for these quasilattices by means of a decomposition-decimation method based on the renormalization-group technique. Under the first approximation, the analytic results show that there exist only six kinds of clusters and the electronic energy bands split as type Y and consist of nine subbands. Instead of the on-site model, the transfer model should be used for the higher hierarchy of the spectra, the electronic energy spectra split as type F. The analytic results are confirmed by numerical simulations.

  14. Tantalum nitride for photocatalytic water splitting: concept and applications

    Directory of Open Access Journals (Sweden)

    Ela Nurlaela

    2016-10-01

    Full Text Available Abstract Along with many other solar energy conversion processes, research on photocatalytic water splitting to generate hydrogen and oxygen has experienced rapid major development over the past years. Developing an efficient visible-light-responsive photocatalyst has been one of the targets of such research efforts. In this regard, nitride materials, particularly Ta3N5, have been the subject of investigation due to their promising properties. This review focuses on the fundamental parameters involved in the photocatalytic processes targeting overall water splitting using Ta3N5 as a model photocatalyst. The discussion primarily focuses on relevant parameters that are involved in photon absorption, exciton separation, carrier diffusion, carrier transport, catalytic efficiency, and mass transfer of the reactants. An overview of collaborative experimental and theoretical approaches to achieve efficient photocatalytic water splitting using Ta3N5 is discussed.

  15. Split and delay photon correlation spectroscopy with a visible light

    International Nuclear Information System (INIS)

    Rasch, Marten

    2016-04-01

    The development and performance of a setup constructed with the aim for the split pulse photon correlation spectroscopy is presented in this thesis. The double pulse time structure is accomplished with help of an Acusto-Optic Modulator (AOM) crystal, which mimics the splitting and delaying of photon pulses. The setup provides double pulses and allows to control the pulse width and delay and to synchronize them into one camera exposure window. The performance of the setup was successfully verified in a proof of principle experiment with a model system of polystyrene particles following Brownian motion. The measured radius of particles obtained with from the split pulse experiment (R h =(2.567±0.097) μm) is in agreement with the particle size provided by the manufacturer (R=(2.26±0.08) μm). The achieved results show higher statistics compared to a standard Dynamic Light Scattering (DLS) measurement.

  16. Guidelines to Develop Efficient Photocatalysts for Water Splitting

    KAUST Repository

    Garcia Esparza, Angel T.

    2016-04-03

    Photocatalytic overall water splitting is the only viable solar-to-fuel conversion technology. The research discloses an investigation process wherein by dissecting the photocatalytic water splitting device, electrocatalysts, and semiconductor photocatalysts can be independently studied, developed and optimized. The assumption of perfect catalysts leads to the realization that semiconductors are the limiting factor in photocatalysis. This dissertation presents a guideline for efficient photocatalysis using semiconductor particles developed from idealized theoretical simulations. No perfect catalysts exist; then the discussion focus on the development of efficient non-noble metal electrocatalysts for hydrogen evolution from water reduction. Tungsten carbide (WC) is selective for the catalysis of hydrogen without the introduction of the reverse reaction of water formation, which is critical to achieving photocatalytic overall water splitting as demonstrated in this work. Finally, photoelectrochemistry is used to characterize thoroughly Cu-based p-type semiconductors with potential for large-scale manufacture. Artificial photosynthesis may be achieved by following the recommendations herein presented.

  17. Rabi splitting in an acoustic cavity embedded plate

    International Nuclear Information System (INIS)

    Ni, Xu; Liu, Xiao-Ping; Chen, Ze-Guo; Zheng, Li-Yang; Xu, Ye-Long; Lu, Ming-Hui; Chen, Yan-Feng

    2014-01-01

    We design a structure to realize Rabi splitting and Rabi oscillation in acoustics. We develop rigorous analytical models to analyze the splitting effect from the aspect of phase matching, and from the aspect of mode coupling using a coupled mode model. In this model, we discover that the splitting effect is caused by the coupling of the Fabry–Perot fundamental mode with the resonant mode of an artificial acoustic ‘atom’. We then extract the coupling strength and analyze the impact of structural parameters on it. In addition, we demonstrate Rabi oscillation in the time domain. Such quantum phenomena in the classical regime may have potential applications in the design of novel ultrasonic devices.

  18. Immediate Loaded Implants in Split-Crest Procedure.

    Science.gov (United States)

    Crespi, Roberto; Bruschi, Giovanni B; Gastaldi, Giorgio; Capparé, Paolo; Gherlone, Enrico F

    2015-10-01

    The aim of this study was to assess survival rate of immediate loading implants placed after split-crest technique. Thirty-six patients were enrolled in the study. They underwent placement of 93 dental implants in edentulous region after split-crest ridge expansion procedure. Implants followed an immediate loading procedure. Crestal bone levels were measured at baseline, at temporary prosthesis placement, at 1 year, and at 2 years from implant placement. For dental implants, a survival rate of 98.92% was reported at 2-year follow-up, with a mean value bone loss of -1.02 ± 0.48. This study assessed immediate loading implant placement after split-crest procedure at 2-year follow-up. © 2015 Wiley Periodicals, Inc.

  19. A Matrix Splitting Method for Composite Function Minimization

    KAUST Repository

    Yuan, Ganzhao

    2016-12-07

    Composite function minimization captures a wide spectrum of applications in both computer vision and machine learning. It includes bound constrained optimization and cardinality regularized optimization as special cases. This paper proposes and analyzes a new Matrix Splitting Method (MSM) for minimizing composite functions. It can be viewed as a generalization of the classical Gauss-Seidel method and the Successive Over-Relaxation method for solving linear systems in the literature. Incorporating a new Gaussian elimination procedure, the matrix splitting method achieves state-of-the-art performance. For convex problems, we establish the global convergence, convergence rate, and iteration complexity of MSM, while for non-convex problems, we prove its global convergence. Finally, we validate the performance of our matrix splitting method on two particular applications: nonnegative matrix factorization and cardinality regularized sparse coding. Extensive experiments show that our method outperforms existing composite function minimization techniques in term of both efficiency and efficacy.

  20. Advanced split-illumination electron holography without Fresnel fringes

    International Nuclear Information System (INIS)

    Tanigaki, Toshiaki; Aizawa, Shinji; Park, Hyun Soon; Matsuda, Tsuyoshi; Harada, Ken; Shindo, Daisuke

    2014-01-01

    Advanced split-illumination electron holography was developed by employing two biprisms in the illuminating system to split an electron wave into two coherent waves and two biprisms in the imaging system to overlap them. A focused image of an upper condenser-biprism filament was formed on the sample plane, and all other filaments were placed in its shadow. This developed system makes it possible to obtain precise reconstructed object waves without modulations due to Fresnel fringes, in addition to holograms of distant objects from reference waves. - Highlights: • Advanced split-illumination electron holography without Fresnel fringes is developed. • Two biprisms are installed in illuminating system of microscope. • High-precision holographic observations of an area locating far from the sample edge become possible

  1. Tantalum nitride for photocatalytic water splitting: concept and applications

    KAUST Repository

    Nurlaela, Ela

    2016-10-12

    Along with many other solar energy conversion processes, research on photocatalytic water splitting to generate hydrogen and oxygen has experienced rapid major development over the past years. Developing an efficient visible-light-responsive photocatalyst has been one of the targets of such research efforts. In this regard, nitride materials, particularly Ta3N5, have been the subject of investigation due to their promising properties. This review focuses on the fundamental parameters involved in the photocatalytic processes targeting overall water splitting using Ta3N5 as a model photocatalyst. The discussion primarily focuses on relevant parameters that are involved in photon absorption, exciton separation, carrier diffusion, carrier transport, catalytic efficiency, and mass transfer of the reactants. An overview of collaborative experimental and theoretical approaches to achieve efficient photocatalytic water splitting using Ta3N5 is discussed.

  2. A comparison between kinetic flux vector splitting and flux difference splitting methods in solution of Euler equations

    International Nuclear Information System (INIS)

    Mirzaei, M.; Shahverdi, M.

    2004-01-01

    This paper is proposed to compare the performances of deferent inviscid flux approximation methods in solution of two-dimensional Euler equations. The methods belong to two different group of flux splitting methods: flux difference splitting (FDS) methods and kinetic flux vector splitting (KFVS) method. Here Roe method and Osher method belonging to flux difference splitting (FDS) group have been employed and their performances are compared with that of kinetic flux vector splitting method (KFVS). Roe and Osher methods are based on approximate solution of Riemann problem over computational cell surfaces while the KFVS has a quit different base. In KFVS inviscid fluxes are approximated based on the kinetic theory and correlation between Boltzmann equation and Euler equations. For comparison the performances of the above mentioned methods three different problems have been solved. The first problem is flow over a 10 degree compression-expansion ramp with Mach number of 2.0, the second one is a transonic flow with Mach number of 0.85 over a 4.2% circular bump in a duct and the third is supersonic flow with Mach number of 3.0 over a circular blunt slab. (author)

  3. Splitting and non splitting are pollution models photochemical reactions in the urban areas of greater Tehran area

    International Nuclear Information System (INIS)

    Heidarinasab, A.; Dabir, B.; Sahimi, M.; Badii, Kh.

    2003-01-01

    During the past years, one of the most important problems has been air pollution in urban areas. In this regards, ozone, as one of the major products of photochemical reactions, has great importance. The term 'photochemical' is applied to a number of secondary pollutants that appear as a result of sun-related reactions, ozone being the most important one. So far various models have been suggested to predict these pollutants. In this paper, we developed the model that has been introduced by Dabir, et al. [4]. In this model more than 48 chemical species and 114 chemical reactions are involved. The result of this development, showed good to excellent agreement across the region for compounds such as O 3 , NO, NO 2 , CO, and SO 2 with regard to VOC and NMHC. The results of the simulation were compared with previous work [4] and the effects of increasing the number of components and reactions were evaluated. The results of the operator splitting method were compared with non splitting solving method. The result showed that splitting method with one-tenth time step collapsed with non splitting method (Crank-Nicolson, under-relaxation iteration method without splitting of the equation terms). Then we developed one dimensional model to 3-D and were compared with experimental data

  4. Screening current induced magnetic field in REBCO superconducting coil wound by using split wire having intermittent inner split

    Science.gov (United States)

    Matsuda, Tetsuro; Jin, Xinzhe; Okamura, Tetsuji

    2017-09-01

    REBCO-coated conductor having a high critical current is promising for applications in next generation apparatuses such as ultra-high field NMR, high-resolution MRI, and high-precision accelerator. However, it has an important challenge for application in NMR and MRI, due to the single core in REBCO superconducting layer. The single core induces a large screening current-induced magnetic field (screening current field), and it influences the controlling of center field in NMR/MRI magnet. To reduce the screening current field, we have recently developed a split wire having multi-core structure by inner split method (electrical separation by bending stress, ESBS). In experiment, short samples with linear inner split by a large bending stress of 80 N were prepared and tested. However, to fabricate a long length wire with good quality, it is better to use a smaller bending stress. In this study, a low-bending-stress inner split method is used to fabricate superconducting tapes with longitudinal split in their superconducting layer. The fabrication and experimental assessments for the wire and coil are carried out.

