International Nuclear Information System (INIS)
Wang Gongke; Yan Changling; Wang Dongchao; Li Dan; Lu Yan
2012-01-01
One of the dihydropyrimidinone derivative 5-(ethoxycarbonyl)-6-methyl-4-(4-methoxyphenyl) -3,4-dihydropyrimidin-2(1H)-one (EMMD) was synthesized, and its binding properties with calf-thymus DNA (ctDNA) were investigated using spectroscopic, viscometric, isothermal titration calorimetric (ITC) and molecular modeling techniques. Fluorescence spectra suggested that the fluorescence enhancement of the binding interaction of EMMD to ctDNA was a static process with ground state complex formation. The binding constant determined with spectroscopic titration and ITC was found to be in the same order of 10 4 M −1 . According to the results of the viscosity analysis, fluorescence competitive binding experiment, fluorescence quenching studies, absorption spectral and ITC investigations, it can be concluded that EMMD is intercalative binding to ctDNA. Furthermore, the results of molecular modeling confirmed those obtained from spectroscopic, viscosimetric and ITC investigations. Additionally, ITC studies also indicated that the binding interaction is predominantly enthalpy driven. - Highlights: ► Medically important dihydropyrimidinones derivative EMMD is synthesized. ► EMMD is intercalative binding into ctDNA helix. ► Hydrogen bonding may play an essential role in the binding of EMCD with ctDNA. ► This binding interaction is predominantly enthalpy driven.
Spectroscopic properties and photoreactivity with DNA of new monofunctional pyridopsoralens
International Nuclear Information System (INIS)
Blais, J.; Vigny, P.; Moron, J.; Bisagni, E.
1984-01-01
New psoralen derivatives have been synthesized in order to enhance their affinity towards DNA. The spectral properties (absorption, fluorescence emission, fluorescence quantum yield) and the photostability of pyrido[3,4-c]psoralen are first reported. The drastic changes observed in the solubility and in the fluorescence emission when these compounds are added to native DNA give evidence of the formation of non covalent dark complexes. Upon UV irradiation (365 nm) of the complexes, a photobinding occurs. Heat denaturation and renaturation experiments of modified DNA show that only monoadducts are formed. From the analysis of their fluorescence properties the involvement of the 4',5' double bond is assumed. The monofunctional character has also been established for psoralens having a fused pyridine ring in the 4',5' site. However, a fused tetrahydropyrido group in the 4',5' site is inefficient to inactivate this reactive site. (author)
Spectroscopic properties and photoreactivity with DNA of new monofunctional pyridopsoralens
Energy Technology Data Exchange (ETDEWEB)
Blais, J.; Vigny, P. (Institut Curie et Universite Paris VI (France). Lab. de Physique et Chimie Biomoleculaire); Moron, J.; Bisagni, E. (Lab. de Synthese Organique, Institut Curie, Orsay (France). Section de Biologie)
1984-02-01
New psoralen derivatives have been synthesized in order to enhance their affinity towards DNA. The spectral properties (absorption, fluorescence emission, fluorescence quantum yield) and the photostability of pyrido(3,4-c)psoralen are first reported. The drastic changes observed in the solubility and in the fluorescence emission when these compounds are added to native DNA give evidence of the formation of non covalent dark complexes. Upon UV irradiation (365 nm) of the complexes, a photobinding occurs. Heat denaturation and renaturation experiments of modified DNA show that only monoadducts are formed. From the analysis of their fluorescence properties the involvement of the 4',5' double bond is assumed. The monofunctional character has also been established for psoralens having a fused pyridine ring in the 4',5' site. However, a fused tetrahydropyrido group in the 4',5' site is inefficient to inactivate this reactive site.
Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad
2018-03-01
DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (Kb) between TMG and DNA was 2.27 × 104 M- 1, that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking.
Sub-THz spectroscopic characterization of vibrational modes in artificially designed DNA monocrystal
International Nuclear Information System (INIS)
Sizov, Igor; Rahman, Masudur; Gelmont, Boris; Norton, Michael L.; Globus, Tatiana
2013-01-01
Highlights: • Sub-THz spectroscopy is used to characterize artificially designed DNA monocrystal. • Results are obtained using a novel near field, RT, frequency domain spectrometer. • Narrow resonances of 0.1 cm −1 width in absorption spectra of crystal are observed. • Signature measured between 310 and 490 GHz is reproducible and well resolved. • Absorption pattern is explained in part by simulation results from dsDNA fragment. - Abstract: Sub-terahertz (sub-THz) vibrational spectroscopy is a new spectroscopic branch for characterizing biological macromolecules. In this work, highly resolved sub-THz resonance spectroscopy is used for characterizing engineered molecular structures, an artificially designed DNA monocrystal, built from a short DNA sequence. Using a recently developed frequency domain spectroscopic instrument operating at room temperature with high spectral and spatial resolution, we demonstrated very intense and specific spectral lines from a DNA crystal in general agreement with a computational molecular dynamics (MD) simulation of a short double stranded DNA fragment. The spectroscopic signature measured in the frequency range between 310 and 490 GHz is rich in well resolved and reproducible spectral features thus demonstrating the capability of THz resonance spectroscopy to be used for characterizing custom macromolecules and structures designed and implemented via nanotechnology for a wide variety of application domains. Analysis of MD simulation indicates that intense and narrow vibrational modes with atomic movements perpendicular (transverse) and parallel (longitudinal) to the long DNA axis coexist in dsDNA, with much higher contribution from longitudinal vibrations
Spectroscopic studies on the interaction of mimosine with BSA and DNA
Baltazar, C. J.; Mun, R.; Tajmir-Riahi, H. A.; Bariyanga, J.
2018-06-01
Mimosine has shown antitumor activity towards cancer cells. It has also been found to inhibit deoxyribonucleic acid (DNA) but the interaction is not fully understood. Here we report the results of investigation of its interactions with bovine serum albumin (BSA) and DNA in aqueous solution (pH 7.4) using FTIR and UV spectroscopic methods. Mimosine was found to disrupt the conformation of BSA by reducing its α-helix component and promoting a partial unfolding of the protein. In addition, the results indicated that mimosine may bind to DNA by electrostatic attractions via phosphate groups and grooves. The overall binding constant of DNA -mimosine complex was 5 × 10 3 M-1.
International Nuclear Information System (INIS)
Sengupta, Bidisa; Uematsu, Takashi; Jacobsson, Per; Swenson, Jan
2006-01-01
Reducing sugars for example glucose, fructose, etc., and their phosphate derivatives non-enzymatically glycate biological macromolecules (e.g., proteins, DNA and lipids) and is related to the production of free radicals. Here we present a novel study, using differential scanning calorimetry (DSC) along with UV/Vis absorption and photon correlation spectroscopy (PCS), on normal and glycated human placenta DNA and have explored the antioxidant property of the naturally occurring polyhydroxy flavone quercetin (3,3',4',5,7-pentahydroxyflavone) in preventing the glycation. The decrease in the absorption intensity of DNA in presence of sugars clearly indicates the existence of sugar molecules between the two bases of a base pair in the duplex DNA molecule. Variations were perceptible in the PCS relaxation profiles of normal and glycated DNA. The melting temperature of placenta DNA was decreased when glycated suggesting a decrease in the structural stability of the double-stranded glycated DNA. Our DSC and PCS data showed, for the first time, that the dramatic changes in the structural properties of glycated DNA can be prevented to a significant extent by adding quercetin. This study provides valuable insights regarding the structure, function, and dynamics of normal and glycated DNA molecules, underlying the manifestation of free radical mediated diseases, and their prevention using therapeutically active naturally occurring flavonoid quercetin
Spectroscopic quantification of 5-hydroxymethylcytosine in genomic DNA.
Shahal, Tamar; Gilat, Noa; Michaeli, Yael; Redy-Keisar, Orit; Shabat, Doron; Ebenstein, Yuval
2014-08-19
5-Hydroxymethylcytosine (5hmC), a modified form of the DNA base cytosine, is an important epigenetic mark linked to regulation of gene expression in development, and tumorigenesis. We have developed a spectroscopic method for a global quantification of 5hmC in genomic DNA. The assay is performed within a multiwell plate, which allows simultaneous recording of up to 350 samples. Our quantification procedure of 5hmC is direct, simple, and rapid. It relies on a two-step protocol that consists of enzymatic glucosylation of 5hmC with an azide-modified glucose, followed by a "click reaction" with an alkyne-fluorescent tag. The fluorescence intensity recorded from the DNA sample is proportional to its 5hmC content and can be quantified by a simple plate reader measurement. This labeling technique is specific and highly sensitive, allowing detection of 5hmC down to 0.002% of the total nucleotides. Our results reveal significant variations in the 5hmC content obtained from different mouse tissues, in agreement with previously reported data.
Xu, Liang; Hu, Yan-Xi; Li, Yan-Cheng; Zhang, Li; Ai, Hai-Xin; Liu, Yu-Feng; Liu, Hong-Sheng
2018-02-01
In the present work, the binding interaction between lenalidomide (LEN) and calf thymus DNA (ct-DNA) was systematically studied by using fluorescence, ultraviolet-visible (UV-vis) absorption, circular dichroism (CD) spectroscopies under imitated physiological conditions (pH = 7.4) coupled with molecular docking. It was found that LEN was bound to ct-DNA with high binding affinity (Ka = 2.308 × 105 M-1 at 283 K) through groove binding as evidenced by a slight decrease in the absorption intensity in combination with CD spectra. Thermodynamic parameters (ΔG 0 and ΔS interaction. Furthermore, competitive binding experiments with ethidium bromide and 4‧, 6-dia-midino-2-phenylindoleas probes showed that LEN could preferentially bind in the minor groove of double-stranded DNA. The average lifetime of LEN was calculated to be 7.645 ns. The φ of LEN was measured as 0.09 and non-radiation energy transfer between LEN and DNA had occurred. The results of the molecular docking were consistent with the experimental results. This study explored the potential applicability of the spectroscopic properties of LEN and also investigated its interactions with relevant biological targets. In addition, it will provide some theoretical references for the deep research of simultaneous administration of LEN with other drugs.
Spectroscopic Tools for Quantitative Studies of DNA Structure and Dynamics
DEFF Research Database (Denmark)
Preus, Søren
The main objective of this thesis is to develop quantitative fluorescence-based, spectroscopic tools for probing the 3D structure and dynamics of DNA and RNA. The thesis is founded on six peer-reviewed papers covering mainly the development, characterization and use of fluorescent nucleobase...... analogues. In addition, four software packages is presented for the simulation and quantitative analysis of time-resolved and steady-state UV-Vis absorption and fluorescence experiments....
Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta
2016-09-01
Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.
International Nuclear Information System (INIS)
Geng, Shaoguang; Cui, Yanrui; Liu, Qingfeng; Cui, Fengling; Zhang, Guisheng; Chi, Yanwei; Peng, Hao
2013-01-01
The method of synthesizing 3′-deoxy-3′-azido doxorubicin (ADOX) directly from doxorubicin has been developed. This study presents the interaction between ADOX and calf thymus deoxyribonucleic acid (ctDNA) by using spectroscopic methods and molecular modeling techniques. Iodide quenching, fluorescence polarization, viscosity and molecular modeling studies of ADOX–ctDNA interactions indicated that ADOX was an intercalator of ctDNA and preferentially bound to C–G rich regions of ctDNA. Simultaneously, spectroscopic results indicated that the quenching mechanism of ADOX–ctDNA was a static quenching. According to thermodynamic parameters, electrostatic force played roles in the interaction of ADOX with ctDNA. -- Highlights: ●An approach to 3′-deoxy-3′-azido doxorubicin (ADOX) from doxorubicin was developed. ●The quenching mechanism of ADOX with ctDNA was a static quenching type. ●The binding mode between ADOX and ctDNA was intercalative binding. ●The results of molecular docking corroborated results of spectra investigations
Synthesis, Spectroscopic Properties and DFT Calculation of Novel ...
Indian Academy of Sciences (India)
L1) identifies its molecular structure and reveals π-π stacking. The synthetic mechanisms for L2, L3 were studied by density functional theory calculations. And a comprehensive study of spectroscopic properties involving experimental data and ...
Spectroscopic properties of Pr -doped erbium oxalate crystals
Indian Academy of Sciences (India)
Spectroscopic properties of praseodymium ions-doped erbium oxalate ... solution with specific gravity 1.04 g/cm3 was mixed homogeneously with 0.5 M oxalic ... of concentrated nitric acid were transferred carefully and gently through the wall ...
International Nuclear Information System (INIS)
Machado, F.B.C.
1985-01-01
The use of the configuration (CI) method for the calculation of very accurate potential energy curves and dipole moment functions, and then their use in the comprehension of spectroscopic properties of diatomic molecules is presented. The spectroscopic properties of CH + and CD + such as: vibrational levels, spectroscopic constants, averaged dipole moments for all vibrational levels, radiative transition probabilities for emission and absorption, and radiative lifetimes are verificated. (M.J.C.) [pt
Optical properties of metals by spectroscopic ellipsometry
International Nuclear Information System (INIS)
Arakawa, E.T.; Inagaki, T.; Williams, M.W.
1979-01-01
The use of spectroscopic ellipsometry for the accurate determination of the optical properties of liquid and solid metals is discussed and illustrated with previously published data for Li and Na. New data on liquid Sn and Hg from 0.6 to 3.7 eV are presented. Liquid Sn is Drude-like. The optical properties of Hg deviate from the Drude expressions, but simultaneous measurements of reflectance and ellipsometric parameters yield consistent results with no evidence for vectorial surface effects
Raman spectroscopic study of plasma-treated salmon DNA
Energy Technology Data Exchange (ETDEWEB)
Lee, Geon Joon; Kim, Yong Hee; Choi, Eun Ha [Plasma Bioscience Research Center, Kwangwoon University, Seoul 139-701 (Korea, Republic of); Kwon, Young-Wan [Department of Chemistry, Korea University, Seoul 136-701 (Korea, Republic of)
2013-01-14
In this research, we studied the effect of plasma treatment on the optical/structural properties of the deoxyribonucleic acid (DNA) extracted from salmon sperm. DNA-cetyltrimethylammonium (CTMA) films were obtained by complexation of DNA with CTMA. Circular dichroism (CD) and Raman spectra indicated that DNA retained its double helical structure in the solid film. The Raman spectra exhibited several vibration modes corresponding to the nuclear bases and the deoxyribose-phosphate backbones of the DNA, as well as the alkylchains of CTMA. Dielectric-barrier-discharge (DBD) plasma treatment induced structural modification and damage to the DNA, as observed by changes in the ultraviolet-visible absorption, CD, and Raman spectra. The optical emission spectra of the DBD plasma confirmed that DNA modification was induced by plasma ions such as reactive oxygen species and reactive nitrogen species.
Geometry-dependent DNA-TiO2 immobilization mechanism: A spectroscopic approach
Silva-Moraes, M. O.; Garcia-Basabe, Y.; de Souza, R. F. B.; Mota, A. J.; Passos, R. R.; Galante, D.; Fonseca Filho, H. D.; Romaguera-Barcelay, Y.; Rocco, M. L. M.; Brito, W. R.
2018-06-01
DNA nucleotides are used as a molecular recognition system on electrodes modified to be applied in the detection of various diseases, but immobilization mechanisms, as well as, charge transfers are not satisfactorily described in the literature. An electrochemical and spectroscopic study was carried out to characterize the molecular groups involved in the direct immobilization of DNA structures on the surface of nanostructured TiO2 with the aim of evaluating the influence of the geometrical aspects. X-ray photoelectron spectroscopy at O1s and P2p core levels indicate that immobilization of DNA samples occurs through covalent (Psbnd Osbnd Ti) bonds. X-ray absorption spectra at the Ti2p edge reinforce this conclusion. A new species at 138.5 eV was reported from P2p XPS spectra analysis which plays an important role in DNA-TiO2 immobilization. The Psbnd Osbnd Ti/Osbnd Ti ratio showed that quantitatively the DNA immobilization mechanism is dependent on their geometry, becoming more efficient for plasmid ds-DNA structures than for PCR ds-DNA structures. The analysis of photoabsorption spectra at C1s edge revealed that the molecular groups that participate in the C1s → LUMO electronic transitions have different pathways in the charge transfer processes at the DNA-TiO2 interface. Our results may contribute to additional studies of immobilization mechanisms understanding the influence of the geometry of different DNA molecules on nanostructured semiconductor and possible impact to the charge transfer processes with application in biosensors or aptamers.
DNA Structures on Silicon and Diamond
Pop, Simona D.; Hinrichs, Karsten; Wenmackers, Sylvia; Cobet, Christoph; Esser, Norbert; Zahn, Dietrich R.T.; Hinrichs, Karsten; Eichhorn, Klaus-Jochen
2014-01-01
In the design of DNA-based hybrid devices, it is essential to have knowledge of the structural, electronic and optical properties of these biomolecular films. Spectroscopic ellipsometry is a powerful technique to probe and asses these properties. In this chapter, we review its application to
Syntheses and spectroscopic properties of mercury(II) and nickel(II ...
African Journals Online (AJOL)
Syntheses and spectroscopic properties of mercury(II) and nickel(II) ... The complexes were characterized by IR, diffuse reflectance, 1H NMR spectra and elemental ... coordinating through thiolato sulphur and hydrazinic nitrogen atoms.
Line narrowing spectroscopic studies of DNA-carcinogen adducts and DNA-dye complexes
International Nuclear Information System (INIS)
Suh, Myungkoo.
1995-01-01
Laser-induced fluorescence line narrowing and non-line narrowing spectroscopic methods were applied to conformational studies of stable DNA adducts of the 7β, 8α-dihydoxy-9α, l0α-epoxy-7,8,9, 10-tetrahydrobenzo[α]pyrene (anti-BPDE). Stereochemically distinct (+)-trans-, (-)-trans-, (+)-cis- and (-)-cis adducts of anti-BPDE bound to exocyclic amino group of the central guanine in an 11-mer oligonucleotide, exist in a mixture of conformations in frozen aqueous buffer matrices. The (+)-trans adduct adopts primarily an external conformation with a smaller fraction ( ∼ 25 %) exists in a partially base-stacked conformation. Both cis adducts were found to be intercalated with significant π-π stacking interactions between the pyrenyl residues and the bases. Conformations of the trans-adduct of (+)-anti -BPDE in 11-mer oligonucleotides were studied as a function of flanking bases. In single stranded form the adduct at G 2 or G 3 (5 ft-flanking, base guanine) adopts a conformation with strong, interaction with the bases. In contrast, the adduct with a 5ft-flanking, thymine exists in a primarily helixexternal conformation. Similar differences were observed in the double stranded oligonucleotides. The nature of the 3ft-flanking base has little influence on the conformational equilibrium of the (+)-trans-anti BPDE-dG adduct. The formation and repair of BPDE-N 2 -dG in DNA isolated from the skin of mice treated topically with benzo[α]pyrene (BP) was studied. Low-temperature fluorescence spectroscopy of the intact DNA identified the major adduct as (+)-trans-anti-BPDE-N-dG, and the minor adduct fraction consisted mainly of (+)-cis-anti-BPDE-N 2 -dG
Spectroscopic properties for identifying sapphire samples from Ban Bo Kaew, Phrae Province, Thailand
Mogmued, J.; Monarumit, N.; Won-in, K.; Satitkune, S.
2017-09-01
Gemstone commercial is a high revenue for Thailand especially ruby and sapphire. Moreover, Phrae is a potential gem field located in the northern part of Thailand. The studies of spectroscopic properties are mainly to identify gemstone using advanced techniques (e.g. UV-Vis-NIR spectrophotometry, FTIR spectrometry and Raman spectroscopy). Typically, UV-Vis-NIR spectrophotometry is a technique to study the cause of color in gemstones. FTIR spectrometry is a technique to study the functional groups in gem-materials. Raman pattern can be applied to identify the mineral inclusions in gemstones. In this study, the natural sapphires from Ban Bo Kaew were divided into two groups based on colors including blue and green. The samples were analyzed by UV-Vis-NIR spectrophotometer, FTIR spectrometer and Raman spectroscope for studying spectroscopic properties. According to UV-Vis-NIR spectra, the blue sapphires show higher Fe3+/Ti4+ and Fe2+/Fe3+ absorption peaks than those of green sapphires. Otherwise, green sapphires display higher Fe3+/Fe3+ absorption peaks than blue sapphires. The FTIR spectra of both blue and green sapphire samples show the absorption peaks of -OH,-CH and CO2. The mineral inclusions such as ferrocolumbite and rutile in sapphires from this area were observed by Raman spectroscope. The spectroscopic properties of sapphire samples from Ban Bo Kaew, Phrae Province, Thailand are applied to be the specific evidence for gemstone identification.
Line narrowing spectroscopic studies of DNA-carcinogen adducts and DNA-dye complexes
Energy Technology Data Exchange (ETDEWEB)
Suh, Myungkoo [Iowa State Univ., Ames, IA (United States)
1995-12-06
Laser-induced fluorescence line narrowing and non-line narrowing spectroscopic methods were applied to conformational studies of stable DNA adducts of the 7β, 8α-dihydoxy-9α, l0α-epoxy-7,8,9, 10-tetrahydrobenzo[α]pyrene (anti-BPDE). Stereochemically distinct (+)-trans-, (-)-trans-, (+)-cis- and (-)-cis adducts of anti-BPDE bound to exocyclic amino group of the central guanine in an 11-mer oligonucleotide, exist in a mixture of conformations in frozen aqueous buffer matrices. The (+)-trans adduct adopts primarily an external conformation with a smaller fraction ( ~25 %) exists in a partially base-stacked conformation. Both cis adducts were found to be intercalated with significant π-π stacking interactions between the pyrenyl residues and the bases. Conformations of the trans-adduct of (+)-anti -BPDE in 11-mer oligonucleotides were studied as a function of flanking bases. In single stranded form the adduct at G2 or G3 (5 ft-flanking, base guanine) adopts a conformation with strong, interaction with the bases. In contrast, the adduct with a 5ft-flanking, thymine exists in a primarily helixexternal conformation. Similar differences were observed in the double stranded oligonucleotides. The nature of the 3ft-flanking base has little influence on the conformational equilibrium of the (+)-trans-anti BPDE-dG adduct. The formation and repair of BPDE-N2-dG in DNA isolated from the skin of mice treated topically with benzo[α]pyrene (BP) was studied. Low-temperature fluorescence spectroscopy of the intact DNA identified the major adduct as (+)-trans-anti-BPDE-N-dG, and the minor adduct fraction consisted mainly of (+)-cis-anti-BPDE-N2-dG.
The Spectroscopic and Conductive Properties of Ru(II Complexes with Potential Anticancer Properties
Directory of Open Access Journals (Sweden)
Adebayo A. Adeniyi
2014-01-01
Full Text Available Different density functional methods (DFT have been used to optimize and study the chemistry of five potential anticancer complexes in terms of their electronic, conductive, and spectroscopic properties. Many of the computed properties in addition to the IR and QTAIM analysis of the NMR are dipole moment vector (μi, linear polarizability tensor (αij, first hyperpolarizability tensors (βijk, polarizability exaltation index (Γ, and chemical hardness (η of the complexes. Stable low energy geometries are obtained using basis set with effective core potential (ECP approximation but, in the computation of atomic or molecular properties, the metal Ru atom is better treated with higher all electron basis set like DGDZVP. The spectroscopic features like the IR of the metal-ligand bonds and the isotropic NMR shielding tensor of the coordinated atoms are significantly influenced by the chemical environment of the participating atoms. The carboxylic and pyrazole units are found to significantly enhance the polarizabilities and hyperpolarizabilities of the complexes while the chloride only improves the polarity of the complexes. Fermi contacts (FC have the highest effect followed by the PSO among all the four Ramsey terms which defined the total spin-spin coupling constant J (HZ of these complexes.
Polarized spectroscopic properties of Nd3+-doped KGd(WO4)2 single crystal
International Nuclear Information System (INIS)
Chen Yujin; Lin Yanfu; Gong Xinghong; Tan Qiguang; Zhuang Jian; Luo Zundu; Huang Yidong
2007-01-01
The polarized absorption spectra, infrared fluorescence spectra, upconversion visible fluorescence spectra, and fluorescence decay curve of orientated Nd 3+ :KGd(WO 4 ) 2 crystal were measured at room-temperature. Some important spectroscopic parameters were investigated in detail in the framework of the Judd-Ofelt theory and the Fuchtbauer-Ladenburg formula. The effect of the crystal structure on the spectroscopic properties of the Nd 3+ ions was analyzed. The relation among the spectroscopic parameters and the laser performances of the Nd 3+ :KGd(WO 4 ) 2 crystal was discussed
Spectroscopic properties of rare earths in optical materials
Parisi, Jürgen; Osgood, R; Warlimont, Hans; Liu, Guokui; Jacquier, Bernard
2005-01-01
Aimed at researchers and graduate students, this book provides up-to-date information for understanding electronic interactions that impact the optical properties of rare earth ions in solids. Its goal is to establish a connection between fundamental principles and the materials properties of rare-earth activated luminescent and laser optical materials. The theoretical survey and introduction to spectroscopic properties include electronic energy level structure, intensities of optical transitions, ion-phonon interactions, line broadening, and energy transfer and up-conversion. An important aspect of the book lies in its deep and detailed discussions on materials properties and the potential of new applications such as optical storage, information processing, nanophotonics, and molecular probes that have been identified in recent experimental studies. This volume will be a valuable reference book on advanced topics of rare earth spectroscopy and materials science.
International Nuclear Information System (INIS)
Yokoya, Akinari; Fujii, Kentaro; Oka, Toshitaka; Watanabe, Ritsuko
2012-01-01
Recent progress on spectroscopic study on physicochemical process of DNA damage induction will be reported. It has been predicted by computer track simulation studies that complex DNA damage, so called clustered DNA damage sites, is produced along the tack particularly of high Linear Energy Transfer (LET) ions. The clustered DNA damage, consisting of two or more isolated lesions such as single strand breaks or nucleobase lesions, is thought to compromise DNA repair enzymes. We have revealed that the nucleobase lesions produced by He 2+ ion impact to simple model DNA (plasmid) are hardly processed by base excision repair enzymes (E. coli DNA glycosylases). Using the third generation synchrotron radiation facility (SPring-8), we have studied unpaired electron species or desorbed ions as intermediates of DNA damage using an EPR apparatus or mass spectrometer installed in the soft X-ray beamline in SPring-8. These aspects are compared with the yields of final products of single- and double-strand breaks and base lesions revealed biochemical techniques. Models of complex DNA damage induction will be proposed considering various modification factors of the damage induction, ionization of valence and inner-shell electrons, OH radicals, hydration layer and the impact of secondary electrons. (author)
DFT calculations on spectroscopic and structural properties of a NLO chromophore
Altürk, Sümeyye; Avci, Davut; Tamer, Ömer; Atalay, Yusuf
2016-03-01
The molecular geometry optimization, vibrational frequencies and gauge including atomic orbital (GIAO) 1H and 13C NMR chemical shift values of 2-(1'-(4'''-Methoxyphenyl)-5'-(thien-2″-yl)pyrrol-2'-yl)-1,3-benzothiazole as potential nonlinear optical (NLO) material were calculated using density functional theory (DFT) HSEh1PBE method with 6-311G(d,p) basis set. The best of our knowledge, this study have not been reported to date. Additionally, a detailed vibrational study was performed on the basis of potential energy distribution (PED) using VEDA program. It is noteworthy that NMR chemical shifts are quite useful for understanding the relationship between the molecular structure and electronic properties of molecules. The computed IR and NMR spectra were used to determine the types of the experimental bands observed. Predicted values of structural and spectroscopic parameters of the chromophore were compared with each other so as to display the effects of the different substituents on the spectroscopic and structural properties. Obtained data showed that there is an agreement between the predicted and experimental data.
Spectroscopic properties of vitamin E models in solution
Oliveira, L. B. A.; Colherinhas, G.; Fonseca, T. L.; Castro, M. A.
2015-05-01
We investigate the first absorption band and the 13C and 17O magnetic shieldings of vitamin E models in chloroform and in water using the S-MC/QM methodology in combination with the TD-DFT and GIAO approaches. The results show that the solvent effects on these spectroscopic properties are small but a proper description of the solvent shift for 17O magnetic shielding of the hydroxyl group in water requires the use of explicit solute-solvent hydrogen bonds. In addition, the effect of the replacement of hydrogen atoms by methyl groups in the vitamin E models only affects magnetic shieldings.
International Nuclear Information System (INIS)
Ahmad, S.A.; Pandey, P.L.
1980-01-01
Spectroscopic data on uranium atom and thermal properties of uranium relevant to atomic schemes for laser isotope separation have been presented in this report. All the relevant spectroscopic data reported in literature so far, as well as some other parameters like photo-absorption cross sections, branching ratios, effects of magnetic and electric fields, evaluated using the existing data, have been presented here. Among the thermal properties, parameters like vapour pressure and number densities for U/Liquid U, U/URe 2 and U/UP systems, partition function, percentage population distribution in energy levels, thermal ionisation and velocities of uranium atom have been presented at different temperatures. Different possible collision processes are mentioned and cross-sections of U-U + charge-exchange and U + + e radiative recombination processes have been also evaluated. (author)
Modeling the mechanical properties of DNA nanostructures.
Arbona, Jean Michel; Aimé, Jean-Pierre; Elezgaray, Juan
2012-11-01
We discuss generalizations of a previously published coarse-grained description [Mergell et al., Phys. Rev. E 68, 021911 (2003)] of double stranded DNA (dsDNA). The model is defined at the base-pair level and includes the electrostatic repulsion between neighbor helices. We show that the model reproduces mechanical and elastic properties of several DNA nanostructures (DNA origamis). We also show that electrostatic interactions are necessary to reproduce atomic force microscopy measurements on planar DNA origamis.
Spectroscopic properties of highly Nd-doped lead phosphate glass
Energy Technology Data Exchange (ETDEWEB)
Novais, A.L.F. [Instituto de Física, Universidade Federal de Alagoas, Grupo de Fotônica e Fluidos Complexos, 57072-970 Maceió, AL (Brazil); Dantas, N.O. [Laboratório de Novos Materiais Isolantes e Semicondutores (LNMIS), Instituto de Física, Universidade Federal de Uberlândia, 38400-902 Uberlândia, MG (Brazil); Guedes, I. [Departamento de Física, Universidade Federal do Ceará, Campus do PICI, Caixa Postal 6030, 60455-760 Fortaleza, CE (Brazil); Vermelho, M.V.D., E-mail: vermelho@fis.ufal.br [Instituto de Física, Universidade Federal de Alagoas, Grupo de Fotônica e Fluidos Complexos, 57072-970 Maceió, AL (Brazil)
2015-11-05
The spectroscopic characteristics of highly Nd{sup 3+}-doped lead phosphate glasses (xNd:Pb{sub 3}(PO{sub 4}){sub 2}) have been investigated. The X-ray spectra show that the matrices are glassy up to 25 wt% of Nd{sup 3+} doping. From the Judd–Ofelt analysis we observe that while the Ω{sub (2)} parameter remains constant indicating that the 4f{sup N} and 4f{sup N−1}5 d{sup 1} configurations are not affected by the Nd{sup 3+} doping, the behavior of both Ω{sub (4)} and Ω{sub (6)} changes for 15 wt% of Nd{sup 3+} doping. The reduction of the Ω{sub (6)} parameter is related to the increase of the covalence bonding between the ligands and the Nd{sup 3+} ions. At this particular concentration, the radiative lifetime has a four-fold enhancement. Such behaviors are likely to be related to a modification in the glass structure for high Nd{sup 3+} concentrations. - Graphical abstract: Highly doped lead-phosphate glass matrix, with nominal concentration of up to 25 wt%, maintain the spectroscopic properties without deterioration. The analysis concerning the point of view of Nd{sup 3+} ions showed that high concentrations only affects the rare earth electronic charge density distribution. - Highlights: • Spectroscopic characterization of Nd{sub 2}O{sub 3} highly doped lead phosphate glasses. • Phosphate glass doped with Nd{sup 3+} for applications in photonic devices. • Judd–Ofelt analysis in phosphate glasses doped with Neodymium.
Nascimento, Denis W S; de Moura, Márcia R; Mattoso, Luiz H C; Aouada, Fauze A
2017-01-01
In this paper, series of novel nanocomposite hydrogels based on polyacrylamide (PAAm), carboxymethylcellulose (CMC) and nanoclay were synthesized. Hydrophilic, kinetic, spectroscopic and morphological properties were investigated as function of their constituents. Spectroscopic properties confirmed the obtaining of the nanocomposites. It was also observed that the nanocomposites have walls of pores with a more rugged morphology compared with the morphology of the hydrogel without clay, contributing to repel the water molecules. Besides, the results showed that the velocity and quantity of water uptake may be controlled by adjusting of matrix rigidity, i.e., nanoclay content into polymeric matrix. This behavior is required to future application in agriculture fields, specifically as carrier vehicle in controlled release of agrochemicals. Thus, these nanocomposites have technological application.
International Nuclear Information System (INIS)
Mullice, L.A.; Buurma, N.J.; Pope, S.J.A.; Laye, R.H.; Harding, L.P.
2008-01-01
The syntheses of two chromophore-appended dipicolylamine-derived ligands and their reactivity with penta-carbonyl-chloro-rhenium have been studied. The resultant complexes each possess the fac-Re(CO) 3 core. The ligands L 1 1-[bis(pyridine-2-yl-methyl)amino]methyl-pyrene and L 2 2-[bis(pyridine-2-yl-methyl)amino]methyl-quinoxaline were isolated via a one-pot reductive amination in moderate yield. The corresponding rhenium complexes were isolated in good yields and characterised by 1 H NMR, MS, IR and UV-Vis studies. X-Ray crystallographic data were obtained for fac-{Re(CO) 3 (L 1 )}(BF 4 ), C 34 H 26 BF 4 N 4 O 3 Re: monoclinic, P2(1)/c, a 18.327(2) Angstroms, α = 90.00 degrees, b 14.1537(14) Angstroms, β96.263(6) degrees, c = 23.511(3) Angstroms, γ 90.00 Angstroms, 6062.4(11) (Angstroms) 3 , Z=8. The luminescence properties of the ligands and complexes were also investigated, with the emission attributed to the appended chromophore in each case. Isothermal titration calorimetry suggests that fac-{Re(CO) 3 (L 1 )}(BF 4 ) self-aggregates cooperatively in aqueous solution, probably forming micelle-like aggregates with a cmc of 0.18 mM. Investigations into the DNA-binding properties of fac-{Re(CO) 3 (L 1 )}(BF 4 ) were undertaken and revealed that fac-{Re(CO) 3 (L 1 )}(BF 4 ) binding to fish sperm DNA (binding constant 1.5 ± 0.2 * 10 5 M -1 , binding site size 3.2 ± 0.3 base pairs) is accompanied by changes in the UV-Vis spectrum as typically observed for pyrene-based intercalators while the calorimetrically determined binding enthalpy (-14 ± 2 kcal mol -1 ) also agrees favourably with values as typically found for intercalators. (authors)
Guo, Hongqin; Cai, Changqun; Gong, Hang; Chen, Xiaoming
2011-06-01
Interactions of the anti-inflammatory drug ketoprofen with calf thymus DNA (ctDNA) in aqueous solution have been studied by multi-spectroscopic method including resonance light scattering (RLS) technique, ultraviolet spectra (UV), 1H NMR, etc. The characteristics of RLS spectra, the effective factors and optimum conditions of the reaction have been unequivocally investigated. Mechanism investigations have shown that ketoprofen can bind to ctDNA by groove binding and form large particles, which resulted in the enhancement of RLS intensity. In Critic acid-Na 2HPO 4 buffer (pH = 6.5), ketoprofen has a maximum peak 451.5 nm and the RLS intensity is remarkably enhanced by trace amount of ctDNA due to the interaction between ketoprofen and ctDNA. The enhancement of RLS signal is directly proportional to the concentration of ctDNA in the range of 1.20 × 10 -6-1.0 × 10 -5 mol/L, and its detection limit (3 σ) is 1.33 × 10 -9 mol/L. The method is simple, rapid, practical and relatively free from interference generated by coexisting substance, and was applied to the determination of trace amounts of nucleic acid in synthetic samples with satisfactory results.
Theoretical study of H2/+/ spectroscopic properties. II, III. [2p and 3d excited electronic states
Beckel, C. L.; Shafi, M.; Peek, J. M.
1973-01-01
Description of the theoretical spectroscopic properties of the 2p pi/sub u/ and 3d sigma/sub g/ excited states of the H2/+/ hydrogen molecular ion. Numerical integration of the Schrodinger equation is used to determine vibration-rotation eigenvalues. Dunham power series expansions are used to determine the equilibrium separation, potential coefficients, and spectroscopic constants. The eigenvalues are used to determine delta-G, Bv, Dv, and Hv.
DNA origami compliant nanostructures with tunable mechanical properties.
Zhou, Lifeng; Marras, Alexander E; Su, Hai-Jun; Castro, Carlos E
2014-01-28
DNA origami enables fabrication of precise nanostructures by programming the self-assembly of DNA. While this approach has been used to make a variety of complex 2D and 3D objects, the mechanical functionality of these structures is limited due to their rigid nature. We explore the fabrication of deformable, or compliant, objects to establish a framework for mechanically functional nanostructures. This compliant design approach is used in macroscopic engineering to make devices including sensors, actuators, and robots. We build compliant nanostructures by utilizing the entropic elasticity of single-stranded DNA (ssDNA) to locally bend bundles of double-stranded DNA into bent geometries whose curvature and mechanical properties can be tuned by controlling the length of ssDNA strands. We demonstrate an ability to achieve a wide range of geometries by adjusting a few strands in the nanostructure design. We further developed a mechanical model to predict both geometry and mechanical properties of our compliant nanostructures that agrees well with experiments. Our results provide a basis for the design of mechanically functional DNA origami devices and materials.
DNA Nucleotides Detection via capacitance properties of Graphene
Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash
2016-05-01
In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.
PHOTOMETRIC AND SPECTROSCOPIC PROPERTIES OF NOVAE IN THE LARGE MAGELLANIC CLOUD
International Nuclear Information System (INIS)
Shafter, A. W.
2013-01-01
The photometric and spectroscopic properties of the 43 known LMC nova candidates are summarized and reviewed. Of these, photometric data sufficient to establish decline rates are available for 29 novae, while spectroscopic data sufficient to establish the spectroscopic classes are available for 18 systems. Half of the 18 novae belong to the Fe II class, with the remaining nine belonging to either the He/N or the Fe IIb classes. As seen in previous nova studies of M31 and M33, the He/N and Fe IIb novae have on average faster photometric developments than do their Fe II counterparts. Overall, the available photometry confirms earlier studies, and shows conclusively that LMC novae have faster rates of decline than do novae in the Galaxy and M31. It appears that the increased fraction of faster, He/N and Fe IIb novae observed in the LMC compared with M31 is almost certainly the result of differences in the underlying stellar population between the two galaxies. We propose that the younger population seen in the LMC compared with M31's bulge (where most of the novae are found), produces progenitor binaries with higher average white dwarf masses. The higher mean white dwarf mass not only produces a larger fraction of fast, He/N novae compared with M31, but also results in a relatively large recurrent nova population.
Optical properties of gold island films-a spectroscopic ellipsometry study
Energy Technology Data Exchange (ETDEWEB)
Loncaric, Martin, E-mail: mloncaric@irb.hr; Sancho-Parramon, Jordi; Zorc, Hrvoje
2011-02-28
Metal island films of noble metals are obtained by deposition on glass substrates during the first stage of evaporation process when supported metal nanoparticles are formed. These films show unique optical properties, owing to the localized surface plasmon resonance of free electrons in metal nanoparticles. In the present work we study the optical properties of gold metal island films deposited on glass substrates with different mass thicknesses at different substrate temperatures. The optical characterization is performed by spectroscopic ellipsometry at different angles of incidence and transmittance measurements at normal incidence in the same point of the sample. Fitting of the ellipsometric data allows determining the effective optical constants and thickness of the island film. A multiple oscillator approach was used to successfully represent the dispersion of the effective optical constants of the films.
Afrin, Shumaila; Rahman, Yusra; Sarwar, Tarique; Husain, Mohammed Amir; Ali, Abad; Shamsuzzaman; Tabish, Mohammad
2017-11-01
Ticlopidine is an anti-platelet drug which belongs to the thienopyridine structural family and exerts its effect by functioning as an ADP receptor inhibitor. Ticlopidine inhibits the expression of TarO gene in S. aureus and may provide protection against MRSA. Groove binding agents are known to disrupt the transcription factor DNA complex and consequently inhibit gene expression. Understanding the mechanism of interaction of ticlopidine with DNA can prove useful in the development of a rational drug designing system. At present, there is no such study on the interaction of anti-platelet drugs with nucleic acids. A series of biophysical experiments were performed to ascertain the binding mode between ticlopidine and calf thymus DNA. UV-visible and fluorescence spectroscopic experiments confirmed the formation of a complex between ticlopidine and calf thymus DNA. Moreover, the values of binding constant were found to be in the range of 103 M- 1, which is indicative of groove binding between ticlopidine and calf thymus DNA. These results were further confirmed by studying the effect of denaturation on double stranded DNA, iodide quenching, viscometric studies, thermal melting profile as well as CD spectral analysis. The thermodynamic profile of the interaction was also determined using isothermal titration calorimetric studies. The reaction was found to be endothermic and the parameters obtained were found to be consistent with those of known groove binders. In silico molecular docking studies further corroborated well with the experimental results.
Usman, Afia; Ahmad, Masood
2017-08-01
BPF (Bisphenol-F), a member of the bisphenol family, having a wide range of industrial applications is gradually replacing Bisphenol-A. It is a recognized endocrine disrupting chemical (EDC). EDCs have been implicated in increased incidences of breast, prostate and testis cancers besides diabetes, obesity and decreased fertility. Due to the adverse effects of EDCs on human health, attempts have been directed towards their mechanism of toxicity especially at the molecular level. Hence, to understand the mechanism at the DNA level, interaction of BPF with calf thymus DNA was studied employing multi-spectroscopic, voltammetric and molecular docking techniques. Fluorescence spectra, cyclic voltammetry (CV), circular dichroism (CD) and molecular docking studies of BPF with DNA were suggestive of minor groove binding of BPF. UV-visible absorption and fluorescence spectra suggested static quenching due to complex formation between BPF and ctDNA. Hoechst 33258 (HO) and ethidium bromide (EB) displacement studies further confirmed such mode of BPF interaction. Thermodynamic and molecular docking parameters revealed the mechanism of binding of BPF with ctDNA to be favorable and spontaneous due to negative ΔG and occurring through hydrogen bonds and van der waals interactions. BPF induced DNA cleavage under in vitro conditions by plasmid nicking assay suggested it to be genotoxic. Copyright © 2017 Elsevier Ltd. All rights reserved.
Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa
2016-01-01
The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636
Synthesis, Characterization and DNA Binding Activity of a Potential DNA Intercalator
International Nuclear Information System (INIS)
Siti Norain Harun; Yaakob Razak; Haslina Ahmad
2016-01-01
A novel complex, (Ru(dppz) 2 (p-MOPIP)) 2+ (dppz = dipyrido-(3,2-a:20,30-c]phenazine, p-MOPIP = 2-(4-methoxyphenyl) imidazo(4,5-f)(1,10]phenanthroline) has been synthesized and characterized by elemental analysis, 1 H Nuclear Magnetic Resonance spectroscopy, mass spectrometry, Fourier Transform Infrared analysis, Ultra Violet visible and fluorescence spectroscopy. Herein, the complex was designed by adding p-MOPIP as an intercalating ligand and dppz as the ancillary ligand. The DNA binding properties of the complex with Calf Thymus DNA (CT-DNA) were investigated using spectroscopic methods. The UV-visible absorption band observed at 460 nm corresponded to the metal-to-ligand charge transfer (MLCT) while bands at 358 and 281 nm corresponded to intra-ligand (IL) π-π * transitions of the ligand scaffold in p-MOPIP and dppz. The intrinsic binding constant, K b for this complex was 1.67x10 6 M -1 and this suggested that this complex, (Ru(dppz) 2 (p-MOPIP)) 2+ bound to DNA via the intercalative mode. Interestingly, the interaction of this complex with CT-DNA also had a molecular light switch effect. (author)
Directory of Open Access Journals (Sweden)
Višňak Jakub
2016-01-01
Full Text Available A brief introduction into computational methodology and preliminary results for spectroscopic (excitation energies, vibrational frequencies in ground and excited electronic states and thermodynamic (stability constants, standard enthalpies and entropies of complexation reactions properties of some 1:1, 1:2 and 1:3 uranyl sulphato- and selenato- complexes in aqueos solutions will be given. The relativistic effects are included via Effective Core Potential (ECP, electron correlation via (TDDFT/B3LYP (dispersion interaction corrected and solvation is described via explicit inclusion of one hydration sphere beyond the coordinated water molecules. We acknowledge limits of this approximate description – more accurate calculations (ranging from semi-phenomenological two-component spin-orbit coupling up to four-component Dirac-Coulomb-Breit hamiltonian and Molecular Dynamics simulations are in preparation. The computational results are compared with the experimental results from Time-resolved Laser-induced Fluorescence Spectroscopy (TRLFS and UV-VIS spectroscopic studies (including our original experimental research on this topic. In case of the TRLFS and UV-VIS speciation studies, the problem of complex solution spectra decomposition into individual components is ill-conditioned and hints from theoretical chemistry could be very important. Qualitative agreement between our quantum chemical calculations of the spectroscopic properties and experimental data was achieved. Possible applications for geochemical modelling (e.g. safety studies of nuclear waste repositories, modelling of a future mining site and analytical chemical studies (including natural samples are discussed.
Sharp, Richard J.; Williams, Ralph A. D.
1988-01-01
Seventeen pink-pigmented strains of the genus Thermus were isolated from samples collected from thermal areas of Iceland. The strains were examined by using phenotypic characterization and DNA:DNA homology and were compared with recognized strains. Visually, the strains could be divided into three groups based on their pigmentation; however, spectroscopic studies of the pigments indicated little difference among them. Most strains required a vitamin supplement for growth and used fructose, maltose, mannose, or sucrose as the sole carbon source. In the presence of nitrate, two strains were able to grow under anaerobic conditions. The optimum growth temperature was 60°C; growth did not occur at 30 or 70°C. PMID:16347714
Li, Wen; Ji, Yuan Yuan; Wang, Jian Wen; Zhu, Yong Ming
2012-01-01
The interaction of calf thymus DNA (ct-DNA) with a novel synthesized pyrazolo[1,5-a]indole compound 1-methyl-7H-indeno[1,2-b]quinolinium-7-(4-dimethylamino) benzylidene triflate (MIDBT) was extensively studied by various spectroscopic techniques, viscosity measurements, and gel electrophoresis. The UV-visible observation implied that the compound interacted with ct-DNA by two binding modes, intercalating into the DNA base pairs and attaching to the helix exterior of DNA. The results of the fl...
Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi
2018-03-15
Molecular interaction of darunavir (DRV), a HIV protease inhibitor with calf thymus deoxyribonucleic acid (ct-DNA) was studied in physiological buffer (pH7.4) by multi-spectroscopic approaches hand in hand with viscosity measurements and molecular docking technique. The UV absorption and fluorescence results together revealed the formation of a DRV-ct-DNA complex having binding affinities of the order of 10 3 M -1 , which was more in keeping with the groove binding. The results that DRV bound to ct-DNA via groove binding mode was further evidenced by KI quenching studies, viscosity measurements, competitive binding investigations with EB and Rhodamine B and CD spectral analysis. The effect of ionic strength indicated the negligible involvement of electrostatic interaction between DRV and ct-DNA. The thermodynamic parameters regarding the binding interaction of DRV with ct-DNA in terms of enthalpy change (ΔH 0 ) and entropy change (ΔS 0 ) were -63.19kJ mol -1 and -141.92J mol -1 K -1 , indicating that hydrogen bonds and van der Waals forces played a predominant role in the binding process. Furthermore, molecular simulation studies suggested that DRV molecule was prone to bind in the A-T rich region of the minor groove of DNA. Copyright © 2017 Elsevier B.V. All rights reserved.
Rajasekhar, Bathula; Bodavarapu, Navya; Sridevi, M.; Thamizhselvi, G.; RizhaNazar, K.; Padmanaban, R.; Swu, Toka
2018-03-01
The present study reports the synthesis and evaluation of nonlinear optical property and G-Quadruplex DNA Stabilization of five novel copper(II) mixed ligand complexes. They were synthesized from copper(II) salt, 2,5- and 2,3- pyridinedicarboxylic acid, diethylenetriamine and amide based ligand (AL). The crystal structure of these complexes were determined through X-ray diffraction and supported by ESI-MAS, NMR, UV-Vis and FT-IR spectroscopic methods. Their nonlinear optical property was studied using Gaussian09 computer program. For structural optimization and nonlinear optical property, density functional theory (DFT) based B3LYP method was used with LANL2DZ basis set for metal ion and 6-31G∗ for C,H,N,O and Cl atoms. The present work reveals that pre-polarized Complex-2 showed higher β value (29.59 × 10-30e.s.u) as compared to that of neutral complex-1 (β = 0.276 × 10-30e.s.u.) which may be due to greater advantage of polarizability. Complex-2 is expected to be a potential material for optoelectronic and photonic technologies. Docking studies using AutodockVina revealed that complex-2 has higher binding energy for both G-Quadruplex DNA (-8.7 kcal/mol) and duplex DNA (-10.1 kcal/mol). It was also observed that structure plays an important role in binding efficiency.
Sureshkumar, B.; Mary, Y. Sheena; Resmi, K. S.; Panicker, C. Yohannan; Armaković, Stevan; Armaković, Sanja J.; Van Alsenoy, C.; Narayana, B.; Suma, S.
2018-03-01
Two 8-hydroxyquinoline derivatives, 5,7-dichloro-8-hydroxyquinoline (57DC8HQ) and 5-chloro-7-iodo-8-hydroxy quinoline (5CL7I8HQ) have been investigated in details by means of spectroscopic characterization and computational molecular modelling techniques. FT-IR and FT-Raman experimental spectroscopic approaches have been utilized in order to obtain detailed spectroscopic signatures of title compounds, while DFT calculations have been used in order to visualize and assign vibrations. The computed values of dipole moment, polarizability and hyperpolarizability indicate that the title molecules exhibit NLO properties. The evaluated HOMO and LUMO energies demonstrate the chemical stability of the molecules. NBO analysis is made to study the stability of the molecules arising from hyperconjugative interactions and charge delocalization. DFT calculations have been also used jointly with MD simulations in order to investigate in details global and local reactivity properties of title compounds. Also, molecular docking has been also used in order to investigate affinity of title compounds against decarboxylase inhibitor and quinoline derivatives can be a lead compounds for developing new antiparkinsonian drug.
Designing Optical Properties in DNA-Programmed Nanoparticle Superlattices
Ross, Michael Brendan
A grand challenge of modern science has been the ability to predict and design the properties of new materials. This approach to the a priori design of materials presents a number of challenges including: predictable properties of the material building blocks, a programmable means for arranging such building blocks into well understood architectures, and robust models that can predict the properties of these new materials. In this dissertation, we present a series of studies that describe how optical properties in DNA-programmed nanoparticle superlattices can be predicted prior to their synthesis. The first chapter provides a history and introduction to the study of metal nanoparticle arrays. Chapter 2 surveys and compares several geometric models and electrodynamics simulations with the measured optical properties of DNA-nanoparticle superlattices. Chapter 3 describes silver nanoparticle superlattices (rather than gold) and identifies their promise as plasmonic metamaterials. In chapter 4, the concept of plasmonic metallurgy is introduced, whereby it is demonstrated that concepts from materials science and metallurgy can be applied to the optical properties of mixed metallic plasmonic materials, unveiling rich and tunable optical properties such as color and asymmetric reflectivity. Chapter 5 presents a comprehensive theoretical exploration of anisotropy (non-spherical) in nanoparticle superlattice architectures. The role of anisotropy is discussed both on the nanoscale, where several desirable metamaterial properties can be tuned from the ultraviolet to near-infrared, and on the mesoscale, where the size and shape of a superlattice is demonstrated to have a pronounced effect on the observed far-field optical properties. Chapter 6 builds upon those theoretical data presented in chapter 5, including the experimental realization of size and shape dependent properties in DNA-programmed superlattices. Specifically, nanoparticle spacing is explored as a parameter that
Structure-Dependent Spectroscopic Properties of Yb3+-Doped Phosphosilicate Glasses Modified by SiO₂.
Wang, Ling; Zeng, Huidan; Yang, Bin; Ye, Feng; Chen, Jianding; Chen, Guorong; Smith, Andew T; Sun, Luyi
2017-02-28
Yb 3+ -doped phosphate glasses containing different amounts of SiO₂ were successfully synthesized by the conventional melt-quenching method. The influence mechanism of SiO₂ on the structural and spectroscopic properties was investigated systematically using the micro-Raman technique. It was worth noting that the glass with 26.7 mol % SiO₂ possessed the longest fluorescence lifetime (1.51 ms), the highest gain coefficient (1.10 ms·pm²), the maximum Stark splitting manifold of ²F 7/2 level (781 cm -1 ), and the largest scalar crystal-field N J and Yb 3+ asymmetry degree. Micro-Raman spectra revealed that introducing SiO₂ promoted the formation of P=O linkages, but broke the P=O linkages when the SiO₂ content was greater than 26.7 mol %. Based on the previous 29 Si MAS NMR experimental results, these findings further demonstrated that the formation of [SiO₆] may significantly affect the formation of P=O linkages, and thus influences the spectroscopic properties of the glass. These results indicate that phosphosilicate glasses may have potential applications as a Yb 3+ -doped gain medium for solid-state lasers and optical fiber amplifiers.
Static and Dynamic Properties of DNA Confined in Nanochannels
Gupta, Damini
Next-generation sequencing (NGS) techniques have considerably reduced the cost of high-throughput DNA sequencing. However, it is challenging to detect large-scale genomic variations by NGS due to short read lengths. Genome mapping can easily detect large-scale structural variations because it operates on extremely large intact molecules of DNA with adequate resolution. One of the promising methods of genome mapping is based on confining large DNA molecules inside a nanochannel whose cross-sectional dimensions are approximately 50 nm. Even though this genome mapping technology has been commercialized, the current understanding of the polymer physics of DNA in nanochannel confinement is based on theories and lacks much needed experimental support. The results of this dissertation are aimed at providing a detailed experimental understanding of equilibrium properties of nanochannel-confined DNA molecules. The results are divided into three parts. In first part, we evaluate the role of channel shape on thermodynamic properties of channel confined DNA molecules using a combination of fluorescence microscopy and simulations. Specifically, we show that high aspect ratio of rectangular channels significantly alters the chain statistics as compared to an equivalent square channel with same cross-sectional area. In the second part, we present experimental evidence that weak excluded volume effects arise in DNA nanochannel confinement, which form the physical basis for the extended de Gennes regime. We also show how confinement spectroscopy and simulations can be combined to reduce molecular weight dispersity effects arising from shearing, photo-cleavage, and nonuniform staining of DNA. Finally, the third part of the thesis concerns the dynamic properties of nanochannel confined DNA. We directly measure the center-of-mass diffusivity of single DNA molecules in confinement and show that that it is necessary to modify the classical results of de Gennes to account for local chain
Koçan, Halit; Kaya, Kerem; Özçeşmeci, İbrahim; Sesalan, B Şebnem; Göksel, Meltem; Durmuş, Mahmut; Burat, Ayfer Kalkan
2017-12-01
In this study, morpholinoethoxy-substituted metal-free (3), zinc(II) (4) and indium(III) (5) phthalocyanines were synthesized. These phthalocyanines were converted to their water-soluble quaternized derivatives (3Q-5Q) using excess methyl iodide as a quaternization agent. All these phthalocyanines (Pcs) were characterized by elemental analysis and different spectroscopic methods such as FT-IR, 1 H NMR, UV-Vis and mass spectrometry. The photophysical and photochemical properties such as fluorescence and generation of singlet oxygen were investigated for determination of these phthalocyanines as photosensitizers in photodynamic therapy (PDT) applications. The binding properties of quaternized phthalocyanines (3Q-5Q) to calf thymus DNA (CT-DNA) were investigated by UV-Vis and fluorescence spectrophotometric methods. The quenching effect of all quaternized phthalocyanines on the fluorescence intensity of SYBR Green-DNA complex was determined. The mixtures of 3Q, 4Q or 5Q and DNA solutions were used to determine the change in T m of double helix DNA with thermal denaturation profile. In addition, thermodynamic parameters considering their aggregation in buffer solution, which shows the spontaneity of the reactions between DNA and quaternized Pcs were investigated. On the other hand, in vitro phototoxicity and cytotoxicity behavior of the quaternized water-soluble phthalocyanine photosensitizers (3Q-5Q) were tested against the cervical cancer cell line named HeLa for evaluation of their suitability for treatment of cancer by PDT method. Peripherally tetra-substituted neutral and quaternized metal-free and metallophthalocyanines (MPcs) (Zn, In) bearing morpholinoethoxy groups were prepared. The binding of quaternized compounds (3Q-5Q) to CT-DNA were examined using UV-Vis, fluorescence spectra, thermal denaturation profiles and K SV values. Besides, thermodynamic studies indicated that binding of 3Q-5Q to DNA was spontaneous. On the other hand, in vitro phototoxicity and
Hambardzumyan, Arayik; Foulon, Laurence; Chabbert, Brigitte; Aguié-Béghin, Véronique
2012-12-10
Novel nanocomposite coatings composed of cellulose nanocrystals (CNCs) and lignin (either synthetic or fractionated from spruce and corn stalks) were prepared without chemical modification or functionalization (via covalent attachment) of one of the two biopolymers. The spectroscopic properties of these coatings were investigated by UV-visible spectrophotometry and spectroscopic ellipsometry. When using the appropriate weight ratio of CNC/lignin (R), these nanocomposite systems exhibited high-performance optical properties, high transmittance in the visible spectrum, and high blocking in the UV spectrum. Atomic force microscopy analysis demonstrated that these coatings were smooth and homogeneous, with visible dispersed lignin nodules in a cellulosic matrix. It was also demonstrated that the introduction of nanoparticles into the medium increases the weight ratio and the CNC-specific surface area, which allows better dispersion of the lignin molecules throughout the solid film. Consequently, the larger molecular expansion of these aromatic polymers on the surface of the cellulosic nanoparticles dislocates the π-π aromatic aggregates, which increases the extinction coefficient and decreases the transmittance in the UV region. These nanocomposite coatings were optically transparent at visible wavelengths.
Interfacing of DNA with carbon nanotubes for nanodevice applications
International Nuclear Information System (INIS)
Rastogi, Richa; Dhindsa, Navneet; Suri, C. Raman; Pant, B.D.; Tripathi, S.K.; Kaur, Inderpreet; Bharadwaj, Lalit M.
2012-01-01
In nanotechnology, carbon nanotubes are evolving as ‘hot spot’ due to their applications as most sensitive biosensors. Thus, study of effect of biomolecular interaction is prerequisite for their electrical application in biosensors and bioelectronics. Here, we have explored this effect on electrical properties of carbon nanotubes with DNA as a model biomolecule. A stable conjugate of carbon nanotubes with DNA is formed via covalent methodology employing quantum dot as fluoropore and characterized with various spectroscopic, fluoroscopic and microscopic techniques. CNT–DNA adduct showed decreased transconductance (from 614.46 μS to 1.34 μS) and shift of threshold voltage (from −0.85 V to 2.5 V) due to change in Schottky barriers at metal–nanotube contact. In addition, decrease in hole mobility (from 4.46 × 10 6 to 9.72 × 10 3 cm 2 V −1 s −1 ) and increase in ON-linear resistance (from 74 kΩ to 0.44 MΩ) conclude large change in device parameters. On the one hand, this substantial change in device parameters after interfacing with biomolecules supports application of carbon nanotubes in the field of biosensors while on the other hand, the same can limit their use in future power electronic devices where stability in device parameters is essential. -- Graphical abstract: Carbon nanotubes are interfaced with DNA via covalent interactions and characterized with spectroscopic, fluoroscopic and microscopic techniques. Electrical characterization of this stable SWNT–DNA conjugate shows decreased transconductance and shift of threshold voltage towards positive gate voltages. On the one hand, this substantial change in device parameters after interfacing with biomolecules supports application of carbon nanotubes in the field of biosensors while on the other hand, the same can limit their use in future power electronic devices where stability in device parameters is essential. Highlights: ► Effect of biomolecular (DNA) interaction on electrical
Hair Dye–DNA Interaction: Plausible Cause of Mutation
Directory of Open Access Journals (Sweden)
Swati Maiti
2015-09-01
Full Text Available Hair dye is one of the most popular cosmetic products which are used more widely and frequently to improve an individual’s appearance. Although the genotoxic effects of dye ingredients are widely reported, hair dye in its usable form is not reported extensively. In this contribution, we report the possible mode of interaction of hair dye with DNA which leads to genotoxicity. The effect of dye DNA interaction was studied on the most popular and globally used hair dye with Calf Thymus DNA and plasmid DNA. This interaction of dye DNA was studied by spectroscopic analyses and gel electrophoresis. The result had shown positive interaction of dye with DNA. Gel electrophoresis study confirms the binding of dye with DNA which results in linearization and fragmentation of the plasmid DNA. Dye–DNA interaction causes fragmentation and oxidation of DNA in absence of any catalyst, implies high toxicity of commercial hair dyes. Thus, it can be deduced from the present studies that hair dye in its usable form may lead to its penetration through skin affecting genomic DNA possesses genotoxic property and can be treated as one of the most common mutagen.
Elastic properties and spectroscopic studies of Na 2 O–ZnO–B 2 O 3 ...
Indian Academy of Sciences (India)
Elastic properties, 11B MAS–NMR and IR spectroscopic studies have been employed to study the structure of Na2O–ZnO–B2O3 glasses. Sound velocities and elastic moduli such as longitudinal, Young's, bulk and shear modulus have been measured at a frequency of 10 MHz as a function of ZnO concentration.
Spectroscopic analysis of radiation-generated changes in tensile properties of a polyetherimide film
International Nuclear Information System (INIS)
Long, E.R. Jr.; Long, S.A.T.
1985-05-01
The effects of electron radiation on Ultem, a polyetherimide were studied for doses from 2 x 10 to the 9th power to 6 x 10 to the 9th power rad. Specimens were studied for tensile property testing and for electron paramagnetic resonance and infrared spectroscopic measurements of molecular structure. A Faraday cup design and a method for remote temperature measurement were developed. The spectroscopic data show that radiation caused dehydrogenation of methyl groups, rupture of main-chain ether linkage, and opening of imide rings, all to form radicals and indicate that the so-formed atomic hydrogen attached to phenyl radicals, but not to phenoxyl radicals, which would have formed hydroxyls. The observed decays of the radiation-generated phenoxyl, gem-dimethyl, and carbonyl radicals were interpreted as a combining of the radicals to form crosslinking. This crosslinking is the probable cause of the major reduction in the elongation of the tensile specimens after irradiation. Subsequent classical solubility tests indicate that the irradiation caused massive crosslinking
Structural properties of replication origins in yeast DNA sequences
International Nuclear Information System (INIS)
Cao Xiaoqin; Zeng Jia; Yan Hong
2008-01-01
Sequence-dependent DNA flexibility is an important structural property originating from the DNA 3D structure. In this paper, we investigate the DNA flexibility of the budding yeast (S. Cerevisiae) replication origins on a genome-wide scale using flexibility parameters from two different models, the trinucleotide and the tetranucleotide models. Based on analyzing average flexibility profiles of 270 replication origins, we find that yeast replication origins are significantly rigid compared with their surrounding genomic regions. To further understand the highly distinctive property of replication origins, we compare the flexibility patterns between yeast replication origins and promoters, and find that they both contain significantly rigid DNAs. Our results suggest that DNA flexibility is an important factor that helps proteins recognize and bind the target sites in order to initiate DNA replication. Inspired by the role of the rigid region in promoters, we speculate that the rigid replication origins may facilitate binding of proteins, including the origin recognition complex (ORC), Cdc6, Cdt1 and the MCM2-7 complex
Fiber optic spectroscopic digital imaging sensor and method for flame properties monitoring
Zelepouga, Serguei A [Hoffman Estates, IL; Rue, David M [Chicago, IL; Saveliev, Alexei V [Chicago, IL
2011-03-15
A system for real-time monitoring of flame properties in combustors and gasifiers which includes an imaging fiber optic bundle having a light receiving end and a light output end and a spectroscopic imaging system operably connected with the light output end of the imaging fiber optic bundle. Focusing of the light received by the light receiving end of the imaging fiber optic bundle by a wall disposed between the light receiving end of the fiber optic bundle and a light source, which wall forms a pinhole opening aligned with the light receiving end.
Transitional circuitry for studying the properties of DNA
Trubochkina, N.
2018-01-01
The article is devoted to a new view of the structure of DNA as an intellectual scheme possessing the properties of logic and memory. The theory of transient circuitry, developed by the author for optimal computer circuits, revealed an amazing structural similarity between mathematical models of transition silicon elements and logic and memory circuits of solid state transient circuitry and atomic models of parts of DNA.
Spectroscopic and electric dipole properties of Sr+Ar and SrAr systems including high excited states
Hamdi, Rafika; Abdessalem, Kawther; Dardouri, Riadh; Al-Ghamdi, Attieh A.; Oujia, Brahim; Gadéa, Florent Xavier
2018-01-01
The spectroscopic properties of the fundamental and several excited states of Sr+Ar and SrAr, Van der Waals systems are investigated by employing an ab initio method in a pseudo-potential approach. The potential energy curves and the spectroscopic parameters are displayed for the 1-10 2Σ+, 1-6 2Π and 1-3 2Δ electronic states of the Sr+Ar molecule and for the 1-6 1Σ+, 1-4 3Σ+, 1-3 1,3Π and 1-3 1,3Δ states of the neutral molecule SrAr. In addition, from these curves, the vibrational levels and their energy spacing are deduced for Σ+, Π and Δ symmetries. The spectra of the permanent and transition dipole moments are studied for the 1,3Σ+ states of SrAr, which are considered to be two-electron systems and 2Σ+ states of the single electron Sr+Ar ion. The spectroscopic parameters obtained for each molecular system are compared with previous theoretical and experimental works. A significant correlation revealed the accuracy of our results.