  5. Tantalum-based semiconductors for solar water splitting.

    Science.gov (United States)

    Zhang, Peng; Zhang, Jijie; Gong, Jinlong

    2014-07-07

    Solar energy utilization is one of the most promising solutions for the energy crises. Among all the possible means to make use of solar energy, solar water splitting is remarkable since it can accomplish the conversion of solar energy into chemical energy. The produced hydrogen is clean and sustainable which could be used in various areas. For the past decades, numerous efforts have been put into this research area with many important achievements. Improving the overall efficiency and stability of semiconductor photocatalysts are the research focuses for the solar water splitting. Tantalum-based semiconductors, including tantalum oxide, tantalate and tantalum (oxy)nitride, are among the most important photocatalysts. Tantalum oxide has the band gap energy that is suitable for the overall solar water splitting. The more negative conduction band minimum of tantalum oxide provides photogenerated electrons with higher potential for the hydrogen generation reaction. Tantalates, with tunable compositions, show high activities owning to their layered perovskite structure. (Oxy)nitrides, especially TaON and Ta3N5, have small band gaps to respond to visible-light, whereas they can still realize overall solar water splitting with the proper positions of conduction band minimum and valence band maximum. This review describes recent progress regarding the improvement of photocatalytic activities of tantalum-based semiconductors. Basic concepts and principles of solar water splitting will be discussed in the introduction section, followed by the three main categories regarding to the different types of tantalum-based semiconductors. In each category, synthetic methodologies, influencing factors on the photocatalytic activities, strategies to enhance the efficiencies of photocatalysts and morphology control of tantalum-based materials will be discussed in detail. Future directions to further explore the research area of tantalum-based semiconductors for solar water splitting

  6. Rabi-like splitting from large area plasmonic microcavity

    Directory of Open Access Journals (Sweden)

    Fatemeh Hosseini Alast

    2017-08-01

    Full Text Available Rabi-like splitting was observed from a hybrid plasmonic microcavity. The splitting comes from the coupling of cavity mode with the surface plasmon polariton mode; anti-crossing was observed alongside the modal conversional channel on the reflection light measurement. The hybrid device consists of a 10x10 mm2 ruled metal grating integrated onto the Fabry-Perot microcavity. The 10x10 mm2 ruled metal grating fabricated from laser interference and the area is sufficiently large to be used in the practical optical device. The larger area hybrid plasmonic microcavity can be employed in polariton lasers and biosensors.

  7. Optimal Cross-Validation Split Ratio: Experimental Investigation

    DEFF Research Database (Denmark)

    Goutte, Cyril; Larsen, Jan

    1998-01-01

    Cross-validation is a common method for assessing the generalisation ability of a model in order to tune a regularisation parameter or otherhyper-parameters of a learning process. The use of cross-validation requires to set yet an additional parameter, the split rati. While a few texts haveinvest......Cross-validation is a common method for assessing the generalisation ability of a model in order to tune a regularisation parameter or otherhyper-parameters of a learning process. The use of cross-validation requires to set yet an additional parameter, the split rati. While a few texts...

  8. Crystal Splitting in the Growth of Bi2S3

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Jing; Alivisatos, A. Paul

    2006-06-15

    Novel Bi{sub 2}S{sub 3} nanostructures with a sheaf-like morphology are obtained via reaction of bismuth acetate-oleic acid complex with elemental sulfur in 1-octadecence. We propose these structures form by the splitting crystal growth mechanism, which is known to account for the morphology some mineral crystals assume in nature. By controlling the synthetic parameters, different forms of splitting, analogous to observed in minerals, are obtained in our case of Bi{sub 2}S{sub 3}. These new and complex Bi{sub 2}S{sub 3} nanostructures are characterized by TEM, SEM, XRD and ED.

  9. SiC MOSFETs based split output half bridge inverter

    DEFF Research Database (Denmark)

    Li, Helong; Munk-Nielsen, Stig; Beczkowski, Szymon

    2014-01-01

    output. The double pulse test shows the devices' current during commutation process and the reduced switching losses of SiC MOSFETs compared to that of the traditional half bridge. The efficiency comparison is presented with experimental results of half bridge power inverter with split output...... and traditional half bridge inverter, from switching frequency 10 kHz to 100 kHz. The experimental results comparison shows that the half bridge with split output has an efficiency improvement of more than 0.5% at 100 kHz switching frequency....

  10. Cooper Pair Splitting by Means of Graphene Quantum Dots

    Science.gov (United States)

    Tan, Z. B.; Cox, D.; Nieminen, T.; Lähteenmäki, P.; Golubev, D.; Lesovik, G. B.; Hakonen, P. J.

    2015-03-01

    A split Cooper pair is a natural source for entangled electrons which is a basic ingredient for quantum information in the solid state. We report an experiment on a superconductor-graphene double quantum dot (QD) system, in which we observe Cooper pair splitting (CPS) up to a CPS efficiency of ˜10 % . With bias on both QDs, we are able to detect a positive conductance correlation across the two distinctly decoupled QDs. Furthermore, with bias only on one QD, CPS and elastic cotunneling can be distinguished by tuning the energy levels of the QDs to be asymmetric or symmetric with respect to the Fermi level in the superconductor.

  11. Frobenius splitting and geometry of $G$-Schubert varieties

    DEFF Research Database (Denmark)

    He, Xuhua; Thomsen, Jesper Funch

    2008-01-01

    Let X be an equivariant embedding of a connected reductive group G over an algebraically closed field k of positive characteristic. Let B denote a Borel subgroup of G. A G-Schubert variety in X is a subvariety of the form diag(G) V , where V is a B×B -orbit closure in X. In the case where X...... admits a stable Frobenius splitting along an ample divisors. Although this indicates that G-Schubert varieties have nice singularities we present an example of a nonnormal G-Schubert variety in the wonderful compactification of a group of type G2 . Finally we also extend the Frobenius splitting results...

  12. Modulated-splitting-ratio fiber-optic temperature sensor

    Science.gov (United States)

    Beheim, Glenn; Anthan, Donald J.; Rys, John R.; Fritsch, Klaus; Ruppe, Walter R.

    1989-06-01

    A fiber-optic temperature sensor is described that uses a small silicon beamsplitter whose splitting ratio varies as a function of temperature. A four-beam technique is used to measure the sensor's temperature-indicating splitting ratio. This referencing method provides a measurement that is largely independent of the transmission properties of the sensor's optical fiber link. A significant advantage of this sensor, relative to other fiber-optic sensors, is its high stability, which permits the fiber-optic components to be readily substituted, thereby simplifying the sensor's installation and maintenance.

  13. Split-plot Experiments with Unusual Numbers of Subplot Runs

    DEFF Research Database (Denmark)

    Kulahci, Murat

    2007-01-01

    In many experimental situations, it may not be feasible or even possible to run experiments in a completely randomized fashion as usually recommended. Under these circumstances, split-plot experiments in which certain factors are changed less frequently than the others are often used. Most...... of the literature on split-plot designs is based on 2-level factorials. For those designs, the number of subplots is a power of 2. There may however be some situations where for cost purposes or physical constraints, we may need to have unusual number of subplots such as 3, 5, 6, etc. In this article, we explore...

  14. Novel Split Chest Tube Improves Post-Surgical Thoracic Drainage

    Science.gov (United States)

    Olivencia-Yurvati, Albert H; Cherry, Brandon H; Gurji, Hunaid A; White, Daniel W; Newton, J Tyler; Scott, Gary F; Hoxha, Besim; Gourlay, Terence; Mallet, Robert T

    2014-01-01

    Objective Conventional, separate mediastinal and pleural tubes are often inefficient at draining thoracic effusions. Description We developed a Y-shaped chest tube with split ends that divide within the thoracic cavity, permitting separate intrathoracic placement and requiring a single exit port. In this study, thoracic drainage by the split drain vs. that of separate drains was tested. Methods After sternotomy, pericardiotomy, and left pleurotomy, pigs were fitted with separate chest drains (n=10) or a split tube prototype (n=9) with internal openings positioned in the mediastinum and in the costo-diaphragmatic recess. Separate series of experiments were conducted to test drainage of D5W or 0.58 M sucrose, an aqueous solution with viscosity approximating that of plasma. One litre of fluid was infused into the thorax, and suction was applied at −20 cm H2O for 30 min. Results When D5W was infused, the split drain left a residual volume of 53 ± 99 ml (mean value ± SD) vs. 148 ± 120 for the separate drain (P=0.007), representing a drainage efficiency (i.e. drained vol/[drained + residual vol]) of 95 ± 10% vs. 86 ± 12% for the separate drains (P = 0.011). In the second series, the split drain evacuated more 0.58 M sucrose in the first minute (967 ± 129 ml) than the separate drains (680 ± 192 ml, P<0.001). By 30 min, the split drain evacuated a similar volume of sucrose vs. the conventional drain (1089 ± 72 vs. 1056 ± 78 ml; P = 0.5). Residual volume tended to be lower (25 ± 10 vs. 62 ± 72 ml; P = 0.128) and drainage efficiency tended to be higher (98 ± 1 vs. 95 ± 6%; P = 0.111) with the split drain vs. conventional separate drains. Conclusion The split chest tube drained the thoracic cavity at least as effectively as conventional separate tubes. This new device could potentially alleviate postoperative complications. PMID:25478289

  15. The complete mitochondrial genome sequence and gene organization of the rainbow runner (Elagatis bipinnulata) (Perciformes: Carangidae).

    Science.gov (United States)

    Ma, Chunyan; Ma, Hongyu; Zhang, Heng; Feng, Chunlei; Wei, Hongqing; Wang, Wei; Chen, Wei; Zhang, Fengying; Ma, Lingbo

    2017-01-01

    The complete mitochondrial genome information can play an important role in species identification, phylogeny, evolution research, genetic differentiation, and diversity. Here we determined the complete mitochondrial genome sequence of Elagatis bipinnulata (Perciformes: Carangidae). This circular genome was 16 542 bp in length, and included all 37 typical mitochondrial genes, containing 13 protein-coding genes, 22 tRNA genes, two rRNA genes, and a putative control region. The gene order of E. bipinnulata was identical to that observed in most other vertebrates. Of 37 genes, 28 were encoded by heavy strand, while the other ones were encoded by light strand. According to the phylogenetic analysis based on 13 concatenated protein-coding genes, E. bipinnulata was genetically closer to the species of genus Seriola compared with any other species within Perciformes. This work can provide helpful data for further studies on population genetic diversity and molecular evolution.

  16. New cell line development for antibody-producing Chinese hamster ovary cells using split green fluorescent protein

    Directory of Open Access Journals (Sweden)

    Kim Yeon-Gu

    2012-05-01

    Full Text Available Abstract Background The establishment of high producer is an important issue in Chinese hamster ovary (CHO cell culture considering increased heterogeneity by the random integration of a transfected foreign gene and the altered position of the integrated gene. Fluorescence-activated cell sorting (FACS-based cell line development is an efficient strategy for the selection of CHO cells in high therapeutic protein production. Results An internal ribosome entry site (IRES was introduced for using two green fluorescence protein (GFP fragments as a reporter to both antibody chains, the heavy chain and the light chain. The cells co-transfected with two GFP fragments showed the emission of green fluorescence by the reconstitution of split GFP. The FACS-sorted pool with GFP expression had a higher specific antibody productivity (qAb than that of the unsorted pool. The qAb was highly correlated with the fluorescence intensity with a high correlation coefficient, evidenced from the analysis of median GFP and qAb in individual selected clones. Conclusions This study proved that the fragment complementation for split GFP could be an efficient indication for antibody production on the basis of high correlation of qAb with reconstitution of GFP. Taken together, we developed an efficient FACS-based screening method for high antibody-producing CHO cells with the benefits of the split GFP system.

  17. SplitRacer - a new Semi-Automatic Tool to Quantify And Interpret Teleseismic Shear-Wave Splitting

    Science.gov (United States)

    Reiss, M. C.; Rumpker, G.

    2017-12-01

    We have developed a semi-automatic, MATLAB-based GUI to combine standard seismological tasks such as the analysis and interpretation of teleseismic shear-wave splitting. Shear-wave splitting analysis is widely used to infer seismic anisotropy, which can be interpreted in terms of lattice-preferred orientation of mantle minerals, shape-preferred orientation caused by fluid-filled cracks or alternating layers. Seismic anisotropy provides a unique link between directly observable surface structures and the more elusive dynamic processes in the mantle below. Thus, resolving the seismic anisotropy of the lithosphere/asthenosphere is of particular importance for geodynamic modeling and interpretations. The increasing number of seismic stations from temporary experiments and permanent installations creates a new basis for comprehensive studies of seismic anisotropy world-wide. However, the increasingly large data sets pose new challenges for the rapid and reliably analysis of teleseismic waveforms and for the interpretation of the measurements. Well-established routines and programs are available but are often impractical for analyzing large data sets from hundreds of stations. Additionally, shear wave splitting results are seldom evaluated using the same well-defined quality criteria which may complicate comparison with results from different studies. SplitRacer has been designed to overcome these challenges by incorporation of the following processing steps: i) downloading of waveform data from multiple stations in mseed-format using FDSNWS tools; ii) automated initial screening and categorizing of XKS-waveforms using a pre-set SNR-threshold; iii) particle-motion analysis of selected phases at longer periods to detect and correct for sensor misalignment; iv) splitting analysis of selected phases based on transverse-energy minimization for multiple, randomly-selected, relevant time windows; v) one and two-layer joint-splitting analysis for all phases at one station by

  18. Tangled up in mood : Exploring Panará split ergativity

    NARCIS (Netherlands)

    Bardagil-Mas, Bernat

    2015-01-01

    The two primary goals of this article are to present data concerning the mood-based alignment split that can be observed in Panará pronominal clitics and to put forward a tentative formal analysis that can capture the motivations of such phenomena in the grammar. This paper aims to explore an

  19. Split Dirac Supersymmetry: An Ultraviolet Completion of Higgsino Dark Matter

    Energy Technology Data Exchange (ETDEWEB)

    Fox, Patrick J. [Fermilab; Kribs, Graham D. [Oregon U.; Martin, Adam [Notre Dame U.

    2014-10-07

    Motivated by the observation that the Higgs quartic coupling runs to zero at an intermediate scale, we propose a new framework for models of split supersymmetry, in which gauginos acquire intermediate scale Dirac masses of $\\sim 10^{8-11}$ GeV. Scalar masses arise from one-loop finite contributions as well as direct gravity-mediated contributions. Like split supersymmetry, one Higgs doublet is fine-tuned to be light. The scale at which the Dirac gauginos are introduced to make the Higgs quartic zero is the same as is necessary for gauge coupling unification. Thus, gauge coupling unification persists (nontrivially, due to adjoint multiplets), though with a somewhat higher unification scale $\\gtrsim 10^{17}$ GeV. The $\\mu$-term is naturally at the weak scale, and provides an opportunity for experimental verification. We present two manifestations of Split Dirac Supersymmetry. In the "Pure Dirac" model, the lightest Higgsino must decay through R-parity violating couplings, leading to an array of interesting signals in colliders. In the "Hypercharge Impure" model, the bino acquires a Majorana mass that is one-loop suppressed compared with the Dirac gluino and wino. This leads to weak scale Higgsino dark matter whose overall mass scale, as well as the mass splitting between the neutral components, is naturally generated from the same UV dynamics. We outline the challenges to discovering pseudo-Dirac Higgsino dark matter in collider and dark matter detection experiments.

  20. Deconstruction, G_2 Holonomy, and Doublet-Triplet Splitting

    OpenAIRE

    Witten, Edward

    2002-01-01

    We describe a mechanism for using discrete symmetries to solve the doublet-triplet splitting problem of four-dimensional supersymmetric GUT's. We present two versions of the mechanism, one via ``deconstruction,'' and one in terms of M-theory compactification to four dimensions on a manifold of G_2 holonomy.

  1. Split shielding plates in electrostatic sector analyzers and Wien filters

    Science.gov (United States)

    Yavor, Mikhail I.

    1995-09-01

    An analytical method is developed for calculation of the influence of the splitted shielding plates in inhomogeneous electrostatic sector analyzers and Wien filters on their electron optical properties. The method allows one to simplify considerably the choice of the mode of operation of the shielding plates needed to achieve a required electrostatic field distribution inside the analyzer.

  2. Split tensile strength of soilcrete blocks | Okere | Nigerian Journal of ...

    African Journals Online (AJOL)

    With the ever increasing problems associated with dredging of rivers to obtain river sand, reduced dependence on river sand should be encouraged by using alternative materials in block production. This work deals with the production of soilcrete blocks using readily available and affordable laterite. Split tensile strength of ...

  3. Signature splitting in two quasiparticle rotational bands of Ta

    Indian Academy of Sciences (India)

    2016-06-20

    Jun 20, 2016 ... ... of 182Ta are analysed within the framework of two-quasiparticle rotor model. The phase as well as magni- tude of the experimentally observed signature splitting in Kπ = 1+ band of 180Ta, which could not be explained in earlier calculations, is successfully reproduced. The conflict regarding placement of ...

  4. Split Hand and Foot Malformation | Salati | East and Central African ...

    African Journals Online (AJOL)

    East and Central African Journal of Surgery. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 16, No 2 (2011) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. Split Hand and Foot Malformation. SA Salati ...

  5. Reconstruction of bilateral tibial aplasia and split hand-foot ...

    African Journals Online (AJOL)

    Background: Tibial aplasia is of heterogeneous aetiology, the majority of reports are sporadic. We describe the reconstruction procedures in two subjects - a daughter and father manifested autosomal dominant (AD) inheritance of the bilateral tibial aplasia and split hand-foot syndrome. Materials and Methods: ...

  6. Split calvarial graft and titanium mesh for reconstruction of post ...

    African Journals Online (AJOL)

    Background: The goal of cranioplasty is to achieve a lifelong, stable and structural reconstruction of the cranium covered by a healthy skin and scalp flap. We present two cases of large frontal bone defect following a accident.. Cases: We describe the utilization of autogenous local split calvarial graft and titanium mesh for ...

  7. Constructing General Orthogonal Fractional Factorial Split-Plot Designs

    NARCIS (Netherlands)

    Sartono, B.; Goos, P.; Schoen, E.

    2015-01-01

    While the orthogonal design of split-plot fractional factorial experiments has received much attention already, there are still major voids in the literature. First, designs with one or more factors acting at more than two levels have not yet been considered. Second, published work on nonregular

  8. Stride length asymmetry in split-belt locomotion

    NARCIS (Netherlands)

    Hoogkamer, W.; Bruijn, S.M.; Duysens, J.

    2013-01-01

    The number of studies utilizing a split-belt treadmill is rapidly increasing in recent years. This has led to some confusion regarding the definitions of reported gait parameters. The purpose of this paper is to clearly present the definitions of the gait parameters that are commonly used in

  9. Relations among the crack growth modes resulting from tensor splitting

    Czech Academy of Sciences Publication Activity Database

    Kafka, Vratislav

    2015-01-01

    Roč. 60, č. 4 (2015), s. 319-335 ISSN 0001-7043 Institutional support: RVO:68378297 Keywords : fracture mechanics * combination of crack-growth modes * non-local effect * tensor splitting Subject RIV: JL - Materials Fatigue, Friction Mechanics http://journal.it.cas.cz/60(15)4-Contents/60(15)4a.pdf

  10. The Case of Missing Solar Neutrinos with their Split Personalities

    Indian Academy of Sciences (India)

    The Case of Missing Solar Neutrinos with their Split Personalities. ~~~'<,. ~. The Case of Missing Solar Neutrinos ... general theory of relativity and the observed precession of the perihelion of Mercury was a great triumph ..... neutrino counting rate, by nearly a factor of 3 over the. SSM prediction, constitutes the solar neutrino ...

  11. Splitting and Projection: Drawing on Psychodynamics in Educational Psychology Practice

    Science.gov (United States)

    Pellegrini, Dario W.

    2010-01-01

    This paper reflects the author's journey into an area of psychology which is not dominant in Educational Psychology discourse, namely psychodynamic psychology. Two psychodynamic mechanisms, namely splitting and projection are explained, and then the author describes and critiques how these mechanisms have proved useful in his practice. Two case…

  12. Split-Framework in Mandibular Implant-Supported Prosthesis

    Directory of Open Access Journals (Sweden)

    Danny Omar Mendoza Marin

    2015-01-01

    Full Text Available During oral rehabilitation of an edentulous patient with an implant-supported prosthesis, mandibular flexure must be considered an important biomechanical factor when planning the metal framework design, especially if implants are installed posterior to the interforaminal region. When an edentulous mandible is restored with a fixed implant-supported prosthesis connected by a fixed full-arch framework, mandibular flexure may cause needless stress in the overall restorative system and lead to screw loosening, poor fit of prosthesis, loss of the posterior implant, and patient’s discomfort due to deformation properties of the mandible during functional movements. The use of a split-framework could decrease the stress with a precise and passive fit on the implants and restore a more natural functional condition of the mandible, helping in the longevity of the prosthesis. Therefore, the present clinical report describes the oral rehabilitation of an edentulous patient by a mandibular fixed implant-supported prosthesis with a split-framework to compensate for mandibular flexure. Clinical Significance. The present clinical report shows that the use of a split-framework reduced the risk of loss of the posterior implants or screws loosening with acceptable patient comfort over the period of a year. The split-framework might have compensated for the mandibular flexure during functional activities.

  13. Transient Splitting of Conoscopic Isogyres of a Uniaxial Nematic

    Science.gov (United States)

    Kim, Young-Ki; Senuk, Bohdan; Tortora, Luana; Sprunt, Samuel; Lehmann, Matthias; Lavrentovich, Oleg D.

    2012-02-01

    The phase identification is often based on conoscopic observations of homeotropic cells: A uniaxial nematic produces a pattern with crossed isogyres, while the biaxial nematic shows a split of isogyres. We demonstrate that the splitting of isogyres occurs even when the material remains in the uniaxial nematic phase. In particular, in the bent core material J35, splitting of isogyres is caused by change of the temperature. The effect is transient and the isogyres return to a uniaxial (crossed) configuration after a certain time that depends on sample thickness, temperature, and rate of temperature change; the time varies from a few seconds to tens of hours. The transient splitting is caused by the temperature-induced material flow that triggers a (uniaxial) director tilt in the cell. The flows and the director tilt are demonstrated by the CARS microscopy and fluorescent confocal polarizing microscopy (FCPM). This transient effect is general and can be observed even in E7 and 5CB. The effect should be considered in textural identifications of potential biaxial nematic materials.

  14. Mass Communication and Ticket Splitting in the 1972 General Election.

    Science.gov (United States)

    Atwood, L. Erwin; Sanders, Keith R.

    There is evidence of a growing trend toward ticket splitting, or independent voting patterns in all U.S. elections, especially in recent years. Independence of the electorate in 1972 was visible in the large Republican vote for President, during substantial voting for Democrats in Congress, and in gubernatorial elections. Analysis of mass media…

  15. Trellis plots as visual aids for analyzing split plot experiments

    DEFF Research Database (Denmark)

    Kulahci, Murat; Menon, Anil

    2017-01-01

    The analysis of split plot experiments can be challenging due to a complicated error structure resulting from restrictions on complete randomization. Similarly, standard visualization methods do not provide the insight practitioners desire to understand the data, think of explanations, generate h...

  16. A cyclic iterative method for solving multiple sets split feasibility ...

    African Journals Online (AJOL)

    (An iterative regularization method for the solution of the split feasibility problem in Banach spaces, Inverse Problems 24 (2008), 055008) and many important recent results in this direction. Mathematics Subject Classification (2010): 49J53, 65K10, 49M37, 90C25. Keywords: Bregman projection, strong convergence, metric ...