A subspace approach to high-resolution spectroscopic imaging.
Lam, Fan; Liang, Zhi-Pei
2014-04-01
To accelerate spectroscopic imaging using sparse sampling of (k,t)-space and subspace (or low-rank) modeling to enable high-resolution metabolic imaging with good signal-to-noise ratio. The proposed method, called SPectroscopic Imaging by exploiting spatiospectral CorrElation, exploits a unique property known as partial separability of spectroscopic signals. This property indicates that high-dimensional spectroscopic signals reside in a very low-dimensional subspace and enables special data acquisition and image reconstruction strategies to be used to obtain high-resolution spatiospectral distributions with good signal-to-noise ratio. More specifically, a hybrid chemical shift imaging/echo-planar spectroscopic imaging pulse sequence is proposed for sparse sampling of (k,t)-space, and a low-rank model-based algorithm is proposed for subspace estimation and image reconstruction from sparse data with the capability to incorporate prior information and field inhomogeneity correction. The performance of the proposed method has been evaluated using both computer simulations and phantom studies, which produced very encouraging results. For two-dimensional spectroscopic imaging experiments on a metabolite phantom, a factor of 10 acceleration was achieved with a minimal loss in signal-to-noise ratio compared to the long chemical shift imaging experiments and with a significant gain in signal-to-noise ratio compared to the accelerated echo-planar spectroscopic imaging experiments. The proposed method, SPectroscopic Imaging by exploiting spatiospectral CorrElation, is able to significantly accelerate spectroscopic imaging experiments, making high-resolution metabolic imaging possible. Copyright © 2014 Wiley Periodicals, Inc.
Moral, Mónica; García, Gregorio; Peñas, Antonio; Garzón, Andrés; Granadino-Roldán, José M.; Melguizo, Manuel; Fernández-Gómez, Manuel
2012-10-01
This work presents a theoretical and spectroscopic study on the electronic and structural properties of the diphenyl-s-tetrazine molecule (Ph2Tz) and some oligomeric derivatives. Ph2Tz was synthesized through a variation of Pinner-type reaction which uses N-acetylcysteine as catalyst. Insight into the structure and electronic properties of the title compound was obtained through IR, Raman, UV-Vis spectra in different solvents, and theoretical calculations. Theoretical studies have been extended to different n-mers derivatives up to an ideal molecular wire through the oligomeric approximation, predicting this way electronic properties such as LUMO energy levels, electron affinity and reorganization energy in order to assess their possible applications in molecular electronics.
Supergiant fast X-ray transients with Swift: Spectroscopic and temporal properties
Romano, P.; Mangano, V.; Ducci, L.; Esposito, P.; Farinelli, R.; Ceccobello, C.; Vercellone, S.; Burrows, D. N.; Kennea, J. A.; Krimm, H. A.; Gehrels, N.
2012-12-01
Supergiant fast X-ray transients (SFXTs) are a class of high-mass X-ray binaries with possible counterparts in the high energy gamma rays. The Swift SFXT Project1 has conducted a systematic investigation of the properties of SFTXs on timescales ranging from minutes to years and in several intensity states (from bright flares, to intermediate intensity states, and down to almost quiescence). We also performed broad-band spectroscopy of outbursts, and intensity-selected spectroscopy outside of outbursts. We demonstrated that while the brightest phase of the outburst only lasts a few hours, further activity is observed at lower fluxes for a remarkably longer time, up to weeks. Furthermore, we assessed the fraction of the time these sources spend in each phase, and their duty cycle of inactivity. We present the most recent results from our investigation. The spectroscopic and, most importantly, timing properties of SFXTs we have uncovered with Swift will serve as a guide in search for the high energy emission from these enigmatic objects.
Desthuilliers-Porquet, M G; Quentin, P; Sauvage-Letessier, J
1981-01-01
Static properties of even-even Os, Pt, Hg nuclei have been obtained from HF+BCS calculations. Single-particle wave functions which come from these self-consistent calculations have been used to calculate some spectroscopic properties of odd Re, Os, Ir, Pt, Au, and Hg nuclei, within the rotor-quasiparticle coupling model. The authors' calculations are able to give a good description of most of available experimental data. (12 refs).
Tuning porosity and radial mechanical properties of DNA origami nanotubes via crossover design
Ma, Zhipeng; Kawai, Kentaro; Hirai, Yoshikazu; Tsuchiya, Toshiyuki; Tabata, Osamu
2017-06-01
DNA origami nanotubes are utilized as structural platforms for the fabrication of various micro/nanosystems for drug delivery, optical or biological sensing, and even nanoscale robots. Their radial structural and mechanical properties, which play a crucial role in the effective use of micro/nanosystems, have not been fully studied. In particular, the effects of crossovers, which are basic structures for rationally assembling double-stranded DNA (dsDNA) helices into a nanotube configuration, have not yet been characterized experimentally. To investigate the effects of crossovers on the porosity and the radial mechanical properties of DNA origami nanotubes, we fabricated a DNA origami nanotube with varied crossover designs along the nanotube axis. The radial geometry of the DNA origami nanotube is experimentally characterized by both atomic force microscopy (AFM) and electron cryomicroscopy (cryo-EM). Moreover, the radial mechanical properties of the DNA origami nanotube including the radial modulus are directly measured by force-distance-based AFM. These measurements reveal that the porosity and the radial modulus of DNA origami nanotubes can be tuned by adjusting the crossover design, which enables the optimal design and construction of DNA origami nanostructures for various applications.
Khan, Ishaat M.; Ahmad, Afaq; Kumar, Sarvendra
2013-03-01
A new charge transfer (CT) complex [(DAPH)+(DNB)-] consisting of 2,6-diaminopyridine (DAP) as donor and 3,5-dinitrobenzoic acid (DNB-H) as acceptor, was synthesized and characterized by FTIR, 1H and 13C NMR, ESI mass spectroscopic and X-ray crystallographic techniques. The hydrogen bonding (N+-H⋯O-) plays an important role to consolidate the cation and anion together. CT complex shows a considerable interaction with Calf thymus DNA. The CT complex was also tested for its antibacterial activity against two Gram-positive bacteria Staphylococcus aureus and Bacillus subtilis and two Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa strains by using Tetracycline as standard, and antifungal property against Aspergillus niger, Candida albicans, and Penicillium sp. by using Nystatin as standard. The results were compared with standard drugs and significant conclusions were obtained. A polymeric net work through H-bonding interactions between neighboring moieties was observed. This has been attributed to the formation of 1:1 type CT complex.
International Nuclear Information System (INIS)
Subastri, A.; Durga, A.; Harikrishna, K.; Sureshkumar, M.; Jeevaratnam, K.; Girish, K.S.; Thirunavukkarasu, C.
2016-01-01
Disulfiram (C 10 H 20 N 2 S 4 ) is an acetaldehyde dehydrogenase inhibitor used in the treatment of chronic alcoholism and it has also been subjected to the clinical trial for cancer in recent times. However, there is no report on the binding effect of this emerging drug with DNA. Hence, the present investigation was taken up to study the binding effect of disulfiram on DNA under physiological conditions. UV–vis absorption spectroscopy, fluorescence emission spectroscopy, circular dichroism spectroscopy, cyclic voltammetry and molecular docking techniques were employed to determine the interaction mode of disulfiram with DNA. Further, DNA cleavage property of disulfiram was carried out by using agarose gel electrophoresis. The UV–vis absorption, emission and cyclic voltammetry measurements revealed that disulfiram showed the intercalative mode of interaction with DNA. The circular dichroism study exhibited structural changes of partial transition from B-conformation to A-conformation in DNA upon addition of disulfiram. Molecular docking study of disulfiram with DNA depicted intercalative mode of binding by formation of hydrogen and hydrophobic interaction along with docking score of −3.07 kcal/mol. The DNA cleavage study revealed that low concentration of disulfiram (50 µM) protected the DNA from oxidative damage sequentially, while high concentration of disulfiram (100 µM) showed less protective activity. Conversely, it caused DNA damage in the presence of hydroxyl radical oxidative system. Hence, the results obtained from the present investigations provide detailed discernment into DNA interaction effects of disulfiram.
Unveiling DNA structural properties of promoter regions of ...
Indian Academy of Sciences (India)
Aditya Kumar
Unveiling DNA structural properties of promoter regions of prokaryotic transcriptome and their role in gene expression. Aditya Kumar. Assistant Professor. Molecular Biology & Biotechnology. Tezpur University. Tezpur – 784028, Assam ...
Interfacing of DNA with carbon nanotubes for nanodevice applications
Energy Technology Data Exchange (ETDEWEB)
Rastogi, Richa, E-mail: richa.bend@gmail.com [Biomolecular Electronics and Nanotechnology Division (BEND), Central Scientific Instruments Organisation (CSIO), Sector-30C, Chandigarh 160030 (India); Centre of Advanced Studies in Physics, Punjab University, Sector-14, Chandigarh 160014 (India); Dhindsa, Navneet [Biomolecular Electronics and Nanotechnology Division (BEND), Central Scientific Instruments Organisation (CSIO), Sector-30C, Chandigarh 160030 (India); Suri, C. Raman [Biosensor Division, Institute of Microbial Technology (IMTECH), Sector-39, Chandigarh 160039 (India); Pant, B.D. [Central Electronics Engineering Research Institute, Pilani, Rajasthan (India); Tripathi, S.K. [Centre of Advanced Studies in Physics, Punjab University, Sector-14, Chandigarh 160014 (India); Kaur, Inderpreet; Bharadwaj, Lalit M. [Biomolecular Electronics and Nanotechnology Division (BEND), Central Scientific Instruments Organisation (CSIO), Sector-30C, Chandigarh 160030 (India)
2012-08-15
In nanotechnology, carbon nanotubes are evolving as 'hot spot' due to their applications as most sensitive biosensors. Thus, study of effect of biomolecular interaction is prerequisite for their electrical application in biosensors and bioelectronics. Here, we have explored this effect on electrical properties of carbon nanotubes with DNA as a model biomolecule. A stable conjugate of carbon nanotubes with DNA is formed via covalent methodology employing quantum dot as fluoropore and characterized with various spectroscopic, fluoroscopic and microscopic techniques. CNT-DNA adduct showed decreased transconductance (from 614.46 {mu}S to 1.34 {mu}S) and shift of threshold voltage (from -0.85 V to 2.5 V) due to change in Schottky barriers at metal-nanotube contact. In addition, decrease in hole mobility (from 4.46 Multiplication-Sign 10{sup 6} to 9.72 Multiplication-Sign 10{sup 3} cm{sup 2} V{sup -1} s{sup -1}) and increase in ON-linear resistance (from 74 k Ohm-Sign to 0.44 M Ohm-Sign ) conclude large change in device parameters. On the one hand, this substantial change in device parameters after interfacing with biomolecules supports application of carbon nanotubes in the field of biosensors while on the other hand, the same can limit their use in future power electronic devices where stability in device parameters is essential. -- Graphical abstract: Carbon nanotubes are interfaced with DNA via covalent interactions and characterized with spectroscopic, fluoroscopic and microscopic techniques. Electrical characterization of this stable SWNT-DNA conjugate shows decreased transconductance and shift of threshold voltage towards positive gate voltages. On the one hand, this substantial change in device parameters after interfacing with biomolecules supports application of carbon nanotubes in the field of biosensors while on the other hand, the same can limit their use in future power electronic devices where stability in device parameters is essential
Influence of Mo impurity on the spectroscopic and scintillation properties of PbWO4 crystals
International Nuclear Information System (INIS)
Boehm, M.; Hofstaetter, A.; Luh, M.; Meyer, B.K.; Scharmann, A.; Drobychev, G.Yu.; Grenoble-1 Univ., 74 - Annecy; Peigneux, J.P.
1997-12-01
The influence of molybdenum doping on the spectroscopic and scintillation properties of lead tungstate crystals has been investigated. From the results the slow scintillation component as well as the afterglow are found to be due to the Mo impurity. In addition the blue luminescence from excited (WO 4 ) 2- -complex seems to be increasingly suppressed as the doping concentration goes on. Possible mechanisms for the effects have been discussed. (author)
Sarath Kumar, S. R.
2012-02-01
The influence of oxygen vacancies on the transport properties of epitaxial thermoelectric (Sr,La)TiO3 thin films is determined using electrical and spectroscopic ellipsometry (SE) measurements. Oxygen vacancy concentration was varied by ex-situ annealing in Ar and Ar/H2. All films exhibited degenerate semiconducting behavior, and electrical conductivity decreased (258–133 S cm−1) with increasing oxygen content. Similar decrease in the Seebeck coefficient is observed and attributed to a decrease in effective mass (7.8–3.2 me ), as determined by SE. Excellent agreement between transport properties deduced from SE and direct electrical measurements suggests that SE is an effective tool for studying oxide thin film thermoelectrics.
Sarath Kumar, S. R.; Abutaha, Anas I.; Hedhili, Mohamed N.; Alshareef, Husam N.
2012-01-01
The influence of oxygen vacancies on the transport properties of epitaxial thermoelectric (Sr,La)TiO3 thin films is determined using electrical and spectroscopic ellipsometry (SE) measurements. Oxygen vacancy concentration was varied by ex-situ annealing in Ar and Ar/H2. All films exhibited degenerate semiconducting behavior, and electrical conductivity decreased (258–133 S cm−1) with increasing oxygen content. Similar decrease in the Seebeck coefficient is observed and attributed to a decrease in effective mass (7.8–3.2 me ), as determined by SE. Excellent agreement between transport properties deduced from SE and direct electrical measurements suggests that SE is an effective tool for studying oxide thin film thermoelectrics.
Rokob, Tibor András; Srnec, Martin; Rulíšek, Lubomír
2012-05-21
In the last decade, we have witnessed substantial progress in the development of quantum chemical methodologies. Simultaneously, robust solvation models and various combined quantum and molecular mechanical (QM/MM) approaches have become an integral part of quantum chemical programs. Along with the steady growth of computer power and, more importantly, the dramatic increase of the computer performance to price ratio, this has led to a situation where computational chemistry, when exercised with the proper amount of diligence and expertise, reproduces, predicts, and complements the experimental data. In this perspective, we review some of the latest achievements in the field of theoretical (quantum) bioinorganic chemistry, concentrating mostly on accurate calculations of the spectroscopic and physico-chemical properties of open-shell bioinorganic systems by wave-function (ab initio) and DFT methods. In our opinion, the one-to-one mapping between the calculated properties and individual molecular structures represents a major advantage of quantum chemical modelling since this type of information is very difficult to obtain experimentally. Once (and only once) the physico-chemical, thermodynamic and spectroscopic properties of complex bioinorganic systems are quantitatively reproduced by theoretical calculations may we consider the outcome of theoretical modelling, such as reaction profiles and the various decompositions of the calculated parameters into individual spatial or physical contributions, to be reliable. In an ideal situation, agreement between theory and experiment may imply that the practical problem at hand, such as the reaction mechanism of the studied metalloprotein, can be considered as essentially solved.
Zabolotnyi, M. A.; Prylutskyy, Yu I.; Poluyan, N. A.; Evstigneev, M. P.; Dovbeshko, G. I.
2016-08-01
Conformational, IR spectroscopic and electronic properties of the components of Conium alkaloids (Conium maculatum) in aqueous environment were determined by model calculations and experiment. With the help of FT-IR spectroscopy the possibility of formation of an adduct between γ-coniceine alkaloid and C60 fullerene was demonstrated, which is important for further application of conium analogues in biomedical purposes.
Dielectric properties of DNA oligonucleotides on the surface of silicon nanostructures
Energy Technology Data Exchange (ETDEWEB)
Bagraev, N. T., E-mail: bagraev@mail.ioffe.ru [St. Petersburg Polytechnic University (Russian Federation); Chernev, A. L. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation); Klyachkin, L. E. [St. Petersburg Polytechnic University (Russian Federation); Malyarenko, A. M. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Emel’yanov, A. K.; Dubina, M. V. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation)
2016-10-15
Planar silicon nanostructures that are formed as a very narrow silicon quantum well confined by δ barriers heavily doped with boron are used to study the dielectric properties of DNA oligonucleotides deposited onto the surface of the nanostructures. The capacitance characteristics of the silicon nanostructures with oligonucleotides deposited onto their surface are determined by recording the local tunneling current–voltage characteristics by means of scanning tunneling microscopy. The results show the possibility of identifying the local dielectric properties of DNA oligonucleotide segments consisting of repeating G–C pairs. These properties apparently give grounds to correlate the segments with polymer molecules exhibiting the properties of multiferroics.
Bignon, Emmanuelle; Gattuso, Hugo; Morell, Christophe; Dumont, Elise; Monari, Antonio
2015-08-03
The main chromophore of (6-4) photoproducts, namely, 5-methyl-2-pyrimidone (Pyo), is an artificial noncanonical nucleobase. This chromophore has recently been reported as a potential photosensitizer that induces triplet damage in thymine DNA. In this study, we investigate the spectroscopic properties of the Pyo unit embedded in DNA by means of explicit solvent molecular-dynamics simulations coupled to time-dependent DFT and quantum-mechanics/molecular-mechanics techniques. Triplet-state transfer from the Pyo to the thymine unit was monitored in B-DNA by probing the propensity of this photoactive pyrimidine analogue to induce a Dexter-type triplet photosensitization and subsequent DNA damage. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Energy Technology Data Exchange (ETDEWEB)
Subastri, A.; Durga, A. [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605014 (India); Harikrishna, K.; Sureshkumar, M. [Centre for Bioinformatics, Pondicherry University, Puducherry 605014 (India); Jeevaratnam, K. [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605014 (India); Girish, K.S. [Department of Studies & Research in Biochemistry, Tumkur University, Tumkur, Karnataka (India); Thirunavukkarasu, C., E-mail: tchinnasamy@hotmail.com [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605014 (India)
2016-02-15
Disulfiram (C{sub 10}H{sub 20}N{sub 2}S{sub 4}) is an acetaldehyde dehydrogenase inhibitor used in the treatment of chronic alcoholism and it has also been subjected to the clinical trial for cancer in recent times. However, there is no report on the binding effect of this emerging drug with DNA. Hence, the present investigation was taken up to study the binding effect of disulfiram on DNA under physiological conditions. UV–vis absorption spectroscopy, fluorescence emission spectroscopy, circular dichroism spectroscopy, cyclic voltammetry and molecular docking techniques were employed to determine the interaction mode of disulfiram with DNA. Further, DNA cleavage property of disulfiram was carried out by using agarose gel electrophoresis. The UV–vis absorption, emission and cyclic voltammetry measurements revealed that disulfiram showed the intercalative mode of interaction with DNA. The circular dichroism study exhibited structural changes of partial transition from B-conformation to A-conformation in DNA upon addition of disulfiram. Molecular docking study of disulfiram with DNA depicted intercalative mode of binding by formation of hydrogen and hydrophobic interaction along with docking score of −3.07 kcal/mol. The DNA cleavage study revealed that low concentration of disulfiram (50 µM) protected the DNA from oxidative damage sequentially, while high concentration of disulfiram (100 µM) showed less protective activity. Conversely, it caused DNA damage in the presence of hydroxyl radical oxidative system. Hence, the results obtained from the present investigations provide detailed discernment into DNA interaction effects of disulfiram.
Vasilyev, V.; Ludwig, H.-G.; Freytag, B.; Lemasle, B.; Marconi, M.
2017-10-01
Context. Standard spectroscopic analyses of Cepheid variables are based on hydrostatic one-dimensional model atmospheres, with convection treated using various formulations of mixing-length theory. Aims: This paper aims to carry out an investigation of the validity of the quasi-static approximation in the context of pulsating stars. We check the adequacy of a two-dimensional time-dependent model of a Cepheid-like variable with focus on its spectroscopic properties. Methods: With the radiation-hydrodynamics code CO5BOLD, we construct a two-dimensional time-dependent envelope model of a Cepheid with Teff = 5600 K, log g = 2.0, solar metallicity, and a 2.8-day pulsation period. Subsequently, we perform extensive spectral syntheses of a set of artificial iron lines in local thermodynamic equilibrium. The set of lines allows us to systematically study effects of line strength, ionization stage, and excitation potential. Results: We evaluate the microturbulent velocity, line asymmetry, projection factor, and Doppler shifts. The microturbulent velocity, averaged over all lines, depends on the pulsational phase and varies between 1.5 and 2.7 km s-1. The derived projection factor lies between 1.23 and 1.27, which agrees with observational results. The mean Doppler shift is non-zero and negative, -1 km s-1, after averaging over several full periods and lines. This residual line-of-sight velocity (related to the "K-term") is primarily caused by horizontal inhomogeneities, and consequently we interpret it as the familiar convective blueshift ubiquitously present in non-pulsating late-type stars. Limited statistics prevent firm conclusions on the line asymmetries. Conclusions: Our two-dimensional model provides a reasonably accurate representation of the spectroscopic properties of a short-period Cepheid-like variable star. Some properties are primarily controlled by convective inhomogeneities rather than by the Cepheid-defining pulsations. Extended multi-dimensional modelling
Structure-Dependent Spectroscopic Properties of Yb3+-Doped Phosphosilicate Glasses Modified by SiO2
Directory of Open Access Journals (Sweden)
Ling Wang
2017-02-01
Full Text Available Yb3+-doped phosphate glasses containing different amounts of SiO2 were successfully synthesized by the conventional melt-quenching method. The influence mechanism of SiO2 on the structural and spectroscopic properties was investigated systematically using the micro-Raman technique. It was worth noting that the glass with 26.7 mol % SiO2 possessed the longest fluorescence lifetime (1.51 ms, the highest gain coefficient (1.10 ms·pm2, the maximum Stark splitting manifold of 2F7/2 level (781 cm−1, and the largest scalar crystal-field NJ and Yb3+ asymmetry degree. Micro-Raman spectra revealed that introducing SiO2 promoted the formation of P=O linkages, but broke the P=O linkages when the SiO2 content was greater than 26.7 mol %. Based on the previous 29Si MAS NMR experimental results, these findings further demonstrated that the formation of [SiO6] may significantly affect the formation of P=O linkages, and thus influences the spectroscopic properties of the glass. These results indicate that phosphosilicate glasses may have potential applications as a Yb3+-doped gain medium for solid-state lasers and optical fiber amplifiers.
Structure-Dependent Spectroscopic Properties of Yb3+-Doped Phosphosilicate Glasses Modified by SiO2
Wang, Ling; Zeng, Huidan; Yang, Bin; Ye, Feng; Chen, Jianding; Chen, Guorong; Smith, Andew T.; Sun, Luyi
2017-01-01
Yb3+-doped phosphate glasses containing different amounts of SiO2 were successfully synthesized by the conventional melt-quenching method. The influence mechanism of SiO2 on the structural and spectroscopic properties was investigated systematically using the micro-Raman technique. It was worth noting that the glass with 26.7 mol % SiO2 possessed the longest fluorescence lifetime (1.51 ms), the highest gain coefficient (1.10 ms·pm2), the maximum Stark splitting manifold of 2F7/2 level (781 cm−1), and the largest scalar crystal-field NJ and Yb3+ asymmetry degree. Micro-Raman spectra revealed that introducing SiO2 promoted the formation of P=O linkages, but broke the P=O linkages when the SiO2 content was greater than 26.7 mol %. Based on the previous 29Si MAS NMR experimental results, these findings further demonstrated that the formation of [SiO6] may significantly affect the formation of P=O linkages, and thus influences the spectroscopic properties of the glass. These results indicate that phosphosilicate glasses may have potential applications as a Yb3+-doped gain medium for solid-state lasers and optical fiber amplifiers. PMID:28772601
Rudra, Suparna; Dasmandal, Somnath; Patra, Chiranjit; Kundu, Arjama; Mahapatra, Ambikesh
2016-09-01
The binding interaction of a synthesized Schiff base Fe(II) complex with biological macromolecules viz., bovine serum albumin (BSA) and calf thymus(ct)-DNA have been investigated using different spectroscopic techniques coupled with viscosity measurements at physiological pH and 298 K. Regular amendments in emission intensities of BSA upon the action of the complex indicate significant interaction between them, and the binding interaction have been characterized by Stern Volmer plots and thermodynamic binding parameters. On the basis of this quenching technique one binding site with binding constant (Kb = (7.6 ± 0.21) × 105) between complex and protein have been obtained at 298 K. Time-resolved fluorescence studies have also been encountered to understand the mechanism of quenching induced by the complex. Binding affinities of the complex to the fluorophores of BSA namely tryptophan (Trp) and tyrosine (Tyr) have been judged by synchronous fluorescence studies. Secondary structural changes of BSA rooted by the complex has been revealed by CD spectra. On the other hand, hypochromicity of absorption spectra of the complex with the addition of ct-DNA and the gradual reduction in emission intensities of ethidium bromide bound ct-DNA in presence of the complex indicate noticeable interaction between ct-DNA and the complex with the binding constant (4.2 ± 0.11) × 106 M- 1. Life-time measurements have been studied to determine the relative amplitude of binding of the complex to ct-DNA base pairs. Mode of binding interaction of the complex with ct-DNA has been deciphered by viscosity measurements. CD spectra have also been used to understand the changes in ct-DNA structure upon binding with the metal complex. Density functional theory (DFT) and molecular docking analysis have been employed in highlighting the interactive phenomenon and binding location of the complex with the macromolecules.
Spectroscopic study on variations in illite surface properties after acid-base titration.
Liu, Wen-xin; Coveney, R M; Tang, Hong-xiao
2003-07-01
FT-IR, Raman microscopy, XRD, 29Si and 27Al MAS NMR, were used to investigate changes in surface properties of a natural illite sample after acid-base potentiometric titration. The characteristic XRD lines indicated the presence of surface Al-Si complexes, preferable to Al(OH)3 precipitates. In the microscopic Raman spectra, the vibration peaks of Si-O and Al-O bonds diminished as a result of treatment with acid, then increased after hydroxide back titration. The varied ratio of signal intensity between (IV)Al and (VI)Al species in 27Al MAS NMR spectra, together with the stable BET surface area after acidimetric titration, suggested that edge faces and basal planes in the layer structure of illite participated in dissolution of structural components. The combined spectroscopic evidence demonstrated that the reactions between illite surfaces and acid-leaching silicic acid and aluminum ions should be considered in the model description of surface acid-base properties of the aqueous illite.
International Nuclear Information System (INIS)
Arasu, Velu; Reddy Dugasani, Sreekantha; Son, Junyoung; Gnapareddy, Bramaramba; Ha Park, Sung; Jeon, Sohee; Jeong, Jun-Ho
2017-01-01
Although the preparation of DNA thin films with well-defined thicknesses controlled by simple physical parameters is crucial for constructing efficient, stable, and reliable DNA-based optoelectronic devices and sensors, it has not been comprehensively studied yet. Here, we construct DNA and surfactant-modified DNA thin films by drop-casting and spin-coating techniques. The DNA thin films formed with different control parameters, such as drop-volume and spin-speed at given DNA concentrations, exhibit characteristic thickness, surface roughness, surface potential, and absorbance, which are measured by a field emission scanning electron microscope, a surface profilometer, an ellipsometer, an atomic force microscope, a Kelvin probe force microscope, and an UV–visible spectroscope. From the observations, we realized that thickness significantly affects the physical properties of DNA thin films. This comprehensive study of thickness-dependent characteristics of DNA and surfactant-modified DNA thin films provides insight into the choice of fabrication techniques in order for the DNA thin films to have desired physical characteristics in further applications, such as optoelectronic devices and sensors. (paper)
Interaction of sulforaphane with DNA and RNA.
Directory of Open Access Journals (Sweden)
Farzaneh Abassi Joozdani
Full Text Available Sulforaphane (SFN is an isothiocyanate found in cruciferous vegetables with anti-inflammatory, anti-oxidant and anti-cancer activities. However, the antioxidant and anticancer mechanism of sulforaphane is not well understood. In the present research, we reported binding modes, binding constants and stability of SFN-DNA and -RNA complexes by Fourier transform infrared (FTIR and UV-Visible spectroscopic methods. Spectroscopic evidence showed DNA intercalation with some degree of groove binding. SFN binds minor and major grooves of DNA and backbone phosphate (PO2, while RNA binding is through G, U, A bases with some degree of SFN-phosphate (PO2 interaction. Overall binding constants were estimated to be K(SFN-DNA=3.01 (± 0.035×10(4 M(-1 and K(SFN-RNA= 6.63 (±0.042×10(3 M(-1. At high SFN concentration (SFN/RNA = 1/1, DNA conformation changed from B to A occurred, while RNA remained in A-family structure.
Faizan, Mohd; Alam, Mohammad Jane; Afroz, Ziya; Rodrigues, Vítor Hugo Nunes; Ahmad, Shabbir
2018-03-01
The present work is focused on the crystal structure, vibrational spectroscopy and DFT calculations of hydrogen bonded 2,3-pyrazinedicorboxylic acid and 2-amino-4-hydroxy-6-methylpyrimidine (PDCA-.AHMP+) crystal. The crystal structure has been determined using single crystal X-ray diffraction analysis which shows that the crystal belongs to monoclinic space group P21/n. The PDCA-.AHMP+ crystal has been characterized by FTIR, FT-Raman and FT-NMR spectroscopic techniques. The FTIR and FT-Raman spectra of the complex have unique spectroscopic feature as compared with those of the starting material to confirm salt formation. The theoretical vibrational studies have been performed to understand the modes of the vibrations of asymmetric unit of the complex by DFT methods. Hirschfeld surface and 2D fingerprint plots analyses were carried out to investigate the intermolecular interactions and its contribution in the building of PDCA-.AHMP+ crystal. The experimental and simulated 13C and 1H NMR studies have assisted in structural analysis of PDCA-.AHMP+ crystal. The electronic spectroscopic properties of the complex were explored by the experimental as well as theoretical electronic spectra simulated using TD-DFT/IEF-PCM method at B3LYP/6-311++G (d,p) level of theory. In addition, frontier molecular orbitals, molecular electrostatic potential map (MEP) and nonlinear optical (NLO) properties using DFT method have been also presented.
International Nuclear Information System (INIS)
Józefowicz, M.; Bajorek, A.; Pietrzak, M.; Heldt, J.R.; Heldt, J.
2014-01-01
In this article, we report the photophysical properties of six, newly synthesized donor-substituted 2-amino-1,3-dicyano-5,6,7,8-tetrahydronaphthalene fluorophores. The steady-state and time-resolved spectroscopic experiments have been used to investigate the substituent and solvent effects on the locally excited (LE) and intramolecular charge transfer (ICT) emission. We demonstrate that the spectroscopic characteristics (fluorescence quantum yields, fluorescence decay times, radiative rate constants, and ground and excited state dipole moments) of the studied D–A dyes, as well as the reorganization energies characterizing the solute–solvent interactions and intramolecular torsion motions greatly depend on different substituents and microenvironment. On the basis of the experimental results and our previous quantum-chemical calculations, it was shown that two emitting charge transfer states: non-relaxed (ICT) NR and relaxed (ICT) R exist in six biphenyl derivatives dissolved in polar solvents (e.g., THF), whereas in non-polar medium (MCH) the existence of two emissive states have been attributed to non-relaxed and relaxed, locally excited state ((LE) NR , (LE) R ). - Highlights: • Spectroscopic properties greatly depend on different substituents and microenvironment. • Investigated dyes form a typically spectrally inhomogeneous system. • Two emitting charge transfer states (ICT) NR and (ICT) R exist in polar solvents. • In non-polar medium locally excited fluorescence is possible from (LE) NR and (LE) R states
PREDICTION OF CHROMATIN STATES USING DNA SEQUENCE PROPERTIES
Bahabri, Rihab R.
2013-06-01
Activities of DNA are to a great extent controlled epigenetically through the internal struc- ture of chromatin. This structure is dynamic and is influenced by different modifications of histone proteins. Various combinations of epigenetic modification of histones pinpoint to different functional regions of the DNA determining the so-called chromatin states. How- ever, the characterization of chromatin states by the DNA sequence properties remains largely unknown. In this study we aim to explore whether DNA sequence patterns in the human genome can characterize different chromatin states. Using DNA sequence motifs we built binary classifiers for each chromatic state to eval- uate whether a given genomic sequence is a good candidate for belonging to a particular chromatin state. Of four classification algorithms (C4.5, Naive Bayes, Random Forest, and SVM) used for this purpose, the decision tree based classifiers (C4.5 and Random Forest) yielded best results among those we evaluated. Our results suggest that in general these models lack sufficient predictive power, although for four chromatin states (insulators, het- erochromatin, and two types of copy number variation) we found that presence of certain motifs in DNA sequences does imply an increased probability that such a sequence is one of these chromatin states.
Synthesis and spectroscopic properties of transfermium isotopes with Z = 105, 106 and 107
International Nuclear Information System (INIS)
Streicher, B.
2006-01-01
The quest for production of new elements has been on for several decades. On the way up the ladder of nuclear chart the systematic research of nuclear properties of elements in transfermium region has been severely overlooked. This drawback is being rectified in past few years by systematic synthesis of especially even-even and odd-A isotopes of these elements. This work proceeds forward also with major contribution of velocity filter SHIP, placed at GSI, Darmstadt. This experimental device represents a unique possibility due to high (up to 1 pμA) beam currents provided by UNILAC accelerator and advancing detection systems to study by means of decay spectroscopy the nuclear structure of isotopes for the elements, possibly up to proton number Z = 110. As the low lying single-particle levels are especially determined by the unpaired nucleon, the odd mass nuclei provide a valuable source of information about the nuclear structure. Such results can be directly compared with the predictions of the calculations based on macroscopic-microscopic model of nuclear matter, thus proving an unambiguous test of the correctness of present models and their power to predict nuclear properties towards yet unknown regions. This work concentrates on the spectroscopic analysis of few of such nuclei. Namely it deals with isotopes 261 Sg and 257 Rf with one unpaired neutron, as well as isotopes 257 Db and 253 Lr with one unpaired proton configuration. Moreover, the analysis of odd-odd nuclei of the the decay sequence 262 Bg → 258 Db → 254 Lr → produced in various experiments at SHIP is discussed in detail. Exhaustive spectroscopic analysis of these data is provided, revealing new information on α, β, EC and SF decay modes of these very heavy isotopes, and deepening the knowledge of the low lying single-particle level structure. Outcomes resulting from the comparison with the systematics of experimentally derived nuclear properties as well as with the predictions of the
Irradiation effects on electrical properties of DNA solution/Al Schottky diodes
Al-Ta'ii, Hassan Maktuff Jaber; Periasamy, Vengadesh; Iwamoto, Mitsumasa
2018-04-01
Deoxyribonucleic acid (DNA) has emerged as one of the most exciting organic material and as such extensively studied as a smart electronic material since the last few decades. DNA molecules have been reported to be utilized in the fabrication of small-scaled sensors and devices. In this current work, the effect of alpha radiation on the electrical properties of an Al/DNA/Al device using DNA solution was studied. It was observed that the carrier transport was governed by electrical interface properties at the Al-DNA interface. Current ( I)-voltage ( V) curves were analyzed by employing the interface limited Schottky current equations, i.e., conventional and Cheung and Cheung's models. Schottky parameters such as ideality factor, barrier height and series resistance were also determined. The extracted barrier height of the Schottky contact before and after radiation was calculated as 0.7845, 0.7877, 0.7948 and 0.7874 eV for the non-radiated, 12, 24 and 36 mGy, respectively. Series resistance of the structure was found to decline with the increase in the irradiation, which was due to the increase in the free radical root effects in charge carriers in the DNA solution. Results pertaining to the electronic profiles obtained in this work may provide a better understanding for the development of precise and rapid radiation sensors using DNA solution.
Temperature-dependent conformations of exciton-coupled Cy3 dimers in double-stranded DNA
Kringle, Loni; Sawaya, Nicolas P. D.; Widom, Julia; Adams, Carson; Raymer, Michael G.; Aspuru-Guzik, Alán; Marcus, Andrew H.
2018-02-01
Understanding the properties of electronically interacting molecular chromophores, which involve internally coupled electronic-vibrational motions, is important to the spectroscopy of many biologically relevant systems. Here we apply linear absorption, circular dichroism, and two-dimensional fluorescence spectroscopy to study the polarized collective excitations of excitonically coupled cyanine dimers (Cy3)2 that are rigidly positioned within the opposing sugar-phosphate backbones of the double-stranded region of a double-stranded (ds)-single-stranded (ss) DNA fork construct. We show that the exciton-coupling strength of the (Cy3)2-DNA construct can be systematically varied with temperature below the ds-ss DNA denaturation transition. We interpret spectroscopic measurements in terms of the Holstein vibronic dimer model, from which we obtain information about the local conformation of the (Cy3)2 dimer, as well as the degree of static disorder experienced by the Cy3 monomer and the (Cy3)2 dimer probe locally within their respective DNA duplex environments. The properties of the (Cy3)2-DNA construct we determine suggest that it may be employed as a useful model system to test fundamental concepts of protein-DNA interactions and the role of electronic-vibrational coherence in electronic energy migration within exciton-coupled bio-molecular arrays.
Magro, Massimiliano; Martinello, Tiziana; Bonaiuto, Emanuela; Gomiero, Chiara; Baratella, Davide; Zoppellaro, Giorgio; Cozza, Giorgio; Patruno, Marco; Zboril, Radek; Vianello, Fabio
2017-11-01
Conversely to common coated iron oxide nanoparticles, novel naked surface active maghemite nanoparticles (SAMNs) can covalently bind DNA. Plasmid (pDNA) harboring the coding gene for GFP was directly chemisorbed onto SAMNs, leading to a novel DNA nanovector (SAMN@pDNA). The spontaneous internalization of SAMN@pDNA into cells was compared with an extensively studied fluorescent SAMN derivative (SAMN@RITC). Moreover, the transfection efficiency of SAMN@pDNA was evaluated and explained by computational model. SAMN@pDNA was prepared and characterized by spectroscopic and computational methods, and molecular dynamic simulation. The size and hydrodynamic properties of SAMN@pDNA and SAMN@RITC were studied by electron transmission microscopy, light scattering and zeta-potential. The two nanomaterials were tested by confocal scanning microscopy on equine peripheral blood-derived mesenchymal stem cells (ePB-MSCs) and GFP expression by SAMN@pDNA was determined. Nanomaterials characterized by similar hydrodynamic properties were successfully internalized and stored into mesenchymal stem cells. Transfection by SAMN@pDNA occurred and GFP expression was higher than lipofectamine procedure, even in the absence of an external magnetic field. A computational model clarified that transfection efficiency can be ascribed to DNA availability inside cells. Direct covalent binding of DNA on naked magnetic nanoparticles led to an extremely robust gene delivery tool. Hydrodynamic and chemical-physical properties of SAMN@pDNA were responsible of the successful uptake by cells and of the efficiency of GFP gene transfection. SAMNs are characterized by colloidal stability, excellent cell uptake, persistence in the host cells, low toxicity and are proposed as novel intelligent DNA nanovectors for efficient cell transfection. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Yogini P. Bhavsar
2011-01-01
Full Text Available Topological variants of single-strand DNA (ssDNA structures, referred to as “functional DNA,” have been detected in regulatory regions of many genes and are thought to affect gene expression. Two fluorescent analogs of deoxycytidine, Pyrrolo-dC (PdC and 1,3-diaza-2-oxophenoxazine (tC∘, can be incorporated into DNA. Here, we describe spectroscopic studies of both analogs to determine fluorescent properties that report on structural transitions from double-strand DNA (dsDNA to ssDNA, a common pathway in the transition to functional DNA structures. We obtained fluorescence-detected circular dichroism (FDCD spectra, steady-state fluorescence spectra, and fluorescence lifetimes of the fluorophores in DNA. Our results show that PdC is advantageous in fluorescence lifetime studies because of a distinct ~2 ns change between paired and unpaired bases. However, tC∘ is a better probe for FDCD experiments that report on the helical structure of DNA surrounding the fluorophore. Both fluorophores provide complementary data to measure DNA structural transitions.
Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.
Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q
2011-03-01
The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.
Barut, Burak; Demirbaş, Ümit; Özel, Arzu; Kantekin, Halit
2017-12-01
In this study, novel peripherally tetra 3-morpholinophenol substituted zinc(II) phthalocyanine (4) and its water soluble form quaternized zinc(II) phthalocyanine (ZnQ) were synthesized for the first time. These novel compounds were characterized by a combination of different spectroscopic techniques such as FT-IR, 1 H NMR, 13 C NMR, UV-vis and mass. The DNA binding of ZnQ was investigated using UV-vis absorption titration, competitive ethidium bromide, thermal denaturation and viscosity experiments that the ZnQ bound to CT-DNA via intercalation mode. ZnQ indicated photocleavage activity on supercoiled pBR322 plasmid DNA via formation of singlet oxygen under irradiation at 700nm. Besides, the topoisomerase I inhibitory effect experiments showed that ZnQ inhibited topoisomerase I enzyme in a concentration-dependent manner. The bovine serum albumin (BSA) binding experiments indicated that ZnQ bound to proteins through a static quenching mechanism. All of these results claim that ZnQ has potential agent for photodynamic therapy owing to its nucleic acid interactions and photobiological or photochemical properties. Copyright © 2017 Elsevier B.V. All rights reserved.
Molecular mechanics of DNA bricks: in situ structure, mechanical properties and ionic conductivity
International Nuclear Information System (INIS)
Slone, Scott Michael; Li, Chen-Yu; Aksimentiev, Aleksei; Yoo, Jejoong
2016-01-01
The DNA bricks method exploits self-assembly of short DNA fragments to produce custom three-dimensional objects with subnanometer precision. In contrast to DNA origami, the DNA brick method permits a variety of different structures to be realized using the same library of DNA strands. As a consequence of their design, however, assembled DNA brick structures have fewer interhelical connections in comparison to equivalent DNA origami structures. Although the overall shape of the DNA brick objects has been characterized and found to conform to the features of the target designs, the microscopic properties of DNA brick objects remain yet to be determined. Here, we use the all-atom molecular dynamics method to directly compare the structure, mechanical properties and ionic conductivity of DNA brick and DNA origami structures different only by internal connectivity of their consistituent DNA strands. In comparison to equivalent DNA origami structures, the DNA brick structures are found to be less rigid and less dense and have a larger cross-section area normal to the DNA helix direction. At the microscopic level, the junction in the DNA brick structures are found to be right-handed, similar to the structure of individual Holliday junctions (HJ) in solution, which contrasts with the left-handed structure of HJ in DNA origami. Subject to external electric field, a DNA brick plate is more leaky to ions than an equivalent DNA origami plate because of its lower density and larger cross-section area. Overall, our results indicate that the structures produced by the DNA brick method are fairly similar in their overall appearance to those created by the DNA origami method but are more compliant when subject to external forces, which likely is a consequence of their single crossover design. (paper)
Structure and linear spectroscopic properties of near IR polymethine dyes
International Nuclear Information System (INIS)
Webster, Scott; Padilha, Lazaro A.; Hu Honghua; Przhonska, Olga V.; Hagan, David J.; Van Stryland, Eric W.; Bondar, Mikhail V.; Davydenko, Iryna G.; Slominsky, Yuriy L.; Kachkovski, Alexei D.
2008-01-01
We performed a detailed experimental investigation and quantum-chemical analysis of a new series of near IR polymethine dyes with 5-butyl-7,8-dihydrobenzo[cd]furo[2,3-f]indolium terminal groups. We also synthesized and studied two neutral dyes, squaraine and tetraone, with the same terminal groups and performed a comparison of the spectroscopic properties of this set of 'near IR' dyes (polymethine, squaraine, and tetraone) with an analogous set of 'visible' dyes with simpler benzo[e]indolium terminal groups. From these measurements, we find that the dyes with dihydrobenzo[cd]furo[2,3-f]indolium terminal groups are characterized by a remarkably large shift ∼300 nm (∼200 nm for tetraone) of their absorption bands towards the red region. We discuss the difference in electronic structure for these molecules and show that the 'near IR' dyes are characterized by an additional weak fluorescence band from the higher lying excited states connected with the terminal groups. Absorption spectra for the longest polymethines are solvent-dependent and are characterized by a broadening of the main band in polar solvents, which is explained by ground state symmetry breaking and reduced charge delocalization within the polymethine chromophore. The results of these experiments combined with the agreement of quantum chemical calculations moves us closer to a predictive capability for structure-property relations in cyanine-like molecules
Sokal, Agnieszka; Pindelska, Edyta; Szeleszczuk, Lukasz; Kolodziejski, Waclaw
2017-04-30
The aim of this study was to evaluate the stability and solubility of the polymorphic forms of the ethenzamide (ET) - gentisic acid (GA) cocrystals during standard technological processes leading to tablet formation, such as compression and excipient addition. In this work two polymorphic forms of pharmaceutical cocrystals (ETGA) were characterized by 13 C and 15 N solid-state nuclear magnetic resonance and Fourier transformed infrared spectroscopy. Spectroscopic studies were supported by gauge including projector augmented wave (GIPAW) calculations of chemical shielding constants.Polymorphs of cocrystals were easily identified and characterized on the basis of solid-state spectroscopic studies. ETGA cocrystals behaviour during direct compressionand tabletting with excipient addition were tested. In order to choose the best tablet composition with suitable properties for the pharmaceutical industry dissolution profile studies of tablets containing polymorphic forms of cocrystals with selected excipients were carried out. Copyright © 2017. Published by Elsevier B.V.
DNA in the material world: electrical properties and nano-applications.
Triberis, Georgios P; Dimakogianni, Margarita
2009-01-01
Contradictory experimental findings and theoretical interpretations have spurred intense debate over the electrical properties of the DNA double helix. In the present review article the various factors responsible for these divergences are discussed. The enlightenment of this issue could improve long range chemistry of oxidative DNA damage and repair processes, monitoring protein-DNA interactions and possible applications in nano-electronic circuit technology. The update experimental situation concerning measurements of the electrical conductivity is given. The character of the carriers responsible for the electrical conductivity measured in DNA is investigated. A theoretical model for the temperature dependence of the electrical conductivity of DNA is presented, based on microscopic models and percolation theoretical arguments. The theoretical results, excluding or including correlation effects, are applied to recent experimental findings for DNA, considering it as a one dimensional molecular wire. The results indicate that correlation effects are probably responsible for large hopping distances in DNA samples. Other theoretical conductivity models proposed for the interpretation of the responsible transport mechanism are also reviewed. Some of the most known and pioneering works on DNA's nano-applications, future developments and perspectives along with current technological limitations and patents are presented and discussed.
Complex DNA structures and structures of DNA complexes
International Nuclear Information System (INIS)
Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J.
1994-01-01
Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe 1 H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful
Complex DNA structures and structures of DNA complexes
Energy Technology Data Exchange (ETDEWEB)
Chazin, W.J.; Carlstroem, G.; Shiow-Meei Chen; Miick, S.; Gomez-Paloma, L.; Smith, J.; Rydzewski, J. [Scripps Research Institute, La Jolla, CA (United States)
1994-12-01
Complex DNA structures (for example, triplexes, quadruplexes, junctions) and DNA-ligand complexes are more difficult to study by NMR than standard DNA duplexes are because they have high molecular weights, show nonstandard or distorted local conformations, and exhibit large resonance linewidths and severe {sup 1}H spectral overlap. These systems also tend to have limited solubility and may require specialized solution conditions to maintain favorable spectral characteristics, which adds to the spectroscopic difficulties. Furthermore, with more atoms in the system, both assignment and structure calculation become more challenging. In this article, we focus on demonstrating the current status of NMR studies of such systems and the limitations to further progress; we also indicate in what ways isotopic enrichment can be useful.
Growth and spectroscopic properties of Tm3+:NaBi(MoO4)2 single crystal
Gusakova, N. V.; Mudryi, A. V.; Demesh, M. P.; Yasukevich, A. S.; Pavlyuk, A. A.; Kornienko, A. A.; Dunina, E. B.; Khodasevich, I. A.; Orlovich, V. A.; Kuleshov, N. V.
2018-06-01
In this work we report the spectroscopic properties of Tm3+:NaBi(MoO4)2 crystals with the dopant concentrations of 0.7 at.% and 3 at.%. The energy levels of the Tm3+ in the NaBi(MoO4)2 host were determined from polarized optical absorption and photoluminescence spectra measured at 77.4 K. Radiative properties of the crystals were calculated in context of Judd-Ofelt theory. Raman spectra of the crystal were studied. The concentration dependences of emission decay times of 3H4 and 3F4 levels were analyzed. The potential of the crystal for building tunable and ultrafast pulse lasers is shown on the base of cross sections and gain coefficient in the range of 1.9 μm.
Synthesis and spectroscopic properties of transfermium isotopes with Z = 105, 106 and 107
Energy Technology Data Exchange (ETDEWEB)
Streicher, B [Comenius University, Faculty of Mathematics, Physics and Informatics, Department of Nuclear Physics and Biopgysics, 84218 Bratislava (Slovakia)
2006-07-01
The quest for production of new elements has been on for several decades. On the way up the ladder of nuclear chart the systematic research of nuclear properties of elements in transfermium region has been severely overlooked. This drawback is being rectified in past few years by systematic synthesis of especially even-even and odd-A isotopes of these elements. This work proceeds forward also with major contribution of velocity filter SHIP, placed at GSI, Darmstadt. This experimental device represents a unique possibility due to high (up to 1 p{mu}A) beam currents provided by UNILAC accelerator and advancing detection systems to study by means of decay spectroscopy the nuclear structure of isotopes for the elements, possibly up to proton number Z = 110. As the low lying single-particle levels are especially determined by the unpaired nucleon, the odd mass nuclei provide a valuable source of information about the nuclear structure. Such results can be directly compared with the predictions of the calculations based on macroscopic-microscopic model of nuclear matter, thus proving an unambiguous test of the correctness of present models and their power to predict nuclear properties towards yet unknown regions. This work concentrates on the spectroscopic analysis of few of such nuclei. Namely it deals with isotopes {sup 261}Sg and {sup 257}Rf with one unpaired neutron, as well as isotopes {sup 257}Db and {sup 253}Lr with one unpaired proton configuration. Moreover, the analysis of odd-odd nuclei of the the decay sequence {sup 262}Bg {yields} {sup 258}Db {yields} {sup 254}Lr {yields} produced in various experiments at SHIP is discussed in detail. Exhaustive spectroscopic analysis of these data is provided, revealing new information on {alpha}, {beta}, EC and SF decay modes of these very heavy isotopes, and deepening the knowledge of the low lying single-particle level structure. Outcomes resulting from the comparison with the systematics of experimentally derived
Spectroscopic properties of Er{sup 3+}-doped antimony oxide glass
Energy Technology Data Exchange (ETDEWEB)
Ouannes, K.; Soltani, M.T. [Laboratoire de Physique Photonique et Nanomatériaux Multifonctionnels, Université de Biskra, BP 145 RP, 07000 Biskra (Algeria); Poulain, M. [UMR 6226 – Verres et Céramiques – Campus de Beaulieu, Université' de Rennes 1, 35042 Rennes (France); Boulon, G.; Alombert-Goget, G.; Guyot, Y.; Pillonnet, A. [Institut Lumière Matière, UMR 5306 Université Lyon 1-CNRS, Université de Lyon, 69622 Villeurbanne (France); Lebbou, K., E-mail: kheireddine.lebbou@univ-lyon1.fr [Institut Lumière Matière, UMR 5306 Université Lyon 1-CNRS, Université de Lyon, 69622 Villeurbanne (France)
2014-08-01
Highlight: • As a function of Er concentration, glasses corresponding to the 60Sb{sub 2}O{sub 3}–20WO{sub 3}–(19 − x) Na{sub 2}O–1Bi{sub 2}O{sub 3}, xEr{sub 2}O{sub 3} formula were prepared. The quantum efficiency shows that this glass could be promised for laser devices. - Abstract: Spectroscopic properties of Er{sup 3+} ions have been studied in the 60Sb{sub 2}O{sub 3}–20WO{sub 3}–19Na{sub 2}O–1Bi{sub 2}O{sub 3} (SWNB) glasses doped with 0.25 and 0.50 mol% Er{sub 2}O{sub 3} respectively. The Judd–Ofelt parameters measured from the absorption spectra have been used to calculate the radiative life-time (τ{sub r}) and the stimulated emission cross section. The low phonon energy, a reduced quenching effect and a high quantum efficiency of 90% for the 1.53 μm expected laser emission into pumping at 980 nm are in favor of promising material laser application.
Reddy, Kotha Laxma; Reddy, Y Harish Kumar; Kumar, K Ashwini; Vidhisha, S; Satyanarayana, S
2009-03-01
The polypyridyl ligand 7-Nitro dipyrido[3,2-a:2'-3'-c]phenazine (7-Nitro-dppz) and its complexes [Co(bpy)(2)(7-NO(2)-dppz)](3+)(1) (bpy = 2,2'-bipyridine), [Co(dmb)(2)(7-NO(2)-dppz)](3+)(2), (dmb = 4,4'-dimethyl-2,2'-bipyridine), and [Co(phen)(2)(7-NO(2)-dppz)](3+)(3) (phen = 1,10-phenanthroline) were synthesized and characterized by UV/VIS, IR, elemental analysis, (1)H and (13)C-NMR, and mass spectra. The binding properties of the three complexes to CT-DNA were investigated by different spectroscopic methods and viscosity measurements and DNA cleavage assay. The experimental results suggest that these complexes bind to CT-DNA through an intercalative mode. Also, the three complexes promote the photocleavage of plasmid pBR-322 DNA under irradiation. Toxicological effects of the selected complexes were estimated with different microorganisms.
Mossbauer spectroscopic studies in ferroboron
Yadav, Ravi Kumar; Govindaraj, R.; Amarendra, G.
2017-05-01
Mossbauer spectroscopic studies have been carried out in a detailed manner on ferroboron in order to understand the local structure and magnetic properties of the system. Evolution of the local structure and magnetic properties of the amorphous and crystalline phases and their thermal stability have been addressed in a detailed manner in this study. Role of bonding between Fe 4s and/or 4p electrons with valence electrons of boron (2s,2p) in influencing the stability and magnetic properties of Fe-B system is elucidated.
Introducing improved structural properties and salt dependence into a coarse-grained model of DNA
Energy Technology Data Exchange (ETDEWEB)
Snodin, Benedict E. K., E-mail: benedict.snodin@chem.ox.ac.uk; Mosayebi, Majid; Schreck, John S.; Romano, Flavio; Doye, Jonathan P. K., E-mail: jonathan.doye@chem.ox.ac.uk [Physical and Theoretical Chemistry Laboratory, Department of Chemistry, University of Oxford, South Parks Road, Oxford OX1 3QZ (United Kingdom); Randisi, Ferdinando [Life Sciences Interface Doctoral Training Center, South Parks Road, Oxford OX1 3QU (United Kingdom); Rudolf Peierls Centre for Theoretical Physics, 1 Keble Road, Oxford OX1 3NP (United Kingdom); Šulc, Petr [Center for Studies in Physics and Biology, The Rockefeller University, 1230 York Avenue, New York, New York 10065 (United States); Ouldridge, Thomas E. [Department of Mathematics, Imperial College, 180 Queen’s Gate, London SW7 2AZ (United Kingdom); Tsukanov, Roman; Nir, Eyal [Department of Chemistry and the Ilse Katz Institute for Nanoscale Science and Technology, Ben-Gurion University of the Negev, Beer Sheva (Israel); Louis, Ard A. [Rudolf Peierls Centre for Theoretical Physics, 1 Keble Road, Oxford OX1 3NP (United Kingdom)
2015-06-21
We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na{sup +}] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.
Introducing improved structural properties and salt dependence into a coarse-grained model of DNA
International Nuclear Information System (INIS)
Snodin, Benedict E. K.; Mosayebi, Majid; Schreck, John S.; Romano, Flavio; Doye, Jonathan P. K.; Randisi, Ferdinando; Šulc, Petr; Ouldridge, Thomas E.; Tsukanov, Roman; Nir, Eyal; Louis, Ard A.
2015-01-01
We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na + ] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA
Shi, Deheng; Song, Ziyue; Niu, Xianghong; Sun, Jinfeng; Zhu, Zunlue
2016-01-01
The PECs are calculated for the 27 Λ-S states and their corresponding 73 Ω states of AsS radical. Of these Λ-S states, only the 22Δ and 54Π states are replulsive. The 12Σ+, 22Σ+, 42Π, 34Δ, 34Σ+, and 44Π states possess double wells. The 32Σ+ state possesses three wells. The A2Π, 32Π, 12Φ, 24Π, 34Π, 24Δ, 34Δ, 16Σ+, and 16Π states are inverted with the SO coupling effect included. The 14Σ+, 24Σ+, 24Σ-, 24Δ, 14Φ, 16Σ+, and 16Π states, the second wells of 12Σ+, 34Σ+, 42Π, 44Π, and 34Δ states, and the third well of 32Σ+ state are very weakly-bound states. The PECs are extrapolated to the CBS limit. The effect of SO coupling on the PECs is discussed. The spectroscopic parameters are evaluated, and compared with available measurements and other theoretical ones. The vibrational properties of several weakly-bound states are determined. The spectroscopic properties reported here can be expected to be reliably predicted ones.
Characterization of Structural and Configurational Properties of DNA by Atomic Force Microscopy.
Meroni, Alice; Lazzaro, Federico; Muzi-Falconi, Marco; Podestà, Alessandro
2018-01-01
We describe a method to extract quantitative information on DNA structural and configurational properties from high-resolution topographic maps recorded by atomic force microscopy (AFM). DNA molecules are deposited on mica surfaces from an aqueous solution, carefully dehydrated, and imaged in air in Tapping Mode. Upon extraction of the spatial coordinates of the DNA backbones from AFM images, several parameters characterizing DNA structure and configuration can be calculated. Here, we explain how to obtain the distribution of contour lengths, end-to-end distances, and gyration radii. This modular protocol can be also used to characterize other statistical parameters from AFM topographies.
Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen
2015-04-15
In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Spectroscopic Evidence for Nonuniform Starspot Properties on II Pegasi
ONeal, Douglas; Saar, Steven H.; Neff, James E.
1998-01-01
We present spectroscopic evidence for Multiple Spot temperatures on the RS CVn star II Pegasi (HD 224085). We model the strengths of the 7055 and 8860 A TiO absorption bands in the spectrum of II Peg using weighted sums of inactive comparison spectra: a K star to represent the nonspotted photosphere and an M star to represent the spots. The best fit yields independent measurements of the starspot filling factor (f(sub s) and mean spot temperature (T(sub s)) averaged over the visible hemisphere of the star. During three-fourths of a rotation of II Peg in late 1996, we measure a constant f(sub s) approximately equals 55% +/- 5%. However, (T(sub s) varies from 3350 +/- 60 to 3550 +/- 70 K. We compute (T(sub s) for two simple models: (1) a star with two distinct spot temperatures, and (2) a star with different umbral/penumbral area ratios. The changing (T(sub s) correlates with emission strengths of H(alpha) and the Ca II infrared triplet in the sense that cooler (T(sub s) accompanies weaker emission. We explore possible implications of these results for the physical properties of the spots on II Peg and for stellar surface structure in general.
Preparation and spectroscopic properties of Yb-doped and Yb-Al-codoped high silica glasses
International Nuclear Information System (INIS)
Qiao Yanbo; Wen Lei; Wu Botao; Ren Jinjun; Chen Danping; Qiu Jianrong
2008-01-01
Yb-doped and Yb-Al-codoped high silica glasses have been prepared by sintering nanoporous glasses. The absorption, fluorescent spectra and fluorescent lifetimes have been measured and the emission cross-section and minimum pump intensities were calculated. Codoping aluminum ions enhanced the fluorescence intensity of Yb-doped high silica glass obviously. The emission cross-sections of Yb-doped and Yb-Al-codoped high silica glasses were 0.65 and 0.82 pm 2 , respectively. The results show that Yb-Al-codoped high silica glass has better spectroscopic properties for a laser material. The study of high silica glass doped with ytterbium is helpful for its application in Yb laser systems, especially for high-power and high-repetition lasers
Spectroscopic Properties of Erbium Ions Doped in Bismuth Boro-Silicate Glasses
Bhardwaj, Sunil; Shukla, Rajni; Sanghi, Sujata; Agarwal, Ashish; Pal, Inder
Glasses with composition 20B2O3.(79.5-x)Bi2O3.xSiO2 (10 ≤ x ≤ 40) containing 0.5mol% of Er3+ ions were prepared by melt-quench technique. Optical absorption and fluorescence spectra were recorded at room temperature for all glass samples. Based on the Judd-Offelt theory, spectroscopic properties of Er3+ ions are discussed by changing the host glass compositions. The intensity parameters Ω2, Ω4, and Ω6 are determined by applying least square analysis method. The variation of Ω2 and Ω6 with Bi2O3 content has been attributed to changes in the asymmetry of the ligand field at the rare earth ion site and to the changes in the rare earth oxygen (RE-O) covalency. The variation of Ω4 with Bi2O3 content has been attributed to rigidity of the samples. Using these intensity parameters various radiative properties like spontaneous emission probability, branching ratio, radiative life time and stimulated emission cross-section of various emission lines have been evaluated. An intense green luminescence bands with maximum around 516 nm and 536 nm are assigned to the 2H11/2→ 4I15/2 and 4S3/2→ 4I15/2 transitions respectively has been obtained.
Spectroscopic studies of the interaction between pirimicarb and calf thymus DNA
Zhang, Guowen; Hu, Xing; Pan, Junhui
2011-02-01
The interaction between pirimicarb and calf thymus DNA in physiological buffer (pH 7.4) was investigated with the use of Neutral Red (NR) dye as a spectral probe by UV-vis absorption, fluorescence and circular dichroism (CD) spectroscopy, as well as viscosity measurements and DNA melting techniques. The results revealed that an intercalation binding should be the interaction mode of pirimicarb to DNA. CD spectra indicated that pirimicarb induced conformational changes of DNA. The binding constants of pirimicarb with DNA were obtained by the fluorescence quenching method. The thermodynamic parameters, enthalpy change (Δ Hθ) and entropy change (Δ Sθ) were calculated to be -52.13 ± 2.04 kJ mol -1 and -108.8 ± 6.72 J mol -1 K -1 according to the van't Hoff equation, which suggested that hydrogen bonds and van der Waals forces might play a major role in the binding of pirimicarb to DNA. Further, the alternative least squares (ALS) method was applied to resolve a complex two-way array of the absorption spectra data, which provided simultaneously the concentration information for the three reaction components, pirimicarb, NR and DNA-NR. This ALS analysis indicated that the intercalation of pirimicarb into the DNA by substituting for NR in the DNA-NR complex.
Energy Technology Data Exchange (ETDEWEB)
Shekhtman, Ya L; Domashenko, A D; Kamzolova, S G; Medvedkov, A A [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki
1976-05-01
Action of an ionizing radiation and the hydrodynamic effect of the matrix activity of thymus DNA and T2 phase DNA have been studied in vitro in the RNA: polymerase system of E.coli B. Also studied have been the thiophosphate protection of matrix properties of T2-DNA against ..gamma..-radiation.
Properties of the chromatin assembled on DNA injected into Xenopus oocytes and eggs
International Nuclear Information System (INIS)
Gargiulo, G.; Wasserman, W.; Worcel, A.
1983-01-01
The onset of DNA synthesis occurs between 10 and 30 minutes after activation of the egg and thus the transition from nuclease-sensitive to nuclease-resistant supercoils may take place on the newly replicated DNA. To test this possibility, the nonradioactive circular 5-kb DNA carrying the Drosophila histone gene repeat and [α -32 P]dCTP were coinjected into fertilized eggs. Such protocol labels both the injected, replicated heterologous DNA and the replicated endogenous, maternal Xenopus DNA. The labeled, presumably replicated, supercoiled DNA is resistant to micrococcal nuclease as expected. The endogenous, high-molecular-weight Xenopus DNA is degraded to 180-bp nucleosomal DNA. Thus, the nuclease resistance is not a general property of chromatin during the cleavage stage of the Xenopus embryo but is a peculiar feature of the injected DNA. 42 references, 5 figures
Czech Academy of Sciences Publication Activity Database
Vavra, M.; Potočňák, I.; Dušek, Michal; Čižmár, E.; Ozerov, M.; Zvyagin, S.A.
2015-01-01
Roč. 225, May (2015), s. 202-208 ISSN 0022-4596 Institutional support: RVO:68378271 Keywords : spectroscopic studies * magnetic properties * crystal structure * [Pt(CN) ]2- anion * 1,2-diaminopropane Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.265, year: 2015
Spectroscopic studies of the interaction between pirimicarb and calf thymus DNA.
Zhang, Guowen; Hu, Xing; Pan, Junhui
2011-02-01
The interaction between pirimicarb and calf thymus DNA in physiological buffer (pH 7.4) was investigated with the use of Neutral Red (NR) dye as a spectral probe by UV-vis absorption, fluorescence and circular dichroism (CD) spectroscopy, as well as viscosity measurements and DNA melting techniques. The results revealed that an intercalation binding should be the interaction mode of pirimicarb to DNA. CD spectra indicated that pirimicarb induced conformational changes of DNA. The binding constants of pirimicarb with DNA were obtained by the fluorescence quenching method. The thermodynamic parameters, enthalpy change (ΔHθ) and entropy change (ΔSθ) were calculated to be -52.13±2.04 kJ mol(-1) and -108.8±6.72 J mol(-1) K(-1) according to the van't Hoff equation, which suggested that hydrogen bonds and van der Waals forces might play a major role in the binding of pirimicarb to DNA. Further, the alternative least squares (ALS) method was applied to resolve a complex two-way array of the absorption spectra data, which provided simultaneously the concentration information for the three reaction components, pirimicarb, NR and DNA-NR. This ALS analysis indicated that the intercalation of pirimicarb into the DNA by substituting for NR in the DNA-NR complex. Copyright © 2010 Elsevier B.V. All rights reserved.