  17. Degloved foot sole successfully reconstructed with split thickness skin grafts

    NARCIS (Netherlands)

    Janssens, Loes; Holtslag, Herman R.; Schellekens, Pascal P A; Leenen, Luke P H

    2015-01-01

    Introduction The current opinion is that split thickness skin grafts are not suitable to reconstruct a degloved foot sole. The tissue is too fragile to carry full bodyweight; and therefore, stress lesions frequently occur. The treatment of choice is the reuse of the avulsed skin whenever possible,

  18. The split notochord syndrome with dorsal enteric fistula.

    Science.gov (United States)

    Hoffman, C H; Dietrich, R B; Pais, M J; Demos, D S; Pribram, H F

    1993-01-01

    Split notochord syndrome with dorsal enteric fistula is an extremely rare congenital anomaly that may be associated with meningomyelocele or meningocele, and genitourinary anomalies. This case presented with an additional finding of bladder exstrophy, raising the possibility of a relationship between this syndrome and the OEIS complex.

  19. Recent developments in solar H 2 generation from water splitting

    Indian Academy of Sciences (India)

    Hydrogen production from water and sunlight through photocatalysis could become one of the channels, in the not-so-distant future, to meet a part of ever growing energy demands. However, accomplishing solar water splitting through semiconductor particulate photocatalysis seems to be the 'Holy Grail' problem of science.

  20. Iterative group splitting algorithm for opportunistic scheduling systems

    KAUST Repository

    Nam, Haewoon

    2014-05-01

    An efficient feedback algorithm for opportunistic scheduling systems based on iterative group splitting is proposed in this paper. Similar to the opportunistic splitting algorithm, the proposed algorithm adjusts (or lowers) the feedback threshold during a guard period if no user sends a feedback. However, when a feedback collision occurs at any point of time, the proposed algorithm no longer updates the threshold but narrows down the user search space by dividing the users into multiple groups iteratively, whereas the opportunistic splitting algorithm keeps adjusting the threshold until a single user is found. Since the threshold is only updated when no user sends a feedback, it is shown that the proposed algorithm significantly alleviates the signaling overhead for the threshold distribution to the users by the scheduler. More importantly, the proposed algorithm requires a less number of mini-slots than the opportunistic splitting algorithm to make a user selection with a given level of scheduling outage probability or provides a higher ergodic capacity given a certain number of mini-slots. © 2013 IEEE.

  1. Fundaments of transport equation splitting and the eigenvalue problem

    International Nuclear Information System (INIS)

    Stancic, V.

    2000-01-01

    In order to remove some singularities concerning the boundary conditions of one dimensional transport equation, a split form of transport equation describing the forward i.e. μ≥0, and a backward μ<0 directed neutrons is being proposed here. The eigenvalue problem has also been considered here (author)

  2. Split-mouth design in Paediatric Dentistry clinical trials.

    Science.gov (United States)

    Pozos-Guillén, A; Chavarría-Bolaños, D; Garrocho-Rangel, A

    2017-03-01

    The aim of this article was to describe the essential concepts of the split-mouth design, its underlying assumptions, advantages, limitations, statistical considerations, and possible applications in Paediatric Dentistry clinical investigation. In Paediatric Dentistry clinical investigation, and as part of randomised controlled trials, the split-mouth design is commonly used. The design is characterised by subdividing the child's dentition into halves (right and left), where two different treatment modalities are assigned to one side randomly, in order to allow further outcome evaluation. Each participant acts as their own control by making within- patient rather than between-patient comparisons, thus diminishing inter-subject variability and increasing study accuracy and power. However, the main problem with this design comprises the potential contamination of the treatment effect from one side to the other, or the "carry-across effect"; likewise, this design is not indicated when the oral disease to be treated is not symmetrically distributed (e.g. severity) in the mouth of children. Thus, in spite of its advantages, the split-mouth design can only be applied in a limited number of strictly selected cases. In order to obtain valid and reliable data from split mouth design studies, it is necessary to evaluate the risk of carry-across effect as well as to carefully analise and select adequate inclusion criteria, sample-size calculation and method of statistical analysis.

  3. Visible-light-induced water splitting on a chip

    NARCIS (Netherlands)

    Zoontjes, M.G.C.

    2015-01-01

    In this thesis, a photoelectrochemical water splitting cell concept is discussed, based on a combination of semiconductors comprising a Z-scheme. The motivation for the development of the cell is that in the future a transition will take place from a fossil fuel-based economy, to an economy based on

  4. Higgs, Binos and Gluinos: Split Susy within Reach

    Energy Technology Data Exchange (ETDEWEB)

    Alves, Daniele S.M.; Izaguirre, Eder; /SLAC /Stanford U., Phys. Dept.; Wacker, Jay G.; /SLAC /Stanford U., ITP

    2012-09-14

    Recent results from the LHC for the Higgs boson with mass between 142 GeV {approx}< m{sub h{sup 0}} {approx}< 147 GeV points to PeV-scale Split Supersymmetry. This article explores the consequences of a Higgs mass in this range and possible discovery modes for Split Susy. Moderate lifetime gluinos, with decay lengths in the 25 {micro}m to 10 yr range, are its imminent smoking gun signature. The 7TeV LHC will be sensitive to the moderately lived gluinos and trilepton signatures from direct electroweakino production. Moreover, the dark matter abundance may be obtained from annihilation through an s-channel Higgs resonance, with the LSP almost purely bino and mass m{sub {chi}{sub 1}{sup 0}} {approx_equal} 70 GeV. The Higgs resonance region of Split Susy has visible signatures in dark matter direct and indirect detection and electric dipole moment experiments. If the anomalies go away, the majority of Split Susy parameter space will be excluded.

  5. On split Lie algebras with symmetric root systems

    Indian Academy of Sciences (India)

    , Spain. E-mail: ajesus.calderon@uca.es. MS received 24 May 2007. Abstract. We develop techniques of connections of roots for split Lie algebras with symmetric root systems. We show that any of such algebras L is of the form L = U +. ∑.

  6. Reduction of Biomass Moisture by Crushing/Splitting - A Concept

    Science.gov (United States)

    Paul E. Barnett; Donald L. Sirois; Colin Ashmore

    1986-01-01

    A biomass crusher/splitter concept is presented as a possible n&ant of tsafntainfng rights-of-way (ROW) or harvesting energy wood plantations. The conceptual system would cut, crush, and split small woody biomass leaving it in windrows for drying. A subsequent operation would bale and transport the dried material for use as an energy source. A survey of twenty...

  7. Robustness of the Rabi Splitting under Nonlocal Corrections in Plexcitonics

    DEFF Research Database (Denmark)

    Tserkezis, Christos; Wubs, Martijn; Mortensen, N. Asger

    2018-01-01

    , the influence of nonlocality is rather limited, as in most occasions the width of the Rabi splitting remains largely unaffected and the two hybrid modes are well distinguishable. We discuss how this behavior can be understood in view of the popular coupled-harmonic-oscillator model, while we also provide...

  8. Ductless Mini-Split Heat Pump Comfort Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Roth, K.; Sehgal, N.; Akers, C.

    2013-03-01

    Field tests were conducted in two homes in Austin, TX to evaluate the comfort performance of ductless mini-split heat pumps (DMSHPs), measuring temperature and relative humidity measurements in four rooms in each home before and after retrofitting a central HVAC system with DMSHPs.

  9. Roadmap on solar water splitting: current status and future prospects

    Science.gov (United States)

    Chu, Sheng; Li, Wei; Yan, Yanfa; Hamann, Thomas; Shih, Ishiang; Wang, Dunwei; Mi, Zetian

    2017-09-01

    Artificial photosynthesis via solar water splitting provides a promising approach to storing solar energy in the form of hydrogen on a global scale. However, an efficient and cost-effective solar hydrogen production system that can compete with traditional methods using fossil fuels is yet to be developed. A photoelectrochemical (PEC) tandem cell consisting of a p-type photocathode and an n-type photoanode, with the photovoltage provided by the two photoelectrodes, is an attractive route to achieve highly efficient unassisted water splitting at a low cost. In this article, we provide an overview of recent developments of semiconductor materials, including metal oxides, nitrides, chalcogenides, Si, III-V compounds and organics, either as photocathodes or photoanodes for water reduction and oxidation, respectively. In addition, recent efforts in constructing a PEC tandem system for unassisted water splitting are outlined. The importance of developing a single-photon photocathode and photoanode that can deliver high photocurrent in the low bias region for efficient PEC tandem system is highlighted. Finally, we discuss the future development of photoelectrode materials, and viable solutions to realize highly efficient PEC water splitting device for practical applications.

  10. Recent developments in solar H2 generation from water splitting

    Indian Academy of Sciences (India)

    Abstract. Hydrogen production from water and sunlight through photocatalysis could become one of the channels, in the not-so-distant future, to meet a part of ever growing energy demands. However, accomplish- ing solar water splitting through semiconductor particulate photocatalysis seems to be the 'Holy Grail' prob-.

  11. The Case of Missing Solar Neutrinos with their Split Personalities

    Indian Academy of Sciences (India)

    The Case of Missing Solar Neutrinos with their Split Personalities. S M Chitre is a Senior. Professor at Tata Institute of Fundamental Research,. Mumbai. His research interests are in the areas of solar physics, physics and astrophysics of condensed objects and gravitational lenses. Keywords. Neutrino. Sun, solar structure.

  12. Modelling of Split Condenser Heat Pump: Optimization and Exergy Analysis

    DEFF Research Database (Denmark)

    Christensen, Stefan Wuust; Elmegaard, Brian; Markussen, Wiebke Brix

    2017-01-01

    This paper presents a numerical study of a split condenser heat pump (SCHP). The SCHP setup differs from a traditional heat pump (THP) setup in the way that two separate water streams on the secondary side of the condenser are heated in parallel to different temperature levels, whereas only one s...

  13. On Split Lie Algebras with Symmetric Root Systems

    Indian Academy of Sciences (India)

    ... and any I j a well described ideal of , satisfying [ I j , I k ] = 0 if j ≠ k . Under certain conditions, the simplicity of is characterized and it is shown that is the direct sum of the family of its minimal ideals, each one being a simple split Lie algebra with a symmetric root system and having all its nonzero roots connected.

  14. On split Lie algebras with symmetric root systems

    Indian Academy of Sciences (India)

    ideal of L, satisfying [Ij ,Ik] = 0 if j = k. Under certain conditions, the simplicity of L is characterized and it is shown that L is the direct sum of the family of its minimal ideals, each one being a simple split Lie algebra with a symmetric root system and having all its nonzero roots connected. Keywords. Infinite dimensional Lie ...

  15. On split Lie algebras with symmetric root systems

    Indian Academy of Sciences (India)

    ... family of its minimal ideals, each one being a simple split Lie algebra with a symmetric root system and having all its nonzero roots connected. Author Affiliations. Antonio J Calderón Martín1. Departamento de Matemáticas, Universidad de Cádiz, 11510 Puerto Real, Cádiz, Spain. Dates. Manuscript received: 24 May 2007 ...

  16. Use of computed tomography assessed kidney length to predict split renal GFR in living kidney donors

    International Nuclear Information System (INIS)

    Gaillard, Francois; Fournier, Catherine; Leon, Carine; Legendre, Christophe; Pavlov, Patrik; Tissier, Anne-Marie; Correas, Jean-Michel; Harache, Benoit; Hignette, Chantal; Weinmann, Pierre; Eladari, Dominique; Timsit, Marc-Olivier; Mejean, Arnaud; Friedlander, Gerard; Courbebaisse, Marie; Houillier, Pascal

    2017-01-01

    Screening of living kidney donors may require scintigraphy to split glomerular filtration rate (GFR). To determine the usefulness of computed tomography (CT) to split GFR, we compared scintigraphy-split GFR to CT-split GFR. We evaluated CT-split GFR as a screening test to detect scintigraphy-split GFR lower than 40 mL/min/1.73 m 2 /kidney. This was a monocentric retrospective study on 346 potential living donors who had GFR measurement, renal scintigraphy, and CT. We predicted GFR for each kidney by splitting GFR using the following formula: Volume-split GFR for a given kidney = measured GFR*[volume of this kidney/(volume of this kidney + volume of the opposite kidney)]. The same formula was used for length-split GFR. We compared length- and volume-split GFR to scintigraphy-split GFR at donation and with a 4-year follow-up. A better correlation was observed between length-split GFR and scintigraphy-split GFR (r = 0.92) than between volume-split GFR and scintigraphy-split GFR (r = 0.89). A length-split GFR threshold of 45 mL/min/1.73 m 2 /kidney had a sensitivity of 100 % and a specificity of 75 % to detect scintigraphy-split GFR less than 40 mL/min/1.73 m 2 /kidney. Both techniques with their respective thresholds detected living donors with similar eGFR evolution during follow-up. Length-split GFR can be used to detect patients requiring scintigraphy. (orig.)

  17. Use of computed tomography assessed kidney length to predict split renal GFR in living kidney donors

    Energy Technology Data Exchange (ETDEWEB)

    Gaillard, Francois; Fournier, Catherine; Leon, Carine; Legendre, Christophe [Paris Descartes University, AP-HP, Hopital Necker-Enfants Malades, Renal Transplantation Department, Paris (France); Pavlov, Patrik [Linkoeping University, Linkoeping (Sweden); Tissier, Anne-Marie; Correas, Jean-Michel [Paris Descartes University, AP-HP, Hopital Necker-Enfants Malades, Radiology Department, Paris (France); Harache, Benoit; Hignette, Chantal; Weinmann, Pierre [Paris Descartes University, AP-HP, Hopital Europeen Georges Pompidou, Nuclear Medicine Department, Paris (France); Eladari, Dominique [Paris Descartes University, and INSERM, Unit 970, AP-HP, Hopital Europeen Georges Pompidou, Physiology Department, Paris (France); Timsit, Marc-Olivier; Mejean, Arnaud [Paris Descartes University, AP-HP, Hopital Europeen Georges Pompidou, Urology Department, Paris (France); Friedlander, Gerard; Courbebaisse, Marie [Paris Descartes University, and INSERM, Unit 1151, AP-HP, Hopital Europeen Georges Pompidou, Physiology Department, Paris (France); Houillier, Pascal [Paris Descartes University, INSERM, Unit umrs1138, and CNRS Unit erl8228, AP-HP, Hopital Europeen Georges Pompidou, Physiology Department, Paris (France)

    2017-02-15

    Screening of living kidney donors may require scintigraphy to split glomerular filtration rate (GFR). To determine the usefulness of computed tomography (CT) to split GFR, we compared scintigraphy-split GFR to CT-split GFR. We evaluated CT-split GFR as a screening test to detect scintigraphy-split GFR lower than 40 mL/min/1.73 m{sup 2}/kidney. This was a monocentric retrospective study on 346 potential living donors who had GFR measurement, renal scintigraphy, and CT. We predicted GFR for each kidney by splitting GFR using the following formula: Volume-split GFR for a given kidney = measured GFR*[volume of this kidney/(volume of this kidney + volume of the opposite kidney)]. The same formula was used for length-split GFR. We compared length- and volume-split GFR to scintigraphy-split GFR at donation and with a 4-year follow-up. A better correlation was observed between length-split GFR and scintigraphy-split GFR (r = 0.92) than between volume-split GFR and scintigraphy-split GFR (r = 0.89). A length-split GFR threshold of 45 mL/min/1.73 m{sup 2}/kidney had a sensitivity of 100 % and a specificity of 75 % to detect scintigraphy-split GFR less than 40 mL/min/1.73 m{sup 2}/kidney. Both techniques with their respective thresholds detected living donors with similar eGFR evolution during follow-up. Length-split GFR can be used to detect patients requiring scintigraphy. (orig.)

  18. Methane splitting in the K plant at Heydebreck

    Energy Technology Data Exchange (ETDEWEB)

    1942-03-09

    This report consisted of two major topics. The first was methane splitting in equipment for gas for distant transmission. The amount to be split was 3500 m/sup 3//hr methane per system. The temperature in the converter outlet was 850/sup 0/C and the methane was preheated to 650/sup 0/C. The results of this showed oxygen requirements to be 0.487 m/sup 3//m/sup 3/ of methane, steam requirements to be 0.529 kg/m/sup 3/ of methane, condensate requirements to be 0.518 kg/m/sup 3/ of methane, and cooling-water requirements to be 16 kg/m/sup 3/ of methane. The second topic was methane splitting in equipment for long-distance gas with additional indirect cooling. A summary showed the oxygen requirements to be 0.487 m/sup 3//m/sup 3/ of methane, steam requirements to be 0.107 kg/m/sup 3/ of methane, condensate requirements to be 0.526 kg/m/sup 3/ of methane, and cooling-water requirements to be 9.6 kg/m/sup 3/ of methane. The items discussed for each topic included calculations of methane converters, which included oxygen requirements and a heat balance of the converter; cooling of the split gas, which included heat content of the split gas at the catalyst converter outlet and heat exchangers; and the cooler-vaporizer system, which included a heat balance of the water circuit, determination of the amount of water in the cooler-vaporizer, and final cooling. 3 figures.

  19. Split quaternions and semi-Euclidean projective spaces

    Energy Technology Data Exchange (ETDEWEB)

    Ata, Erhan [Department of Mathematics, Dumlupinar University, 43100 Kutahya (Turkey); Department of Mathematics, Ankara University, 06100 Ankara (Turkey)], E-mail: eata@dumlupinar.edu.tr; Yayli, Yusuf [Department of Mathematics, Dumlupinar University, 43100 Kutahya (Turkey); Department of Mathematics, Ankara University, 06100 Ankara (Turkey)

    2009-08-30

    In this study, we give one-to-one correspondence between the elements of the unit split three-sphere S(3,2) with the complex hyperbolic special unitary matrices SU(2,1). Thus, we express spherical concepts such as meridians of longitude and parallels of latitude on SU(2,1) by using the method given in Toth [Toth G. Glimpses of algebra and geometry. Springer-Verlag; 1998] for S{sup 3}. The relation among the special orthogonal group SO(R{sup 3}), the quotient group of unit quaternions S{sup 3}/{l_brace}{+-}1{r_brace} and the projective space RP{sup 3} given as SO(R{sup 3}){approx_equal}S{sup 3}/{l_brace}{+-}1{r_brace}=RP{sup 3} is known as the Euclidean projective spaces [Toth G. Glimpses of algebra and geometry. Springer-Verlag; 1998]. This relation was generalized to the semi-Euclidean projective space and then, the expression SO(3,1){approx_equal}S(3,2)/{l_brace}{+-}1{r_brace}=RP{sub 2}{sup 3} was acquired. Thus, it was found that Hopf fibriation map of S(2,1) can be used for Twistors (in not-null state) in quantum mechanics applications. In addition, the octonions and the split-octonions can be obtained from the Cayley-Dickson construction by defining a multiplication on pairs of quaternions or split quaternions. The automorphism group of the octonions is an exceptional Lie group. The split-octonions are used in the description of physical law. For example, the Dirac equation in physics (the equation of motion of a free spin 1/2 particle, like e.g. an electron or a proton) can be represented by a native split-octonion arithmetic.

  20. A parallel imaging technique using mutual calibration for split-blade diffusion-weighted PROPELLER.

    Science.gov (United States)

    Li, Zhiqiang; Pipe, James G; Aboussouan, Eric; Karis, John P; Huo, Donglai

    2011-03-01

    Split-blade diffusion-weighted periodically rotated overlapping parallel lines with enhanced reconstruction (DW-PROPELLER) was proposed to address the issues associated with diffusion-weighted echo planar imaging such as geometric distortion and difficulty in high-resolution imaging. The major drawbacks with DW-PROPELLER are its high SAR (especially at 3T) and violation of the Carr-Purcell-Meiboom-Gill condition, which leads to a long scan time and narrow blade. Parallel imaging can reduce scan time and increase blade width; however, it is very challenging to apply standard k-space-based techniques such as GeneRalized Autocalibrating Partially Parallel Acquisitions (GRAPPA) to split-blade DW-PROPELLER due to its narrow blade. In this work, a new calibration scheme is proposed for k-space-based parallel imaging method without the need of additional calibration data, which results in a wider, more stable blade. The in vivo results show that this technique is very promising. Copyright © 2010 Wiley-Liss, Inc.

  1. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  2. A structure-preserving split finite element discretization of the split 1D linear shallow-water equations

    Science.gov (United States)

    Bauer, Werner; Behrens, Jörn

    2017-04-01

    We present a locally conservative, low-order finite element (FE) discretization of the covariant 1D linear shallow-water equations written in split form (cf. tet{[1]}). The introduction of additional differential forms (DF) that build pairs with the original ones permits a splitting of these equations into topological momentum and continuity equations and metric-dependent closure equations that apply the Hodge-star. Our novel discretization framework conserves this geometrical structure, in particular it provides for all DFs proper FE spaces such that the differential operators (here gradient and divergence) hold in strong form. The discrete topological equations simply follow by trivial projections onto piecewise constant FE spaces without need to partially integrate. The discrete Hodge-stars operators, representing the discretized metric equations, are realized by nontrivial Galerkin projections (GP). Here they follow by projections onto either a piecewise constant (GP0) or a piecewise linear (GP1) space. Our framework thus provides essentially three different schemes with significantly different behavior. The split scheme using twice GP1 is unstable and shares the same discrete dispersion relation and similar second-order convergence rates as the conventional P1-P1 FE scheme that approximates both velocity and height variables by piecewise linear spaces. The split scheme that applies both GP1 and GP0 is stable and shares the dispersion relation of the conventional P1-P0 FE scheme that approximates the velocity by a piecewise linear and the height by a piecewise constant space with corresponding second- and first-order convergence rates. Exhibiting for both velocity and height fields second-order convergence rates, we might consider the split GP1-GP0 scheme though as stable versions of the conventional P1-P1 FE scheme. For the split scheme applying twice GP0, we are not aware of a corresponding conventional formulation to compare with. Though exhibiting larger

  3. Pharmaceutical counselling about different types of tablet-splitting methods based on the results of weighing tests and mechanical development of splitting devices.

    Science.gov (United States)

    Somogyi, O; Meskó, A; Csorba, L; Szabó, P; Zelkó, R

    2017-08-30

    The division of tablets and adequate methods of splitting them are a complex problem in all sectors of health care. Although tablet-splitting is often required, this procedure can be difficult for patients. Four tablets were investigated with different external features (shape, score-line, film-coat and size). The influencing effect of these features and the splitting methods was investigated according to the precision and "weight loss" of splitting techniques. All four types of tablets were halved by four methods: by hand, with a kitchen knife, with an original manufactured splitting device and with a modified tablet splitter based on a self-developed mechanical model. The mechanical parameters (harness and friability) of the products were measured during the study. The "weight loss" and precision of splitting methods were determined and compared by statistical analysis. On the basis of the results, the external features (geometry), the mechanical parameters of tablets and the mechanical structure of splitting devices can influence the "weight loss" and precision of tablet-splitting. Accordingly, a new decision-making scheme was developed for the selection of splitting methods. In addition, the skills of patients and the specialties of therapy should be considered so that pharmaceutical counselling can be more effective regarding tablet-splitting. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Investigation of the Effects of Split Sleep Schedules on Commercial Vehicle Driver Safety and Health

    Science.gov (United States)

    2012-12-01

    The objective of this study was to evaluate the consequences for safety and health of split sleep versus consolidated sleep by comparing the effects of consolidated nighttime sleep, split sleep, and consolidated daytime sleep on total sleep time, per...