Influence of Gd2O3 on thermal and spectroscopic properties of aluminosilicate glasses
Kasprzyk, Marta; Środa, Marcin
2018-06-01
A series of aluminosilicate glasses 25SiO2·(20-x)Al2O3·40Na2O·15BaO-xGd2O3 with 0 ≤ x ≤ 10 were prepared in order to analyze the influence of gadolinium on thermal and spectroscopic properties of these materials. Increasing of thermal parameters (Tg, Tx, Δcp, ΔT) values with higher Gd2O3 content was determined using DSC method. Crystalline phases, formed during heat treatment, were identified with XRD - NaAlSiO4 and BaSiO3 in glass with 0% mol. Gd2O3 and Gd9.33(SiO4)6O2, NaAlSiO4 and BaAl2Si2O6 in glass with 10% mol. Gd2O3. Spectroscopic analysis - FTIR and Raman - revealed Gd2O3 influence on glass structure in the same way like Al2O3, but some differences appear due to the differ bond strength and ionic radius between Gd and Al. Raman spectra confirmed higher network polymerization (enriched with Q2 units). Optical band gap energy (Eopt) and Urbach energy (ΔE) were calculated from the Tauc plot. Mechanical tests demonstrated lower microhardness with increasing content of Gd2O3 content, as a result of higher concentration of atoms with larger radius.
Directory of Open Access Journals (Sweden)
Zhongjie Xu
2016-06-01
Full Text Available Di-2-pyridylketone-4,4,-dimethyl-3-thiosemicarbazone (Dp44mT exhibits significant antitumor activity. However, the mechanism of its pharmacological interaction with human serum albumin (HSA and DNA remains poorly understood. Here, we aimed to elucidate the interactions of Dp44mT with HSA and DNA using MTT assays, spectroscopic methods, and molecular docking analysis. Our results indicated that addition of HSA at a ratio of 1:1 did not alter the cytotoxicity of Dp44mT, but did affect the cytotoxicity of the Dp44mT-Cu complex. Data from fluorescence quenching and UV-VIS absorbance measurements demonstrated that Dp44mT could bind to HSA with a moderate affinity (Ka = approximately 104 M−1. CD spectra revealed that Dp44mT could slightly disrupt the secondary structure of HSA. Dp44mT could also interact with Ct-DNA, but had a moderate binding constant (KEB = approximately 104 M−1. Docking studies indicated that the IB site of HSA, but not the IIA and IIIA sites, could be favorable for Dp44mT and that binding of Dp44mT to HSA involved hydrogen bonds and hydrophobic force, consistent with thermodynamic results from spectral investigations. Thus, the moderate binding affinity of Dp44mT with HSA and DNA partially contributed to its antitumor activity and may be preferable in drug design approaches.
Energy Technology Data Exchange (ETDEWEB)
Rovani, Pablo Roberto; Herrera, Alvaro; Azevedo, Gustavo de Medeiros; Balzaretti, Naira Maria, E-mail: rovani.pr@gmail.com [Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre (Brazil)
2016-07-01
Full text: The effect of densification under high pressure (7.7 GPa) on spectroscopic and structural properties of Ge{sub 2}O-PbO glass doped with Sm{sup 3+} ion were investigated. Raman spectroscopy and Extended X-ray Absorption Fine Structure (EXAFS) were used to investigate the effect of high pressure on the structural properties. The spectroscopic properties were investigated through the absorption and luminescence spectra recorded at room temperature The splitting in the VIS-NIR fluorescence bands increased after densification. Judd-Ofelt (J-O) theory was applied to evaluate phenomenological JO intensity parameters Ω (λ = 2, 4 and 6). The effect of high pressure on the transition probabilities (A{sub R}), radiative lifetimes (t{sub R}), branching ratio (b{sub R}) and stimulated emission cross-section s(l{sub p}) was also investigated. The results obtained from EXAFS indicated changes around the vicinity of Sm{sup 3+} ion which would explain the quenching in emission intensities in the visible range. A novel band related to the transition {sup 4}G{sub 5/2} to {sup 6}F{sub 11/2} was observed in the Sm{sup 3+} doped GeO{sub 2}-PbO. The obtained results may be useful for compact light sources, optical devices in the visible region and optoelectronic devices. (author)
Investigation on the toxic interaction of typical plasticizers with calf thymus DNA
Energy Technology Data Exchange (ETDEWEB)
Sun, Xiaojing [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China); Zong, Wansong, E-mail: gaocz@sdu.edu.cn [College of Population, Resources and Environment, Shandong Normal University, 88# East Wenhua Road, Jinan 250014 (China); Liu, Chunguang; Liu, Yang [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China); Gao, Canzhu, E-mail: rutaoliu@sdu.edu.cn [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China); Liu, Rutao [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China)
2015-05-15
The interactions of typical plasticizers dimethyl phthalate (DMP), diethyl phthalate (DEP) and dibutyl phthalate (DBP) with calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopic techniques and molecular modeling. Experimental results indicated that the characteristic fluorescence intensity of phthalic acid rose with the increase of DNA concentration; while the characteristic fluorescence intensities of plasticizers decreased with the increase of DNA concentration. Experiments on native and denatured DNA determined that plasticizers interacted with DNA both in groove and electrostatic binding mode. The molecular modeling results further illustrated that there is groove binding between them; hydrogen bonding and Van der Waals interactions were the main forces. With the extension of branched-chains, the binding effects between plasticizers and DNA were weakened, which could be related to the increased steric hindrance. - Highlights: • This work established the binding mode of plasticizers with DNA on molecular level. • The mechanism was explored by fluorescence spectroscopic and molecular docking methods. • There are two kinds of binding mode between DMP, DEP, DBP and DNA, electrostatic and groove. • With the branched chain extension, the binding effect of plasticizers and DNA has been weakened.
International Nuclear Information System (INIS)
Moral, Mónica; García, Gregorio; Peñas, Antonio; Garzón, Andrés; Granadino-Roldán, José M.; Melguizo, Manuel; Fernández-Gómez, Manuel
2012-01-01
Highlights: ► We study properties of Ph 2 Tz and (PhTz) n Ph as candidates for organic electronics. ► The synthesis of Ph 2 Tz was performed through a modified Pinner-type reaction. ► IR/Raman spectra allowed to conclude that Ph 2 Tz is nearly planar in liquid phase. ► Electronic structure was studied by UV–Vis/TD-DFT methods in different solvents. ► Bandgap, E LUMO , electron mobility predict some n-type character for limit polymer. -- Abstract: This work presents a theoretical and spectroscopic study on the electronic and structural properties of the diphenyl-s-tetrazine molecule (Ph 2 Tz) and some oligomeric derivatives. Ph 2 Tz was synthesized through a variation of Pinner-type reaction which uses N-acetylcysteine as catalyst. Insight into the structure and electronic properties of the title compound was obtained through IR, Raman, UV–Vis spectra in different solvents, and theoretical calculations. Theoretical studies have been extended to different n-mers derivatives up to an ideal molecular wire through the oligomeric approximation, predicting this way electronic properties such as LUMO energy levels, electron affinity and reorganization energy in order to assess their possible applications in molecular electronics.
Directory of Open Access Journals (Sweden)
Paweł Misiak
2018-01-01
Full Text Available The formation of an intramolecular hydrogen bond in pyrrolo[1,2-a]pyrazin-1(2H-one bicyclic diazoles was analyzed, and the influence of N-substitution on HB formation is discussed in this study. B3LYP/aug-cc-pVDZ calculations were performed for the diazole, and the quantum theory of atoms in molecules (QTAIM approach as well as the natural bond orbital (NBO method was applied to analyze the strength of this interaction. It was found that the intramolecular hydrogen bond that closes an extra ring between the C=O proton acceptor group and the CH proton donor, that is, C=O⋯H–C, influences the spectroscopic properties of pyrrolopyrazine bicyclic diazoles, particularly the carbonyl frequencies. The influence of N-substitution on the aromaticity of heterocyclic rings is also discussed in this report.
A spectroscopic study of absorption and emission features of interstellar dust components
International Nuclear Information System (INIS)
Zwet, G.P. van der.
1986-01-01
The spectroscopic properties of silicate interstellar dust grains are the subject of this thesis. The process of accretion and photolysis is simulated in the laboratory by condensing mixtures of gases onto a cold substrate (T ∼ 12 K) in a vacuum chamber and photolyzing these mixtures with a vacuum ultraviolet source. Alternatively, the gas mixtures may be passed through a microwave discharge first, before deposition. The spectroscopic properties of the ices are investigated using ultraviolet, visible and infrared spectroscopy. (Auth.)
Ma, Zhipeng; Huang, Yunfei; Park, Seongsu; Kawai, Kentaro; Kim, Do-Nyun; Hirai, Yoshikazu; Tsuchiya, Toshiyuki; Yamada, Hirofumi; Tabata, Osamu
2018-01-01
DNA origami methods enable the fabrication of various nanostructures and nanodevices, but their effective use depends on an understanding of their structural and mechanical properties and the effects of basic structural features. Frequency-modulation atomic force microscopy is introduced to directly characterize, in aqueous solution, the crossover regions of sets of 2D DNA origami based on different crossover/nick designs. Rhombic-shaped nanostructures formed under the influence of flexible crossovers placed between DNA helices are observed in DNA origami incorporating crossovers every 3, 4, or 6 DNA turns. The bending rigidity of crossovers is determined to be only one-third of that of the DNA helix, based on interhelical electrostatic forces reported elsewhere, and the measured pitches of the 3-turn crossover design rhombic-shaped nanostructures undergoing negligible bending. To evaluate the robustness of their structural integrity, they are intentionally and simultaneously stressed using force-controlled atomic force microscopy. DNA crossovers are verified to have a stabilizing effect on the structural robustness, while the nicks have an opposite effect. The structural and mechanical properties of DNA origami and the effects of crossovers and nicks revealed in this paper can provide information essential for the design of versatile DNA origami structures that exhibit specified and desirable properties. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Optical properties of LiGaS2: an ab initio study and spectroscopic ellipsometry measurement
International Nuclear Information System (INIS)
Atuchin, V V; Lin, Z S; Isaenko, L I; Lobanov, S I; Kesler, V G; Kruchinin, V N
2009-01-01
Electronic and optical properties of lithium thiogallate crystal, LiGaS 2 , have been investigated by both experimental and theoretical methods. The plane-wave pseudopotential method based on DFT theory has been used for band structure calculations. The electronic parameters of Ga 3d orbitals have been corrected by the DFT+U methods to be consistent with those measured with x-ray photoemission spectroscopy. Evolution of optical constants of LiGaS 2 over a wide spectral range was determined by developed first-principles theory and dispersion curves were compared with optical parameters defined by spectroscopic ellipsometry in the photon energy range 1.2-5.0 eV. Good agreement has been achieved between theoretical and experimental results.
pH-induced fabrication of DNA/chitosan/α-ZrP nanocomposite and DNA release
International Nuclear Information System (INIS)
Liu Limin; Zhang Haitang; Shen Bo; He Weijiang; Lu Guoyuan; Liu Yuge; Zhu Junjie
2010-01-01
With positively charged chitosan as an intermediary, herring sperm DNA was intercalated into the interlayer galleries of negatively charged α-ZrP to form DNA/chitosan/α-ZrP ternary hybrids at pH 5.5. Fourier-transform IR, x-ray diffraction and scanning electron microscopy confirmed not only the coexistence of DNA, chitosan and α-ZrP in the composite but also the layered composite structure with an interlayer distance of 4.25 nm. Circular dichroism (CD) and UV spectroscopic studies disclosed that the restraint of DNA by the layered α-ZrP favors stabilization of the double-helical conformation of DNA and enhances the denaturation temperature. The intercalated DNA can be effectively released from the ternary nanocomposites at pHs higher than 6.5, and the released DNA displayed a similar CD spectrum to that of free DNA. The current research displays the promising potential to obtain a non-viral gene vector by intercalating DNA into negatively charged inorganic layered materials in the presence of a positively charged intermediary.
Vologodskii, Alexander
2015-01-01
Surveying the last sixty years of research, this book describes the physical properties of DNA in the context of its biological functioning. It is designed to enable both students and researchers of molecular biology, biochemistry and physics to better understand the biophysics of DNA, addressing key questions and facilitating further research. The chapters integrate theoretical and experimental approaches, emphasising throughout the importance of a quantitative knowledge of physical properties in building and analysing models of DNA functioning. For example, the book shows how the relationship between DNA mechanical properties and the sequence specificity of DNA-protein binding can be analyzed quantitatively by using our current knowledge of the physical and structural properties of DNA. Theoretical models and experimental methods in the field are critically considered to enable the reader to engage effectively with the current scientific literature on the physical properties of DNA.
Optical Characterization of Oligonucleotide DNA Influenced by Magnetic Fields
Directory of Open Access Journals (Sweden)
Seyedeh Maryam Banihashemian
2013-09-01
Full Text Available UV-VIS spectroscopic analysis of oligonucleotide DNA exposed to different magnetic fields was performed in order to investigate the relationship between DNA extinction coefficients and optical parameters according to magnetic-field strength. The results with the oligonucleotides adenine-thymine 100 mer (AT-100 DNA and cytosine-guanine 100 mer (CG-100 DNA indicate that the magnetic field influences DNA molar extinction coefficients and refractive indexes. The imaginary parts of the refractive index and molar extinction coefficients of the AT-100 and CG-100 DNA decreased after exposure to a magnetic field of 750 mT due to cleavage of the DNA oligonucleotides into smaller segments.
International Nuclear Information System (INIS)
Zhao Shilong; Wang Xiuli; Fang Dawei; Xu Shiqing; Hu Lili
2006-01-01
Tungsten-tellurite glass with molar composition of 60TeO 2 -30WO 3 -10Na 2 O has been investigated for developing planar broadband waveguide amplifier application. Spectroscopic properties and thermal stability of Er 3+ -doped tungsten-tellurite glass have been discussed. The results show that the introduction of WO 3 increases significantly the glass transition temperature and the maximum phonon energy. Er 3+ -doped tungsten-tellurite glass exhibits high glass transition temperature (377 deg. C), large emission cross-section (0.91 x 10 -20 cm 2 ) at 1532 nm and broad full width at half maximum (FWHM), which make it preferable for broadband Er 3+ -doped waveguide amplifier application
Spectroscopic investigation of Indium Bromide for lighting purposes
Mulders, H.C.J.; Kroesen, G.M.W.; Haverlag, M.; Haverlag, M.; Kroesen, G.M.W.; Tagushi, T.
2010-01-01
Laser Induced Fluorescence was used to study the radiative properties of InBr for lighting purposes. Results include the temperature dependence of the fluorescence decay time, spectroscopic constants and rotational temperature determination from a LIF spectrum.
Shi, Deheng; Song, Ziyue; Niu, Xianghong; Sun, Jinfeng; Zhu, Zunlue
2016-01-15
The PECs are calculated for the 27 Λ-S states and their corresponding 73 Ω states of AsS radical. Of these Λ-S states, only the 2(2)Δ and 5(4)Π states are replulsive. The 1(2)Σ(+), 2(2)Σ(+), 4(2)Π, 3(4)Δ, 3(4)Σ(+), and 4(4)Π states possess double wells. The 3(2)Σ(+) state possesses three wells. The A(2)Π, 3(2)Π, 1(2)Φ, 2(4)Π, 3(4)Π, 2(4)Δ, 3(4)Δ, 1(6)Σ(+), and 1(6)Π states are inverted with the SO coupling effect included. The 1(4)Σ(+), 2(4)Σ(+), 2(4)Σ(-), 2(4)Δ, 1(4)Φ, 1(6)Σ(+), and 1(6)Π states, the second wells of 1(2)Σ(+), 3(4)Σ(+), 4(2)Π, 4(4)Π, and 3(4)Δ states, and the third well of 3(2)Σ(+) state are very weakly-bound states. The PECs are extrapolated to the CBS limit. The effect of SO coupling on the PECs is discussed. The spectroscopic parameters are evaluated, and compared with available measurements and other theoretical ones. The vibrational properties of several weakly-bound states are determined. The spectroscopic properties reported here can be expected to be reliably predicted ones. Copyright © 2015 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Moral, Monica; Garcia, Gregorio [Departamento de Quimica Fisica y Analitica, Facultad de Ciencias Experimentales, Universidad de Jaen, Campus las Lagunillas, E23071 Jaen (Spain); Penas, Antonio [Departamento de Quimica Inorganica y Organica, Facultad de Ciencias Experimentales, Universidad de Jaen, Campus las Lagunillas, E23071 Jaen (Spain); Garzon, Andres; Granadino-Roldan, Jose M. [Departamento de Quimica Fisica y Analitica, Facultad de Ciencias Experimentales, Universidad de Jaen, Campus las Lagunillas, E23071 Jaen (Spain); Melguizo, Manuel [Departamento de Quimica Inorganica y Organica, Facultad de Ciencias Experimentales, Universidad de Jaen, Campus las Lagunillas, E23071 Jaen (Spain); Fernandez-Gomez, Manuel, E-mail: mfg@ujaen.es [Departamento de Quimica Fisica y Analitica, Facultad de Ciencias Experimentales, Universidad de Jaen, Campus las Lagunillas, E23071 Jaen (Spain)
2012-10-26
Highlights: Black-Right-Pointing-Pointer We study properties of Ph{sub 2}Tz and (PhTz){sub n}Ph as candidates for organic electronics. Black-Right-Pointing-Pointer The synthesis of Ph{sub 2}Tz was performed through a modified Pinner-type reaction. Black-Right-Pointing-Pointer IR/Raman spectra allowed to conclude that Ph{sub 2}Tz is nearly planar in liquid phase. Black-Right-Pointing-Pointer Electronic structure was studied by UV-Vis/TD-DFT methods in different solvents. Black-Right-Pointing-Pointer Bandgap, E{sub LUMO}, electron mobility predict some n-type character for limit polymer. -- Abstract: This work presents a theoretical and spectroscopic study on the electronic and structural properties of the diphenyl-s-tetrazine molecule (Ph{sub 2}Tz) and some oligomeric derivatives. Ph{sub 2}Tz was synthesized through a variation of Pinner-type reaction which uses N-acetylcysteine as catalyst. Insight into the structure and electronic properties of the title compound was obtained through IR, Raman, UV-Vis spectra in different solvents, and theoretical calculations. Theoretical studies have been extended to different n-mers derivatives up to an ideal molecular wire through the oligomeric approximation, predicting this way electronic properties such as LUMO energy levels, electron affinity and reorganization energy in order to assess their possible applications in molecular electronics.
Directory of Open Access Journals (Sweden)
Chukwuemeka P. Azubuike
2012-09-01
Full Text Available α-Cellulose and microcrystalline cellulose powders, derived from agricultural waste products, that have for the pharmaceutical industry, desirable physical (flow properties were investigated. α–Cellulose (GCN was extracted from groundnut shell (an agricultural waste product using a non-dissolving method based on inorganic reagents. Modification of this α -cellulose was carried out by partially hydrolysing it with 2N hydrochloric acid under reflux to obtain microcrystalline cellulose (MCGN. The physical, spectroscopic and thermal properties of the derived α-cellulose and microcrystalline cellulose powders were compared with Avicel® PH 101, a commercial brand of microcrystalline cellulose (MCCA, using standard methods. X-ray diffraction and infrared spectroscopy analysis showed that the α-cellulose had lower crystallinity. This suggested that treatment with 2N hydrochloric acid led to an increase in the crystallinity index. Thermogravimetric analysis showed quite similar thermal behavior for all cellulose samples, although the α-cellulose had a somewhat lower stability. A comparison of the physical properties between the microcrystalline celluloses and the α-cellulose suggests that microcrystalline cellulose (MCGN and MCCA might have better flow properties. In almost all cases, MCGN and MCCA had similar characteristics. Since groundnut shells are agricultural waste products, its utilization as a source of microcrystalline cellulose might be a good low-cost alternative to the more expensive commercial brand.
Spliced DNA Sequences in the Paramecium Germline: Their Properties and Evolutionary Potential
Catania, Francesco; McGrath, Casey L.; Doak, Thomas G.; Lynch, Michael
2013-01-01
Despite playing a crucial role in germline-soma differentiation, the evolutionary significance of developmentally regulated genome rearrangements (DRGRs) has received scant attention. An example of DRGR is DNA splicing, a process that removes segments of DNA interrupting genic and/or intergenic sequences. Perhaps, best known for shaping immune-system genes in vertebrates, DNA splicing plays a central role in the life of ciliated protozoa, where thousands of germline DNA segments are eliminated after sexual reproduction to regenerate a functional somatic genome. Here, we identify and chronicle the properties of 5,286 sequences that putatively undergo DNA splicing (i.e., internal eliminated sequences [IESs]) across the genomes of three closely related species of the ciliate Paramecium (P. tetraurelia, P. biaurelia, and P. sexaurelia). The study reveals that these putative IESs share several physical characteristics. Although our results are consistent with excision events being largely conserved between species, episodes of differential IES retention/excision occur, may have a recent origin, and frequently involve coding regions. Our findings indicate interconversion between somatic—often coding—DNA sequences and noncoding IESs, and provide insights into the role of DNA splicing in creating potentially functional genetic innovation. PMID:23737328
DNA-linked NanoParticle Lattices with Diamond Symmetry: Stability, Shape and Optical Properties
Emamy, Hamed; Tkachenko, Alexei; Gang, Oleg; Starr, Francis
The linking of nanoparticles (NP) by DNA has been proven to be an effective means to create NP lattices with specific order. Lattices with diamond symmetry are predicted to offer novel photonic properties, but self-assembly of such lattices has proven to be challenging due to the low packing fraction, sensitivity to bond orientation, and local heterogeneity. Recently, we reported an approach to create diamond NP lattices based on the association between anisotropic particles with well-defined tetravalent DNA binding topology and isotropically functionalized NP. Here, we use molecular dynamics simulations to evaluate the Gibbs free energy of these lattices, and thereby determine the stability of these lattices as a function of NP size and DNA stiffness. We also predict the equilibrium shape for the cubic diamond crystallite using the Wulff construction method. Specifically, we predict the equilibrium shape using the surface energy for different crystallographic planes. We evaluate surface energy directly form molecular dynamics simulation, which we correlate with theoretical estimates from the expected number of broken DNA bonds along a facet. Furthermore we study the optical properties of this structure, e.g optical bandgap.
Losurdo, M.; Giangregorio, M.; Capezzuto, P.; Bruno, G.; de Rosa, R.; Roca, F.; Summonte, C.; Plá, J.; Rizzoli, R.
2002-01-01
Indium-tin-oxide (ITO) films deposited by sputtering and e-gun evaporation on both transparent (Corning glass) and opaque (c-Si, c-Si/SiO2) substrates and in c-Si/a-Si:H/ITO heterostructures have been analyzed by spectroscopic ellipsometry (SE) in the range 1.5-5.0 eV. Taking the SE advantage of being applicable to absorbent substrate, ellipsometry is used to determine the spectra of the refractive index and extinction coefficient of the ITO films. The effect of the substrate surface on the ITO optical properties is focused and discussed. To this aim, a parametrized equation combining the Drude model, which considers the free-carrier response at the infrared end, and a double Lorentzian oscillator, which takes into account the interband transition contribution at the UV end, is used to model the ITO optical properties in the useful UV-visible range, whatever the substrate and deposition technique. Ellipsometric analysis is corroborated by sheet resistance measurements.
Directory of Open Access Journals (Sweden)
Soler-López Montserrat
2011-10-01
Full Text Available Abstract Background In eukaryotic organisms, DNA is packaged into chromatin structure, where most of DNA is wrapped into nucleosomes. DNA compaction and nucleosome positioning have clear functional implications, since they modulate the accessibility of genomic regions to regulatory proteins. Despite the intensive research effort focused in this area, the rules defining nucleosome positioning and the location of DNA regulatory regions still remain elusive. Results Naked (histone-free and nucleosomal DNA from yeast were digested by microccocal nuclease (MNase and sequenced genome-wide. MNase cutting preferences were determined for both naked and nucleosomal DNAs. Integration of their sequencing profiles with DNA conformational descriptors derived from atomistic molecular dynamic simulations enabled us to extract the physical properties of DNA on a genomic scale and to correlate them with chromatin structure and gene regulation. The local structure of DNA around regulatory regions was found to be unusually flexible and to display a unique pattern of nucleosome positioning. Ab initio physical descriptors derived from molecular dynamics were used to develop a computational method that accurately predicts nucleosome enriched and depleted regions. Conclusions Our experimental and computational analyses jointly demonstrate a clear correlation between sequence-dependent physical properties of naked DNA and regulatory signals in the chromatin structure. These results demonstrate that nucleosome positioning around TSS (Transcription Start Site and TTS (Transcription Termination Site (at least in yeast is strongly dependent on DNA physical properties, which can define a basal regulatory mechanism of gene expression.
DNA Hydrogel with Tunable pH-Responsive Properties Produced by Rolling Circle Amplification.
Xu, Wanlin; Huang, Yishun; Zhao, Haoran; Li, Pan; Liu, Guoyuan; Li, Jing; Zhu, Chengshen; Tian, Leilei
2017-12-22
Recently, smart DNA hydrogels, which are generally formed by the self-assembly of oligonucleotides or through the cross-linking of oligonucleotide-polymer hybrids, have attracted tremendous attention. However, the difficulties of fabricating DNA hydrogels limit their practical applications. We report herein a novel method for producing pH-responsive hydrogels by rolling circle amplification (RCA). In this method, pH-sensitive cross-linking sites were introduced into the polymeric DNA chains during DNA synthesis. As the DNA sequence can be precisely defined by its template, the properties of such hydrogels can be finely tuned in a very facile way through template design. We have investigated the process of hydrogel formation and pH-responsiveness to provide rationales for functional hydrogel design based on the RCA reaction. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Spectroscopic study on the interaction of eugenol with salmon sperm DNA in vitro
Energy Technology Data Exchange (ETDEWEB)
Bi Shuyun, E-mail: sy_bi@sina.com [College of Chemistry, Changchun Normal University, Changchun 130032 (China); Yan Lili; Wang Yu; Pang Bong; Wang Tianjiao [College of Chemistry, Changchun Normal University, Changchun 130032 (China)
2012-09-15
Fluorescence spectra, absorption spectra, melting temperature, ionic strength effect, and viscosity experiments were described that characterize the interaction of eugenol with salmon sperm DNA in vitro. Eugenol was found to bind but weakly to DNA, with binding constants of 4.23 Multiplication-Sign 10{sup 3}, 3.62 Multiplication-Sign 10{sup 3} and 2.47 Multiplication-Sign 10{sup 3} L mol{sup -1} at 18, 28 and 38 Degree-Sign C respectively. The Stern-Volmer plots at different temperatures suggested that the quenching type of fluorescence of eugenol by DNA was a static quenching. Both the relative viscosity and the melting temperature of DNA were increased by the addition of eugenol. The changes of ionic strength had no affect on the binding. In addition, the binding constant of eugenol with single stranded DNA (ssDNA) was larger than that of eugenol with double stranded DNA (dsDNA). These results revealed that the binding mode of eugenol to DNA was intercalative binding. The thermodynamic parameters {Delta}H, {Delta}G and {Delta}S were also obtained according to the Van't Hoff equations, which suggested that hydrogen bond or van der Waals force might play an important role in a binding of eugenol to DNA. Based on the theory of the Foerster energy transference, the binding distance between DNA and eugenol was determined as 4.40 nm, indicating that the static fluorescence quenching of eugenol by DNA was also a non-radiation energy transfer process. - Highlights: Black-Right-Pointing-Pointer DNA quenched the fluorescence of eugenol. Black-Right-Pointing-Pointer Binding constant, binding site and binding force were determined. Black-Right-Pointing-Pointer Binding mode of eugenol to DNA was intercalative. Black-Right-Pointing-Pointer Energy transfer occurred between eugenol and DNA.
Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H
2015-02-14
The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.
Synthesis, characterization, spectroscopic properties and DFT study of a new pyridazinone family
Arrue, Lily; Rey, Marina; Rubilar-Hernandez, Carlos; Correa, Sebastian; Molins, Elies; Norambuena, Lorena; Zarate, Ximena; Schott, Eduardo
2017-11-01
Nitrogen compounds are widely investigated due to their pharmacological properties such as antihypertensive, antinociceptive, antibacterial, antifungal, analgesic, anticancer and inhibition activities and lately even as pesticide. In this context, we present the synthesis of new compounds: (E)-6-(3,4-dimethoxyphenyl)-3-(3-(3,4-dimethoxyphenyl)acryloyl)-1-(4-R-phenyl)- 5,6-dihydropyridazin-4(1H)-one (with R = sbnd H(1), -Cl(2), -Br(3), sbnd I(4) and sbnd COOH(5)) that was carried out by reaction of (1E, 6E)-1,7-bis(3,4-dimethoxyphenyl)hepta-1,6-diene-3,5-dione with a substituted phenylamine with general formula p-R-C6H4sbnd NH2 (R = sbnd H (1), sbnd Cl (2), -Br(3), sbnd I(4) and sbnd COOH(5)). This is the first synthesis report of a pyridazinone using as precursors a curcuminoid derivative and a diazonium salt formed in situ. All compounds were characterized by EA, FT-IR, UV-Vis, Emission,1H- and13C-NMR spectroscopy and the crystalline and molecular structure of 4 was solved by X-rays diffraction method. DFT and TD-DFT quantum chemical calculations were also employed to characterize the compounds and provide a rational explanation to the spectroscopic properties. To assess the biological activity of the systems, we focused on pesticide tests on compound 2, which showed an inhibitory effect in plant growth of Agrostis tenuis Higland.
International Nuclear Information System (INIS)
Flores, M.; Rodriguez, R.; Arroyo, R.
1999-01-01
This work is focused about the spectroscopic properties of a polymer material which consists of Polyacrylic acid (Paa) doped at different concentrations of Europium ions (Eu 3+ ). They show that to stay chemically joined with the polymer by a study of Nuclear Magnetic Resonance (NMR) of 1 H, 13 C and Fourier Transform Infrared Spectroscopy (Ft-IR) they present changes in the intensity of signals, just as too when this material is irradiated at λ = 394 nm. In according with the results obtained experimentally in this type of materials it can say that is possible to unify chemically the polymer with this type of cations, as well as, varying the concentration of them, since that these are distributed homogeneously inside the matrix maintaining its optical properties. These materials can be obtained more quickly and easy in solid or liquid phase and they have the best conditions for to make a quantitative analysis. (Author)
Energy Technology Data Exchange (ETDEWEB)
Mohanraj, Maruthachalam; Ayyannan, Ganesan; Raja, Gunasekaran; Jayabalakrishnan, Chinnasamy, E-mail: drcjbstar@gmail.com
2016-12-01
The new ruthenium(II) complexes with hydrazone ligands, 4-Methyl-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL{sup 1}), 4-Methoxy-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL{sup 2}), 4-Bromo-benzoic acid (2,4-dihydroxy-benzylidene)-hydrazide (HL{sup 3}), were synthesized and characterized by various spectro analytical techniques. The molecular structures of the ligands were confirmed by single crystal X-ray diffraction technique. The DNA binding studies of the ligands and complexes were examined by absorption, fluorescence, viscosity and cyclic voltammetry methods. The results indicated that the ligands and complexes could interact with calf thymus DNA (CT-DNA) through intercalation. The DNA cleavage activity of the complexes was evaluated by gel electrophoresis assay, which revealed that the complexes are good DNA cleaving agents. The binding interaction of the ligands and complexes with bovine serum albumin (BSA) was investigated using fluorescence spectroscopic method. Antioxidant studies showed that the complexes have a strong radical scavenging properties. Further, the cytotoxic effect of the complexes examined on cancerous cell lines showed that the complexes exhibit significant anticancer activity. - Highlights: • Synthesis of ruthenium(II) hydrazone complexes • Molecular structure of the ligands was elucidated by single crystal X-ray diffraction method. • The ligands and complexes interact with CT-DNA via intercalation. • The complexes possess significant antioxidant activity against DPPH, OH and NO radicals. • The complex 6 shows higher IC{sub 50} value than the other complexes against cancer cells.
In vitro study on the interaction of 4,4-dimethylcurcumin with calf thymus DNA
Energy Technology Data Exchange (ETDEWEB)
Liu, Bing-Mi, E-mail: liubingmi@163.com [Department of Pharmacy, Liaoning University, Shenyang 110036 (China); Bai, Chong-Liang [Centre for Molecular Science and Engineering, Northeastern University, Shenyang 110819 (China); Zhang, Jun; Liu, Yang; Dong, Bo-Yang; Zhang, Yi-Tong [Department of Pharmacy, Liaoning University, Shenyang 110036 (China); Liu, Bin, E-mail: liubinzehao@163.com [Department of Pharmacy, Liaoning University, Shenyang 110036 (China)
2015-10-15
The interaction of 4,4-dimethylcurcumin (DMCU), a synthesized analog of curcumin, with calf-thymus DNA (ct-DNA) was investigated using fluorescence, absorption, and circular dichroism (CD) spectroscopy, coupled with viscosity measurements and molecular docking techniques. DMCU was found to bind to ct-DNA with moderate binding affinity through groove binding as evidenced by a decrease in the absorption intensity in combination with no obvious change in the relative specific viscosity of ct-DNA and the CD spectrum. Thermodynamic analysis of the fluorescence data obtained at different temperatures suggested that the binding process was spontaneous and was primarily driven by hydrogen bonding and van der Waals forces. Furthermore, competitive binding experiments with ethidium bromide and 4′,6-diamidino-2-phenylindole as probes showed that DMCU could preferentially bind in the minor groove of double-stranded DNA. The results obtained from the molecular docking studies were consistent with these experimental results. This study explored the potential applicability of the spectroscopic properties of DMCU for studying its interactions with relevant biological or biomimicking targets. - Highlights: • 4,4-dimethylcurcumin (DMCU) has strong fluorescence characteristics. • DMCU could bind to DNA through groove binding. • Docking studies revealed that DMCU bound to the A–T region in the minor groove.
National Research Council Canada - National Science Library
Kwon, Young-Wan; Do, Eui D; Choi, Dong H; Jin, Jung-Il; Lee, Chang H; Koh, Eui K; Grote, James Gerard
2008-01-01
.... In particular, interest in nanoscience and nanotechnology is accelerating the exploration of DNA for various properties such as electrical conductivity electron or hole transport and optical properties...
Computational Approach for Studying Optical Properties of DNA Systems in Solution
DEFF Research Database (Denmark)
Nørby, Morten Steen; Svendsen, Casper Steinmann; Olsen, Jógvan Magnus Haugaard
2016-01-01
In this paper we present a study of the methodological aspects regarding calculations of optical properties for DNA systems in solution. Our computational approach will be built upon a fully polarizable QM/MM/Continuum model within a damped linear response theory framework. In this approach...... the environment is given a highly advanced description in terms of the electrostatic potential through the polarizable embedding model. Furthermore, bulk solvent effects are included in an efficient manner through a conductor-like screening model. With the aim of reducing the computational cost we develop a set...... of averaged partial charges and distributed isotropic dipole-dipole polarizabilities for DNA suitable for describing the classical region in ground-state and excited-state calculations. Calculations of the UV-spectrum of the 2-aminopurine optical probe embedded in a DNA double helical structure are presented...
International Nuclear Information System (INIS)
Hayashi, Y.; Yu, G.; Rahman, M. M.; Krishna, K. M.; Soga, T.; Jimbo, T.; Umeno, M.
2001-01-01
Nitrogen doped hydrogenated amorphous carbon thin films have been deposited by rf plasma-enhanced chemical vapor deposition using CH 4 as the source of carbon and with different nitrogen flow rates (N 2 /CH 4 gas ratios between 0 and 3), at 300 K. The dependence modifications of the optical and the structural properties on nitrogen incorporation were investigated using different spectroscopic techniques, such as, Raman spectroscopy, Fourier transform infrared spectroscopy, x-ray photoelectron spectroscopy, ultraviolet-visible (UV-VIS) spectroscopy, electron spin resonance (ESR), photoluminescence (PL) and spectroscopic ellipsometry (SE). Raman spectroscopy and IR absorption reveal an increase in sp 2 -bonded carbon or a change in sp 2 domain size with increasing nitrogen flow rate. It is found that the configuration of nitrogen atoms incorporated into an amorphous carbon network gradually changes from nitrogen atoms surrounded by three (σ bonded) to two (π bonded) neighboring carbons with increasing nitrogen flow rate. Tauc optical gap is reduced from 2.6 to 2.0 eV, and the ESR spin density and the peak-to-peak linewidth increase sharply with increasing nitrogen flow rate. Excellent agreement has been found between the measured SE data and modeled spectra, in which an empirical dielectric function of amorphous materials and a linear void distribution along the thickness have been assumed. The influence of nitrogen on the electronic density of states is explained based on the optical properties measured by UV-VIS and PL including nitrogen lone pair band. [copyright] 2001 American Institute of Physics
Sub–100-nm metafluorophores with digitally tunable optical properties self-assembled from DNA
Woehrstein, Johannes B.; Strauss, Maximilian T.; Ong, Luvena L.; Wei, Bryan; Zhang, David Y.; Jungmann, Ralf; Yin, Peng
2017-01-01
Fluorescence microscopy allows specific target detection down to the level of single molecules and has become an enabling tool in biological research. To transduce the biological information to an imageable signal, we have developed a variety of fluorescent probes, such as organic dyes or fluorescent proteins with different colors. Despite their success, a limitation on constructing small fluorescent probes is the lack of a general framework to achieve precise and programmable control of critical optical properties, such as color and brightness. To address this challenge, we introduce metafluorophores, which are constructed as DNA nanostructure–based fluorescent probes with digitally tunable optical properties. Each metafluorophore is composed of multiple organic fluorophores, organized in a spatially controlled fashion in a compact sub–100-nm architecture using a DNA nanostructure scaffold. Using DNA origami with a size of 90 × 60 nm2, substantially smaller than the optical diffraction limit, we constructed small fluorescent probes with digitally tunable brightness, color, and photostability and demonstrated a palette of 124 virtual colors. Using these probes as fluorescent barcodes, we implemented an assay for multiplexed quantification of nucleic acids. Additionally, we demonstrated the triggered in situ self-assembly of fluorescent DNA nanostructures with prescribed brightness upon initial hybridization to a nucleic acid target. PMID:28691083
International Nuclear Information System (INIS)
Moreira, Leonardo M.; Rodrigues, Maira R.; Oliveira, Hueder P. M. de; Lima, Adriana; Soares, Rafael R. S.; Batistela, Vagner R.; Gerola, Adriana P.; Hioka, Noboru; Severino, Divinomar; Baptista, Mauricio S.; Machado, Antonio Eduardo da Hora
2010-01-01
This work focus on the influence of solvent on the photophysical properties of chlorophyll a and pheophytin. Both compounds are related to the photosynthesis process and are considered prototypes of photosensitizers in Photodynamic Therapy. Fluorescence measurements were developed using water/ethanol mixtures at different compositions, since both solvents could be employed in biological applications. The spectroscopic properties of these compounds undergo profound changes depending on water content in the ethanol due to auto-aggregation processes. The major hydrophobicity and the lower dielectric constant of ethanol when compared with water precluded significantly the auto-aggregation process of these compounds. (author)
Jomova, Klaudia; Lawson, Michael; Drostinova, Lenka; Lauro, Peter; Poprac, Patrik; Brezova, Vlasta; Michalik, Martin; Lukes, Vladimir; Valko, Marian
2017-12-01
The radical scavenging and metal chelating properties of flavonoids indicate that they may play a protective role in diseases with perturbed metal homeostasis such as Alzheimer's disease. In this work we investigated the effect of the coordination of quercetin to copper(II) in view of the formation of ROS in Cu-catalyzed Fenton reaction. ABTS and DPPH assays confirmed that the copper(II)-quercetin complex exhibits a stronger radical scavenging activity than does quercetin alone. EPR spin trapping experiments have shown that chelation of quercetin to copper significantly suppressed the formation of hydroxyl radicals in the Cu(II)-Fenton reaction. DNA damage experiments revealed a protective effect for quercetin, but only at higher stoichiometric ratios of quercetin relative to copper. DNA protective effect of quercetin against ROS attack was described by two mechanisms. The first mechanism lies in suppressed formation of ROS due to the decreased catalytic action of copper in the Fenton reaction, as a consequence of its chelation and direct scavenging of ROS by free quercetin. Since the Cu-quercetin complex intercalates into DNA, the second mechanism was attributed to a suppressed intercalating ability of the Cu-quercetin complex due to the mildly intercalating free quercetin into DNA, thus creating a protective wall against stronger intercalators. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kurkcuoglu, Doga Murat; de Melo, C. A. R. Sá
2018-05-01
We propose the creation and investigation of a system of spin-one fermions in the presence of artificial spin-orbit coupling, via the interaction of three hyperfine states of fermionic atoms to Raman laser fields. We explore the emergence of spinor physics in the Hamiltonian described by the interaction between light and atoms, and analyze spectroscopic properties such as dispersion relation, Fermi surfaces, spectral functions, spin-dependent momentum distributions and density of states. Connections to spin-one bosons and SU(3) systems is made, as well relations to the Lifshitz transition and Pomeranchuk instability are presented.
Topological and metric properties of linear and circular DNA chains in nano-slits and nano-channels
Orlandini, Enzo; Micheletti, Cristian
2014-03-01
Motivated by recent advancements in single DNA molecule experiments, based on nanofluidic devices, we investigate numerically the metric and topological properties of a modelof open and circular DNA chains confined inside nano-slits and nano-channles. The results reveal an interesting characterization of the metric crossover behaviour in terms of the abundance, type and length of occuring knots. In particular we find that the knotting probability is nonmonotonic for increasing confinement and can be largely enhanced or suppressed, compared to the bulk case, by simply varying the slit or channel trasversal dimension. The observed knot population consists of knots that are far simpler than for DNA chains in spherical (i.e. cavities or capsids) confinement. These results suggest that nanoslits and nanochannels can be properly designed to produce open DNA chains hosting simple knots or to sieve DNA rings according to their knotted state. Finally we discuss the implications that the presence of knots may have on the dynamical properties of confined DNA chains such as chain elongation, injection/ejection processes and entanglement relaxation. We acknowledge financial support from the Italian ministry of education, grant PRIN 2010HXAW77.
Rajina, S. R.; Sudhi, Geethu; Austin, P.; Praveen, S. G.; Xavier, T. S.; Kenny, Peter T. M.; Binoy, J.
2018-05-01
The interaction of a drug with DNA and BSA play a great role in studying anti cancer activity and drug transport properties, which can be effectively, investigated using vibrational spectroscopy, UV visible spectroscopy and Fluorescence spectroscopy. The present work reports the structural features of N-(6-ferrocenyl-2-naphthoyl)-gamma-amino butyric acid Methyl ester (FNGABME) based on FTIR and FTRaman spectroscopy. The absorption and fluorescence spectroscopic methods were used to study the efficiency of the interaction of the compound FNGABME with BSA and DNA and also molecular docking were performed computationally to validate the results which shows that the title compound may exhibit inhibitory activity against the cancer cells.
Differential Impact of the Monovalent Ions Li+, Na+, K+, and Rb+ on DNA Conformational Properties
Savelyev, Alexey; MacKerell, Alexander D.
2014-01-01
The present report demonstrates that the conformational properties of DNA in solution are sensitive to the type of monovalent ion. Results are based on the ability of a polarizable force field using the classical Drude oscillator to reproduce experimental solution X-ray scattering data more accurately than two nonpolarizable DNA models, AMBER Parmbsc0 and CHARMM36. The polarizable model is then used to calculate scattering profiles of DNA in the presence of four different monovalent salts, Li...
Directory of Open Access Journals (Sweden)
Raj Kaushal
2016-01-01
Full Text Available Five structurally related titanium (IV heteroleptic complexes, [TiCl2(bzac(L1–4] and [TiCl3(bzac(HL5]; bzac = benzoylacetonate; L1–5 = benzohydroximate (L1, salicylhydroximate (L2, acetohydroximate (L3, hydroxyurea (L4, and N-benzoyl-N-phenyl hydroxylamine (L5, were used for the assessment of their antibacterial activities against ten pathogenic bacterial strains. The titanium (IV complexes (1–5 demonstrated significant level of antibacterial properties as measured using agar well diffusion method. UV-Vis absorption spectroscopic technique was applied, to get a better insight into the nature of binding between titanium (IV complexes with calf thymus DNA (ct-DNA. On the basis of the results of UV-Vis absorption spectroscopy, the interaction between ct-DNA and the titanium (IV complexes is likely to occur through the same mode. Results indicated that titanium (IV complex can bind to calf thymus DNA (ct-DNA via an intercalative mode. The intrinsic binding constant (Kb was calculated by absorption spectra by using Benesi-Hildebrand equation. Further, Gibbs free energy was also calculated for all the complexes.
Optical properties of LiGaS{sub 2}: an ab initio study and spectroscopic ellipsometry measurement
Energy Technology Data Exchange (ETDEWEB)
Atuchin, V V [Laboratory of Optical Materials and Structures, Institute of Semiconductor Physics, SB RAS, Novosibirsk 90, 630090 (Russian Federation); Lin, Z S [Beijing Center for Crystal R and D, Technical Institute of Physics and Chemistry, Chinese Academy of Sciences, PO Box 2711, Beijing 100190 (China); Isaenko, L I; Lobanov, S I [Laboratory of Crystal Growth, Institute of Geology and Mineralogy, SB RAS, Novosibirsk 90, 630090 (Russian Federation); Kesler, V G [Laboratory of Physical Bases of Integrated Microelectronics, Institute of Semiconductor Physics, SB RAS, Novosibirsk 90, 630090 (Russian Federation); Kruchinin, V N, E-mail: zslin@mail.ipc.ac.c [Laboratory for Ellipsometry of Semiconductor Materials and Structures, Institute of Semiconductor Physics, SB RAS, Novosibirsk 90, 630090 (Russian Federation)
2009-11-11
Electronic and optical properties of lithium thiogallate crystal, LiGaS{sub 2}, have been investigated by both experimental and theoretical methods. The plane-wave pseudopotential method based on DFT theory has been used for band structure calculations. The electronic parameters of Ga 3d orbitals have been corrected by the DFT+U methods to be consistent with those measured with x-ray photoemission spectroscopy. Evolution of optical constants of LiGaS{sub 2} over a wide spectral range was determined by developed first-principles theory and dispersion curves were compared with optical parameters defined by spectroscopic ellipsometry in the photon energy range 1.2-5.0 eV. Good agreement has been achieved between theoretical and experimental results.
Frey, E. Ramsey; Sygula, Andrzej; Hammer, Nathan I.
2014-01-01
This laboratory exercise introduces undergraduate chemistry majors to the spectroscopic and theoretical study of the polycyclic aromatic hydrocarbon (PAH), corannulene. Students explore the spectroscopic properties of corannulene using UV-vis and Raman vibrational spectroscopies. They compare their experimental results to simulated vibrational…
Spectroscopic properties of Ho{sup 3+}-doped K-Sr-Al phosphate glasses
Energy Technology Data Exchange (ETDEWEB)
Linganna, K.; Rathaiah, M.; Venkatramu, V. [Yogi Vemana University, Department of Physics, Kadapa (India); Jayasankar, C.K. [Sri Venkateswara University, Department of Physics, Tirupati (India)
2014-05-15
Trivalent holmium-doped K-Sr-Al phosphate glasses (P{sub 2}O{sub 5}-K{sub 2}O-SrO-Al{sub 2}O{sub 3}-Ho{sub 2}O{sub 3}) were prepared, and their spectroscopic properties have been evaluated using absorption, emission, and excitation measurements. The Judd-Ofelt theory has been used to derive spectral intensities of various absorption bands from measured absorption spectrum of 1.0 mol% Ho{sub 2}O{sub 3}-doped K-Sr-Al phosphate glass. The Judd-Ofelt intensity parameters (Ω{sub λ}, x 10{sup -20} cm{sup 2}) have been determined of the order of Ω{sub 2} = 11.39, Ω{sub 4} = 3.59, and Ω{sub 6} = 2.92, which in turn used to derive radiative properties such as radiative transition probability, radiative lifetime, branching ratios, etc. for excited states of Ho{sup 3+} ions. The radiative lifetimes for the {sup 5}F{sub 4}, {sup 5}S{sub 2}, and {sup 5}F{sub 5} levels of Ho{sup 3+} ions are found to be 169, 296, and 317 μs, respectively. The stimulated emission cross-section for 2.05-μm emission was calculated by the McCumber theory and found to be 9.3 x 10{sup -21} cm{sup 2}. The wavelength-dependent gain coefficient with population inversion rate has been evaluated. The results obtained in the titled glasses are discussed systematically and compared with other Ho{sup 3+}-doped systems to assess the possibility for visible and infrared device applications. (orig.)
Chumwangwapee, Sasiwimon; Chingsungnoen, Artit; Siri, Sineenat
2016-11-01
In forensic DNA analyses, biological specimens are collected and stored for subsequent recovery and analysis of DNA. A cost-effective and efficient DNA recovery approach is therefore a need. This study aims to produce a plasma modified cellulose-chitosan membrane (pCE-CS) that efficiently binds and retains DNA as a potential DNA collecting card. The pCE-CS membrane was produced by a phase separation of ionic liquid dissolving CE and CS in water with subsequent surface-modification by a two-step exposure of argon plasma and nitrogen gas. Through plasma modification, the pCE-CS membrane demonstrated better DNA retention after a washing process and higher rate of DNA recovery as compared with the original CE-CS membrane and the commercial FTA card. In addition, the pCE-CS membrane exhibited anti-bacterial properties against both Escherichia coli and Staphylococcus aureus. The results of this work suggest a potential function of the pCE-CS membrane as a DNA collecting card with a high recovery rate of captured DNA. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Ji, Cuiying; Zhang, Xuewei; Yu, Peiqiang
2016-03-05
The non-invasive molecular spectroscopic technique-FT/IR is capable to detect the molecular structure spectral features that are associated with biological, nutritional and biodegradation functions. However, to date, few researches have been conducted to use these non-invasive molecular spectroscopic techniques to study forage internal protein structures associated with biodegradation and biological functions. The objectives of this study were to detect unique aspects and association of protein Amide functional groups in terms of protein Amide I and II spectral profiles and chemical properties in the alfalfa forage (Medicago sativa L.) from different sourced-origins. In this study, alfalfa hay with two different origins was used as modeled forage for molecular structure and chemical property study. In each forage origin, five to seven sources were analyzed. The molecular spectral profiles were determined using FT/IR non-invasive molecular spectroscopy. The parameters of protein spectral profiles included functional groups of Amide I, Amide II and Amide I to II ratio. The results show that the modeled forage Amide I and Amide II were centered at 1653 cm(-1) and 1545 cm(-1), respectively. The Amide I spectral height and area intensities were from 0.02 to 0.03 and 2.67 to 3.36 AI, respectively. The Amide II spectral height and area intensities were from 0.01 to 0.02 and 0.71 to 0.93 AI, respectively. The Amide I to II spectral peak height and area ratios were from 1.86 to 1.88 and 3.68 to 3.79, respectively. Our results show that the non-invasive molecular spectroscopic techniques are capable to detect forage internal protein structure features which are associated with forage chemical properties. Copyright © 2015 Elsevier B.V. All rights reserved.
The HITRAN 2008 molecular spectroscopic database
International Nuclear Information System (INIS)
Rothman, L.S.; Gordon, I.E.; Barbe, A.; Benner, D.Chris; Bernath, P.F.; Birk, M.; Boudon, V.; Brown, L.R.; Campargue, A.; Champion, J.-P.; Chance, K.; Coudert, L.H.; Dana, V.; Devi, V.M.; Fally, S.; Flaud, J.-M.
2009-01-01
This paper describes the status of the 2008 edition of the HITRAN molecular spectroscopic database. The new edition is the first official public release since the 2004 edition, although a number of crucial updates had been made available online since 2004. The HITRAN compilation consists of several components that serve as input for radiative-transfer calculation codes: individual line parameters for the microwave through visible spectra of molecules in the gas phase; absorption cross-sections for molecules having dense spectral features, i.e. spectra in which the individual lines are not resolved; individual line parameters and absorption cross-sections for bands in the ultraviolet; refractive indices of aerosols, tables and files of general properties associated with the database; and database management software. The line-by-line portion of the database contains spectroscopic parameters for 42 molecules including many of their isotopologues.
Optical and spectroscopic properties of neodymium doped cadmium-sodium borate glasses
Mohan, Shaweta; Thind, Kulwant Singh
2017-10-01
Neodymium doped cadmium sodium borate glasses having composition xCdO-(40-x) Na2CO3-59.5H3BO3-0.5Nd2O3; x = 10, 20 and 30 mol% were prepared by conventional melt-quenching technique. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. Conventional methods were used to determine the physical properties such as density, molar volume, refractive index, and rare earth ion concentration. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The calculated intensity parameters were further used to predict the radiative transition probability (A), radiative lifetime (τR) and branching ratio (βR) for the various fluorescent levels of Nd3+ ion in the prepared glass series. The effect of the compositional changes on the spectroscopic characteristics of Nd3+ ions have been studied and reported. The value of Ω2 is found to decrease with the decrease in the sodium content and the corresponding increase in the cadmium content. This can be ascribed to the changes in the asymmetry of the ligand field at the rare earth ion site and the change in rare earth oxygen (RE-O) covalency. Florescence spectra has been used to determine the peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σp) for the 4F3/2 → 4I9/2,4I11/2,4I13/2 transitions of the Nd3+ ion. The reasonably higher values of branching ratios and stimulated emission cross-section for the prepared glasses points towards the efficacy of these glasses as laser host materials. However, the glass with more sodium content is found to show better lasing properties.
International Nuclear Information System (INIS)
Fuentes-Cabrera, Miguel A.; Sumpter, Bobby G.; Sponer, Judit; Sponer, Jiri; Petit, Leon; Wells, Jack C.
2007-01-01
M-DNA is a type of metalated DNA that forms at high pH and in the presence of Zn, Ni, and Co, with the metals placed in between each base pair, as in G-Zn-C. Experiments have found that M-DNA could be a promising candidate for a variety of nanotechnological applications, as it is speculated that the metal d-states enhance the conductivity, but controversy still clouds these findings. In this paper, we carry out a comprehensive ab initio study of eight G-Zn-C models in the gas phase to help discern the structure and electronic properties of Zn-DNA. Specifically, we study whether a model prefers to be planar and has electronic properties that correlate with Zn-DNA having a metallic-like conductivity. Out of all the studied models, there is only one which preserves its planarity upon full geometry optimization. Nevertheless, starting from this model, one can deduce a parallel Zn-DNA architecture only. This duplex would contain the imino proton, in contrast to what has been proposed experimentally. Among the nonplanar models, there is one that requires less than 8 kcal/mol to flatten (both in gas and solvent conditions), and we propose that it is a plausible model for building an antiparallel duplex. In this duplex, the imino proton would be replaced by Zn, in accordance with experimental models. Neither planar nor nonplanar models have electronic properties that correlate with Zn-DNA having a metallic-like conductivity due to Zn d-states. To understand whether density functional theory (DFT) can describe appropriately the electronic properties of M-DNAs, we have investigated the electronic properties of G-Co-C base pairs. We have found that when self-interaction corrections (SIC) are not included the HOMO state contains Co d-levels, whereas these levels are moved below the HOMO state when SIC are considered. This result indicates that caution should be exercised when studying the electronic properties of M-DNAs with functionals that do not account for strong
D'Abrosca, Brigida; Buommino, Elisabetta; D'Angelo, Grazia; Coretti, Lorena; Scognamiglio, Monica; Severino, Valeria; Pacifico, Severina; Donnarumma, Giovanna; Fiorentino, Antonio
2013-11-15
Two new acylated styrylpyrones, one 5-methoxy-1(3H)-isobenzofuranone glucoside and a hydroxymethyl-orcinol derivative, along with sixteen known aromatic metabolites, including lignans, quinic acid derivatives low-molecular weight phenol glucosides, have been isolated from the methanol extract of Helichrysum italicum, a medicinal plant typical of the Mediterranean vegetation. The structures of these compounds have been elucidated on the basis of extensive 2D-NMR spectroscopic analyses, including COSY, TOCSY, HSQC, CIGAR-HMBC, H2BC and HSQC-TOCSY, along with Q-TOF HRMS(2) analysis. Selected compounds were evaluated for their anti-biofilm properties against Pseudomonas aeruginosa. Copyright © 2013. Published by Elsevier Ltd.
Important hydrodynamic and spectroscopic techniques in the field of chromatin structure
Energy Technology Data Exchange (ETDEWEB)
Olins, D. E.
1978-01-01
Combining hydrodynamic and spectroscopic techniques in the study of conformational states of ..nu../sub 1/ induced by a variety of perturbants has led us to a general coneption: the two structural domains of ..nu../sub 1/ (i.e., the DNA-rich outer shell and the ..cap alpha..-helix-rich apolar histone core) exhibit differential responsiveness. In general, the ..cap alpha..-helical regions are more resistant, than DNA conformation or ..nu../sub 1/ size and shape, to the perturbing effects of urea, decreased ionic strength and pH, trypsin treatment, or a variety of water-miscible organic solvents. There are a number of reasonable conceptual models to explain this differential responsiveness of the structural domains of ..nu../sub 1/.
Chemical mapping of pharmaceutical cocrystals using terahertz spectroscopic imaging.
Charron, Danielle M; Ajito, Katsuhiro; Kim, Jae-Young; Ueno, Yuko
2013-02-19
Terahertz (THz) spectroscopic imaging is a promising technique for distinguishing pharmaceuticals of similar molecular composition but differing crystal structures. Physicochemical properties, for instance bioavailability, are manipulated by altering a drug's crystal structure through methods such as cocrystallization. Cocrystals are molecular complexes having crystal structures different from those of their pure components. A technique for identifying the two-dimensional distribution of these alternate forms is required. Here we present the first demonstration of THz spectroscopic imaging of cocrystals. THz spectra of caffeine-oxalic acid cocrystal measured at low temperature exhibit sharp peaks, enabling us to visualize the cocrystal distribution in nonuniform tablets. The cocrystal distribution was clearly identified using THz spectroscopic data, and the cocrystal concentration was calculated with 0.3-1.3% w/w error from the known total concentration. From this result, THz spectroscopy allows quantitative chemical mapping of cocrystals and offers researchers and drug developers a new analytical tool.
International Nuclear Information System (INIS)
Chitnis, Dipti; Thejokalyani, N.; Dhoble, S.J.
2017-01-01
In order to explore the spectroscopic properties of a novel europium activated hybrid organic tris(thenoyltrifluoroacetonate)(2,2′-bipyridine)europium(III), Eu(TTA) 3 bipy phosphor in various solvents at different pH and molar concentrations, UV–vis optical absorption and photoluminescence spectra were carried out. With a variation in the solvent from basic (chloroform, toluene, tetrahydrofuran) to acidic (acetic acid, formic acid) media, staggering differences in optical absorptions and optical densities were noticed with hypsochromic shift in the absorption peaks. The optical density was found to be maximum for the complex with pH= 7.0 and the intensity as well as optical density gradually decreased when pH is lowered to 6.0 or raised to 8.0 (at an interval of 0.5), proving that the complex is pH sensitive. It's optical energy gap and stokes shift values in various organic solvents were also calculated on the basis of Lippert-Mataga plot. The exploration of spectroscopic properties of solvated Eu(TTA) 3 bipy complex demonstrates its prospective for solution processed OLEDs and display devices. - Graphical abstract: Pictorial depiction of photoluminescence in solvated Eu(TTA) 3 bipy complex under UV light.
Study of DNA interactions with bifenthrin by spectroscopic techniques and molecular modeling
Zhu, Pan; Zhang, Guowen; Ma, Yadi; Zhang, Yepeng; Miao, Hong; Wu, Yongning
2013-08-01
The interaction between bifenthrin (BF) and calf thymus DNA (ctDNA) in physiological buffer (pH 7.4) was investigated by UV-vis absorption, fluorescence, circular dichroism (CD), and Fourier transform infrared (FT-IR) spectroscopy, coupled with viscosity measurements and molecular docking techniques. It was found that BF molecular could intercalate into the base pairs of ctDNA as evidenced by significant increases in absorption intensity, fluorescence polarization and relative viscosity of ctDNA, decrease in iodide quenching effect, and induced CD spectral changes. The association constant of BF with ctDNA was evaluated to be in the order of 104 L mol-1. Thermodynamic analysis of the binding data obtained at different temperatures suggested that the binding process was primarily driven by hydrogen bonds and van der Waals forces, as the values of the enthalpy change (ΔH) and the entropy change (ΔS) were calculated to be -31.13 ± 1.89 kJ mol-1 and -22.79 ± 1.21 J mol-1 K-1, respectively. The results of FT-IR spectra and molecular docking showed that a specific binding mainly existed between BF and adenine and guanine bases.
Spectroscopic studies of the transplutonium elements
International Nuclear Information System (INIS)
Carnall, W.T.; Conway, J.G.
1983-01-01
The challenging opportunity to develop insights into both atomic structure and the effects of bonding in compounds makes the study of actinide spectroscopy a particularly fruitful and exciting area of scientific endeavor. It is also the interpretation of f-element spectra that has stimulated the development of the most sophisticated theoretical modeling attempted for any elements in the periodic table. The unique nature of the spectra and the wealth of fine detail revealed make possible sensitive tests of both physical models and the results of Hartree-Fock type ab initio calculations. This paper focuses on the unique character of heavy actinide spectroscopy. It discusses how it differs from that of the lighter member of the series and what are the special properties that are manifested. Following the introduction, the paper covers the following: (1) the role of systematic studies and the relationships of heavy-actinide spectroscopy to ongoing spectroscopic investigations of the lighter members of the series; (2) atomic (free-ion) spectra which covers the present status of spectroscopic studies with transplutonium elements, and future needs and directions in atomic spectroscopy; (3) the spectra of actinide compounds which covers the present status and future directions of spectroscopic studies with compounds of the transplutonium elements; and other spectroscopies. 1 figure, 2 tables
2011-01-01
Background Existing methods of predicting DNA-binding proteins used valuable features of physicochemical properties to design support vector machine (SVM) based classifiers. Generally, selection of physicochemical properties and determination of their corresponding feature vectors rely mainly on known properties of binding mechanism and experience of designers. However, there exists a troublesome problem for designers that some different physicochemical properties have similar vectors of representing 20 amino acids and some closely related physicochemical properties have dissimilar vectors. Results This study proposes a systematic approach (named Auto-IDPCPs) to automatically identify a set of physicochemical and biochemical properties in the AAindex database to design SVM-based classifiers for predicting and analyzing DNA-binding domains/proteins. Auto-IDPCPs consists of 1) clustering 531 amino acid indices in AAindex into 20 clusters using a fuzzy c-means algorithm, 2) utilizing an efficient genetic algorithm based optimization method IBCGA to select an informative feature set of size m to represent sequences, and 3) analyzing the selected features to identify related physicochemical properties which may affect the binding mechanism of DNA-binding domains/proteins. The proposed Auto-IDPCPs identified m=22 features of properties belonging to five clusters for predicting DNA-binding domains with a five-fold cross-validation accuracy of 87.12%, which is promising compared with the accuracy of 86.62% of the existing method PSSM-400. For predicting DNA-binding sequences, the accuracy of 75.50% was obtained using m=28 features, where PSSM-400 has an accuracy of 74.22%. Auto-IDPCPs and PSSM-400 have accuracies of 80.73% and 82.81%, respectively, applied to an independent test data set of DNA-binding domains. Some typical physicochemical properties discovered are hydrophobicity, secondary structure, charge, solvent accessibility, polarity, flexibility, normalized Van Der
Spectroscopic study of site selective DNA damage induced by intense soft X-rays
Fujii, K
2003-01-01
To investigate the mechanisms of DNA damage induced by direct photon impact, we observed the near edge X-ray absorption fine structures (NEXAFS) of DNA nucleobases using monochromatic synchrotron soft X-rays around nitrogen and oxygen K-shell excitation regions. Each spectrum obtained has unique structure corresponding to pi* excitation of oxygen or nitrogen 1s electron. These aspects open a way of nucleobase-selective photo-excitation in a DNA molecule using high resolution monochromatized soft X-rays. From the analysis of polarization-dependent intensities of the pi* resonance peak, it is clarified that adenine, guanine an uracil form orientated surface structure. Furthermore from the direct measurement of positive ions desorbed from photon irradiated DNA components, it is revealed that the sugar moiety is a fragile site in a DNA molecule. (author)
International Nuclear Information System (INIS)
Cowan, D.S.M.; Rauth, A.M.; Toronto Univ., ON; Matejovic, J.F.; McClelland, R.A.; Wardman, P.
1994-01-01
2-Nitroimidazoles targeted to DNA via intercalation have previously been shown to be as much as 10-100 times more efficient on a molar basis than the untargeted nitroimidazole, misonidazole, in vitro as hypoxic cell selective radiosensitizers and cytotoxins based on extracellular concentrations. In this work the effect of varying the nitroaromatic group has been examined through the preparation of a DNA-targeted 4-nitroimidazole (4-MeNLP-3), a 5-nitroimidazole (5-NLP-3) and a 5-nitrofuran (FEP-2) linked to phenanthridinium ions. With the previously synthesized 2-nitroimidazoles, this provides a series of DNA targeted compounds of varying electron affinity as well as structure at the nitroaromatic position. The present series of compounds was tested for partition coefficient, DNA binding ability, reduction potentials and in vitro radiosensitizing and cytotoxic abilities. The results obtained indicate that targeting such compounds to DNA diminishes the dependency of radiosensitizing and cytotoxic properties on reduction potential and may allow significant uncoupling of toxicity from radiosensitizing ability. (author)
Denning, Elizabeth J; Mackerell, Alexander D
2011-04-20
Deoxyribonucleic acid (DNA) is composed of five major elements carbon, hydrogen, nitrogen, oxygen, and phosphorus. The substitution of any of these elements in DNA would be anticipated to have major biological implications. However, recent studies have suggested that the substitution of arsenic into DNA (As-DNA) in bacteria may be possible. To help evaluate this possibility, ab initio quantum mechanical calculations are used to show that arsenodiester and phosphodiester linkages have similar geometric and conformational properties. Based on these results, it is suggested that the As-DNA will have similar conformational properties to phosphorus-based DNA, including the maintenance of base stacking.