  5. Selective isolation and detailed analysis of intra-RNA cross-links induced in the large ribosomal subunit of E. coli: a model for the tertiary structure of the tRNA binding domain in 23S RNA.

    OpenAIRE

    Mitchell, P; Osswald, M; Schueler, D; Brimacombe, R

    1990-01-01

    Intramolecular RNA cross-links were induced within the large ribosomal subunit of E. coli by mild ultraviolet irradiation. Regions of the 23S RNA previously implicated in interactions with ribosomal-bound tRNA were then specifically excised by addressed cleavage using ribonuclease H, in conjunction with synthetic complementary decadeoxyribonucleotides. Individual cross-linked fragments within these regions released by such 'directed digests' were isolated by two-dimensional gel electrophoresi...

  6. Spin-valley splitting of electron beam in graphene

    Directory of Open Access Journals (Sweden)

    Yu Song

    2016-11-01

    Full Text Available We study spatial separation of the four degenerate spin-valley components of an electron beam in a EuO-induced and top-gated ferromagnetic/pristine/strained graphene structure. We show that, in a full resonant tunneling regime for all beam components, the formation of standing waves can lead sudden phase jumps ∼−π and giant lateral Goos-Hänchen shifts as large as the transverse beam width, while the interplay of the spin and valley imaginary wave vectors in the modulated regions can lead differences of resonant angles for the four spin-valley flavors, manifesting a spin-valley beam splitting effect. The splitting effect is found to be controllable by the gating and strain.

  7. Chargino pair production at linear collider and split supersymmetry

    International Nuclear Information System (INIS)

    Zhu Shouhua

    2004-01-01

    Recently Arkani-Hamed and Dimopoulos proposed a supersymmetric model [hep-th/0405159], dubbed 'Split supersymmetry' in [hep-ph/0406088], which can remove most of the unpleasant shortcomings of TeV Supersymmetry. In this model all scalars except one finely tuned Higgs boson are ultra heavy while the neutralino and chargino might remain light in order to achieve gauge coupling unification and accord with the dark matter density. In this Letter, we investigated the impact of this new model on chargino pair production at next generation linear colliders. Our numerical results show that this process can be used to probe sneutrino mass up to 10 TeV. Therefore, precise measurements of chargino pair production at the linear colliders could distinguish split supersymmetry from TeV supersymmetry

  8. Using Protection Layers for a 2-Photon Water Splitting Device

    DEFF Research Database (Denmark)

    Seger, Brian; Mei, Bastian Timo; Frydendal, Rasmus

    2015-01-01

    The 2-photon tandem device for photocatalytic water splitting has been theoretically shown to provide a higher efficiency than a single photon device(1). This increased efficiency can be achieved by having one material optimized to absorb high energy photons (large bandgap) and another material...... optimized to absorb low energy photons (small bandgap). To a large degree this approach has been hindered by corrosion issues. In this talk I will first discuss how our computational screening of 2,400 materials showed that very few materials can efficiently absorb light without corroding in water splitting...... conditions.(2) I will follow this up by discussing how protection layers bypass the corrosion issue by creating a buffer layer.(3) Finally I will show how we integrated a photocatalyst/protection layer/(co-catalyst) scheme to produce highly efficient H2 evolution photocathodes and O2 evolution photoanodes.(3...

  9. Photoelectrochemical water splitting standards, experimental methods, and protocols

    CERN Document Server

    Chen, Zhebo; Miller, Eric

    2014-01-01

    This book outlines many of the techniques involved in materials development and characterization for photoelectrochemical (PEC) - for example, proper metrics for describing material performance, how to assemble testing cells and prepare materials for assessment of their properties, and how to perform the experimental measurements needed to achieve reliable results towards better scientific understanding. For each technique, proper procedure, benefits, limitations, and data interpretation are discussed. Consolidating this information in a short, accessible, and easy to read reference guide will allow researchers to more rapidly immerse themselves into PEC research and also better compare their results against those of other researchers to better advance materials development. This book serves as a "how-to" guide for researchers engaged in or interested in engaging in the field of photoelectrochemical (PEC) water splitting. PEC water splitting is a rapidly growing field of research in which the goal is to deve...

  10. Photochemical water splitting mediated by a C1 shuttle

    KAUST Repository

    Alderman, N. P.

    2016-10-31

    The possibility of performing photochemical water splitting in a two-stage system, separately releasing the H and O components, has been probed with two separate catalysts and in combination with a formaldehyde/formate shuttling redox couple. In the first stage, formaldehyde releases hydrogen vigorously in the presence of an Na[Fe(CN)]·10HO catalyst, selectively affording the formate anion. In the second stage, the formate anion is hydro-genated back to formaldehyde by water and in the presence of a BiWO photocatalyst whilst releasing oxygen. Both stages operate at room temperature and under visible light irradiation. The two separate photocatalysts are compatible since water splitting can also be obtained in one-pot experiments with simultaneous H/O evolution.

  11. Toward visible light response: Overall water splitting using heterogeneous photocatalysts

    KAUST Repository

    Takanabe, Kazuhiro

    2011-01-01

    Extensive energy conversion of solar energy can only be achieved by large-scale collection of solar flux. The technology that satisfies this requirement must be as simple as possible to reduce capital cost. Overall water splitting by powder-form photocatalysts directly produces a mixture of H 2 and O2 (chemical energy) in a single reactor, which does not require any complicated parabolic mirrors and electronic devices. Because of its simplicity and low capital cost, it has tremendous potential to become the major technology of solar energy conversion. Development of highly efficient photocatalysts is desired. This review addresses why visible light responsive photocatalysts are essential to be developed. The state of the art for the photocatalysts for overall water splitting is briefly described. Moreover, various fundamental aspects for developing efficient photocatalysts, such as particle size of photocatalysts, cocatalysts, and reaction kinetics are discussed. Copyright © 2011 De Gruyter.

  12. Photoelectrochemical water splitting in separate oxygen and hydrogen cells

    Science.gov (United States)

    Landman, Avigail; Dotan, Hen; Shter, Gennady E.; Wullenkord, Michael; Houaijia, Anis; Maljusch, Artjom; Grader, Gideon S.; Rothschild, Avner

    2017-06-01

    Solar water splitting provides a promising path for sustainable hydrogen production and solar energy storage. One of the greatest challenges towards large-scale utilization of this technology is reducing the hydrogen production cost. The conventional electrolyser architecture, where hydrogen and oxygen are co-produced in the same cell, gives rise to critical challenges in photoelectrochemical water splitting cells that directly convert solar energy and water to hydrogen. Here we overcome these challenges by separating the hydrogen and oxygen cells. The ion exchange in our cells is mediated by auxiliary electrodes, and the cells are connected to each other only by metal wires, enabling centralized hydrogen production. We demonstrate hydrogen generation in separate cells with solar-to-hydrogen conversion efficiency of 7.5%, which can readily surpass 10% using standard commercial components. A basic cost comparison shows that our approach is competitive with conventional photoelectrochemical systems, enabling safe and potentially affordable solar hydrogen production.

  13. Protein subcellular localization assays using split fluorescent proteins

    Science.gov (United States)

    Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

    2009-09-08

    The invention provides protein subcellular localization assays using split fluorescent protein systems. The assays are conducted in living cells, do not require fixation and washing steps inherent in existing immunostaining and related techniques, and permit rapid, non-invasive, direct visualization of protein localization in living cells. The split fluorescent protein systems used in the practice of the invention generally comprise two or more self-complementing fragments of a fluorescent protein, such as GFP, wherein one or more of the fragments correspond to one or more beta-strand microdomains and are used to "tag" proteins of interest, and a complementary "assay" fragment of the fluorescent protein. Either or both of the fragments may be functionalized with a subcellular targeting sequence enabling it to be expressed in or directed to a particular subcellular compartment (i.e., the nucleus).

  14. Image segmentation by iterative parallel region growing and splitting

    Science.gov (United States)

    Tilton, James C.

    1989-01-01

    The spatially constrained clustering (SCC) iterative parallel region-growing technique is applied to image analysis. The SCC algorithm is implemented on the massively parallel processor at NASA Goddard. Most previous region-growing approaches have the drawback that the segmentation produced depends on the order in which portions of the image are processed. The ideal solution to this problem (merging only the single most similar pair of spatially adjacent regions in the image in each iteration) becomes impractical except for very small images, even on a massively parallel computer. The SCC algorithm overcomes these problems by performing, in parallel, the best merge within each of a set of local, possibly overlapping, subimages. A region-splitting stage is also incorporated into the algorithm, but experiments show that region splitting generally does not improve segmentation results. The SCC algorithm has been tested on various imagery data, and test results for a Landsat TM image are summarized.

  15. Isospin Mass Splittings and the $\\ms$ Corrections in the Semibosonized SU(3)-NJL-Model

    OpenAIRE

    Blotz, Andree; Goeke, K.; Praszalowicz, M.

    1994-01-01

    The mass splittings of hyperons including the isospin splittings are calculated with $O(\\ms^2)$ and $O(\\ms \\dm)$ accuracy respectively within the semibosonized SU(3)-NJL model. The pattern of the isospin splittings is not spoiled by the terms of the order $O(\\ms \\dm)$, and both splittings between the different isospin multiplets and within the same multiplet are well reproduced for acceptable values of $\\ms$ and $\\dm$.

  16. Peptidyl transferase antibiotics perturb the relative positioning of the 3'-terminal adenosine of P/P'-site-bound tRNA and 23S rRNA in the ribosome

    DEFF Research Database (Denmark)

    Kirillov, S V; Porse, B T; Garrett, R A

    1999-01-01

    A range of antibiotic inhibitors that act within the peptidyl transferase center of the ribosome were examined for their capacity to perturb the relative positioning of the 3' end of P/P'-site-bound tRNA and the Escherichia coli ribosome. The 3'-terminal adenosines of deacylated tRNA and N...... decreases, at one or more rRNA sites but, with the exception of chloramphenicol, did not affect cross-linking to the ribosomal proteins. Moreover, the effects were closely similar for both deacylated and N-Ac-Phe-tRNAs, indicating that the drugs selectively perturb the 3' terminus of the tRNA. The strongest...... decreases in the rRNA cross-links were observed with pristinamycin IIA and chloramphenicol, which correlates with their both producing complex chemical footprints on 23S rRNA within E. coli ribosomes. Furthermore, gougerotin and pristinamycin IA strongly increased the yields of fragments F2' (U2506) and F4...

  17. Transfer Pricing Profit Split Methods : A Practical Solution?

    OpenAIRE

    Quttineh, Yousef

    2009-01-01

    The purpose of this master’s thesis is to explain and analyze whether today’s existing regulations provide sufficient guidance on how to apply the Profit Split Method (PSM) in practice. Since the enterprises’ profits arising from intra-group transactions increases, the tax base for any government also becomes larger and more important. This issue will likely become even more problematic as the globalization branches out and the majority of the global trade is undertaken between associated ent...

  18. Left-right splitting for electromagnetic scattering in 3D

    CERN Document Server

    Spivack, M; Sillence, C; 10.1049/ip-smt:20040945

    2004-01-01

    The left-right splitting method and its application to electromagnetic scattering by large 3D scatterers are described. Exact numerical solutions to the governing integral equations can be prohibitively expensive for large scatterers. Under the assumption that energy is predominantly forward-scattered, the solution is expressed as a series of terms, each of which is rapidly and efficiently evaluated. In many cases only one or two terms are needed, and the formulation provides additional physical insight.

  19. Chitosan Nanoparticle Encapsulated Hemagglutinin-Split Influenza Virus Mucosal Vaccine

    OpenAIRE

    Sawaengsak, Chompoonuch; Mori, Yasuko; Yamanishi, Koichi; Mitrevej, Ampol; Sinchaipanid, Nuttanan

    2013-01-01

    Subunit/split influenza vaccines are less reactogenic compared with the whole virus vaccines. However, their immunogenicity is relatively low and thus required proper adjuvant and/or delivery vehicle for immunogenicity enhancement. Influenza vaccines administered intramuscularly induce minimum, if any, mucosal immunity at the respiratory mucosa which is the prime site of the infection. In this study, chitosan (CS) nanoparticles were prepared by ionic cross-linking of the CS with sodium tripol...

  20. Point splitting regularization of classical string field theory

    International Nuclear Information System (INIS)

    Strominger, A.

    1987-01-01

    We regulate Witten's star algebra using point splitting and conformal field theory techniques. Certain products of nonassociative operators and states are defined. This involves a refinement of star that exists in cases where Witten's star is ill-defined. A simple derivation of a recently discovered associativity anomaly is given. It is shown that there is no anomaly obstructing the equivalence of Witten's string theory action and the cubic action for string fields in the open string Fock space. (orig.)

  1. Shear-wave splitting measurements – Problems and solutions

    Czech Academy of Sciences Publication Activity Database

    Vecsey, Luděk; Plomerová, Jaroslava; Babuška, Vladislav

    2008-01-01

    Roč. 462, č. 1-4 (2008), s. 178-196 ISSN 0040-1951 R&D Projects: GA AV ČR(CZ) KJB300120605; GA AV ČR IAA3012405; GA AV ČR IAA300120709 Institutional research plan: CEZ:AV0Z30120515 Keywords : seismic anisotropy * shear-wave splitting * comparison of cross- correlation * eigenvalue * transverse minimization methods Subject RIV: DC - Siesmology, Volcanology, Earth Structure Impact factor: 1.677, year: 2008

  2. Hanford tank wastes; salt splitting: FY92 activities

    International Nuclear Information System (INIS)

    Hickman, R.G.

    1992-09-01

    For the first time, sodium nitrate was split into the nitric acid and sodium hydroxide from which it originated. Current-voltage characteristics were determined and found to be in the range normally judged to be economically feasible. Six different membranes were exposed to 1M NaOH or 1M HN0 3 for 100 days without apparent deterioration. It is concluded that this technology holds significant promise for the processing of Hanford Tank Wastes

  3. Split-based computation of majority-rule supertrees.

    Science.gov (United States)

    Kupczok, Anne

    2011-07-13

    Supertree methods combine overlapping input trees into a larger supertree. Here, I consider split-based supertree methods that first extract the split information of the input trees and subsequently combine this split information into a phylogeny. Well known split-based supertree methods are matrix representation with parsimony and matrix representation with compatibility. Combining input trees on the same taxon set, as in the consensus setting, is a well-studied task and it is thus desirable to generalize consensus methods to supertree methods. Here, three variants of majority-rule (MR) supertrees that generalize majority-rule consensus trees are investigated. I provide simple formulas for computing the respective score for bifurcating input- and supertrees. These score computations, together with a heuristic tree search minmizing the scores, were implemented in the python program PluMiST (Plus- and Minus SuperTrees) available from http://www.cibiv.at/software/plumist. The different MR methods were tested by simulation and on real data sets. The search heuristic was successful in combining compatible input trees. When combining incompatible input trees, especially one variant, MR(-) supertrees, performed well. The presented framework allows for an efficient score computation of three majority-rule supertree variants and input trees. I combined the score computation with a heuristic search over the supertree space. The implementation was tested by simulation and on real data sets and showed promising results. Especially the MR(-) variant seems to be a reasonable score for supertree reconstruction. Generalizing these computations to multifurcating trees is an open problem, which may be tackled using this framework.

  4. Split-Plot Designs with Mirror Image Pairs as Subplots

    DEFF Research Database (Denmark)

    Tyssedal, John; Kulahci, Murat; Bisgaard, Soren

    2011-01-01

    In this article we investigate two-level split-plot designs where the sub-plots consist of only two mirror image trials. Assuming third and higher order interactions negligible, we show that these designs divide the estimated effects into two orthogonal sub-spaces, separating sub-plot main effects...... appealing with effects of major interest free from full aliasing assuming that 3rd and higher order interactions are negligible....

  5. Some Fixed Points Results of Quadratic Functions in Split Quaternions

    Directory of Open Access Journals (Sweden)

    Young Chel Kwun

    2016-01-01

    Full Text Available We attempt to find fixed points of a general quadratic polynomial in the algebra of split quaternion. In some cases, we characterize fixed points in terms of the coefficients of these polynomials and also give the cardinality of these points. As a consequence, we give some simple examples to strengthen the infinitude of these points in these cases. We also find the roots of quadratic polynomials as simple consequences.

  6. Fluorescence of molecules placed near a spherical particle: Rabi splitting

    Directory of Open Access Journals (Sweden)

    M.M. Dvoynenko

    2017-12-01

    Full Text Available Theoretical study of spontaneously emitted spectra of point-like source placed near spherical Ag particle was performed. It was shown that near-field electromagnetic interaction between a point-like emitter and spherical Ag particle leads to strong coupling between them at very small emitter-metal surface distances. It was shown that values of Rabi splitting are quantitatively close to that of emitter-flat substrate interaction.

  7. Ultrafast reduction of exchange splitting in ferromagnetic nickel

    International Nuclear Information System (INIS)

    Zhang, G P; Bai, Y H; George, Thomas F

    2016-01-01

    A decade ago Rhie et al (2003 Phys. Rev. Lett . 90 247201) reported that when ferromagnetic nickel is subject to an intense ultrashort laser pulse, its exchange splitting is reduced quickly. But to simulate such reduction remains a big challenge. The popular rigid band approximation (RBA), where both the band structure and the exchange splitting are held fixed before and after laser excitation, is unsuitable for this purpose, while the time-dependent density functional theory could be time-consuming. To overcome these difficulties, we propose a time-dependent Liouville and density functional theory (TDLDFT) that integrates the time-dependent Liouville equation into the density functional theory. As a result, the excited charge density is reiterated back into the Kohn–Sham equation, and the band structure is allowed to change dynamically. Even with the ground-state density functional, a larger demagnetization than RBA is found; after we expand Ortenzi’s spin scaling method into an excited-state (laser) density functional, we find that the exchange splitting is indeed strongly reduced, as seen in the experiment. Both the majority and minority bands are shifted toward the Fermi level, but the majority shifts a lot more. The ultrafast reduction in exchange splitting occurs concomitantly with demagnetization. While our current theory is still unable to yield the same percentage loss in the spin moment as observed in the experiment, it predicts a correct trend that agrees with the experiments. With a better functional, we believe that our results can be further improved. (paper)

  8. Interpretation and inverse analysis of the wedge splitting test

    DEFF Research Database (Denmark)

    Østergaard, Lennart; Stang, Henrik

    2002-01-01

    to the wedge splitting test and that it is well suited for the interpretation of test results in terms of s(w). A fine agreement between the hinge and FEM-models has been found. It has also been found that the test and the hinge model form a solid basis for inverse analysis. The paper also discusses possible...... three dimensional problems in the experiment as well as the influence of specimen size....

  9. Split-Stirling-cycle displacer linear-electric drive

    Science.gov (United States)

    Ackermann, R. A.; Bhate, S. K.; Byrne, D. V.

    1983-01-01

    The retrofit of a 1/4-W split-Stirling cooler with a linear driven on the displacer was achieved and its performance characterized. The objective of this work was to demonstrate that a small linear motor could be designed to meet the existing envelope specifications of the cooler and that an electric linear drive on the displacer could improve the cooler's reliability and performance. The paper describes the characteristics of this motor and presents cooler test results.

  10. Mdp1, a Saccharomyces Cerevisiae Gene Involved in Mitochondrial/Cytoplasmic Protein Distribution, Is Identical to the Ubiquitin-Protein Ligase Gene Rsp5

    OpenAIRE

    Zoladek, T.; Tobiasz, A.; Vaduva, G.; Boguta, M.; Martin, N. C.; Hopper, A. K.

    1997-01-01

    Alteration of the subcellular distribution of Mod5p-I, a tRNA modification enzyme, member of the sorting isozyme family, affects tRNA-mediated nonsense suppression. Altered suppression efficiency was used to identify MDP genes, which, when mutant, change the mitochondrial/cytosolic distribution of Mod5p-I,KR6. MDP2 is the previously identified VRP1, which encodes verprolin, required for proper organization of the actin cytoskeleton. MDP3 is identical to PAN1, which encodes a protein involved ...

  11. Comparing the Dictyostelium and Entamoeba genomes reveals an ancient split in the Conosa lineage.

    Directory of Open Access Journals (Sweden)

    Jie Song

    2005-12-01

    Full Text Available The Amoebozoa are a sister clade to the fungi and the animals, but are poorly sampled for completely sequenced genomes. The social amoeba Dictyostelium discoideum and amitochondriate pathogen Entamoeba histolytica are the first Amoebozoa with genomes completely sequenced. Both organisms are classified under the Conosa subphylum. To identify Amoebozoa-specific genomic elements, we compared these two genomes to each other and to other eukaryotic genomes. An expanded phylogenetic tree built from the complete predicted proteomes of 23 eukaryotes places the two amoebae in the same lineage, although the divergence is estimated to be greater than that between animals and fungi, and probably happened shortly after the Amoebozoa split from the opisthokont lineage. Most of the 1,500 orthologous gene families shared between the two amoebae are also shared with plant, animal, and fungal genomes. We found that only 42 gene families are distinct to the amoeba lineage; among these are a large number of proteins that contain repeats of the FNIP domain, and a putative transcription factor essential for proper cell type differentiation in D. discoideum. These Amoebozoa-specific genes may be useful in the design of novel diagnostics and therapies for amoebal pathologies.

  12. A split accumulation gate architecture for silicon MOS quantum dots

    Science.gov (United States)

    Rochette, Sophie; Rudolph, Martin; Roy, Anne-Marie; Curry, Matthew; Ten Eyck, Gregory; Dominguez, Jason; Manginell, Ronald; Pluym, Tammy; King Gamble, John; Lilly, Michael; Bureau-Oxton, Chloé; Carroll, Malcolm S.; Pioro-Ladrière, Michel

    We investigate tunnel barrier modulation without barrier electrodes in a split accumulation gate architecture for silicon metal-oxide-semiconductor quantum dots (QD). The layout consists of two independent accumulation gates, one gate forming a reservoir and the other the QD. The devices are fabricated with a foundry-compatible, etched, poly-silicon gate stack. We demonstrate 4 orders of magnitude of tunnel-rate control between the QD and the reservoir by modulating the reservoir gate voltage. Last electron charging energies of app. 10 meV and tuning of the ST splitting in the range 100-200 ueV are observed in two different split gate layouts and labs. This work was performed, in part, at the Center for Integrated Nanotechnologies, an Office of Science User Facility operated for the U.S. Department of Energy (DOE) Office of Science. Sandia National Laboratories is a multi-program laboratory operated by Sandia Corporation, a Lockheed-Martin Company, for the U. S. Department of Energy under Contract No. DE-AC04-94AL85000.