Ghosh, Shyamsundar; Dev, Bhupendra Nath
2018-05-01
Indium-tin oxide (ITO) 1D nanostructures with tunable morphologies i.e. nanorods, nanocombs and nanowires are grown on c-axis (0 0 0 1) sapphire (Al2O3) substrate in oxygen deficient atmosphere through pulsed laser deposition (PLD) technique and the effect of oxygen vacancies on optical, electrical, magnetic and photoresponse properties is investigated using spectroscopic methods. ITO nanostructures are found to be enriched with significant oxygen vacancy defects as evident from X-ray photoelectron and Raman spectroscopic analysis. Photoluminescence spectra exhibited intense mid-band blue emission at wavelength of region of 400-450 nm due to the electronic transition from conduction band maxima (CBM) to the singly ionized oxygen-vacancy (VO+) defect level within the band-gap. Interestingly, ITO nanostructures exhibited significant room-temperature ferromagnetism (RTFM) and the magnetic moment found proportional to concentration of VO+ defects which indicates VO+ defects are mainly responsible for the observed RTFM in nanostructures. ITO nanowires being enriched with more VO+ defects exhibited strongest RTFM as compared to other morphologies. Current voltage (I-V) characteristics of ITO nanostructures showed an enhancement of current under UV light as compared to dark which indicates such 1D nanostructure can be used as photovoltaic material. Hence, the study shows that there is ample opportunity to tailor the properties of ITOs through proper defect engineering's and such photosensitive ferromagnetic semiconductors might be promising for spintronic and photovoltaic applications.
Garrido, E. Manuela; Garrido, Jorge; Calheiros, Rita; Marques, M. Paula M.; Borges, Fernanda
2009-08-01
The extent to which humans and wildlife are exposed to the vast array of anthropogenic chemicals and their degradation products, along with related naturally occurring compounds, is nowadays an important issue. The study of the physical-chemical properties of the compounds and/or degradation products is an important subject because some of them are intrinsically related to its resistance to degradation and/or bioaccumulation. Accordingly, the study of the electrochemical behavior of the selective serotonin reuptake inhibitor fluoxetine and its main metabolite norfluoxetine was investigated. The identification of the oxidation processes was done via two fluoxetine analogues, 1-(benzyloxy)-4-(trifluoromethyl)benzene and N-methyl-3-phenylpropan-1-amine hydrochloride. The oxidative processes occurring in fluoxetine are pH-dependent and were ascribed to the chemical moieties present in the molecule: the secondary amine group and the substituted aromatic nucleus. To perform an unequivocal ascription, the structural preferences of the drug and metabolite were also determined, by Raman spectroscopy coupled to quantum mechanical calculations (at the DFT level). The analytical data obtained in this work will allow the development of a rapid and unequivocal spectroscopic procedure suitable for fluoxetine identification, as well as to distinguish between the drug and its main metabolite.
A direct detection of Escherichia coli genomic DNA using gold nanoprobes
Directory of Open Access Journals (Sweden)
Padmavathy
2012-02-01
Full Text Available Abstract Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to
Visual characterization and quantitative measurement of artemisinin-induced DNA breakage
Energy Technology Data Exchange (ETDEWEB)
Cai Huaihong [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China); Yang Peihui [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China)], E-mail: typh@jnu.edu.cn; Chen Jianan [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China); Liang Zhihong [Experiment and Technology Center, Jinan University, Guangzhou 510632 (China); Chen Qiongyu [Institute of Genetic Engineering, Jinan University, Guangzhou 510632 (China); Cai Jiye [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China)], E-mail: tjycai@jnu.edu.cn
2009-05-01
DNA conformational change and breakage induced by artemisinin, a traditional Chinese herbal medicine, have been visually characterized and quantitatively measured by the multiple tools of electrochemistry, UV-vis absorption spectroscopy, atomic force microscopy (AFM), and DNA electrophoresis. Electrochemical and spectroscopic results confirm that artemisinin can intercalate into DNA double helix, which causes DNA conformational changes. AFM imaging vividly demonstrates uneven DNA strand breaking induced by QHS interaction. To assess these DNA breakages, quantitative analysis of the extent of DNA breakage has been performed by analyzing AFM images. Basing on the statistical analysis, the occurrence of DNA breaks is found to depend on the concentration of artemisinin. DNA electrophoresis further validates that the intact DNA molecules are unwound due to the breakages occur at the single strands. A reliable scheme is proposed to explain the process of artemisinin-induced DNA cleavage. These results can provide further information for better understanding the anticancer activity of artemisinin.
Energy Technology Data Exchange (ETDEWEB)
Chitnis, Dipti [Department of Physics, RTM Nagpur University, Nagpur 440033 (India); Thejokalyani, N., E-mail: thejokalyani@rediffmail.com [Department of Applied Physics, Laxminarayan Institute of Technology, Nagpur 440033 (India); Dhoble, S.J. [Department of Physics, RTM Nagpur University, Nagpur 440033 (India)
2017-05-15
In order to explore the spectroscopic properties of a novel europium activated hybrid organic tris(thenoyltrifluoroacetonate)(2,2′-bipyridine)europium(III), Eu(TTA){sub 3}bipy phosphor in various solvents at different pH and molar concentrations, UV–vis optical absorption and photoluminescence spectra were carried out. With a variation in the solvent from basic (chloroform, toluene, tetrahydrofuran) to acidic (acetic acid, formic acid) media, staggering differences in optical absorptions and optical densities were noticed with hypsochromic shift in the absorption peaks. The optical density was found to be maximum for the complex with pH= 7.0 and the intensity as well as optical density gradually decreased when pH is lowered to 6.0 or raised to 8.0 (at an interval of 0.5), proving that the complex is pH sensitive. It's optical energy gap and stokes shift values in various organic solvents were also calculated on the basis of Lippert-Mataga plot. The exploration of spectroscopic properties of solvated Eu(TTA){sub 3}bipy complex demonstrates its prospective for solution processed OLEDs and display devices. - Graphical abstract: Pictorial depiction of photoluminescence in solvated Eu(TTA){sub 3}bipy complex under UV light.
Mondal, Palash; Roy, Sanjay; Loganathan, Gayathri; Mandal, Bitapi; Dharumadurai, Dhanasekaran; Akbarsha, Mohammad A; Sengupta, Partha Sarathi; Chattopadhyay, Shouvik; Guin, Partha Sarathi
2015-12-01
The X-ray diffraction and spectroscopic properties of 1-amino-4-hydroxy-9,10-anthraquinone (1-AHAQ), a simple analogue of anthracycline chemotherapeutic drugs were studied by adopting experimental and computational methods. The optimized geometrical parameters obtained from computational methods were compared with the results of X-ray diffraction analysis and the two were found to be in reasonably good agreement. X-ray diffraction study, Density Functional Theory (DFT) and natural bond orbital (NBO) analysis indicated two types of hydrogen bonds in the molecule. The IR spectra of 1-AHAQ were studied by Vibrational Energy Distribution Analysis (VEDA) using potential energy distribution (PED) analysis. The electronic spectra were studied by TDDFT computation and compared with the experimental results. Experimental and theoretical results corroborated each other to a fair extent. To understand the biological efficacy of 1-AHAQ, it was allowed to interact with calf thymus DNA and human breast adino-carcinoma cell MDA-MB-231. It was found that the molecule induces apoptosis in this adinocarcinoma cell, with little, if any, cytotoxic effect in HBL-100 normal breast epithelial cell.
Güder, Aytaç; Korkmaz, Halil; Gökce, Halil; Alpaslan, Yelda Bingöl; Alpaslan, Gökhan
2014-12-01
In this study, isolation and characterization of trans-resveratrol (RES) as an antioxidant compound were carried out from VLE, VLG and VLS. Furthermore, antioxidant activities were evaluated by using six different methods. Finally, total phenolic, flavonoid, ascorbic acid, anthocyanin, lycopene, β-carotene and vitamin E contents were carried out. In addition, the FT-IR, 13C and 1H NMR chemical shifts and UV-vis. spectra of trans-resveratrol were experimentally recorded. Quantum chemical computations such as the molecular geometry, vibrational frequencies, UV-vis. spectroscopic parameters, HOMOs-LUMOs energies, molecular electrostatic potential (MEP), natural bond orbitals (NBO) and nonlinear optics (NLO) properties of title molecule have been calculated by using DFT/B3PW91 method with 6-311++G(d,p) basis set in ground state for the first time. The obtained results show that the calculated spectroscopic data are in a good agreement with experimental data.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Spectroscopic properties of Er3+-doped fluorotellurite glasses containing various modifiers
Burtan-Gwizdała, Bożena; Reben, Manuela; Cisowski, Jan; Grelowska, Iwona; Yousef, El Sayed; Algarni, Hamed; Lisiecki, Radosław; Nosidlak, Natalia
2017-11-01
We have investigated the optical and spectroscopic properties of new Er3+-doped fluorotellurite glasses with the basic molar composition 75%TeO2-10%P2O5-10%ZnO-5%PbF2, modified by replacing 5%TeO2 by four various metal oxides, namely MgO, PbO, SrO and CdO. The ellipsometric data have provided a Sellmeier-type dispersion relation of the refractive index of the investigated glasses. The optical absorption edge has been described within the Urbach approach, while the absorption and fluorescence spectra have been analyzed in terms of the standard Judd-Ofelt theory along with the photoluminescence decay of the 4I13/2 and 4S3/2 levels of the Er3+ ion. The absorption and emission spectra of the 4I15/2 ↔ 4I13/2 infrared transition have been analyzed within the McCumber theory to yield the peak emission cross-section and figure of merit (FOM) for the amplifier gain. It appears that the glass containing MgO as a modifier is characterized by the largest FOM suggesting that the fluorotellurite matrix with this oxide can be a good novel host for Er3+ ion doping. Finally, we propose a new simple method to calculate the mean transition energy of the McCumber approach as the arithmetic average of the barycenter wavenumbers of absorption and emission spectra.
Spectroscopic properties of tetravalent actinide ions in solids
International Nuclear Information System (INIS)
Krupa, J.C.
1987-01-01
Optical spectroscopy is a powerful tool to study the electronic structure of an optically active transition ion in the condensed phase media and consequently to study the interactions between the central ion and its environment. The main interactions that are essential for an understanding of the energy level distribution of an f N ion in solids is briefly examined and the deduced free-ion and crystal field parameters for Pa 4+ , U 4+ , Np 4+ are compared to those of the isoelectronic configuration lanthanide ions. At last, the actinide series offers an interesting situation since the 5f electrons in the metals are delocalized in the light actinides and then localized, that sould affect the nature of the chemical bonding in the two parts of the series. Is this trend reflected in the An 4+ spectroscopic parameters
Spectroscopic characterization of low dose rate brachytherapy sources
Beach, Stephen M.
analogs. Several dosimetrically-relevant water-equivalent plastics were also investigated for their transmission properties within a liquid water environment, as well as in air. The framework for the accurate spectrometry of LDR sources is established as a result of this dissertation work. In addition to the measurement and analysis methods, this work presents the basic measured spectroscopic characteristics of each LDR seed currently in use in the clinic today.
Cui, Yanrui; Hao, Erjun; Hui, Guangquan; Guo, Wei; Cui, Fengling
2013-06-01
A tentative study on interaction of diclofenac sodium (DF-Na) with human serum albumin (HSA) and calf thymus DNA (ctDNA) was conducted by using multi-spectroscopic and molecular modeling techniques under simulative physiological conditions. The results of spectroscopic measurements suggested that the quenching mechanisms were static quenching. Three-dimensional fluorescence spectroscopy clearly demonstrated the occurrence of conformational changes of HSA with addition of DF-Na. In addition, competitive studies with ethidium bromide (EB) have shown that DF-Na can bind to ctDNA relatively strong via groove binding. Based on the values of thermodynamic parameters and the results of molecular modeling, it was confirmed that hydrophobic forces and hydrogen bond were the mainly binding forces in DF-Na-HSA and DF-Na-DNA systems. The binding distance between DF-Na and HSA was also determined using the theory of the Förster energy transference.
Gia, O; Anselmo, A; Pozzan, A; Antonello, C; Magno, S M; Uriarte, E
1997-01-01
The tricyclic structure of known natural photochemotherapeutic drugs such as 8-methoxypsoralen and 5-methoxypsoralen is often taken as a model in the search of new photosensitizer agents with less phototoxic and mutagenic effects. This paper describes the synthesis, characterization, photobinding to DNA, photobiological properties and computational chemistry of some 8-methoxypsoralen derivatives bearing two or three methyl groups at the key positions of the two photoactive double bonds. Results showed that photoreactivity and photobiological behaviour depend on the pattern of methyl substitutions. Antiproliferative activity in cell lines shows good correlation with DNA interaction data.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...
How spectroscopic x-ray imaging benefits from inter-pixel communication
Koenig, Thomas; Hamann, Elias; Cecilia, Angelica; Ballabriga, Rafael; Campbell, Michael; Ruat, Marie; Tlustos, Lukas; Fauler, Alex; Fiederle, Michael; Baumbach, Tilo
2014-01-01
Spectroscopic x-ray imaging based on pixellated semiconductor detectors can be sensitive to charge sharing and K-fluorescence, depending on the sensor material used, its thickness and the pixel pitch employed. As a consequence, spectroscopic resolution is partially lost. In this paper, we study a new detector ASIC, the Medipix3RX, that offers a novel feature called charge summing, which is established by making adjacent pixels communicate with each other. Consequently, single photon interactions resulting in multiple hits are almost completely avoided. We investigate this charge summing mode with respect to those of its imaging properties that are of interest in medical physics and benchmark them against the case without charge summing. In particular, we review its influence on spectroscopic resolution and find that the low energy bias normally present when recording energy spectra is dramatically reduced. Furthermore, we show that charge summing provides a modulation transfer function which is almost indepen...
Energy Technology Data Exchange (ETDEWEB)
Raju, G Naga; Ramesh, N Ch; Naresh, P; Krishna, T L; Srinivasulu, K; Sudhkar, K S V; Rao, P Venkateswara, E-mail: gnag_9@rediffmail.com [Department of Physics, Acharya Nagarjuna University-Nuzvid Campus, Nuzvid - 521 201 (India)
2009-07-15
In this paper we have reported the influence of titanium ions on different spectroscopic and dielectric properties of MgO-Al{sub 2}O{sub 3}-B{sub 2}O{sub 3} glasses. The analysis of result of all these studies has indicated that as the concentration of TiO{sub 2} increased in the glass matrix, there is a gradual transformation of titanium ions from octahedral position to tetrahedral positions and cause to increase the rigidity of glass network.
Fatieiev, Yevhen
2015-09-25
Bridged silsesquioxane nanocomposites with tunable morphologies incorporating o-nitrophenylene-ammonium bridges are described. The systematic screening of the sol-gel parameters allowed the material to reach the nanoscale –unlike most reported bridged silsesquioxane materials– with controlled dense and hollow structures of 100 to 200 nm. The hybrid composition of silsesquioxanes with 50% of organic content homogenously distributed in the nanomaterials endowed them with photoresponsive properties. Light irradiation was performed to reverse the surface charge of nanoparticles from +46 to -39 mV via the photoreaction of the organic fragments within the particles, as confirmed by spectroscopic monitorings. Furthermore, such NPs were ap-plied for the first time for the on-demand delivery of plasmid DNA in HeLa cancer cells via light actuation.
Fatieiev, Yevhen; Croissant, Jonas G.; Alsaiari, Shahad K.; Moosa, Basem; Anjum, Dalaver H.; Khashab, Niveen M.
2015-01-01
Bridged silsesquioxane nanocomposites with tunable morphologies incorporating o-nitrophenylene-ammonium bridges are described. The systematic screening of the sol-gel parameters allowed the material to reach the nanoscale –unlike most reported bridged silsesquioxane materials– with controlled dense and hollow structures of 100 to 200 nm. The hybrid composition of silsesquioxanes with 50% of organic content homogenously distributed in the nanomaterials endowed them with photoresponsive properties. Light irradiation was performed to reverse the surface charge of nanoparticles from +46 to -39 mV via the photoreaction of the organic fragments within the particles, as confirmed by spectroscopic monitorings. Furthermore, such NPs were ap-plied for the first time for the on-demand delivery of plasmid DNA in HeLa cancer cells via light actuation.
DNA binding properties of dioxin receptors in wild-type and mutant mouse hepatoma cells
International Nuclear Information System (INIS)
Cuthill, S.; Poellinger, L.
1988-01-01
The current model of action of 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) entails stimulation of target gene transcription via the formation of dioxin-receptor complexes and subsequent accumulation of the complexes within the cell nucleus. Here, the authors have analyzed the DNA binding properties of the dioxin receptor in wild-type mouse hepatoma (Hepa 1c1c7) cells and a class of nonresponsive mutant cells which fail to accumulate dioxin-receptor complexes within the nucleus in vivo. In vitro, both the wild-type and mutant [ 3 H]dioxin-receptor complexes exhibited low affinity for DNA-cellulose (5-8% and around 4% retention, respectively) in the absence of prior biochemical manipulations. However, following chromatography on heparin-Sepharose, the wild-type but not the mutant dioxin receptor was transformed to a species with an increased affinity for DNA (40-50% retention on DNA-cellulose). The gross molecular structure of the mutant, non DNA binding dioxin receptor did not appear to be altered as compared to that of the wild-type receptor. These results imply that the primary deficiency in the mutant dioxin receptor form may reside at the DNA binding level and that, in analogy to steroid hormone receptors, DNA binding of the receptor may be an essential step in the regulation of target gene transcription by dioxin
Koller, Verena J; Fürhacker, Maria; Nersesyan, Armen; Mišík, Miroslav; Eisenbauer, Maria; Knasmueller, Siegfried
2012-05-01
Glyphosate (G) is the largest selling herbicide worldwide; the most common formulations (Roundup, R) contain polyoxyethyleneamine as main surfactant. Recent findings indicate that G exposure may cause DNA damage and cancer in humans. Aim of this investigation was to study the cytotoxic and genotoxic properties of G and R (UltraMax) in a buccal epithelial cell line (TR146), as workers are exposed via inhalation to the herbicide. R induced acute cytotoxic effects at concentrations > 40 mg/l after 20 min, which were due to membrane damage and impairment of mitochondrial functions. With G, increased release of extracellular lactate dehydrogenase indicative for membrane damage was observed at doses > 80 mg/l. Both G and R induced DNA migration in single-cell gel electrophoresis assays at doses > 20 mg/l. Furthermore, an increase of nuclear aberrations that reflect DNA damage was observed. The frequencies of micronuclei and nuclear buds were elevated after 20-min exposure to 10-20 mg/l, while nucleoplasmatic bridges were only enhanced by R at the highest dose (20 mg/l). R was under all conditions more active than its active principle (G). Comparisons with results of earlier studies with lymphocytes and cells from internal organs indicate that epithelial cells are more susceptible to the cytotoxic and DNA-damaging properties of the herbicide and its formulation. Since we found genotoxic effects after short exposure to concentrations that correspond to a 450-fold dilution of spraying used in agriculture, our findings indicate that inhalation may cause DNA damage in exposed individuals.
Wcisło, Anna; Niedziałkowski, Paweł; Wnuk, Elżbieta; Zarzeczańska, Dorota; Ossowski, Tadeusz
2013-05-01
A series of novel 1-amino and 1,4-diamino-9,10-anthraquinones, substituted with different alkyl groups, were synthesized as the result of alkylation with amino substituents. All the obtained aminoanthraquinone derivatives were characterized by NMR, IR spectroscopy and mass spectrometry. The spectroscopic properties of these compounds were determined by using UV-Vis spectroscopy in acetonitrile, and in the mixture of acetonitrile and methanol at different pH ranges. The effects of various substituents present in the newly developed anthraquinone derivatives and their ability to form hydrogen bonds between the carbonyl oxygen atom of anthraquinone moiety and nitrogen atom of N-H group in 1-aminoanthraquinone (1-AAQ) and 1,4-diaminoanthraquinone (1,4-DAAQ) were studied. Additionally, the effects of hydrogen bond formation between O-H group in hydroxyethylamino substituent and the carbonyl oxygen atom of anthraquinone were investigated. The spectroscopic behavior of the studied derivatives strongly depended on the solvent-solute interactions and the nature of solvent. The values of pKa for the new anthraquinones were determined by the combined potentiometric and spectrophotometric titration methods. Copyright © 2013 Elsevier B.V. All rights reserved.
Synthesis, spectroscopic and redox properties of the mononuclear ...
Indian Academy of Sciences (India)
Administrator
magnetic susceptibility measurements, molar conductivity, cyclic voltammetry, mass ... gens donor atoms show DNA binding and antitumor ... trum can be correlated with the strength of the ... ties, the investigation of redox behaviour has a vital.
Statistical properties and fractals of nucleotide clusters in DNA sequences
International Nuclear Information System (INIS)
Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting
2004-01-01
Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences
Application of Spectroscopic Methods for Structural Analysis of Chitin and Chitosan
Directory of Open Access Journals (Sweden)
Jolanta Kumirska
2010-04-01
Full Text Available Chitin, the second most important natural polymer in the world, and its N-deacetylated derivative chitosan, have been identified as versatile biopolymers for a broad range of applications in medicine, agriculture and the food industry. Two of the main reasons for this are firstly the unique chemical, physicochemical and biological properties of chitin and chitosan, and secondly the unlimited supply of raw materials for their production. These polymers exhibit widely differing physicochemical properties depending on the chitin source and the conditions of chitosan production. The presence of reactive functional groups as well as the polysaccharide nature of these biopolymers enables them to undergo diverse chemical modifications. A complete chemical and physicochemical characterization of chitin, chitosan and their derivatives is not possible without using spectroscopic techniques. This review focuses on the application of spectroscopic methods for the structural analysis of these compounds.
Mechanisms for radiation damage in DNA. Final report, June 1, 1986--August 31, 1996
International Nuclear Information System (INIS)
Sevilla, M.D.
1996-08-01
Over the last 10 years significant advances have been made impacting the understanding of radiation damage to DNA. The principal objective of this work was the elucidation of the fundamental mechanisms of radiation damage to DNA through the direct and indirect effects. Recently the work concentrated on the direct effect of radiation damage on DNA. The objective was to elucidate the ultimate radiation chemical damage to DNA arising from the direct effect. In this effort the focus was on the application of three techniques. ESR spectroscopic measurement of initial radicals formed in DNA and its hydration layer at low temperatures. Ab initio molecular orbital calculations were employed to give highly accurate theoretical predictions of early events such as electron and hole localization sites which serve to test and to clarify the experimental observations. HPLC and GC-mass spectroscopic assays of DNA base products formation provide the ultimate chemical outcome of the initial radiation events. The bridge between the early ion radical species and the non-radical products is made in ESR studies which follow the chemistry of the early species as they react with water and or other DNA bases. The use of these techniques has resulted in a new and fundamental understanding of the radiation damage to DNA on a molecular scale. From this work, a working model for DNA damage from the initial ionization event to the eventual formation of molecular base damage products and strand breaks has been formulated. Results over the past several years which have led to the formulation of this model are described
Conformational properties of DNA containing (CCA)n and (TGG)n trinucleotide repeats
Czech Academy of Sciences Publication Activity Database
Zemánek, Michal; Kypr, Jaroslav; Vorlíčková, Michaela
2005-01-01
Roč. 36, - (2005), s. 23-32 ISSN 0141-8130. [Študentská vedecká konferencia. Bratislava, 9.03.2003-10.03.2003] R&D Projects: GA MZd(CZ) NM7634; GA AV ČR(CZ) IAA4004201 Institutional research plan: CEZ:AV0Z50040507 Keywords : DNA conformational properties * length polymorphism * microsatellite sequences Subject RIV: BO - Biophysics Impact factor: 1.684, year: 2005
Quasiparticle properties of DNA bases from GW calculations in a Wannier basis
Qian, Xiaofeng; Marzari, Nicola; Umari, Paolo
2009-03-01
The quasiparticle GW-Wannier (GWW) approach [1] has been recently developed to overcome the size limitations of conventional planewave GW calculations. By taking advantage of the localization properties of the maximally-localized Wannier functions and choosing a small set of polarization basis we reduce the number of Bloch wavefunctions products required for the evaluation of dynamical polarizabilities, and in turn greatly reduce memory requirements and computational efficiency. We apply GWW to study quasiparticle properties of different DNA bases and base-pairs, and solvation effects on the energy gap, demonstrating in the process the key advantages of this approach. [1] P. Umari,G. Stenuit, and S. Baroni, cond-mat/0811.1453
Spectroscopic characterisation of the stellar content of ultra diffuse galaxies
Ruiz-Lara, T.; Beasley, M. A.; Falcón-Barroso, J.; Román, J.; Pinna, F.; Brook, C.; Di Cintio, A.; Martín-Navarro, I.; Trujillo, I.; Vazdekis, A.
2018-05-01
Understanding the peculiar properties of Ultra Diffuse Galaxies (UDGs) via spectroscopic analysis is a challenging task requiring very deep observations and exquisite data reduction. In this work we perform one of the most complete characterisations of the stellar component of UDGs to date using deep optical spectroscopic data from OSIRIS at GTC. We measure radial and rotation velocities, star formation histories (SFH) and mean population parameters, such as ages and metallicities, for a sample of five UDG candidates in the Coma cluster. From the radial velocities, we confirm the Coma membership of these galaxies. We find that their rotation properties, if detected at all, are compatible with dwarf-like galaxies. The SFHs of the UDG are dominated by old (˜ 7 Gyr), metal-poor ([M/H] ˜ -1.1) and α-enhanced ([Mg/Fe] ˜ 0.4) populations followed by a smooth or episodic decline which halted ˜ 2 Gyr ago, possibly a sign of cluster-induced quenching. We find no obvious correlation between individual SFH shapes and any UDG morphological properties. The recovered stellar properties for UDGs are similar to those found for DDO 44, a local UDG analogue resolved into stars. We conclude that the UDGs in our sample are extended dwarfs whose properties are likely the outcome of both internal processes, such as bursty SFHs and/or high-spin haloes, as well as environmental effects within the Coma cluster.
NARROW-LINE X-RAY-SELECTED GALAXIES IN THE CHANDRA -COSMOS FIELD. I. OPTICAL SPECTROSCOPIC CATALOG
Energy Technology Data Exchange (ETDEWEB)
Pons, E.; Watson, M. G. [University of Leicester, Leicester (United Kingdom); Elvis, M.; Civano, F. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States)
2016-04-20
The COSMOS survey is a large and deep survey with multiwavelength observations of sources from X-rays to the UV, allowing an extensive study of their properties. The central 0.9 deg{sup 2} of the COSMOS field have been observed by Chandra with a sensitivity up to 1.9 × 10{sup −16} erg cm{sup −2} s{sup −1} in the full (0.5–10 keV) band. Photometric and spectroscopic identification of the Chandra -COSMOS (C-COSMOS) sources is available from several catalogs and campaigns. Despite the fact that the C-COSMOS galaxies have a reliable spectroscopic redshift in addition to a spectroscopic classification, the emission-line properties of this sample have not yet been measured. We present here the creation of an emission-line catalog of 453 narrow-line sources from the C-COSMOS spectroscopic sample. We have performed spectral fitting for the more common lines in galaxies ([O ii] λ 3727, [Ne iii] λ 3869, H β , [O iii] λλ 4959, 5007, H α , and [N ii] λλ 6548, 6584). These data provide an optical classification for 151 (i.e., 33%) of the C-COSMOS narrow-line galaxies based on emission-line diagnostic diagrams.
Sørensen, L. K.; Fleig, T.; Olsen, J.
2009-08-01
Aimed at obtaining complete and highly accurate potential energy surfaces for molecules containing heavy elements, we present a new general-order coupled cluster method which can be applied in the framework of the spin-free Dirac formalism. As an initial application we present a systematic study of electron correlation and relativistic effects on the spectroscopic and electric properties of the LiCs molecule in its electronic ground state. In particular, we closely investigate the importance of excitations higher than coupled cluster doubles, spin-free and spin-dependent relativistic effects and the correlation of outer-core electrons on the equilibrium bond length, the harmonic vibrational frequency, the dissociation energy, the dipole moment and the static electric dipole polarizability. We demonstrate that our new implementation allows for highly accurate calculations not only in the bonding region but also along the complete potential curve. The quality of our results is demonstrated by a vibrational analysis where an almost complete set of vibrational levels has been calculated accurately.
International Nuclear Information System (INIS)
Soerensen, L K; Fleig, T; Olsen, J
2009-01-01
Aimed at obtaining complete and highly accurate potential energy surfaces for molecules containing heavy elements, we present a new general-order coupled cluster method which can be applied in the framework of the spin-free Dirac formalism. As an initial application we present a systematic study of electron correlation and relativistic effects on the spectroscopic and electric properties of the LiCs molecule in its electronic ground state. In particular, we closely investigate the importance of excitations higher than coupled cluster doubles, spin-free and spin-dependent relativistic effects and the correlation of outer-core electrons on the equilibrium bond length, the harmonic vibrational frequency, the dissociation energy, the dipole moment and the static electric dipole polarizability. We demonstrate that our new implementation allows for highly accurate calculations not only in the bonding region but also along the complete potential curve. The quality of our results is demonstrated by a vibrational analysis where an almost complete set of vibrational levels has been calculated accurately.
Zhang, Liaolin; Dong, Guoping; Peng, Mingying; Qiu, Jianrong
We report on the spectroscopic properties of Pr3+-doped boro-phosphate, boro-germo-silicate and tellurite glasses. The stimulated absorption and emission cross sections were estimated. Only one emission at 596 nm and 605 nm is observed in Pr3+-doped boro-phosphate and boro-germo-silicate glasses, respectively, while three emissions at 605 nm, 612 nm and 645 nm are observed in Pr3+-doped tellurite glass when excited at 467 nm. The fluorescence lifetime at 600 nm in Pr3+-doped boro-phosphate, boro-germo-silicate and tellurite glasses is 137 μs, 73 μs and 51 μs, respectively. The emissions from Pr3+-doped boro-phosphate, boro-germo-silicate and tellurite glasses show different decay behaviors and can be well explained by multiphonon relaxation theory.
International Nuclear Information System (INIS)
Bera, Anuradha; Ram, Surendra; Singh, Shailendra K.; Vaijapurkar, S.G.
2009-01-01
Bromocresol Green (BCG) - Polyvinyl chloride (PVC) film was prepared by dispersing the dye in the polymer matrix in a suitable solvent medium in the presence of an organic base and then solvent casting the formulation in the form of transparent colored film. Preliminary studies through UV-Vis Spectroscopic measurements show that the prepared PVC - dye films was sensitive to gamma radiation almost linearly in the dose range upto 8 kGy range. This spectroscopic change becomes visually distinguishable from 4 kGy onwards until 8 kGy where it finally changes color from green to yellow, beyond which no significant optical change was observed. The gamma response of the film could be tailored by varying the concentration of the pH sensitive dye and the organic base. (author)
Hassani, Leila; Hakimian, Fatemeh; Safaei, Elham; Fazeli, Zahra
2013-11-01
Resistance to antibiotics is a public health issue and identification of new antibacterial agents is one of the most important goals of pharmacological research. Among the novel developed antibacterial agents, porphyrin complexes and their derivatives are ideal candidates for use in medical applications. Phthalocyanines differ from porphyrins by having nitrogen atoms link the individual pyrrol units. The aza analogues of the phthalocyanines (azaPcs) such as tetramethylmetalloporphyrazines are heterocyclic Pc analogues. In this investigation, interaction of an anionic phthalocyanine (Cu(PcTs)) and two cationic tetrapyridinoporphyrazines including [Cu(2,3-tmtppa)]4+ and [Cu(3,4-tmtppa)]4+ complexes with plasmid DNA was studied using spectroscopic and gel electrophoresis methods. In addition, antibacterial effect of the complexes against Gram-positive (Staphylococcus aureus) and Gram-negative (Escherichia coli) bacteria was investigated using dilution test method. The results indicated that both porphyrazines have significant antibacterial properties, but Cu(PcTs) has weak antibacterial effect. Compairing the binding of the phthalocyanine and the porphyrazines to DNA demonstrated that the interaction of cationic porphyrazines is stronger than the anionic phthalocyanine remarkably. The extent of hypochromicity and red shift of absorption spectra indicated preferential intercalation of the two porphyrazine into the base pairs of DNA helix. Gel electrophoresis result implied Cu(2,3-tmtppa) and Cu(3,4-tmtppa) are able to perform cleavage of the plasmid DNA. Consequently, DNA binding and cleavage might be one of the antibacterial mechanisms of the complexes.
Optical and spectroscopic properties of Eu-doped tellurite glasses and glass ceramics
International Nuclear Information System (INIS)
Stambouli, W.; Elhouichet, H.; Gelloz, B.; Férid, M.
2013-01-01
in the nanocrystals precipitated in the glass ceramics. -- Highlights: ► Structural, thermal and optical properties of Eu 3+ doped tellurite glass, vitoceramic and ceramic were investigated. ► Judd–Ofelt model is used to determine the spectroscopic parameters of Eu 3+ doped tellurite glass and ceramic. ► Large improvements of the emission cross-section, gain bandwidth and quantum efficiency of Eu were found after thermal annealing of the glass
Sarkar, Biswatrish; Kumar, Dhananjay; Sasmal, Dinakar; Mukhopadhyay, Kunal
2014-01-01
Anthocyanin extracts (AEs) from Ocimum tenuiflorum (leaf), Hibiscus rosa-sinensis (petal) and Hibiscus sabdariffa (calyx) were investigated and compared for in vitro antioxidant activity and DNA damage protective property. Total phenolic content (TPC) and total anthocyanin content (TAC) of the AEs were determined and the major anthocyanins were characterised. In vitro antioxidant activities were assessed by ferric-reducing antioxidant power (FRAP) assay, 2,2-diphenyl-1-picryl hydrazyl (DPPH) radical-scavenging activity, 2-deoxy-D-ribose degradation assay and lipid peroxidation assay. The protective property of the AEs was also examined against oxidative DNA damage by H2O2 and UV using pUC19 plasmid. All the AEs particularly those from O. tenuiflorum demonstrated efficient antioxidant activity and protected DNA from damage. Strong correlation between antioxidant capacity and TPC and TAC was observed. Significant correlation between antioxidant capacity and TPC and TAC ascertained that phenolics and anthocyanins were the major contributors of antioxidant activity.
Liu, Hsiang-Lin
2014-11-17
Spectroscopic ellipsometry was used to characterize the complex refractive index of chemical-vapor-deposited monolayer transition metal dichalcogenides (TMDs). The extraordinary large value of the refractive index in the visible frequency range is obtained. The absorption response shows a strong correlation between the magnitude of the exciton binding energy and band gap energy. Together with the observed giant spin-orbit splitting, these findings advance the fundamental understanding of their novel electronic structures and the development of monolayer TMDs-based optoelectronic and spintronic devices.
Liu, Hsiang-Lin; Shen, Chih-Chiang; Su, Sheng-Han; Hsu, Chang-Lung; Li, Ming-Yang; Li, Lain-Jong
2014-01-01
Spectroscopic ellipsometry was used to characterize the complex refractive index of chemical-vapor-deposited monolayer transition metal dichalcogenides (TMDs). The extraordinary large value of the refractive index in the visible frequency range is obtained. The absorption response shows a strong correlation between the magnitude of the exciton binding energy and band gap energy. Together with the observed giant spin-orbit splitting, these findings advance the fundamental understanding of their novel electronic structures and the development of monolayer TMDs-based optoelectronic and spintronic devices.
The prion protein has DNA strand transfer properties similar to retroviral nucleocapsid protein.
Gabus, C; Auxilien, S; Péchoux, C; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W; Nandi, P; Darlix, J L
2001-04-06
The transmissible spongiform encephalopathies are fatal neurodegenerative diseases that are associated with the accumulation of a protease-resistant form of the cellular prion protein (PrP). Although PrP is highly conserved and widely expressed in vertebrates, its function remains a matter of speculation. Indeed PrP null mice develop normally and are healthy. Recent results show that PrP binds to nucleic acids in vitro and is found associated with retroviral particles. Furthermore, in mice the scrapie infectious process appears to be accelerated by MuLV replication. These observations prompted us to further investigate the interaction between PrP and nucleic acids, and compare it with that of the retroviral nucleocapsid protein (NC). As the major nucleic acid-binding protein of the retroviral particle, NC protein is tightly associated with the genomic RNA in the virion nucleocapsid, where it chaperones proviral DNA synthesis by reverse transcriptase. Our results show that the human prion protein (huPrP) functionally resembles NCp7 of HIV-1. Both proteins form large nucleoprotein complexes upon binding to DNA. They accelerate the hybridization of complementary DNA strands and chaperone viral DNA synthesis during the minus and plus DNA strand transfers necessary to generate the long terminal repeats. The DNA-binding and strand transfer properties of huPrP appear to map to the N-terminal fragment comprising residues 23 to 144, whereas the C-terminal domain is inactive. These findings suggest that PrP could be involved in nucleic acid metabolism in vivo. Copyright 2001 Academic Press.
Energy Technology Data Exchange (ETDEWEB)
Shi, D.M.; Zhao, Y.G.; Wang, X.F.; Liao, G.H. [Department of Materials Science and Engineering, Luoyang Institute of Science and Technology, Luoyang 471023 (China); Zhao, C. [Department of Physics, South China University of Technology, Guangzhou 510641 (China); MOE Key Lab of Specially Functional Materials and Institute of Optical Communication Materials, South China University of Technology, Guangzhou 510641 (China); Peng, M.Y. [MOE Key Lab of Specially Functional Materials and Institute of Optical Communication Materials, South China University of Technology, Guangzhou 510641 (China); Zhang, Q.Y., E-mail: qyzhang@scut.edu.c [MOE Key Lab of Specially Functional Materials and Institute of Optical Communication Materials, South China University of Technology, Guangzhou 510641 (China)
2011-02-01
Since information transportation capacity of optical communication network increases rapidly, new optical materials are always demanded with gain bandwidth desirably much broader than traditional erbium-doped silica fiber amplifier (EDFA). We show here in this paper the erbium-doped gallogermanate glasses with a full-width at half-maximum (FWHM) more than 50 nm. Incorporation of alkali ions such as Li{sup +}, Na{sup +}, K{sup +} into the system can on the one hand improve the thermal stability of the glasses, and on the other hand enhance the emission at 1.5 {mu}m due to the {sup 4}I{sub 13/2{yields}}{sup 4}I{sub 15/2} transition of Er{sup 3+} and suppress the upconversion process at the same time. This particularly works best for the case of K{sup +} inclusion. This work might give a general idea on controlling the Er{sup 3+} luminescence by simply adjusting the glass component and find a potential laser glass applicable to developing new broadband fiber amplifier. -- Research highlights: {yields} We report on spectroscopic properties of Er{sup 3+}-doped Ga{sub 2}O{sub 3}-GeO{sub 2}-R{sub 2}O (GGR, R=Li, Na and K) glasses for 1.53 {mu}m fiber amplifier. Effects of alkali metal ions on the thermal stability and spectroscopic properties of Er{sup 3+}-doped GGR glasses have been investigated. {yields} Incorporation of alkali ions such as Li{sup +}, Na{sup +}, K{sup +} into the system can on the one hand improve the thermal stability of the glasses, and on the other hand enhance the emission at 1.5 {mu}m due to the {sup 4}I{sub 13/2{yields}}{sup 4}I{sub 15/2} transition of Er{sup 3+} and suppress the upconversion process at the same time. This particularly works best for the case of K{sup +} inclusion. This work might give a general idea on controlling the Er{sup 3+} luminescence by simply adjusting the glass component and find a potential laser glass applicable to developing new broadband fiber amplifier.
Shell model and spectroscopic factors
International Nuclear Information System (INIS)
Poves, P.
2007-01-01
In these lectures, I introduce the notion of spectroscopic factor in the shell model context. A brief review is given of the present status of the large scale applications of the Interacting Shell Model. The spectroscopic factors and the spectroscopic strength are discussed for nuclei in the vicinity of magic closures and for deformed nuclei. (author)
SSGSS: THE SPITZER–SDSS–GALEX SPECTROSCOPIC SURVEY
International Nuclear Information System (INIS)
O'Dowd, Matthew J.; Schiminovich, David; Johnson, Benjamin D.; Treyer, Marie A.; Martin, Christopher D.; Wyder, Ted K.; Charlot, Stéphane; Heckman, Timothy M.; Martins, Lucimara P.; Seibert, Mark; Van der Hulst, J. M.
2011-01-01
The Spitzer-SDSS-GALEX Spectroscopic Survey (SSGSS) provides a new sample of 101 star-forming galaxies at z < 0.2 with unprecedented multi-wavelength coverage. New mid- to far-infrared spectroscopy from the Spitzer Space Telescope is added to a rich suite of previous imaging and spectroscopy, including ROSAT, Galaxy Evolution Explorer, Sloan Digital Sky Survey, Two Micron All Sky Survey, and Spitzer/SWIRE. Sample selection ensures an even coverage of the full range of normal galaxy properties, spanning two orders of magnitude in stellar mass, color, and dust attenuation. In this paper we present the SSGSS data set, describe the science drivers, and detail the sample selection, observations, data reduction, and quality assessment. Also in this paper, we compare the shape of the thermal continuum and the degree of silicate absorption of these typical, star-forming galaxies to those of starburst galaxies. We investigate the link between star formation rate, infrared luminosity, and total polycyclic aromatic hydrocarbon luminosity, with a view to calibrating the latter for spectral energy distribution models in photometric samples and at high redshift. Last, we take advantage of the 5-40 μm spectroscopic and far-infrared photometric coverage of this sample to perform detailed fitting of the Draine et al. dust models, and investigate the link between dust mass and star formation history and active galactic nucleus properties.
Energy Technology Data Exchange (ETDEWEB)
Dickens, Peter T.; Marcial, José; McCloy, John; McDonald, Benjamin S.; Lynn, Kelvin G.
2017-10-01
In this study, LiAlO2 crystals doped with rare-earth elements and Ti were produced by the CZ method and spectroscopic and neutron detection properties were investigated. Photoluminescence revealed no clear luminescent activation of LiAlO2 by the rare-earth dopants though some interesting luminescence was observed from secondary phases within the crystal. Gamma-ray pulse height spectra collected using a 137Cs source exhibited only a Compton edge for the crystals. Neutron modeling using Monte Carlo N-Particle Transport Code revealed most neutrons used in the detection setup are thermalized, and while using natural lithium in the crystal growth, which contains 7.6 % 6Li, a 10 mm Ø by 10 mm sample of LiAlO2 has a 70.7 % intrinsic thermal neutron capture efficiency. Furthermore, the pulse height spectra collected using a 241Am-Be neutron source demonstrated a distinct neutron peak.
International Nuclear Information System (INIS)
Sablayrolles, J.
2006-12-01
The trivalent ytterbium ion can give rise to two emissions with different spectroscopic properties: the first one, with a short lifetime, in the ultraviolet (charge transfer emission) is used in detectors such as scintillators, and the other one, with a long lifetime, in the infrared (4f-4f emission) for laser applications. The strong link between material structure and properties is illustrated through ytterbium luminescence study, in the ultraviolet and infrared, inserted in the borate Li 6 Y(BO 3 ) 3 and two oxy-borates: LiY 6 O 5 (BO 3 ) 3 and Y 17,33 B 8 O 38 . For the first time an ytterbium charge transfer emission in oxy-borates has been observed. The calculation of the single configurational coordinate diagram, as well as the thermal quenching, has been conducted under a fundamental approach on the ytterbium - oxygen bond. The study of the ytterbium infrared spectroscopy in these compounds has been realised and an energy level attribution is proposed in the particular case of the borate Li 6 Y(BO 3 ) 3 : Yb 3+ . An original approach is introduced with the study of the charge transfer states for the three compounds by looking at the infrared emission. The first laser performances in three operating modes (continuous wave, Q-switch and mode locking) of a Li 6 Y(BO 3 ) 3 : Yb 3+ crystal are reported. (author)
DNA-Protected Silver Clusters for Nanophotonics
Directory of Open Access Journals (Sweden)
Elisabeth Gwinn
2015-02-01
Full Text Available DNA-protected silver clusters (AgN-DNA possess unique fluorescence properties that depend on the specific DNA template that stabilizes the cluster. They exhibit peak emission wavelengths that range across the visible and near-IR spectrum. This wide color palette, combined with low toxicity, high fluorescence quantum yields of some clusters, low synthesis costs, small cluster sizes and compatibility with DNA are enabling many applications that employ AgN-DNA. Here we review what is known about the underlying composition and structure of AgN-DNA, and how these relate to the optical properties of these fascinating, hybrid biomolecule-metal cluster nanomaterials. We place AgN-DNA in the general context of ligand-stabilized metal clusters and compare their properties to those of other noble metal clusters stabilized by small molecule ligands. The methods used to isolate pure AgN-DNA for analysis of composition and for studies of solution and single-emitter optical properties are discussed. We give a brief overview of structurally sensitive chiroptical studies, both theoretical and experimental, and review experiments on bringing silver clusters of distinct size and color into nanoscale DNA assemblies. Progress towards using DNA scaffolds to assemble multi-cluster arrays is also reviewed.
Recognition of thymine in DNA bulges by a Zn(II) macrocyclic complex.
del Mundo, Imee Marie A; Fountain, Matthew A; Morrow, Janet R
2011-08-14
A Zn(II) macrocyclic complex with appended quinoline is a bifunctional recognition agent that uses both the Zn(II) center and the pendent aromatic group to bind to thymine in bulges with good selectivity over DNA containing G, C or A bulges. Spectroscopic studies show that the stem containing the bulge stays largely intact in a DNA hairpin with the Zn(II) complex bound to the thymine bulge. This journal is © The Royal Society of Chemistry 2011
Linko, Veikko; Leppiniemi, Jenni; Paasonen, Seppo-Tapio; Hytönen, Vesa P; Toppari, J Jussi
2011-07-08
We present a novel, defined-size, small and rigid DNA template, a so-called B-A-B complex, based on DNA triple crossover motifs (TX tiles), which can be utilized in molecular scale patterning for nanoelectronics, plasmonics and sensing applications. The feasibility of the designed construct is demonstrated by functionalizing the TX tiles with one biotin-triethylene glycol (TEG) and efficiently decorating them with streptavidin, and furthermore by positioning and anchoring single thiol-modified B-A-B complexes to certain locations on a chip via dielectrophoretic trapping. Finally, we characterize the conductance properties of the non-functionalized construct, first by measuring DC conductivity and second by utilizing AC impedance spectroscopy in order to describe the conductivity mechanism of a single B-A-B complex using a detailed equivalent circuit model. This analysis also reveals further information about the conductivity of DNA structures in general.
Studies of interaction between two alkaloids and double helix DNA
International Nuclear Information System (INIS)
Sun, Yantao; Peng, Tingting; Zhao, Lei; Jiang, Dayu; Cui, Yuncheng
2014-01-01
This article presents the study on the interaction of two alkaloids (matrine and evodiamine) and hs-DNA by absorption, fluorescence, circular dichroism (CD), DNA melting and viscosity experiments. The spectroscopic studies suggested that two alkaloids can bind to DNA through an intercalative mode. The viscosity measurement and thermal denaturation also indicated that two alkaloids can intercalate to DNA. The binding constants (K A ) and the number of binding sites (n) were determined. At the same time, some significant thermodynamic parameters of the binding of the alkaloids to DNA were obtained. Competitive binding studies revealed that alkaloids had an effect on ethidium bromide (EB) bound DNA. In addition, it was also proved that the fluorescence quenching was influenced by ionic strength. - Highlights: • Interaction between two alkaloids and DNA is studied by spectral methods. • The binding constant and the binding sites between two alkaloids and DNA are obtained. • There are a classical intercalative mode between alkaloids and DNA. • The binding of matrine with DNA is weaker than that of evodiamine. • It is important for us to understand the alkaloids–DNA interactions at a molecular level
International Nuclear Information System (INIS)
Kochanov, R.V.; Gordon, I.E.; Rothman, L.S.; Wcisło, P.; Hill, C.; Wilzewski, J.S.
2016-01-01
The HITRAN Application Programming Interface (HAPI) is presented. HAPI is a free Python library, which extends the capabilities of the HITRANonline interface ( (www.hitran.org)) and can be used to filter and process the structured spectroscopic data. HAPI incorporates a set of tools for spectra simulation accounting for the temperature, pressure, optical path length, and instrument properties. HAPI is aimed to facilitate the spectroscopic data analysis and the spectra simulation based on the line-by-line data, such as from the HITRAN database [JQSRT (2013) 130, 4–50], allowing the usage of the non-Voigt line profile parameters, custom temperature and pressure dependences, and partition sums. The HAPI functions allow the user to control the spectra simulation and data filtering process via a set of the function parameters. HAPI can be obtained at its homepage (www.hitran.org/hapi). - Highlights: • HAPI extends the HITRANonline portal and provides an access to the HITRAN data. • Free, flexible, and portable Python library for working with the spectroscopic data. • Incorporates functions for querying, filtering and processing the spectroscopic data. • Provides functionality for single-layer spectra simulation. • Can be used in the radiative transfer codes, spectroscopic data validation, etc.
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Binding property of the complex with calf thymus DNA (CT-DNA) has been investigated using absorption and emission studies. Thermal melting and viscosity experiments were further performed to determine the mode of binding of 1 with CT-DNA. Spectroscopic and viscosity investigations revealed an intercalative binding ...
Platzek, T; Bochert, G; Rahm, U; Neubert, D
1987-05-01
Synthesis and spectroscopic analysis of some alkylated DNA purine bases are described. HPLC separation methods are developed for the determination of DNA alkylation rates in mammalian embryonic tissues. Following treatment of pregnant mice with the ethylating agent ethylmethanesulfonate (EMS), an appreciable amount of alkylation (ethylation and methylation) was found in the nuclear DNA of the embryos during organogenesis. The results are discussed in context of our thesis that a certain amount of DNA alkylation in the embryos is correlated to the teratogenic potential of alkylating agents.
Marques, Ricardo A; Gomes, Akenaton O C V; de Brito, Maria V; Dos Santos, Ana L P; da Silva, Gladyane S; de Lima, Leandro B; Nunes, Fátima M; de Mattos, Marcos C; de Oliveira, Fátima C E; do Ó Pessoa, Cláudia; de Moraes, Manoel O; de Fátima, Ângelo; Franco, Lucas L; Silva, Marina de M; Dantas, Maria Dayanne de A; Santos, Josué C C; Figueiredo, Isis M; da Silva-Júnior, Edeíldo F; de Aquino, Thiago M; de Araújo-Júnior, João X; de Oliveira, Maria C F; Leslie Gunatilaka, A A
2018-02-01
The cytotoxic activity of the pimarane diterpene annonalide (1) and nine of its semisynthetic derivatives (2-10) was investigated against the human tumor cell lines HL-60 (leukemia), PC-3 (prostate adenocarcinoma), HepG2 (hepatocellular carcinoma), SF-295 (glioblastoma) and HCT-116 (colon cancer), and normal mouse fibroblast (L929) cells. The preparation of 2-10 involved derivatization of the side chain of 1 at C-13. Except for 2, all derivatives are being reported for the first time. Most of the tested compounds presented IC 50 s below 4.0 μM, being considered potential antitumor agents. The structures of all new compounds were elucidated by spectroscopic analyses including 2D NMR and HRMS. Additionally, the interaction of annonalide (1) with ctDNA was evaluated using spectroscopic techniques, and the formation of a supramolecular complex with the macromolecule was confirmed. Competition assays with fluorescent probes (Hoechst and ethidium bromide) and theoretical studies confirmed that 1 interacts preferentially via DNA intercalation with stoichiometric ratio of 1:1 (1:ctDNA). The ΔG value was calculated as -28.24 kJ mol -1 , and indicated that the interaction process occurs spontaneously. Docking studies revealed that van der Walls is the most important interaction in 1-DNA and EB-DNA complexes, and that both ligands (1 and EB) interact with the same DNA residues (DA6, DA17 and DT19). Copyright © 2018. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Hacali Necefoglu
2007-06-01
Full Text Available The interaction of [Co(H2O4(p-NO2C6H4COO2]. 2H2O with sheep genomicDNA has been investigated by spectroscopic studies and electrophoresis measurements.The interaction between cobalt(II p-nitrobenzoate and DNA has been followed by gelelectrophoresis while the concentration of the complex was increased from 0 to 14 mM.The spectroscopic study and electrophoretic experiments support the fact that the complexbinds to DNA by intercalation via p-nitrobenzoate into the base pairs of DNA. Themobility of the bands decreased as the concentration of complex was increased, indicatingthat there was increase in interaction between the metal ion and DNA.
Tasca, L. A. M.; Le Fèvre, O.; Ribeiro, B.; Thomas, R.; Moreau, C.; Cassata, P.; Garilli, B.; Le Brun, V.; Lemaux, B. C.; Maccagni, D.; Pentericci, L.; Schaerer, D.; Vanzella, E.; Zamorani, G.; Zucca, E.; Amorin, R.; Bardelli, S.; Cassarà, L. P.; Castellano, M.; Cimatti, A.; Cucciati, O.; Durkalec, A.; Fontana, A.; Giavalisco, M.; Grazian, A.; Hathi, N. P.; Ilbert, O.; Paltani, S.; Pforr, J.; Scodeggio, M.; Sommariva, V.; Talia, M.; Tresse, L.; Vergani, D.; Capak, P.; Charlot, S.; Contini, T.; de la Torre, S.; Dunlop, J.; Fotopoulou, S.; Guaita, L.; Koekemoer, A.; López-Sanjuan, C.; Mellier, Y.; Salvato, M.; Scoville, N.; Taniguchi, Y.; Wang, P. W.
2017-04-01
This paper describes the first data release (DR1) of the VIMOS Ultra Deep Survey (VUDS). The VUDS-DR1 is the release of all low-resolution spectroscopic data obtained in 276.9 arcmin2 of the CANDELS-COSMOS and CANDELS-ECDFS survey areas, including accurate spectroscopic redshifts zspec and individual spectra obtained with VIMOS on the ESO-VLT. A total of 698 objects have a measured redshift, with 677 galaxies, two type-I AGN, and a small number of 19 contaminating stars. The targets of the spectroscopic survey are selected primarily on the basis of their photometric redshifts to ensure a broad population coverage. About 500 galaxies have zspec > 2, 48of which have zspec > 4; the highest reliable redshifts reach beyond zspec = 6. This data set approximately doubles the number of galaxies with spectroscopic redshifts at z > 3 in these fields. We discuss the general properties of the VUDS-DR1 sample in terms of the spectroscopic redshift distribution, the distribution of Lyman-α equivalent widths, and physical properties including stellar masses M⋆ and star formation rates derived from spectral energy distribution fitting with the knowledge of zspec. We highlight the properties of the most massive star-forming galaxies, noting the wide range in spectral properties, with Lyman-α in emission or in absorption, and in imaging properties with compact, multi-component, or pair morphologies. We present the catalogue database and data products. All VUDS-DR1 data are publicly available and can be retrieved from a dedicated query-based database. Future VUDS data releases will follow this VUDS-DR1 to give access to the spectra and associated measurement of 8000 objects in the full 1 square degree of the VUDS survey. Based on data obtained with the European Southern Observatory Very Large Telescope, Paranal, Chile, under Large Program 185.A-0791. http://cesam.lam.fr/vuds
Effect of F- ions on physical and spectroscopic properties of Yb3+-doped TeO2-based glasses
International Nuclear Information System (INIS)
Wang Guonian; Dai Shixun; Zhang Junjie; Xu Shiqing; Hu Lili; Jiang Zhonghong
2005-01-01
The effects of F - ions on physical and spectroscopic properties of the Yb 3+ in tellurite glass system are investigated. The results show that the glass system takes on good thermal stability with the content of ZnF 2 lower than 15 mol%, both the emission cross-section and the fluorescence lifetime of Yb 3+ ions increase evidently which indicate that such oxyfluoride tellurite glass system is a promising laser host matrix for high power generation. FT-IR spectra were used to analyze the effect of F- ions on the structure of tellurite glasses and OH - groups in this glass system. Analysis demonstrates that addition of fluoride decreases the symmetry of the structure of tellurite glasses which increases the emission cross-section and removes the OH - groups, and which improves the measured fluorescence lifetime of Yb 3+ ions
Binding and thermodynamics of REV peptide-ctDNA interaction.
Upadhyay, Santosh Kumar
2017-03-01
The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically
Muthuraj, V.; Umadevi, M.
2018-04-01
The present research article is related with the method of preparation, structure and spectroscopic properties of a series of carbothioamide ruthenium (II) complexes with N and S donor ligands namely, 2-((6-chloro-4-oxo-4H-chromen-3-yl)methylene) hydrazine carbothioamide (ClChrTs)/2-((6-methoxy-4-oxo-4H-chromen-3-yl)methylene)hydrazine carbothioamide (MeOChrTS). The synthesized complexes were characterized by several techniques using analytical methods as well as by spectral techniques such as FT-IR, 1HNMR, 13CNMR, ESI mass and thermogravimetry/differential thermal analysis (TG-DTA). The IR spectra shows that the ligand acts as a neutral bidentate with N and S donor atoms. The biological activity of the prepared compounds and metal complexes were tested against cell line of calf-thymus DNA via an intercalation mechanism (MCF-7). In addition, the interaction of Ru(II) complexes and its free ligands with CT-DNA were also investigated by titration with UV-Vis spectra, fluorescence spectra, and Circular dichroism studies. Results suggest that both of the two Ru(II) complexes can bind with calf-thymus DNA via an intercalation mechanism.
A novel method to obtain chitosan/DNA nanospheres and a study of their release properties
International Nuclear Information System (INIS)
Masotti, Andrea; Bordi, Federico; Ortaggi, Giancarlo; Marino, Federica; Palocci, Cleofe
2008-01-01
Polysaccharides and other cationic polymers have recently been used in pharmaceutical research and industry for their properties to control the release of antibiotics, DNA, proteins, peptide drugs or vaccines, and they have also been extensively studied as non-viral DNA carriers for gene delivery and therapy. Among them, chitosan is the most used since it can promote long-term release of incorporated drugs. This work is focused on the preparation of chitosan and chitosan/DNA nanospheres by using a novel and simple osmosis-based method, recently patented. The morphology of chitosan/DNA particles is spherical (as observed by scanning electron microscopy, SEM) and the nanospheres' average diameter is 38 ± 4 nm (obtained by dynamic light scattering, DLS). With this method, DNA is incorporated with high yield (up to 30%) and the release process is gradual and prolonged in time. The novelty of the reported method resides in the general applicability to various synthetic or natural biopolymers. Solvent, temperature and membrane cut-off are the physicochemical parameters that one is able to use to control the overall osmotic process, leading to several nanostructured systems with different size and shape that may be used in several biotechnological applications
A novel method to obtain chitosan/DNA nanospheres and a study of their release properties
Masotti, Andrea; Bordi, Federico; Ortaggi, Giancarlo; Marino, Federica; Palocci, Cleofe
2008-02-01
Polysaccharides and other cationic polymers have recently been used in pharmaceutical research and industry for their properties to control the release of antibiotics, DNA, proteins, peptide drugs or vaccines, and they have also been extensively studied as non-viral DNA carriers for gene delivery and therapy. Among them, chitosan is the most used since it can promote long-term release of incorporated drugs. This work is focused on the preparation of chitosan and chitosan/DNA nanospheres by using a novel and simple osmosis-based method, recently patented. The morphology of chitosan/DNA particles is spherical (as observed by scanning electron microscopy, SEM) and the nanospheres' average diameter is 38 ± 4 nm (obtained by dynamic light scattering, DLS). With this method, DNA is incorporated with high yield (up to 30%) and the release process is gradual and prolonged in time. The novelty of the reported method resides in the general applicability to various synthetic or natural biopolymers. Solvent, temperature and membrane cut-off are the physicochemical parameters that one is able to use to control the overall osmotic process, leading to several nanostructured systems with different size and shape that may be used in several biotechnological applications.
Chen, Xi; Xue, Long-Xin; Ju, Chun-Chuan; Wang, Ke-Zhi
2013-07-01
A novel Ru(II) complex of [Ru(bpy)2(Hbcpip)](ClO4)2 {where bpy = 2,2-bipyridine, Hbcpip = 2-(4-(9H-3,9'-bicarbazol-9-yl)phenyl)-1H-imidazo[4,5-f][1,10]phenanthroline} is synthesized and characterized. Calf-thymus DNA-binding properties of the complex were studied by UV-vis absorption and luminescence titrations, steady-state emission quenching by [Fe(CN)6]4-, DNA competitive binding with ethidium bromide, thermal denaturation and DNA viscosity measurements. The results indicate that the complex partially intercalated into the DNA with a binding constant of (5.5 ± 1.4) × 105 M-1 in buffered 50 mM NaCl. The acid-base properties of the complex were also studied by UV-visible and luminescence spectrophotometric pH titrations, and ground- and excited-state acidity ionization constant values were derived.
Lindahl, Tomas; Barnes, Deborah E; Yang, Yun-Gui; Robins, Peter
2009-06-01
The major DNA-specific 3'-5' exonuclease of mammalian cells is TREX1 (3' repair exonuclease 1; previously called DNase III). The human enzyme is encoded by a single exon and, like many 3' exonucleases, exists as a homodimer. TREX1 degrades ssDNA (single-stranded DNA) more efficiently than dsDNA (double-stranded DNA), and its catalytic properties are similar to those of Escherichia coli exonuclease X. However, TREX1 is only found in mammals and has an extended C-terminal domain containing a leucine-rich sequence required for its association with the endoplasmic reticulum. In normal S-phase and also in response to genotoxic stress, TREX1 at least partly redistributes to the cell nucleus. In a collaborative project, we have demonstrated TREX1 enzyme deficiency in Aicardi-Goutières syndrome. Subsequently, we have shown that AGS1 cells exhibit chronic ATM (ataxia telangiectasia mutated)-dependent checkpoint activation, and these TREX1-deficient cells accumulate ssDNA fragments of a distinct size generated during DNA replication. Other groups have shown that the syndromes of familial chilblain lupus as well as systemic lupus erythematosus, and the distinct neurovascular disorder retinal vasculopathy with cerebral leukodystrophy, can be caused by dominant mutations at different sites within the TREX1 gene.
Spectroscopic properties of the B meson
Directory of Open Access Journals (Sweden)
Devlani Nayneshkumar
2015-01-01
Full Text Available Investigation of the B(bq̄; q = u, d meson properties is carried out using variational method within phenomenological quark antiquark potential(coulomb plus power model using the Gaussian wave function. O(1/m correction to the potential energy term and relativistic corrections to the kinetic energy term of the hamiltonian are incorporated. Spin-orbit, spin-spin and tensor interactions are employed to obtain the mass spectra. Various other properties such as the decay constants, e1 and m1 transitions are also obtained
Charge transport properties of a twisted DNA molecule: A renormalization approach
Energy Technology Data Exchange (ETDEWEB)
Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2016-10-20
In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.
DNA complexes with Ni nanoparticles: structural and functional properties
Energy Technology Data Exchange (ETDEWEB)
Tatarinova, Olga N.; Smirnov, Igor P. [Research Institute for Physico-Chemical Medicine of the Federal Medical-Biological Agency of the Russian Federation (Russian Federation); Safenkova, Irina V. [A.N. Bach Institute of Biochemistry (Russian Federation); Varizhuk, Anna M.; Pozmogova, Galina E., E-mail: pozmge@gmail.com [Research Institute for Physico-Chemical Medicine of the Federal Medical-Biological Agency of the Russian Federation (Russian Federation)
2012-10-15
Supramolecular complexes of biopolymers based on magnetic nanoparticles play an important role in creation of biosensors, implementation of theragnostic and gene therapeutic methods and biosafety evaluation. We investigated the impact of DNA interactions with nanoparticles of nickel (nNi) on the integrity and functionality of DNA. Data obtained by mass spectrometry, electrophoresis, TEM and AFM microscopy techniques, bacterial transformation, and real-time PCR provide evidence that ssDNA and plasmid DNA (pDNA) efficiently form complexes with nNi. AFM data suggest that the complexes are necklace-type structures, in which nanoparticles are randomly distributed along the DNA chains, rather than highly entangled clot-type structures. After desorption, observed DNA characteristics in bioanalytical and biological systems remain unchanged. Only supercoiled pDNA was nicked, but remained, as well as a plasmid-nNi complex, active in expression vector assays. These results are very important for creation of new methods of DNA immobilization and controlled manipulation.
DNA complexes with Ni nanoparticles: structural and functional properties
International Nuclear Information System (INIS)
Tatarinova, Olga N.; Smirnov, Igor P.; Safenkova, Irina V.; Varizhuk, Anna M.; Pozmogova, Galina E.
2012-01-01
Supramolecular complexes of biopolymers based on magnetic nanoparticles play an important role in creation of biosensors, implementation of theragnostic and gene therapeutic methods and biosafety evaluation. We investigated the impact of DNA interactions with nanoparticles of nickel (nNi) on the integrity and functionality of DNA. Data obtained by mass spectrometry, electrophoresis, TEM and AFM microscopy techniques, bacterial transformation, and real-time PCR provide evidence that ssDNA and plasmid DNA (pDNA) efficiently form complexes with nNi. AFM data suggest that the complexes are necklace-type structures, in which nanoparticles are randomly distributed along the DNA chains, rather than highly entangled clot-type structures. After desorption, observed DNA characteristics in bioanalytical and biological systems remain unchanged. Only supercoiled pDNA was nicked, but remained, as well as a plasmid–nNi complex, active in expression vector assays. These results are very important for creation of new methods of DNA immobilization and controlled manipulation.
Spectroscopic studies of pulsed-power plasmas
International Nuclear Information System (INIS)
Maron, Y.; Arad, R.; Dadusc, G.; Davara, G.; Duvall, R.E.; Fisher, V.; Foord, M.E.; Fruchtman, A.; Gregorian, L.; Krasik, Ya.
1993-01-01
Recently developed spectroscopic diagnostic techniques are used to investigate the plasma behavior in a Magnetically Insulated Ion Diode, a Plasma Opening Switch, and a gas-puffed Z-pinch. Measurements with relatively high spectral, temporal, and spatial resolutions are performed. The particle velocity and density distributions within a few tens of microns from the dielectric-anode surface are observed using laser spectroscopy. Collective fluctuating electric fields in the plasma are inferred from anisotropic Stark broadening. For the Plasma Opening Switch experiment, a novel gaseous plasma source was developed which is mounted inside the high-voltage inner conductor. The properties of this source, together with spectroscopic observations of the electron density and particle velocities of the injected plasma, are described. Emission line intensities and spectral profiles give the electron kinetic energies during the switch operation and the ion velocity distributions. Secondary plasma ejection from the electrodes is also studied. In the Z-pinch experiment, spectral emission-line profiles are studied during the implosion phase. Doppler line shifts and widths yield the radial velocity distributions for various charge states in various regions of the plasma. Effects of plasma ejection from the cathode are also studied
The HITRAN 2004 molecular spectroscopic database
Energy Technology Data Exchange (ETDEWEB)
Rothman, L.S. [Harvard-Smithsonian Center for Astrophysics, Atomic and Molecular Physics Division, Cambridge, MA 02138 (United States)]. E-mail: lrothman@cfa.harvard.edu; Jacquemart, D. [Harvard-Smithsonian Center for Astrophysics, Atomic and Molecular Physics Division, Cambridge, MA 02138 (United States); Barbe, A. [Universite de Reims-Champagne-Ardenne, Groupe de Spectrometrie Moleculaire et Atmospherique, 51062 Reims (France)] (and others)
2005-12-01
This paper describes the status of the 2004 edition of the HITRAN molecular spectroscopic database. The HITRAN compilation consists of several components that serve as input for radiative transfer calculation codes: individual line parameters for the microwave through visible spectra of molecules in the gas phase; absorption cross-sections for molecules having dense spectral features, i.e., spectra in which the individual lines are unresolvable; individual line parameters and absorption cross-sections for bands in the ultra-violet; refractive indices of aerosols; tables and files of general properties associated with the database; and database management software. The line-by-line portion of the database contains spectroscopic parameters for 39 molecules including many of their isotopologues. The format of the section of the database on individual line parameters of HITRAN has undergone the most extensive enhancement in almost two decades. It now lists the Einstein A-coefficients, statistical weights of the upper and lower levels of the transitions, a better system for the representation of quantum identifications, and enhanced referencing and uncertainty codes. In addition, there is a provision for making corrections to the broadening of line transitions due to line mixing.
The HITRAN 2004 molecular spectroscopic database
International Nuclear Information System (INIS)
Rothman, L.S.; Jacquemart, D.; Barbe, A.
2005-01-01
This paper describes the status of the 2004 edition of the HITRAN molecular spectroscopic database. The HITRAN compilation consists of several components that serve as input for radiative transfer calculation codes: individual line parameters for the microwave through visible spectra of molecules in the gas phase; absorption cross-sections for molecules having dense spectral features, i.e., spectra in which the individual lines are unresolvable; individual line parameters and absorption cross-sections for bands in the ultra-violet; refractive indices of aerosols; tables and files of general properties associated with the database; and database management software. The line-by-line portion of the database contains spectroscopic parameters for 39 molecules including many of their isotopologues. The format of the section of the database on individual line parameters of HITRAN has undergone the most extensive enhancement in almost two decades. It now lists the Einstein A-coefficients, statistical weights of the upper and lower levels of the transitions, a better system for the representation of quantum identifications, and enhanced referencing and uncertainty codes. In addition, there is a provision for making corrections to the broadening of line transitions due to line mixing
International Nuclear Information System (INIS)
Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman; Sujatha, Venugopal; Thirunavukkarasu, Chinnasamy
2017-01-01
Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern–Volmer quenching constant (K SV ) were found to be 7.02 × 10 6 Mˉ 1 (ethidium bromide), 4.22 × 10 6 Mˉ 1 (acridine orange) and 7.6 × 10 6 Mˉ 1 (Hoechst) indicating strong binding of SeNPs with CT–DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. - Graphical abstract: Highly stable, innocuous, biocompatible SeNPs nanoparticle has been synthesized using Allium sativum (garlic) extract as reductant. The purity and crystallinity were characterized, further divulge the base pare interaction with Calf –Thymus DNA through various spectroscopic methods and atomic force microscopy. Display Omitted - Highlights: • Synthesis of SeNPs in aqueous extract of Allium sativum. • Characterization of synthesized SeNPs using high throughput techniques. • SeNPs directly interact with CT-DNA through intercalation and groove binding.
Energy Technology Data Exchange (ETDEWEB)
Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605 014 (India); Sujatha, Venugopal [Department of Chemistry, Periyar University, Salem 636011 (India); Thirunavukkarasu, Chinnasamy, E-mail: tchinnasamy@hotmail.com [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605 014 (India)
2017-05-01
Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern–Volmer quenching constant (K{sub SV}) were found to be 7.02 × 10{sup 6} Mˉ{sup 1} (ethidium bromide), 4.22 × 10{sup 6} Mˉ{sup 1} (acridine orange) and 7.6 × 10{sup 6} Mˉ{sup 1} (Hoechst) indicating strong binding of SeNPs with CT–DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. - Graphical abstract: Highly stable, innocuous, biocompatible SeNPs nanoparticle has been synthesized using Allium sativum (garlic) extract as reductant. The purity and crystallinity were characterized, further divulge the base pare interaction with Calf –Thymus DNA through various spectroscopic methods and atomic force microscopy. Display Omitted - Highlights: • Synthesis of SeNPs in aqueous extract of Allium sativum. • Characterization of synthesized SeNPs using high throughput techniques. • SeNPs directly interact with CT-DNA through intercalation and groove binding.
DNA dosimetry applied to problems in genetic toxicology
International Nuclear Information System (INIS)
Rahn, R.O.; Sellin, H.
1984-01-01
Studies have been conducted using uv, metal ions, and polyaromatic hydrocarbons as DNA damaging agents. A method has been devised for removing Pt-base adducts from DNA and for separating these adducts chromatographically. This method has been applied to DNA isolated from tissue culture cells treated with cisplatin. The results indicate that a significant (approx. 35%) portion of the cisplatin binds in a form which is the same as that found in DNA treated in vitro. This adduct consists of two guanine molecules connected by a platinum atom. A very useful tool in photobiological research has been the substitution of BrdUrd for Thd in DNA. Following radiation, debromination and damage to the sugar phosphate backbone results. However, the actual chemical event responsible for the observed enhanced cell killing is not known. Attempts to answer this question have employed the use of IdUrd instead of BrdUrd, because of certain spectroscopic and chemical advantages. Current research deals with the mechanisms by which the uracil radical formed upon dehalogenation reacts with its environment to pick up a hydrogen atom and form uracil
Mallajosyula, Sairam S; Pati, Swapan K
2007-10-11
Protonation of DNA basepairs is a reversible phenomenon that can be controlled by tuning the pH of the system. Under mild acidic conditions, the hydrogen-bonding pattern of the DNA basepairs undergoes a change. We study the effect of protonation on the electronic properties of the DNA basepairs to probe for possible molecular electronics applications. We find that, under mild acidic pH conditions, the A:T basepair shows excellent rectification behavior that is, however, absent in the G:C basepair. The mechanism of rectification has been discussed using a simple chemical potential model. We also consider the noncanonical A:A basepair and find that it can be used as efficient pH dependent molecular switch. The switching action in the A:A basepair is explained in the light of pi-pi interactions, which lead to efficient delocalization over the entire basepair.
International Nuclear Information System (INIS)
Gomathi, G.; Gopalakrishnan, R.
2016-01-01
Hydrazone Schiff bases have been widely explored for their antimicrobial, anticancer, anticonvulsant properties. The aim of the present work is to investigate the spectroscopic, electrochemical, thermal properties, in vitro study of antimicrobial activity and molecular docking studies of the MBHC compound. Slow evaporation solution growth technique was used to grow the single crystal of the MBHC compound. Single crystal X-ray diffraction, FTIR and FT-Raman spectroscopic studies are performed and confirmed the grown MBHC compound. UV–Vis spectroscopy and electrochemical studies deduced the absorption region and HOMO-LUMO band gap value of the compound. Resazurin reduction assay method was utilized to perform antibacterial and antifungal studies which resulted in lesser effectiveness of the MBHC compound compared to the erythromycin and fluconazole tablets. Molecular docking of the MBHC compound with the DNA gyrase protein exhibited the good binding affinity with energy of − 43.196 kcal/mol and docking score of − 6.266 and having good interaction with aminoacids – ASP81 and ARG84. - Highlights: • MBHC single crystal was grown by employing slow evaporation solution growth technique. • The compound crystallizes in monoclinic crystal system with space group P2_1/c. • The HOMO-LUMO band gap value was found to be 1.96 eV. • The compound has lesser antimicrobial activity when compared to erythromycin and fluconazole. • MBHC shows better binding affinity towards DNA gyrase protein.
International Nuclear Information System (INIS)
Lim, Jong Kuk; Jo, Jihee; Jang, Dasol; Jang, Hyeong Ju
2015-01-01
Isoalloxazine derivatives (flavins) are commonly found in natural systems that are involved in an electron transfer process, such as photosynthetic or metabolic systems, and are also frequently used as electron donors in organic-based electronic devices. As an example, molecular photodiodes composed of 7,8-dimethyl-10-dodecyl isoalloxazine (DDI) have been fabricated by the Langmuir–Blodgett (LB) technique, and such devices showed characteristic properties of photodiodes. The efficiency of molecular photodiodes is dependent on the assembled structure of the LB films, which is related to the morphology of the LB films. For that reason, Lim has investigated the morphology of LB films, and found that rod-shaped domains are formed when a DDI monolayer is transferred to a solid substrate above a specific surface pressure (Thin Solid Films, 531 (2013) 499). In that paper, rod-shaped domains were revealed to be collapsed triple layers, i.e., double layers collapsed on the monolayer; however, the detailed aggregation structure of the constituent molecules (DDI) has not been studied. Herein, we investigate the microscopic and spectroscopic properties of LB films composed of DDI. We apply the extended dipole model to explain spectral changes in the absorption spectra and propose an aggregation structure for DDI in the LB films. - Highlights: • Aggregation structure of DDI in LB films was experimentally investigated. • Theoretical estimation is in good agreement with experimental result. • Molecular aggregation structure for DDI in LB films was proposed. • Molecular configuration in LB films is changed from side-by-side to face-to-face.
THE APOKASC CATALOG: AN ASTEROSEISMIC AND SPECTROSCOPIC JOINT SURVEY OF TARGETS IN THE KEPLER FIELDS
Energy Technology Data Exchange (ETDEWEB)
Pinsonneault, Marc H.; Epstein, Courtney; Johnson, Jennifer A. [Department of Astronomy, The Ohio State University, Columbus, OH 43210 (United States); Elsworth, Yvonne; Chaplin, William J. [University of Birmingham, School of Physics and Astronomy, Edgbaston, Birmingham B15 2TT (United Kingdom); Hekker, Saskia; Silva Aguirre, Victor; Stello, Dennis [Stellar Astrophysics Centre, Department of Physics and Astronomy, Aarhus University, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Mészáros, Sz. [Astronomy Department, Indiana University, Bloomington, IN 47405 (United States); García, Rafael A.; Beck, Paul [Laboratoire AIM, CEA/DSM-CNRS—Université Denis Diderot-IRFU/SAp, F-91191 Gif-sur-Yvette Cedex (France); Holtzman, Jon [Department of Astronomy, MSC 4500, New Mexico State University, P.O. Box 30001, Las Cruces, NM 88003 (United States); Mathur, Savita [Space Science Institute, 4750 Walnut street, Suite 205, Boulder, CO 80301 (United States); García Pérez, Ana [Department of Astronomy, University of Virginia, P.O. Box 400325, Charlottesville, VA 22904-4325 (United States); Girardi, Léo [Osservatorio Astronomico di Padova—INAF, Vicolo dell' Osservatorio 5, I-35122 Padova (Italy); Basu, Sarbani [Department of Astronomy, Yale University, P.O. Box 208101, New Haven, CT 06520-8101 (United States); Shetrone, Matthew [University of Texas at Austin, McDonald Observatory, 32 Fowlkes Road, TX 79734-3005 (United States); Allende Prieto, Carlos [Instituto de Astrofsica de Canarias (IAC), C/Va Lactea, s/n, E-38200 La Laguna, Tenerife (Spain); An, Deokkeun [Department of Science Education, Ewha Womans University, Seoul (Korea, Republic of); Beers, Timothy C., E-mail: pinsonneault.1@osu.edu [Department of Physics, University of Notre Dame, 225 Nieuwland Science Hall, Notre Dame, IN 46656 (United States); and others
2015-01-01
We present the first APOKASC catalog of spectroscopic and asteroseismic properties of 1916 red giants observed in the Kepler fields. The spectroscopic parameters provided from the Apache Point Observatory Galactic Evolution Experiment project are complemented with asteroseismic surface gravities, masses, radii, and mean densities determined by members of the Kepler Asteroseismology Science Consortium. We assess both random and systematic sources of error and include a discussion of sample selection for giants in the Kepler fields. Total uncertainties in the main catalog properties are of the order of 80 K in T {sub eff}, 0.06 dex in [M/H], 0.014 dex in log g, and 12% and 5% in mass and radius, respectively; these reflect a combination of systematic and random errors. Asteroseismic surface gravities are substantially more precise and accurate than spectroscopic ones, and we find good agreement between their mean values and the calibrated spectroscopic surface gravities. There are, however, systematic underlying trends with T {sub eff} and log g. Our effective temperature scale is between 0 and 200 K cooler than that expected from the infrared flux method, depending on the adopted extinction map, which provides evidence for a lower value on average than that inferred for the Kepler Input Catalog (KIC). We find a reasonable correspondence between the photometric KIC and spectroscopic APOKASC metallicity scales, with increased dispersion in KIC metallicities as the absolute metal abundance decreases, and offsets in T {sub eff} and log g consistent with those derived in the literature. We present mean fitting relations between APOKASC and KIC observables and discuss future prospects, strengths, and limitations of the catalog data.
Replicating animal mitochondrial DNA
Directory of Open Access Journals (Sweden)
Emily A. McKinney
2013-01-01
Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.
Geng, Jiafeng; Aioub, Mena; El-Sayed, Mostafa A; Barry, Bridgette A
2017-09-28
Ultraviolet resonance Raman (UVRR) spectroscopy is a label-free method to define biomacromolecular interactions with anticancer compounds. Using UVRR, we describe the binding interactions of two Pt(II) compounds, cisplatin (cis-diamminedichloroplatinum(II)) and its isomer, transplatin, with nucleotides and genomic DNA. Cisplatin binds to DNA and other cellular components and triggers apoptosis, whereas transplatin is clinically ineffective. Here, a 244 nm UVRR study shows that purine UVRR bands are altered in frequency and intensity when mononucleotides are treated with cisplatin. This result is consistent with previous suggestions that purine N7 provides the cisplatin-binding site. The addition of cisplatin to DNA also causes changes in the UVRR spectrum, consistent with binding of platinum to purine N7 and disruption of hydrogen-bonding interactions between base pairs. Equally important is that transplatin treatment of DNA generates similar UVRR spectral changes, when compared to cisplatin-treated samples. Kinetic analysis, performed by monitoring decreases of the 1492 cm -1 band, reveals biphasic kinetics and is consistent with a two-step binding mechanism for both platinum compounds. For cisplatin-DNA, the rate constants (6.8 × 10 -5 and 6.5 × 10 -6 s -1 ) are assigned to the formation of monofunctional adducts and to bifunctional, intrastrand cross-linking, respectively. In transplatin-DNA, there is a 3.4-fold decrease in the rate constant of the slow phase, compared with the cisplatin samples. This change is attributed to generation of interstrand, rather than intrastrand, adducts. This longer reaction time may result in increased competition in the cellular environment and account, at least in part, for the lower pharmacological efficacy of transplatin.
DNA based radiological dosimetry technology
International Nuclear Information System (INIS)
Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin
2008-01-01
Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)
Energy Technology Data Exchange (ETDEWEB)
Gomathi, G.; Gopalakrishnan, R., E-mail: krgkrishnan@annauniv.edu
2016-07-01
Hydrazone Schiff bases have been widely explored for their antimicrobial, anticancer, anticonvulsant properties. The aim of the present work is to investigate the spectroscopic, electrochemical, thermal properties, in vitro study of antimicrobial activity and molecular docking studies of the MBHC compound. Slow evaporation solution growth technique was used to grow the single crystal of the MBHC compound. Single crystal X-ray diffraction, FTIR and FT-Raman spectroscopic studies are performed and confirmed the grown MBHC compound. UV–Vis spectroscopy and electrochemical studies deduced the absorption region and HOMO-LUMO band gap value of the compound. Resazurin reduction assay method was utilized to perform antibacterial and antifungal studies which resulted in lesser effectiveness of the MBHC compound compared to the erythromycin and fluconazole tablets. Molecular docking of the MBHC compound with the DNA gyrase protein exhibited the good binding affinity with energy of − 43.196 kcal/mol and docking score of − 6.266 and having good interaction with aminoacids – ASP81 and ARG84. - Highlights: • MBHC single crystal was grown by employing slow evaporation solution growth technique. • The compound crystallizes in monoclinic crystal system with space group P2{sub 1}/c. • The HOMO-LUMO band gap value was found to be 1.96 eV. • The compound has lesser antimicrobial activity when compared to erythromycin and fluconazole. • MBHC shows better binding affinity towards DNA gyrase protein.
Redondo, Pilar; Largo, Antonio; Vega-Vega, Álvaro; Barrientos, Carmen
2015-05-01
The structure and spectroscopic parameters of the most relevant [C,H,N,Zn] isomers have been studied employing high-level quantum chemical methods. For each isomer, we provide predictions for their molecular structure, thermodynamic stabilities as well as vibrational and rotational spectroscopic parameters which could eventually help in their experimental detection. In addition, we have carried out a detailed study of the bonding situations by means of a topological analysis of the electron density in the framework of the Bader's quantum theory of atoms in molecules. The analysis of the relative stabilities and spectroscopic parameters suggests two linear isomers of the neutral [C,H,N,Zn] composition, namely, cyanidehydridezinc HZnCN (1Σ) and hydrideisocyanidezinc HZnNC (1Σ), as possible candidates for experimental detections. For the cationic [C,H,N,Zn]+ composition, the most stable isomers are the ion-molecule complexes arising from the direct interaction of the zinc cation with either the nitrogen or carbon atom of either hydrogen cyanide or hydrogen isocyanide, namely, HCNZn+ (2Σ) and HCNZn+ (2Σ).
International Nuclear Information System (INIS)
Redondo, Pilar; Largo, Antonio; Vega-Vega, Álvaro; Barrientos, Carmen
2015-01-01
The structure and spectroscopic parameters of the most relevant [C,H,N,Zn] isomers have been studied employing high-level quantum chemical methods. For each isomer, we provide predictions for their molecular structure, thermodynamic stabilities as well as vibrational and rotational spectroscopic parameters which could eventually help in their experimental detection. In addition, we have carried out a detailed study of the bonding situations by means of a topological analysis of the electron density in the framework of the Bader’s quantum theory of atoms in molecules. The analysis of the relative stabilities and spectroscopic parameters suggests two linear isomers of the neutral [C,H,N,Zn] composition, namely, cyanidehydridezinc HZnCN ( 1 Σ) and hydrideisocyanidezinc HZnNC ( 1 Σ), as possible candidates for experimental detections. For the cationic [C,H,N,Zn] + composition, the most stable isomers are the ion-molecule complexes arising from the direct interaction of the zinc cation with either the nitrogen or carbon atom of either hydrogen cyanide or hydrogen isocyanide, namely, HCNZn + ( 2 Σ) and HCNZn + ( 2 Σ)
Energy Technology Data Exchange (ETDEWEB)
Redondo, Pilar; Largo, Antonio; Vega-Vega, Álvaro; Barrientos, Carmen, E-mail: cbb@qf.uva.es [Departamento de Química Física y Química Inorgánica, Facultad de Ciencias, Universidad de Valladolid, 47011 Valladolid (Spain)
2015-05-14
The structure and spectroscopic parameters of the most relevant [C,H,N,Zn] isomers have been studied employing high-level quantum chemical methods. For each isomer, we provide predictions for their molecular structure, thermodynamic stabilities as well as vibrational and rotational spectroscopic parameters which could eventually help in their experimental detection. In addition, we have carried out a detailed study of the bonding situations by means of a topological analysis of the electron density in the framework of the Bader’s quantum theory of atoms in molecules. The analysis of the relative stabilities and spectroscopic parameters suggests two linear isomers of the neutral [C,H,N,Zn] composition, namely, cyanidehydridezinc HZnCN ({sup 1}Σ) and hydrideisocyanidezinc HZnNC ({sup 1}Σ), as possible candidates for experimental detections. For the cationic [C,H,N,Zn]{sup +} composition, the most stable isomers are the ion-molecule complexes arising from the direct interaction of the zinc cation with either the nitrogen or carbon atom of either hydrogen cyanide or hydrogen isocyanide, namely, HCNZn{sup +} ({sup 2}Σ) and HCNZn{sup +} ({sup 2}Σ)
A Green Solvent Induced DNA Package
Satpathi, Sagar; Sengupta, Abhigyan; Hridya, V. M.; Gavvala, Krishna; Koninti, Raj Kumar; Roy, Bibhisan; Hazra, Partha
2015-03-01
Mechanistic details of DNA compaction is essential blue print for gene regulation in living organisms. Many in vitro studies have been implemented using several compaction agents. However, these compacting agents may have some kinds of cytotoxic effects to the cells. To minimize this aspect, several research works had been performed, but people have never focused green solvent, i.e. room temperature ionic liquid as DNA compaction agent. To the best of our knowledge, this is the first ever report where we have shown that guanidinium tris(pentafluoroethyl)trifluorophosphate (Gua-IL) acts as a DNA compacting agent. The compaction ability of Gua-IL has been verified by different spectroscopic techniques, like steady state emission, circular dichroism, dynamic light scattering and UV melting. Notably, we have extensively probed this compaction by Gua-IL through field emission scanning electron microscopy (FE-SEM) and fluorescence microscopy images. We also have discussed the plausible compaction mechanism process of DNA by Gua-IL. Our results suggest that Gua-IL forms a micellar kind of self aggregation above a certain concentration (>=1 mM), which instigates this compaction process. This study divulges the specific details of DNA compaction mechanism by a new class of compaction agent, which is highly biodegradable and eco friendly in nature.
Karami, Kazem; Rafiee, Mina; Lighvan, Zohreh Mehri; Zakariazadeh, Mostafa; Faal, Ali Yeganeh; Esmaeili, Seyed-Alireza; Momtazi-Borojeni, Amir Abbas
2018-02-01
[Pd{(C,N)sbnd C6H4CH (CH3)NH}(CUR)] (3) and [Pd2{(C,N)sbnd C6H4CH(CH3)NH2}2(μ-N3CS2)] (4) [cur = 1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dion] novel organometallic complexes with biologically active ligands have been prepared and characterized via elemental analysis, multinuclear spectroscopic techniques (1H, and 13C NMR and IR) and their biological activities, including antitumoral activity and DNA-protein interactions have been investigated. Fluorescence spectroscopy used to study the interaction of the complexes with BSA have shown the affinity of the complexes for these proteins with relatively high binding constant values and the changed secondary structure of BSA in the presence of the complexes. In the meantime, spectroscopy and competitive titration have been applied to investigate the interaction of complexes with Warfarin and Ibuprofen site markers for sites I and II, respectively, with BSA. The results have suggested that the locations of complexes 3 and 4 are sites II and I, respectively. UV-Vis spectroscopy, emission titration and helix melting methods have been used to study the interaction of these complexes with CT-DNA, indicating that complexes are bound to CT-DNA by intercalation binding mode. In addition, good cytotoxic activity against MCF-7 (human breast cancer) and JURKAT (human leukemia) cell line has been shown by both complexes whereas low cytotoxicity was exerted on normal peripheral blood mononuclear cells.
DNA-Based Applications in Nanobiotechnology
Directory of Open Access Journals (Sweden)
Khalid M. Abu-Salah
2010-01-01
Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.
Energy Technology Data Exchange (ETDEWEB)
B Akabayov; C Richardson
2011-12-31
Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstrate that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.
Kratochvílová, Irena; Vala, Martin; Weiter, Martin; Špérová, Miroslava; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír
2013-01-01
Oligonucleotides conduct electric charge via various mechanisms and their characterization and understanding is a very important and complicated task. In this work, experimental (temperature dependent steady state fluorescence spectroscopy, time-resolved fluorescence spectroscopy) and theoretical (Density Functional Theory) approaches were combined to study charge transfer processes in short DNA/DNA and RNA/DNA duplexes with virtually equivalent sequences. The experimental results were consistent with the theoretical model - the delocalized nature of HOMO orbitals and holes, base stacking, electronic coupling and conformational flexibility formed the conditions for more effective short distance charge transfer processes in RNA/DNA hybrids. RNA/DNA and DNA/DNA charge transfer properties were strongly connected with temperature affected structural changes of molecular systems - charge transfer could be used as a probe of even tiny changes of molecular structures and settings. © 2013. Published by Elsevier B.V. All rights reserved.
Nabok, Alexei; Tsargorodskaya, Anna; Davis, Frank; Higson, Séamus P J
2007-10-31
The adsorption of genomic DNA and subsequent interactions between adsorbed and solvated DNA was studied using a novel sensitive optical method of total internal reflection ellipsometry (TIRE), which combines spectroscopic ellipsometry with surface plasmon resonance (SPR). Single strands of DNA of two species of fish (herring and salmon) were electrostatically adsorbed on top of polyethylenimine films deposited upon gold coated glass slides. The ellipsometric spectra were recorded and data fitting utilized to extract optical parameters (thickness and refractive index) of adsorbed DNA layers. The further adsorption of single stranded DNA from an identical source, i.e. herring ss-DNA on herring ss-DNA or salmon ss-DNA on salmon ss-DNA, on the surface was observed to give rise to substantial film thickness increases at the surface of about 20-21 nm. Conversely adsorption of DNA from alternate species, i.e. salmon ss-DNA on herring ss-DNA or herring ss-DNA on salmon ss-DNA, yielded much smaller changes in thickness of 3-5 nm. AFM studies of the surface roughness of adsorbed layers were in line with the TIRE data.
Spectroscopic classification of transients
DEFF Research Database (Denmark)
Stritzinger, M. D.; Fraser, M.; Hummelmose, N. N.
2017-01-01
We report the spectroscopic classification of several transients based on observations taken with the Nordic Optical Telescope (NOT) equipped with ALFOSC, over the nights 23-25 August 2017.......We report the spectroscopic classification of several transients based on observations taken with the Nordic Optical Telescope (NOT) equipped with ALFOSC, over the nights 23-25 August 2017....
The dynamic interplay between DNA topoisomerases and DNA topology.
Seol, Yeonee; Neuman, Keir C
2016-11-01
Topological properties of DNA influence its structure and biochemical interactions. Within the cell, DNA topology is constantly in flux. Transcription and other essential processes, including DNA replication and repair, not only alter the topology of the genome but also introduce additional complications associated with DNA knotting and catenation. These topological perturbations are counteracted by the action of topoisomerases, a specialized class of highly conserved and essential enzymes that actively regulate the topological state of the genome. This dynamic interplay among DNA topology, DNA processing enzymes, and DNA topoisomerases is a pervasive factor that influences DNA metabolism in vivo. Building on the extensive structural and biochemical characterization over the past four decades that has established the fundamental mechanistic basis of topoisomerase activity, scientists have begun to explore the unique roles played by DNA topology in modulating and influencing the activity of topoisomerases. In this review we survey established and emerging DNA topology-dependent protein-DNA interactions with a focus on in vitro measurements of the dynamic interplay between DNA topology and topoisomerase activity.
Spectroscopic Study of the Binding of Netropsin and Hoechst 33258 to Nucleic Acids
Vardevanyan, P. O.; Parsadanyan, M. A.; Antonyan, A. P.; Sahakyan, V. G.
2018-05-01
The interaction of groove binding compounds — peptide antibiotic (polyamide) netropsin and fluorescent dye (bisbenzimidazole) Hoechst 33258 — with the double-stranded DNA and synthetic double-stranded polynucleotide poly(rA)-poly(rU) has been studied by spectrophotometry. Absorption spectra of these ligand complexes with nucleic acids have been obtained. Spectral changes at the complexation of individual ligands with the mentioned nucleic acids reveal the similarity of binding of each of these ligands with both DNA and RNA. Based on the spectroscopic measurements, the binding parameters of netropsin and Hoechst 33258 binding to DNA and poly(rA)-poly(rU) - K and n, as well as the thermodynamic parameters ΔS, ΔG, and ΔH have been determined. It was found that the binding of Hoechst 33258 to both nucleic acids is accompanied by a positive change in enthalpy, while in the case of netropsin the change in enthalpy is negative. Moreover, the contribution of entropy to the formation of the complexes is more pronounced in the case of Hoechst 33258.
Shahabadi, Nahid; Falsafi, Monireh
The toxic interaction of adefovir dipivoxil with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove binding mode. The binding constant of UV-visible and the number of binding sites were 3.33 ± 0.2 × 104 L mol-1and 0.99, respectively. The fluorimetric studies showed that the reaction between the drug and CT-DNA is exothermic (ΔH = 34.4 kJ mol-1; ΔS = 184.32 J mol-1 K-1). Circular dichroism spectroscopy (CD) was employed to measure the conformational change of CT-DNA in the presence of adefovir dipivoxil, which verified the groove binding mode. Furthermore, the drug induces detectable changes in its viscosity. The molecular modeling results illustrated that adefovir strongly binds to groove of DNA by relative binding energy of docked structure -16.83 kJ mol-1. This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the toxic interaction of small molecular pollutants and drugs with bio macromolecules, which contributes to clarify the molecular mechanism of toxicity or side effect in vivo.
Edengeiser, Eugen; Lackmann, Jan-Wilm; Bründermann, Erik; Schneider, Simon; Benedikt, Jan; Bandow, Julia E; Havenith, Martina
2015-11-01
Cold atmospheric-pressure plasmas have become of increasing importance in sterilization processes especially with the growing prevalence of multi-resistant bacteria. Albeit the potential for technological application is obvious, much less is known about the molecular mechanisms underlying bacterial inactivation. X-jet technology separates plasma-generated reactive particles and photons, thus allowing the investigation of their individual and joint effects on DNA. Raman spectroscopy shows that particles and photons cause different modifications in DNA single and double strands. The treatment with the combination of particles and photons does not only result in cumulative, but in synergistic effects. Profilometry confirms that etching is a minor contributor to the observed DNA damage in vitro. Schematics of DNA oligomer treatment with cold atmospheric-pressure plasma. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs.
Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam
2017-11-02
In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.
Cao, Maoqing; Hu, Zewang; Ivanov, Maxim; Dai, Jiawei; Li, Chaoyu; Kou, Huamin; Shi, Yun; Chen, Haohong; Xu, Jiayue; Pan, Yubai; Li, Jiang
2018-02-01
In this paper, (Lu1-xGdx)2O3:Eu (x = 0, 0.1, 0.3, 0.5, 0.7, 0.9) ceramics were consolidated by the solid-state reaction method combined with vacuum sintering without sintering aids. We investigated the effect of the varying contents of Gd2O3 on the structure and spectroscopic properties of (Lu1-xGdx)2O3:Eu ceramics. X-ray diffraction (XRD) patterns indicate that proper amount of Gd2O3 can incorporate well with Lu2O3 and form Lu2O3-Gd2O3 solid solution. However, excessive Gd3+-doping in Lu2O3 will lead to the cubic phase transforming into monoclinic even hexagonal phase. The Gd3+ substitution no more than 50% of Lu2O3 enhances the radioluminescence, and reduces the fluorescence lifetime. Transmittance, photoluminescence, and radiation damage of the (Lu1-xGdx)2O3:Eu scintillation ceramics were also studied.
Directory of Open Access Journals (Sweden)
M.V. Sasi kumar
2017-07-01
Full Text Available This paper offers a study on Pr3+-doped alkali and mixed-alkali borate glasses prepared by the melt quenching technique and characterized by thermal, structural and spectroscopic studies. The amorphous nature of the glassy systems was identified based on X-ray diffraction. The thermal behaviour of glasses was studied using differential thermal analysis (DTA. The functional groups contained in the glasses were identified by Fourier transform infrared spectroscopy (FTIR. Spectral intensities were evaluated from the absorption spectra and used for calculating J–O intensity parameters, Ωλ (λ = 2, 4 and 6. Further, these parameters were used for calculating different radiative properties. The best radiative state was identified as the laser transition state among the various states. Emission analysis was performed for this state by calculating the branching ratios and stimulated emission cross sections (σp for all the prepared glasses. These studies suggest that borate glasses are useful for visible fluorescence.
Directory of Open Access Journals (Sweden)
Poomalai Jayaseelan
2016-09-01
Full Text Available A novel Schiff base ligand has been prepared by the condensation between butanedione monoxime with 3,3′-diaminobenzidine. The ligand and metal complexes have been characterized by elemental analysis, UV, IR, 1H NMR, conductivity measurements, EPR and magnetic studies. The molar conductance studies of Cu(II, Ni(II, Co(II and Mn(II complexes showed non-electrolyte in nature. The ligand acts as dibasic with two N4-tetradentate sites and can coordinate with two metal ions to form binuclear complexes. The spectroscopic data of metal complexes indicated that the metal ions are complexed with azomethine nitrogen and oxyimino nitrogen atoms. The binuclear metal complexes exhibit octahedral arrangements. DNA binding properties of copper(II metal complex have been investigated by electronic absorption spectroscopy. Results suggest that the copper(II complex bind to DNA via an intercalation binding mode. The nucleolytic cleavage activities of the ligand and their complexes were assayed on CT-DNA using gel electrophoresis in the presence and absence of H2O2. The ligand showed increased nuclease activity when administered as copper complex and copper(II complex behave as efficient chemical nucleases with hydrogen peroxide activation. The anti-microbial activities and thermal studies have also been studied. In anti-microbial activity all complexes showed good anti-microbial activity higher than ligand against gram positive, gram negative bacteria and fungi.
Supercoil Formation During DNA Melting
Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan
2009-03-01
Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.
Resonance Enhanced Multi-photon Spectroscopy of DNA
Ligare, Marshall Robert
For over 50 years DNA has been studied to better understand its connection to life and evolution. These past experiments have led to our understanding of its structure and function in the biological environment but the interaction of DNA with UV radiation at the molecular level is still not very well understood. Unique mechanisms in nucleobase chromaphores protect us from adverse chemical reactions after UV absorption. Studying these processes can help develop theories for prebiotic chemistry and the possibility of alternative forms of DNA. Using resonance enhanced multi-photon spectroscopic techniques in the gas phase allow for the structure and dynamics of individual nucleobases to be studied in detail. Experiments studying different levels of structure/complexity with relation to their biological function are presented. Resonant IR multiphoton dissociation spectroscopy in conjunction with molecular mechanics and DFT calculations are used to determine gas phase structures of anionic nucleotide clusters. A comparison of the identified structures with known biological function shows how the hydrogen bonding of the nucleotides and their clusters free of solvent create favorable structures for quick incorporation into enzymes such as DNA polymerase. Resonance enhanced multi-photon ionization (REMPI) spectroscopy techniques such as resonant two photon ionization (R2PI) and IR-UV double resonance are used to further elucidate the structure and excited state dynamics of the bare nucleobases thymine and uracil. Both exhibit long lived excited electronic states that have been implicated in DNA photolesions which can ultimately lead to melanoma and carcinoma. Our experimental data in comparison with many quantum chemical calculations suggest a new picture for the dynamics of thymine and uracil in the gas phase. A high probability of UV absorption from a vibrationally hot ground state to the excited electronic state shows that the stability of thymine and uracil comes from
Multiscale modelling of DNA mechanics
International Nuclear Information System (INIS)
Dršata, Tomáš; Lankaš, Filip
2015-01-01
Mechanical properties of DNA are important not only in a wide range of biological processes but also in the emerging field of DNA nanotechnology. We review some of the recent developments in modeling these properties, emphasizing the multiscale nature of the problem. Modern atomic resolution, explicit solvent molecular dynamics simulations have contributed to our understanding of DNA fine structure and conformational polymorphism. These simulations may serve as data sources to parameterize rigid base models which themselves have undergone major development. A consistent buildup of larger entities involving multiple rigid bases enables us to describe DNA at more global scales. Free energy methods to impose large strains on DNA, as well as bead models and other approaches, are also briefly discussed. (topical review)
Rizvi, Masood Ahmad; Zaki, Mehvash; Afzal, Mohd; Mane, Manoj; Kumar, Manjeet; Shah, Bhahwal Ali; Srivastav, Saurabh; Srikrishna, Saripella; Peerzada, Ghulam Mustafa; Tabassum, Sartaj
2015-01-27
New pharmacophore organoselenium compound (1) was designed, synthesized and characterized by various spectroscopic methods (IR, ESI-MS, (1)H, (13)C and (77)Se NMR) and further confirmed by X-ray crystallography. Compound 1 consists of two 3,5-bis(trifluoromethyl)phenyl units which are connected to the selenium atom via the organometallic C-Se bond. In vitro DNA binding studies of 1 was investigated by absorption and emission titration methods which revealed that 1 recognizes the minor groove of DNA in accordance with molecular docking studies with the DNA duplex. Gel electrophoretic assay demonstrates the ability of 1 to cleave pBR322 DNA through hydrolytic process which was further validated by T4 religation assay. To understand the drug-protein interaction of which ultimate molecular target was DNA, the affinity of 1 towards HSA was also investigated by the spectroscopic and molecular modeling techniques which showed hydrophobic interaction in the subdomain IIA of HSA. Furthermore, the intracellular localization of 1 was evidenced by cell imaging studies using HeLa cells. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Sicoli, Giuseppe; Mathis, Gérald; Aci-Sèche, Samia; Saint-Pierre, Christine; Boulard, Yves; Gasparutto, Didier; Gambarelli, Serge
2009-06-01
Double electron-electron resonance (DEER) was applied to determine nanometre spin-spin distances on DNA duplexes that contain selected structural alterations. The present approach to evaluate the structural features of DNA damages is thus related to the interspin distance changes, as well as to the flexibility of the overall structure deduced from the distance distribution. A set of site-directed nitroxide-labelled double-stranded DNA fragments containing defined lesions, namely an 8-oxoguanine, an abasic site or abasic site analogues, a nick, a gap and a bulge structure were prepared and then analysed by the DEER spectroscopic technique. New insights into the application of 4-pulse DEER sequence are also provided, in particular with respect to the spin probes' positions and the rigidity of selected systems. The lesion-induced conformational changes observed, which were supported by molecular dynamics studies, confirm the results obtained by other, more conventional, spectroscopic techniques. Thus, the experimental approaches described herein provide an efficient method for probing lesion-induced structural changes of nucleic acids.
Physicochemical and Spectroscopic Characterization of Biofield Treated Triphenyl Phosphate
Trivedi, Mahendra
2015-01-01
Triphenyl phosphate (TPP) is a triester of phosphoric acid and phenol. It is commonly used as a fire-retarding agent and plasticizer for nitrocellulose and cellulose acetate. The present study was an attempt to evaluate the impact of biofield treatment on physicochemical and spectroscopic properties of TPP. The study was carried out in two groups i.e. control and treatment. The treatment group was subjected to Mr. Trivedi's biofield treatment. The control and treated samples of TPP were chara...
Dai Shi Xun; Wen Lei; Hu Li Li; Jiang Zhong Hon
2003-01-01
The effect of radiative trapping on measurement of the spectroscopic properties of Yb sup 3 sup + -doped phosphate glasses was investigated as a function of Yb sup 3 sup + concentration at different thicknesses. It was found that radiative trapping exists generally in Yb sup 3 sup + :phosphate glasses, even at low concentration. As a result, the measured lifetime of Yb sup 3 sup + in phosphate glasses is usually larger than the calculated one. The maximum discrepancies between them at high concentration are found to be <42%. The calculated lifetime should be used as a reference in determining the true value of the measured lifetime because of it being lengthened largely by radiative trapping. On the other hand, the shape of fluorescence spectrum exhibits remarkable changes due to the radiative trapping. What is more, the intensity increase of DELTA lambda sub e sub f sub f at high concentration is greater than that of low doping. The DELTA lambda sub e sub f sub f increases 36% from 53 to 72 nm with thickn...
A novel constraint for thermodynamically designing DNA sequences.
Directory of Open Access Journals (Sweden)
Qiang Zhang
Full Text Available Biotechnological and biomolecular advances have introduced novel uses for DNA such as DNA computing, storage, and encryption. For these applications, DNA sequence design requires maximal desired (and minimal undesired hybridizations, which are the product of a single new DNA strand from 2 single DNA strands. Here, we propose a novel constraint to design DNA sequences based on thermodynamic properties. Existing constraints for DNA design are based on the Hamming distance, a constraint that does not address the thermodynamic properties of the DNA sequence. Using a unique, improved genetic algorithm, we designed DNA sequence sets which satisfy different distance constraints and employ a free energy gap based on a minimum free energy (MFE to gauge DNA sequences based on set thermodynamic properties. When compared to the best constraints of the Hamming distance, our method yielded better thermodynamic qualities. We then used our improved genetic algorithm to obtain lower-bound DNA sequence sets. Here, we discuss the effects of novel constraint parameters on the free energy gap.
Electronic properties of Al/DNA/p-Si MIS diode: Application as temperature sensor
International Nuclear Information System (INIS)
Guellue, O.; Tueruet, A.
2011-01-01
Research highlights: → This work proposes that DNA molecules should be considered, among other candidates, as a potential organic thin film for metal-interface layer-semiconductor devices. → We successfully fabricated Al/DNA/p-Si device with interlayer by a simple cast method. → The temperature is found to significantly effect the electrical properties of the Al/DNA/p-Si device. → The facts: (i) that the technology of the fabrication of a Al/DNA/p-Si Schottky diode much simpler and economical than that for the Si p-n junction and (ii) the sensibility of the Al/DNA/p-Si Schottky diode as temperature sensor is 42% higher than that of a Si p-n junction, indicate that the Al/DNA/p-Si Schottky diode is a good alternative as temperature sensor. - Abstract: The current-voltage (I-V) measurements were performed in the temperature range (200-300 K) on Al/DNA/p-Si Schottky barrier type diodes. The Schottky diode shows non-ideal I-V behaviour with ideality factors n equal to 1.34 ± 0.02 and 1.70 ± 0.02 at 300 K and 200 K, respectively, and is thought to have a metal-interface layer-semiconductor (MIS) configuration. The zero-bias barrier height Φ b determined from the I-V measurements was 0.75 ± 0.01 eV at 300 K and decreases to 0.61 ± 0.01 eV at 200 K. The forward voltage-temperature (V F -T) characteristics were obtained from the I-V measurements in the temperature range 200-300 K at different activation currents (I F ) in the range 20 nA-6 μA. The V F -T characteristics were linear for three activation currents in the diode. From the V F -T characteristics at 20 nA, 100 nA and 6 μA, the values of the temperature coefficients of the forward bias voltage (dV F /dT) for the diode were determined as -2.30 mV K -1 , -2.60 mV K -1 and -3.26 mV K -1 with a standard error of 0.05 mV K -1 , respectively.
Electronic properties of Al/DNA/p-Si MIS diode: Application as temperature sensor
Energy Technology Data Exchange (ETDEWEB)
Guellue, O., E-mail: omergullu@gmail.com [Batman University, Science and Art Faculty, Department of Physics, 72060 Batman (Turkey); Osmaniye Korkut Ata University, Science and Art Faculty, Department of Physics, 80000 Osmaniye (Turkey); Tueruet, A. [Atatuerk University, Science Faculty, Department of Physics, 25240 Erzurum (Turkey)
2011-01-21
Research highlights: > This work proposes that DNA molecules should be considered, among other candidates, as a potential organic thin film for metal-interface layer-semiconductor devices. > We successfully fabricated Al/DNA/p-Si device with interlayer by a simple cast method. > The temperature is found to significantly effect the electrical properties of the Al/DNA/p-Si device. > The facts: (i) that the technology of the fabrication of a Al/DNA/p-Si Schottky diode much simpler and economical than that for the Si p-n junction and (ii) the sensibility of the Al/DNA/p-Si Schottky diode as temperature sensor is 42% higher than that of a Si p-n junction, indicate that the Al/DNA/p-Si Schottky diode is a good alternative as temperature sensor. - Abstract: The current-voltage (I-V) measurements were performed in the temperature range (200-300 K) on Al/DNA/p-Si Schottky barrier type diodes. The Schottky diode shows non-ideal I-V behaviour with ideality factors n equal to 1.34 {+-} 0.02 and 1.70 {+-} 0.02 at 300 K and 200 K, respectively, and is thought to have a metal-interface layer-semiconductor (MIS) configuration. The zero-bias barrier height {Phi}{sub b} determined from the I-V measurements was 0.75 {+-} 0.01 eV at 300 K and decreases to 0.61 {+-} 0.01 eV at 200 K. The forward voltage-temperature (V{sub F}-T) characteristics were obtained from the I-V measurements in the temperature range 200-300 K at different activation currents (I{sub F}) in the range 20 nA-6 {mu}A. The V{sub F}-T characteristics were linear for three activation currents in the diode. From the V{sub F}-T characteristics at 20 nA, 100 nA and 6 {mu}A, the values of the temperature coefficients of the forward bias voltage (dV{sub F}/dT) for the diode were determined as -2.30 mV K{sup -1}, -2.60 mV K{sup -1} and -3.26 mV K{sup -1} with a standard error of 0.05 mV K{sup -1}, respectively.
Energy Technology Data Exchange (ETDEWEB)
Bakkali, H., E-mail: hicham.bakkali@mail.uca.es [Departamento de Física de la Materia Condensada and Instituto de Microscopía Electrónica y Materiales (IMEYMAT), Universidad de Cadiz, 11510 Puerto Real, Cádiz (Spain); Centro de Ciencias Aplicadas y Desarrollo Tecnológico (CCADET), Universidad Nacional Autónoma de México (UNAM), México, D.F. 04510 (Mexico); Blanco, E.; Dominguez, M. [Departamento de Física de la Materia Condensada and Instituto de Microscopía Electrónica y Materiales (IMEYMAT), Universidad de Cadiz, 11510 Puerto Real, Cádiz (Spain); Mora, M.B. de la [CONACyT Research Fellow-CCADET, Universidad Nacional Autónoma de México (UNAM), México, D.F. 04510 (Mexico); Sánchez-Aké, C.; Villagrán-Muniz, M. [Centro de Ciencias Aplicadas y Desarrollo Tecnológico (CCADET), Universidad Nacional Autónoma de México (UNAM), México, D.F. 04510 (Mexico)
2017-05-31
Highlights: • Gold NPs embedded in TiO{sub 2} or SiO{sub 2} are fabricated by single RF magnetron sputtering. • Films thickness and optical constants are determined by Spectroscopic Ellipsometry. - Abstract: We report on the optical properties in the dielectric regime of gold nanostructured granular thin films fabricated through sputter deposition with a composite target at room temperature and over a wide photon energy range (0.62–4.13 eV) by means of Spectroscopic Ellipsometry. The thickness and the films effective optical constants are successfully determined using an approach based on multiple Gaussian oscillators. In the quasi-static regime, i.e., 2R ≪ λ, and in the dipole approximation, examining the real and imaginary parts, ε{sub 1}, ε{sub 2}, of the dielectric function, it is shown that the dc optical conductivity is almost negligible (σ = ωε{sub 0}ε{sub 2} ≪ 10{sup −5} Ω cm{sup −1}) and only the capacitive contribution holds for the electron-phonon relaxation in localized surface plasmon of the gold particles. Furthermore, we find that the resonant frequencies ω{sub p} becomes red-shifted when the particles are electromagnetically coupled to each other or when the surrounding medium dielectric constant, ε{sub m}, increases, thus exhibiting a wide spectral tuning range of 1.95–2.24 eV.
Lasri, Jamal; Ismail, Ali I.; Haukka, Matti; Soliman, Saied M.
2015-02-01
New N-methyl-C-2,4,6-trimethylphenylnitrone 1 has been synthesized starting from N-methylhydroxylamine and mesitaldehyde. The product was fully characterized using different spectroscopic techniques; FTIR, NMR, UV-Vis, high resolution mass spectrometry and X-ray diffraction. The relative stability and percent of population of its two possible isomers (E and Z) were calculated using the B3LYP/6-311++G(d,p) method in gas phase and in solution. In agreement with the X-ray results, it was found that Z-isomer is the most stable one in both gas phase and solution. The molecular geometry, vibrational frequencies, gauge-including atomic orbital (GIAO), and chemical shift values were also calculated using the same level of theory. The TD-DFT results of the studied nitrone predicted a π-π∗ transition band at 285.1 nm (fosc = 0.3543) in the gas phase. The rest of the spectral bands undergo either hyperchromic or hypsochromic shifts in the presence of solvent. Polarizability and HOMO-LUMO gap values were used to predict the nonlinear optical properties (NLO) of the studied compound. NBO analysis has been used to determine the most accurate Lewis structure of the studied molecule.
Scanning Tunneling Spectroscope Use in Electrocatalysis Testing
Knutsen, Turid
2010-01-01
The relationship between the electrocatalytic properties of an electrode and its ability to transfer electrons between the electrode and a metallic tip in a scanning tunneling microscope (STM) is investigated. The alkaline oxygen evolution reaction (OER) was used as a test reaction with four different metallic glasses, Ni78Si8B14, Ni70Mo20Si5B5, Ni58Co20Si10B12, and Ni25Co50Si15B10, as electrodes. The electrocatalytic properties of the electrodes were determined. The electrode surfaces were then investigated with an STM. A clear relationship between the catalytic activity of an electrode toward the OER and its tunneling characteristics was found. The use of a scanning tunneling spectroscope (STS) in electrocatalytic testing may increase the efficiency of the optimization of electrochemical processes.
Scanning Tunneling Spectroscope Use in Electrocatalysis Testing
Directory of Open Access Journals (Sweden)
Turid Knutsen
2010-06-01
Full Text Available The relationship between the electrocatalytic properties of an electrode and its ability to transfer electrons between the electrode and a metallic tip in a scanning tunneling microscope (STM is investigated. The alkaline oxygen evolution reaction (OER was used as a test reaction with four different metallic glasses, Ni78Si8B14, Ni70Mo20Si5B5, Ni58Co20Si10B12, and Ni25Co50Si15B10, as electrodes. The electrocatalytic properties of the electrodes were determined. The electrode surfaces were then investigated with an STM. A clear relationship between the catalytic activity of an electrode toward the OER and its tunneling characteristics was found. The use of a scanning tunneling spectroscope (STS in electrocatalytic testing may increase the efficiency of the optimization of electrochemical processes.
International Nuclear Information System (INIS)
Tabassum, Sartaj; Chandra Sharma, Girish; Arjmand, Farukh; Azam, Ameer
2010-01-01
A new nano dimensional heterobimetallic Cu-Sn containing complex as a potential drug candidate was designed, synthesized and characterized by analytical and spectral methods. The electronic absorption and electron paramagnetic resonance parameters of the complex revealed that the Cu(II) ion exhibits a square pyramidal geometry with the two pyrazole nitrogen atoms, the amine nitrogen atom and the carboxylate oxygen of the phenyl glycine chloride ligand located at the equatorial sites and the coordinated chloride ion occupying an apical position. 119 Sn NMR spectral data showed a hexa-coordinated environment around the Sn(IV) metal ion. TEM, AFM and XRD measurements illustrate that the complex could induce the condensation of CT-DNA to a particulate nanostructure. The interaction of the Cu-Sn complex with CT-DNA was investigated by UV-vis absorption and emission spectroscopy, as well as cyclic voltammetric measurements. The results indicated that the complex interacts with DNA through an electrostatic mode of binding with an intrinsic binding constant K b = 8.42 x 10 4 M -1 . The Cu-Sn complex exhibits effective cleavage of pBR322 plasmid DNA by an oxidative cleavage mechanism, monitored at different concentrations both in the absence and in the presence of reducing agents.
Energy Technology Data Exchange (ETDEWEB)
Tabassum, Sartaj; Chandra Sharma, Girish; Arjmand, Farukh [Department of Chemistry, Aligarh Muslim University, Aligarh-202002 (India); Azam, Ameer [Center of Excellence in Materials Science (Nanomaterials), Department of Applied Physics, Aligarh Muslim University, Aligarh 202002, UP (India)
2010-05-14
A new nano dimensional heterobimetallic Cu-Sn containing complex as a potential drug candidate was designed, synthesized and characterized by analytical and spectral methods. The electronic absorption and electron paramagnetic resonance parameters of the complex revealed that the Cu(II) ion exhibits a square pyramidal geometry with the two pyrazole nitrogen atoms, the amine nitrogen atom and the carboxylate oxygen of the phenyl glycine chloride ligand located at the equatorial sites and the coordinated chloride ion occupying an apical position. {sup 119}Sn NMR spectral data showed a hexa-coordinated environment around the Sn(IV) metal ion. TEM, AFM and XRD measurements illustrate that the complex could induce the condensation of CT-DNA to a particulate nanostructure. The interaction of the Cu-Sn complex with CT-DNA was investigated by UV-vis absorption and emission spectroscopy, as well as cyclic voltammetric measurements. The results indicated that the complex interacts with DNA through an electrostatic mode of binding with an intrinsic binding constant K{sub b} = 8.42 x 10{sup 4} M{sup -1}. The Cu-Sn complex exhibits effective cleavage of pBR322 plasmid DNA by an oxidative cleavage mechanism, monitored at different concentrations both in the absence and in the presence of reducing agents.
Raman Spectroscopic Studies of YBa2Cu3O7 Coated Conductors
International Nuclear Information System (INIS)
Choi, Mi Kyeung; Mnh, Nguyen Van; Bae, J. S.; Jo, William; Yang, In Sang; Ko, Rock Kil; Ha, Hong Soo; Park, Chan
2005-01-01
We present results of Raman spectroscopic studies of superconducting YBa 2 Cu 3 O 7 (YBCO) coated conductors. Raman scattering is used to characterize optical phonon modes, oxygen content, c-axis misalignment, and second phases of the YBCO coated conductors at a micro scale. A two-dimensional mapping of Raman spectra with transport properties has been performed to elucidate the effect of local propertied on current path and superconducting phase. The information taken from the local measurement will be useful for optimizing the process condition.
Spectroscopic studies of copper enzymes
International Nuclear Information System (INIS)
Dooley, D.M.; Moog, R.; Zumft, W.; Koenig, S.H.; Scott, R.A.; Cote, C.E.; McGuirl, M.
1986-01-01
Several spectroscopic methods, including absorption, circular dichroism (CD), magnetic CD (MCD), X-ray absorption, resonance Raman, EPR, NMR, and quasi-elastic light-scattering spectroscopy, have been used to probe the structures of copper-containing amine oxidases, nitrite reductase, and nitrous oxide reductase. The basic goals are to determine the copper site structure, electronic properties, and to generate structure-reactivity correlations. Collectively, the results on the amine oxidases permit a detailed model for the Cu(II) sites in these enzymes to be constructed that, in turn, rationalizes the ligand-binding chemistry. Resonance Raman spectra of the phenylhydrazine and 2,4-dinitrophenyl-hydrazine derivatives of bovine plasma amine oxidase and models for its organic cofactor, e.g. pyridoxal, methoxatin, are most consistent with methoxatin being the intrinsic cofactor. The structure of the Cu(I) forms of the amine oxidases have been investigated by X-ray absorption spectroscopy (XAS); the copper coordination geometry is significantly different in the oxidized and reduced forms. Some anomalous properties of the amine oxidases in solution are explicable in terms of their reversible aggregation, which the authors have characterized via light scattering. Nitrite and nitrous oxide reductases display several novel spectral properties. The data suggest that new types of copper sites are present
Nonplanar property study of antifungal agent tolnaftate-spectroscopic approach
Arul Dhas, D.; Hubert Joe, I.; Roy, S. D. D.; Balachandran, S.
2011-09-01
Vibrational analysis of the thionocarbamate fungicide tolnaftate which is antidermatophytic, antitrichophytic and antimycotic agent, primarily inhibits the ergosterol biosynthesis in the fungus, was carried out using NIR FT-Raman and FTIR spectroscopic techniques. The equilibrium geometry, various bonding features, harmonic vibrational wavenumbers and torsional potential energy surface (PES) scan studies have been computed using density functional theory method. The detailed interpretation of the vibrational spectra has been carried out with the aid of VEDA.4 program. Vibrational spectra, natural bonding orbital (NBO) analysis and optimized molecular structure show the clear evidence for electronic interaction of thionocarbamate group with aromatic ring. Predicted electronic absorption spectrum from TD-DFT calculation has been compared with the UV-vis spectrum. The Mulliken population analysis on atomic charges and the HOMO-LUMO energy were also calculated. Vibrational analysis reveals that the simultaneous IR and Raman activation of the C-C stretching mode in the phenyl and naphthalene ring provide evidence for the charge transfer interaction between the donor and acceptor groups and is responsible for its bioactivity as a fungicide.
Energy Technology Data Exchange (ETDEWEB)
Orimoto, Yuuichi, E-mail: orimoto.yuuichi.888@m.kyushu-u.ac.jp [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Aoki, Yuriko [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012 (Japan)
2016-07-14
An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method, and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between “choose-maximum” (choose a base pair giving the maximum β for each step) and “choose-minimum” (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.
International Nuclear Information System (INIS)
Orimoto, Yuuichi; Aoki, Yuriko
2016-01-01
An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method, and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between “choose-maximum” (choose a base pair giving the maximum β for each step) and “choose-minimum” (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.
Albumin adsorption on oxide thin films studied by spectroscopic ellipsometry
Energy Technology Data Exchange (ETDEWEB)
Silva-Bermudez, P., E-mail: suriel21@yahoo.com [Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, Circuito Exterior s/n, C.U., 04510, Mexico D.F. (Mexico); Unidad de Posgrado, Facultad de Odontologia, Universidad Nacional Autonoma de Mexico, CU, 04510, Mexico D.F. (Mexico); Rodil, S.E.; Muhl, S. [Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, Circuito Exterior s/n, C.U., 04510, Mexico D.F. (Mexico)
2011-12-15
Thin films of tantalum, niobium, zirconium and titanium oxides were deposited by reactive magnetron sputtering and their wettability and surface energy, optical properties, roughness, chemical composition and microstructure were characterized using contact angle measurements, spectroscopic ellipsometry, profilometry, X-ray photoelectron spectroscopy and X-ray diffraction, respectively. The purpose of the work was to correlate the surface properties of the films to the Bovine Serum Albumin (BSA) adsorption, as a first step into the development of an initial in vitro test of the films biocompatibility, based on standardized protein adsorption essays. The films were immersed into BSA solutions with different protein concentrations and protein adsorption was monitored in situ by dynamic ellipsometry; the adsorption-rate was dependent on the solution concentration and the immersion time. The overall BSA adsorption was studied in situ using spectroscopic ellipsometry and it was found to be influenced by the wettability of the films; larger BSA adsorption occurred on the more hydrophobic surface, the ZrO{sub 2} film. On the Ta{sub 2}O{sub 5}, Nb{sub 2}O{sub 5} and TiO{sub 2} films, hydrophilic surfaces, the overall BSA adsorption increased with the surface roughness or the polar component of the surface energy.
Zhang, Liaolin; Dong, Guoping; Peng, Mingying; Qiu, Jianrong
2012-07-01
We report on the spectroscopic properties of Pr(3+)-doped boro-phosphate, boro-germo-silicate and tellurite glasses. The stimulated absorption and emission cross sections were estimated. Only one emission at 596 nm and 605 nm is observed in Pr(3+)-doped boro-phosphate and boro-germo-silicate glasses, respectively, while three emissions at 605 nm, 612 nm and 645 nm are observed in Pr(3+)-doped tellurite glass when excited at 467 nm. The fluorescence lifetime at 600 nm in Pr(3+)-doped boro-phosphate, boro-germo-silicate and tellurite glasses is 137 μs, 73 μs and 51 μs, respectively. The emissions from Pr(3+)-doped boro-phosphate, boro-germo-silicate and tellurite glasses show different decay behaviors and can be well explained by multiphonon relaxation theory. Copyright © 2012 Elsevier B.V. All rights reserved.
PEG and mPEG-anthracene induce DNA condensation and particle formation.
Froehlich, E; Mandeville, J S; Arnold, D; Kreplak, L; Tajmir-Riahi, H A
2011-08-18
In this study, we investigated the binding of DNA with poly(ethylene glycol) (PEG) of different sizes and compositions such as PEG 3350, PEG 6000, and mPEG-anthracene in aqueous solution at physiological conditions. The effects of size and composition on DNA aggregation and condensation as well as conformation were determined using Fourier transform infrared (FTIR), UV-visible, CD, fluorescence spectroscopic methods and atomic force microscopy (AFM). Structural analysis showed moderate complex formation for PEG 3350 and PEG 6000 and weaker interaction for mPE-anthracene-DNA adducts with both hydrophilic and hydrophobic contacts. The order of ± stability of the complexes formed is K(PEG 6000) = 1.5 (±0.4) × 10(4) M(-1) > K(PEG 3350) = 7.9 (±1) × 10(3) M(-1) > K(m(PEG-anthracene))= 3.6 (±0.8) × 10(3) M(-1) with nearly 1 bound PEG molecule per DNA. No B-DNA conformational changes were observed, while DNA condensation and particle formation occurred at high PEG concentration.
The Spectral Properties and Photostability of DNA, RNA and Oligonucleotides
International Nuclear Information System (INIS)
Kudrya, V.Yu.; Yashchuk, V.M.
2012-01-01
The present work discusses the results of comparative investigations of the optical absorption, luminescence, and photostability of the biomacromolecules (DNA, RNA), as well as synthetic poly- and oligonucleotides. The separate nucleotides in DNA and RNA are examined as almost independent absorbing centers. It is confirmed that the main triplet excitons traps responsible for the DNA phosphorescence emission are AT-complexes in DNA. In contrast to DNA, the main triplet excitons traps in RNA are adenosine bases. These bases are the most photostable against UV-irradiation as compared with all other nucleotides in both DNA and RNA. The fact of the photostability of adenosine bases and the AT-complex provides the existence of the DNA/RNA self-protection mechanisms against a damage caused by UV-irradiation. It is found the deoxyribonucleotides are more photostable than the corresponding ribonucleotides. So, the results presented here show that DNA is more photostable than RNA.
Dual-probe spectroscopic fingerprints of defects in graphene
DEFF Research Database (Denmark)
Settnes, Mikkel; Power, Stephen; Petersen, Dirch Hjorth
2014-01-01
(e.g., an extended graphene sheet). Applying this method, we study the transport anisotropies in pristine graphene sheets, and analyze the spectroscopic fingerprints arising from quantum interference around single-site defects, such as vacancies and adatoms. Furthermore, we demonstrate that the dual......-probe setup is a useful tool for characterizing the electronic transport properties of extended defects or designed nanostructures. In particular, we show that nanoscale perforations, or antidots, in a graphene sheet display Fano-type resonances with a strong dependence on the edge geometry of the perforation....
How spectroscopic ellipsometry can aid graphene technology?
Energy Technology Data Exchange (ETDEWEB)
Losurdo, Maria, E-mail: maria.losurdo@cnr.it; Giangregorio, Maria M.; Bianco, Giuseppe V.; Capezzuto, Pio; Bruno, Giovanni
2014-11-28
We explore the effects of substrate, grain size, oxidation and cleaning on the optical properties of chemical vapor deposited polycrystalline monolayer graphene exploiting spectroscopic ellipsometry in the NIR-Vis–UV range. Both Drude–Lorentz oscillators' and point-by-point fit approaches are used to analyze the ellipsometric spectra. For monolayer graphene, since anisotropy cannot be resolved, an isotropic model is used. A prominent absorption peak at approximately 4.8 eV, which is a mixture of π–π* interband transitions at the M-point of the Brillouin zone and of the π-plasmonic excitation, is observed. We discuss the sensitivity of this peak to the structural and cleaning quality of graphene. The comparison with previous published dielectric function spectra of graphene is discussed giving a rationale for the observed differences. - Highlights: • Optical properties of graphene are determined by ellipsometry on copper and on glass. • Optical spectra reveal the cleaning quality of transferred graphene. • Sensitivity of absorption peak to graphene structural quality is proven. • Optical properties are proven to be sensitive to oxidation of graphene. • Electronic interaction with substrate affects graphene optical properties.
Mueller matrix spectroscopic ellipsometry study of chiral nanocrystalline cellulose films
Mendoza-Galván, Arturo; Muñoz-Pineda, Eloy; Ribeiro, Sidney J. L.; Santos, Moliria V.; Järrendahl, Kenneth; Arwin, Hans
2018-02-01
Chiral nanocrystalline cellulose (NCC) free-standing films were prepared through slow evaporation of aqueous suspensions of cellulose nanocrystals in a nematic chiral liquid crystal phase. Mueller matrix (MM) spectroscopic ellipsometry is used to study the polarization and depolarization properties of the chiral films. In the reflection mode, the MM is similar to the matrices reported for the cuticle of some beetles reflecting near circular left-handed polarized light in the visible range. The polarization properties of light transmitted at normal incidence for different polarization states of incident light are discussed. By using a differential decomposition of the MM, the structural circular birefringence and dichroism of a NCC chiral film are evaluated.