  13. Photoelectrochemical devices for solar water splitting - materials and challenges.

    Science.gov (United States)

    Jiang, Chaoran; Moniz, Savio J A; Wang, Aiqin; Zhang, Tao; Tang, Junwang

    2017-07-31

    It is widely accepted within the community that to achieve a sustainable society with an energy mix primarily based on solar energy we need an efficient strategy to convert and store sunlight into chemical fuels. A photoelectrochemical (PEC) device would therefore play a key role in offering the possibility of carbon-neutral solar fuel production through artificial photosynthesis. The past five years have seen a surge in the development of promising semiconductor materials. In addition, low-cost earth-abundant co-catalysts are ubiquitous in their employment in water splitting cells due to the sluggish kinetics of the oxygen evolution reaction (OER). This review commences with a fundamental understanding of semiconductor properties and charge transfer processes in a PEC device. We then describe various configurations of PEC devices, including single light-absorber cells and multi light-absorber devices (PEC, PV-PEC and PV/electrolyser tandem cell). Recent progress on both photoelectrode materials (light absorbers) and electrocatalysts is summarized, and important factors which dominate photoelectrode performance, including light absorption, charge separation and transport, surface chemical reaction rate and the stability of the photoanode, are discussed. Controlling semiconductor properties is the primary concern in developing materials for solar water splitting. Accordingly, strategies to address the challenges for materials development in this area, such as the adoption of smart architectures, innovative device configuration design, co-catalyst loading, and surface protection layer deposition, are outlined throughout the text, to deliver a highly efficient and stable PEC device for water splitting.

  14. SKS splitting observed at Romanian broad-band seismic network

    Science.gov (United States)

    Ivan, Marian; Popa, Mihaela; Ghica, Daniela

    2008-12-01

    Shear-wave splitting results are presented for the broad-band stations of the Romanian seismic network. For stations BUC1 and CRAR (located in Moesian Platform), IAS (in East-European Platform), TIRR and CVD (in Central Dobrudja-Black Sea microplate), TIM and DRGR (in Dacia-Tisza plate, including Apuseni Mts.), BURAR, BZS and GZR (in, or very close to the Carpathian Arc), the fast directions ( φ) are around 135°. The mean delay values ( δt) of the slow wave are slightly greater for the stations placed in platform areas ( δt ~ 1.5 s) than for the stations situated in the (proximity) of Carpathians ( δt ~ 1.2 s). For the MLR station located in the South-Western part of Vrancea area, at the Carpathian Bend, the fast direction is 48°, similar to VOIR station (located in Southern Carpathians, 70 km West of MLR). At VRI and PLOR, located in the North-Eastern part of Vrancea, the fast axis is oriented approximately on North-South direction, with a possible dependence of the splitting parameters with back azimuth. At least for some stations, the splitting results are not consistent with vertical coherent lithospheric anisotropy.

  15. Photocatalytic and Photoelectrochemical Water Splitting by Inorganic Materials

    KAUST Repository

    Deng, Xiaohui

    2012-12-01

    Hydrogen has been identified as a potential energy carrier due to its high energy capacity and environmental harmlessness. Compared with hydrogen production from hydrocarbons such as methane and naphtha in a conventional hydrogen energy system, photocatalytic hydrogen evolution from water splitting offers a more economic approach since it utilizes the abundant solar irradiation as energy source and water as initial reactant. Powder photocatalyst, which generates electrons and holes under illumination, is the origin where the overall reaction happens. High solar energy conversion efficiency especially from visible range is commonly the target. Besides, cocatalyst for hydrogen and oxygen evolution is also playing an essential role in facilitating the charge separation and enhancing the kinetics. In this thesis, the objective is to achieve high energy conversion efficiency towards water splitting from diverse aspects. The third chapter focuses on a controllable method to fabricate metal pattern, which is candidate for hydrogen evolution cocatalyst while chapter 4 is on the combination of strontium titanium oxide (SrTiO3) with graphene oxide (GO) for a better photocatalytic performance. In the last chapter, photoelectrochemical water splitting by Ta3N5 photoanode and FeOOH as a novel oxygen evolution cocatalyst has been investigated.

  16. Fundamental metallurgical aspects of axial splitting in zircaloy cladding

    International Nuclear Information System (INIS)

    Chung, H. M.

    2000-01-01

    Fundamental metallurgical aspects of axial splitting in irradiated Zircaloy cladding have been investigated by microstructural characterization and analytical modeling, with emphasis on application of the results to understand high-burnup fuel failure under RIA situations. Optical microscopy, SEM, and TEM were conducted on BWR and PWR fuel cladding tubes that were irradiated to fluence levels of 3.3 x 10 21 n cm -2 to 5.9 x 10 21 n cm -2 (E > 1 MeV) and tested in hot cell at 292--325 C in Ar. The morphology, distribution, and habit planes of macroscopic and microscopic hydrides in as-irradiated and posttest cladding were determined by stereo-TEM. The type and magnitude of the residual stress produced in association with oxide-layer growth and dense hydride precipitation, and several synergistic factors that strongly influence axial-splitting behavior were analyzed. The results of the microstructural characterization and stress analyses were then correlated with axial-splitting behavior of high-burnup PWR cladding reported for simulated-RIA conditions. The effects of key test procedures and their implications for the interpretation of RIA test results are discussed

  17. A Beta-splitting model for evolutionary trees.

    Science.gov (United States)

    Sainudiin, Raazesh; Véber, Amandine

    2016-05-01

    In this article, we construct a generalization of the Blum-François Beta-splitting model for evolutionary trees, which was itself inspired by Aldous' Beta-splitting model on cladograms. The novelty of our approach allows for asymmetric shares of diversification rates (or diversification 'potential') between two sister species in an evolutionarily interpretable manner, as well as the addition of extinction to the model in a natural way. We describe the incremental evolutionary construction of a tree with n leaves by splitting or freezing extant lineages through the generating, organizing and deleting processes. We then give the probability of any (binary rooted) tree under this model with no extinction, at several resolutions: ranked planar trees giving asymmetric roles to the first and second offspring species of a given species and keeping track of the order of the speciation events occurring during the creation of the tree, unranked planar trees, ranked non-planar trees and finally (unranked non-planar) trees. We also describe a continuous-time equivalent of the generating, organizing and deleting processes where tree topology and branch lengths are jointly modelled and provide code in SageMath/Python for these algorithms.

  18. Nanoscale strontium titanate photocatalysts for overall water splitting.

    Science.gov (United States)

    Townsend, Troy K; Browning, Nigel D; Osterloh, Frank E

    2012-08-28

    SrTiO(3) (STO) is a large band gap (3.2 eV) semiconductor that catalyzes the overall water splitting reaction under UV light irradiation in the presence of a NiO cocatalyst. As we show here, the reactivity persists in nanoscale particles of the material, although the process is less effective at the nanoscale. To reach these conclusions, Bulk STO, 30 ± 5 nm STO, and 6.5 ± 1 nm STO were synthesized by three different methods, their crystal structures verified with XRD and their morphology observed with HRTEM before and after NiO deposition. In connection with NiO, all samples split water into stoichiometric mixtures of H(2) and O(2), but the activity is decreasing from 28 μmol H(2) g(-1) h(-1) (bulk STO), to 19.4 μmol H(2) g(-1) h(-1) (30 nm STO), and 3.0 μmol H(2) g(-1) h(-1) (6.5 nm STO). The reasons for this decrease are an increase of the water oxidation overpotential for the smaller particles and reduced light absorption due to a quantum size effect. Overall, these findings establish the first nanoscale titanate photocatalyst for overall water splitting.

  19. Investigation of the splitting of quark and gluon jets

    CERN Document Server

    Abreu, P; Adye, T; Adzic, P; Ajinenko, I; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andersson, P; Andreazza, A; Antilogus, P; Apel, W D; Arnoud, Y; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barão, F; Barbier, R; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bärring, O; Bates, M J; Battaglia, Marco; Baubillier, M; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Belous, K S; Benvenuti, Alberto C; Bérat, C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bizouard, M A; Bloch, D; Bonesini, M; Bonivento, W; Boonekamp, M; Booth, P S L; Borgland, A W; Borisov, G; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozovic, I; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Brown, R; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Cerruti, C; Chabaud, V; Chapkin, M M; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Collins, P; Colomer, M; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; D'Almagne, B; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djannati, A; Dolbeau, J; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Duperrin, A; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Ellert, M; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fanourakis, G K; Fassouliotis, D; Fayot, J; Feindt, Michael; Fenyuk, A; Ferrari, P; Ferrer, A; Fichet, S; Firestone, A; Fischer, P A; Flagmeyer, U; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frodesen, A G; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gaspar, M; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Ghodbane, N; Glege, F; Gokieli, R; Golob, B; Gonçalves, P; González-Caballero, I; Gopal, Gian P; Gorn, L; Górski, M; Gracco, Valerio; Grahl, J; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Günther, M; Guy, J; Hahn, F; Hahn, S; Haider, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Heising, S; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Heuser, J M; Higón, E; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, C; Juillot, P; Kapusta, F; Karafasoulis, K; Katsanevas, S; Katsoufis, E C; Keränen, R; Khokhlov, Yu A; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Kluit, P M; Knoblauch, D; Kokkinias, P; Konoplyannikov, A K; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Krammer, Manfred; Kreuter, C; Kronkvist, I J; Krumshtein, Z; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leisos, A; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Lethuillier, M; Libby, J; Liko, D; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; Lopes, J H; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J N; Maehlum, G; Mahon, J R; Maio, A; Malek, A; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Masik, J; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, F; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; McPherson, G; Medbo, J; Meroni, C; Meyer, W T; Myagkov, A; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Moreau, X; Morettini, P; Müller, H; Münich, K; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Myklebust, T; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Némécek, S; Neufeld, N; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Nikolenko, M; Niss, P; Nomerotski, A; Normand, Ainsley; Nygren, A; Oberschulte-Beckmann, W; Obraztsov, V F

    1998-01-01

    The splitting processes in identified quark and gluon jets are investigated using longitudinal and transverse observables. The jets are selected from symmetric three-jet events measured in Z decays L with the {\\sc Delphi} detector in 1991-1994. Gluon jets are identified using heavy quark anti-tagging. Scaling violations in identified gluon jets are observed for the first time. The scale energy dependence of the gluon fragmentation function is found to be about two times larger than for the corresponding quark jets, consistent with the QCD expectation $C_A/C_F$. The primary splitting of gluons and quarks into subjets agrees with fragmentation models and, for specific regions of the jet resolution $y$, with NLLA calculations. The maximum of the ratio of the primary subjet splittings in quark and gluon jets is $2.77\\pm0.11\\pm0.10$. Due to non-perturbative effects, the data are below the expectation at small $y$. The transition from the perturbative to the non-perturbative domain appears at smaller $y$ for quark ...

  20. Noble metal-free hydrogen evolution catalysts for water splitting.

    Science.gov (United States)

    Zou, Xiaoxin; Zhang, Yu

    2015-08-07

    Sustainable hydrogen production is an essential prerequisite of a future hydrogen economy. Water electrolysis driven by renewable resource-derived electricity and direct solar-to-hydrogen conversion based on photochemical and photoelectrochemical water splitting are promising pathways for sustainable hydrogen production. All these techniques require, among many things, highly active noble metal-free hydrogen evolution catalysts to make the water splitting process more energy-efficient and economical. In this review, we highlight the recent research efforts toward the synthesis of noble metal-free electrocatalysts, especially at the nanoscale, and their catalytic properties for the hydrogen evolution reaction (HER). We review several important kinds of heterogeneous non-precious metal electrocatalysts, including metal sulfides, metal selenides, metal carbides, metal nitrides, metal phosphides, and heteroatom-doped nanocarbons. In the discussion, emphasis is given to the synthetic methods of these HER electrocatalysts, the strategies of performance improvement, and the structure/composition-catalytic activity relationship. We also summarize some important examples showing that non-Pt HER electrocatalysts could serve as efficient cocatalysts for promoting direct solar-to-hydrogen conversion in both photochemical and photoelectrochemical water splitting systems, when combined with suitable semiconductor photocatalysts.