In situ spectroscopic ellipsometry as a surface sensitive tool to probe thin film growth
International Nuclear Information System (INIS)
Liu, C.
1999-01-01
Sputtered thin film and multilayer x-ray mirrors are made routinely at the Advanced Photon Source (APS) for the APS users. Precise film growth control and characterization are very critical in fabricating high-quality x-ray mirrors. Film thickness calibrations are carried out using in situ and ex situ spectroscopic ellipsometry, interferometry, and x-ray scattering. To better understand the growth and optical properties of different thin film systems, we have carried out a systematic study of sputtered thin films of Au, Rh, Pg Pd, Cu, and Cr, using in situ ellipsometry. Multiple data sets were obtained in situ for each film material with incremental thicknesses and were analyzed with their correlation in mind. We found that in situ spectroscopic ellipsometry as a surface-sensitive tool can also be used to probe the growth and morphology of the thin film system. This application of in situ spectroscopic ellipsometry for metal thin film systems will be discussed
Novel vanillin derivatives: Synthesis, anti-oxidant, DNA and cellular protection properties.
Scipioni, Matteo; Kay, Graeme; Megson, Ian; Kong Thoo Lin, Paul
2018-01-01
Antioxidants have been the subject of intense research interest mainly due to their beneficial properties associated with human health and wellbeing. Phenolic molecules, such as naturally occurring Resveratrol and Vanillin, are well known for their anti-oxidant properties, providing a starting point for the development of new antioxidants. Here we report, for the first time, the synthesis of a number of new vanillin through the reductive amination reaction between vanillin and a selection of amines. All the compounds synthesised, exhibited strong antioxidant properties in DPPH, FRAP and ORAC assays, with compounds 1b and 2c being the most active. The latter also demonstrated the ability to protect plasmid DNA from oxidative damage in the presence of the radical initiator AAPH. At cellular level, neuroblastoma SH-SY5Y cells were protected from oxidative damage (H 2 O 2 , 400 μM) with both 1b and 2c. The presence of a tertiary amino group, along with the number of vanillin moieties in the molecule contribute for the antioxidant activity. Furthermore, the delocalization of the electron pair of the nitrogen and the presence of an electron donating substituent to enhance the antioxidant properties of this new class of compounds. In our opinion, vanillin derivatives 1b and 2c described in this work can provide a viable platform for the development of antioxidant based therapeutics. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)
2016-10-12
Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.
International Nuclear Information System (INIS)
Losetty, Venkatramana; Chennuri, Bharath Kumar; Gardas, Ramesh L.
2016-01-01
Graphical abstract: Density, ρ (■) in kg · m"−"3, speed of sound, u (●) in m · s"−"1, dynamic viscosity, η (▴) in mPa · s, electrical conductivity, σ (♦) in S · cm"−"1of [BHEA][TFA] as the function of temperature and at 0.1 MPa pressure. - Highlights: • N-butyl-(N-hydroxyethyl) ammonium based protic ionic liquids (PILs) were synthesized. • Density, speed of sound, electrical conductivity and viscosity were measured for studied PILs. • Transport property data were fitted to Vogel–Tammann–Fulcher (VTF) equation. • FT-IR spectrum was helpful to explain the hydrogen bonding between ions. • Measured and derived properties were analyzed in terms of chemical structure of PILs. - Abstract: In the present work, solvent-free synthesis of two hydroxyethyl ammonium-based ionic liquids (ILs) at room temperature was carried out namely, N-butyl-(N-hydroxyethyl) ammonium trifluoroacetate ([BHEA][TFA]) and N-butyl-(N-hydroxyethyl) ammonium nitrate ([BHEA][NO_3]). The synthesized ionic liquids were characterized by various spectroscopic techniques such as "1H-NMR, "1"3C-NMR and FTIR. Furthermore, density (ρ), speed of sound (u), electrical conductivity (σ) and viscosity (η) have been measured within the temperature range from T = (303.15 to 343.15) K and at 0.1 MPa pressure. The measured density and viscosity values were fitted to the linear and Vogel–Tammann–Fulcher (VTF) equation, respectively. The temperature dependence conductivity of the measured ILs was fitted to a similar equation type of viscosity (VTF). Furthermore, the refractive index was measured at T = 303.15 K, in turn molar refraction (R_m) and free volume (f_V) were calculated using the Lorentz–Lorenz equation. The thermodynamic properties such as thermal expansion coefficient (α), isentropic compressibility (β_S) and intermolecular free length (L_f) were calculated by using the experimental values of density and speed of sound. The thermal decomposition temperature (T
Khan, M Nuruzzaman; Tjong, Vinalia; Chilkoti, Ashutosh; Zharnikov, Michael
2013-08-29
We used a combination of synchrotron-based X-ray photoelectron spectroscopy (XPS) and angle-resolved near-edge X-ray absorption fine structure (NEXAFS) spectroscopy to study the chemical integrity, purity, and possible internal alignment of single-strand (ss) adenine deoxynucleotide (poly(A)) DNA brushes. The brushes were synthesized by surface-initiated enzymatic polymerization (SIEP) on a 25-mer of adenine self-assembled monolayer (SAM) on gold (A25-SH), wherein the terminal 3'-OH of the A25-SH serve as the initiation sites for SIEP of poly(A). XPS and NEXAFS spectra of poly(A) brushes were found to be almost identical to those of A25-SH initiator, with no unambiguous traces of contamination. Apart from the well-defined chemical integrity and contamination-free character, the brushes were found to have a high degree of orientational order, with an upright orientation of individual strands, despite their large thickness up to ~55 nm, that corresponds to a chain length of at least several hundred nucleotides for individual ssDNA molecules. The orientational order exhibited by these poly(A) DNA brushes, mediated presumably by base stacking, was found to be independent of the brush thickness as long as the packing density was high enough. The well-defined character and orientational ordering of the ssDNA brushes make them a potentially promising system for different applications.
Subhapriya, G.; Kalyanaraman, S.; Jeyachandran, M.; Ragavendran, V.; Krishnakumar, V.
2018-04-01
Synthesized 4-nitro-N-(2,4-dinitrophenyl) benzenamine (NDPBA) molecule was confirmed applying the tool of NMR. Theoretical prediction addressed the NMR chemical shifts and correlated well with the experimental data. The molecule subjected to theoretical DFT at 6-311++G** level unraveled the spectroscopic and structural properties of the NDPBA molecule. Moreover the structural features proved the occurrence of intramolecular Nsbnd H· · O hydrogen bonding in the molecule which was further confirmed with the help of Frontier molecular orbital analysis. Vibrational spectroscopic characterization through FT-IR and Raman experimentally and theoretically gave an account for the vibrational properties. An illustration of the topology of the molecule theoretically helped also in finding the hydrogen bonding energy.
Łodyga-Chruscińska, Elżbieta; Pilo, Maria; Zucca, Antonio; Garribba, Eugenio; Klewicka, Elżbieta; Rowińska-Żyrek, Magdalena; Symonowicz, Marzena; Chrusciński, Longin; Cheshchevik, Vitalij T
2018-03-01
Fisetin (3,3',4',7-tetrahydroxyflavone) metal chelates are of interest as this plant polyphenol has revealed broad prospects for its use as natural medicine in the treatment of various diseases. Metal interactions may change or enhance fisetin biological properties so understanding fisetin metal chelation is important for its application not only in medicine but also as a food additive in nutritional supplements. This work was aimed to determine and characterize copper complexes formed in different pH range at applying various metal/ligand ratios. Fisetin and Cu(II)-fisetin complexes were characterized by potentiometric titrations, UV-Vis (Ultraviolet-visible spectroscopy), EPR, ESI-MS, FTIR and cyclic voltammetry. Their effects on DNA were investigated by using circular dichroism, spectrofluorimetry and gel electrophoresis methods. The copper complex with the ratio of Cu(II)/fisetin 1/2 exhibited significant DNA cleavage activity, followed by complete degradation of DNA. The influence of copper(II) ions on antioxidant activity of fisetin in vitro has been studied using DPPH, ABTS and mitochondrial assays. The results have pointed out that fisetin or copper complexes can behave both as antioxidants or pro-oxidants. Antimicrobial activity of the compounds has been investigated towards several bacteria and fungi. The copper complex of Cu(II)/fisetin 1/2 ratio showed higher antagonistic activity against bacteria comparing to the ligand and it revealed a promising antifungal activity. Copyright © 2017 Elsevier Inc. All rights reserved.
Spectroscopic ellipsometry study of FePt nanoparticle films
Energy Technology Data Exchange (ETDEWEB)
Lee, S.J.; Lo, C.C.H. [Ames Laboratory, Iowa State University, Ames, IA 50011 (United States); Yu, A.C.C. [Sony Corporation, Sendai Technology Center, 3-4-1 Sakuragi, Miyagi 985-0842 (Japan); Fan, M. [School of Materials Science and Technology, Georgia Institute of Technology, Atlanta, Georgia 30332 (United States)
2006-12-15
The optical properties of a FePt nanoparticle film were investigated using spectroscopic ellipsometry. The FePt nanoparticle film of thickness about 15 nm was prepared by deposition of FePt nanoparticles directly on a Si substrate. The nanoparticle film was annealed at 600 C in vacuum for two hours before the measurements. The optical properties of the FePt nanoparticle film showed distinctively different spectra from those obtained from the bulk and thin film FePt samples, in particular in the low photon energy range (below 3.5 eV) where the nanoparticle film exhibited a relatively flat refractive index and a substantially lower extinction coefficient than the bulk and epitaxial thin film samples. (copyright 2006 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Photophysical properties of columnar phases formed by triphenylene derivatives
International Nuclear Information System (INIS)
Sigal, Herve
1997-01-01
This research thesis reports the study of the spectroscopic properties and of the migration of excitation energy in the singlet state in columnar phases formed by alkyloxy and alkylthio derivatives of triphenylene. First, the author studied the spectroscopic properties of chromophores in solutions, and characterized excited states by using computation codes (CS-INDO-CIPSI). Then, by using the excitonic theory in the case of the considered triphenylene derivatives, the author studied the influence of molecular movements and of the intra-columnar order on the spectroscopic properties. In some circumstances, the non-radiative transfer of excitation energy is governed by a mechanism displaying a random evolution. This stochastic movement is studied by using Monte Carlo simulations. The author shows that the energy migration is one-dimensional on short times, and then becomes three-dimensional. The evolution of excitation energy in space and in time is determined [fr
DNA-binding proteins essential for protein-primed bacteriophage ø29 DNA replication
Directory of Open Access Journals (Sweden)
Margarita Salas
2016-08-01
Full Text Available Bacillus subtilis phage Φ29 has a linear, double-stranded DNA 19 kb long with an inverted terminal repeat of 6 nucleotides and a protein covalently linked to the 5’ ends of the DNA. This protein, called terminal protein (TP, is the primer for the initiation of replication, a reaction catalyzed by the viral DNA polymerase at the two DNA ends. The DNA polymerase further elongates the nascent DNA chain in a processive manner, coupling strand displacement with elongation. The viral protein p5 is a single-stranded DNA binding protein (SSB that binds to the single strands generated by strand displacement during the elongation process. Viral protein p6 is a double-stranded DNA binding protein (DBP that preferentially binds to the origins of replication at the Φ29 DNA ends and is required for the initiation of replication. Both SSB and DBP are essential for Φ29 DNA amplification. This review focuses on the role of these phage DNA-binding proteins in Φ29 DNA replication both in vitro and in vivo, as well as on the implication of several B. subtilis DNA-binding proteins in different processes of the viral cycle. We will revise the enzymatic activities of the Φ29 DNA polymerase: TP-deoxynucleotidylation, processive DNA polymerization coupled to strand displacement, 3’-5’ exonucleolysis and pyrophosphorolysis. The resolution of the Φ29 DNA polymerase structure has shed light on the translocation mechanism and the determinants responsible for processivity and strand displacement. These two properties have made Φ29 DNA polymerase one of the main enzymes used in the current DNA amplification technologies. The determination of the structure of Φ29 TP revealed the existence of three domains: the priming domain, where the primer residue Ser232, as well as Phe230, involved in the determination of the initiating nucleotide, are located, the intermediate domain, involved in DNA polymerase binding, and the N-terminal domain, responsible for DNA binding
Czech Academy of Sciences Publication Activity Database
Fuentes-Cabrera, M.; Sumpter, B.G.; Šponer, Judit E.; Šponer, Jiří; Petit, L.; Wells, J.C.
2007-01-01
Roč. 111, č. 4 (2007), s. 870-879 ISSN 1520-6106 R&D Projects: GA AV ČR(CZ) 1QS500040581; GA ČR(CZ) GA203/05/0388; GA ČR(CZ) GA203/05/0009; GA MŠk(CZ) LC512 Institutional research plan: CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : metalated DNA * ab initio * electronic properties of DNA Subject RIV: BO - Biophysics Impact factor: 4.086, year: 2007
Alterations of ultraviolet irradiated DNA
International Nuclear Information System (INIS)
Davila, C.; Garces, F.
1980-01-01
Thymine dimers production has been studied in several DNA- 3 H irradiated at various wave lenght of U.V. Light. The influence of dimers on the hydrodynamic and optic properties, thermal structural stability and transformant capacity of DNA have been studied too. At last the recognition and excision of dimers by the DNA-UV-Endonuclease and DNA-Polimerase-I was also studied. (author)
DNA recognition by synthetic constructs.
Pazos, Elena; Mosquera, Jesús; Vázquez, M Eugenio; Mascareñas, José L
2011-09-05
The interaction of transcription factors with specific DNA sites is key for the regulation of gene expression. Despite the availability of a large body of structural data on protein-DNA complexes, we are still far from fully understanding the molecular and biophysical bases underlying such interactions. Therefore, the development of non-natural agents that can reproduce the DNA-recognition properties of natural transcription factors remains a major and challenging goal in chemical biology. In this review we summarize the basics of double-stranded DNA recognition by transcription factors, and describe recent developments in the design and preparation of synthetic DNA binders. We mainly focus on synthetic peptides that have been designed by following the DNA interaction of natural proteins, and we discuss how the tools of organic synthesis can be used to make artificial constructs equipped with functionalities that introduce additional properties to the recognition process, such as sensing and controllability. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Spectroscopic detection of fluorescent protein marker gene activity in genetically modified plants
Liew, O. W.; Chong, Jenny P. C.; Asundi, Anand K.
2005-04-01
This work focuses on developing a portable fibre optic fluorescence analyser for rapid identification of genetically modified plants tagged with a fluorescent marker gene. Independent transgenic tobacco plant lines expressing the enhanced green fluorescence protein (EGFP) gene were regenerated following Agrobacterium-mediated gene transfer. Molecular characterisation of these plant lines was carried out at the DNA level by PCR screening to confirm their transgenic status. Conventional transgene expression analysis was then carried out at the RNA level by RT-PCR and at the protein level by Western blotting using anti-GFP rabbit antiserum. The amount of plant-expressed EGFP on a Western blot was quantified against known amounts of purified EGFP by scanning densitometry. The expression level of EGFP in transformed plants was found to range from 0.1 - 0.6% of total extractable protein. A comparison between conventional western analysis of transformants and direct spectroscopic quantification using the fibre optic fluorescence analyser was made. The results showed that spectroscopic measurements of fluorescence emission from strong EGFP expressors correlated positively with Western blot data. However, the fluorescence analyser was also able to identify weakly expressing plant transformants below the detection limit of colorimetric Western blotting.
Nuclear DNA but not mtDNA controls tumor phenotypes in mouse cells
International Nuclear Information System (INIS)
Akimoto, Miho; Niikura, Mamoru; Ichikawa, Masami; Yonekawa, Hiromichi; Nakada, Kazuto; Honma, Yoshio; Hayashi, Jun-Ichi
2005-01-01
Recent studies showed high frequencies of homoplasmic mtDNA mutations in various human tumor types, suggesting that the mutated mtDNA haplotypes somehow contribute to expression of tumor phenotypes. We directly addressed this issue by isolating mouse mtDNA-less (ρ 0 ) cells for complete mtDNA replacement between normal cells and their carcinogen-induced transformants, and examined the effect of the mtDNA replacement on expression of tumorigenicity, a phenotype forming tumors in nude mice. The results showed that genome chimera cells carrying nuclear DNA from tumor cells and mtDNA from normal cells expressed tumorigenicity, whereas those carrying nuclear DNA from normal cells and mtDNA from tumor cells did not. These observations provided direct evidence that nuclear DNA, but not mtDNA, is responsible for carcinogen-induced malignant transformation, although it remains possible that mtDNA mutations and resultant respiration defects may influence the degree of malignancy, such as invasive or metastatic properties
Imaging properties of small-pixel spectroscopic x-ray detectors based on cadmium telluride sensors
International Nuclear Information System (INIS)
Koenig, Thomas; Schulze, Julia; Zuber, Marcus; Rink, Kristian; Oelfke, Uwe; Butzer, Jochen; Hamann, Elias; Cecilia, Angelica; Zwerger, Andreas; Fauler, Alex; Fiederle, Michael
2012-01-01
Spectroscopic x-ray imaging by means of photon counting detectors has received growing interest during the past years. Critical to the image quality of such devices is their pixel pitch and the sensor material employed. This paper describes the imaging properties of Medipix2 MXR multi-chip assemblies bump bonded to 1 mm thick CdTe sensors. Two systems were investigated with pixel pitches of 110 and 165 μm, which are in the order of the mean free path lengths of the characteristic x-rays produced in their sensors. Peak widths were found to be almost constant across the energy range of 10 to 60 keV, with values of 2.3 and 2.2 keV (FWHM) for the two pixel pitches. The average number of pixels responding to a single incoming photon are about 1.85 and 1.45 at 60 keV, amounting to detective quantum efficiencies of 0.77 and 0.84 at a spatial frequency of zero. Energy selective CT acquisitions are presented, and the two pixel pitches' abilities to discriminate between iodine and gadolinium contrast agents are examined. It is shown that the choice of the pixel pitch translates into a minimum contrast agent concentration for which material discrimination is still possible. We finally investigate saturation effects at high x-ray fluxes and conclude with the finding that higher maximum count rates come at the cost of a reduced energy resolution. (paper)
DEFF Research Database (Denmark)
Bunkenborg, Jakob; Behrens, Carsten; Jacobsen, Jens Peter
2002-01-01
A novel aryl-bis-benzimidazole amino acid analogue of the DNA-binding compound Hoechst 33258 has recently been designed for incorporation in peptide combinatorial libraries by replacing the N-methylpiperazine group with a carboxyl group and the hydroxy group with an amino-methyl group. The DNA......-binding properties of the aryl-bis-benzimidazole monomer with the C-terminus derivatized with 3-(dimethylamino)-propylamine has been investigated in this paper by (1)H NMR studies of two different complexes with two different DNA sequences: A(5) d(5'-GCCA(5)CG-3'):d(5'-CGT(5)GGC-3') and A(3)T(3) d(5'-CGA(3)T(3)CG-3...... preference with the bis-benzimidazole moiety displaced toward the 3'-end from the center of the duplex. Two families of models of the complexes with A(5) and A(3)T(3) were derived with restrained molecular dynamics based on a large set of 70 and 61, respectively, intermolecular ligand NOEs. Both models give...
Spectroscopic and visible luminescence properties of rare earth ions in lead fluoroborate glasses
Energy Technology Data Exchange (ETDEWEB)
Anjaiah, G. [Department of Physics, Osmania University, Hyderabad 500007 (India); Nayab Rasool, SK. [Department of Physics, Sri Venkateswara University, Tirupati 517502 (India); Kistaiah, P., E-mail: pkistaiah@yahoo.com [Department of Physics, Osmania University, Hyderabad 500007 (India)
2015-03-15
The lanthanide doped lead lithium calcium zinc fluoroborate glasses (LLCZFB:Ln) of composition 20PbF{sub 2}+10Li{sub 2}O+5Cao+5ZnO+59B{sub 2}O{sub 3}+1Ln{sub 2}O{sub 3} (where Ln=Sm, Eu and Dy in mol%) were prepared by conventional melt quench technique. The amorphous nature of these glasses was confirmed by X-ray diffraction studies. The glass transition temperatures (T{sub g}) were studied by DSC analysis. The glass structure and spectroscopic properties were investigated using optical absorption, vibrational and fluorescence spectra. The FT-IR spectra and Raman spectra reveal the presence of BO{sub 3}, BO{sub 4} and non-bridging oxygen's. The Judd–Ofelt intensity parameters Ω{sub λ} (λ=2, 4, 6) were determined from the spectral intensities of absorption bands. These parameters were used to calculate the radiative parameters such as radiative transition probability (A{sub R}), radiative life time (τ{sub R}) and branching ratio (β{sub r}) for various excited luminescent states of rare earth ions. The visible emission spectra for different rare earth ions were recorded by exciting the samples at different wavelengths and the decay rates for the different rare earth ions were measured. Using the emission spectra, full width half maxima (FWFM), stimulated emission cross section (σ{sup E}{sub p}) were evaluated. The nature of decay profiles of {sup 4}F{sub 9/2}, {sup 4}G{sub 5/2} and {sup 5}D{sub 0} states of Dy, Sm and Eu ions respectively are analyzed. Comparison of luminescence features of these glasses and also with those reported for different glass hosts indicates that the LLCZFB:Dy glass has strong luminescence in the visible region. - Highlights: • LLCZFB:Ln glasses are prepared with Ln: Sm, Eu and Dy. • Glasses are characterized by XRD, FTIR, Raman, absorption and emission spectra. • J–O theory is used to calculate different radiative properties. • Green, yellow and red emissions are observed. • Glasses are useful for the development
Effect of Molecular Weight on the Thermal and Spectroscopic Properties of Poly(vinyl alcohol) Films
International Nuclear Information System (INIS)
Khafagy, R.M.; Abd El-Kader, K.M.; Badr, Y.A.
2009-01-01
Thin films of Poly(vinyl alcohol) (PVA) with molecular weights 5000, 17000,72000 and 125000 g/mol were prepared by casting technique.Samples were thermally and spectroscopically investigated using TGA, DSC, FTIR and FT-Raman spectroscopy, in order to show how the thermal stability and structure of PVA might be correlated with its molecular weight. Thermal analysis showed that samples degrade in two steps mechanism. The mechanism observed for degradation in an inert atmosphere was in accordance with the accepted mechanism of elimination followed by pyrolisation. PVA 5000MW and PVA 17000Mw showed almost similar thermal behavior due to their expected similar structure. PVA 72000Mw showed lower thermal stability since it is characterized with the presence of the unstable C-O-C ether linkages, which lead to the fast melting of this sample. PVA 125000Mw showed the highest thermal stability because crosslinking of the main chains takes place due to introducing additional PVA units, which substitute each over oxygen atom. ΔH values obtained from DSC showed good accordance with TGA and Drtg analysis. Moreover, FTIR and FT-Raman results agreed well with thermal analysis, and confirmed our supposed structural changes which might take place as the molecular weight of the sample changes: since the water uptake, presence of ether linkages, and double bonds formulation due to crosslinking, were confirmed with FTIR and FT-Raman spectral analysis. The crystallinity percentage of the samples was calculated from Raman spectra and results confirmed our spectroscopic explanations. The thermal and spectroscopic behavior of the samples was explained as a result of the competitive action of at least three factors due to increasing the molecular weight: (i) diminution of the existing physical network due to changes in hydrogen bonding; (ii) formation of a chemical network; and (iii) introduction of flexible moieties due to the specific chemical structure after crosslinking
Energy Technology Data Exchange (ETDEWEB)
Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr [Department of Biochemistry, College of Natural Sciences, Kangwon National University, 1 Kangwondaehak-gil, Chuncheon-si, Gangwon-do, 24341, South Korea (Korea, Republic of); Chung, Jeong Min [Department of Biochemistry, College of Natural Sciences, Kangwon National University, 1 Kangwondaehak-gil, Chuncheon-si, Gangwon-do, 24341, South Korea (Korea, Republic of); Yun, Hyung Joong; Won, Jonghan [Advanced Nano Surface Research Group, Korea Basic Science Institute, 169-148 Gwahak-ro, Daejeon, 305-333 (Korea, Republic of); Jung, Hyun Suk, E-mail: hsjung@kangwon.ac.kr [Department of Biochemistry, College of Natural Sciences, Kangwon National University, 1 Kangwondaehak-gil, Chuncheon-si, Gangwon-do, 24341, South Korea (Korea, Republic of)
2016-01-22
Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stress by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.
International Nuclear Information System (INIS)
Lee, Sangmin; Chung, Jeong Min; Yun, Hyung Joong; Won, Jonghan; Jung, Hyun Suk
2016-01-01
Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stress by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.
International Nuclear Information System (INIS)
Özaydın, C.; Güllü, Ö.; Pakma, O.; Ilhan, S.; Akkılıç, K.
2016-01-01
Highlights: • Optical properties and thickness of the A novel organometallic complex (OMC) film were investigated by spectroscopic ellipsometry (SE). • Au/OMC/n-Si metal/interlayer/semiconductor (MIS) diode has been fabricated • This paper presents the I–V analysis of Au/OMC/n-Si MIS diode. • Current–voltage and photovoltaic properties of the diode were investigated. - Abstract: In this work, organometallic complex (OMC) films have been deposited onto glass or silicon substrates by spin coating technique and their photovoltaic application potential has been investigated. Optical properties and thickness of the film have been investigated by spectroscopic ellipsometry (SE). Also, transmittance spectrum has been taken by UV/vis spectrophotometer. The optical method has been used to determine the band gap value of the films. Also, Au/OMC/n-Si metal/interlayer/semiconductor (MIS) diode has been fabricated. Current–voltage and photovoltaic properties of the structure were investigated. The ideality factor (n) and barrier height (Φ_b) values of the diode were found to be 2.89 and 0.79 eV, respectively. The device shows photovoltaic behavior with a maximum open-circuit voltage of 396 mV and a short circuit current of 33.8 μA under 300 W light.
Energy Technology Data Exchange (ETDEWEB)
Özaydın, C. [Batman University, Engineering Faculty, Department of Computer Eng., Batman (Turkey); Güllü, Ö., E-mail: omergullu@gmail.com [Batman University, Science and Art Faculty, Department of Physics, Batman (Turkey); Pakma, O. [Batman University, Science and Art Faculty, Department of Physics, Batman (Turkey); Ilhan, S. [Siirt University, Science and Art Faculty, Department of Chemistry, Siirt (Turkey); Akkılıç, K. [Dicle University, Education Faculty, Department of Physics Education, Diyarbakır (Turkey)
2016-05-15
Highlights: • Optical properties and thickness of the A novel organometallic complex (OMC) film were investigated by spectroscopic ellipsometry (SE). • Au/OMC/n-Si metal/interlayer/semiconductor (MIS) diode has been fabricated • This paper presents the I–V analysis of Au/OMC/n-Si MIS diode. • Current–voltage and photovoltaic properties of the diode were investigated. - Abstract: In this work, organometallic complex (OMC) films have been deposited onto glass or silicon substrates by spin coating technique and their photovoltaic application potential has been investigated. Optical properties and thickness of the film have been investigated by spectroscopic ellipsometry (SE). Also, transmittance spectrum has been taken by UV/vis spectrophotometer. The optical method has been used to determine the band gap value of the films. Also, Au/OMC/n-Si metal/interlayer/semiconductor (MIS) diode has been fabricated. Current–voltage and photovoltaic properties of the structure were investigated. The ideality factor (n) and barrier height (Φ{sub b}) values of the diode were found to be 2.89 and 0.79 eV, respectively. The device shows photovoltaic behavior with a maximum open-circuit voltage of 396 mV and a short circuit current of 33.8 μA under 300 W light.
Chen, Haorong; Weng, Te-Wei; Riccitelli, Molly M; Cui, Yi; Irudayaraj, Joseph; Choi, Jong Hyun
2014-05-14
DNA origami represents a class of highly programmable macromolecules that can go through conformational changes in response to external signals. Here we show that a two-dimensional origami rectangle can be effectively folded into a short, cylindrical tube by connecting the two opposite edges through the hybridization of linker strands and that this process can be efficiently reversed via toehold-mediated strand displacement. The reconfiguration kinetics was experimentally studied as a function of incubation temperature, initial origami concentration, missing staples, and origami geometry. A kinetic model was developed by introducing the j factor to describe the reaction rates in the cyclization process. We found that the cyclization efficiency (j factor) increases sharply with temperature and depends strongly on the structural flexibility and geometry. A simple mechanical model was used to correlate the observed cyclization efficiency with origami structure details. The mechanical analysis suggests two sources of the energy barrier for DNA origami folding: overcoming global twisting and bending the structure into a circular conformation. It also provides the first semiquantitative estimation of the rigidity of DNA interhelix crossovers, an essential element in structural DNA nanotechnology. This work demonstrates efficient DNA origami reconfiguration, advances our understanding of the dynamics and mechanical properties of self-assembled DNA structures, and should be valuable to the field of DNA nanotechnology.
International Nuclear Information System (INIS)
Cornard, Jean-Paul; Rasmiwetti; Merlin, Jean-Claude
2005-01-01
We investigated theoretically, by density functional theoretical calculations and by vibrational and electronic spectroscopies, the structure and the molecular spectroscopic properties of the 4-nitrocatechol molecule with varying pH. The lower energy stable structures of the neutral, monoanion and dianion forms were compared, and influence of water solvation was examined. The Raman and UV-visible spectra of 4-nitrocatechol and of its singly deprotonated form were recorded by varying the pH from 2 to 9. A calculation of the vibrational frequencies has allowed a complete assignment of the Raman spectra of the two forms of 4-nitrocatechol, and has permitted to investigate the evolution of vibrational normal modes upon deprotonation. Based on the molecular orbital analysis and the time dependent DFT (TD-DFT) calculations, we discussed the electronic structure and the assignment of the absorption bands in the electronic spectra of 4-nitrocatechol and mono-deprotonated 4-nitrocatechol
Olsztyńska-Janus, Sylwia; Szymborska-Małek, Katarzyna; Gąsior-Głogowska, Marlena; Walski, Tomasz; Komorowska, Małgorzata; Witkiewicz, Wojciech; Pezowicz, Celina; Kobielarz, Magdalena; Szotek, Sylwia
2012-01-01
Among the currently used methods of monitoring human tissues and their components many types of research are distinguished. These include spectroscopic techniques. The advantage of these techniques is the small amount of sample required, the rapid process of recording the spectra, and most importantly in the case of biological samples - preparation of tissues is not required. In this work, vibrational spectroscopy: ATR-FTIR and Raman spectroscopy will be used. Studies are carried out on tissues: tendons, blood vessels, skin, red blood cells and biological components: amino acids, proteins, DNA, plasma, and deposits.
Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah
2016-01-01
Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.
Directory of Open Access Journals (Sweden)
Seyedeh Maryam Banihashemian
Full Text Available Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100, is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT. As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.
Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman; Sujatha, Venugopal; Thirunavukkarasu, Chinnasamy
2017-05-01
Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern-Volmer quenching constant (K SV ) were found to be 7.02×10 6 M- 1 (ethidium bromide), 4.22×10 6 M- 1 (acridine orange) and 7.6×10 6 M- 1 (Hoechst) indicating strong binding of SeNPs with CT-DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. Copyright © 2017 Elsevier B.V. All rights reserved.
[DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells].
D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V
1980-11-01
A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.
Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke
The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.
Ma, Q.; Tipping, R. H.; Lavrentieva, N. N.
2010-01-01
Two basic rules (i.e. the pair identity and the smooth variation) applicable for H2O transitions involving high-J states have been discovered. The origins of these rules are the properties of the energy levels and wavefunctions of H2O states with the quantum number J above certain boundaries. As a result, for lines involving high-J states in individually defined groups, all their spectroscopic parameters (i.e. the transition wavenumber, intensity, pressure-broadened half-width, pressure-induced shift, and temperature exponent) must follow these rules. One can use these rules to screen spectroscopic data provided by databases and to identify possible errors. In addition, by using extrapolation methods within the individual groups, one is able to predict the spectroscopic parameters for lines in this group involving very high-J states. The latter are required in developing high-temperature molecular spectroscopic databases such as HITEMP.
Martínez-Calvo, Miguel; Orange, Kim N; Elmes, Robert B P; la Cour Poulsen, Bjørn; Williams, D Clive; Gunnlaugsson, Thorfinnur
2016-01-07
The development of Ru(II) functionalized gold nanoparticles 1–3·AuNP is described. These systems were found to be mono-disperse with a hydrodynamic radius of ca. 15 nm in water but gave rise to the formation of higher order structures in buffered solution. The interaction of 1–3·AuNP with DNA was also studied by spectroscopic and microscopic methods and suggested the formation of large self-assembly structures in solution. The uptake of 1–3·AuNP by cancer cells was studied using both confocal fluorescence as well as transmission electron microscopy (TEM), with the aim of investigating their potential as tools for cellular biology. These systems displaying a non-toxic profile with favourable photophysical properties may have application across various biological fields including diagnostics and therapeutics.
Spectroscopic surveys of LAMOST
International Nuclear Information System (INIS)
Zhao Yongheng
2015-01-01
The Large Sky Area Multi-Object Fiber Spectroscopic Telescope (LAMOST), a new type of reflecting Schmidt telescope, has been designed and produced in China. It marks a breakthrough for large scale spectroscopic survey observation in that both large aperture and wide field of view have been achieved. LAMOST has the highest spectrum acquisition rate, and from October 2011 to June 2014 it has obtained 4.13 million spectra of celestial objects, of which 3.78 million are spectra of stars, with the stellar parameters of 2.20 million stars included. (author)
Mechanical contrast in spectroscopic magnetomotive optical coherence elastography
International Nuclear Information System (INIS)
Ahmad, Adeel; Huang, Pin-Chieh; Sobh, Nahil A; Pande, Paritosh; Kim, Jongsik; Boppart, Stephen A
2015-01-01
The viscoelastic properties of tissues are altered during pathogenesis of numerous diseases and can therefore be a useful indicator of disease status and progression. Several elastography studies have utilized the mechanical frequency response and the resonance frequencies of tissue samples to characterize their mechanical properties. However, using the resonance frequency as a source of mechanical contrast in heterogeneous samples is complicated because it not only depends on the viscoelastic properties but also on the geometry and boundary conditions. In an elastography technique called magnetomotive optical coherence elastography (MM-OCE), the controlled movement of magnetic nanoparticles (MNPs) within the sample is used to obtain the mechanical properties. Previous demonstrations of MM-OCE have typically used point measurements in elastically homogeneous samples assuming a uniform concentration of MNPs. In this study, we evaluate the feasibility of generating MM-OCE elastograms in heterogeneous samples based on a spectroscopic approach which involves measuring the magnetomotive response at different excitation frequencies. Biological tissues and tissue-mimicking phantoms with two elastically distinct regions placed in side-by-side and bilayer configurations were used for the experiments, and finite element method simulations were used to validate the experimental results. (paper)
Maffeo, C.; Yoo, J.; Comer, J.; Wells, D. B.; Luan, B.; Aksimentiev, A.
2014-01-01
Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena and we review the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field. PMID:25238560
Maffeo, C; Yoo, J; Comer, J; Wells, D B; Luan, B; Aksimentiev, A
2014-10-15
Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena. We also discuss the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field.
DNA binding properties of the small cascade subunit Csa5.
Directory of Open Access Journals (Sweden)
Michael Daume
Full Text Available CRISPR-Cas systems provide immunity against viral attacks in archaeal and bacterial cells. Type I systems employ a Cas protein complex termed Cascade, which utilizes small CRISPR RNAs to detect and degrade the exogenic DNA. A small sequence motif, the PAM, marks the foreign substrates. Previously, a recombinant type I-A Cascade complex from the archaeon Thermoproteus tenax was shown to target and degrade DNA in vitro, dependent on a native PAM sequence. Here, we present the biochemical analysis of the small subunit, Csa5, of this Cascade complex. T. tenax Csa5 preferentially bound ssDNA and mutants that showed decreased ssDNA-binding and reduced Cascade-mediated DNA cleavage were identified. Csa5 oligomerization prevented DNA binding. Specific recognition of the PAM sequence was not observed. Phylogenetic analyses identified Csa5 as a universal member of type I-A systems and revealed three distinct groups. A potential role of Csa5 in R-loop stabilization is discussed.
Electronic Properties of Functional Biomolecules at Metal/Aqueous Solution Interfaces
DEFF Research Database (Denmark)
Zhang, Jingdong; Chi, Qijin; Kuznetsov, A.M.
2002-01-01
in electronic properties and stochastic single-molecule features and can be probed by new methods which approach the single-molecule level. Olle of these is in situ scanning tunneling microscopy (STM) in which single-molecule electronic properties directly in aqueous solution are probed. In situ STM combined...... with physical electrochemistry, single-crystal electrodes, and spectroscopic methods is now a new dimension in interfacial bioelectrochemistry. We overview first same approaches to spectroscopic single-molecule imaging, including fluorescence spectroscopy, chemical reaction dynamics, atomic force microscopy...
THE zCOSMOS 10k-BRIGHT SPECTROSCOPIC SAMPLE
International Nuclear Information System (INIS)
Lilly, Simon J.; Maier, Christian; Carollo, Marcella; Caputi, Karina; Le Brun, Vincent; Kneib, Jean-Paul; Le Fevre, Olivier; De la Torre, Sylvain; De Ravel, Loic; Mainieri, Vincenzo; Mignoli, Marco; Zamorani, Gianni; Bardelli, Sandro; Bolzonella, Micol; Coppa, Graziano; Scodeggio, Marco; Contini, Thierry; Renzini, Alvio; Bongiorno, Angela; Cucciati, Olga
2009-01-01
We present spectroscopic redshifts of a large sample of galaxies with I AB -1 , independent of redshift. The reliability of individual redshifts is described by a Confidence Class that has been empirically calibrated through repeat spectroscopic observations of over 600 galaxies. There is very good agreement between spectroscopic and photometric redshifts for the most secure Confidence Classes. For the less secure Confidence Classes, there is a good correspondence between the fraction of objects with a consistent photometric redshift and the spectroscopic repeatability, suggesting that the photometric redshifts can be used to indicate which of the less secure spectroscopic redshifts are likely right and which are probably wrong, and to give an indication of the nature of objects for which we failed to determine a redshift. Using this approach, we can construct a spectroscopic sample that is 99% reliable and which is 88% complete in the sample as a whole, and 95% complete in the redshift range 0.5 < z < 0.8. The luminosity and mass completeness levels of the zCOSMOS-bright sample of galaxies is also discussed.
Single-molecule mechanics of protein-labelled DNA handles
Directory of Open Access Journals (Sweden)
Vivek S. Jadhav
2016-01-01
Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular
Precise Coating of a Wide Range of DNA Templates by a Protein Polymer with a DNA Binding Domain
Hernandez-Garcia, Armando; Estrich, Nicole A.; Werten, Marc W.T.; Maarel, van der Johan R.C.; Labean, Thomas H.; Wolf, de Frits A.; Cohen Stuart, Martien A.; Vries, de Renko
2017-01-01
Emerging DNA-based nanotechnologies would benefit from the ability to modulate the properties (e.g., solubility, melting temperature, chemical stability) of diverse DNA templates (single molecules or origami nanostructures) through controlled, self-assembling coatings. We here introduce a DNA
Spectroscopic properties of transition elements and their related magnetic properties
International Nuclear Information System (INIS)
Porcher, P.; Malta, O.L.
1988-01-01
The optical and magnetic properties of transition elements (nd N and nf N ions) are analysed. The phenomenological parameters introduced in the crystal-ligand field theory, the free ion interactions and crystalline matrix as well as electrostatic repulsion are studied. (M.J.C.) [pt
Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V
2017-07-21
DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.
Dimitrov, Valentin V.
2009-01-01
This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…
Energy Technology Data Exchange (ETDEWEB)
Muhammad, Fahmi Fariq, E-mail: fahmi982@gmail.com [Low Dimensional Materials Research Center, Department of Physics, Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Department of Physics, Faculty of Science and Engineering, University of Koya, Koya, Kurdistan Region (Iraq); Sulaiman, Khaulah [Low Dimensional Materials Research Center, Department of Physics, Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia)
2011-10-03
Highlights: {yields} Achieving a broad absorption band for Gaq3 covering the whole UV and some parts of visible spectra. {yields} Increasing photoluminescence emission to five times stronger than that of pristine film. {yields} Conformational changes towards the formation of crystalline {alpha}-Gaq3 polymorph. {yields} Determination of glass transition temperature for Gaq3 (T{sub g} 182 deg. C) and Alq3 (T{sub g} = 173 deg. C). {yields} Improving and understanding the physical properties of Gaq3 film by means of thermal treatment. - Abstract: In this study we report the optical, spectroscopic, and structural properties of vacuum deposited tris (8-hydroxyquinolinate) gallium film upon thermal annealing in the temperature range from 85 deg. C to 255 deg. C under a flowing nitrogen gas for 10 min. The optical UV-vis-NIR and luminescence spectroscopy measurements were performed to estimate the absorption bands, optical energy gap (E{sub g}), and photoluminescence (PL) of the films. Fourier transform infrared (FTIR) spectroscopy and X-ray diffraction (XRD) techniques were used to probe the spectroscopic and structural nature of the films. We show that, by annealing the films from 85 deg. C to 235 deg. C, it is possible to achieve an enhanced absorption and increased photoluminescence to five times stronger than that of the pristine film. The PL quenching at 255 deg. C was attributed to the presence of plainer chains allow easy going for excitons to a long distance due to the crystalline region formation of {alpha}-Gaq3 polymorph. The reduction in E{sub g} and infrared absorption bands upon annealing were referred to the enhancement in {pi}-{pi} interchain interaction and conformational changes by re-arrangement of the Gaq3 quinolinate ligands, respectively. Stokes shift for the films were observed and calculated. From the differential scanning calorimetry, DSC measurements, higher glass transition temperature was observed for Gaq3 (T{sub g} = 182 deg. C) compared to
International Nuclear Information System (INIS)
Buanam-Om, C.
1981-01-01
The chapter of reviews presents in particular the Badger-Bauer-rule, distance and angle dependence of O-H...Y hydrogen bond and the structure of aqueous electrolyte solutions. A chapter of vibrational spectroscopic investigations of crystalline hydrates - metal perchlorate hydrates follows. Two further chapters just so investigate metal halide hydrates and some sulfate hydrates and related systems. The following chapter describes near infrared spectroscopic investigations of HOD(D 2 O) and its electrolyte solutions. The concluding chapter contains thermodynamic consequences and some properties of electrolyte solutions from vibrational spectroscopic investigations. (SPI) [de
Energy Technology Data Exchange (ETDEWEB)
Gupta, Gaurav; Sontakke, Atul D.; Karmakar, P.; Biswas, K.; Balaji, S.; Saha, R.; Sen, R.; Annapurna, K., E-mail: annapurnak@cgcri.res.in
2014-05-01
The present investigation reports, influence of bismuth addition on structural, elastic and spectral properties of [(99.5−x) {4ZnO−3B_2O_3}−0.5Nd{sub 2}O{sub 3}−x Bi{sub 2}O{sub 3} where x=0, 5, 10, 20, 30, 40, 50 and 60] glasses. The measured FTIR reflectance spectra facilitated a thorough insight of methodical modifications that are arising in the glass structure from borate (build by BO{sub 3} and BO{sub 4} units) to bismuthate (BiO{sub 3} and BiO{sub 6} units) network due to the increase of bismuth content ensuing with a steady decrease in host phonon energy (ν{sub ph}). The elastic properties estimated from measured longitudinal and shear ultrasonic velocities (U{sub L} and U{sub s}) demonstrated the reduction in network rigidity of glasses on Bi{sub 2}O{sub 3} inclusion. The three phenomenological Judd–Ofelt intensity parameters (Ω{sub 2,4,6}) were obtained from recorded absorption spectra of Nd{sup 3+} ions in these glasses and have been used to predict radiative properties as a function of variation in bismuth content. The reduced host phonon energy and high optical basicity effect due to Bi{sub 2}O{sub 3} incorporation remarkably improved the Nd{sup 3+} luminescence properties such as emission intensity, quantum yield and emission cross-section. The quantum yield showed a strong increase from mere 16% in Zinc–Borate glass to almost 73% in 60 mol% Bi{sub 2}O{sub 3} containing glass. Similarly, the emission cross-section for Nd{sup 3+4}F{sub 3/2}→{sup 4}I{sub 11/2} laser transition raised from 2.43×10{sup −20} cm{sup 2} to 3.95×10{sup −20} cm{sup 2} in studied concentration suggesting a strong improvement in Nd{sup 3+} laser spectroscopic properties in Zinc–Boro-Bismuthate glass. These materials may be promising for compact solid state infrared lasers. - Highlights: • Continuous structural changes associated with reduction in host phonon energy by Bi{sub 2}O{sub 3} inclusion. • Ultrasonic velocity study revealed reduced Debye
Spectroscopic enhancement in nanoparticles embedded glasses
Energy Technology Data Exchange (ETDEWEB)
Sahar, M. R., E-mail: mrahim057@gmail.com; Ghoshal, S. K., E-mail: mrahim057@gmail.com [Advanced Optical Material Research Group, Department of Physics, Faculty of Science, Universiti Teknologi Malaysia, 81310, Skudai, Johor Bahru, Johor (Malaysia)
2014-09-25
This presentation provides an overview of the recent progress in the enhancement of the spectroscopic characteristics of the glass embedded with nanoparticles (NPs). Some of our research activities with few significantly new results are highlighted and facilely analyzed. The science and technology dealing with the manipulation of the physical properties of rare earth doped inorganic glasses by embedding metallic NPs or nanoclusters produce the so-called 'nanoglass'. Meanwhile, the spectroscopic enhancement relates the intensity of the luminescence measured at certain transition. The enhancement which expectedly due to the 'plasmonics wave' (referring to the coherent coupling of photons to free electron oscillations called plasmon) occurs at the interface between a conductor and a dielectric. Plasmonics being an emerging concept in advanced optical material of nanophotonics has given this material the ability to exploit the optical response at nanoscale and opened up a new avenue in metal-based glass optics. There is a vast array of plasmonic NPs concepts yet to be explored, with applications spanning solar cells, (bio) sensing, communications, lasers, solid-state lighting, waveguides, imaging, optical data transfer, display and even bio-medicine. Localized surface plasmon resonance (LSPR) can enhance the optical response of nanoglass by orders of magnitude as observed. The luminescence enhancement and surface enhanced Raman scattering (SERS) are new paradigm of research. The enhancement of luminescence due to the influence of metallic NPs is the recurring theme of this paper.
International Nuclear Information System (INIS)
Erzgraber, G.; Kozubek, S.; Lapidus, I.L.
1985-01-01
The dependence of the relative sedimentation velocity of DNA-membrane complexes on the dose of irradiation and time of incubation of Chinese Hamster cells is analysed. It is concluded that the initial part of the curve provides the information on the occurrence of single strand breaks in DNA; the position of the local maximum allows us to calculate the yield of DNA double strand breaks. The reparation decay constant can be estimated as well
Directory of Open Access Journals (Sweden)
Nicoleta E. Dina
2016-05-01
Full Text Available In this work, surface-enhanced Raman spectra of ten genomic DNAs extracted from leaf tissues of different grapevine (Vitis vinifera L. varieties, respectively, are analyzed in the wavenumber range 300–1800 cm−1. Furthermore, structural changes induced in grapevine genomic nucleic acids upon femtosecond (170 fs infrared (IR laser pulse irradiation (λ = 1100 nm are discussed in detail for seven genomic DNAs, respectively. Surface-enhanced Raman spectroscopy (SERS signatures, vibrational band assignments and structural characterization of genomic DNAs are reported for each case. As a general observation, the wavenumber range between 1500 and 1660 cm−1 of the spectra seems to be modified upon laser treatment. This finding could reflect changes in the base-stacking interactions in DNA. Spectral shifts are mainly attributed to purines (dA, dG and deoxyribose. Pyrimidine residues seem to be less affected by IR femtosecond laser pulse irradiation. Furthermore, changes in the conformational properties of nucleic acid segments are observed after laser treatment. We have found that DNA isolated from Feteasca Neagra grapevine leaf tissues is the most structurally-responsive system to the femtosecond IR laser irradiation process. In addition, using unbiased computational resources by means of principal component analysis (PCA, eight different grapevine varieties were discriminated.
International Nuclear Information System (INIS)
Potocnak, Ivan; Vavra, Martin; Cizmar, Erik; Kajnakova, Marcela; Radvakova, Alena; Steinborn, Dirk; Zvyagin, Sergei A.; Wosnitza, Jochen; Feher, Alexander
2009-01-01
The synthesis, structural analysis, spectroscopic studies, susceptibility and specific-heat measurements of {[Cu(bmen) 2 ][Pt(CN) 4 ]} n (bmen=N,N'-dimethylethylenediamine) are presented. X-ray crystal-structure analysis revealed that the [Pt(CN) 4 ] 2- building blocks are combined with [Cu(bmen) 2 ] 2+ units to form a chain-like structure along the a axis. The Cu(II) atoms are hexacoordinated by four nitrogen atoms in the equatorial plane belonging to two molecules of bidentate bmen ligands with average Cu-N distance of 2.043(18) A. The axial positions are occupied by two nitrogen atoms from bridging [Pt(CN) 4 ] 2- anions at a longer axial Cu-N distance of 2.490(4) A. The compound is characterized by the presence of a weak antiferromagnetic exchange coupling J/k B =0.6 K. Despite the one-dimensional (1D) character of the structure, the analysis of the magnetic properties and specific heat at very low temperatures shows that [Cu(bmen) 2 ][Pt(CN) 4 ] behaves as a two-dimensional (2D) square-lattice Heisenberg magnet with weak interlayer coupling. - Graphical abstract: The synthesis, structural analysis, spectroscopic studies, susceptibility and specific-heat measurements of {[Cu(bmen) 2 ][Pt(CN) 4 ]} n (bmen=N,N'-dimethylethylenediamine) are presented. X-ray crystal-structure analysis revealed that the [Pt(CN) 4 ] 2- building blocks are combined with [Cu(bmen) 2 ] 2+ units to form a chain-like structure. The compound is characterized by the presence of a weak antiferromagnetic exchange coupling J/k B =-0.6 K. Despite the one-dimensional character of the structure, the analysis of the magnetic properties and specific heat at very low temperatures shows that [Cu(bmen) 2 ][Pt(CN) 4 ] behaves as a two-dimensional square-lattice Heisenberg magnet with weak interlayer coupling
International Nuclear Information System (INIS)
Navarro, Maribel; Betancourt, Adelmo; Hernandez, Clara; Marchan, Edgar
2008-01-01
This paper describes the search for new potential chemotherapeutic agents based on transition metal complexes with planar ligands. In this study, palladium polypyridyl complexes were synthesized and characterized by elemental analysis, NMR, UV-VIS and IR spectroscopies. The interaction of the complexes with DNA was also investigated by spectroscopic methods. All metal-to-ligand charge transfer (MLCT) bands of the palladium polypyridyl complexes exhibited hypochromism and red shift in the presence of DNA. The binding constant and viscosity data suggested that the complexes [PdCl 2 (phen)] and [PdCl 2 (phendiamine)] interact with DNA by electrostatic forces. Additionally, these complexes induced an important leishmanistatic effect on L. (L.) mexicana promastigotes at the final concentration of 10 μmol L -1 in 48 h. (author)
Optical spectroscopic elucidation of beta-turns in disulfide bridged cyclic tetrapeptides.
Borics, Attila; Murphy, Richard F; Lovas, Sándor
2007-01-01
Vibrational circular dichroism (VCD) spectroscopic features of type II beta-turns were characterized previously, but, criteria for differentiation between beta-turn types had not been established yet. Model tetrapeptides, cyclized through a disulfide bridge, were designed on the basis of previous experimental results and the observed incidence of amino acid residues in the i + 1 and i + 2 positions in beta-turns, to determine the features of VCD spectra of type I and II beta-turns. The results were correlated with electronic circular dichroism (ECD) spectra and VCD spectra calculated from conformational data obtained by molecular dynamics (MD) simulations. All cyclic tetrapeptides yielded VCD signals with a higher frequency negative and a lower frequency positive couplet with negative lobes overlapping. MD simulations confirmed the conformational homogeneity of these peptides in solution. Comparison with ECD spectroscopy, MD, and quantum chemical calculation results suggested that the low frequency component of VCD spectra originating from the tertiary amide vibrations could be used to distinguish between types of beta-turn structures. On the basis of this observation, VCD spectroscopic features of type II and VIII beta-turns and ECD spectroscopic properties of a type VIII beta-turn were suggested. The need for independent experimental as well as theoretical investigations to obtain decisive conformational information was recognized. Copyright 2006 Wiley Periodicals, Inc.
Composition and immuno-stimulatory properties of extracellular DNA from mouse gut flora.
Qi, Ce; Li, Ya; Yu, Ren-Qiang; Zhou, Sheng-Li; Wang, Xing-Guo; Le, Guo-Wei; Jin, Qing-Zhe; Xiao, Hang; Sun, Jin
2017-11-28
To demonstrate that specific bacteria might release bacterial extracellular DNA (eDNA) to exert immunomodulatory functions in the mouse small intestine. Extracellular DNA was extracted using phosphate buffered saline with 0.5 mmol/L dithiothreitol combined with two phenol extractions. TOTO-1 iodide, a cell-impermeant and high-affinity nucleic acid stain, was used to confirm the existence of eDNA in the mucus layers of the small intestine and colon in healthy Male C57BL/6 mice. Composition difference of eDNA and intracellular DNA (iDNA) of the small intestinal mucus was studied by Illumina sequencing and terminal restriction fragment length polymorphism (T-RFLP). Stimulation of cytokine production by eDNA was studied in RAW264.7 cells in vitro . TOTO-1 iodide staining confirmed existence of eDNA in loose mucus layer of the mouse colon and thin surface mucus layer of the small intestine. Illumina sequencing analysis and T-RFLP revealed that the composition of the eDNA in the small intestinal mucus was significantly different from that of the iDNA of the small intestinal mucus bacteria. Illumina Miseq sequencing showed that the eDNA sequences came mainly from Gram-negative bacteria of Bacteroidales S24-7. By contrast, predominant bacteria of the small intestinal flora comprised Gram-positive bacteria. Both eDNA and iDNA were added to native or lipopolysaccharide-stimulated Raw267.4 macrophages, respectively. The eDNA induced significantly lower tumor necrosis factor-α/interleukin-10 (IL-10) and IL-6/IL-10 ratios than iDNA, suggesting the predominance for maintaining immune homeostasis of the gut. Our results indicated that degraded bacterial genomic DNA was mainly released by Gram-negative bacteria, especially Bacteroidales-S24-7 and Stenotrophomonas genus in gut mucus of mice. They decreased pro-inflammatory activity compared to total gut flora genomic DNA.
DNA nanotechnology-enabled biosensors.
Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai
2016-02-15
Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Chen, Hua-Yan; Wei, Jing-Ru; Pan, Jiong-Xiu; Zhang, Wei; Dang, Fu-Quan; Zhang, Zhi-Qi; Zhang, Jing
2017-05-15
5-hydroxymethylcytosine (5hmC) is the sixth base of DNA. It is involved in active DNA demethylation and can be a marker of diseases such as cancer. In this study, we developed a simple and sensitive 2-(4-boronophenyl)quinoline-4-carboxylic acid modified poly (glycidyl methacrylate (PBAQA-PGMA) fluorescent probe to detect the 5hmC content of genomic DNA based on T4 β-glucosyltransferase-catalyzed glucosylation of 5hmC. The fluorescence-enhanced intensity recorded from the DNA sample was proportional to its 5-hydroxymethylcytosine content and could be quantified by fluorescence spectrophotometry. The developed probe showed good detection sensitivity and selectivity and a good linear relationship between the fluorescence intensity and the concentration of 5 hmC within a 0-100nM range. Compared with other fluorescence detection methods, this method not only could determine trace amounts of 5 hmC from genomic DNA but also could eliminate the interference of fluorescent dyes and the need for purification. It also could avoid multiple labeling. Because the PBAQA-PGMA probe could enrich the content of glycosyl-5-hydroxymethyl-2-deoxycytidine from a complex ground substance, it will broaden the linear detection range and improve sensitivity. The limit of detection was calculated to be 0.167nM after enrichment. Furthermore, the method was successfully used to detect 5-hydroxymethylcytosine from mouse tissues. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Gasparro, F.P.; Santella, R.M.
1988-01-01
The direct photomodification of DNA by ultraviolet light or the photo-induced addition of exogenous compounds to DNA components results in alterations of DNA structure ranging from subtle to profound. There are two consequences of these conformational changes. First, cells in which the DNA has been damaged are capable of executing repair steps. Second, the DNA which is usually of very low immunogenicity now becomes highly antigenic. This latter property has allowed the production of a series of monoclonal antibodies that recognize photo-induced DNA damage. Monoclonal antibodies have been generated that recognize the 4',5'-monoadduct and the crosslink of 8-methoxypsoralen in DNA. In addition, another antibody has been prepared which recognizes the furan-side monoadduct of 6,4,4'-trimethylangelicin in DNA. These monoclonal antibodies have been characterized as to sensitivity and specificity using non-competitive and competitive enzyme-linked-immunosorbent assays (ELISA). (author)
Energy Technology Data Exchange (ETDEWEB)
Gasparro, F P; Santella, R M
1988-09-01
The direct photomodification of DNA by ultraviolet light or the photo-induced addition of exogenous compounds to DNA components results in alterations of DNA structure ranging from subtle to profound. There are two consequences of these conformational changes. First, cells in which the DNA has been damaged are capable of executing repair steps. Second, the DNA which is usually of very low immunogenicity now becomes highly antigenic. This latter property has allowed the production of a series of monoclonal antibodies that recognize photo-induced DNA damage. Monoclonal antibodies have been generated that recognize the 4',5'-monoadduct and the crosslink of 8-methoxypsoralen in DNA. In addition, another antibody has been prepared which recognizes the furan-side monoadduct of 6,4,4'-trimethylangelicin in DNA. These monoclonal antibodies have been characterized as to sensitivity and specificity using non-competitive and competitive enzyme-linked-immunosorbent assays (ELISA).
Antioxidant and cyto/DNA protective properties of apple pomace enriched bakery products.
Sudha, M L; Dharmesh, Shylaja M; Pynam, Hasitha; Bhimangouder, Shivaleela V; Eipson, Sushma W; Somasundaram, Rajarathnam; Nanjarajurs, Shashirekha M
2016-04-01
Apple pomace (AP), the residue that remains after the extraction of juice from apple accounts for ~25 % of total apple weight. Current study is aimed at identification of phytochemicals and utilization of Dehydrated apple pomace (DAP) in the preparation of bakery products with potential health benefits. DAP was prepared by drying the pomace obtained by crushing peeled apple fruits. DAP was incorporated into bakery products such as bun, muffin and cookies for value addition. Bioactivity such as free radical scavenging, cyto/DNA protectivity was evaluated in these products. DAP contained 17 g/100 g starch, 49.86 g/100 g fructose and 37 g/100 g dietary fibre. The phenolics and flavonoids content was 1.5 mg/g and 3.92 mg/g, respectively. Increase in DAP resulted in decreased volume and enhanced firmness of buns and muffins. DAP at 15 % in buns, 30 % in muffins and 20 % in cookies were found to be acceptable. DAP blended products exhibited better free radical scavenging as well as cyto/DNA protective properties suggesting the retention of bioactivity after baking. Addition of DAP potentially enhanced the bioactivity of the products evaluated.
Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard
2012-11-01
8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127
Halogen-containing thiazole orange analogues – new fluorogenic DNA stains
Directory of Open Access Journals (Sweden)
Aleksey A. Vasilev
2017-12-01
Full Text Available Novel asymmetric monomeric monomethine cyanine dyes 5a–d, which are analogues of the commercial dsDNA fluorescence binder thiazole orange (TO, have been synthesized. The synthesis was achieved by using a simple, efficient and environmetally benign synthetic procedure to obtain these cationic dyes in good to excellent yields. Interactions of the new derivatives of TO with dsDNA have been investigated by absorption and fluorescence spectroscopy. The longest wavelength absorption bands in the UV–vis spectra of the target compounds are in the range of 509–519 nm and these are characterized by high molar absorptivities (63000–91480 L·mol−1·cm−1. All investigated dyes from the series are either not fluorescent or their fluorescence is quite low, but they become strongly fluorescent after binding to dsDNA. The influence of the substituents attached to the chromophores was investigated by combination of spectroscopic (UV–vis and fluorescence spectroscopy and theoretical (DFT and TDDFT calculations methods.
Zhang, Wei; Yao, Di; Wei, Yi; Tang, Jie; Bian, He-Dong; Huang, Fu-Ping; Liang, Hong
2016-06-01
Four different transition metal complexes containing dipyridyl triazole ligands, namely [Cu(abpt)2Cl2]·2H2O (1), [Cu(abpt)2(ClO4)2] (2), [Co2(abpt)2(H2O)2Cl2]·Cl2·4H2O (3) and [Co2(Hbpt)2(CH3OH)2(NO3)2] (4) have been designed, synthesized and further structurally characterized by X-ray crystallography, ESI-MS, elemental analysis, IR and Raman spectroscopy. In these complexes, the both ligands act as bidentate ligands with N, N donors. DNA binding interactions with calf thymus DNA (ct-DNA) of the ligand and its complexes 1 ~ 4 were investigated via electronic absorption, fluorescence quenching, circular dichroism and viscosity measurements as well as confocal Laser Raman spectroscopy. The results show these complexes are able to bind to DNA via the non-covalent mode i.e. intercalation and groove binding or electrostatic interactions. The interactions with bovine serum albumin (BSA) were also studied using UV-Vis and fluorescence spectroscopic methods which indicated that fluorescence quenching of BSA by these compounds was the presence of both static and dynamic quenching. Moreover, the in vitro cytotoxic effects of the complexes against four cell lines SK-OV-3, HL-7702, BEL7404 and NCI-H460 showed the necessity of the coordination action on the biological properties on the respective complex and that all four complexes exhibited substantial cytotoxic activity.
Jaiswal, Jyoti; Mourya, Satyendra; Malik, Gaurav; Chandra, Ramesh
2018-05-01
In the present work, we have fabricated plasmonic gold/alumina nanocomposite (Au/Al 2 O 3 NC) thin films on a glass substrate at room temperature by RF magnetron co-sputtering. The influence of the film thickness (∼10-40 nm) on the optical and other physical properties of the samples was investigated and correlated with the structural and compositional properties. The X-ray diffractometer measurement revealed the formation of Au nanoparticles with average crystallite size (5-9.2 nm) embedded in an amorphous Al 2 O 3 matrix. The energy-dispersive X ray and X-ray photoelectron spectroscopy results confirmed the formation of Au/Al 2 O 3 NC quantitatively and qualitatively and it was observed that atomic% of Au increased by increasing thickness. The optical constants of the plasmonic Au/Al 2 O 3 NC thin films were examined by variable angle spectroscopic ellipsometry in the wide spectral range of 246-1688 nm, accounting the surface characteristics in the optical stack model, and the obtained results are expected to be unique. Additionally, a thickness-dependent blueshift (631-590 nm) of surface plasmon resonance peak was observed in the absorption spectra. These findings of the plasmonic Au/Al 2 O 3 NC films may allow the design and fabrication of small, compact, and efficient devices for optoelectronic and photonic applications.
Directory of Open Access Journals (Sweden)
Leonhardt Heinrich
2007-09-01
Full Text Available Abstract Background Genome integrity is constantly challenged and requires the coordinated recruitment of multiple enzyme activities to ensure efficient repair of DNA lesions. We investigated the dynamics of XRCC1 and PCNA that act as molecular loading platforms and play a central role in this coordination. Results Local DNA damage was introduced by laser microirradation and the recruitment of fluorescent XRCC1 and PCNA fusion proteins was monitored by live cell microscopy. We found an immediate and fast recruitment of XRCC1 preceding the slow and continuous recruitment of PCNA. Fluorescence bleaching experiments (FRAP and FLIP revealed a stable association of PCNA with DNA repair sites, contrasting the high turnover of XRCC1. When cells were repeatedly challenged with multiple DNA lesions we observed a gradual depletion of the nuclear pool of PCNA, while XRCC1 dynamically redistributed even to lesions inflicted last. Conclusion These results show that PCNA and XRCC1 have distinct kinetic properties with functional consequences for their capacity to respond to successive DNA damage events.
Mortusewicz, Oliver; Leonhardt, Heinrich
2007-01-01
Background Genome integrity is constantly challenged and requires the coordinated recruitment of multiple enzyme activities to ensure efficient repair of DNA lesions. We investigated the dynamics of XRCC1 and PCNA that act as molecular loading platforms and play a central role in this coordination. Results Local DNA damage was introduced by laser microirradation and the recruitment of fluorescent XRCC1 and PCNA fusion proteins was monitored by live cell microscopy. We found an immediate and fast recruitment of XRCC1 preceding the slow and continuous recruitment of PCNA. Fluorescence bleaching experiments (FRAP and FLIP) revealed a stable association of PCNA with DNA repair sites, contrasting the high turnover of XRCC1. When cells were repeatedly challenged with multiple DNA lesions we observed a gradual depletion of the nuclear pool of PCNA, while XRCC1 dynamically redistributed even to lesions inflicted last. Conclusion These results show that PCNA and XRCC1 have distinct kinetic properties with functional consequences for their capacity to respond to successive DNA damage events. PMID:17880707
A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F
DEFF Research Database (Denmark)
Helin, K; Lees, J A; Vidal, M
1992-01-01
The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...
Moradi, Zohreh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam
2018-02-01
In order to evaluate biological potential of a novel synthesized complex [Nd(dmp) 2 Cl 3 .OH 2 ] where dmp is 29-dimethyl 110-phenanthroline, the DNA-binding, cleavage, BSA binding, and antimicrobial activity properties of the complex are investigated by multispectroscopic techniques study in physiological buffer (pH 7.2).The intrinsic binding constant (K b ) for interaction of Nd(III) complex and FS-DNA is calculated by UV-Vis (K b = 2.7 ± 0.07 × 10 5 ) and fluorescence spectroscopy (K b = 1.13 ± 0.03 × 10 5 ). The Stern-Volmer constant (K SV ), thermodynamic parameters including free energy change (ΔG°), enthalpy change (∆H°), and entropy change (∆S°), are calculated by fluorescent data and Vant' Hoff equation. The experimental results show that the complex can bind to FS-DNA and the major binding mode is groove binding. Meanwhile, the interaction of Nd(III) complex with protein, bovine serum albumin (BSA), has also been studied by using absorption and emission spectroscopic tools. The experimental results show that the complex exhibits good binding propensity to BSA. The positive ΔH° and ∆S° values indicate that the hydrophobic interaction is main force in the binding of the Nd(III) complex to BSA, and the complex can quench the intrinsic fluorescence of BSA remarkably through a static quenching process. Also, DNA cleavage was investigated by agarose gel electrophoresis that according to the results cleavage of DNA increased with increasing of concentration of the complex. Antimicrobial screening test gives good results in the presence of Nd(III) complex system.
Spectroscopic analysis of optoelectronic semiconductors
Jimenez, Juan
2016-01-01
This book deals with standard spectroscopic techniques which can be used to analyze semiconductor samples or devices, in both, bulk, micrometer and submicrometer scale. The book aims helping experimental physicists and engineers to choose the right analytical spectroscopic technique in order to get specific information about their specific demands. For this purpose, the techniques including technical details such as apparatus and probed sample region are described. More important, also the expected outcome from experiments is provided. This involves also the link to theory, that is not subject of this book, and the link to current experimental results in the literature which are presented in a review-like style. Many special spectroscopic techniques are introduced and their relationship to the standard techniques is revealed. Thus the book works also as a type of guide or reference book for people researching in optical spectroscopy of semiconductors.
Spectroscopic and tribological studies of the interactions between β-lactoglobulin and mucins
DEFF Research Database (Denmark)
Celebioglu, Hilal Yilmaz; Guðjónsdóttir, María; Chronakis, Ioannis S.
to understand the interaction mechanisms of food proteins-saliva/gastrointestinal fluid ona molecular level, we have selected β-lactoglobulin (BLG) and mucins (bovine submaxillarymucin (BSM) and porcine gastric mucin (PGM)) as representative macromolecules of food proteins and saliva/gastric juice, respectively...... stress. The combined spectroscopic and lubricating properties of BLG and mucins provided advanced understanding on the molecular level interaction between two macromolecules, representing food proteins and bodily fluids.......Proteins are important ingredients for food products in terms of providing desirable textural,sensory, and nutritional properties. In oral processing, food products are continuously mixed with saliva and it is the resulting aggregates that are ultimately consumed by human body. In order...
Spectroscopic and asteroseismic analysis of the remarkable main-sequence A star KIC 11145123
DEFF Research Database (Denmark)
Takada-Hidai, Masahide; Kurtz, Donald W.; Shibahashi, Hiromoto
2017-01-01
A spectroscopic analysis was carried out to clarify the properties of KIC 11145123 - the first main-sequence star with a directly measured core-to-surface rotation profile - based on spectra observed with the High Dispersion Spectrograph (HDS) of the Subaru telescope. The atmospheric parameters (T......-eff = 7600 K, log g = 4.2, xi = 3.1 kms(-1) and [Fe/H] = -0.71 dex), the radial and rotation velocities, and elemental abundances were obtained by analysing line strengths and fitting line profiles, which were calculated with a 1D LTE model atmosphere. The main properties of KIC 11145123 are: (1) a low [Fe...
Zając, A.; Dymińska, L.; Lorenc, J.; Ptak, M.; Hanuza, J.
2018-03-01
Silver phytate IP6, IP6Ag, IP6Ag2 and IP6Ag3 complexes in the solid state have been synthesized changing the phosphate to metal mole ratio. The obtained products have been characterized by means of chemical and spectroscopic studies. Attenuated total reflection Fourier transform infrared technique and Raman microscope were used in the measurements. These results were discussed in terms of DFT (Density Functional Theory) quantum chemical calculations using the B3LYP/6-31G(d,p) approach. The molecular structures of these compounds have been proposed on the basis of group theory and geometry optimization taking into account the shape and the number of the observed bands corresponding to the stretching and bending vibrations of the phosphate group and metal-oxygen polyhedron. The role of inter- and intra-hydrogen bonds in stabilization of the structure has been discussed. It was found that three types of hydrogen bonds appear in the studied compounds: terminal, and those engaged in the inter- and intra-molecular interactions. The Fermi resonance as a result of the strong intra-molecular Osbnd H⋯O hydrogen bonds was discovered. Electron absorption spectra have been measured to characterize the electron properties of the studied complexes and their local symmetry.
Spectroscopic properties of Er3+ and Yb3+ co-doped glass ceramics containing SrF2 nanocrystals
International Nuclear Information System (INIS)
Qiao Xvsheng; Fan Xianping; Wang Minquan; Zhang Xianghua
2009-01-01
The spectroscopic properties of Er 3+ /Yb 3+ co-doped 50SiO 2 -10Al 2 O 3 -20ZnF 2 -20SrF 2 glass and glass ceramic containing SrF 2 nanocrystals were investigated. The formation of SrF 2 nanocrystals in the glass ceramic was confirmed by XRD. The oscillator strengths for several transitions of the Er 3+ ions in the glass ceramic have been obtained and the Judd-Ofelt parameters were then determined. The XRD result and Judd-Ofelt parameters suggested that Er 3+ and Yb 3+ ions had efficiently enriched in the SrF 2 nanocrystals in the glass ceramic. The lifetime of excited states has been used to reveal the surroundings of luminescent Er 3+ and Yb 3+ and energy transfer (ET) mechanism between Er 3+ and Yb 3+ . Much stronger upconversion luminescence and longer lifetime of the Er 3+ /Yb 3+ co-doped glass ceramic were observed in comparison with the Er 3+ /Yb 3+ co-doped glass, which could be ascribed to more efficient ET from Yb 3+ to Er 3+ due to the enrichment of Yb 3+ and Er 3+ and the shortening of the distance between lanthanide ions in the precipitated SrF 2 nanocrystals.
Properties of symbiotic stars from studies in the optical region
International Nuclear Information System (INIS)
Ciatti, F.
1982-01-01
The author uses observations of symbiotic stars in the optical region to discuss the following aspects: definition, photometric and spectroscopic evolution, the three-component model, evidence for the binary nature, spectroscopic properties and anomalies, single-star interpretations, the ''very slow novae'' and BQ// stars and a comparison of symbiotic stars with other classes. (C.F.)
Simple Laboratory methods to measure cell proliferation using DNA synthesis property
Directory of Open Access Journals (Sweden)
Madhavan H N
2007-01-01
Full Text Available This is a mini-review on the techniques to measure proliferation of cells by estimation of DNA synthesis. This is not an exhaustive review of literature, but a bird’s eye view of a few selected articles which may provide the technical details to the readers.The nucleus of a cell occupies about 10-30% of the cells space, depends on the type of genetic material (DNA -DeoxyriboNucleic Acid. DNA is a long, double-stranded, helical molecule which carries the genetic information. Duplication of the DNA takes place by the phenomena of replication. One copy of double-stranded DNA molecule forms two double-stranded DNA molecules. DNA replication is the fundamental process used in all living organisms as it is the basis for biological inheritance. This process is known also as Mitosis in somatic cells. In Mitosis, the duplication process results in two genetically identical "daughter" cells from a single "parent" cell. The resulting double-stranded DNA molecules are identical; proof reading and error-checking mechanisms exist to ensure near perfect pair. Mitosis is divided into six phases: prophase, prometaphase, metaphase, anaphase, telophase, and cytokinesis.
Kochanov, R. V.; Gordon, I. E.; Rothman, L. S.; Wcisło, P.; Hill, C.; Wilzewski, J. S.
2016-07-01
The HITRAN Application Programming Interface (HAPI) is presented. HAPI is a free Python library, which extends the capabilities of the HITRANonline interface (www.hitran.org) and can be used to filter and process the structured spectroscopic data. HAPI incorporates a set of tools for spectra simulation accounting for the temperature, pressure, optical path length, and instrument properties. HAPI is aimed to facilitate the spectroscopic data analysis and the spectra simulation based on the line-by-line data, such as from the HITRAN database [JQSRT (2013) 130, 4-50], allowing the usage of the non-Voigt line profile parameters, custom temperature and pressure dependences, and partition sums. The HAPI functions allow the user to control the spectra simulation and data filtering process via a set of the function parameters. HAPI can be obtained at its homepage www.hitran.org/hapi.
DNA nanotechnology and fluorescence applications.
Schlichthaerle, Thomas; Strauss, Maximilian T; Schueder, Florian; Woehrstein, Johannes B; Jungmann, Ralf
2016-06-01
Structural DNA nanotechnology allow researchers to use the unique molecular recognition properties of DNA strands to construct nanoscale objects with almost arbitrary complexity in two and three dimensions. Abstracted as molecular breadboards, DNA nanostructures enable nanometer-precise placement of guest molecules such as proteins, fluorophores, or nanoparticles. These assemblies can be used to study biological phenomena with unprecedented control over number, spacing, and molecular identity. Here, we give a general introduction to structural DNA nanotechnology and more specifically discuss applications of DNA nanostructures in the field of fluorescence and plasmonics. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Bensalah, A.; Ito, M.; Guyot, Y.; Goutaudier, C.; Jouini, A.; Brenier, A.; Sato, H.; Fukuda, T.; Boulon, G.
2007-01-01
Spectroscopic characterization is carried out to identify Stark's levels of Yb 3+ transitions in several fluoride crystals grown either by the Czochralski technique or by the laser-heated pedestal growth method. Yb 3+ concentration dependence of the decay time is analyzed in order to understand involved concentration quenching mechanisms. Laser tests under saphire:Ti pumping are presented for all our materials as well as under diode pumping for Yb:CaF 2
DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair
Directory of Open Access Journals (Sweden)
Elisa Mentegari
2016-08-01
Full Text Available DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell’s genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.
DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.
Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele
2016-08-31
DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.
DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present
Directory of Open Access Journals (Sweden)
Cheng-Yao eChen
2014-06-01
Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.
International Nuclear Information System (INIS)
Nishimura, Y.
1985-01-01
Raman spectra have been examined to clarify the polymorphic forms of DNA, A, B, and Z forms. From an analysis the authors found that the guanine ring breathing vibration is sensitive to its local conformation. Examination of nine crystals of guanosine residues in which the local conformations are well established revealed that a guanosine residue with a C3'endo-anti gives a strong line at 666+-2 cm/sup -1/, O4'endo-anti at 682 cm/sup -1/, C1'exo-anti at 673 cm/sup -1/, C2'endo-anti at 677 cm/sup -1/ and syn-forms around 625 cm/sup -1/. Using this characteristic line, they were able to obtain the local conformations of guanosine moieties in poly(dG-dC). Such a sequence derived variation is suggested to be recognized by sequence specific proteins such as restriction enzymes. The authors found a correlation between sequence dependent DNA conformation and a mode of action of restriction enzymes. The cutting mode of restriction enzymes is classified into three groups. The classification of whether the products have blunt ends, two-base-long cohesive ends, or four-base-long cohesive ends depends primarily on the substrate, not on the enzyme. It is suggested that sequence dependent DNA conformation causes such a classification by the use of the Calladine-Dickerson analysis. In the recognition of restriction enzymes, the methyl group in a certain sequence is considered to play an important role by changing the local conformation of DNA
Thermodynamics of sequence-specific binding of PNA to DNA
DEFF Research Database (Denmark)
Ratilainen, T; Holmén, A; Tuite, E
2000-01-01
For further characterization of the hybridization properties of peptide nucleic acids (PNAs), the thermodynamics of hybridization of mixed sequence PNA-DNA duplexes have been studied. We have characterized the binding of PNA to DNA in terms of binding affinity (perfectly matched duplexes) and seq......For further characterization of the hybridization properties of peptide nucleic acids (PNAs), the thermodynamics of hybridization of mixed sequence PNA-DNA duplexes have been studied. We have characterized the binding of PNA to DNA in terms of binding affinity (perfectly matched duplexes...
Iterated function systems for DNA replication
Gaspard, Pierre
2017-10-01
The kinetic equations of DNA replication are shown to be exactly solved in terms of iterated function systems, running along the template sequence and giving the statistical properties of the copy sequences, as well as the kinetic and thermodynamic properties of the replication process. With this method, different effects due to sequence heterogeneity can be studied, in particular, a transition between linear and sublinear growths in time of the copies, and a transition between continuous and fractal distributions of the local velocities of the DNA polymerase along the template. The method is applied to the human mitochondrial DNA polymerase γ without and with exonuclease proofreading.
DEFF Research Database (Denmark)
Arcisauskaité, Vaida
have been used to elucidate Hg coordination in proteins. Computational chemistry calculations have a potential to contribute to the interpretation of this spectroscopic data, as calculated diagonalised electric field gradient (EFG) tensor components (jVzzj jVyyj jVxxj) and NMR shielding constants...... steps towards understanding how Zn(II) reaches its target position in biological systems in vivo and in vitro experiments in aqueous solution, is the detailed investigation of water exchange reactions for Zn(II)(aq). A very advanced (albeit not complete) picture of structure and dynamics of solvated Zn...
The Redshift Evolution of Rest-UV Spectroscopic Properties in Lyman-break Galaxies at z ∼ 2–4
Du, Xinnan; Shapley, Alice E.; Reddy, Naveen A.; Jones, Tucker; Stark, Daniel P.; Steidel, Charles C.; Strom, Allison L.; Rudie, Gwen C.; Erb, Dawn K.; Ellis, Richard S.; Pettini, Max
2018-06-01
We present the first comprehensive evolutionary analysis of the rest-frame UV spectroscopic properties of star-forming galaxies at z ∼ 2–4. We match samples at different redshifts in UV luminosity and stellar mass, and perform systematic measurements of spectral features and stellar population modeling. By creating composite spectra grouped according to Lyα equivalent width (EW) and various galaxy properties, we study the evolutionary trends among Lyα, low- and high-ionization interstellar (LIS and HIS) absorption features, and integrated galaxy properties. We also examine the redshift evolution of Lyα and LIS absorption kinematics, and fine-structure emission EWs. The connections among the strengths of Lyα, LIS lines, and dust extinction are redshift independent, as is the decoupling of the Lyα and HIS line strengths, and the bulk outflow kinematics as traced by the LIS lines. Stronger Lyα emission is observed at higher redshift at fixed UV luminosity, stellar mass, SFR, and age. Much of this variation in the average Lyα strength with redshift, and the variation in Lyα strength at fixed redshift, can be explained in terms of variations in the neutral gas covering fraction and/or dust content in the ISM and CGM. However, based on the connection between Lyα and C III] emission strengths, we additionally find evidence for variations in the intrinsic production rate of Lyα photons at the highest Lyα EWs. The challenge now is to understand the observed evolution of the neutral gas covering fraction and dust extinction within a coherent model for galaxy formation, and make robust predictions for the escape of ionizing radiation at z > 6.
DNA hybridization sensor based on pentacene thin film transistor.
Kim, Jung-Min; Jha, Sandeep Kumar; Chand, Rohit; Lee, Dong-Hoon; Kim, Yong-Sang
2011-01-15
A DNA hybridization sensor using pentacene thin film transistors (TFTs) is an excellent candidate for disposable sensor applications due to their low-cost fabrication process and fast detection. We fabricated pentacene TFTs on glass substrate for the sensing of DNA hybridization. The ss-DNA (polyA/polyT) or ds-DNA (polyA/polyT hybrid) were immobilized directly on the surface of the pentacene, producing a dramatic change in the electrical properties of the devices. The electrical characteristics of devices were studied as a function of DNA immobilization, single-stranded vs. double-stranded DNA, DNA length and concentration. The TFT device was further tested for detection of λ-phage genomic DNA using probe hybridization. Based on these results, we propose that a "label-free" detection technique for DNA hybridization is possible through direct measurement of electrical properties of DNA-immobilized pentacene TFTs. Copyright © 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Erhong Meng
Full Text Available OBJECTIVE: Aldehyde dehydrogenase (ALDH expressing cells have been characterized as possessing stem cell-like properties. We evaluated ALDH+ ovarian cancer stem cell-like properties and their role in platinum resistance. METHODS: Isogenic ovarian cancer cell lines for platinum sensitivity (A2780 and platinum resistant (A2780/CP70 as well as ascites from ovarian cancer patients were analyzed for ALDH+ by flow cytometry to determine its association to platinum resistance, recurrence and survival. A stable shRNA knockdown model for ALDH1A1 was utilized to determine its effect on cancer stem cell-like properties, cell cycle checkpoints, and DNA repair mediators. RESULTS: ALDH status directly correlated to platinum resistance in primary ovarian cancer samples obtained from ascites. Patients with ALDHHIGH displayed significantly lower progression free survival than the patients with ALDHLOW cells (9 vs. 3 months, respectively p<0.01. ALDH1A1-knockdown significantly attenuated clonogenic potential, PARP-1 protein levels, and reversed inherent platinum resistance. ALDH1A1-knockdown resulted in dramatic decrease of KLF4 and p21 protein levels thereby leading to S and G2 phase accumulation of cells. Increases in S and G2 cells demonstrated increased expression of replication stress associated Fanconi Anemia DNA repair proteins (FANCD2, FANCJ and replication checkpoint (pS317 Chk1 were affected. ALDH1A1-knockdown induced DNA damage, evidenced by robust induction of γ-H2AX and BAX mediated apoptosis, with significant increases in BRCA1 expression, suggesting ALDH1A1-dependent regulation of cell cycle checkpoints and DNA repair networks in ovarian cancer stem-like cells. CONCLUSION: This data suggests that ovarian cancer cells expressing ALDH1A1 may maintain platinum resistance by altered regulation of cell cycle checkpoint and DNA repair network signaling.
Ogieglo, Wojciech; Wormeester, Herbert; Wessling, Matthias; Benes, Nieck E
2012-02-01
Exposure of a thin polymer film to a fluid can affect properties of the film such as the density and thickness. In particular in membrane technology, these changes can have important implications for membrane performance. Spectroscopic ellipsometry is a convenient technique for in situ studies of thin films, because of its noninvasive character and very high precision. The applicability of spectroscopic ellipsometry is usually limited to samples with well-defined interfacial regions, whereas in typical composite membranes, often substantial and irregular intrusion of the thin film into the pores of a support exists. In this work, we provide a detailed characterization of a polished porous alumina membrane support, using variable-angle spectroscopic ellipsometry in combination with atomic force microscopy and mercury porosimetry. Two Spectroscopic ellipsometry optical models are presented that can adequately describe the surface roughness of the support. These models consider the surface roughness as a distinct layer in which the porosity gradually increases toward the outer ambient interface. The first model considers the porosity profile to be linear; the second model assumes an exponential profile. It is shown that the models can be extended to account for a composite membrane geometry, by deposition of a thin polysulfone film onto the support. The developed method facilitates practicability for in situ spectroscopic ellipsometry studies of nonequilibrium systems, i.e., membranes under actual permeation conditions.
Energy Technology Data Exchange (ETDEWEB)
Navarro, Maribel [Instituto Venezolano de Investigaciones Cientificas, Caracas (Venezuela). Centro de Quimica; Betancourt, Adelmo [Universidad de Carabobo, Valencia (Venezuela). Facultad Experimental de Ciencia y Tecnologia. Dept. de Quimica; Hernandez, Clara [Universidad de Carabobo Sede Aragua, Maracay (Venezuela). Facultad de Ciencias de la Salud. Dept. de Ciencias Basicas; Marchan, Edgar [Universidad de Oriente, Cumana (Venezuela). Inst. de Investigaciones en Biomedicina y Ciencias Aplicadas. Nucleo de Sucre
2008-07-01
This paper describes the search for new potential chemotherapeutic agents based on transition metal complexes with planar ligands. In this study, palladium polypyridyl complexes were synthesized and characterized by elemental analysis, NMR, UV-VIS and IR spectroscopies. The interaction of the complexes with DNA was also investigated by spectroscopic methods. All metal-to-ligand charge transfer (MLCT) bands of the palladium polypyridyl complexes exhibited hypochromism and red shift in the presence of DNA. The binding constant and viscosity data suggested that the complexes [PdCl{sub 2}(phen)] and [PdCl{sub 2}(phendiamine)] interact with DNA by electrostatic forces. Additionally, these complexes induced an important leishmanistatic effect on L. (L.) mexicana promastigotes at the final concentration of 10 {mu}mol L{sup -1} in 48 h. (author)
DNA-binding, DNA cleavage and cytotoxicity studies of two anthraquinone derivatives.
Gholivand, M B; Kashanian, S; Peyman, H
2012-02-15
The interaction of native calf thymus DNA (CT-DNA) with two anthraquinones including quinizarin (1,4-dihydroxy anthraquinone) and danthron (1,8-dihydroxy anthraquinone) in a mixture of 0.04M Brittone-Robinson buffer and 50% of ethanol were studied at physiological pH by spectrofluorometric and cyclic voltammetry techniques. The former technique was used to calculate the binding constants of anthraquinones-DNA complexes at different temperatures. Thermodynamic study indicated that the reactions of both anthraquinone-DNA systems are predominantly entropically driven. Furthermore, the binding mechanisms on the reaction of the two anthraquinones with DNA and the effect of ionic strength on the fluorescence property of the system have also been investigated. The results of the experiments indicated that the binding modes of quinizarin and danthron with DNA were evaluated to be groove binding. Moreover, the cytotoxic activity of both compounds against human chronic myelogenous leukemia K562 cell line and DNA cleavage were investigated. The results indicated that these compounds slightly cleavage pUC18 plasmid DNA and showed minor antitumor activity against K562 (human chronic myeloid leukemia) cell line. Copyright © 2011 Elsevier B.V. All rights reserved.
3D DNA Crystals and Nanotechnology
Directory of Open Access Journals (Sweden)
Paul J. Paukstelis
2016-08-01
Full Text Available DNA’s molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.
Energy Technology Data Exchange (ETDEWEB)
Miller, Terry [The Ohio State Univ., Columbus, OH (United States)
2015-06-04
Combustion chemistry is enormously complex. The chemical mechanisms involve a multitude of elementary reaction steps and a comparable number of reactive intermediates, many of which are free radicals. Computer simulations based upon these mechanisms are limited by the validity of the mechanisms and the parameters characterizing the properties of the intermediates and their reactivity. Spectroscopy can provide data for sensitive and selective diagnostics to follow their reactions. Spectroscopic analysis also provides detailed parameters characterizing the properties of these intermediates. These parameters serve as experimental gold standards to benchmark predictions of these properties from large-scale, electronic structure calculations. This work has demonstrated the unique capabilities of near-infrared cavity ringdown spectroscopy (NIR CRDS) to identify, characterize and monitor intermediates of key importance in complex chemical reactions. Our studies have focussed on the large family of organic peroxy radicals which are arguably themost important intermediates in combustion chemistry and many other reactions involving the oxidation of organic compounds. Our spectroscopic studies have shown that the NIR Ã - ˜X electronic spectra of the peroxy radicals allows one to differentiate among chemical species in the organic peroxy family and also determine their isomeric and conformic structure in many cases. We have clearly demonstrated this capability on saturated and unsaturated peroxy radicals and β-hydroxy peroxy radicals. In addition we have developed a unique dual wavelength CRDS apparatus specifically for the purpose of measuring absolute absorption cross section and following the reaction of chemical intermediates. The utility of the apparatus has been demonstrated by measuring the cross-section and self-reaction rate constant for ethyl peroxy.
DNA modification by alkylating compounds
Energy Technology Data Exchange (ETDEWEB)
Kruglyakova, E.E.
1985-09-01
Results are given for research on the physico-chemical properties of alkylating compounds - nitroso alkyl ureas (NAU) which possess a broad spectrum of biological activity, such as mutagenic, carcinogenic, and anti-tumor action that is due to the alkylation and carbamoylation of DNA as well as other cellular components. Identified chemical products of NAU interaction with DNA and its components are cited. Structural conversions of a DNA macromolecule resulting from its chemical modification are examined. NAU are used to discuss possible biological consequences of DNA modification. 148 references.
Suarez, O.; Garcia-Lario, P.; Manchado, A.; Manteiga, M.; Ulla, A.; Pottasch, S. R.
2006-01-01
Aims. We study the optical spectral properties of a sample of stars showing far infrared colours similar to those of well-known planetary nebulae. The large majority of them were unidentified sources or poorly known in the literature at the time when this spectroscopic survey started, some 15 years
Raman Spectroscopic Studies of Methane Gas Hydrates
DEFF Research Database (Denmark)
Hansen, Susanne Brunsgaard; Berg, Rolf W.
2009-01-01
A brief review of the Raman spectroscopic studies of methane gas hydrates is given, supported by some new measurements done in our laboratory.......A brief review of the Raman spectroscopic studies of methane gas hydrates is given, supported by some new measurements done in our laboratory....
International Nuclear Information System (INIS)
Chaudhary, Ganga Ram; Bansal, Shafila; Mehta, S.K.; Ahluwalia, A.S.
2012-01-01
Highlights: ► Thermophysical studies of new formulations of [BMIM][PF 6 ]+TX(45,100) have been made. ► Strong intermolecular interactions between [BMIM][PF 6 ] and TX (45, 100) is observed. ► Magnitude of interactions increases with the addition of oxyethylene groups in TX. ► With rise in temperature, intermolecular interactions increases. ► Spectroscopic studies show that interactions are via aromatic rings of RTIL and TX. - Abstract: The thermophysical properties viz. density ρ, speed of sound u, and specific conductivity κ of pure room temperature ionic liquid (1-butyl-3-methylimidazolium hexafluorophosphate) and its binary formulations with Triton X-45 and Triton X-100 have been studied over the entire composition range at different temperatures (293.15 to 323.15) K. Excess molar volume V E , deviation in isentropic compressibility ΔK S , partial molar excess volume V i E , deviation in partial molar isentropic compressibility ΔK S,i , deviation in specific conductivity Δκ have also been estimated and analysed. Spectroscopic properties (IR, 1 H and 13 C NMR) of these mixtures have been investigated in order to understand the structural and interactional behaviour of formulations studied. The magnitude of interactions between the two components increases with addition of number of oxyethylene groups in Tritons and with rise in temperature. Spectroscopic measurements indicate that interactions are mainly taking place through the five member ring of room temperature ionic liquid and six member ring of Tritons.
International Nuclear Information System (INIS)
Muller, E.
2002-01-01
Several oxidative processes induce the formation of DNA lesions. In order to evaluate the biological and structural significance of such damage, several DNA lesions were inserted into synthetic oligonucleotides at defined sites. The research work aimed at describing the preparation of oligonucleotides t hat contained DNA damage and the evaluation of the biological properties of the lesions. A first part described the incorporation of radiation-induced lesions, namely (5'S,6S)-5',6-cyclo-5,6-dihydro-2'-deoxyuridine and (5'S,5S,6S)-5',6-cyclo-5-hydroxy-5,6-dihydro-2'-desoxyuridine into oligonucleotides. The modified DNA fragments were characterised by several spectroscopic and biochemical analyses including ESI MS, MALDI-TOF MS, CLHP and enzymatic digestions. During in vitro DNA synthesis by Taq DNA polymerase and Klenow exo fragment, the pyrimidine cyclo-nucleosides were found to block the progression of the enzymes. Then, repair studies by ADN N glycosylases, operating in the base excision repair pathway, have shown that the anhydro-nucleoside lesions were not recognised nor excised by Fpg, endo III, endo VIII, yNtg1 yNtg2 and yOgg1. Interestingly, the Latococcus lactis Fpg protein recognises (formation of a non covalent complex) but do not excise the damage. The incorporation into oligonucleotides of the (5R*) and (5S*) diastereoisomers of 1-[2-deoxy-β-D-erythro-pentofuranosyl]-5-hydroxy-hydantoin, generated by several oxidative processes was then described. In vitro DNA replication assays using modified oligonucleotides matrix showed a lethal potential of the latter base damage. Repair studies by ADN N-glycosylases showed that the damage was substrate for Fpg, endo III, endo VIII, Ntg1, Ntg2 and Fpg-L1. The rates of excision as inferred from the determination of the Michaelis kinetics constants were found to be affected by the presence of the damage. MALDI-TOF MS was used in order to gain insights into mechanistic aspects of oligonucleotides cleavage by the
Pathak, Arup Kumar; Mukherjee, Tulsi; Maity, Dilip Kumar
2010-01-18
The vibrational (IR and Raman) and photoelectron spectral properties of hydrated iodine-dimer radical-anion clusters, I(2)(*-) x n H(2)O (n=1-10), are presented. Several initial guess structures are considered for each size of cluster to locate the global minimum-energy structure by applying a Monte Carlo simulated annealing procedure including spin-orbit interaction. In the Raman spectrum, hydration reduces the intensity of the I-I stretching band but enhances the intensity of the O-H stretching band of water. Raman spectra of more highly hydrated clusters appear to be simpler than the corresponding IR spectra. Vibrational bands due to simultaneous stretching vibrations of O-H bonds in a cyclic water network are observed for I(2)(*-) x n H(2)O clusters with n > or = 3. The vertical detachment energy (VDE) profile shows stepwise saturation that indicates closing of the geometrical shell in the hydrated clusters on addition of every four water molecules. The calculated VDE of finite-size small hydrated clusters is extrapolated to evaluate the bulk VDE value of I(2)(*-) in aqueous solution as 7.6 eV at the CCSD(T) level of theory. Structure and spectroscopic properties of these hydrated clusters are compared with those of hydrated clusters of Cl(2)(*-) and Br(2)(*-).
Characterization of muntjac DNA
International Nuclear Information System (INIS)
Davis, R.C.
1981-01-01
Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange
Characterization of muntjac DNA
Energy Technology Data Exchange (ETDEWEB)
Davis, R.C.
1981-05-27
Sister chromatid exchange (SCE) in muntjac chromosomes is generally proportional to the chromosomal DNA content, but the SCE frequency is reduced in the heterochromatic neck region of the X chromosome. The physical properties of muntjac DNA and the kinetics of repair of UV damage in muntjac heterochromatin and euchromatin were examined and compared with the distribution of sister chromatid exchange.
Assembly of DNA Architectures in a Non-Aqueous Solution
Directory of Open Access Journals (Sweden)
Thomas J. Proctor
2012-08-01
Full Text Available In the present work, the procedures for the creation of self-assembled DNA nanostructures in aqueous and non-aqueous media are described. DNA-Surfactant complex formation renders the DNA soluble in organic solvents offering an exciting way to bridge the transition of DNA origami materials electronics applications. The DNA retains its structural features, and these unique geometries provide an interesting candidate for future electronics and nanofabrication applications with potential for new properties. The DNA architectures were first assembled under aqueous conditions, and then characterized in solution (using circular dichroism (CD spectroscopy and on the surface (using atomic force microscopy (AFM. Following aqueous assembly, the DNA nanostructures were transitioned to a non-aqueous environment, where butanol was chosen for optical compatibility and thermal properties. The retention of DNA hierarchical structure and thermal stability in non-aqueous conditions were confirmed via CD spectroscopy. The formation and characterization of these higher order DNA-surfactant complexes is described in this paper.
Growth and spectroscopic properties of Yb{sup 3+}-doped Li{sub 6}Y(BO{sub 3}){sub 3} single crystal
Energy Technology Data Exchange (ETDEWEB)
Brenier, A. [Laboratoire de Physico-Chimie des Materiaux Luminescents, UMR CNRS no 5620, Universite Claude Bernard-Lyon1, 10 rue Ampere, 69622 Villeurbanne (France)]. E-mail: brenier@pcml.univ-lyon1.fr; Yoshikawa, A. [Institute of Multidisciplinary for Advanced Materials, Tohoku University, Sendai 980 8577 (Japan); Lebbou, K. [Laboratoire de Physico-Chimie des Materiaux Luminescents, UMR CNRS no 5620, Universite Claude Bernard-Lyon1, 10 rue Ampere, 69622 Villeurbanne (France); Jouini, A. [Laboratoire de Physico-Chimie des Materiaux Luminescents, UMR CNRS no 5620, Universite Claude Bernard-Lyon1, 10 rue Ampere, 69622 Villeurbanne (France); Institute of Multidisciplinary for Advanced Materials, Tohoku University, Sendai 980 8577 (Japan); Aloui-Lebbou, O. [Laboratoire de Physico-Chimie des Materiaux Luminescents, UMR CNRS no 5620, Universite Claude Bernard-Lyon1, 10 rue Ampere, 69622 Villeurbanne (France); Boulon, G. [Laboratoire de Physico-Chimie des Materiaux Luminescents, UMR CNRS no 5620, Universite Claude Bernard-Lyon1, 10 rue Ampere, 69622 Villeurbanne (France); Institute of Multidisciplinary for Advanced Materials, Tohoku University, Sendai 980 8577 (Japan); Fukuda, T. [Institute of Multidisciplinary for Advanced Materials, Tohoku University, Sendai 980 8577 (Japan)
2007-10-15
The spectroscopic properties of high-quality Czochralski grown 20% Yb{sup 3+}-doped Li{sub 6}Y(BO{sub 3}){sub 3} single crystal as new promising laser material are presented. The crystal was seeded-grown in the <0 1 0> direction and its crystallinity was measured using X-ray rocking curve analysis. Low temperature transmission spectrum exhibits broad bands in a short range of wavelengths and two sharp lines at 972.5 and 978 nm, interpreted as two zero-lines of two nonequivalent Yb{sup 3+} centers inside the lattice. The fluorescence lifetimes associated to these two intense lines are different: 0.867 and 1.33 ms. An attempt of determination of the Stark sublevels energies of the {sup 4}F{sub 5/2} and {sup 4}F{sub 7/2} manifolds of the two Yb{sup 3+} nonequivalent ions is given. The polarized absorption and emission spectra were also recorded at room temperature and we conclude that the most favorable emission line for laser application could be around 1042 nm in n {sub g} polarization.
Raman Spectroscopic Studies of YBa{sub 2}Cu{sub 3}O{sub 7} Coated Conductors
Energy Technology Data Exchange (ETDEWEB)
Choi, Mi Kyeung; Mnh, Nguyen Van; Bae, J. S.; Jo, William; Yang, In Sang [Ewha Womans University, Seoul (Korea, Republic of); Ko, Rock Kil; Ha, Hong Soo; Park, Chan [Korea Electrotecnology Research Institute, Changwon (Korea, Republic of)
2005-04-15
We present results of Raman spectroscopic studies of superconducting YBa{sub 2}Cu{sub 3}O{sub 7} (YBCO) coated conductors. Raman scattering is used to characterize optical phonon modes, oxygen content, c-axis misalignment, and second phases of the YBCO coated conductors at a micro scale. A two-dimensional mapping of Raman spectra with transport properties has been performed to elucidate the effect of local propertied on current path and superconducting phase. The information taken from the local measurement will be useful for optimizing the process condition.
Directory of Open Access Journals (Sweden)
Gaëlle Lenglet
2010-01-01
Full Text Available DNA targeting drugs represent a large proportion of the actual anticancer drug pharmacopeia, both in terms of drug brands and prescription volumes. Small DNA-interacting molecules share the ability of certain proteins to change the DNA helix's overall organization and geometrical orientation via tilt, roll, twist, slip, and flip effects. In this ocean of DNA-interacting compounds, most stabilize both DNA strands and very few display helix-destabilizing properties. These types of DNA-destabilizing effect are observed with certain mono- or bis-intercalators and DNA alkylating agents (some of which have been or are being developed as cancer drugs. The formation of locally destabilized DNA portions could interfere with protein/DNA recognition and potentially affect several crucial cellular processes, such as DNA repair, replication, and transcription. The present paper describes the molecular basis of DNA destabilization, the cellular impact on protein recognition, and DNA repair processes and the latter's relationships with antitumour efficacy.
Multi-pass spectroscopic ellipsometry
International Nuclear Information System (INIS)
Stehle, Jean-Louis; Samartzis, Peter C.; Stamataki, Katerina; Piel, Jean-Philippe; Katsoprinakis, George E.; Papadakis, Vassilis; Schimowski, Xavier; Rakitzis, T. Peter; Loppinet, Benoit
2014-01-01
Spectroscopic ellipsometry is an established technique, particularly useful for thickness measurements of thin films. It measures polarization rotation after a single reflection of a beam of light on the measured substrate at a given incidence angle. In this paper, we report the development of multi-pass spectroscopic ellipsometry where the light beam reflects multiple times on the sample. We have investigated both theoretically and experimentally the effect of sample reflectivity, number of reflections (passes), angles of incidence and detector dynamic range on ellipsometric observables tanΨ and cosΔ. The multiple pass approach provides increased sensitivity to small changes in Ψ and Δ, opening the way for single measurement determination of optical thickness T, refractive index n and absorption coefficient k of thin films, a significant improvement over the existing techniques. Based on our results, we discuss the strengths, the weaknesses and possible applications of this technique. - Highlights: • We present multi-pass spectroscopic ellipsometry (MPSE), a multi-pass approach to ellipsometry. • Different detectors, samples, angles of incidence and number of passes were tested. • N passes improve polarization ratio sensitivity to the power of N. • N reflections improve phase shift sensitivity by a factor of N. • MPSE can significantly improve thickness measurements in thin films
Energy Technology Data Exchange (ETDEWEB)
Kesavulu, C.R. [Department of Physics, Changwon National University, Changwon 641-773 (Korea, Republic of); Sreedhar, V.B.; Jayasankar, C.K. [Department of Physics, Sri Venkateswara University, Tirupati 517502 (India); Jang, Kiwan [Department of Physics, Changwon National University, Changwon 641-773 (Korea, Republic of); Shin, Dong-Soo [Department of Chemistry, Changwon National University, Changwon 641-773 (Korea, Republic of); Yi, Soung Soo, E-mail: ssyi@silla.ac.kr [Department of Electronic Materials Engineering, Silla University, Busan 617-736 (Korea, Republic of)
2014-03-01
Graphical abstract: - Highlights: • Er{sup 3+}-doped novel oxyfluoride glasses have been prepared by melt quenching technique. • Structural, thermal and spectroscopic properties have been carried out. • SALSFEr glasses exhibit intense green and weak red emissions at 365 nm excitation. • Major laser transition for Er{sup 3+} ion in SALSFEr glasses is {sup 4}I{sub 13/2} → {sup 4}I{sub 15/2} (1.53 μm). • These results suggest the possibility of using SALSFEr glasses as photonic devices. - Abstract: The Er{sup 3+}-doped novel oxyfluoride glasses of composition (43 − x)SiO{sub 2}–10Al{sub 2}O{sub 3}–24LiF–23SrF{sub 2}–xEr{sub 2}O{sub 3}, where x = 1.0, 2.0, 4.0 and 6.0 mol%, have been prepared by conventional melt quenching technique and are characterized through X-ray diffraction (XRD), differential thermal analysis (DTA), Raman, Fourier transform infrared (FT-IR) analysis, optical absorption spectra, visible (vis) and near-infrared (NIR) emission spectra measurements. Judd–Ofelt (JO) intensity parameters (Ω{sub λ}, λ = 2, 4 and 6) have been derived from the absorption spectrum of 1.0 mol% Er{sub 2}O{sub 3} doped glass and are in turn used to calculate radiative properties for the important luminescent levels of Er{sup 3+} ions. The studied glasses show intense green and weak red visible emissions under 365 nm excitation. The decrease in visible emission intensities with concentration of Er{sup 3+} ions has been explained due to energy transfer processes between Er{sup 3+} ions. Upon excitation at 980 nm laser diode, an intense 1.53 μm NIR emission has been observed with the maximum full width at half maximum (FWHM) for Er{sup 3+}-doped oxyfluoride glasses. The higher Er{sup 3+} ion doping capability and relatively high gain and broad emission at 1.5 μm are the most notable features of these glasses to realize efficient short-length optical amplifiers.
Effect of Ga2O3 on the spectroscopic properties of erbium-doped boro-bismuth glasses.
Ling, Zhou; Ya-Xun, Zhou; Shi-Xun, Dai; Tie-Feng, Xu; Qiu-Hua, Nie; Xiang, Shen
2007-11-01
The spectroscopic properties and thermal stability of Er3+-doped Bi2O3-B2O3-Ga2O3 glasses are investigated experimentally. The effect of Ga2O3 content on absorption spectra, the Judd-Ofelt parameters Omega t (t=2, 4, 6), fluorescence spectra and the lifetimes of Er3+:4I 13/2 level are also investigated, and the stimulated emission cross-section is calculated from McCumber theory. With the increasing of Ga2O3 content in the glass composition, the Omega t (t=2, 4, 6) parameters, fluorescence full width at half maximum (FWHM) and the 4I 13/2 lifetimes of Er3+ first increase, reach its maximum at Ga2O3=8 mol.%, and then decrease. The results show that Er3+-doped 50Bi2O3-42B2O3-8Ga2O3 glass has the broadest FWHM (81nm) and large stimulated emission cross-section (1.03 x1 0(-20)cm2) in these glass samples. Compared with other glass hosts, the gain bandwidth properties of Er+3-doped Bi2O3-B2O3-Ga2O3 glass is better than tellurite, silicate, phosphate and germante glasses. In addition, the lifetime of 4I 13/2 level of Er(3+) in bismuth-based glass, compared with those in other glasses, is relative low due to the high-phonon energy of the B-O bond, the large refractive index of the host and the existence of OH* in the glass. At the same time, the glass thermal stability is improved in which the substitution of Ga2O3 for B2O3 strengthens the network structure. The suitability of bismuth-based glass as a host for a Er3+-doped broadband amplifier and its advantages over other glass hosts are also discussed.
Effects of sequence on DNA wrapping around histones
Ortiz, Vanessa
2011-03-01
A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).
Keller, P. B.; Hartman, K. A.
Infrared spectroscopy was used to measure the effects of NaCl, NaNO 3 and HgCl 2 on the structure and structural transitions of DNA in hydrated films. The following conclusions are supported by the data. (1) The transition from the B- to the A-structural form in films of salt-free, calf-thymus DNA occurs between 86 and 75% r.h. Previous failures to obtain this transition in salt-free films and the finding that ca 4% (w/w) NaCl is needed to observe the B to A transition in films of DNA appear to be anomalies produced by the very slow kinetics for this transition. (2) The addition of NaCl to DNA increases the quantity of water absorbed at a given r.h. value and shifts the B to A transition to lower r.h. values. (3) Highly hydrated DNA (100% r.h.) with or without added NaCl exists in the B-helical structure for all samples examined. (4) DNA films containing one NaNO 3 per 6.7 nucleotide residues remained in the B-helical form to very low values of hydration. (5) The interaction of HgCl 2 with DNA to form the type I complex prevents the transition of DNA from the B- to the A-helical form but a conformational variation within the B family of structures was observed to occur between 94 and 75% r.h. (6) The primary sites of binding of Hg 2+ in the type-1 complex with the DNA are the AT base pairs. Hg 2+ binds to the N3 atom of thymine. Binding of Hg 2+ to AT pairs perturbs the CG pairs but has only a minor effect on the sugar—phosphate conformation.
DNA nanochannels [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Dianming Wang
2017-04-01
Full Text Available Transmembrane proteins are mostly nanochannels playing a highly important role in metabolism. Understanding their structures and functions is vital for revealing life processes. It is of fundamental interest to develop chemical devices to mimic biological channels. Structural DNA nanotechnology has been proven to be a promising method for the preparation of fine DNA nanochannels as a result of the excellent properties of DNA molecules. This review presents the development history and current situation of three different types of DNA nanochannel: tile-based nanotube, DNA origami nanochannel, and DNA bundle nanochannel.
CDSD-4000: High-resolution, high-temperature carbon dioxide spectroscopic databank
International Nuclear Information System (INIS)
Tashkun, S.A.; Perevalov, V.I.
2011-01-01
We present a high-resolution, high-temperature version of the Carbon Dioxide Spectroscopic Databank called CDSD-4000. The databank contains the line parameters (positions, intensities, air- and self-broadened half-widths, coefficients of temperature dependence of air- and self-broadened half-widths, and air-broadened pressure shifts) of the four most abundant isotopologues of CO 2 . A reference temperature is 296 K and an intensity cutoff is 10 -27 cm -1 /molecule cm -2 at 4000 K. The databank has 628,324,454 entries, covers the 226-8310 cm -1 spectral range and designed for the temperature range 2500-5000 K. Format of CDSD-4000 is similar to that of HITRAN-2008. The databank has been generated within the framework of the method of effective operators and based on the global fittings of spectroscopic parameters (parameters of the effective Hamiltonians and effective dipole moment operators) to observed data collected from the literature. The databank is useful for studying high-temperature radiative properties of CO 2 , including exoplanets atmospheres, aerothemal modeling for Mars entry missions, high-temperature laboratory spectra, and industrial applications. CDSD-4000 is freely accessible via the Internet site (ftp://ftp.iao.ru/pub/CDSD-4000).
Sikora, Anna; Mielecki, Damian; Chojnacka, Aleksandra; Nieminuszczy, Jadwiga; Wrzesinski, Michal; Grzesiuk, Elzbieta
2010-03-01
Methylmethane sulphonate (MMS), an S(N)2-type alkylating agent, generates DNA methylated bases exhibiting cytotoxic and mutagenic properties. Such damaged bases can be removed by a system of base excision repair (BER) and by oxidative DNA demethylation catalysed by AlkB protein. Here, we have shown that the lack of the BER system and functional AlkB dioxygenase results in (i) increased sensitivity to MMS, (ii) elevated level of spontaneous and MMS-induced mutations (measured by argE3 --> Arg(+) reversion) and (iii) induction of the SOS response shown by visualization of filamentous growth of bacteria. In the xth nth nfo strain additionally mutated in alkB gene, all these effects were extreme and led to 'error catastrophe', resulting from the presence of unrepaired apurinic/apyrimidinic (AP) sites and 1-methyladenine (1meA)/3-methylcytosine (3meC) lesions caused by deficiency in, respectively, BER and AlkB dioxygenase. The decreased level of MMS-induced Arg(+) revertants in the strains deficient in polymerase V (PolV) (bearing the deletion of the umuDC operon), and the increased frequency of these revertants in bacteria overproducing PolV (harbouring the pRW134 plasmid) indicate the involvement of PolV in the error-prone repair of 1meA/3meC and AP sites. Comparison of the sensitivity to MMS and the induction of Arg(+) revertants in the double nfo alkB and xth alkB, and the quadruple xth nth nfo alkB mutants showed that the more AP sites there are in DNA, the stronger the effect of the lack of AlkB protein. Since the sum of MMS-induced Arg(+) revertants in xth, nfo and nth xth nfo and alkB mutants is smaller than the frequency of these revertants in the BER(-) alkB(-) strain, we consider two possibilities: (i) the presence of AP sites in DNA results in relaxation of its structure that facilitates methylation and (ii) additional AP sites are formed in the BER(-) alkB(-) mutants.
Almeida, Michell O.; Barros, Daiane A. S.; Araujo, Sheila C.; Faria, Sergio H. D. M.; Maltarollo, Vinicius G.; Honorio, Kathia M.
2017-09-01
Cancer cells can expand to other parts of body through blood system and nodes from a mechanism known as metastasis. Due to the large annual growth of cancer cases, various biological targets have been studied and related to this disorder. A very interesting target related to cancer is human epidermal growth factor receptor 2 (HER2). In this study, we analyzed the main intermolecular interactions between a drug used in the cancer treatment (5-fluorouracil) and HER2. Molecular modeling methods were also employed to assess the molecular structure, spectroscopic properties (FTIR and UV-Vis), NBO, QTAIM and HOMO-LUMO energies of 5-FU. From the docking simulations it was possible to analyze the interactions that occur between some residues in the binding site of HER2 and 5-FU. To validate the choice of basis set that was used in the NBO and QTAIM analyses, theoretical calculations were performed to obtain FT-IR and UV/Vis spectra, and the theoretical results are consistent with the experimental data, showing that the basis set chosen is suitable. For the maximum λ from the theoretical calculation (254.89 nm) of UV/Vis, the electronic transition from HOMO to LUMO occurs at 4.89 eV. From NBO analyses, we observed interactions between Asp863 and 5-FU, i.e. the orbitals with high transfer of electrons are LP O15 (donor NBO) and BD* (π) N1-H10 (acceptor NBO), being that the value of this interaction is 7.72 kcal/mol. Results from QTAIM indicate one main intermolecular H bond, which is necessary to stabilize the complex formed between the ligands and the biological target. Therefore, this study allowed a careful evaluation on the main structural, spectroscopic and electronic properties involved in the interaction between 5-FU and HER2, an important biological complex related to the cancer treatment.
Energy Technology Data Exchange (ETDEWEB)
Marciniak, L., E-mail: L.Marciniak@int.pan.wroc.pl [Institute for Low Temperature and Structure Research, Polish Academy of Sciences, Wroclaw (Poland); Hreniak, D.; Strek, W. [Institute for Low Temperature and Structure Research, Polish Academy of Sciences, Wroclaw (Poland); Piccinelli, F., E-mail: fabio.piccinelli@univr.it [Laboratorio di Chimica dello Stato Solido, DB, Università di Verona and INSTM, UdR Verona, Strada Le Grazie 15, 37134 Verona (Italy); Speghini, A.; Bettinelli, M. [Laboratorio di Chimica dello Stato Solido, DB, Università di Verona and INSTM, UdR Verona, Strada Le Grazie 15, 37134 Verona (Italy); Miritello, M., E-mail: maria.miritello@ct.infn.it [CNR-IMM MATIS and Dipartimento di Fisica e Astronomia, Università di Catania, Via S. Sofia 64, 95123 Catania (Italy); Lo Savio, R.; Cardile, P.; Priolo, F. [CNR-IMM MATIS and Dipartimento di Fisica e Astronomia, Università di Catania, Via S. Sofia 64, 95123 Catania (Italy)
2016-02-15
Powders of yttrium disilicate (Y{sub 2}Si{sub 2}O{sub 7}) doped with Er{sup 3+} have been prepared by the sol–gel method. The structure of the obtained powders has been determined. Room temperature emission spectra have been recorded and excited state decay profiles have been analyzed. Differences between the spectroscopic properties of Er{sup 3+} in monoclinic α-Y{sub 2}Si{sub 2}O{sub 7} (space group P-1) and β-Y{sub 2}Si{sub 2}O{sub 7} (space group C2/m) polymorphs have been investigated and shown. The significant broadening of the emission spectra recorded for the α phase compared to the one for the β phase was discussed in terms of higher number of Y{sup 3+} sites (4) present in the α phase with respect to only one Y{sup 3+} site in the case of β phase. The higher value of the luminescence decay time of β phase (11.2 ms) compared to the α phase (8.5 ms) is associated with the higher site symmetry of β-Y{sub 2}Si{sub 2}O{sub 7}. Moreover it was found that Er{sup 3+} concentration affects the shape of the {sup 4}I{sub 13/2}→{sup 4}I{sub 15/2} emission band. It results in changes of the relative emission intensities of peaks localized at 1527 nm and 1532 nm; this indicates changes of the Y{sup 3+} sites occupation on increasing the Er{sup 3+} concentration. The luminescence lifetime was observed to decrease with the increase of Er{sup 3+} concentration. The spectroscopic results have been compared with the ones relative to thin films of Y{sub 2}Si{sub 2}O{sub 7}:Er{sup 3+} with a similar composition. The lower value of the luminescence decay time observed for thin films compared to the powder of α phase was explained with the changes of the particles packing resulting in the change of the effective refractive index.
Directory of Open Access Journals (Sweden)
Hali Bordelon
2011-01-01
Full Text Available Poly(D,L-lactide-co-glycolide- (PLGA-chitosan nanoparticles are becoming an increasingly common choice for the delivery of nucleic acids to cells for various genetic manipulation techniques. These particles are biocompatible, with tunable size and surface properties, possessing an overall positive charge that promotes complex formation with negatively charged nucleic acids. This study examines properties of the PLGA-chitosan nanoparticle/plasmid DNA complex after formation. Specifically, the study aims to determine the optimal ratio of plasmid DNA:nanoparticles for nucleic acid delivery purposes and to elucidate the location of the pDNA within these complexes. Such characterization will be necessary for the adoption of these formulations in a clinical setting. The ability of PLGA-chitosan nanoparticles to form complexes with pDNA was evaluated by using the fluorescent intercalating due OliGreen to label free plasmid DNA. By monitoring the fluorescence at different plasmid: nanoparticle ratios, the ideal plasmid:nanoparticle ration for complete complexation of plasmid was determined to be 1:50. Surface-Enhanced Raman Spectroscopy and gel digest studies suggested that even at these optimal complexation ratios, a portion of the plasmid DNA was located on the outer complex surface. This knowledge will facilitate future investigations into the functionality of the system in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Trainor, Ryan F. [Department of Astronomy, University of California, Berkeley, 501 Campbell Hall, Berkeley, CA 94720 (United States); Strom, Allison L.; Steidel, Charles C. [Cahill Center for Astrophysics, MC 249-17, 1200 E California Boulevard, Pasadena, CA 91125 (United States); Rudie, Gwen C., E-mail: trainor@berkeley.edu [Carnegie Observatories, 813 Santa Barbara Street, Pasadena, CA 91101 (United States)
2016-12-01
We present the rest-frame optical spectroscopic properties of 60 faint ( R {sub AB} ∼ 27; L ∼ 0.1 L {sub *}) Ly α -selected galaxies (LAEs) at z ≈ 2.56. These LAEs also have rest-UV spectra of their Ly α emission line morphologies, which trace the effects of interstellar and circumgalactic gas on the escape of Ly α photons. We find that the LAEs have diverse rest-optical spectra, but their average spectroscopic properties are broadly consistent with the extreme low-metallicity end of the populations of continuum-selected galaxies selected at z ≈ 2–3. In particular, the LAEs have extremely high [O iii] λ 5008/H β ratios (log([O iii]/H β ) ∼ 0.8) and low [N ii] λ 6585/H α ratios (log([N ii]/H α ) < 1.15). Coupled with a detection of the [O iii] λ 4364 auroral line, these measurements indicate that the star-forming regions in faint LAEs are characterized by high electron temperatures (T{sub e} ≈ 1.8 × 10{sup 4} K), low oxygen abundances (12 + log(O/H) ≈ 8.04, Z{sub neb} ≈ 0.22 Z {sub ⊙}), and high excitations with respect to their more luminous continuum-selected analogs. Several of our faintest LAEs have line ratios consistent with even lower metallicities, including six with 12 + log(O/H) ≈ 6.9–7.4 (Z {sub neb} ≈ 0.02–0.05 Z{sub ⊙}). We interpret these observations in light of new models of stellar evolution (including binary interactions) that have been shown to produce long-lived populations of hot, massive stars at low metallicities. We find that strong, hard ionizing continua are required to reproduce our observed line ratios, suggesting that faint galaxies are efficient producers of ionizing photons and important analogs of reionization-era galaxies. Furthermore, we investigate the physical trends accompanying Ly α emission across the largest current sample of combined Ly α and rest-optical galaxy spectroscopy, including both the 60 KBSS-Ly α LAEs and 368 more luminous galaxies at similar redshifts. We
Mechanistic Studies with DNA Polymerases Reveal Complex Outcomes following Bypass of DNA Damage
Directory of Open Access Journals (Sweden)
Robert L. Eoff
2010-01-01
Full Text Available DNA is a chemically reactive molecule that is subject to many different covalent modifications from sources that are both endogenous and exogenous in origin. The inherent instability of DNA is a major obstacle to genomic maintenance and contributes in varying degrees to cellular dysfunction and disease in multi-cellular organisms. Investigations into the chemical and biological aspects of DNA damage have identified multi-tiered and overlapping cellular systems that have evolved as a means of stabilizing the genome. One of these pathways supports DNA replication events by in a sense adopting the mantra that one must “make the best of a bad situation” and tolerating covalent modification to DNA through less accurate copying of the damaged region. Part of this so-called DNA damage tolerance pathway involves the recruitment of specialized DNA polymerases to sites of stalled or collapsed replication forks. These enzymes have unique structural and functional attributes that often allow bypass of adducted template DNA and successful completion of genomic replication. What follows is a selective description of the salient structural features and bypass properties of specialized DNA polymerases with an emphasis on Y-family members.
Optical properties of DNA-hosted silver clusters
Markešević, Nemanja
2015-01-01
DNA-hosted silver clusters (Ag:DNAs) have attracted a lot of attention due to their small size (~20 atoms), wide range of applications in chemistry and biology, and sequence-dependent optical tunability. Most of the previous studies are focused on the ensemble of emitters in solution. However,
Sun, Lu
2014-10-16
© 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions. Here, we investigate if conformational changes induced in surface-attached DNA molecules upon ligand binding can be monitored by the quartz crystal microbalance with dissipation (QCM-D) technique. DNA duplexes containing 59-184 base pairs were formed on QCM-D crystals by stepwise assembly of synthetic oligonucleotides of designed base sequences. The DNA films were exposed to the cationic polyamines spermidine and spermine, known to condense DNA molecules in bulk experiments, or to the recombination protein Rad51, known to extend the DNA helix. The binding and dissociation of the ligands to the DNA films were monitored in real time by measurements of the shifts in resonance frequency (Δf) and in dissipation (ΔD). The QCM-D data were analyzed using a Voigt-based model for the viscoelastic properties of polymer films in order to evaluate how the ligands affect thickness and shear viscosity of the DNA layer. Binding of spermine shrinks all DNA layers and increases their viscosity in a reversible fashion, and so does spermidine, but to a smaller extent, in agreement with its lower positive charge. SPR was used to measure the amount of bound polyamines, and when combined with QCM-D, the data indicate that the layer condensation leads to a small release of water from the highly hydrated DNA films. The binding of Rad51 increases the effective layer thickness of a 59bp film, more than expected from the know 50% DNA helix extension. The combined results provide guidelines for a QCM-D biosensor based on ligand-induced structural changes in DNA films. The QCM-D approach provides high discrimination between ligands affecting the thickness and the structural properties of the DNA layer differently. The reversibility of the film
DNA as a component of ER materials
International Nuclear Information System (INIS)
Minagawa, K; Aoki, Y; Berber, M R; Mori, T; Tanaka, M
2009-01-01
Deoxyribonucleic acid (DNA), which is known as a typical biopolymer, has been utilized for a few types of ER materials. Suspensions were prepared with the particles of DNA, DNA/lipid complexes, and LDH (layered double hydroxide)/DNA composites. The purified DNA showed larger ER effect than the others, but this particle tended to absorb water, which caused less stability. Preliminary experiments of preparing composite with LDH indicated that this inorganic material would be useful for hydrophobic modification of DNA particles, although further optimization of composite preparation is needed. In addition, the LDH/DNA suspensions showed interesting behaviours under some conditions, which indicated possibility for controlling ER property in a wide range.
DNA as a component of ER materials
Energy Technology Data Exchange (ETDEWEB)
Minagawa, K; Aoki, Y; Berber, M R [Institute of Technology and Science, University of Tokushima, Tokushima 770-8506 (Japan); Mori, T [Department of Applied Chemistry, Faculty of Engineering, Kyushu University, Fukuoka 819-0395 (Japan); Tanaka, M [Faculty of Pharmaceutical Science, Tokushima Bunri University, Tokushima 770-8514 (Japan)], E-mail: minagawa@chem.tokushima-u.ac.jp
2009-02-01
Deoxyribonucleic acid (DNA), which is known as a typical biopolymer, has been utilized for a few types of ER materials. Suspensions were prepared with the particles of DNA, DNA/lipid complexes, and LDH (layered double hydroxide)/DNA composites. The purified DNA showed larger ER effect than the others, but this particle tended to absorb water, which caused less stability. Preliminary experiments of preparing composite with LDH indicated that this inorganic material would be useful for hydrophobic modification of DNA particles, although further optimization of composite preparation is needed. In addition, the LDH/DNA suspensions showed interesting behaviours under some conditions, which indicated possibility for controlling ER property in a wide range.
International Nuclear Information System (INIS)
Matsumoto, Yoshihisa
1996-01-01
This review described findings hitherto and future perspective on the DNA-PK. The enzyme was activated by double-strand DNA, required the end of the DNA and was the major component of p350 protein. Ku-antigen (an autoimmune antigen) was found a subunit. It phosphorylated p53, c-Myc, RPAp34, DNA ligase I, DNA topoisomerase I and II. Therefore DNA-PK can be a trigger factor which recognizes DNA break induced by radiation, and phosphorylates proteins participating in the DNA repair, cell cycle regulation and cell death. Recently p350 was found to be a responsible gene product to SCID syndrome of mice hypersensitive to ionizing radiation. The review included; On the DNA-PK: Discovery, relation to Ku antigen and molecular properties. On the DNA-PK and radiation sensitivity, and V(D)J recombination: Ku80 was the product of X-ray repair cross-complementing (XRCC). p350 was found the gene product whose lack causing SCID syndrome of radiosensitive mice. On the significance of phosphorylation of DNA-PK and the substrate: p53. RPA (replication protein A, alias RF-A or SSB). P1/MCM3, a possible substrate. On the other properties of DNA-PK: DNA-helicase activity. Suppression of transcription by RNA polymerase. DNA-PKp350 and ATM (ataxia-telangiectasia). Family molecules of p53 and ATM (MEI-41, Tel1p and Mec1p, and Rad3). (H.O). 70 refs
DNA under Force: Mechanics, Electrostatics, and Hydration
Directory of Open Access Journals (Sweden)
Jingqiang Li
2015-02-01
Full Text Available Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.
Antimicrobial activity, cytotoxicity and DNA binding studies of carbon dots
Jhonsi, Mariadoss Asha; Ananth, Devanesan Arul; Nambirajan, Gayathri; Sivasudha, Thilagar; Yamini, Rekha; Bera, Soumen; Kathiravan, Arunkumar
2018-05-01
In recent years, quantum dots (QDs) are one of the most promising nanomaterials in life sciences community due to their unexploited potential in biomedical applications; particularly in bio-labeling and sensing. In the advanced nanomaterials, carbon dots (CDs) have shown promise in next generation bioimaging and drug delivery studies. Therefore the knowledge of the exact nature of interaction with biomolecules is of great interest to designing better biosensors. In this study, the interaction between CDs derived from tamarind and calf thymus DNA (ct-DNA) has been studied by vital spectroscopic techniques, which revealed that the CDs could interact with DNA via intercalation. The apparent association constant has been deduced from the absorption spectral changes of ct-DNA-CDs using the Benesi-Hildebrand equation. From the DNA induced emission quenching experiments the apparent DNA binding constant of the CDs (Kapp) have also been evaluated. Furthermore, we have analyzed the antibacterial and antifungal activity of CDs using disc diffusion assay method which exhibited excellent activity against E. coli and C. albicans with inhibition zone in the range of 7-12 mm. The biocompatible nature of CDs was confirmed by an in vitro cytotoxicity test on L6 normal rat myoblast cells by using MTT assay. The cell viability is not affected till the high dosage of CDs (200 μg/mL) for >48 h. As a consequence of the work, future development of CDs for microbial control and DNA sensing among the various biomolecules is possible in view of emerging biofields.
Stolzenburg, Sabine; Goubert, Désirée; Rots, Marianne
2016-01-01
DNA methyltransferases are important enzymes in a broad range of organisms. Dysfunction of DNA methyltransferases in humans leads to many severe diseases, including cancer. This book focuses on the biochemical properties of these enzymes, describing their structures and mechanisms in bacteria,
In situ structure and dynamics of DNA origami determined through molecular dynamics simulations.
Yoo, Jejoong; Aksimentiev, Aleksei
2013-12-10
The DNA origami method permits folding of long single-stranded DNA into complex 3D structures with subnanometer precision. Transmission electron microscopy, atomic force microscopy, and recently cryo-EM tomography have been used to characterize the properties of such DNA origami objects, however their microscopic structures and dynamics have remained unknown. Here, we report the results of all-atom molecular dynamics simulations that characterized the structural and mechanical properties of DNA origami objects in unprecedented microscopic detail. When simulated in an aqueous environment, the structures of DNA origami objects depart from their idealized targets as a result of steric, electrostatic, and solvent-mediated forces. Whereas the global structural features of such relaxed conformations conform to the target designs, local deformations are abundant and vary in magnitude along the structures. In contrast to their free-solution conformation, the Holliday junctions in the DNA origami structures adopt a left-handed antiparallel conformation. We find the DNA origami structures undergo considerable temporal fluctuations on both local and global scales. Analysis of such structural fluctuations reveals the local mechanical properties of the DNA origami objects. The lattice type of the structures considerably affects global mechanical properties such as bending rigidity. Our study demonstrates the potential of all-atom molecular dynamics simulations to play a considerable role in future development of the DNA origami field by providing accurate, quantitative assessment of local and global structural and mechanical properties of DNA origami objects.
Wang, Fuan; Willner, Bilha; Willner, Itamar
2014-01-01
The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.
Energy Technology Data Exchange (ETDEWEB)
Cabral, Analucia Guedes Silveira; Tenorio-Souza, Fabio Henrique; Moura, Marcelo Dantas; Mota, Sabrina Gondim Ribeiro; Silva Lins, Antonio Claudio da; Dias, Celidarque da Silva; Barbosa-Filho, Jose Maria [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Dept. de Ciencias Frmaceuticas; Giulietti, Ana Maria [Universidade Estadual de Feira de Santana, Feira de Santana, BA (Brazil). Dept. de Ciencias Biologicas; Silva, Tania Maria Sarmento da [Universidade Federal Rural de Pernambuco, Recife, PE (Brazil). Dept. de Ciencias Moleculares; Santos, Creusioni Figueredo dos, E-mail: jbarbosa@ltf.ufpb.br [Universidade Federal da Paraiba (UFPB), Joao Pessoa, PB (Brazil). Dept. de Biologia Molecular
2012-07-01
Our study reports the extraction and isolation of a new phaeophytin derivative 15{sup 1}-hydroxy-(15{sup 1}-S)-porphyrinolactone, designated anamariaine (1) herein, isolated from the chloroform fraction of aerial parts of Thyrsacanthus ramosissimus Moric. along with the known 15{sup 1}-ethoxy-(15{sup 1}-S)-porphyrinolactone (2). These compounds were identified by usual spectroscopic methods. Both compounds were subjected to in vitro (inhibitory activity) tests by means of supercoiled DNA relaxation techniques and were shown to display inhibitory activity against human DNA topoisomerase II-{alpha} at 50 {mu}M. Interconversion of these two pigments under the mild conditions of the isolation techniques should be highly unlikely but cannot be entirely ruled out. (author)
Temperature influence on spectroscopic properties and 2.7-μm lasing of Er:YAP crystal
Švejkar, Richard; Šulc, Jan; Němec, Michal; Jelínková, Helena; Nejezchleb, Karel; Čech, Miroslav
2018-02-01
The spectroscopic and laser properties of Er:YAP crystal, that is appropriate for generation at 2.7 μm, in temperature range 78 - 400 K are presented. The sample of Er:YAP (1 at. % of Er3+) had face-polished plan-parallel faces without anti-reflection coatings (thickness 4.47 mm). During experiments the Er:YAP was attached to temperature controlled copper holder and it was placed in vacuum chamber. The transmission and emission spectra together with the fluorescence decay time were measured depending on temperature. The Er:YAP crystal was longitudinally pumped by radiation from laser diode that works in pulse regime (repetition rate 66.6 Hz, pulse duration 1.5 ms, pump wavelength 972.5 nm) or in CW regime. Laser resonator was hemispherical, 145 mm in length with flat pumping mirror (HR @ 2.7 μm) and spherical output coupler (r = 150 mm, R = 95 % @ 2.5 - 2.8 μm). The fluorescence decay time of manifold 4I11/2 (upper laser level) became shorter and intensity of up-conversion radiation was increasing with decreasing temperature. In pulsed regime, the highest slope efficiency with respect to absorbed mean power was 1.27 % at 78 K. The maximum output of mean power was 3.5 mW at 78 K, i.e. 8.7 times higher than measured this value at 300 K. The maximal output power 27 mW with slope efficiency up to 3.5 % was achieved in CW. The radiation generated by Er:YAP laser (2.73 μm) is close to absorption peak of water (3 μm) thus this wavelength can be use in medicine and spectroscopy.
Investigation of the optical properties of MoS2 thin films using spectroscopic ellipsometry
International Nuclear Information System (INIS)
Yim, Chanyoung; O'Brien, Maria; Winters, Sinéad; McEvoy, Niall; Mirza, Inam; Lunney, James G.; Duesberg, Georg S.
2014-01-01
Spectroscopic ellipsometry (SE) characterization of layered transition metal dichalcogenide (TMD) thin films grown by vapor phase sulfurization is reported. By developing an optical dispersion model, the extinction coefficient and refractive index, as well as the thickness of molybdenum disulfide (MoS 2 ) films, were extracted. In addition, the optical band gap was obtained from SE and showed a clear dependence on the MoS 2 film thickness, with thinner films having a larger band gap energy. These results are consistent with theory and observations made on MoS 2 flakes prepared by exfoliation, showing the viability of vapor phase derived TMDs for optical applications
Energy Technology Data Exchange (ETDEWEB)
Cunha, Carlos E. [KIPAC, Menlo Park; Huterer, Dragan [Michigan U.; Lin, Huan [Fermilab; Busha, Michael T. [Zurich U.; Wechsler, Risa H. [SLAC
2014-10-11
We use N-body-spectro-photometric simulations to investigate the impact of incompleteness and incorrect redshifts in spectroscopic surveys to photometric redshift training and calibration and the resulting effects on cosmological parameter estimation from weak lensing shear-shear correlations. The photometry of the simulations is modeled after the upcoming Dark Energy Survey and the spectroscopy is based on a low/intermediate resolution spectrograph with wavelength coverage of 5500{\\AA} < {\\lambda} < 9500{\\AA}. The principal systematic errors that such a spectroscopic follow-up encounters are incompleteness (inability to obtain spectroscopic redshifts for certain galaxies) and wrong redshifts. Encouragingly, we find that a neural network-based approach can effectively describe the spectroscopic incompleteness in terms of the galaxies' colors, so that the spectroscopic selection can be applied to the photometric sample. Hence, we find that spectroscopic incompleteness yields no appreciable biases to cosmology, although the statistical constraints degrade somewhat because the photometric survey has to be culled to match the spectroscopic selection. Unfortunately, wrong redshifts have a more severe impact: the cosmological biases are intolerable if more than a percent of the spectroscopic redshifts are incorrect. Moreover, we find that incorrect redshifts can also substantially degrade the accuracy of training set based photo-z estimators. The main problem is the difficulty of obtaining redshifts, either spectroscopically or photometrically, for objects at z > 1.3. We discuss several approaches for reducing the cosmological biases, in particular finding that photo-z error estimators can reduce biases appreciably.
Platinated DNA oligonucleotides: new probes forming ultrastable conjugates with graphene oxide
Wang, Feng; Liu, Juewen
2014-05-01
Metal containing polymers have expanded the property of polymers by involving covalently associated metal complexes. DNA is a special block copolymer. While metal ions are known to influence DNA, little is explored on its polymer property when strong metal complexes are associated. In this work, we study cisplatin modified DNA as a new polymer and probe. Out of the complexes formed between cisplatin-A15, HAuCl4-A15, Hg2+-T15 and Ag+-C15, only the cisplatin adduct is stable under the denaturing gel electrophoresis condition. Each Pt-nucleobase bond gives a positive charge and thus makes DNA a zwitterionic polymer. This allows ultrafast adsorption of DNA by graphene oxide (GO) and the adsorbed complex is highly stable. Non-specific DNA, protein, surfactants and thiolated compounds cannot displace platinated DNA from GO, while non-modified DNA is easily displaced in most cases. The stable GO/DNA conjugate is further tested for surface hybridization. This is the first demonstration of using metallated DNA as a polymeric material for interfacing with nanoscale materials.Metal containing polymers have expanded the property of polymers by involving covalently associated metal complexes. DNA is a special block copolymer. While metal ions are known to influence DNA, little is explored on its polymer property when strong metal complexes are associated. In this work, we study cisplatin modified DNA as a new polymer and probe. Out of the complexes formed between cisplatin-A15, HAuCl4-A15, Hg2+-T15 and Ag+-C15, only the cisplatin adduct is stable under the denaturing gel electrophoresis condition. Each Pt-nucleobase bond gives a positive charge and thus makes DNA a zwitterionic polymer. This allows ultrafast adsorption of DNA by graphene oxide (GO) and the adsorbed complex is highly stable. Non-specific DNA, protein, surfactants and thiolated compounds cannot displace platinated DNA from GO, while non-modified DNA is easily displaced in most cases. The stable GO/DNA conjugate
Self-assembled catalytic DNA nanostructures for synthesis of para-directed polyaniline.
Wang, Zhen-Gang; Zhan, Pengfei; Ding, Baoquan
2013-02-26
Templated synthesis has been considered as an efficient approach to produce polyaniline (PANI) nanostructures. The features of DNA molecules enable a DNA template to be an intriguing template for fabrication of emeraldine PANI. In this work, we assembled HRP-mimicking DNAzyme with different artificial DNA nanostructures, aiming to manipulate the molecular structures and morphologies of PANI nanostructures through the controlled DNA self-assembly. UV-vis absorption spectra were used to investigate the molecular structures of PANI and monitor kinetic growth of PANI. It was found that PANI was well-doped at neutral pH and the redox behaviors of the resultant PANI were dependent on the charge density of the template, which was controlled by the template configurations. CD spectra indicated that the PANI threaded tightly around the helical DNA backbone, resulting in the right handedness of PANI. These reveal the formation of the emeraldine form of PANI that was doped by the DNA. The morphologies of the resultant PANI were studied by AFM and SEM. It was concluded from the imaging and spectroscopic kinetic results that PANI grew preferably from the DNAzyme sites and then expanded over the template to form 1D PANI nanostructures. The strategy of the DNAzyme-DNA template assembly brings several advantages in the synthesis of para-coupling PANI, including the region-selective growth of PANI, facilitating the formation of a para-coupling structure and facile regulation. We believe this study contributes significantly to the fabrication of doped PANI nanopatterns with controlled complexity, and the development of DNA nanotechnology.
Controlling charge current through a DNA based molecular transistor
Energy Technology Data Exchange (ETDEWEB)
Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.
2017-01-05
Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.
Tabassum, Sartaj; Zaki, Mehvash; Ahmad, Musheer; Afzal, Mohd; Srivastav, Saurabh; Srikrishna, Saripella; Arjmand, Farukh
2014-08-18
New Cu(II) complex 1 of indole-3-propionic acid and 1,10-phenanthroline was synthesized and characterized by analytical, spectroscopic and single crystal X-ray diffraction. In vitro DNA binding studies of 1 was performed by employing UV-vis and fluorescence spectroscopic techniques. The binding affinity towards human serum albumin (HSA) was also investigated to understand the carrier role in body system, as the time dependent HPLC experiment of 1 revealed that bonded drug with protein releases slowly in presence of DNA. Complex 1 exhibited good anti-tumor activity (GI50 values <10 μg/ml), and to elucidate the mechanism of tumor inhibition, topoisomerase I enzymatic activity was carried out and further validated by cell imaging studies which clearly showed its nuclear localization. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Studies of torsional properties of DNA and nucleosomes using angular optical trapping
Sheinin, Maxim Y.
DNA in vivo is subjected to torsional stress due to the action of molecular motors and other DNA-binding proteins. Several decades of research have uncovered the fascinating diversity of DNA transformations under torsion and the important role they play in the regulation of vital cellular processes such as transcription and replication. Recent studies have also suggested that torsion can influence the structure and stability of nucleosomes---basic building blocks of the eukaryotic genome. However, our understanding of the impact of torsion is far from being complete due to significant experimental challenges. In this work we have used a powerful single-molecule experimental technique, angular optical trapping, to address several long-standing issues in the field of DNA and nucleosome mechanics. First, we utilized the high resolution and direct torque measuring capability of the angular optical trapping to precisely measure DNA twist-stretch coupling. Second, we characterized DNA melting under tension and torsion. We found that torsionally underwound DNA forms a left-handed structure, significantly more flexible compared to the regular B-DNA. Finally, we performed the first comprehensive investigation of the single nucleosome behavior under torque and force. Importantly, we discovered that positive torque causes significant dimer loss, which can have implications for transcription through chromatin.
Theoretical spectroscopic study of the conjugate microcystin-LR-europium cryptate
Energy Technology Data Exchange (ETDEWEB)
Santos, Julio G.; Dutra, Jose Diogo L.; Costa Junior, Nivan B. da; Freire, Ricardo O., E-mail: rfreire@ufs.br [Universidade Federal de Sergipe (UFS), Sao Cristovao, SE (Brazil). Departamento de Quimica; Alves Junior, Severino; Sa, Gilberto F. de [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Departamento de Quimica Fundamental
2013-02-15
In this work, theoretical tools were used to study spectroscopic properties of the conjugate microcystin-LR-europium cryptate. The Sparkle/AM1 model was applied to predict the geometry of the system and the INDO/S-CIS model was used to calculate the excited state energies. Based on the Judd-Ofelt theory, the intensity parameters were predicted and a theoretical model based on the theory of the 4f-4f transitions was applied to calculate energy transfer and backtransfer rates, radiative and non-radiative decay rates, quantum efficiency and quantum yield. A detailed study of the luminescent properties of the conjugate Microcystin-LR-europium cryptate was carried out. The results show that the theoretical quantum yield of luminescence of 23% is in good agreement with the experimental value published. This fact suggests that this theoretical protocol can be used to design new systems in order to improve their luminescence properties. The results suggest that this luminescent system may be a good conjugate for using in assay ELISA for detection by luminescence of the Microcystin-LR in water. (author)
Directory of Open Access Journals (Sweden)
Ezequiel A. Belo
2018-01-01
Full Text Available Enantiomeric amino acids have specific physiological functions in complex biological systems. Systematic studies focusing on the solid-state properties of d-amino acids are, however, still limited. To shed light on this field, structural and spectroscopic studies of d-alanine using neutron powder diffraction, polarized Raman scattering and ab initio calculations of harmonic vibrational frequencies were carried out. Clear changes in the number of vibrational modes are observed as a function of temperature, which can be directly connected to variations of the N—D bond lengths. These results reveal dissimilarities in the structural properties of d-alanine compared with l-alanine.
DNA-FET using carbon nanotube electrodes
International Nuclear Information System (INIS)
Sasaki, T K; Ikegami, A; Aoki, N; Ochiai, Y
2006-01-01
We demonstrate DNA field effect transistor (DNA-FET) using multiwalled carbon nanotube (MWNT) as nano-structural source and drain electrodes. The MWNT electrodes have been fabricated by focused ion-beam bombardment (FIBB). A very short channel, approximately 50 nm, was easily formed between the severed MWNT. The current-voltage (I-V) characteristics of DNA molecules between the MWNT electrodes showed hopping transport property. We have also measured the gate-voltage dependence in the I-V characteristics and found that poly DNA molecules exhibits p-type conduction. The transport of DNA-FET can be explained by two hopping lengths which depend on the range of the source-drain bias voltages
Neocarzinostatin as a probe for DNA protection activity--molecular interaction with caffeine.
Chin, Der-Hang; Li, Huang-Hsien; Kuo, Hsiu-Maan; Chao, Pei-Dawn Lee; Liu, Chia-Wen
2012-04-01
Neocarzinostatin (NCS), a potent mutagen and carcinogen, consists of an enediyne prodrug and a protein carrier. It has a unique double role in that it intercalates into DNA and imposes radical-mediated damage after thiol activation. Here we employed NCS as a probe to examine the DNA-protection capability of caffeine, one of common dietary phytochemicals with potential cancer-chemopreventive activity. NCS at the nanomolar concentration range could induce significant single- and double-strand lesions in DNA, but up to 75 ± 5% of such lesions were found to be efficiently inhibited by caffeine. The percentage of inhibition was caffeine-concentration dependent, but was not sensitive to the DNA-lesion types. The well-characterized activation reactions of NCS allowed us to explore the effect of caffeine on the enediyne-generated radicals. Postactivation analyses by chromatographic and mass spectroscopic methods identified a caffeine-quenched enediyne-radical adduct, but the yield was too small to fully account for the large inhibition effect on DNA lesions. The affinity between NCS chromophore and DNA was characterized by a fluorescence-based kinetic method. The drug-DNA intercalation was hampered by caffeine, and the caffeine-induced increases in DNA-drug dissociation constant was caffeine-concentration dependent, suggesting importance of binding affinity in the protection mechanism. Caffeine has been shown to be both an effective free radical scavenger and an intercalation inhibitor. Our results demonstrated that caffeine ingeniously protected DNA against the enediyne-induced damages mainly by inhibiting DNA intercalation beforehand. The direct scavenging of the DNA-bound NCS free radicals by caffeine played only a minor role. Copyright © 2011 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Gorski, Christopher A.; Voegelin, Andreas; Sander, Michael; Hofstetter, Thomas B.
2012-01-01
. Our results indicate that the reduction and oxidation of SWa-1 is complex and partly irreversible, implying that classically used thermodynamic relationships (i.e., the Nernst equation and Gibbs free energy) cannot be used to describe SWa-1 redox reactions. SWa-1 is redox active over a much wider potential range (approx. 1.0 V) than would be expected for a single electron transferring species (i.e., Fe 2+ /Fe 3+ ) in Nernstian system, which is attributed to redox interdependence between octahedral Fe sites. SWa-1 reduction and oxidation is also shown to be inherently thermodynamically irreversible based on oxidation and reduction paths following different Fe 2+ /Fe 3+ versus applied potential (E H ) curves depending on the initial redox state of the SWa-1. By modeling the Fe 2+ /Fe 3+ versus applied potential curves, we were able to fit apparent standard reduction potential values for native and dithionite-reduced SWa-1 that can be used in future studies. Current work is underway to determine the effect of pH on the redox properties of Fe-bearing clay minerals. Spectroscopic observations indicate that the reduction and subsequent re-oxidation of all the clay minerals studied was chemically irreversible, as indicated by the native and re-oxidized samples exhibiting differences in Moessbauer and XAS spectra. Further characterization of the Moessbauer spectra suggest that certain spectral features are indicative of the reduction potential (Eh) at which structural Fe 3+ reduction occurs. Our results point out that the complex redox behavior of Fe-bearing clay minerals must be taken into account to understand and predict the fate of radionuclides in matrices containing Fe-bearing clay minerals. The spectroscopic and electrochemical characterization of Fe-bearing clay minerals in this study also provides a means to account for these factors in future studies. Finally, we show that mediated electrochemistry offers new avenues to assess the redox properties of other redox
Energy Technology Data Exchange (ETDEWEB)
Bensalah, A. [Physical Chemistry of Luminescent Materials, Claude Bernard/Lyon1 University, UMR 5620, CNRS Bat. A. Kastler, 10 rue Ampere, 69622 Villeurbanne (France) and Institute for Multidisciplinary Research of Advanced Materials, Tohoku University, Sendai 980-8577 (Japan)]. E-mail: amina-bensalah@enscp.fr; Ito, M. [Physical Chemistry of Luminescent Materials, Claude Bernard/Lyon1 University, UMR 5620, CNRS Bat. A. Kastler, 10 rue Ampere, 69622 Villeurbanne (France); Guyot, Y. [Physical Chemistry of Luminescent Materials, Claude Bernard/Lyon1 University, UMR 5620, CNRS Bat. A. Kastler, 10 rue Ampere, 69622 Villeurbanne (France); Goutaudier, C. [Physical Chemistry of Luminescent Materials, Claude Bernard/Lyon1 University, UMR 5620, CNRS Bat. A. Kastler, 10 rue Ampere, 69622 Villeurbanne (France); Jouini, A. [Physical Chemistry of Luminescent Materials, Claude Bernard /Lyon1 University, UMR 5620, CNRS Bat. A. Kastler, 10 rue Ampere, 69622 Villeurbanne (France); Institute for Multidisciplinary Research of Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Brenier, A. [Physical Chemistry of Luminescent Materials, Claude Bernard/Lyon1 University, UMR 5620, CNRS Bat. A. Kastler, 10 rue Ampere, 69622 Villeurbanne (France); Sato, H. [Institute for Multidisciplinary Research of Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Fukuda, T. [Institute for Multidisciplinary Research of Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Boulon, G. [Physical Chemistry of Luminescent Materials, Claude Bernard /Lyon1 University, UMR 5620, CNRS Bat. A. Kastler, 10 rue Ampere, 69622 Villeurbanne (France)
2007-01-15
Spectroscopic characterization is carried out to identify Stark's levels of Yb{sup 3+} transitions in several fluoride crystals grown either by the Czochralski technique or by the laser-heated pedestal growth method. Yb{sup 3+} concentration dependence of the decay time is analyzed in order to understand involved concentration quenching mechanisms. Laser tests under saphire:Ti pumping are presented for all our materials as well as under diode pumping for Yb:CaF{sub 2}.
International Nuclear Information System (INIS)
Cukovicova, M.; Cernusak, I.
2010-01-01
For our study we have chosen a series of diatomic molecules MeB (where Me = Li, Na, K, Rb, Cs, Fr). These molecules present experimentally unknown species, hence we were motivated to predict theoretically potential energy curves, equilibrium bond lengths, harmonic frequencies, constants of anharmonicity, dipole moments and dissociation energies for the ground and low-lying excited states using high level ab initio techniques. Based on previous state averaged MRCI calculations in ANO-S basis set of NaB and KB molecules, we have focused on four lowest-lying electronic states, ground state 3Π and excited states 1Σ+, 1Π and 3Σ+. All four states dissociate to the atoms in ground states 2P1/2(B) and 2S1/2(Me). 3Π, 1Σ+, 1Π and 3Σ+ electronic states we investigated employing CCSD(T) method using relativistic ANO-RCC basis set. Our calculations include scalar relativistic effects via the second order one-component (spin-free) Douglas-Kroll-Hess Hamiltonian. Relativistic effects become remarkable in the case of heavy atoms, hence properties of CsB and FrB molecules may differ from trend of properties in row from LiB to FrB. Spectroscopic properties of particular state were obtained from the analysis of the potential energy curves using VIBROT and DUNHAM programs.
Detection of parvovirus B19 DNA in blood: Viruses or DNA remnants?
Molenaar-de Backer, M W A; Russcher, A; Kroes, A C M; Koppelman, M H G M; Lanfermeijer, M; Zaaijer, H L
2016-11-01
Parvovirus B19 (B19V) DNA can be detected in blood over a long period after acute infection. Several reports associate the presence of B19V DNA with disease, irrespective of timing of the initial B19V infection. This study aims to analyze the properties of B19V DNA in blood, differentiating between bare, non-infectious strands of DNA and B19V DNA in viable virions. Ten blood donors with asymptomatic acute B19V infection were followed and sampled up to 22 months after infection. The samples were treated with and without an endonuclease and tested for B19V DNA, to distinguish between DNA in virions and naked DNA. In the acute phase of infection, high levels of B19V DNA were detected, concurrent with B19V IgM antibodies. B19V DNA apparently was encapsidated, as indicated by resistance to endonuclease degradation. Subsequently, B19V DNA remained detectable for more than one year in all donors at low levels (<10 5 IU/mL). Approximately 150days after infection B19V DNA became degradable by an endonuclease, indicating that this concerned naked DNA. In some donors a second endonuclease-resistant peak occurred. Detection of B19V DNA in blood by PCR does not necessarily imply that B19V replication takes place and that infectious B19V virions are present. We propose that remnant B19V DNA strands can be released from tissues without active replication. This finding urges to reconsider an assumed role of B19V infection mainly based on B19V DNA detection in blood, a much debated subject in clinical syndromes such as myocarditis and arthritis. Copyright © 2016 Elsevier B.V. All rights reserved.
Some Effective Tight-Binding Models for Electrons in DNA Conduction: A Review
International Nuclear Information System (INIS)
Yamada, H.; Iguchi, K.
2010-01-01
Quantum transport for DNA conduction has been widely studied with interest in application as a candidate in making nanowires as well as interest in the scientific mechanism. In this paper, we review recent works concerning the electronic states and the conduction/transfer in DNA polymers. We have mainly investigated the energy-band structure and the correlation effects of localization property in the two- and three-chain systems (ladder model) with long-range correlation as a simple model for electronic property in a double strand of DNA by using the tight-bindingmodel. In addition, we investigated the localization properties of electronic states in several actual DNA sequences such as bacteriophages of Escherichia coli, human-chromosome 22, compared with those of the artificial disordered sequences with correlation. The charge-transfer properties for poly(dA)-poly(dT) and poly(dG)-poly(dC) DNA polymers are also presented in terms of localization lengths within the frameworks of the polaron models due to the coupling between the charge carriers and the lattice vibrations of the double strand of DNA
Mechanical design of DNA nanostructures
Castro, Carlos E.; Su, Hai-Jun; Marras, Alexander E.; Zhou, Lifeng; Johnson, Joshua
2015-03-01
Structural DNA nanotechnology is a rapidly emerging field that has demonstrated great potential for applications such as single molecule sensing, drug delivery, and templating molecular components. As the applications of DNA nanotechnology expand, a consideration of their mechanical behavior is becoming essential to understand how these structures will respond to physical interactions. This review considers three major avenues of recent progress in this area: (1) measuring and designing mechanical properties of DNA nanostructures, (2) designing complex nanostructures based on imposed mechanical stresses, and (3) designing and controlling structurally dynamic nanostructures. This work has laid the foundation for mechanically active nanomachines that can generate, transmit, and respond to physical cues in molecular systems.Structural DNA nanotechnology is a rapidly emerging field that has demonstrated great potential for applications such as single molecule sensing, drug delivery, and templating molecular components. As the applications of DNA nanotechnology expand, a consideration of their mechanical behavior is becoming essential to understand how these structures will respond to physical interactions. This review considers three major avenues of recent progress in this area: (1) measuring and designing mechanical properties of DNA nanostructures, (2) designing complex nanostructures based on imposed mechanical stresses, and (3) designing and controlling structurally dynamic nanostructures. This work has laid the foundation for mechanically active nanomachines that can generate, transmit, and respond to physical cues in molecular systems. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr07153k
Directory of Open Access Journals (Sweden)
Marcin Olszewski
Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.
International Nuclear Information System (INIS)
Kraft, G.; Taucher-Scholz, G.; Heilmann, J.
1994-11-01
In this contribution, an introductory view on the physical properties of ions is given and the cellular response to high LET radiation is summarized. Then the measurements of strand break induction of DNA in solution and in intracellular DNA are reported and compared to cell survival. The possibility of changes in the quality of the lesions is discussed and finally the present status of model calculations in comparison to the experiments is given. (orig./HSI)
Single-molecule chemical reactions on DNA origami
DEFF Research Database (Denmark)
Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru
2010-01-01
as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...
Spectroscopic and chemometric exploration of food quality
DEFF Research Database (Denmark)
Pedersen, Dorthe Kjær
2002-01-01
and multi-way chemometrics demonstrated the potential for screening of environmental contamination in complex food samples. Significant prediction models were established with correlation coefficients in the range from r = 0.69 to r = 0.97 for dioxin. Further development of the fluorescence measurements......The desire to develop non-invasive rapid measurements of essential quality parameters in foods is the motivation of this thesis. Due to the speed and noninvasive properties of spectroscopic techniques, they have potential as on-line or atline methods and can be employed in the food industry...... in order to control the quality of the end product and to continuously monitor the production. In this thesis, the possibilities and limitations of the application of spectroscopy and chemometrics in rapid control of food quality are discussed and demonstrated by the examples in the eight included...
Quantum chemical study of TiO2/dopamine-DNA triads
International Nuclear Information System (INIS)
Vega-Arroyo, Manuel; LeBreton, Pierre R.; Zapol, Peter; Curtiss, Larry A.; Rajh, Tijana
2007-01-01
Photoinduced charge separation in triads of DNA covalently linked to an anatase nanoparticle via a dopamine bridge was studied by ab initio calculations of the oxidation potentials of carboxyl-DNA trimers and the TiO 2 /dopamine complex. Conjugation of dopamine to the TiO 2 surface results in a lower oxidation potential of the complex relative to the surface and in localization of photogenerated holes on dopamine, while photogenerated electrons are excited into the conduction band of TiO 2 . Linking dopamine to the DNA trimers at the 5' end of the oligonucleotide may lead to further hole migration to the DNA. Calculations show that for several different sequences hole migration is favorable in double stranded DNA and unfavorable in single-stranded DNA. This extended charge separation was shown to follow from the redox properties of DNA sequence rather than from the modification of DNA's electron donating properties by the dopamine linker, which explains experimental observations
Potential energy curves and spectroscopic properties of X2Σ+ and A2Π states of 13C14N
International Nuclear Information System (INIS)
Liao Jian-Wen; Yang Chuan-Lu
2014-01-01
The potential energy curves (PECs) of X 2 Σ + and A 2 Π states of the CN molecule have been calculated with the multi-reference configuration interaction method and the aug-cc-pwCV5Z basis set. Based on the PECs, all of the vibrational and rotational levels of the 13 C 14 N molecule are obtained by solving the Schrödinger equation of the molecular nuclear motion. The spectroscopic parameters are determined by fitting the Dunham coefficients with the levels. Both the levels and the spectroscopic parameters are in good qualitative agreement with the experimental data available. The analytical potential energy functions are also deduced from the calculated PECs. The present results can provide a helpful reference for future spectroscopy experiments or dynamical calculations of the molecule. (atomic and molecular physics)
Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I
2016-01-01
Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.
On some surprising statistical properties of a DNA fingerprinting technique called AFLP
Gort, G.
2010-01-01
AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary
Microrheology of concentrated DNA solutions using optical tweezers
Indian Academy of Sciences (India)
. In this work, we report the determination of microrheological properties of concentrated, double-stranded calf thymus DNA (CT-DNA) solutions using passive, laser-scattering based particle-tracking methodology. From power spectral analysis, ...
Esteghamat-Panah, Roya; Hadadzadeh, Hassan; Farrokhpour, Hossein; Simpson, Jim; Abdolmaleki, Amir; Abyar, Fatemeh
2017-02-15
A new mononuclear rhodium(III) complex, [Rh(bzimpy)Cl 3 ] (bzimpy = 2,6-bis(2-benzimidazolyl)pyridine), was synthesized and characterized by elemental analysis and spectroscopic methods. The molecular structure of the complex was confirmed by single-crystal X-ray crystallography. The interaction of the complex with fish sperm DNA (FS-DNA) was investigated by UV spectroscopy, emission titration, and viscosity measurement in order to evaluate the possible DNA-binding mode and to calculate the corresponding DNA-binding constant. The results reveal that the Rh(III) complex interacts with DNA through groove binding mode with a binding affinity on the order of 10 4 . In addition, the binding of the Rh(III) complex to bovine serum albumin (BSA) was monitored by UV-Vis and fluorescence emission spectroscopy at different temperatures. The mechanism of the complex interaction was found to be static quenching. The thermodynamic parameters (ΔH, ΔS, and ΔG) obtained from the fluorescence spectroscopy data show that van der Waals interactions and hydrogen bonds play a major role in the binding of the Rh(III) complex to BSA. For the comparison of the DNA- and BSA-binding affinities of the free bzimpy ligand with its Rh(III) complex, the absorbance titration and fluorescence quenching experiments of the free bzimpy ligand with DNA and BSA were carried out. Competitive experiments using eosin Y and ibuprofen as site markers indicated that the complex was mainly located in the hydrophobic cavity of site I of the protein. These experimental results were confirmed by the results of molecular docking. Finally, the in vitro cytotoxicity properties of the Rh(III) complex against the MCF-7, K562, and HT-29 cell lines were evaluated and compared with those of the free ligand (bzimpy). It was found that the complexation process improved the anticancer activity significantly. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Fundamental spectroscopic studies of carbenes and hydrocarbon radicals
Energy Technology Data Exchange (ETDEWEB)
Gottlieb, C.A.; Thaddeus, P. [Harvard Univ., Cambridge, MA (United States)
1993-12-01
Highly reactive carbenes and carbon-chain radicals are studied at millimeter wavelengths by observing their rotational spectra. The purpose is to provide definitive spectroscopic identification, accurate spectroscopic constants in the lowest vibrational states, and reliable structures of the key intermediates in reactions leading to aromatic hydrocarbons and soot particles in combustion.
Sun, Lu; Frykholm, Karolin; Fornander, Louise H.; Svedhem, Sofia; Westerlund, Fredrik; Å kerman, Bjö rn
2014-01-01
© 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions
Mössbauer spectroscopic study of cobalt hexacyanoferrate nanoparticles: Effect of hydrogenation
Kumar, Asheesh; Kanagare, A. B.; Meena, Sher Singh; Banerjee, S.; Kumar, P.; Sudarsan, V.
2018-04-01
This paper reports Mössbauer study of cobalt hexacyanoferrate (CoHCF) before and after hydrogenation. The CoHCF was synthesised by chemical precipitation method. The sample was characterized by using various techniques (XRD, TG, EDX and FTIR). The CoHCF paricles show fcc structure. The hydrogen storage property was measured at different temperature. The COHCF shows maximum 0.93 wt% hydrogen storage capacity at 223K. 57Fe Mössbauer spectroscopic study shows the effect of hydrogenation on the electronic structure in terms of electronic charge distribution and volume expansion. Isomer shift and quadrupole splitting values were found to be increased after hydrogenation.
Kilic, Ahmet; Alcay, Ferhat; Aydemir, Murat; Durgun, Mustafa; Keles, Armagan; Baysal, Akın
2015-05-01
A new series of Schiff base ligands (L1-L3) and their corresponding fluorine/phenyl boron hybrid complexes [LnBF2] and [LnBPh2] (n = 1, 2 or 3) have been synthesized and well characterized by both analytical and spectroscopic methods. The Schiff base ligands and their corresponding fluorine/phenyl boron hybrid complexes have been characterized by NMR (1H, 13C and 19F), FT-IR, UV-Vis, LC-MS, and fluorescence spectroscopy as well as melting point and elemental analysis. The fluorescence efficiencies of phenyl chelate complexes are greatly red-shifted compared to those of the fluorine chelate analogs based on the same ligands, presumably due to the large steric hindrance and hard π → π∗ transition of the diphenyl boron chelation, which can effectively prevent molecular aggregation. The boron hybrid complexes were applied to the transfer hydrogenation of acetophenone derivatives to 1-phenylethanol derivatives in the presence of 2-propanol as the hydrogen source. The catalytic studies showed that boron hybrid complexes are good catalytic precursors for transfer hydrogenation of aromatic ketones in 0.1 M iso-PrOH solution. Also, we have found that both steric and electronic factors have a significant impact on the catalytic properties of this class of molecules.
DNA origami applications in cancer therapy.
Udomprasert, Anuttara; Kangsamaksin, Thaned
2017-08-01
Due to the complexity and heterogeneity of cancer, the development of cancer diagnosis and therapy is still progressing, and a complete understanding of cancer biology remains elusive. Recently, cancer nanomedicine has gained much interest as a promising diagnostic and therapeutic strategy, as a wide range of nanomaterials possess unique physical properties that can render drug delivery systems safer and more effective. Also, targeted drug delivery and precision medicine have now become a new paradigm in cancer therapy. With nanocarriers, chemotherapeutic drugs could be directly delivered into target cancer cells, resulting in enhanced efficiency with fewer side-effects. DNA, a biomolecule with molecular self-assembly properties, has emerged as a versatile nanomaterial to construct multifunctional platforms; DNA nanostructures can be modified with functional groups to improve their utilities as biosensors or drug carriers. Such applications have become possible with the advent of the scaffolded DNA origami method. This breakthrough technique in structural DNA nanotechnology provides an easier and faster way to construct DNA nanostructures with various shapes. Several experiments proved that DNA origami nanostructures possess abilities to enhance efficacies of chemotherapy, reduce adverse side-effects, and even circumvent drug resistance. Here, we highlight the principles of the DNA origami technique and its applications in cancer therapeutics and discuss current challenges and opportunities to improve cancer detection and targeted drug delivery. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
DNA-scaffolded nanoparticle structures
Energy Technology Data Exchange (ETDEWEB)
Hoegberg, Bjoern; Olin, Haakan [Department of Engineering Physics and Mathematics, Mid Sweden University, SE-851 70 Sundsvall, Sweden (Sweden)
2007-03-15
DNA self-assembly is a powerful route to the production of very small, complex structures. When used in combination with nanoparticles it is likely to become a key technology in the production of nanoelectronics in the future. Previously, demonstrated nanoparticle assemblies have mainly been periodic and highly symmetric arrays, unsuited as building blocks for any complex circuits. With the invention of DNA-scaffolded origami reported earlier this year (Rothemund P W K 2006 Nature 440 (7082) 297-302), a new route to complex nanostructures using DNA has been opened. Here, we give a short review of the field and present the current status of our experiments were DNA origami is used in conjunction with nanoparticles. Gold nanoparticles are functionalized with thiolated single stranded DNA. Strands that are complementary to the gold particle strands can be positioned on the self-assembled DNA-structure in arbitrary patterns. This property should allow an accurate positioning of the particles by letting them hybridize on the lattice. We report on our recent experiments on this system and discuss open problems and future applications.
DNA-scaffolded nanoparticle structures
International Nuclear Information System (INIS)
Hoegberg, Bjoern; Olin, Haakan
2007-01-01
DNA self-assembly is a powerful route to the production of very small, complex structures. When used in combination with nanoparticles it is likely to become a key technology in the production of nanoelectronics in the future. Previously, demonstrated nanoparticle assemblies have mainly been periodic and highly symmetric arrays, unsuited as building blocks for any complex circuits. With the invention of DNA-scaffolded origami reported earlier this year (Rothemund P W K 2006 Nature 440 (7082) 297-302), a new route to complex nanostructures using DNA has been opened. Here, we give a short review of the field and present the current status of our experiments were DNA origami is used in conjunction with nanoparticles. Gold nanoparticles are functionalized with thiolated single stranded DNA. Strands that are complementary to the gold particle strands can be positioned on the self-assembled DNA-structure in arbitrary patterns. This property should allow an accurate positioning of the particles by letting them hybridize on the lattice. We report on our recent experiments on this system and discuss open problems and future applications
Li, Zuo-Sheng; Zou, Lu-Yi; Min, Chun-Gang; Ren, Ai-Min
2013-10-05
Despite the fact that the luminescence reaction mechanism of aequorin has been intensively investigated, details in luminescence such as the effect of important amino acids residues and explicit water molecules on spectroscopic properties of coelenteramide remain unclear. In this work, the effect of amino acids residues His16, Tyr82, Trp86, Phe113, Trp129, Tyr132, explicit water molecules Wat505 and Wat405 on the spectral properties of CLM(-) has been studied by CAM-B3LYP, TD M06L and TD CAM-B3LYP methods in hydrophobic environment and aqueous solution. In hydrophobic environment, the amino acids or water molecules have no significant effect on the absorption. Tyr82 and Trp86 move close to CLM(-) changes the hydrogen bond network, and thus, the spectral properties is significantly affected by the hydrogen bonds between His16H(+)+Tyr82+Trp86 and CLM(-). Tyr82, Trp86 hydrogen bonding to CLM(-) upshifts the excited energy and helps emission spectra shift to blue region. Therefore, it is concluded that His16H(+)+Tyr82+Trp86 modify the emission spectra. The molecular electrostatic potential indicated that the greater electron density is located at the oxygen atom of 6-p-hydroxyphenyl group of CLM(-), and it facilitates the formation of hydrogen bond with His16H(+)+Tyr82+Trp86. It is a critical condition for the modification of emission spectra. It is expected to help to understand the interactions between emitter and amino acids in the micro environment. Copyright © 2013 Elsevier B.V. All rights reserved.
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Pan, Gaofeng; Jiang, Limin; Tang, Jijun; Guo, Fei
2018-02-08
DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods-especially machine learning methods-have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k -gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria-area under the receiver operating characteristic curve (AUC), Matthew's correlation coefficient (MCC), accuracy (ACC), sensitivity (SN), and specificity-are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.
Directory of Open Access Journals (Sweden)
Gaofeng Pan
2018-02-01
Full Text Available DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods—especially machine learning methods—have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k-gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria—area under the receiver operating characteristic curve (AUC, Matthew’s correlation coefficient (MCC, accuracy (ACC, sensitivity (SN, and specificity—are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.
Energy Technology Data Exchange (ETDEWEB)
Anselmi, Massimiliano, E-mail: m.anselmi@caspur.it [Department of Chemistry, University of Rome ' La Sapienza' , P.le Aldo Moro 5, 00185 Rome (Italy); Marocchi, Simone [Department of Chemistry, University of Rome ' La Sapienza' , P.le Aldo Moro 5, 00185 Rome (Italy); Aschi, Massimiliano [Department of Chemistry, Chemical Engineering and Materials, University of L' Aquila, Via Vetoio (Coppito 1), 67100 Coppito, L' Aquila (Italy); Amadei, Andrea [Department of Chemistry, University of Rome ' Tor Vergata' , Via della Ricerca Scientifica 1, 00133 Rome (Italy)
2012-01-02
Highlights: Black-Right-Pointing-Pointer The calculated absorption spectra were compared with experimental data. Black-Right-Pointing-Pointer Shapes and absorption maxima were reproduced for luciferin and oxyluciferin spectra. Black-Right-Pointing-Pointer The effect of the solvent largely changes the electronic transition probabilities. Black-Right-Pointing-Pointer Higher excitations provide an important contribution to the main absorption peak. - Abstract: Firefly luciferin and its oxidated form, oxyluciferin, are two heterocyclic compounds involved in the enzymatic reaction, catalyzed by redox proteins called luciferases, which provides the bioluminescence in a wide group of arthropods. Whereas the electronic absorption spectra of D-luciferin in water at different pHs are known since 1960s, only recently reliable experimental electronic spectra of oxyluciferin have become available. In addition oxyluciferin is involved in a triple chemical equilibria (deprotonation of the two hydroxyl groups and keto-enol tautomerism of the 4-hydroxythiazole ring), that obligates to select during an experiment a predominant species, tuning pH or solvent polarity besides introducing chemical modifications. In this study we report the absorption spectra of luciferin and oxyluciferin in each principal chemical form, calculated by means of perturbed matrix method (PMM), which allowed us to successfully introduce the effect of the solvent on the spectroscopic absorption properties, and compare the result with available experimental data.
Energy Technology Data Exchange (ETDEWEB)
Jantz, Stephan G.; Dialer, Marwin; Hoeppe, Henning A. [Lehrstuhl fuer Festkoerperchemie, Universitaet Augsburg (Germany); Pielnhofer, Florian [Abteilung Nanochemie, Max-Planck-Institut fuer Festkoerperforschung, Stuttgart (Germany)
2017-12-13
The crystal structures of Sr{sub 2}[WO{sub 5}] [Pna2{sub 1}, a = 7.2457(3) Aa, b = 10.8867(5) Aa, c = 5.5391(3) Aa, Z = 4, R{sub int} = 0.0671, R{sub 1} = 0.0495, wR{sub 2} = 0.0462] and Ba{sub 2}[WO{sub 5}] [Pnma, a = 7.3828(2) Aa, b = 5.71420(10) Aa, c = 11.4701(3) Aa, Z = 4, R{sub int} = 0.0294, R{sub 1} = 0.0146, wR{sub 2} = 0.0284] are revised, based on single-crystal XRD data. Furthermore spectroscopic data (infrared, Raman, and UV/Vis) assisted by DFT calculations are discussed and first results on the luminescence properties of Sr{sub 2}[WO{sub 5}]:Eu{sup 3+} are presented. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
A Selective G-Quadruplex DNA-Stabilizing Ligand Based on a Cyclic Naphthalene Diimide Derivative
Directory of Open Access Journals (Sweden)
Md. Monirul Islam
2015-06-01
Full Text Available A cyclic naphthalene diimide (cyclic NDI, 1, carrying a benzene moiety as linker chain, was synthesized and its interaction with G-quadruplex DNAs of a-core and a-coreTT as a human telomeric DNA, c-kit and c-myc as DNA sequence at promoter region, or thrombin-binding aptamer (TBA studied based on UV-VIS and circular dichroism (CD spectroscopic techniques, thermal melting temperature measurement, and FRET-melting assay. The circular dichroism spectra showed that 1 induced the formation of different types of G-quadruplex DNA structure. Compound 1 bound to these G-quadruplexes with affinities in the range of 106–107 M−1 order and a 2:1 stoichiometry. Compound 1 showed 270-fold higher selectivity for a-core than dsDNA with a preferable a-core binding than a-coreTT, c-kit, c-myc and TBA in the presence of K+, which is supported by thermal melting studies. The FRET-melting assay also showed that 1 bound preferentially to human telomeric DNA. Compound 1 showed potent inhibition against telomerase activity with an IC50 value of 0.9 μM and preferable binding to G-quadruplexes DNA than our previously published cyclic NDI derivative 3 carrying a benzene moiety as longer linker chain.
International Nuclear Information System (INIS)
Debenham, P.G.; Webb, M.B.T.; Masson, W.K.; Cox, R.
1984-01-01
An investigation was made of the feasibility of DNA-mediated gene transfer into human diploid fibroblasts derived from patients with the radiation sensitive syndrome ataxia-telangiectasia (A-T) and from a normal donor. Although they are markedly different in their growth characteristics, both normal and A-T strains give similar frequencies for DNA transfer in a model system using the recombinant plasmid pSV2-gpt. pSV2-gpt DNA transformants arise with a frequency between 10 -5 and 10 -4 per viable cell. Analysis of such transformants, although possible, is severely handicapped by the limited clonal life span of diploid human cells. Despite these problems it may be concluded that diploid human fibroblasts are competent recipients for DNA-mediated gene transfer and the putative repair deficiency of A-T does not markedly effect the efficiency of this process. (author)
Electrochemical DNA Hybridization Sensors Based on Conducting Polymers
Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon
2015-01-01
Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436
Electrochemical DNA Hybridization Sensors Based on Conducting Polymers
Directory of Open Access Journals (Sweden)
Md. Mahbubur Rahman
2015-02-01
Full Text Available Conducting polymers (CPs are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.
Gas Chromatography-Mass Spectroscopic (GC-MS) Analysis of n ...
African Journals Online (AJOL)
tuber-regium (synonym Pleurotus tuber regium) using gas chromatography-mass spectroscopic (GC-. MS) techniques. Methods: The n-hexane extract of the sclerotia ... Soxhlet extraction and analysed using gas chromatography-mass spectroscopic (MS) techniques. ..... Phytochemical composition of Pleurotus tuber regium.
Optical constants of graphene measured by spectroscopic ellipsometry
Weber, J.W.; Calado, V.E.; Van de Sanden, M.C.M.
2010-01-01
A mechanically exfoliated graphene flake ( ? 150×380??m2) on a silicon wafer with 98 nm silicon dioxide on top was scanned with a spectroscopic ellipsometer with a focused spot ( ? 100×55??m2) at an angle of 55°. The spectroscopic ellipsometric data were analyzed with an optical model in which the
Optical constants of graphene measured by spectroscopic ellipsometry
Weber, J.W.; Calado, V.E.; Sanden, van de M.C.M.
2010-01-01
A mechanically exfoliated graphene flake ( ~ 150×380 µm2) on a silicon wafer with 98 nm silicon dioxide on top was scanned with a spectroscopic ellipsometer with a focused spot ( ~ 100×55 µm2) at an angle of 55°. The spectroscopic ellipsometric data were analyzed with an optical model in which the
Li, Z; Meighen, E A
1994-09-01
Bacterial luciferase, which catalyzes the bioluminescence reaction in luminous bacteria, consists of two nonidentical polypeptides, α and β. Eight mutants of luciferase with each of the tryptophans replaced by tyrosine were generated by site-directed mutagenesis and purified to homogeneity. The steady-state tryptophan fluorescence and low-temperature phosphorescence spectroscopic properties of these mutants were characterized. In some instances, mutation of only a single tryptophan residue resulted in large spectral changes. The tryptophan residues conserved in both the α and the β subunits exhibited distinct fluorescence emission properties, suggesting that these tryptophans have different local enviroments. The low-temperature phosphorescence data suggest that the tryptophans conserved in bot the α and the β subunits are not located at the subunit interface and/or involved in subunit interactions. The differences in the spectral properties of the mutants have provided useful information on the local environment of the individual tryptophan residues as well as on the quaternary structure of the protein.
Directory of Open Access Journals (Sweden)
Xingcan Qian
2018-06-01
Full Text Available Foodborne pathogens such as Clostridium perfringens can cause diverse illnesses and seriously threaten to human health, yet far less attention has been given to detecting these pathogenic bacteria. Herein, two morphologies of nanoceria were synthesized via adjusting the concentration of NaOH, and CeO2 nanorod has been utilized as sensing material to achieve sensitive and selective detection of C. perfringens DNA sequence due to its strong adsorption ability towards DNA compared to nanoparticle. The DNA probe was tightly immobilized on CeO2/chitosan modified electrode surface via metal coordination, and the DNA surface density was 2.51 × 10−10 mol/cm2. Under optimal experimental conditions, the electrochemical impedance biosensor displays favorable selectivity toward target DNA in comparison with base-mismatched and non-complementary DNA. The dynamic linear range of the proposed biosensor for detecting oligonucleotide sequence of Clostridium perfringens was from 1.0 × 10−14 to 1.0 × 10−7 mol/L. The detection limit was 7.06 × 10−15 mol/L. In comparison, differential pulse voltammetry (DPV method quantified the target DNA with a detection limit of 1.95 × 10−15 mol/L. Moreover, the DNA biosensor could detect C. perfringens extracted DNA in dairy products and provided a potential application in food quality control.
Johnson, Irudayam Maria; Prakash, Halan; Prathiba, Jeyaguru; Raghunathan, Raghavachary; Malathi, Raghunathan
2012-01-01
Nucleic acids exist in a dynamic equilibrium with a number of molecules that constantly interact with them and regulate the cellular activities. The inherent nature of the structure and conformational integrity of these macromolecules can lead to altered biological activity through proper targeting of nucleic acids binding ligands or drug molecules. We studied the interaction of naturally occurring methylxanthines such as theophylline, theobromine and caffeine with DNA, using UV absorption and Fourier transform infrared (FTIR) spectroscopic methods, and especially monitored their binding affinity in the presence of Mg(2+) and during helix-coil transitions of DNA by temperature (T(m)) or pH melting profiles. The study indicates that all these molecules effectively bind to DNA in a dose dependent manner. The overall binding constants of DNA-theophylline = 3.5×10(3) M(-1), DNA-theobromine = 1.1×10(3) M(-1), and DNA-Caffeine = 3.8×10(3) M(-1). On the other hand T(m)/pH melting profiles showed 24-35% of enhanced binding activity of methylxanthines during helix-coil transitions of DNA rather than to its native double helical structure. The FTIR analysis divulged that theophylline, theobromine and caffeine interact with all the base pairs of DNA (A-T; G-C) and phosphate group through hydrogen bond (H-bond) interaction. In the presence of Mg(2+), methylxanthines altered the structure of DNA from B to A-family. However, the B-family structure of DNA remained unaltered in DNA-methylxanthines complexes or in the absence of Mg(2+). The spectral analyses indicated the order of binding affinity as "caffeine≥theophylline>theobromine" to the native double helical DNA, and "theophylline≥theobromine>caffeine to the denatured form of DNA and in the presence of divalent metal ions.
Directory of Open Access Journals (Sweden)
Irudayam Maria Johnson
Full Text Available Nucleic acids exist in a dynamic equilibrium with a number of molecules that constantly interact with them and regulate the cellular activities. The inherent nature of the structure and conformational integrity of these macromolecules can lead to altered biological activity through proper targeting of nucleic acids binding ligands or drug molecules. We studied the interaction of naturally occurring methylxanthines such as theophylline, theobromine and caffeine with DNA, using UV absorption and Fourier transform infrared (FTIR spectroscopic methods, and especially monitored their binding affinity in the presence of Mg(2+ and during helix-coil transitions of DNA by temperature (T(m or pH melting profiles. The study indicates that all these molecules effectively bind to DNA in a dose dependent manner. The overall binding constants of DNA-theophylline = 3.5×10(3 M(-1, DNA-theobromine = 1.1×10(3 M(-1, and DNA-Caffeine = 3.8×10(3 M(-1. On the other hand T(m/pH melting profiles showed 24-35% of enhanced binding activity of methylxanthines during helix-coil transitions of DNA rather than to its native double helical structure. The FTIR analysis divulged that theophylline, theobromine and caffeine interact with all the base pairs of DNA (A-T; G-C and phosphate group through hydrogen bond (H-bond interaction. In the presence of Mg(2+, methylxanthines altered the structure of DNA from B to A-family. However, the B-family structure of DNA remained unaltered in DNA-methylxanthines complexes or in the absence of Mg(2+. The spectral analyses indicated the order of binding affinity as "caffeine≥theophylline>theobromine" to the native double helical DNA, and "theophylline≥theobromine>caffeine to the denatured form of DNA and in the presence of divalent metal ions.
International Nuclear Information System (INIS)
Farnsworth, P.B.
1993-01-01
Inductively coupled plasmas (ICPs) are stable, robust sources for the generation of spectra from neutral and singly ionized atoms. They are used extensively for analytical spectrometry, but have seen limited use for the measurement of fundamental spectroscopic constants. Several properties of the ICP affect its suitability for such fundamental measurements. They include: spatial structure, spectral background, noise characteristics, electron densities and temperatures, and the state of equilibrium in the plasma. These properties are particularly sensitive to the means by which foreign atoms are introduced into the plasma. With some departures from the operating procedures normally used in analytical measurements, the ICP promise to be a useful source for the measurement of fundamental atomic constants. (orig.)
Dolgova, Evgeniya V; Potter, Ekaterina A; Proskurina, Anastasiya S; Minkevich, Alexandra M; Chernych, Elena R; Ostanin, Alexandr A; Efremov, Yaroslav R; Bayborodin, Sergey I; Nikolin, Valeriy P; Popova, Nelly A; Kolchanov, Nikolay A; Bogachev, Sergey S
2016-05-25
Previously, we demonstrated that poorly differentiated cells of various origins, including tumor-initiating stem cells present in the ascites form of mouse cancer cell line Krebs-2, are capable of naturally internalizing both linear double-stranded DNA and circular plasmid DNA. The method of co-incubating Krebs-2 cells with extracellular plasmid DNA (pUC19) or TAMRA-5'-dUTP-labeled polymerase chain reaction (PCR) product was used. It was found that internalized plasmid DNA isolated from Krebs-2 can be transformed into competent Escherichia coli cells. Thus, the internalization processes taking place in the Krebs-2 cell subpopulation have been analyzed and compared, as assayed by E. coli colony formation assay (plasmid DNA) and cytofluorescence (TAMRA-DNA). We showed that extracellular DNA both in the form of plasmid DNA and a PCR product is internalized by the same subpopulation of Krebs-2 cells. We found that the saturation threshold for Krebs-2 ascites cells is 0.5 μg DNA/10(6) cells. Supercoiled plasmid DNA, human high-molecular weight DNA, and 500 bp PCR fragments are internalized into the Krebs-2 tumor-initiating stem cells via distinct, non-competing internalization pathways. Under our experimental conditions, each cell may harbor 340-2600 copies of intact plasmid material, or up to 3.097 ± 0.044×10(6) plasmid copies (intact or not), as detected by quantitative PCR. The internalization dynamics of extracellular DNA, copy number of the plasmids taken up by the cells, and competition between different types of double-stranded DNA upon internalization into tumor-initiating stem cells of mouse ascites Krebs-2 have been comprehensively analyzed. Investigation of the extracellular DNA internalization into tumor-initiating stem cells is an important part of understanding their properties and possible destruction mechanisms. For example, a TAMRA-labeled DNA probe may serve as an instrument to develop a target for the therapy of cancer, aiming at elimination of
Wang, Fengchao; Cai, Muzhi; Chen, Rong; Jing, Xufeng; Li, Bingpeng; Tian, Ying; Zhang, Junjie; Xu, Shiqing
2015-11-05
In this work, the thermal and spectroscopic properties of Er(3+)-doped oxyfluorite glass based on AMCSBYT (AlF3-MgF2-CaF2-SrF2-BaF2-YF3-TeO2) system for different TeO2 concentrations from 6 to 21 mol% is reported. After adding a suitable content of TeO2, the thermal ability of glass improves significantly whose ΔT and S can reach to 118 °C and 4.47, respectively. The stimulated emission cross-section reaches to 7.80×10(-21) cm(2) and the fluorescence lifetime is 12.18 ms. At the same time, the bandwidth characteristics reach to 46.41×10(-21) cm(2) nm and the gain performance is 63.73×10(-21) cm(2) ms. These results show that the optical performances of this oxyfluorite glass are very well. Hence, AMCSBYT glass with superior performances might be a useful material for applications in optical amplifier around 1.53 μm. Copyright © 2015 Elsevier B.V. All rights reserved.
Lectin cDNA and transgenic plants derived therefrom
Raikhel, Natasha V.
2000-10-03
Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.
Luque-Ceballos, Jonathan C.; Posada-Borbón, Alvaro; Herrera-Urbina, Ronaldo; Aceves, R.; Juárez-Sánchez, J. Octavio; Posada-Amarillas, Alvaro
2018-03-01
Spectroscopic properties of gas-phase copper sulfide clusters (CuS)n (n = 2-6) are calculated using Density Functional Theory (DFT) and time-dependent (TD) DFT approaches. The energy landscape of the potential energy surface is explored through a basin-hopping DFT methodology. Ground-state and low-lying isomer structures are obtained. The global search was performed at the B3PW91/SDD level of theory. Normal modes are calculated to validate the existence of optimal cluster structures. Energetic properties are obtained for the ground-state and isomer clusters and their relative energies are evaluated for probing isomerization. This is a few tenths of an eV, except for (CuS)2 cluster, which presents energy differences of ∼1 eV. Notable differences in the infrared spectra exist between the ground-state and first isomer structures, even for the (CuS)5 cluster, which has in both configurations a core copper pyramid. TDDFT provides the simulated absorption spectrum, presenting a theoretical description of optical absorption bands in terms of electronic excitations in the UV and visible regions. Results exhibit a significant dependence of the calculated UV/vis spectra on clusters size and shape regarding the ground state structures. Optical absorption is strong in the UV region, and weak or forbidden in the visible region of the spectrum.
Energy Technology Data Exchange (ETDEWEB)
Asadi, Zahra; Mosallaei, Hamta; Sedaghat, Moslem [Shiraz Univ. (Iran, Islamic Republic of). Dept. of Chemistry; Yousefi, Reza [Shiraz Univ. (Iran, Islamic Republic of). Protein Chemistry Lab. (PCL)
2017-11-15
In the present study, two water-soluble lanthanum(III) hexaaza Schiff base complexes were synthesized and characterized and also theoretically investigated. The interactions of these complexes with DNA and bovine serum albumin (BSA) were studied using different spectroscopic assessments and docking simulation analysis. The DNA docking studies suggested that these two complexes are able to interact with DNA through the minor groove, and also the binding affinity is in the order of La(L{sup 1}) > La(L{sup 2}). Furthermore, the spectral titration was carried out and viscosity measurements were taken. In this regard, protein-binding studies revealed that these complexes quench the intrinsic fluorescence of BSA, and indicated that the possible binding site is located on the vicinity of Trp 213, which is further validated by docking simulation analysis. The in vitro anticancer activities of these complexes indicated that the La(L{sup 1}) complex is more effective than the other one and also exhibits a better interaction with DNA.
Quantitative properties of clustering within modern microscopic nuclear models
International Nuclear Information System (INIS)
Volya, A.; Tchuvil’sky, Yu. M.
2016-01-01
A method for studying cluster spectroscopic properties of nuclear fragmentation, such as spectroscopic amplitudes, cluster form factors, and spectroscopic factors, is developed on the basis of modern precision nuclear models that take into account the mixing of large-scale shell-model configurations. Alpha-cluster channels are considered as an example. A mathematical proof of the need for taking into account the channel-wave-function renormalization generated by exchange terms of the antisymmetrization operator (Fliessbach effect) is given. Examples where this effect is confirmed by a high quality of the description of experimental data are presented. By and large, the method in question extends substantially the possibilities for studying clustering phenomena in nuclei and for improving the quality of their description.
Preissler, Janina; Wahlefeld, Stefan; Lorent, Christian; Teutloff, Christian; Horch, Marius; Lauterbach, Lars; Cramer, Stephen P; Zebger, Ingo; Lenz, Oliver
2018-01-01
Biocatalysts that mediate the H 2 -dependent reduction of NAD + to NADH are attractive from both a fundamental and applied perspective. Here we present the first biochemical and spectroscopic characterization of an NAD + -reducing [NiFe]‑hydrogenase that sustains catalytic activity at high temperatures and in the presence of O 2 , which usually acts as an inhibitor. We isolated and sequenced the four structural genes, hoxFUYH, encoding the soluble NAD + -reducing [NiFe]‑hydrogenase (SH) from the thermophilic betaproteobacterium, Hydrogenophilus thermoluteolus TH-1 T (Ht). The HtSH was recombinantly overproduced in a hydrogenase-free mutant of the well-studied, H 2 -oxidizing betaproteobacterium Ralstonia eutropha H16 (Re). The enzyme was purified and characterized with various biochemical and spectroscopic techniques. Highest H 2 -mediated NAD + reduction activity was observed at 80°C and pH6.5, and catalytic activity was found to be sustained at low O 2 concentrations. Infrared spectroscopic analyses revealed a spectral pattern for as-isolated HtSH that is remarkably different from those of the closely related ReSH and other [NiFe]‑hydrogenases. This indicates an unusual configuration of the oxidized catalytic center in HtSH. Complementary electron paramagnetic resonance spectroscopic analyses revealed spectral signatures similar to related NAD + -reducing [NiFe]‑hydrogenases. This study lays the groundwork for structural and functional analyses of the HtSH as well as application of this enzyme for H 2 -driven cofactor recycling under oxic conditions at elevated temperatures. Copyright © 2017 Elsevier B.V. All rights reserved.
Ultrafast Spectroscopic Noninvasive Probe of Vertical Carrier Transport in Heterostructure Devices
2016-03-01
ARL-TR-7618 ● MAR 2016 US Army Research Laboratory Ultrafast Spectroscopic Noninvasive Probe of Vertical Carrier Transport in...US Army Research Laboratory Ultrafast Spectroscopic Noninvasive Probe of Vertical Carrier Transport in Heterostructure Devices by Blair C...Spectroscopic Noninvasive Probe of Vertical Carrier Transport in Heterostructure Devices 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT
Generalization of DNA microarray dispersion properties: microarray equivalent of t-distribution
DEFF Research Database (Denmark)
Novak, Jaroslav P; Kim, Seon-Young; Xu, Jun
2006-01-01
BACKGROUND: DNA microarrays are a powerful technology that can provide a wealth of gene expression data for disease studies, drug development, and a wide scope of other investigations. Because of the large volume and inherent variability of DNA microarray data, many new statistical methods have...
Asekunowo, Patrick O; Haque, Rosenani A; Razali, Mohd R; Avicor, Silas W; Wajidi, Mustafa F F
2018-04-25
A series of four benzimidazolium based nitrile-functionalized mononuclear-Ag(I)-N-heterocyclic carbene and binuclear-Ag(I)-N-heterocyclic carbene (Ag(I)-NHC) hexafluorophosphate complexes (5b-8b) were synthesized by reacting the corresponding hexafluorophosphate salts (1b-4b) with Ag 2 O in acetonitrile, respectively. These compounds were characterized by 1 H NMR, 13 C NMR, IR, UV-visible spectroscopic techniques, elemental analyses and molar conductivity. Additionally, 8b was structurally characterized by single crystal X-ray diffraction technique. Preliminary in vitro antibacterial evaluation was conducted for all the compounds against two standard bacteria; gram-positive (Staphylococcus aureus) and gram-negative (Escherichia coli) bacterial strains. Most of the Ag(I)-NHC complexes (5b-8b) showed moderate to good antibacterial activity with MIC values in the range of 12.5-100 μg/mL. Especially, compound 8b exhibited promising anti-Staphylococcus aureus activity with a low MIC value (12.5 μg/mL). However, all the hexafluorophosphate salts (1b-4b) were inactive against the bacteria strains. The preliminary interactive investigation revealed that the most active compound, 8b, could effectively intercalate into DNA to form 8b-DNA complex which shows a better binding ability for DNA (K b = 3.627 × 10 6 ) than the complexes 5b-7b (2.177 × 10 6 , 8.672 × 10 5 and 6.665 × 10 5 , respectively). Nuclease activity of the complexes on plasmid DNA and Aedes albopictus genomic DNA was time-dependent, although minimal. The complexes were larvicidal to the mosquito, with 5b, 6b and 8b being highly active. Developmental progression from the larval to the adult stage was affected by the complexes, progressively being toxic to the insect's development with increasing concentration. These indicate the potential use of these complexes as control agents against bacteria and the dengue mosquito Ae. albopictus. Copyright © 2018 Elsevier Masson SAS. All
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Almeida, Michell O; Barros, Daiane A S; Araujo, Sheila C; Faria, Sergio H D M; Maltarollo, Vinicius G; Honorio, Kathia M
2017-09-05
Cancer cells can expand to other parts of body through blood system and nodes from a mechanism known as metastasis. Due to the large annual growth of cancer cases, various biological targets have been studied and related to this disorder. A very interesting target related to cancer is human epidermal growth factor receptor 2 (HER2). In this study, we analyzed the main intermolecular interactions between a drug used in the cancer treatment (5-fluorouracil) and HER2. Molecular modeling methods were also employed to assess the molecular structure, spectroscopic properties (FTIR and UV-Vis), NBO, QTAIM and HOMO-LUMO energies of 5-FU. From the docking simulations it was possible to analyze the interactions that occur between some residues in the binding site of HER2 and 5-FU. To validate the choice of basis set that was used in the NBO and QTAIM analyses, theoretical calculations were performed to obtain FT-IR and UV/Vis spectra, and the theoretical results are consistent with the experimental data, showing that the basis set chosen is suitable. For the maximum λ from the theoretical calculation (254.89nm) of UV/Vis, the electronic transition from HOMO to LUMO occurs at 4.89eV. From NBO analyses, we observed interactions between Asp863 and 5-FU, i.e. the orbitals with high transfer of electrons are LP O 15 (donor NBO) and BD* (π) N 1 -H 10 (acceptor NBO), being that the value of this interaction is 7.72kcal/mol. Results from QTAIM indicate one main intermolecular H bond, which is necessary to stabilize the complex formed between the ligands and the biological target. Therefore, this study allowed a careful evaluation on the main structural, spectroscopic and electronic properties involved in the interaction between 5-FU and HER2, an important biological complex related to the cancer treatment. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Watkins, D K [Hammersmith Hospital, London (UK). M.R.C. Experimental Radiopathology Unit
1980-09-01
DNA-membrane complexes from three strains of E. coli were irradiated and changes in the rates of DNA synthesis were observed. Doses from 1-10 krad to complexes from W3110 and pol A1 strains gave up to a 100 per cent increase in DNA synthesis; under the same conditions, no change was observed in Bsub(s-1). The degree of stimulation did not depend on the presence of oxygen during irradiation, and a post-irradiation incubation was necessary to achieve activation. The properties of all three complexes were similar when unirradiated. Irradiation of intact organisms under conditions which produced marked, oxygen-dependent inhibition of the Bsub(s-1) complex had no significant effect on those from W3110 and pol A1. Enhanced DNA synthesis is concluded to be due wholly to repair of pre-existing DNA. It is further postulated that DNA synthesis in untreated complexes (E.coli B's,W3110 and pol A1) is mainly of the repair-type and does not necessarily take place at the site of DNA-membrane attachment.